You are on page 1of 6

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 2003, p. 32903295 Vol. 47, No.

10
0066-4804/03/$08.000 DOI: 10.1128/AAC.47.10.32903295.2003
Copyright 2003, American Society for Microbiology. All Rights Reserved.

Identifying Antimicrobial Resistance Genes with DNA Microarrays


Douglas R. Call,1* Marlene K. Bakko,1 Melissa J. Krug,1 and Marilyn C. Roberts2
Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine, Washington State University,
Pullman, Washington 99164,1 and Department of Pathobiology, University of Washington,
Seattle, Washington 981952
Received 24 April 2003/Returned for modification 6 June 2003/Accepted 2 July 2003

We developed and tested a glass-based microarray suitable for detecting multiple tetracycline (tet) resistance
genes. Microarray probes for 17 tet genes, the -lactamase blaTEM-1 gene, and a 16S ribosomal DNA gene
(Escherichia coli) were generated from known controls by PCR. The resulting products (ca. 550 bp) were
applied as spots onto epoxy-silane-derivatized, Teflon-masked slides by using a robotic spotter. DNA was
extracted from test strains, biotinylated, hybridized overnight to individual microarrays at 65C, and detected

Downloaded from http://aac.asm.org/ on April 8, 2017 by guest


with Tyramide Signal Amplification, Alexa Fluor 546, and a microarray scanner. Using a detection threshold
of 3 the standard deviation, we correctly identified tet genes carried by 39 test strains. Nine additional strains
were not known to harbor any genes represented on the microarray, and these strains were negative for all 17
tet probes as expected. We verified that R741a, which was originally thought to carry a novel tet gene, tet(I),
actually harbored a tet(G) gene. Microarray technology has the potential for screening a large number of
different antibiotic resistance genes by the relatively low-cost methods outlined in this paper.

Antimicrobial resistance testing is an invaluable method for of ca. 550-bp PCR products. This microarray functions with a
characterizing clinical and environmental bacteria, although a high degree of specificity and is suitable for detection of mul-
resistance phenotype provides only limited information about tiple tetracycline resistance genes from multiple genera of bac-
the identity of the actual resistance genes harbored by the teria.
microbes (15). In contrast, when the specific antibiotic resis-
tance genes are identified, this information can be used to
MATERIALS AND METHODS
investigate the diversity and the spatial and temporal distribu-
tion of resistance genes within and between different host res- Controls and test isolates. Seventeen cloned tet genes were used as PCR
templates and hybridization controls for the microarray (Table 1). A diverse
ervoirs, populations, and environments (1, 14). When identi-
group of test isolates (n 48), including 12 different genera, were assembled
fying specific resistance genes, researchers have used a variety from previous studies (10, 14) and from bovine sources (Table 2). We included
of methods, including DNA-DNA hybridization on mem- Escherichia coli transconjugants that harbored tet genes from other sources,
branes and gene-specific PCR assays (10, 14). PCR assays are including isolate 33, which harbors plasmid R714a from a Providencia species
relatively rapid and can be used with a variety of sample types, (13). All isolates either harbored known tet genes or required MICs that were
consistent with resistance based on National Committee for Clinical Laboratory
such as individual bacterial colonies or environmental samples Standards breakpoints for E. coli (17, 18).
(4, 5, 9). Multiplex PCR assays have been devised for detection Microarray probes. We used PCR to generate probes for the microarray.
of a large number of genes (12), and this approach could be Cloned DNA from 17 of 35 recognized tet genes was extracted by using a DNeasy
used for different classes of antibiotic resistance genes. For kit (Qiagen, Valencia, Calif.) (Table 1) (http://faculty.washington.edu/marilynr/).
Primers for each gene were identified with Primer3 software (20) with the goal
example, it should be possible to devise multiplex PCRs to
of producing products ca. 550 bp in length (Table 1). This probe size was selected
detect the 35 genetically diverse tetracycline resistance genes based on previous success by similar procedures for microarray hybridizations
(8). (6). Additional PCR products were used as controls, including the 16S ribosomal
DNA microarrays offer an alternative method for screening DNA (rDNA) gene (rrn from E. coli) and the blaTEM-1 gene (from pBR322). All
for the presence of a wide diversity of genes. In this format, predicted PCR products were compared by using Vector NTI software (Infor-
Max Inc., Bethesda, Md.) to verify that probe sequences were unique (85%
probes specific to each gene are deposited onto a solid sub- sequence identity between predicted probe sequences). Oligonucleotides were
strate (usually glass) in a lattice pattern. DNA is then labeled synthesized by Invitrogen Corp. (Carlsbad, Calif.) with no modifications and with
and hybridized to the array, and specific target-probe duplexes basic desalting after synthesis. PCR mixtures (100 l) were composed of 1
are detected with a reporter molecule (21). In this study, we reaction buffer (Fisher Scientific, Pittsburgh, Pa.), 200 nM each deoxynucleoside
triphosphate (dNTP), 2 mM MgCl2, 4 U of Taq polymerase, 400 nM each primer,
investigated the feasibility of using DNA microarrays as a tool
and ca. 40 ng of template DNA. The thermal cycler conditions included 2 min of
to screen bacterial isolates for tetracycline resistance genes. denaturation at 95C followed by 30 cycles of 96C for 30 s, 60C for 30 s, and
Our initial efforts involved short oligonucleotide probes (25- 72C for 30 s and a final 10-min extension time at 72C. Each PCR product was
mer), but we found this array design to be insensitive to low- verified by gel electrophoresis and ethanol precipitated. Products were resus-
copy-number genes (data not shown). Herein we demonstrate pended in sterile water and quantified by spectrophotometry.
Slide preparation. Multiple microarrays were printed on glass slides so that
a more conventional format in which microarray probes consist independent microarrays were contained within each of 12 wells defined by a
Teflon-masked surface (Erie Scientific, Portsmouth, N.H.); the hydrophobic
nature of the masking permitted independent samples to be hybridized within
* Corresponding author. Mailing address: Department of Veteri- each well. Slides were derivatized with an epoxy-silane monolayer as described
nary Microbiology and Pathology, Washington State University, 402 previously (7). Briefly, slides were sonicated for 2 min in a detergent solution
Bustad Hall, Pullman, WA 99164-7040. Phone: (509) 335-6313. Fax: (Contrad 70 detergent; Fisher Scientific), rinsed with deionized water, and dried
(509) 335-8529. E-mail: drcall@wsu.edu. by compressed air. Slides were then soaked for 1 h in 3 N HCl, rinsed, dried, and

3290
VOL. 47, 2003 TETRACYCLINE RESISTANCE MICROARRAY 3291

TABLE 1. Primers and predicted amplification products used as microarray probes


GenBank
Gene Primersa Locationc Size (bp)d
accession no.b

tet(A) TTGGCATTCTGCATTCACTC X75761 1822 494


GTATAGCTTGCCGGAAGTCG 2316

tet(B) CAGTGCTGTTGTTGTCATTAA V00611 275 571


GCTTGGAATACTGAGTGTAA 846

tet(C) ATATCGTCCATTCCGACAGC Y19114 92 502


CTGACTGGGTTGAAGGCTCT 594

tet(D) GCAAACCATTACGGCATTCT X65876 1638 546


GATAAGCTGCGCGGTAAAAA 2184

tet(E) TATTAACGGGCTGGCATTTC L06940 518 544


AGCTGTCAGGTGGGTCAAAC 1062

Downloaded from http://aac.asm.org/ on April 8, 2017 by guest


tet(G) GCTCGGTGGTATCTCTGCTC AF133140 1209 550
CAAAGCCCCTTGCTTGTTAC 1759

tet(H) TCAACCACACTTTGGATGCT U00792 986 550


CCCATTTTTGTGCCAATTTC 1536

tet(L) ACTGGGTGAACACAGCCTTT X60828 322 548


CAGGAATGACAGCACGCTAA 870

tet(M) ACACGCCAGGACATATGGAT M85225 740 536


ATTTCCGCAAAGTTCAGACG 1276

tet(O) GCGGTAATTATGGGAAACGA M18896 735 550


TTTCCCGCTGTTCAGATTTC 1285

tet(S) CGCTACATTTGCGAGACTCA L09756 1267 555


GAATGCCACTACCCAAAGGA 1822

tet(W) GGGAAATTGTTCGGACAGAC AJ222769 1090 549


AACGGATACCATCCCTGACA 1639

tet(Z) GATGAGATGGGGAAGGTTCA AF121000 15666 544


CTTGTTGGTAACCCGGAAGA 16210

tet(30) CCGTCATGCAATTTGTGTTC AF090987 1281 550


TAGAGCACCCAGATCGTTCC 1831

tetA(P) TTGGGGGAGTTTTAACAGGA L20800 1292 564


TTCCAAAAATTCCAAACCAA 1856

tetB(P) TGGGGCAAATTTCAACAAAG L20800 2710 537


TCAACAACTCCCCCATTTTC 3247

otr(B) CAAGAAACTGGCGATCGTG AF061335 969 545


GGAACCAGGTCATGACGAAC 1514

blaTEM-1 CCAATGCTTAATCAGTGAGG L09137 1629 858


ATGAGTATTCAACATTTCCG 2487

16S rDNA AGAGTTTGATCMTGGCTCAG AE000452 8 528


ATTACCGCGGCTGCTGG 536
a
Primers designed for this study. Primers for the blaTEM-1 and 16S rDNA genes were adopted from references 2 and 16, respectively.
b
GenBank accession number for the reference sequence used to design the microarray probes.
c
Primer location within the reference sequence.
d
Predicted size of the microarray probe.

then incubated in a 2% solution of 3-glycidoxypropyltrimethoxysilane (Sigma pH 11), heat denatured (95C, 5 min) with a thermal cycler, and allowed to cool
Aldrich, St. Louis, Mo.) in high-performance liquid chromatography HPLC- to room temperature. Each probe was then deposited at a fixed location within
grade methanol. After 15 min, slides were rinsed in 100% methanol and dried by each masked well by a robotic spotter (BioRobotics Microgrid II; Woburn,
compressed air. Mass.). Each probe was printed as four replicate spots within each array, and
Microarray construction. PCR products were diluted to 75 ng/l in print every array included an arbitrary oligonucleotide probe (25-mer) conjugated with
buffer (100 mM Na2HPO4, 200 mM NaCl, 0.01% sodium dodecyl sulfate [SDS]; biotin. These biotin pseudoprobes served as positive controls for the detection
3292 CALL ET AL. ANTIMICROB. AGENTS CHEMOTHER.

TABLE 2. Field isolates and other test strains used in this study
Isolate no.a Species Geneb Intensityc Thresholdd

1 Acinetobacter sp. None 11,130


2 Acinetobacter sp. None 1,113
3 Acinetobacter woffii None 259
4 Escherichia coli None 4,549
5 Escherichia coli None 15,589
6 Pantoea sp. None 17,606
7 Providencia rettgeri None 12,467
9 Pseudomonas putida None 23,694
10 Ralstonia pickettii None 15,160
11 Aeromonas hydrophila tet(A) 4,895 4,035
12 Aeromonas hydrophila tet(A) 33,819 26,808
13 Citrobacter freundii tet(A) 65,535 51,741
14 Citrobacter freundii tet(A) 62,044 48,931
EC3e Escherichia coli tet(A),(B) 65,535 73,099
EC4 Escherichia coli tet(A) 26,433 21,129
EC5 Escherichia coli tet(A) 65,535 52,592

Downloaded from http://aac.asm.org/ on April 8, 2017 by guest


EC6 Escherichia coli tet(A) 26,002 20,713
EC8 Escherichia coli tet(A) 49,000 38,695
EC9 Escherichia coli tet(A) 14,199 11,304
15 Escherichia coli tet(A) 61,251 55,416
SSuTA1 Escherichia coli tet(A) 48,778 38,454
SSuTA2 Escherichia coli tet(A) 38,426 30,303
SSuTCH1 Escherichia coli tet(A) 33,717 26,769
SSuTCH2 Escherichia coli tet(A) 36,390 28,889
SSuTCH3 Escherichia coli tet(A) 9,964 8,073
17 Pseudomonas fluorescens tet(A) 48,640 39,580
18 Pseudomonas fluorescens tet(A) 61,988 51,568
19 Pseudomonas fluorescens tet(A) 29,881 24,043
20 Pseudomonas fluorescens tet(A) 51,838 41,179
22 Pseudomonas sp. tet(A) 59,082 46,700
24 Brevundimonas vesicularis tet(B) 60,669 51,384
25 Enterobacter sakazakii tet(B) 59,673 50,585
SSuT1 Escherichia coli tet(B) 24,672 20,814
SSuT2 Escherichia coli tet(B) 34,982 29,552
SSuT3 Escherichia coli tet(B) 52,593 44,385
SSuTA3 Escherichia coli tet(B) 61,319 48,373
26 Serratia liquifaciens tet(B) 64,873 57,964
27 Citrobacter freundii tet(D) 12,974 10,353
28 Citrobacter freundii tet(D) 8,499 6,872
29 Aeromonas hydrophila tet(E) 65,535 60,134
30 Aeromonas hydrophila tet(E) 23,357 18,635
31 Aeromonas hydrophila tet(E) 63,840 50,459
32 Aeromonas hydrophila tet(E) 39,391 31,303
33f Escherichia coli tet(G) 32,777 25,887
34 Acinetobacter radioresistens tet(H) 42,763 37,004
EC2 Escherichia coli tet(H) 65,535 51,935
35 Moraxella sp. tet(H) 60,039 53,763
EC1 Escherichia coli tet(Z) 65,535 52,207
a
Isolate reference number. Both EC2 and EC3 harbored cloned genes and do not represent field isolates.
b
Gene detected by the DNA microarray. Gene identity was confirmed by previous work (14) or by PCR with gene-specific primers (strains designated with an SSuT
prefix).
c
Median pixel intensity of the microarray probe.
d
Detection threshold based on the average median pixel intensity for tet probes plus 3 SD.
e
EC3 was clearly positive for both tet(A) and tet(B).
f
Isolate 33 harbored plasmid R714a from a strain of Providencia (13).

chemistry and served as orientation points for image processing. After being also prepared with a DNeasy kit extraction so that both genomic DNA and
spotted, slides were baked for 1 h at 130C under vacuum (22 Hg) and stored at plasmid DNA were present in the labeling reaction mixture, and a 1:5 dilution
room temperature while protected from light. was used in the subsequent hybridizations. Labeled DNA was ethanol precipi-
Hybridization and detection. Target DNA was prepared by growing a test tated and resuspended in 75 l of hybridization buffer, composed of 4 SSC (0.6
isolate in Luria-Bertani (LB) broth or on an LB plate. Cells were pelleted, and M NaCl plus 0.6 M Na citrate) and 5 Denhardts solution (0.001% Ficoll,
DNA was extracted with a DNeasy kit (Qiagen) followed by quantification by 0.001% polyvinylpyrrolidone, 0.001% bovine serum albumin). In preparation for
spectrophotometry. Target DNA (1 g) was nick translated according to the hybridization, slides were incubated with TNB (100 mM Tris-HCl [pH 7.5], 0.15
manufacturers instructions (biotin-dATP; BioNick kit; Invitrogen Corp.), except mM NaCl) with 0.5% blocking reagent (biotin Tyramide Signal Amplification
reaction mixtures were incubated for 2 h. The labeled DNA was used directly [TSA] kit; Perkin-Elmer Life Sciences, Boston, Mass.) for 30 min at room
with hybridization buffer for the 48 test strains, whereas 1:1,000 dilutions were temperature. Labeled DNA was heat denatured (95C for 3 min), briefly cen-
prepared from pure plasmid extractions containing cloned positive control genes trifuged, and held on ice until applied to the slide. Blocking buffer was aspirated
(Table 1). To more closely simulate test samples, positive control clones were and immediately replaced with 35 l of denatured target per well. Slides were
VOL. 47, 2003 TETRACYCLINE RESISTANCE MICROARRAY 3293

Downloaded from http://aac.asm.org/ on April 8, 2017 by guest


FIG. 1. Hybridization results illustrating specificity of tet gene probes. Probes were printed in quadruplicate in two columns. From top to bottom
of each array, the left column included tet(A), tet(B), tet(C), tet(D), tet(E), tet(G), tet(H), tet(L), tet(M), and tet(O). The right column included
tetP(A), tetP(B), tet(S), tet(W), tet(Z), otr(B), tet(30), 16S rDNA, blaTEM-1, and a biotin marker.

then placed into a humidified, conical tube (50 ml) and submerged into a water RESULTS AND DISCUSSION
bath overnight at 65C.
After incubation, the labeled target was aspirated and could be stored at Microarray validation. In all cases, there was a one-to-one
20C for replicate hybridizations. Slides were washed with a mixture of 1 SSC correspondence between a control gene and its respective
and 0.2% SDS at hybridization temperature (4 min) followed by 0.1 SSC0.2%
probe, and many hybridizations with cloned genes were posi-
SDS at room temperature (4 min) and 0.1 SSC at room temperature (4 min)
(11). Stringent washes were followed by three 1-min washes in TNT buffer (0.1 tive for the blaTEM-1 probe (Fig. 1). The latter result reflected
M Tris-HCl [pH 7.5], 0.15 M NaCl, 0.05% Tween 20). A streptavidin-horseradish the presence of the ampicillin resistance gene harbored by
peroxidase conjugate (TSA kit) was diluted 1:100 in TNB and incubated in each many of the cloning vectors. The tetA(P) and tetB(P) genes
well for 30 min, followed by three 1-min washes in TNT. Ten percent fetal equine
were contained on the same plasmid, so both probes were
serum in 2 SSC was incubated in each well for 30 min to provide a protein
surface for tyramide binding followed by three 1-min washes in TNT buffer. expected to be visible for this hybridization. We subsequently
Biotinyl tyramide (diluted 1:50 in amplification diluent) was incubated in each nick translated individual PCR products and demonstrated
well for 10 min. After biotinyl tyramide had been washed from the slide, 2-mg/ml that both probes were specific for their respective targets (data
streptavidin conjugated to Alexa Fluor 546 (Molecular Probes, Eugene, Oreg.) not shown).
was added in 1 SSC5 Denhardts solution, and the slides were incubated for
1 h before being given three 1-min washes in TNT followed by drying by high-
Threshold for detection. Our positive control hybridizations
speed centrifugation. Images were captured with an arrayWoRxe scanner (Ap- yielded some minor cross-hybridization with other probes
plied Precision, Issaquah, Wash.), and image quantification was accomplished most commonly involving tet(A) (Fig. 1). Therefore, we se-
with softWoRx software (Applied Precision). Median pixel values are reported lected an arbitrary threshold for positive detection based on
as signal intensity (averaged for replicate probes). Positive detection was con-
firmed by either PCR (primers from Table 1) or by DNA-DNA hybridization (10,
three standard deviations (3 SD) above the average signal
14). Resistant strains that failed to hybridize to any tet probes were hybridized a intensity for all tet probes on the array (excluding 16S rDNA,
second time to confirm the finding. blaTEM-1, and biotin spots). For example, the results for 3 SD
3294 CALL ET AL. ANTIMICROB. AGENTS CHEMOTHER.

Downloaded from http://aac.asm.org/ on April 8, 2017 by guest

FIG. 2. Example of quantified signal intensity for positive control hybridizations tet(A) (upper panel) and tet(S) (lower panel). The horizontal
line represents a detection threshold equivalent to the average median intensity plus 3 SD for all tet probes.
VOL. 47, 2003 TETRACYCLINE RESISTANCE MICROARRAY 3295

for the tet(A) and tet(S) hybridizations (Fig. 1) were 54,532 and This project received financial assistance from the Morris Animal
55,003, which yielded very clear detection thresholds for these Foundation (Englewood, Colo.) and the Agricultural Animal Health
Program (Washington State University, Pullman).
hybridizations (Fig. 2). We adopted this procedure for scoring
subsequent hybridizations. If more than one tet probe had a REFERENCES
high signal intensity, then a 3 SD detection threshold may 1. Aminov, R. I., N. Garrigues-Jeanjean, and R. I. Mackie. 2001. Molecular
not be appropriate. For example, the threshold for the tetA(P) ecology of tetracycline resistance: development and validation of primers for
and tetB(P) hybridization (Fig. 1) was 73,754, which exceeds detection of tetracycline resistance genes encoding ribosomal protection
proteins. Appl. Environ. Microbiol. 67:2232.
the maximum possible signal intensity, 65,535. Therefore, each 2. Arlet, G., G. Brami, D. Decre, A. Flippo, O. Gaillot, P. H. Lagrange, and A.
hybridization needs to be examined to avoid loss of informa- Philippon. 1995. Molecular characterization by PCR-restriction fragment
tion where more than one tet gene may be present. length polymorphism of TEM beta-lactamases. FEMS Microbiol. Lett. 134:
203208.
Sample hybridizations. We tested 48 isolates on the mi- 3. Arlet, G., S. Goussard, P. Courvalin, and A. Philippon. 1999. Sequences of
croarray: 38 isolates were identified as having a single tet gene, the genes for the TEM-20, TEM-21, TEM-22, and TEM-29 extended-spec-
trum -lactamases. Antimicrob. Agents Chemother. 43:969971.
and 1 isolate (EC3) harbored two tet genes, tet(A) and tet(B). 4. Arlet, G., and A. Philippon. 1994. PCR-based approaches for the detection
The nine remaining strains did not hybridize to any of the tet of bacterial resistance, p. 665687. In G. D. Ehrlich and S. J. Greenberg
genes present on the array (Table 2). In the latter case, all nine (ed.), PCR-based diagnostics in infectious diseases. Blackwell Scientific Pub-
lications, Oxford, United Kingdom.
field isolates were positive for the 16S rDNA probe, indicating 5. Bergeron, M. G., and M. Ouellette. 1998. Preventing antibiotic resistance

Downloaded from http://aac.asm.org/ on April 8, 2017 by guest


that failure to detect a gene was not due to failed labeling and through rapid genotypic identification of bacteria and of their antibiotic
hybridization procedures, but presumably was due to the ab- resistance genes in the clinical microbiology laboratory. J. Clin. Microbiol.
36:21692172.
sence of a corresponding probe. Both positive and negative 6. Call, D. R., M. K. Borucki, and T. E. Besser. 2003. Mixed-genome microar-
hybridization results for 38 isolates were described previously rays reveal multiple serotype and lineage-specific differences among strains
of Listeria monocytogenes. J. Clin. Microbiol. 41:632639.
by using DNA-DNA hybridization for the 17 tet genes (10, 14). 7. Call, D. R., D. P. Chandler, and F. Brockman. 2001. Fabrication of DNA
Positive detections for the remaining nine isolates (Table 2) microarrays using unmodified oligonucleotide probes. BioTechniques 30:
were confirmed with gene-specific primers (this study). The E. 368379.
8. Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action,
coli isolate harboring plasmid R741a (isolate 33) was shown to applications, molecular biology, and epidemiology of bacterial resistance.
have tet(G), and this was confirmed by sequence analysis (data Microbiol. Mol. Biol. Rev. 65:232260.
not shown). 9. Courvalin, P. 1991. Genotypic approach to the study of bacterial resistance
to antibiotics. Antimicrob. Agents Chemother. 35:10191023.
Assay design. For the proposed technique to have applica- 10. DePaola, A., and M. C. Roberts. 1995. Class D and E tetracycline resistance
bility in a high-throughput setting, it would clearly require determinants in gram-negative bacteria from catfish ponds. Mol. Cell. Probes
9:311313.
shorter incubation times and automation. In this study, we 11. Hegde, P., R. Qi, K. Abernathy, C. Gay, S. Dharap, R. Gaspard, J. Hughes,
used overnight incubations before proceeding with TSA detec- E. Snesrud, N. Less, and J. Quackenbush. 2000. A concise guide to cDNA
tion simply as a matter of convenience. We also tested the microarray analysis. BioTechniques 29:548562.
12. Johnson, J. R., and A. L. Stell. 2000. Extended virulence genotypes of
feasibility of reducing the hybridization incubation to 3 or 6 h Escherichia coli strains from patients with urosepsis in relation to phylogeny
by using tet(B) as a test target. Probe signal was not saturated and host compromise. J. Infect. Dis. 181:261272.
at 3 h (intensity, 54,266), but saturation was evident by 6 h 13. Jones, C. S., D. J. Osborne, and J. Stanley. 1992. Cloning of a probe for a
previously undescribed enterobacterial tetracycline resistance gene. Lett.
(intensity, 65,535), indicating that a truncated hybridization Appl. Microbiol. 15:106108.
procedure is feasible. 14. Miranda, C. D., C. Kehrenberg, C. Ulep, S. Schwarz, and M. C. Roberts.
2003. Diversity of tetracycline resistance genes in bacteria isolated from
Our prototype microarray demonstrates the feasibility of Chilean salmon farms. Antimicrob. Agents Chemother. 47:883888.
developing relatively high-throughput, planar microarrays for 15. Moland, E. S., C. C. Sanders, and K. S. Thomson. 1998. Can results obtained
identification of resistance genes. These probe fragments can with commercially available MicroScan microdilution panels serve as an
indicator of -lactamase production among Escherichia coli and Klebsiella
be cloned into a common vector to make the production pro- isolates with hidden resistance to expanded-spectrum cephalosporins and
cess more efficient, and because PCR is not required to gen- aztreonam? J. Clin. Microbiol. 36:25752579.
erate targets, the array is limited only by the physical con- 16. Muyzer, G., E. C. de Waal, and A. G. Uitterlinden. 1993. Profiling of complex
microbial populations by denaturing gradient gel electrophoresis analysis of
straints of the slide. For example, we have designed a new polymerase chain reaction-amplified genes coding for 16S rRNA. Appl.
masked formatting that accommodates over 400 probes per Environ. Microbiol. 59:695700.
17. National Committee for Clinical Laboratory Standards. 2003. Methods for
well. If no masking is used, then it is not unusual to incorporate dilution antimicrobial susceptibility tests for bacteria that grow aerobically:
over 10,000 probes on a single slide. Nevertheless, microarrays approved standard, 6th ed. NCCLS document M7-A6. National Committee
designed from PCR products have the disadvantage of requir- for Clinical Laboratory Standards, Wayne, Pa.
18. National Committee for Clinical Laboratory Standards. 2003. Performance
ing positive control constructs for the PCR template. These standards for antimicrobial disk susceptibility tests: approved standard, 8th
long probes are less sensitive to minor point mutations, such as ed. NCCLS document M2-A8. National Committee for Clinical Laboratory
those responsible for protection against extended-spectrum Standards, Wayne, Pa.
19. Perry-OKeefe, H., X. W. Yao, J. M. Coull, M. Fuchs, and M. Egholm. 1996.
-lactams (3). Longer probes, such as the PCR products em- Peptide nucleic acid pre-gel hybridization: an alternative to Southern hy-
ployed here, are clearly more sensitive for target detection bridization. Proc. Natl. Acad. Sci. USA 93:1467014675.
20. Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general users
(22), but a compromise may be achieved by using long (ca., 70- and for biologist programmers, p. 365386. In S. Krawetz and S. Misener
to 100-mer) oligonucleotide probes or peptide nucleic acids (ed.), Bioinformatics methods and protocols: methods in molecular biology.
(19). Humana Press, Totowa, N.J.
21. Schena, M. 2000. Microarray biochip technology. Eaton Publishing, Natick,
Mass.
ACKNOWLEDGMENTS 22. Wu, L., D. K. Thompson, G. Li, R. A. Hurt, J. M. Tiedje, and J. Zhou. 2001.
Development and evaluation of functional gene arrays for detection of se-
We are very grateful to Stacey LaFrentz for technical assistance. lected genes in the environment. Appl. Environ. Microbiol. 67:57805790.