You are on page 1of 338

Salazar • Sandoval • Armendáriz

El enorme avance de la biología molecular ha revolucionado la
manera de visualizar la medicina y la biología en general, lo
que permite una mejor comprensión y un entendimiento más
amplio de los procesos biológicos. Los estudios en este campo,
aplicados a la medicina y a la ingeniería genética, han origina-
do nuevos conocimientos para ofrecer a los pacientes diagnós-
ticos y tratamientos más certeros, logrando así establecer una
conexión estrecha entre las ciencias básicas y las disciplinas
clínicas, de forma tal que múltiples universidades la han inclui-
do dentro de sus planes de estudio como una materia obliga-
toria, tanto de licenciaturas como de maestrías y doctorados.

Este libro permite al lector adentrarse en el campo de la biolo-
gía molecular presentándole un panorama general y a la vez
profundo, con un abordaje sencillo y didáctico. Para ello, el
contenido está dividido en cuatro secciones que cubren desde

BIOLOGÍA MOLECULAR
los aspectos básicos, la estructura y función de las principales
moléculas que participan en el flujo de la información genéti-
ca, hasta temas especializados y de interés general como
terapia génica, organismos transgénicos, dopaje génico, nutri-
genómica y proyecto del genoma humano.

Sin lugar a dudas, el lector tiene en sus manos una herramienta
muy útil para el estudio de la biología molecular en el área de
las ciencias de la salud, y estamos seguros de que su lectura
desarrollará el gusto por esta fascinante rama de la ciencia.

Visite: www.mhhe.com/med/salazar_bmfa1e

Fundamentos y aplicaciones
en las ciencias de la salud
978-607-15-0912-3

Fundamentos y aplicaciones
en las ciencias de la salud

Adriana María Salazar Montes
Instituto de Biología Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

Ana Soledad Sandoval Rodríguez
Instituto de Biología Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara

Juan Socorro Armendáriz Borunda
Instituto de Biología Molecular en Medicina, Centro Universitario de Ciencias de la Salud
Universidad de Guadalajara
O.P.D. Hospital Civil de Guadalajara “Dr. Juan I. Menchaca”

.­9*$0r#0(05Ár#6&/04"*3&4r$"3"$"4r(6"5&."-"r."%3*%r/6&7":03,
4"/+6"/r4"/5*"(0r4"01"6-0r"6$,-"/%r-0/%3&4r.*-¦/r.0/53&"-
/6&7"%&-)*r4"/'3"/$*4$0r4*/("163r45-06*4r4*%/&:r5030/50

Director editorial: Javier de León Fraga
Editor sponsor: Emilio Salas Castillo
Editor de desarrollo: Héctor F. Guerrero Aguilar
Supervisor de producción: Juan José Manjarrez de la Vega

NOTA
La medicina es una ciencia en constante desarrollo. Conforme surjan nuevos conocimientos, se requerirán cambios de la
terapéutica. El(los) autor(es) y los editores se han esforzado para que los cuadros de dosificación medicamentosa sean preci-
sos y acordes con lo establecido en la fecha de publicación. Sin embargo, ante los posibles errores humanos y cambios en la
medicina, ni los editores ni cualquier otra persona que haya participado en la preparación de la obra garantizan que la infor-
mación contenida en ella sea precisa o completa, tampoco son responsables de errores u omisiones, ni de los resultados que
con dicha información se obtengan. Convendría recurrir a otras fuentes de datos, por ejemplo, y de manera particular, habrá
que consultar la hoja informativa que se adjunta con cada medicamento, para tener certeza de que la información de esta
obra es precisa y no se han introducido cambios en la dosis recomendada o en las contraindicaciones para su administración.
Esto es de particular importancia con respecto a fármacos nuevos o de uso no frecuente. También deberá consultarse a los
laboratorios para recabar información sobre los valores normales.

BIOLOGÍA MOLECULAR
Fundamentos y aplicaciones en las ciencias de la salud

Prohibida la reproducción total o parcial de esta obra,
por cualquier medio, sin autorización escrita del editor.

DERECHOS RESERVADOS © 2013, respecto a la primera edición en español por,
McGRAW-HILL INTERAMERICANA EDITORES, S.A. de C. V.
Prolongación Paseo de la Reforma 1015, Torre A, Piso 17, Col. Desarrollo Santa Fe,
Delegación Álvaro Obregón
C. P. 01376, México, D. F.
Miembro de la Cámara Nacional de la Industria Editorial Mexicana Reg. No. 736

ISBN: 978-607-15-0912-3

1234567890 2456789013

Impreso en México Printed in Mexico

Editores

Adriana María Salazar Montes Centro de Investigaciones Médicas Aplicadas. Es profesora
investigadora del Instituto de Biología Molecular en Medi-
Licenciada en Biología. Maestra en Ciencias en Biología cina y Terapia Génica, responsable del área de Terapia
Celular. Doctorado en Ciencias en Biología Molecular en Celular. Es profesora del Doctorado en Ciencias en Biología
Medicina. Universidad de Guadalajara. Posdoctorado en la Molecular en Medicina de la Universidad de Guadalajara.
Universidad de Tuffs, Boston, Estados Unidos. En la actualidad es editora asociada de la Revista Archivos
Obtuvo Doctorado en la Universidad de Guadalajara en de Ciencias, órgano oficial del Centro Universitario de
el área de Biología Molecular y realizó su estancia posdoc- Ciencias de la Salud.
toral en la Universidad de Tuffs, en Boston, Estados Unidos.
Es profesora investigadora y en este momento encargada
del Instituto de Biología Molecular en Medicina y Terapia Juan Armendáriz Borunda
Génica. Es profesora del Doctorado en Ciencias en Biología
Molecular en Medicina y del Doctorado en Farmacología Licenciado en Farmacología. Maestría y Doctorado en Bio-
de la Universidad de Guadalajara. En la actualidad es edito- química en el Centro de Investigaciones y Estudios Avanza-
ra asociada de la Revista Archivos de Ciencias, órgano ofi- dos del Instituto Politécnico Nacional. Posdoctorado en la
cial del Centro Universitario de Ciencias de la Salud. Universidad de Tennessee, Memphis, Estados Unidos.
Obtuvo Doctorado en Bioquímica en el Centro de
Investigaciones y Estudios Avanzados del Instituto Politéc-
nico Nacional, y Posdoctoral en la Universidad de Tennes-
Ana Soledad Sandoval Rodríguez
see, Memphis, Estados Unidos. Es profesor investigador del
Quimicofarmacobióloga de formación con Doctorado en Instituto de Biología Molecular en Medicina y Terapia
Ciencias Biomédicas, con orientación en Inmunología. Génica y actualmente jefe del Departamento de Biología
Universidad de Guadalajara. Posdoctorado en el Centro de Molecular y Genómica. Es profesor del Doctorado en Cien-
Investigaciones Médicas Aplicadas de la Universidad de cias en Biología Molecular en Medicina, del Doctorado en
Navarra, en España. Genética y del Doctorado en Ciencias Biomédicas de la
Obtuvo Doctorado en la Universidad de Guadalajara en Universidad de Guadalajara. En la actualidad es editor de la
el área de las Ciencias Biomédicas. Realizó su estancia pos- Revista Archivos de Ciencias, órgano oficial del Centro Uni-
doctoral en la Universidad de Navarra, en España, en el versitario de Ciencias de la Salud.

iii

Colaboradores

Blanca Estela Alcántar Díaz Adriana Díaz Rivera
Doctora en Ciencias en Biología Molecular en Medicina. Licenciatura en Biología. Doctorado en Ciencias en
Universidad Autónoma de Nayarit. Biología Molecular en Medicina. Centro Universitario
de Ciencias de la Salud, Universidad de Guadalajara.
Bertha Adriana Álvarez Rodríguez
Doctora en Genética. Departamento de Biología
Martha Escoto Delgadillo
Molecular y Genómica, Centro Universitario de Doctora en Ciencias en Biología Celular. Instituto de
Ciencias de la Salud, Universidad de Guadalajara. Patología Infecciosa y Experimental “Dr. Francisco Ruiz
Sánchez” de la Universidad de Guadalajara. Centro de
Juan Armendáriz Borunda Investigaciones Biomédicas de Occidente, Instituto
Mexicano del Seguro Social.
Doctor en Bioquímica. Instituto de Biología Molecular en
Medicina y Terapia Génica, Departamento de Biología
Molecular y Genómica, Centro Universitario de Lucía Flores Contreras
Ciencias de la Salud, Universidad de Guadalajara.
Licenciatura en Biología. Doctorado en Genética. Centro
Universitario de Ciencias de la Salud, Universidad de
Blanca Estela Bastidas Ramírez Guadalajara.
Doctora en Ciencias en Biología Molecular en Medicina.
Instituto de Enfermedades Crónico Degenerativas, Jorge Fernando Floresvillar Mosqueda
Departamento de Biología Molecular y Genómica,
Licenciatura en Microbiología. Doctorado en Ciencias
Centro Universitario de Ciencias de la Salud,
Biomédicas. Orientación Inmunológica. Centro
Universidad de Guadalajara.
Universitario de Ciencias de la Salud, Universidad de
Guadalajara.
Óscar Gabriel Béjar Mejía
Licenciatura en Deportes. Especialidad en Natación. Jesús Javier García Bañuelos
Consejo Municipal del Deporte de Guadalajara.
Doctor en Ciencias en Biología Molecular en Medicina.
Instituto de Biología Molecular y Terapia Génica,
Miriam Ruth Bueno Topete Departamento de Biología Molecular y Genómica,
Doctora en Ciencias en Biología Molecular en Medicina. Centro Universitario de Ciencias de la Salud,
Instituto de Enfermedades Crónico Degenerativas, Universidad de Guadalajara.
Centro Universitario de Ciencias de la Salud,
Universidad de Guadalajara. Belinda Claudia Gómez Meda
Doctora en Genética. Instituto de Biología Molecular en
Paola B. Castro García Medicina y Terapia Génica, Departamento de Biología
Doctora en Neurociencias. Posdoctoral en Division of Molecular y Genómica, Centro Universitario de
Stem Cell Biology. Institute for Genetic Medicine, Ciencias de la Salud, Universidad de Guadalajara.
Hokkaido University.

iv

Universidad de Guadalajara. Centro Universitario de Ciencias de la Salud. Carlos Mata Munguía Departamento de Biología Molecular y Genómica. Instituto de Enfermedades Inmunología. Universidad de Guadalajara. Universidad de Guadalajara. Exactas. Alfonso López Vázquez Departamento de Biología Molecular y Genómica. Biología Molecular en Medicina. Universidad Autónoma de Nayarit. Centro Ciencias en Biología Molecular en Medicina. de Occidente. Centro Tecnológico y de Estudios Superiores de Monterrey. Licenciatura en Médico Cirujano Partero. Centro Universidad de Guadalajara. Departamento de Biología Tecnología y Diseño del Estado de Jalisco. Luis Daniel Hernández Ortega Mayra Guadalupe Mena Enríquez Licenciatura en Quimicofarmacobiólogo. Departamento de Ciencias Instituto de Biología Molecular en Medicina y Terapia Médicas y de la Vida. Doctor en Genética. Centro de Investigaciones Biomédicas Universidad de Guadalajara. Patología Molecular y Biología Doctorado en Ciencias Biomédicas con Orientación en Molecular del Cáncer. Departamento de Biología Molecular y Ciénega. Doctorado en Licenciatura en Biología. Universitario de Ciencias de la Salud. Centro Universitario de los Valles. Orientación Departamento de Biología Molecular y Genómica. Universitario de Ciencias de la Salud. Colaboradores v Jaime González Cuevas Selene Guadalupe Huerta Olvera Doctor en Ciencias en Biología Molecular en Medicina. Elizabeth Gordillo Bastidas Doctora en Ciencias en Biología Molecular en Medicina. Instituto de José Guadalupe Macías Barragán Biología Molecular en Medicina y Terapia Génica. Carmen Magdalena Gurrola Díaz Ana Laura Márquez Aguirre Doctorado en Ciencias. Doctorado en Centro Universitario de Ciencias de la Salud. Juan I. Instituto de Investigación Cardiovascular. Abril Bernardette Martínez Rizo Doctora en Ciencias Biomédicas. Licenciatura en Quimicofarmacobiólogo. Salud. Centro Universitario de la Génica. Universidad de Guadalajara. Centro Universitario de de Ciencias de la Salud. Centro Universitario de Ciencias de la Salud. Doctorado en Ciencias en Medicina. Centro Universitario de Ciencias de la Salud. Doctora en Toxicología. Doctora en Ciencias en Biología Molecular en Medicina. OPD Hospital Genómica. Centro Universitario de Ciencias de la Civil de Guadalajara “Dr. Centro de Investigación y Asistencia en Crónico Degenerativas. Universidad de Guadalajara. de Guadalajara. Ciencias en Biología Molecular en Medicina. Guadalajara. Doctor en Ciencias Biomédicas. Universidad de Universitario de Ciencias de la Salud. María Cristina Islas Carbajal Angélica Sofía González Garibay Doctora en Ciencias en Biología Molecular en Licenciatura en Nutrición. Instituto de Enfermedades Crónico Degenerativas. Centro Universitario Departamento de Fisiología. Universidad Universidad de Guadalajara. Instituto Mexicano del Seguro Social. César Guardado Mora Licenciatura en Quimicofarmacobiólogo. Inmunológica. Universidad de Guadalajara. Orientación Zamira Helena Hernández Nazará Inmunológica. Doctorado en Coordinación de la Carrera de Nutrición. Universidad de Guadalajara. Ciencias de la Salud. . Departamento de Ciencias Naturales y Centro Universitario de Ciencias de la Salud. Universidad de Guadalajara. Menchaca”. Doctorado en Genética. Instituto Ciencias en Biología Molecular en Medicina. Daniela Gordillo Bastidas David Alejandro López de la Mora Doctora en Ciencias en Biología Molecular en Medicina. Molecular y Genómica.

Universidad de Guadalajara. Guadalajara. Maestro en Ciencias en Biología Celular. Doctor en Genética. Universidad de Guadalajara. Departamento de Ciencias Medicina y Terapia Génica. Centro Universitario de Ciencias de la Universitario de Ciencias de la Salud. Centro Universitario de Ciencias de la Salud. Centro Universitario de Ciencias de la Salud. Departamento de Fisiología. Salud. Guadalajara. División Instituto de Biología Molecular en Medicina y Terapia de Medicina Molecular. Centro de Investigación Génica. Departamento de Biología Molecular y Biomédica de Occidente. . José Navarro Partida Pablo Manuel Saucedo Galindo Doctor en Ciencias en Biología Molecular en Medicina. Laboratorio de Mutagénesis. Centro Universitario de los Valles. Universidad de Guadalajara. Departamento de Biología Molecular y Eduardo Vázquez Valls Genómica. Ana Lourdes Zamora Pérez Samantha Rivero-Borrel Sandoval Doctora en Genética. Biología Molecular en Medicina. Universidad de Guadalajara. Ana Soledad Sandoval Rodríguez Silvia Mora Lee Doctora en Ciencias Biomédicas. Centro Universitario de Ciencias de la Social. Doctorado en Ciencias en Mexicano del Seguro Social. Universidad de Salud. Departamento de Clínicas Odontológicas Universitario de Ciencias de la Salud. Instituto Mexicano del Seguro Genómica. Laura Verónica Sánchez Orozco Doctora en Ciencias en Biología Molecular en Medicina. Instituto de Enfermedades Crónico Degenerativas. Adriana María Salazar Montes Guillermo Moisés Zúñiga González Doctora en Ciencias en Biología Molecular en Medicina. Universidad de Guadalajara. Universidad de Guadalajara. Instituto de Investigación en Licenciatura en Médico Cirujano Partero. Instituto de Biología Molecular en Medicina y Terapia Génica. Centro Universitario de Ciencias de la Salud. Instituto de Investigación Génica. Centro Genética. Laboratorio de Ciencias Inmunológica. Instituto de Patología Infecciosa y Experimental “Dr. Centro Universitario de Universidad de Guadalajara. Entrenador. Instituto Licenciatura en Biología. Orientación Doctora en Neurociencias. Molecular y Genómica. Universidad de Universidad de Guadalajara. Ciencias de la Salud. José María Vera Cruz Doctor en Ciencias en Biología Molecular en Medicina.vi Colaboradores Alejandra Meza Ríos María Guadalupe Sánchez Parada Licenciatura en Quimicofarmacobiólogo. Centro Odontología. Instituto de Biología Molecular en Biomédicas y Biotecnología. Universidad de Integrales. Francisco Ruiz Sánchez” de la Universidad de Guadalajara. Centro de Viviana Carolina Núñez Valdez Investigaciones Biomédicas de Occidente. Guadalajara. Centro Universitario de Ciencias de la Salud. Universitario de Ciencias de la Salud. Departamento de Biología Molecular y Cardiovascular. Doctorado en Licenciatura en Médico Cirujano Partero. Centro Universitario de Ciencias de la Salud. Ana Rosa Rincón Sánchez Instituto de Biología Molecular en Medicina y Terapia Doctora en Farmacología. Doctorado en Ciencias en Biología Molecular en Medicina. Centro Genómica. Departamento de Biología Naturales y Exactas. Universidad de Guadalajara.

Contenido Prólogo Capítulo 5 Transcripción 44 Parte I Zamira Helena Hernández Nazará Conceptos básicos Capítulo 6 de biología molecular 1 Traducción 52 Capítulo 1 José María Vera Cruz Bertha Adriana Álvarez Rodríguez Historia de la biología molecular 3 Belinda Claudia Gómez Meda José María Vera Cruz Adriana María Salazar Montes Capítulo 7 César Guardado Mora Juan Armendáriz Borunda Regulación de la expresión génica 66 Adriana María Salazar Montes Capítulo 2 Ana Soledad Sandoval Rodríguez Juan Armendáriz Borunda Ciclo celular 15 Blanca Estela Alcántar Díaz Capítulo 8 Luis Daniel Hernández Ortega Adriana María Salazar Montes Mutaciones 75 María Guadalupe Sánchez Parada Capítulo 3 Belinda Claudia Gómez Meda Estructura de ácidos nucleicos 25 Capítulo 9 José Navarro Partida Mayra Mena Enríquez Mecanismos de reparación del ADN 82 Capítulo 4 Mayra Guadalupe Mena Enríquez Lucía Flores Contreras Replicación 36 Ana Soledad Sandoval Rodríguez Jorge Fernando Floresvillar Mosqueda Juan Armendáriz Borunda José Guadalupe Macías Barragán vii .

Castro García Capítulo 15 Capítulo 21 Técnicas de hibridación 139 Miriam Ruth Bueno Topete Bases moleculares del cáncer 197 Jaime González Cuevas Carmen Magdalena Gurrola Díaz .viii Contenido Parte II Capítulo 16 Metodología del ADN Reacción en cadena de la polimerasa 145 recombinante 91 Ana Soledad Sandoval Rodríguez Alejandra Meza Ríos Capítulo 10 Jorge Fernando Floresvillar Mosqueda Manejo de muestras para estudios moleculares 93 Capítulo 17 Jesús Javier García Bañuelos Secuenciación del ADN Blanca Estela Bastidas Ramírez y microarreglos 160 Elizabeth Gordillo Bastidas Daniela Gordillo Bastidas Belinda Claudia Gómez Meda Guillermo Moisés Zúñiga González José María Vera Cruz Capítulo 11 Bertha Adriana Álvarez Rodríguez Métodos de extraccción de ácidos nucleicos 99 Capítulo 18 Ana Soledad Sandoval Rodríguez Polimorfismos de ADN Abril Bernardette Martínez Rizo y huella genética 171 David Alejandro López de la Mora Belinda Claudia Gómez Meda Ana Lourdes Zamora Pérez Capítulo 12 María Guadalupe Sánchez Parada Electroforesis 110 David Alejandro López de la Mora Ana Soledad Sandoval Rodríguez Parte III Bases moleculares Capítulo 13 de las enfermedades 181 Enzimas de restricción 120 Jaime González Cuevas Capítulo 19 Miriam Ruth Bueno Topete Ana Soledad Sandoval Rodríguez Bases moleculares de las patologías humanas 183 Capítulo 14 José Macías Barragán Selene Guadalupe Huerta Olvera Vectores de clonación y expresión 127 Capítulo 20 Ana Soledad Sandoval Rodríguez Mayra Mena Enríquez Enfermedades monogénicas 191 Ana Laura Márquez Aguirre Silvia Mora Lee Paola B.

Fernández Galindo Miriam Ruth Bueno Topete Capítulo 31 Juan Armendáriz Borunda Dopaje génico 298 Capítulo 26 Ana Soledad Sandoval Rodríguez Bases moleculares del virus de la Óscar Gabriel Béjar Mejía Adriana María Salazar Montes inmunodeficiencia humana 241 Jesús Javier García Bañuelos Martha Escoto Delgadillo Carlos Mata Munguía Eduardo Vázquez Valls Capítulo 32 Proyecto del Genoma Humano: Parte IV aportaciones a la medicina 305 Adriana María Salazar Montes Tópicos selectos 255 Luis Daniel Hernández Ortega Juan Armendáriz Borunda Capítulo 27 Terapia génica 257 Índice alfabético Ana Soledad Sandoval Rodríguez Juan Armendáriz Borunda . Contenido ix Capítulo 22 Adriana María Salazar Montes Adriana Díaz Rivera Bases moleculares de la diabetes mellitus 204 Capítulo 28 Ana Rosa Rincón Sánchez María Cristina Islas Carvajal Animales transgénicos y clonación 268 Capítulo 23 Jesús Javier García Bañuelos Blanca Estela Bastidas Ramírez Bases moleculares Juan Armendáriz Borunda de la obesidad 218 Blanca Estela Bastidas Ramírez Capítulo 29 Angélica Sof ía González Garibay Alfonso López Vázquez Nutrigenómica Viviana Carolina Núñez Valdez y nutrigenética 277 Capítulo 24 Blanca Estela Bastidas Ramírez Jesús Javier García Bañuelos Bases moleculares Elizabeth Gordillo Bastidas de la hepatitis B 227 Daniela Gordillo Bastidas Laura Verónica Sánchez Orozco Miriam Ruth Bueno Topete Capítulo 30 Juan Armendáriz Borunda Biología molecular Capítulo 25 del deporte 287 Óscar Gabriel Béjar Mejía Bases moleculares Ana Soledad Sandoval Rodríguez de la hepatitis C 235C Pablo Manuel Saucedo Galindo Laura Verónica Sánchez Orozco Samantha Rivero-Borrel Sandoval David A.

quienes con sus preguntas. elaboración. corrección y día. por el tiempo dedicado y el empeño dispuesto para que este libro de texto sea com- prensible al alumno de pregrado. Queremos manifestar nuestro agradecimiento a quie. Por su enorme entusiasmo y dedicación. tro sincero agradecimiento. medida gracias a las personas que influyen en su realiza. que tuvo gran paciencia el contenido con sus puntos de vista. pregrado y posgrado. Mucho de lo que aprendimos respecto de la manera de En primer lugar. tulos que conforman esta obra. que el lector tiene en sus manos. a los miembros del comité editorial. Gracias a todos ellos. contribuyeron al resultado comentarios enriquecieron los temas que abarca este libro. redactar dichos temas con mayor claridad fue impartiendo con cuyos comentarios y nuestras discusiones sobre los estos cursos. dudas y nes. pero conocimientos en las diferentes ramas y aplicaciones de la si este trabajo se concluye de manera exitosa es en buena Biología Molecular. a cualquier hora del con este proyecto y perseveró en su edición. Agradecimientos Escribir un libro de texto es tarea muy complicada. temas y capítulos estuvieron siempre solícitos a enriquecer A la editorial McGraw-Hill. nues- A todos y cada uno de los colaboradores de los capí. A los alumnos de los cursos de Biología Molecular de ción. de forma directa o indirecta. donde comparten sus Los autores x .

La tercera sección muestra un panorama lo cual múltiples universidades la han incluido dentro de amplio de las bases moleculares implicadas en el desarrollo sus planes de estudios como una materia obligatoria. un microorganismo o un lar en el área de las ciencias de la salud. para su estudio y aplicadas al diagnóstico. Esta de diversas patologías humanas. ocasionando así una de que su lectura desarrollará en los estudiantes el gusto por patología. También se expone con lo que en el campo de la medicina ha permitido ofrecer a los detalle aquellos mecanismos involucrados en el control de pacientes diagnósticos y tratamientos más certeros. interés general. estos nos permiten una mejor comprensión y un entendimiento procesos pueden ser modificados con la finalidad de mejo- más amplio de los procesos biológicos. tura y función de los genes en el genoma humano parece con intención de regresar al organismo a la homeostasis. Prólogo El enorme avance de la biología molecular en los últimos que ocurren dentro de nuestras células. el presente libro representa una que suceden dentro de las células de todos los organismos herramienta muy útil para el estudio de la biología molecu- vivos. con Rui Pérez Tamayo un abordaje sencillo y didáctico de los eventos moleculares xi . finalmente entender la importancia que ha cobrado la bio. al adentrarnos un poco más en su estudio nos asom. por ros y oportunos. la estructura y función de las principales moléculas la ingeniería genética han generado enormes avances como que participan en el flujo de la información genética como consecuencia del entendimiento de las bases moleculares lo son el ADN. de las principales sesenta años ha venido a revolucionar la manera de visuali. nutrigenómica y proyecto del genoma y sean capaces de entender los mecanismos moleculares humano. logía molecular. La do así establecer una conexión estrecha antes inexistente segunda parte presenta las principales técnicas de biología entre las ciencias básicas y las disciplinas clínicas. rar o revertir el curso de un proceso fisiológico anormal. con el fin de ofrecer a los pacientes diagnósticos más certe- logía molecular en el desarrollo de la vida moderna. tanto de licenciatura como de maestría y doctora. simple. Podemos molecular e ingeniería genética aplicadas a la medicina. todos los días se publican datos nuevos que con ayuda de la biotecnología y la ingeniería genética. y por último. técnicas empleadas en un laboratorio de biología molecular zar la medicina y la biología en general. logran. y de qué manera. y estamos seguros factor ambiental puede modificarlos. En el área de la bio. esta fascinante rama de la ciencia. la cuarta par- medida pretende que los estudiantes de las ciencias de la te brinda una revisión actual de temas especializados y de salud. El texto está dividido en cuatro partes: la primera se bramos de cuán complejos son. conjunten los conocimientos pasados con los actuales cos. nismos que controlan su síntesis. Este libro ofrece al lector adentrarse en el campo de la biología molecular al presentarle un panorama general y a la vez profundo de cada uno de los temas planteados. Los estudios logrados en el enfoca a estudiar los aspectos básicos de la biología mo- campo de la biología molecular aplicados a la medicina y a lecular. y cómo un agente genético. Sin lugar a dudas. Aunque la estruc. dopaje génico. así como los meca- de los fenómenos biológicos que suceden en el organismo. la expresión de los genes de manera positiva y negativa. organismos transgéni- do. como terapia génica. el ARN y las proteínas.

.

Parte I Conceptos básicos de biología molecular Contenido Capítulo 1 Historia de la biología molecular Capítulo 2 Ciclo celular Capítulo 3 Ácidos nucleicos Capítulo 4 Replicación Capítulo 5 Transcripción Capítulo 6 Traducción Capítulo 7 Regulación de la expresión génica Capítulo 8 Mutaciones Capítulo 9 Mecanismos de reparación del ADN .

.

y demostró que los cromosomas son 3 . Ese hecho excepcional Charles Darwin (figura 1-1) propuso la teoría del origen de hizo que Hoppe-Seyler decidiera demorar hasta 1871 la las especies. Kossel demostró que la nucleína de Mies- Gregor Mendel cher contenía proteínas y moléculas básicas ricas en nitróge- no. Johann Gregor Mendel. nunca se preguntó por la naturaleza química buciones científicas más importantes se centraron en el de los genes ni por su localización dentro de las células. en 1889. Al principio esta investigación no pareció secuencia de un cambio en la secuencia del ADN. comunidad científica. realizó unos experimentos hoy conside- resulta dominante sobre el otro (recesivo). lo que en relevante. ción definitiva. Capítulo 1 Historia de la biología molecular José María Vera Cruz / Adriana María Salazar Montes César Guardado Mora / Juan Armendáriz Borunda Introducción Friedrich Miescher La historia de la biología molecular implica muchas historias Entre 1868 y 1869. hasta que Albrecht Kossel llevó a cabo sus pri- la actualidad se conoce como mutación. (figura 1-3). en 1865. Estas “uni. celular. un monje como bases nitrogenadas. por lo que se le considera el padre de la ción investigadora le introdujo en el área de la fisiología genética. en la Universi- transmiten con toda la información. donde destacó la importancia de las enzimas e intu- Estos experimentos causaron un gran impacto en la yó el papel de los ácidos nucleicos en la herencia. así. Por este trabajo híbridas. y llama a los resultados de su investigación “Leyes se le otorgó el Premio Nobel de Fisiología en 1910. y comprobó que los núcleos contenían una a considerar algunos de los sucesos que han dejado huella de sustancia química homogénea y no proteica a la que deno- manera significativa en el desarrollo del área de la biología minó nucleína (el término ácido nucleico fue acuñado que hoy se conoce como biología molecular. siendo posdoctorado en el laboratorio de cado tratar de describirlas de manera individual y más si se Hoppe-Seyler (el acuñador del término biochimie). Thomas Hunt Morgan (figura 1-4). el químico suizo Friedrich Miescher y todas ellas se encuentran entrelazadas. Sería muy compli. la nucleína es una “sustancia rica en fósforo loca- Charles Darwin lizada exclusivamente en el núcleo celular”. lo a la formulación de las leyes fundamentales de la herencia. y le permitieron deducir que las características del organismo están determinadas por un par de factores. en este capítulo sólo se van quirúrgicos. lo que da origen rados clásicos sobre los rasgos genéticos ligados al sexo. cuando información hereditaria. posteriormente. por Richard Altman). En 1888. preparó el camino para la identificación de la molécula portadora de la Esta historia comienza a principios del siglo XIX. Thomas Hunt Morgan dades hereditarias” (genes) no se mezclan sino que se En 1909. Su voca- de la herencia”. meras investigaciones sobre la estructura química de la nucleína. publica sus experimentos con plantas de un glúcido de cinco átomos de carbono. También demostró la presencia agustino (figura 1-2). lo que llevó a la identificación de lo que hoy se conoce Posteriormente. en la que se plantea la preservación de las publicación de estos resultados. a la espera de la confirma- características más favorables de un organismo como con. aisló presta atención a todos los acontecimientos que han tenido los núcleos a partir de células presentes en pus de vendajes impacto en esta ciencia. campo de la genética. Sus contri- Sin embargo. Según sus palabras. aportados por cada progenitor. Por ello. el ADN. y uno de los factores dad de Columbia. que le hizo acreedor del Premio Nobel en 1933.

De sus expe. Los resultados de sus investigaciones les 1. Gregor Mendel. Figura 1-4. Morgan y Alfred Stur- machos mostraban el caracter “ojos blancos”. se percató de que sólo los recombinación de los cromosomas. miles de moscas y estudiaron su herencia. que observó que las personas con ciertas anormalidades genéticas (errores innatos del metabolismo) carecían de ciertas enzimas. permitieron escribir el libro El mecanismo de la herencia 2. la Drosophila melanogaster se convirtió en uno de los principales modelos en genética. En 1910 descubrió una mosca mutante de ojos blancos entre individuos de estirpe silvestre de ojos rojos. portadores de los genes. tevant prepararon un mapa con la localización de los genes rimentos. El gen responsable del caracter “ojos blancos” está en el mendeliana. Friedrich Miescher. cromosoma X. defectuosa. fenómeno descrito por el f ísico inglés Archi- bald Garrod. Gracias a su trabajo. Empleando la los. Con esta observación se rela- cionó a las proteínas (enzimas) con los cambios genéticos. En 1913. Thomas Hunt Morgan. asimismo. Al cruzar estas moscas entre sí. Morgan denomi- nó white al gen correspondiente. Existe la posibilidad de que otros genes también residan como la alcaptonuria. . Calvin Bridges demostró que los genes están en los cromosomas. lo que indicaba que el caracter “ojos blancos” era recesivo. Morgan también descubrió que algunas enfermedades. hembra de ojos rojos presentó ojos rojos. concluyó que: en el cromosoma. lo que dio lugar a lo que se conoce como la teoría cromosómica de Sutton y Boveri. tienen su origen en una enzima en cromosomas específicos. Algunos caracteres se heredan ligados al sexo. La proge- nie del cruzamiento de un macho de ojos blancos con una Figura 1-3. 3. e inició así la tradición de Hunt y sus estudiantes analizaron las características de nombrar a los genes según el fenotipo causado por sus ale. Charles Darwin. Alfred Henry Sturtevant (como Figura 1-2.4 PARTE I • Conceptos básicos de biología molecular Figura 1-1.

y la R (no virulenta). ce Bell. Cuando se inyectaba a ratones la cepa S cau- saba neumonía y muerte en un día o dos. que carecía de ella. demostró que algunos genes Al aislar la bacteria en la sangre de estos ratones se des- tienden a heredarse juntos y dedujo que se localizan en el cubrió que la cepa R. cápsula y se transformaba en S. que conte- nía una cápsula de polisacáridos. Sin embargo. sir William Thomas Astbury (figura 1-7) y Floren- consolidaba la edad de oro de la genética clásica. en el que descubrió el “principio transformante”. Cuando se inyectaba la cepa R no causaba neumonía. ya que la cápsula permitía a la bacteria resistir los ataques del sistema inmu- ne del hospedero. Morgan. Para ello usó dos cepas de la bacteria Streptococcus pneumoniae: la cepa S (virulenta). presentaba mismo cromosoma. William Thomas Astbury ca. en el que se establecían de forma definitiva las bases fundamentales de la herencia genotípi. Bridges. Hermann Muller y Calvin Bridges. Experimento del principio transformante. En 1928 realizó lo que se conoce como “experimento de Griffith”. se iniciaba la teoría cromosómica de la herencia y se En 1938. Alfred Sturtevant. Frederick Griffith. en Inglaterra. taba en ratones perdía su virulencia y los ratones no desa- rrollaban neumonía. los ratones infectados morían. Griffith hipotetizó que En 1915 quedaron definitivamente establecidas las existía un principio transformante presente en las bacterias bases fundamentales de la herencia fenotípica y se publicó muertas de la cepa S que hacía que las bacterias de la cepa R el libro El mecanismo de la herencia mendeliana. Si la cepa S se calentaba para matarla y se inyec- Figura 1-5. anteriormente avirulenta. de la Universidad de Leeds. . si se inyectaban bacterias muertas de la cepa S mezcladas con bacterias vivas de la cepa R (S/R). alumno de Morgan). El experimento de Griffith (figura 1-6) tuvo lugar mien- tras investigaba una vacuna para prevenir la neumonía durante la pandemia de gripe que se produjo tras la Primera Guerra Mundial. Así. que hoy se conoce como ADN. al realizar Bacterias Bacterias S1 S1 R S/R S virulentas (S) avirulentas (R) no encapsuladas encapsuladas 1 2 Figura 1-6. CAPÍTULO 1 • Historia de la biología molecular 5 ADN como material genético Frederick Griffith Oficial médico y genetista británico. por Thomas H. escrito se transformaran en bacterias de tipo S.

El nombramiento de Astbury marcó el nacimiento de la biología molecular como un área de conocimiento independiente. propusieron que el ADN era una fibra compuesta de bases nitrogenadas apiladas a 0. en lana. ron que las cepas inocuas de neumococo estudiadas por en 1943. George Wells Beadle y Edward Lawrie Tatum. Posteriormente. George Wells Beadle y Edward Lawrie Tatum Figura 1-8. Delbrück y Alfred Day Hershey se les otorgó el (enzimas que degradan lípidos) y glucosidasas (enzimas que degradan carbohidratos). Su per- severancia y dedicación lograron que en 1945 consiguiera la primera cátedra de Estructura Biomolecular. Sus resultados. Avery. fue el primer científico en autodenominarse biólogo molecular.33 nm unas de otras. brück demostraron que las mutaciones en E. El tratamiento con ribonucleasa (enzima que degrada el ARN). lipasas cos. el médico italiano Salvador E.6 PARTE I • Conceptos básicos de biología molecular estudios de difracción por rayos X. En 1941. William Thomas Astbury. conocido En 1944. El análisis permitió suponer que el factor transformante podría estar compuesto por ácidos nucleicos. publicados en 1941. A Luria. tampoco producía su inacti- vación. ya que su peso molecular era alto y se precipitaba en presencia de alcohol. como se creyó en un principio. California. proponían y Maclyn McCarty un vínculo directo entre los genes y las enzimas. perpendiculares al eje de la molécu- la. Este compuesto se trató son las causantes de la resistencia de las bacterias a fárma. Sólo cuando el principio se trataba con desoxirribo- Figura 1-9. en la Universidad de Stanford. sin necesidad de exposición a agentes MacLeod. El tratamiento con estas enzimas no logró inactivar su acción. coli LB (Luria broth). como las queratinas. Colin MacLeod y Maclyn Figura 1-7. encontraron sólidas evidencias de una correlación entre los Premio Nobel de Fisiología en 1963 por sus descubrimien- genes y las enzimas en el hongo Neurospora crassa. y que éstas se transmitían siguiendo las leyes de mismo. median. Sus experimentos consistían en expo- ner a Neurospora crassa a rayos X que causaban mutaciones Oswald Theodore Avery. con la finalidad de conocer su naturaleza química. empleando refinadas técnicas desarrolladas por él mutagénicos. tos acerca del mecanismo de replicación de los virus y su te el estudio de rutas metabólicas implicadas en la síntesis estructura genética. Además. MacLeod y McCarty (figura 1-9) demostra- como la hipótesis “Un gen. McCarty. Colin MacLeod que originaban cambios en las enzimas implicadas en rutas metabólicas. con proteasas (enzimas que degradan proteínas). aisló el principio transformante de muestras de neu- la herencia. Oswald Theodore Avery. . Warren Weaver había acuñado el término biología molecular. lécula de ADN y no proteínas. George Wells Beadle y Edward Lawrie Tatum (figura 1-8). de los aminoácidos. Luria. coli ocurrían y demostraron así que el principio transformante era ADN. Astbury siguió trabajando en el estudio de la estructura de proteínas fibrosas. conocido por Griffith se transformaban en patógenas al adquirir la mo- el medio de cultivo para E. Estos autores postularon que las mutaciones mococos biológicamente activo. y Max Del. una enzima”. aprovechando que en 1938. de forma espontánea.

mediante estudios solamente penetra el ADN viral. descubrió que el ADN presentaba introduce a la bacteria y. la mayor parte de la comunidad científi- mico propio de las proteínas y el fósforo del ADN). ca comenzaba a admitir que el material genético es el ADN. lord NH CH Alexander Robertus demostró que los nucleótidos se CO CH2 NH unían al ADN a través de enlaces fosfodiéster. . Epstein. Figura 1-12. demostró que el porcentaje de bases purinas era igual al de bases piri- midinas (véase el capítulo 3). Martha Chase y Alfred Hershey. traron que cuando un virus infecta a una bacteria La quimicof ísica Rosalind Elsie Franklin. utilizando bacte- riófagos (virus que infectan bacterias) marcados con Rosalind Franklin isótopos radiactivos 35S o 32P (el azufre como elemento quí. La cápside viral no se de difracción de rayos X. por lo tanto. En ese mismo año. Erwin Chargaff. así como de citosinas y de guaninas. Reglas de Chargaff. O HC CH CH2 Esta regla tuvo sentido sólo hasta que James Dewey CH2 CH Watson y Francis Harry Compton Crick propusieron su N H N NH modelo de la estructura del ADN. no participa en la los grupos fosfato hacia el exterior y podía hallarse de dos formación de nuevas partículas virales. Con estos descubrimientos se B CH3 fundamentó el principio de complementariedad de las NH CH H NH bases de los ácidos nucleicos (figura 1-11). ca para la síntesis de nuevos viriones. ADN-A y ADN-B (véase el capítulo 3). figura 1-12). CAPÍTULO 1 • Historia de la biología molecular 7 nucleasa (enzima que degrada el ADN) se perdía su acción. CH2 CH CH CH2 N H Erwin Chargaff NH N CH NH C En 1950. Timina Adenina Alfred Hershey y Martha Chase Figura 1-11. por lo que propuso una estructura lineal para la cadena de ADN. Alfred Hershey y Martha Chase (también conoci- da como Martha C. demos. y concluyeron que formas helicoidales distintas: las que hoy conocemos como el ADN. En 1952. y no las proteínas. Erwin Chargaff (figura 1-10) descubre las leyes CH NH que rigen la complementariedad de bases de los ácidos Citosina NH nucleicos. contiene la información genéti. Mediante cromatograf ía en papel. Entre 1950 y 1953. Figura 1-10. Asimismo. Chargaff Guanina demostró que el ADN aislado de diferentes organismos O H contiene la misma proporción de Adeninas y de Timinas. NH H De esta manera se demostró que la naturaleza química del O A CH2 NH principio transformante era ADN y era el causante de pro- HC ducir los cambios permanentes heredables.

8 PARTE I • Conceptos básicos de biología molecular Pares de bases Adenina Timina Guanina Citosina Figura 1-13. En 1957 propuso que el código genético debe leerse en triple- tes. de la biología molecular moderna. y los grupos fosfato (figura 1-15). Era moderna de la biología molecular tulo 3). Rosalind Franklin. siguien- das por enlaces fosfodiéster. nía 14N (ligero) y se permitió que las células se replicaran . James Dewey Watson y Francis Harry Compton Crick. y la otra que lo hace en la dirección opuesta 3´-5´ (véase el capí. Esqueleto de azúcar-fosfatos James Dewey Watson y Francis Harry Compton Crick En 1953. uni. hacia la par. propuso el dogma central de la biología molecular: “El ADN dirige su propia replicación y su trascripción para formar ARN complementario a su secuencia. Cultivaron bacterias en un medio que contenía el isótopo 15N (pesado) para marcar las cadenas de ADN pro- genitoras. Después cambiaron el medio por uno que conte- Figura 1-14. función que hoy se sabe realiza el ARN. que el ADN podía duplicarse y transmitirse de una célula a otra. mientos esenciales en las ciencias de la vida y marcó el inicio te externa de la cadena se localizan las desoxirribosas. En cambio. Su maqueta representaba al ADN formado por dos cadenas antiparalelas: una que corre en dirección 5´-3´. propuso que para la síntesis de proteínas debe existir una molécula mediadora entre las proteínas y el ADN. que explicaba de manera clara Figura 1-15. propuso la existencia de la barandal o pasamanos de una escalera que deja expuestos a tautomería y la replicación semiconservadora del ADN. En su experimento utilizaron centrifuga- ción con gradientes de soluciones de cloruro de cesio (CsCl). Mathew Stanley Meselson y Franklin Stahl En 1958. el bioquímico estadounidense Watson y el biof ísi- co inglés Crick (figura 1-14) elaboraron el famoso modelo de la doble hélice de ADN. Modelo de la doble hélice del ADN. el ARN es traducido en aminoácidos para formar una proteína” (figura 1-16). Estas cadenas tienen una estructura de α-hélice y se hallan unidas por dos y tres puentes de hidrógeno entre las El hallazgo de la estructura del ADN es uno de los descubri- bases A-T y G-C. Crick. En 1955. Mathew Stanley Meselson y Franklin Stahl (figura 1-17) confirmaron la replicación semiconservadora pro- puesta por Crick. respectivamente. formando una especie de do el modelo de la doble hélice. En ese mismo año.

de la Universidad de Wis- consin-Madison. Mathew Stanley Meselson y Franklin Stahl. a partir de Haemophilus influenzae (véase el capítulo 13). Steward Lynn y Werner Arber (figura 1-19) descu. que logró cor- tar el ADN del virus SV40 (que induce la formación de tumores cancerosos en los simios) a 11 fragmentos. se aísla la pri- mera enzima de restricción Hind II. logía de Massachusetts (MIT). híbridas. demostraron que el genoma de ARN de los retrovirus era Hamilton Smith. intermedia. durante la infección de infectadas por virus liberaban unas enzimas (enzimas de restricción). y en consecuencia su densidad sería intermedia. Un año más tarde. con función de ADN polime- En 1968. lo que es más importante. una sola vez con la finalidad de que el ADN recién replicado describió sus genes específicos y. y David Baltimore. . Si la replicación del ADN con. ligera. es decir. Suiza. En 1971. incorporara este nitrógeno. des. con densidad na en 1978. CAPÍTULO 1 • Historia de la biología molecular 9 ADN REPLICACIÓN TRANSCRIPCIÓN TRADUCCIÓN ADN polimerasa ARN polimerasa ARNm. ARNt y ARNm ADN ARN PROTEÍNA cADN RETROTRANSCRIPCIÓN Retrotranscriptasa Figura 1-16. en 1972. Nathans Figura 1-17. Janet replicación. Daniel Nathans. rasa dependiente de ARN. primer mapa de restricción del ADN que detallaba los genes decir la densidad de las moléculas de ADN después de una de una molécula de ADN. Mertz y Ron Davis demostraron que un fragmento de res- pués de una replicación. Smith y dos replicaciones en 14N la mitad de las moléculas de ADN Nathans recibieron el Premio Nobel de Fisiología y Medici- eran ligeras y la otra mitad. El enorme potencial del empleo de las enzimas de res- tricción quedó demostrado por un colega de Smith. en la copiado a una molécula de ADN de doble cadena por la Universidad de Ginebra. Arber. Nathans elaboró el templaba la separación de las dos cadenas. la bac- teria libera otra enzima que modifica químicamente las bases de su propio ADN evitando que la enzima de restric- ción lo corte. de la Universidad Johns-Hopkins. que los inactivan al cortar sus secuencias de ADN. Si la replicación fuera semiconservadora. todas las moléculas de ADN resul. En 1970. del Instituto de Tecno- Hamilton Smith. De esta manera se demostró que la replicación Howard Martin Temin del ADN es semiconservadora y el nuevo ADN preserva y David Baltimore una de las cadenas originales y se sintetiza una de novo (figura 1-18). de manera independiente descubrieron una nueva enzima denominada transcriptasa Werner Arber inversa o retrotranscriptasa. era posible pre. Flujo de la información genética. justo como lo predice la replicación semicon- servadora. Simultáneamente a este ataque molecular. Howard Martin Temin. Después de las técnicas de la ingeniería genética. Daniel Nathans. a principios de la década de 1960. descubrió que las bacterias acción de la transcriptasa inversa. En 1970. las funciones que desempeñan. Este Por las excepcionales contribuciones al nacimiento de resultado fue observado por Meselson y Stahl. produciendo su autodestrucción. Temin y Baltimore (figura 1-20) brieron los sistemas de restricción de las bacterias. tricción podía insertarse y ligarse a otro ADN cortado por tantes tendrían que contener una cadena pesada y una la misma enzima. Este proceso en dos pasos se denomina “sistema controlado de restric- ción-modificación” del hospedero.

lo de ADN (un provirus) que servía como molde para la sínte. Daniel Nathans.10 PARTE I • Conceptos básicos de biología molecular Figura 1-18. Se síntesis de ADN. Temin sugirió que la replicación de los observó. que a su encontrado en ningún tipo de células. Este ARN era si el genoma de estos virus pasaba de padres a producto era degradado por una DNasa pero no se afectó hijos como ARN o se integraba al ADN de la célula huésped por la RNasa ni por hidrólisis alcalina (a la cual es sensible en alguna etapa de su ciclo viral. Incubó el virus en condiciones en que se mentos no sólo sugirieron que la transformación celular indujera la actividad del ADN polimerasa y los cuatro por los virus de ARN ocurría a través de un intermediario Figura 1-19. CTP. si los viriones se trataban con RNasa de transformación indicaban que estos virus requerían de la antes de la reacción. estos virus. . Temin y Baltimore. Estos experi- virus de ARN. GTP. Replicación semiconservadora del ADN. radiactivo. TTP). Werner Arber. la molécula molde se degradaba. junto con Dulbecco. Howard Martin Temin y David Baltimore. vez servía como molde para la síntesis del ARN viral nece- more examinó los viriones (partículas virales maduras) de sario para la infección y la transformación. Por su parte. este molde necesita de una Estos resultados reforzaron la idea de que el ARN viral se ADN polimerasa dependiente de ARN que nunca se había copiaba a una molécula de ADN de doble cadena. Figura 1-20. sis de ARN viral. Sin embargo. que mostraba las propiedades del ADN. Hamilton Smith. Las pruebas de infección y el ARN). también. que la enzima que sintetizaba el ADN se virus de ARN ocurría mediante una molécula intermediaria sedimentaba junto con las partículas virales maduras. El producto resultante fue una molécula insolu- El principal cuestionamiento acerca de los virus de ble en ácido. que sugiere que era parte del virus y no de la célula huésped. fueron dNTP (ATP. Sin embargo. uno de los cuales (TTP) era galardonados con el Premio Nobel de Fisiología en 1975. Balti.

La secuenciación genéti- cis Crick. La idea de multiplicar una hebra de ADN millones de veces le surgió en 1983 pero no convenció a sus colegas de la compañía. por lo que tuvo que desarrollarla solo. de gran valor en biotecnología y como herramienta de investigación científica y forense. La técnica ha permitido también investigar reaction. aplica- fluía del ADN al ARN y a la proteína. Cetus. PRIMER CICLO 94ºC 60ºC 72ºC SEGUNDO CICLO 94ºC 60ºC 72ºC CICLO 35 = 235 MOLÉCULAS Figura 1-22. ble sólo cuando se podían obtener de manera natural muchas copias del mismo ADN. mediante la comparación de Cetus. desarrolló la PCR. La versión de la técnica propuesta inicial- mente por Mullis. PCR). como la Taq polimerasa procedente de Thermus aquaticus (véase el capí- tulo 16. era poco eficiente. La PCR convirtió en una Kary Mullis rutina la secuenciación génica y permitió la lectura comple- Kary Banks Mullis (figura 1-21) desarrolló una técnica inno. Kary Mullis. Por esta invención. hasta entonces. En 1985. compartido con el canadiense Michael Smith. sobre PCR) (figura 1-22). hasta que se le ocurrió emplear ADN polimerasas termoestables. como la identificación de individuos a partir de muestras de sangre de ADN sino que también contradijeron el antiguo concep- o saliva (utilizada en ciencia forense) y la secuenciación de to del dogma de la biología molecular propuesto por Fran- genes de todo tipo de organismos. un proceso muy complicado. así como de muchos organismos vadora que revolucionó la investigación en biología molecu. . aunque efectiva. ta del genoma humano. le dio una recompensa Figura 1-21. mientras trabajaba en la compañía la filogenia (historia evolutiva). en 1993 recibió el Premio Japón y el Premio Nobel de Quími- ca. que postulaba que la información de una célula ca era. que se toman como modelos de problemas biológicos en la lar: la reacción en cadena de la polimerasa (polymerase chain investigación. que permite la amplificación de las secuencias genéticas de distintas especies. Reacción en cadena de la polimerasa (PCR). de 10 000 dólares por la invención de la PCR y luego vendió la patente por 300 millones de dólares a Roche Molecular Systems. extraídas de microorganismos termof ílicos. la compañía en que trabajaba Mullis. La PCR tiene múltiples aplicaciones. CAPÍTULO 1 • Historia de la biología molecular 11 una secuencia específica de ADN mediante nucleótidos tri- fosfatados y un ADN polimerasa.

Esta asevera- ción de los responsables políticos de muchos países. la elaboración de mapas genéticos déficit de la enzima adenosín deaminasa (ADA) fue la pri. algunos autores componen el ADN e identificar los aproximadamente 30 000 han especulado que había un factor agravante en la muerte genes del genoma humano. de pares de bases. 4. Para su desarrollo se destinó de su elección para este tratamiento son las siguientes: un presupuesto de 3000 millones de dólares y se calculó que 1. Ambos pacientes individuos seniles. la adulta. Se ha demostrado que las células genéticamente corre. Dolly aféresis los linfocitos T periféricos. nes obtenidas al finalizar este proyecto fueron las siguientes: 3. Demostró ser fértil y tuvo niveles mucho más altos que durante el periodo de trata- crías en tres ocasiones. es del 99. como artritis (figura 1-23). que vivió del 5 de junio de 1996 al 2 de enero incompleta al tratamiento con reemplazamiento enzimáti- de 2003. Se cultivaron durante 9 a 12 días y posteriormente se Dolly. desde un punto de vista físico y de Dolly: al nacer tenía una edad genética de seis años. la funcional. A los cinco años de edad. característica presente en células viejas. Las razones poder abordar todo el genoma. que se estimularon con fue una oveja resultado de una transferencia nuclear desde interleucina-2 (IL-2) y anticuerpos anti-CD3 durante 72 h y una célula donante diferenciada (de glándula mamaria) a un se transdujeron con un vector retroviral que contenía el gen óvulo no fecundado y anucleado. ción inmune en el paciente. mantuvieron A pesar de que la expectativa de vida de la raza Finn un crecimiento normal de linfocitos T y tuvieron el mismo Dorset. La producción de tan sólo el 10% de los niveles normales • El genoma humano está constituido por 3000 millones de la enzima ADA es suficiente para establecer una fun. secuencia de ADN. Los efec- que ser sacrificada debido a una enfermedad progresiva pul- tos adversos asociados a esta terapia fueron mínimos. Sin embargo. no es el chimpancé. • Existen 25000 genes codificantes. Antes de incluirse en el ensayo se Clonación del primer mamífero (1997) había demostrado que estos niños tenían una respuesta La oveja Dolly. En una primera etapa. sino ADN eran cortos. causado por un retrovirus. tuvieron una respuesta variable a los antígenos. Esta estrategia terapéutica se consolidó en 1989. modelo de la doble hélice del ADN en 1953). exigió el desarrollo de nuevas técnicas de secuenciación para mera enfermedad tratada con terapia génica. a la que pertenecía Dolly. con 99. Los pacientes recibieron 10 a 12 infusiones durante dos años. la sobrepro. misma edad de la oveja de la cual fue clonada. pues internacional de investigación científica con el objetivo fun. Los téc- Proyecto del Genoma Humano (1990) nicos de Roslin no han podido certificar si hubo conexión El Proyecto del Genoma Humano (PGH) fue un proyecto entre su muerte prematura y el hecho de ser un clon. uno de cuatro años y otro de nueve. inmunodeficiencia más estudiada. ma. La deficiencia de ADA es la enfermedad congénita de iba a terminar en 2005. Se les realizó una extracción de sangre y se aislaron por científicos del Instituto Roslin de Edimburgo (Escocia).99%. rrollara. la única cría resultante de 277 fusiones de óvulos anu- reincorporaron al paciente (véase capítulo de terapia génica). Dolly miento con sustitución enzimática. Las conclusio- 2. genoma humano. tuvo tipo de infecciones que los demás niños de su edad. no sólo ción se sustenta en el hallazgo de que los telómeros de su porque el PGH suponía un gran reto técnico-científico. el uso de genes para el tratamiento de enferme. es de 11 a 12 años. • La especie más cercana filogenéticamente al ser huma- gidas tienen una ventaja selectiva en cuanto al creci. La función de la enzima está perfectamente dilucidada. Cinco meses después nacía ADA. guró definitivamente el PGH y se calcularon 15 años de tra- El síndrome de inmunodeficiencia combinada grave por bajo. El debate público que suscitó la idea captó la aten. En este estudio se incluyó a dos pacientes. donde fue Como resultado. con éxito en niños (1989) así como porque el conocimiento obtenido podría asegurar la superioridad tecnológica y comercial del país que lo desa- En la década de 1980 se propició el advenimiento de la tera. la función inmunológica de ambos llegó a estudiada conforme envejecía. En 1990 se inau- cuando se llevó a cabo el primer protocolo clínico. cleados con núcleos de células mamarias. fue el primer mamífero clonado a partir de una célu- co y no había ningún donante de médula ósea compatible. monar a los ocho años de edad. ducción de ADA superior a 50 veces los valores normales • La homología en la secuencia de ADN entre individuos sólo ocasiona una ligera anemia hemolítica. Por el otro lado. La necropsia demostró que tenía cáncer de pulmón. . dos años antes de lo previsto. y se mantuvieron estables desarrolló enfermedades crónico-degenerativas propias de dos años después del último tratamiento. otras ovejas del mismo rebaño sufrieron la misma enferme- damental de determinar la secuencia de pares de bases que dad y murieron a causa de ella. Sus creadores fueron Ian Wilmut y Keith Campbell.12 PARTE I • Conceptos básicos de biología molecular Primer tratamiento de terapia génica también por las tecnologías de vanguardia que podían surgir. En abril de 2003 se publicó la secuencia completa del caron tempranamente (1983). ya que la secuencia En 2001 se elaboró y publicó el primer borrador del geno- del ARNm y del gen que codifica para ADA se identifi. Dolly vivió siempre en el Instituto Roslin. pia génica.9% de homología en su miento frente a las células no modificadas. Se nombró responsable del proyecto a James D. Watson (uno de los dos investigadores que propusieron el dades.

Con el uso de 14N y 15N comprueban que el ADN se 1958 replica de manera semiconservadora. 1865 Temin y Baltimore Se demuestra cómo los virus con ARN como genoma sintetizan ADN y se replican. Ejercicios de integración 1. Erwin Chargaff 1950 Watson y Crick Elaboran el modelo de la doble hélice de ADN. Nombre Aporte (experimento) Características Año Gregor Mendel Leyes fundamentales de la herencia. Desarrolla la técnica de la reacción en cadena de la Permite la amplificación de una secuencia específica polimerasa (PCR). Clonación de la oveja Dolly. Explica cómo una cepa avirulenta puede transformar- se en una virulenta. Complete la información que corresponde en los recuadros vacíos. . de ADN mediante nucleótidos trifosfatados y un ADN polimerasa termoestable. Principio transformante. CAPÍTULO 1 • Historia de la biología molecular 13 Fusión mediada por shock eléctrico Núcleo donante (2n) Formación del Oveja donante del tejido embrión mamario Finn Dorset Ovocito (n) de Remoción del otra célula núcleo del Oveja donante del óvulo adulta ovocito Scottish (cara negra) Dolly con fenotipo Embrión con de la oveja caracteres de la de donde se obtuvo oveja donante la célula mamaria Implantación en madre sustituta oveja Scottish (cara negra) Figura 1-23.

. 1990.44:671-682.291:1304-1351. Venter J. 2001. incubada con cepa R e inyectada al ratón. Adams M. Cepa S Tratada con calor e inyectada al ratón. 2001. 4ª ed. Crick F. Karp G. Stahl F.D..C. et al.. J Hyg. 1958. 5ª ed. complete la información que corresponde en los recuadros vacíos. Luque J. A structure for deoxyribose nucleics acids. Biología Molecular del gen.C. Myer E. Watson J. 1ª ed.. Cepa Experimento Resultado Cepa S El ratón muere. The sequence of the México. conceptos y experimentos. The significance of pneumococcal types. Nature. The replication of DNA in Escherichia coli. Watson J. Herráez A. De acuerdo con los experimentos del principio transformante de Griffith. Bibliografía Griffith F. human genome.B. Ciencia.D.W. Madrid: Elsevier.W. mericana.14 PARTE I • Conceptos básicos de biología molecular 2. Madrid: Médica Pana- ría Genética.171:737-738. 2006.165:30-37. Cepa S Tratada con calor. Biología celular y molecular. 1953. Science. Proc Natl Acad Sci.H. 2006:7-46. DF: McGraw-Hill.27:113-159. Mullis K.D. Texto ilustrado de Biología Molecular e Ingenie. Investigación y 1928. Inyectada al ratón. El ratón vive. Meselson M.. Reacción en cadena de la polimerasa.

Durante la interfase varía el grado de condensa. organelos. y ción del material genético así como el contenido de ADN. división. Rudolf Virchow estableció lo que puede conside. tará una gran cantidad de divisiones celulares. fase S y Durante esta etapa. mamíferos (figura 2-1). división y duplica su material genético. incapaces de entrar nuevamente al ciclo celular. cada división celular produce un organismo renuevan constantemente (por ejemplo. Capítulo 2 Ciclo celular Blanca Estela Alcántar Díaz / Luis Daniel Hernández Ortega Adriana María Salazar Montes Introducción sin modificarse el número de cromosomas. los precur- mo pluricelular como el ser humano. el revestimiento nuevo completo. los túbulos renales proximales y las células endoteliales de vasos sanguíneos. de en etapas. sión. cómo la célula transcurre de manera ordenada y sin discon- La fase M. semanas o incluso más tiempo. que en condiciones normales tienen celular. la interfase se subdivide en: fase G1. M (mitosis en células somáticas y meiosis en células germi- cinesis. que se origi- división celular a la siguiente. Estas células renuevan de manera lenta son necesarias para reponer las células muertas o senescen. o fase mitótica. El ciclo celular se divide en dos fases principales: la fase Una visión global del ciclo celular permite observar M. epitelial de las cavidades y la superficie corporal. y la interfase. es decir el ADN. cializadas. mientras que la fase M suele durar aproximadamente 1 h en las células de En 1858. la célula se prepara para la siguiente fase G2. muy espe- yacente a la reproducción de todos los seres vivos. La interfase puede tener una dura- rarse el segundo principio de la teoría celular: “Toda célula ción de días. que dan origen a los espermatozoides). mientras que para dar origen a un organis. sino que continúan durante toda la vida del individuo y estímulo apropiado. pero pueden aumentar la velo- tes. que carecen de la capacidad de El ciclo celular representa el mecanismo fundamental sub. a través de las cuales la célula pasa de una un ejemplo representativo son los eritrocitos. nales) y la interfase (común en ambas). los tejidos menos expuestos. se subdivide en mitosis. Sin embargo. ARN. a partir de un cigoto sores hematopoyéticos en la médula ósea y las espermato- (originado por la unión de dos gametos sexuales). membra- 15 . es la unidad de origen de todos los seres vivos. dividen. o periodo preparatorio. como suce- de con el hígado. a su vez. nan de su precursor y pasan por un proceso de maduración lizan mediante una secuencia ordenada de procesos en los en el cual pierden su núcleo y con ello su capacidad de divi- que la célula duplica su contenido y luego se divide en dos. El ciclo celular Células permanentes. En los organismos unicelulares. como las bacterias una alta actividad mitótica. pero cuya división puede inducirse mediante el to. Por esto. gonias. se considera que la célula rantes (figura 2-2). así como en situaciones de traumatismo o lesión. que en condiciones normales no se éstas no se detienen una vez que el organismo está comple. todo su contenido (proteínas. De acuerdo con su potencial proliferativo. Son células totalmente diferenciadas. cidad de renovación en caso de pérdida tisular. y cito. donde toda la célula se divide en dos células hijas. las células Para que esta acción pueda llevarse a cabo es necesario pueden categorizarse en: que la célula pase por un proceso denominado división Células lábiles. Estos acontecimientos se rea. Por otra parte. se necesi. según el linaje procede de otra célula preexistente por división de ésta” celular y las condiciones ambientales o fisiológicas impe- (omnis cellula e cellula). y se divi. Células estables. Se encuentran en tejidos que se y las levaduras. en la cual los tinuidad por dos grandes etapas bien diferenciadas: la fase cromosomas duplicados se dividen en dos núcleos.

con una duración des- igual. . De 2 a 5 días La mayor parte de la vida celular. En este le a 2c (dos copias). las células mantienen un número constante de cromosomas diploides (2n) y su contenido en dida (correspondiente a la doble hélice). necesaria para la el ADN no está duplicado. lo que acelera la velocidad de división. se divide en cuatro fases. por lo que se afirma que equiva. en hepatoci- tos la duración es de aproximadamente un año. en el medio de cultivo. S y G2. mientras que la interfase incluye las fases G1. Las De las tres etapas de la interfase. En la figura puede observarse la duración división rápida y las de división lenta es la duración de la del ciclo celular en diferentes estirpes celulares. G2: la célula M crece y condensa se Fa s gradualmente su esi Epitelio del páncreas cin cromatina. las células que han detenido su que se dice que pasan de S a M. El ciclo celular tiene especializadas. sino en un estado par- cialmente condensado conocido como cromatina. internas son adecuadas para la división celular. La principal diferencia entre las células de diferente duración. se encuentran en una etapa previa al inicio de la síntesis de ADN. mientras que la interfase puede tener una duración de días.16 PARTE I • Conceptos básicos de biología molecular I nt Hepatocito er fas G1: la célula ±1 año e crece y realiza S: replicación del sus actividades ADN y duplicación especializadas. de manera que duplica su tamaño antes de dividirse en Epitelio intestinal dos células hijas. la fase M tiene una duración aproximada de una hora en las células de mamíferos. y viceversa. La cromatina se descondensa de forma periodo la célula determina si las condiciones ambientales e gradual hasta adoptar una conformación totalmente exten. durante la cual se dedica a sus actividades Figura 2-2. Cito fase ±50 días lo Te ase af se An tafa se ase e ofa af M Pr met 1h o or Pr a Figura 2-1. la célula entra en la fase G1 (G. separación de las dos hebras en la siguiente fase. Duración del ciclo celular. Fases del ciclo celular. aunque con fase G1. en el cuerpo o y G2. un estímulo (pérdida o daño tisular) el tiempo se acorta. por lo Con notables excepciones. Durante la fase G1. de cromosomas. células embrionarias tienen etapas G1 y G2 muy cortas. La fase M. que se exponen a continuación. sin pasar por G1 división de manera transitoria o permanente. la molécula de ADN no está pre- sente en la forma extendida de doble hélice ni tampoco en la forma compacta de cromosomas. de gap. nas). incluye mitosis ±25 días y cariocinesis. semanas o incluso más tiempo. “intervalo”). a su vez. El ciclo celular transcurre entre dos divisiones celulares sucesivas. la G1 es la más variable. Células embrionarias ±60 minutos Fase de descompactación (G1) Tras la mitosis. El ciclo celular se divide en Espermatogonias dos fases: interfase y M. ya sea en la interfase o en quiescencia (reposo). que proporciona tiempo adicional de crecimiento.

El largo de cada una de ellas a medida que el ADN se va repli. Cuando la mitosis termina y la aspecto típico de dos cromátidas y cuatro brazos. pero el contenido de ADN mátidas hermanas idénticas) y las mantienen juntas. Cuando de forma correcta y decide entre permitir el paso a mitosis. Las dos denominados condensinas ayudan a producir esta conden- moléculas de ADN resultantes permanecen unidas por el sación. en sí. se inicia la mitosis. su propio centrosoma. con un más tardía de la mitosis. que originalmente se definió como el periodo en el célula atraviesa el punto de inicio (start) que compromete que los cromosomas se condensan visiblemente. En cambio. La citoci- de forma irreversible el comienzo del ciclo celular. Al terminar la re. metafase. El eje central de la mitosis consiste en separar y distribuir de manera equitativa los cromosomas. la mitosis. esperar a que se realicen las reparacio. Ésta es una etapa del La fase M es. anafase y telofase) constituyen la puesta a estímulos externos. un conjunto de complejos proteicos que permanece asociada por apareamiento de bases. estas etapas constituyen puede repetir el ciclo varias veces más. los términos cromosoma meta. misma que poder contribuir a la formación de los dos polos del huso desaparece en la fase tardía de la mitosis. cada célula hija recibe un centrosoma mosoma en cualquier momento del ciclo. Cada hebra de este ADN sir. cen íntimamente unidas entre sí como cromátidas herma. lo que tura los cromosomas y finalmente los separa en una fase da lugar a cromosomas visibles al microscopio. los dos centrosomas se separan y cada o en caso contrario. En conjunto. Los dos ásteres se desplazan en direcciones En la fase G2 se inicia la condensación gradual de la cro. res. un proceso continuo. opuestas del núcleo para formar los dos polos del huso matina (proceso inverso a la fase G1 o de descondensación). y ambas copias permanecen jun- En la fase G2 la célula verifica si se ha completado la fase S tas como un complejo único a un lado del núcleo. Las da. Las cohesinas y las condensinas están relacionadas centrómero. Cada doble hebra constituye una cromáti. ya replicados en la fase S que le precede. que para su estu. de esta forma el número de cromosomas es constante. los distribuirán en las dos células hijas. cada uno constituido por una estruc- Fase de preparación para la división tura cilíndrica de microtúbulos cortos. estructuras filiformes. actividades metabólicas y presenta una falta relativa de res- prometafase. uno origina una estructura radial de microtúbulos denomi- nes necesarias. que en las células animales debe duplicarse para la segregación adecuada de los cromosomas. Éstas se mantienen juntas debido a complejos dos eventos básicos: el ADN tiene que replicarse totalmente proteicos denominados cohesinas. Aunque envoltura nuclear se reconstituye alrededor de los cromo- puede considerarse que cada molécula de ADN es un cro. la célula final de la mitosis. Durante la interfase de cada ciclo de una célula animal. de la cromatina (G2) el centrosoma se duplica. nada áster. somas separados. que se superpone con el condiciones ambientales vuelven a ser favorables. Si las nesis se produce en la sexta etapa. mitótico. El proceso de duplicación y mosoma corresponde estrictamente a esta forma de máxima separación del centrosoma se conoce como ciclo del cen- condensación. Antes de que comience la fase M tienen que completarse nas idénticas. cuando se rompe la envoltura nuclear el huso cap- que se completa en las primeras etapas de la mitosis. debido a que dedica toda su . con lo que dan lugar a cromosomas con cuatro de forma estructural y trabajan en conjunto para ayudar a hebras de ADN. una secuencia dinámica en la que varios ciclos indepen- dientes se desarrollan de forma coordinada para producir dos células hijas genéticamente idénticas y en las que parti- Fase de duplicación o síntesis (S) cipan los cromosomas: el citoesqueleto y los centrosomas. trosoma. centrosoma es el principal centro organizador de los micro- cando. que deberán tener plicación. mosomas replicados se condensan y se visualizan como ve de molde para la síntesis o producción de la hebra nueva. configurar los cromosomas replicados para la mitosis. que luego separarán los cromosomas duplicados y separación de las cromátidas hermanas. en tan- se duplica de dos copias (2c) hasta cuatro (4c). que se ensamblan a lo y en las células animales debe duplicarse el centrosoma. o de síntesis. CAPÍTULO 2 • Ciclo celular 17 En el caso de que las condiciones sean favorables. En las células animales el centrosoma también contiene un par de centríolos. los cro- de los cromosomas individuales. la célula entra en la fase G2. para permitir la mitótico. ciclo celular en la que la célula cesa la mayor parte de sus dio se divide en seis etapas. La cohesión de las cromátidas es fundamental para túbulos. junto con sus cromosomas. Mitosis pectivamente. fásico y cromosoma interfásico se utilizan para referirse a las formas de la cromatina condensada y descondensada. cohesinas se unen a dos moléculas paralelas de ADN (cro- mente diploide en el núcleo (2n). Las primeras cinco (profase. se produce la replicación del ADN Cuando la célula está por ingresar en la fase M. to que las condensinas se unen a una molécula individual de Las dos copias de cada cromosoma replicado permane. ADN para ayudar a condensarla. con la finalidad de que cada célula hija Fase de compactación o división (M) reciba una copia idéntica del genoma. el término cro. En la fase S.

anafase y telofa- conectada a un polo opuesto. La mitosis está conformada por varias etapas: profase. anclaje de los microtúbulos del huso a los cromosomas y se denomina cinetocoro. y se acompaña de la liberación La división del citoplasma se inicia al final de la anafase y de la proteína “pegamento” dentro del citoplasma. Fases de la mitosis. san y se preparan para separarse. 2. Los cromosomas migran a polos En esta fase se forma el huso mitótico definitivo que permi.18 PARTE I • Conceptos básicos de biología molecular energía a la separación cromosómica. metafase. y la envol. te a los microtúbulos del huso entrar en contacto con los Telofase cromosomas. 1. ambos polos. El plano de alineación de los se. opuestos del huso. 3. que se extien. que se Durante la telofase los cromosomas se acercan a sus respec- extienden desde el centrosoma hasta pasar los cromosomas tivos polos y tienden a reunirse en una sola masa marcando y forman una canastilla estructural que mantiene la integri. el inicio de esta etapa final de la mitosis. con una cromátide de cada cromosoma Figura 2-3. En este esquema pueden observarse las características de cromosomas se conoce como placa de la metafase. La envoltura nuclear dad del huso. prometafase. La envoltura nuclear se 1. ecuador del hueso. . inician su migración hacia los polos. anafase y telofase. el citoesqueleto se desensambla. La mitosis. El material genético se condensa. 2. El movimiento de cada den desde el centrosoma hacia una estructura proteica cromosoma hacia un polo se acompaña del acortamiento localizada en el centrómero del cromosoma. que irradian hacia fuera a partir del centrosoma en la región situada por fuera del cuerpo del cromosomas de la placa metafásica se separan de manera huso. Metafase 4. En la metafase los cromosomas se encuentran alineados en el ecuador del huso. metafase. se reconstituye conforme las vesículas membranosas se Las dos cromátides hermanas de cada cromosoma unen a la superficie de los cromosomas y luego se fusionan replicado se comprimen una contra otra a lo largo de las lateralmente para formar una cubierta de doble membrana superficies internas y aparentemente se mantienen juntas cada vez más grande. Prometafase 2. Los cromosomas se dispersan. Los cromosomas se encuentran rompe. y 3) microtúbulos polares (o interpolares). polos opuestos. Profase se subdivide en cinco fases. organizado para separar los cromosomas duplicados. tafase. este proceso es necesario para el des- Telofase plazamiento de los cromosomas hacia los polos durante la anafase. El huso cada una de ellas en relación con los cambios experimentados mitótico de la célula en metafase se encuentra altamente por el material genético y la célula en general. La envoltura nuclear se dispersa separa en dos. y es probable que ayuden en la colocación del aparato sincronizada. La envoltura nuclear se ensambla. que permite el de los microtúbulos fijos al cinetocoro. a su vez. Las células hijas se forman por citocinesis. Las cromatides hermanas se separan. lo que marca el inicio de la prome. Los cromosomas se alinean al Durante la profase los cromosomas replicados se conden. unidos por microtúbulos cromosómicos por tura nuclear se dispersa. 3. Anafase Ésta se inicia cuando se separan en forma sincrónica y súbi- Citocinesis o citodiéresis ta las cromátides hermanas. llamadas profase. Los cromosomas se aglomeran en centro de la célula. Prometafase 1. Los microtúbulos del huso en esta fase tienen la misma pola- ridad pero funcionalmente se dividen en tres grupos: 1) microtúbulos astrales. 2) microtúbulos cromosómicos. en el cual la célula en división se 3. cromosomas separados para formar dos núcleos (figura 2-3). Los centrómeros se dividen. el complejo de alineados al ecuador en la placa Golgi y el retículo endoplásmico se fragmentan. acompañadas de un proceso 2. Anafase 1. de la metafase. La envoltura nuclear reconstituida se por unas proteínas de “pegamento” no cromosómicas acomoda alrededor de cada uno de los dos conjuntos de denominadas cohesinas. denominado citocinesis. todos los continúa durante la telofase. y las cromátides (ahora conocidas como cro- del huso dentro de las células y determinen el plano de la mosomas. mismos que se mueven a una posición en el 1. Los microtúbulos cromosómicos Profase se unen a los cinetocoros. prometafase. y el huso mitótico comien- Metafase za a formarse afuera del núcleo. El citoesqueleto se desensambla y el uso mitótico se ensambla. pues ya no se encuentran fijas a su duplicado) citocinesis.

de miosina na (actina y miosina). que hará posible la división celular (figura 2-4). CAPÍTULO 2 • Ciclo celular 19 La citocinesis. La composición del anillo contráctil es principalmente formando complejos de dos subunidades: una posee activi. la indentación se profun- diza y se convierte en un surco que rodea por completo a la célula. las denominó Cdk. Control del ciclo celular Como resultado se originan dos células hijas En el control del ciclo celular participan complejos de pro. y la va. en otras palabras. o citodiéresis. Figura 2-4. El primer indicio de citocinesis en animales se observa durante la anafase tardía como una depresión en la superfi- cie de la célula dentro de una banda estrecha alrededor de ésta. El plano del surco se sitúa en el mismo plano que ocupaban previamente los cromosomas de la placa de la metafase. el avance del ciclo. Citocinesis. Este proceso se lleva a cabo por el impulso de contracciones progresivas causadas por un ani- llo periférico contráctil. es la separación f ísica del citoplasma en dos células hijas durante la división celular y Filamentos se produce después de la cariocinesis. celular. de filamentos de actina y miosina. a menos que se estimulen para ello. La formación del anillo contráctil se teínas que actúan en cada una de las etapas y permiten. que contienen elementos de la pared celular. de actina El mecanismo de las células animales y el de las vegetales es distinto. que puede ser una etapa transitoria. En las células animales tiene lugar por estrangula- ción de la célula en el ecuador del huso. que se unen en dos. pueden pro- seguir a la fase G1 del ciclo y continuar hasta la mitosis. implicadas en la progresión del ciclo celular. o produce durante la etapa de citocinesis. lo que garantiza que los dos conjuntos de cromosomas se separen finalmente en dos cé- lulas. El surco continúa profundizándose hasta que las superficies opuestas hacen contacto en el centro de la célula Formación del anillo contráctil y ésta se separa en dos. el plano del surco es perpen- dicular al eje del huso mitótico. dad cinasa y transfiere grupos fosfato del adenosín trifosfa- to (ATP) a residuos serina y treonina de proteínas diana o blanco. Fase G0 o de quiescencia Surco de división Algunas células permanecen en reposo tras la fase M. pero si la concentración de ciclina se ele. o si las condiciones ambientales son las idóneas. Dicho anillo es el en- no. Debido a esto a las enzimas con actividad cinasa se Cuando la concentración de ciclina es baja. Las vesículas se fusionan y entran en contacto con las paredes laterales de la célula. la cinasa per. vidades durante el ciclo celular. En el cuerpo o en un medio de cultivo se encuentran “detenidas”. al final de la telofase. . Conforme avanza el tiempo. en la zona media de la célula. que forman un anillo contráctil. y se lleva a cabo Filamentos mediante la participación de proteínas ligadas a la membra. y cuando se produce un estímulo adecuado. la cinasa se activa y la célula avanza dentro del ciclo otra actúa como una subunidad reguladora llamada ciclina. Estas proteínas se denominan cicli. y se descubrió que dirigen diversas acti- manece inactiva. cargado de estrangular el citoplasma de la célula hasta dividirla nas y cinasas dependientes de ciclinas (Cdk). De esta forma se origina el tabique o fragmoplasto. Las células vegetales tienen un proceso diferente de división que consiste en la acumulación de vesículas proce- dentes del aparato de Golgi. durar largo tiempo o no dividirse definitivamente.

transcripción E2F. Rb se encarga de detener la más de los complejos ciclina B1-Cdk1. Al ser activada. El paso por START del ciclo celular para permitir la reparación del daño. reconocen el daño en el ADN y las anormalidades G2 celulares. y le permite Estudios en levaduras permitieron observar que el ciclo comenzar la síntesis de ADN. es irreparable. ATM es el presenta la ubicación de los principales puntos de control que regulan el ciclo celular. El paso de la fase G1 a S. haploide en el ciclo de vida. En este esquema se multiproteicos capaces de unirse al ADN dañado. El paso de G2 a la mitosis requiere de la activación de Cdk por un grupo diferente de ciclinas. Meiosis cas. la estabilización y antes del final de G1. pero se incrementa conforme avanza la radiaciones ionizantes. logos. que son parte de complejos Figura 2-5. transcripción de varios genes como los que codifican para Otro tipo de proteínas con capacidad de regular el ciclo las ciclinas E y A. ini- cia una respuesta que detiene de forma transitoria el pro- greso del ciclo celular. A este complejo se lo denomina factor promotor de la mitosis (MPF). lo que provoca que Rb se desprenda de E2F. La actividad de Cdk en G1 cadenas del ADN. la meiosis garantiza la producción de una fase centración de ciclinas mitóticas. p53 desempe- celular en una célula eucariota se regula en distintas etapas. principal mediador de la respuesta a las roturas de ambas lado por complejos ciclina-cinasa. Cdk1 y varias proteínas que participan en celular son las conocidas como proteínas supresoras de la replicación. mientras que ATR interviene en fase. a manera de M sensores. Así. y se encarga de fosforilar los sustratos nece. Ciclina B/A + Cdk1 En estos puntos participan proteínas que. ocurre nuclear dan lugar a la fosforilación. La salida de la mosomas se reduce de modo que se forman células que sólo mitosis y el ingreso a G1 depende de un descenso rápido en contienen un miembro de cada par de cromosomas homó- la actividad de Cdk. consecuencia de una caída en la con. su fosforilación conlleva la que participan en los puntos de revisión del ciclo celular. ña su función reguladora en la fase G1. esta proteína estimula la punto. · La célula es lo suficientemente grande Dos de las principales proteínas que funcionan como · El medio ambiente favorable sensores en estos puntos de control son ATM (ataxia- Punto de control en G1 telangiectasia mutada) y ATR (proteína relacionada con ataxia-telangiectasia y Rad3). En caso de que el daño sea mayor y no sea posible o Cdk6 repararlo. También se observa actividad de Cdk4 y Cdk6 acopladas respuesta al daño inducido por radiación ultravioleta (UV). Por otra parte. denominado START. cuyos niveles se elevan al final de G1. A medida que avanza el ciclo celular. los cuales se cree que célula en la fase G1.20 PARTE I • Conceptos básicos de biología molecular Punto de control en G2 Puntos de revisión (check points) · Todo el ADN está replicado Punto de control en la metafase · La célula es lo suficientemente grande Los puntos de revisión son mecanismos que detienen la · Todos los cromosomas están · El medio ambiente es favorable alineados adecuadamente progresión del ciclo celular en caso de que cualquier ADN Entrada cromosómico se dañe o si ciertos procesos no se llevaron a aM Salida de M cabo de manera correcta. El principal sustrato de estas Una vez unidas pueden fosforilar una variedad de proteínas Cdk es la proteína reguladora Rb. El paso de una etapa a otra está regu. un tipo de daño característico de las temprana es muy baja. Los principa- Ciclina les puntos de control se encuentran ubicados en G1 antes de A + Cdk2 Ciclina Entrada la síntesis de ADN. Las lesiones del ADN El primer punto de transición. teína del retinoblastoma) y p53. Entre las más importantes se encuentran Rb (pro- actividad de la Cdk2 con ciclina E y ciclina A. como la replicación del ADN en la fase S o la alineación cromosómica durante la fase M. Una vez que la célula ha pasado este la activación de p53. D2 y D3). p53 desencadena la apoptosis (figura 2-6). ade. Rb se hiperfosforila de manera progresiva. Entonces la célula puede reparar el S G1 Ciclina daño o corregir el defecto antes de ingresar a una nueva D’s + Cdk4 etapa. a las ciclinas D (D1. Regulación del ciclo celular. es impulsada por la tumores. y la fertilización asegura una . contiene pocos aminoácidos fosforila- fosforilan sustratos como proteínas citoesqueléticas. Si éste requiere la activación de Cdk por una o más ciclinas G1. en G2 antes de la mitosis y en la mitosis E + Cdk2 aS durante la metafase (figura 2-5). histonas y dos. La meiosis es el proceso durante el cual el número de cro- sarios para que la célula inicie la mitosis. las ciclinas mitóti. está destinada en forma irrevocable a replicar su transcripción de la proteína p21 que detiene la progresión ADN y a completar el ciclo celular. La transición de G2 a M comienza con la activación de la ciclina A y Cdk1. el mecanismo de revisión transmite una señal que conduce a la muerte de la célula dañada. Si una de estas proteínas detecta un defecto. e impide la entrada a la fase S al unirse al factor de proteínas de la envoltura nuclear. evitando que éste se asocie a secuencias potenciadoras en sus genes blanco.

se activa y fosforila y activa la cinasa del punto de revisión Chk2 a) que fosforila p53 b). lo que provoca que se desprenda de E2F permitiéndole a la célula entrar a la fase S. fosforila y activa la cinasa del punto de revisión Chk1 1). a su vez. tras activarse por un daño específico. en condiciones normales se encuentra parcialmente fosforilada y unida al factor transcripcional E2F (I). En la vía C se muestra la proteína Rb que. y la proteína p21 producida inhibe de forma directa la Cdk e) en ambas vías. resultando en el paro del ciclo celular. el cual activa la transcripción de P21 c). la cual. . que fosforila y desactiva la fosfatasa Cdc25 2). en condiciones normales. En la vía B se observa cómo ATM. lo que deja a Cdk en su estado inactivo 5). En la vía A se muestra cómo ATR se activa tras un daño específico. En este esquema se muestran tres de las principales vías que controlan la progresión del ci- clo celular. pero una vez fosforilada se une a una proteína adaptadora en el citoplasma 4) y no puede importarse de nuevo al núcleo. CAPÍTULO 2 • Ciclo celular 21 Radiación ionizante B ATM Chk2 a C Chk2 P P P p53 Rb DP 1/2 p53 E2F b Radiación Ciclina D P I UV c P21 gen Cdk 4/6 P P P A p53 P Rb ARNm p21 DP 1/2 ATR p21 d E2F Activa Inactiva Cdk Chk1 Inactiva Activa II Cdk 1 Chk1 e p21 DP 1/2 Cdc25 P E2F 2 Cdc25 Paro del ciclo celular Inactiva Progresión del 3 CdK ciclo celular 5 Proteína adaptadora Citoplasma P 4 Cdc25 Figura 2-6. ésta se hiperfosforila por el complejo D-Cdk 4/6. se desplaza entre el núcleo y el citoplasma 3). Control del ciclo celular. éste.

PROFASE I • Diploteno: comienza la separación de los cromosomas Ésta es la fase más larga de la meiosis. que suele comenzar por los extremos y se el plano ecuatorial completamente al azar. no ocurre separación de cro- mátidas. que ya tienen Telofase II el número diploide de cromosomas (2n). • A diferencia de la mitosis. cada una de Metafase II las cuales contiene la mitad de la dotación cromosómica Alineación de los cromosomas normal. Esquema general de las fases involucradas en la meiosis. y forman largas tiras en (tétradas). La célula duplica su material ción de los cromosomas va seguida por dos divisiones en genético secuencia que distribuyen los cromosomas entre cuatro núcleos. Tiene lugar un entrecruzamiento cromosómico Este intercambio supondrá la formación de cromátidas mediante quiasmas. empiezan cómo cada bivalente está unido por cuatro cromátidas a condensarse y hacerse visibles. la reunión de los cromosomas maternos y paternos. la reproducción sexual sería im. una recombinación genética. Se puede apreciar por dos cromátidas unidas por el centrómero. Sin meiosis. Etapas de la meiosis. forma una tétrada. • Cigoteno: los pares de cromosomas homólogos se METAFASE I aproximan entre sí. para una misma característica) entre las cromátidas de • Paquiteno: se completa la sinapsis en todos los cromo- los pares homólogos de los cromosomas duplicados. Profase I Entrecruzamiento cromosómico Para asegurar que cada núcleo hijo. A medida que se alinean los pares de cromosomas se desarrolla un proceso de recombinación genética entre las Anafase I cromátidas hermanas con intercambio de fragmentos de Desplazamiento de los ADN entre un cromosoma paterno y su correspondiente cromosomas hacia polos opuestos cromosoma materno. Interfase posible. Telofase I Se forma la membrana nuclear y comienza la citocinesis Fases de la meiosis Profase I La meiosis es un tipo especial de división celular que origi. Se divide en cinco subfases: desaparecen el núcleo y la membrana nuclear. dando como resultado la producción de cromosomas en donde ninguno de ellos es idéntico a otro. y como consecuencia tiene lugar con diferente constitución genética en la célula madre. y pone aún más de manifiesto los quiasmas. • Diacinesis: los cromosomas se condensan al máximo y tico. Se separan las cromátidas de termina produciendo cuatro células hijas (gametos). el núcleo. que cada cromosoma más tarde se fusionarán para formar cigotos. posea un miembro de cada par de cromosomas homólogos. Durante esta fase los cromosomas homólogos se alinean en miento. Se rompe la membrana nuclear na gametos o células germinales masculinas y femeninas y se forma el nuevo huso (espermatozoides y óvulos. y en ella los cromoso. ocurre un elaborado proceso de formación de Metafase I pares de cromosomas que no tienen contraparte en la mito. formado durante la meiosis. Suelen darse dos o tres de estos entrecruzamientos por cada par bivalente. esta división. respectivamente). Alineamiento de los cromosomas en el plano ecuatorial sis. compuestos que quedan libres en el citoplasma. Anafase II to.22 PARTE I • Conceptos básicos de biología molecular fase diploide. también conocida como gametogénesis. por lo • Leptoteno: los cromosomas individuales. en la meiosis la duplica. somas. Por lo tan. • Durante esta primera división meiótica hay un intercam- que se establece por medio del complejo sinaptonémi- bio de alelos (genes alternos que representan el código co. . Esta sinapsis. A esta dotación media de cromosomas de cada en el plano ecuatorial gameto se la conoce como número haploide (n). homólogos. y tiene lugar la sinapsis o aparea. lo que garantiza extiende a lo largo de los cromosomas. mas homólogos intercambian fragmentos de material gené. Se forma la membrana nuclear y comienza la citocinesis La meiosis se divide en dos fases separadas: Como resultado se obtienen 4 Meiosis I (o división reductora) células haploides En ella tienen lugar algunos sucesos importantes: Figura 2-7. sino que cada cromosoma duplicado de cada par homólogo emigra a cada polo del huso. A diferencia de la mitosis.

Ejercicios de integración 1. Complete la imagen colocando el nombre de las etapas 2. ciclo celular y qué características revisan cada uno de mo. cada uno de ellos formado por dos cro- cromosomas (n). M G1: S: G2 G2: M se Fa S G1 . G1. el contenido de ADN todavía es diploide. describa las características principales de las fases ellos. cada uno de los cuatro gametos resultan- haploide de cromosomas y son distintas desde el punto de tes sufre una transformación hasta espermatozoide madu- vista de su dotación genética. se rompe la membrana nuclear y se forma el TELOFASE I nuevo huso. desigual entre los cuatro gametos resultantes: uno de ellos lo gana casi todo (óvulo). mátidas. puesto por dos cromátidas. Esto significa que cada gameto ro. mientras que los otros tres (cuer- pos residuales) degeneran. TELOFASE II Meiosis II (o división ecuatorial) Se forma la membrana nuclear alrededor de los cuatro Tan sólo tiene lugar la separación por el centrómero de núcleos haploides y comienza la citocinesis. resulta bastante similar a la mitosis: los polos opuestos de la célula. que se desplazan hacia demás. a diferen- cada polo opuesto del huso. Asimis. el citoplasma se distribuye de manera contiene su propio complemento genético único (figura 2-7). contienen el número En el hombre. Cada cromosoma sigue constituido aún por dos cromátidas. Cada célula hija recibe 23 Los cromosomas. S y G2 y el nombre con el que se conoce a estas tres etapas en conjunto. Cada una de las células hijas recién formadas entra ANAFASE II en la meiosis II. se vuelven a formar los METAFASE II núcleos y comienza la citocinesis. pero como cada cromosoma está com. Se separan las cromátidas de cada cromosoma. se alinean en el plano ecuatorial. CAPÍTULO 2 • Ciclo celular 23 ANAFASE I Esta división no va precedida por una fase S. Señale la ubicación de los puntos de control dentro del que componen la fase M y su duración promedio. En la mujer. cia de lo que ocurre en la mitosis. por lo Es la separación de cada bivalente. Esta fase es parecida a la de la mitosis: los cromosomas lle- gan hasta los polos opuestos. cada cromosoma para liberar las cromátidas que emigran a El resultado final son cuatro células hijas que. PROFASE II Es muy corta.

Mayes PA. Hopkin K. DF: McGraw-Hill Madrid: McGraw-Hill Interamericana Aravaca. Herráez A. Raff M. Patología Interamericana. En cuanto a las células hijas originadas. México. Lewis J. Rubín R. et al. Murray RK. 2001. 4ª ed. Stephen CW. Fundamentos Harper. 5. Mencione las fases que componen la mitosis en orden de en cada uno de ellos. 2006:611-671. 4ª ed. Madrid: Editorial Médica drid: Harcourt Editora. Baltimore D. Granner DK. Darnell J. Bray D. 4. P P P P P P P Ciclina Cinasa p53 p53 Rb Rb Cinasa Ciclina Cinasa p21 Preguntas de repaso 1. Gorstein F. Schwarting R. Para permitir la progresión del ciclo celular. 2000. Strayer D. Karp G. In. Bioquímica de Gregory CS. México. Lodish H. Biología celular y molecular. Barcelona: McGraw-Hill Rubín E. ¿cuál es la dife. Interamericana. Zipursky SL. Escriba en los cuadros inferiores si el estado de la proteína de arriba es activo o inactivo. Mencione la ubicación de los tres principales puntos de rencia principal entre mitosis y meiosis? control dentro del ciclo celular y qué es lo que se verifica 2. 2006:621-669. Luque J. Fundamentos clinicopatológicos en Medicina. 2006:97-106. Berk A. 2000. Johnson A. clínicos patológicos en medicina. 2ª ed. Rodwell VK. Patología estructural. Biología molecular e ingeniería genética. Cuando se habla de células con un número haploide y que las Cdk se encuentren en su forma activa o inactiva? diploide de cromosomas. 4ª ed. estructural. 15ª ed. Ma- troducción a la biología celular. ¿es necesario 3. . ¿a qué se hace referencia? ¿Qué proteínas activan e inactivan a las Cdk? Bibliografía Alberts B. Nueva York: Freeman. 2006:99-101. Panamericana. Molecular cell biology. Matsudaira P.24 PARTE I • Conceptos básicos de biología molecular 3. ejecución. DF: El Manual Moderno.

Los Composición de los ácidos nucleicos nucleótidos que contienen ribosa se denominan ribonu- cleótidos. mientras que las pirimidinas están formadas por un solo anillo. La pentosa que compone el nucleótido es la D-ribosa para el ARN y la D-desoxirribosa en el caso del ADN. eucariotas y virus. Es importante mencionar ácido desoxirribonucleico (ADN) y el ácido ribonucleico que el recambio de ácidos nucleicos da lugar a la liberación (ARN). La unidad básica de los ácidos nucleicos es el nucleótido. ambas presentes en los nucleóti- encuentra en su único cromosoma y. Existen dos tipos de 5-fosfato. El ARN interviene en la los ácidos nucleicos son la citosina (C). una ribosa o desoxirribosa según el ácido ribosa y la desoxirribosa es que la primera posee un grupo nucleico. Capítulo 3 Ácidos nucleicos José Navarro Partida / Mayra Mena Enríquez Introducción 3. organismo vivo. Los carbonos de la pentosa se iden- una molécula orgánica compuesta por tres componentes: tifican en los nucleótidos mediante números del 1 al 5. OH en el carbono dos. Las instrucciones necesarias para dirigir Las bases nitrogenadas son moléculas formadas de sus actividades están contenidas en los cromosomas. para generar de nuevo el nucleótido. Las pirimidinas características de mosómica. Pentosa. en forma de plásmidos. con 1. las pirimidinas lo hacen como bases libres y des- ácidos nucleicos química y estructuralmente distintos: el pués se unen a la ribosa 5-fosfato. ambos se encuentran en todas las células procario. Grupo fosfato. las mitocondrias y los cloroplastos de Las purinas características de los ácidos nucleicos son las células eucariotas. desoxirribonucleótidos. La diferencia entre la 2. de manera extracro. mientras que los que contienen desoxirribosa. riotas. causante de las cargas negativas de los ácidos nucleicos y que le brinda características ácidas Las células son las unidades funcionales de cualquier (figura 3-1). dos del ADN y del ARN. la matriz mitocondrial y el estroma de cloro. Se conocen dos tipos de bases nitrogenadas: las puri- y son conocidas en su conjunto como información gené- nas y las pirimidinas. mientras que la segunda carece de 25 . En las células procariotas el ADN se adenina (A) y guanina (G). Las purinas se sintetizan de novo en el hígado organismos y son necesarios para el almacenamiento y la como mononucleótidos unidos con una molécula de ribosa expresión de la información genética. estas tas. mientras que la T sólo citoplasma. y se denominan primos. la timina (T) y el transferencia de la información contenida en el ADN hacia uracilo (U). de bases libres. mente los nucleótidos que componen al ARN. Base nitrogenada. La C está presente en los nucleótidos que com- los compartimientos celulares. una purina o pirimidina. forma los nucleótidos que componen al ADN y el U. una comilla. Los átomos de carbono y nitró- Ácidos nucleicos geno de los anillos se identifican mediante números natura- les: del 1 al 6 para las pirimidinas y del 1 al 9 para las purinas Los ácidos nucleicos constituyen el material genético de los (figura 3-2). el ponen tanto al ADN como al ARN. El ADN funciona como el almacén bases se reciclan y se unen a una pentosa y un grupo fosfato de la información genética y se localiza en los cromo. anillos condensados. somas del núcleo. que átomos de carbono y nitrógeno que crean anillos heterocí- en el caso de las eucariotas se localizan en el núcleo celular clicos. única- plastos de células eucariotas y en el citosol de células proca. Se encuentra en el núcleo. tanto de purinas como pirimidinas. Las purinas se componen de dos tica.

mientras que si la molécula de nucleósido monofosfato o nucleótido. El nucleótidos o secuencia de la cadena se considera la estruc- N O OH H O NH2 N 7 NH2 CH3 7 6 5 8 HN 3 4 8 9 N 3 6 5 5 4 5 4 N 1 4 N 2 9 N 1 4 N H 6 3 N 2 6 1 2 3 5 H 1 2 1 6 2 3 N O OH N N N N NH2 O H Adenina Guanina Citosina Timina Uracilo Figura 3-2. T y C. Por un lado de la cadena se encuentra un extremo 5’-fosfato y. aunque cuando se encuentran libres lo están en su forma la secuencia de nucleótidos en una cadena de polinucleóti- trifosfatada. Por consenso universal. Cadenas de ácidos nucleicos Nucleósidos o polinucleótidos La unión de una base nitrogenada y la pentosa produce un Los nucleótidos se unen mediante enlaces fosfodiéster para nucleósido. (Para la nomenclatura completa de las moléculas nucleotí- dicho grupo funcional y sólo cuenta con un hidrógeno dicas véase el cuadro 3-1. y si. . N-glucosídico que se forma entre el C-1’ de la pentosa y el El enlace fosfodiéster tiene lugar entre el C-5’-fosfato de un N-1 de las pirimidinas o bien el N-9 de las purinas (figura nucleótido y el C-3’-hidroxilo del siguiente nucleótido. lo hace a una desoxi- diéster genera un polinucleótido polarizado. Si la cadena es de ribonucleótidos. dos pueden definirse como ésteres monofosfato. Los nucleósidos.5-fosfo- ribonucleósidos. difosfato o trifosfato de nucleósidos. Bases nitrogenadas. son los componentes de los ácidos nucleicos. Estructura hemiacetal de la ribosa y desoxirribosa. G. Si la base nitrogenada se une a una ribosa da lugar a los unión sucesiva de nucleótidos mediante enlace 3. un segundo o un tercer fosfato al nucleósido monofosfato Los nucleótidos que constituyen las cadenas de ADN se obtiene un nucleósido difosfato (como el ADP) o bien contienen las bases A. ya que el grupo fosfato se ioniza en medio acuoso. y el orden exacto de te un enlace éster con el OH del carbono 5’ de la pentosa. se genera un La unión de un grupo fosfato a un nucleósido da lugar a una polirribonucleótido o cadena de ARN.) (figura 3-3). mediante un enlace covalente denominado dar lugar a cadenas de ácidos nucleicos o polinucleótidos. Estructura de los nucleótidos. en su forma de dos que forman las cadenas de ARN están constituidos por monofosfato. Los nucleótidos son moléculas ácidas. G. por el contrario. con rribosa genera los desoxirribonucleósidos. extremos diferentes. un extremo 3’-hidroxilo Nucleótidos (figura 3-5). El primer fosfato se une al nucleósido median. C y U. como cadena se forma con desoxirribonucleótidos se origina un por ejemplo la adenosina monofosfato (AMP). dos se escribe en dirección 5’ → 3’. Si se agrega polidesoxirribonucleótido o cadena de ADN. Químicamente. las bases nitrogenadas A. mientras que los nucleóti- trifosfato (como el ATP).26 PARTE I • Conceptos básicos de biología molecular NH2 O O OHCH 2 OH OHCH 2 OH 5´ 5´ 5 4 4´ 1´ 4´ 1´ O 6 3 N H H H H H H H H 1 2 3´ 2´ 3´ 2´ O P O CH2 O N 5 O OH OH OH H O 4 1 Ribosa Desoxirribosa H H H H 3 2 Figura 3-3. La 3-4). por el otro. es decir. OH H segundo y el tercer fosfatos se conectan con el nucleótido mediante un enlace fosfoanhídrido que requiere un gasto Grupo fosfato + Pentosa + Base nitrogenada de energía para su formación. los nucleóti- Figura 3-1.

La información genética está bases nitrogenadas de una de las cadenas del ADN se unen contenida en el orden exacto de las bases nitrogenadas que mediante puentes de hidrógeno a las bases nitrogenadas de Cuadro 3-1. Estructura de los nucleósidos. mientras que las Figura 3-4. La doble cadena del ADN entre nucleótidos puede escindirse por las nucleasas: DNa. CAPÍTULO 3 • Ácidos nucleicos 27 NH2 N componen los nucleótidos. otra. Las dos cadenas del ADN giran alrededor 4´ 1´ 4´ 1´ H H H H de un eje de simetría imaginario y forman una estructura H H H H 3´ 2´ 3´ 2´ helicoidal. Base Nucleósido Nucleótido 2 grupos fosfato 3 grupos fosfato Base + ribosa Base + ribosa 1 grupo fosfato Adenina Adenosina Ácido adenílico Adenosina difosfato (ADP) Adenosina trifosfato (ATP) Adenosina monofosfato (AMP) Guanina Guanosina Ácido guanílico Guanosina difosfato (GDP) Guanosina trifosfato (GTP) Guanosina monofosfato (GMP) Citosina Citidina Ácido citidílico Citidina bifosfato (CDP) Citidina trifosfato (CTP) Citidina monofosfato (CMP) Uracilo Uridina Ácido uridílico Uridina difosfato (CDP) Uridina trifosfato (UTP) Uridina monofosfato (UMP) Nucleótido Desoxinucleósido Base + desoxirribosa Base Base + desoxirribosa 1 grupo fosfato 2 grupos fosfato 3 grupos fosfato Adenina Desoxiadenosina Ácido desoxiadenílico Desoxiadenosina difosfato (ADP) Desoxiadenosina trifosfato (ATP) Desoxiadenosina monofosfato (AMP) Guanina Desoxiguanosina Ácido desoxiguanílico Desoxiguanosina difosfato (GDP) Desoxiguanosina trifosfato (GTP) Desoxiguanosina monofosfato (GMP) Citosina Desoxicitidina Ácido desoxicitidílico Desoxicitidina difosfato (CDP) Desoxicitidina trifosfato (CTP) Desoxicitidina monofosfato (CMP) Uracilo Desoxiuridina Ácido desoxiuridílico Desoxiuridina difosfato (UDP) Desoxiuridina trifosfato (UTP) Desoxiuridina monofosfato (UMP) . • Es antiparalela. • Es complementaria. Nomenclatura de nucleótidos. La relación espacial que se genera por el giro entre las dos cadenas de la hélice crea un surco mayor (ancho) y uno tura primaria de los ácidos nucleicos. Estructura del ADN • Forma un giro helicoidal dextrógiro o levógiro. bases nitrogenadas hidrófobas se orientan hacia el interior. En la hélice del ADN. dsADN). y si se modifica alguna de estas 7 bases o su orden se alterará la información. es Estructura primaria del ADN decir. de aquí su nombre de “doble hélice del ADN” descrita por Watson y Crick en 1953. tiene tres características principales: sas para el ADN y RNasas para el ARN. el extremo 5´ de una se asocia con el extremo 3’ de la Corresponde a la secuencia de nucleótidos del polinucleóti. esto es. 6 5 8 NH2 9 N 1 4 N 5 4 2 3 Estructura secundaria del ADN 6 3 N N En células eucariotas el ADN se encuentra como una cade- 1 2 CH2 O N CH2 O na doble de polidesoxirribonucleótidos (double strand 5´ O 5´ DNA. Las dos cadenas son complementarias. las do linearizado (figura 3-6). OH H OH H la columna hidrof ílica de desoxirribosa-fosfato de cada Pentosa + Base nitrogenada Pentosa + Base nitrogenada cadena está en el exterior de la molécula. La asociación entre las dos cadenas es antiparalela. El enlace fosfodiéster menor (estrecho) (figura 3-7).

una de las variantes se describen en el cuadro 3-2. Así. característica de regiones donde se encuentra una secuencia reamiento específico de bases entre las cadenas de ADN de purinas y pirimidinas alternadas (por ejemplo. la cantidad de A es igual comprendida. Variantes de la doble cadena de ADN Se han descrito tres formas estructurales principales del ADN: la forma B. y G a la forma Z. Formación de un polinucleótido o cadena de ADN. La función biológica del ADN-Z es poco muestra de ADN de cadena doble. zonas de sustenta las llamadas reglas de Chargaff: en cualquier repetición de GC). . Extremo 3´ OH H Figura 3-5. pero puede estar relacionada con la regulación a la cantidad de T. Las características detalladas de cada cantidad de purinas es igual a la de pirimidinas. una cadena de la doble hélice del ADN siempre es deshidratación moderada de la forma B. la cantidad de G es igual a la de C. La forma A se produce in vitro con la otra. El apa. de manera que A siempre se une a T. la secuencia de nucleótidos de una cadena nes fisiológicas. Es probable que la el complemento de la otra. Estructura primaria del ADN. y cadena se asemeje a la forma A.28 PARTE I • Conceptos básicos de biología molecular Extremo 5´ O A O P O O CH2 O C C 5 4 1 H H H H 3 2 T O H O P O O G CH2 O A 5 4 1 H H H H T 3 2 O H O P O C O CH2 O T 5 4 1 A H H H H 3 2 O H T O P O O CH2 O G G 5 4 1 H H H H 3 2 Figura 3-6. y la de la expresión génica. La forma Z del ADN es tres enlaces de hidrógeno entre G y C (figura 3-8). la forma A y la otra cadena. La forma B es la que adopta el ADN en condicio- C. Por lo tanto. por lo que es la estructura predominante en define y complementa la secuencia de nucleótidos en la el ADN cromosómico. descrita por Watson y Crick. Los pares de bases se mantienen conformación de los híbridos ADN-ARN y del ARN de doble unidos mediante dos enlaces de hidrógeno entre A y T.

estas características influyen en su disponibilidad como fuente de información genética .37 nm (23.23 nm (2. Figura 3-8. sin profundidad Surco menor Amplio. tra en forma de molécula circular. sin extremos. donde no hay interrupción de los enlaces fosfodiéster.2° (casi perpendicular al eje 19° (gran inclinación) 9° (ligera inclinación) pares de bases de la hélice) Surco mayor Estrecho.38 nm (3. Características de los tipos de ADN según su estructura. con ello el número de bases por giro. Estructura del ADN.34 nm (3.55 nm (25. El superenrollamiento se produce debido a la acción ADN circular superenrollado permite la compactación del Cuadro 3-2. CAPÍTULO 3 • Ácidos nucleicos 29 5´ 3´ Extremo 5´ Esqueleto de O T=A O fosfato- O P O O P O pentosa O O CH2 O C G O C=G CH2 5´ 5´ 4´ 1´ 4´ 1´ A=T HH HH HH 3´ 2´ HH G=C 3´ 2´ Surco H O O H menor O P O O P O O O T=A O A T CH2 CH2 O 5´ 5´ C=G 4´ 1´ 4´ 1´ HH HH HH HH Surco 3´ 2´ 3´ 2´ mayor O H O H T=A O P O O P O Par de bases O O C=G CH2 O T A CH2 O A=T 5´ 5´ 4´ 1´ 4´ 1´ HH HH H H HH 3´ 2´ 3´ 2´ O H O H G=C O P O O P O 3´ 5´ O O Figura 3-7. sí misma (superenrollada) y genera una superhélice (figura respectivamente) en el número de vueltas de hélice. El 3-9B). CH2 O G C CH2 O 5´ 4´ 1´ HH HH H H3´ HH 2´ ADN circular Extremo 3´ OH H OH H Extremo 5´ El ADN mitocondrial y el de células procariotas se encuen.84 A) Distancia entre pares de bases 0. Tipo estructural del ADN Características ADN B ADN Z ADN A (deshidratada) (Watson-Crick) (Rich-Dickerson) Sentido de giro de la hélice Dextrógiro Dextrógiro Levógiro Diámetro de la hélice 2. donde la hélice del ADN (ya enrollada) gira sobre una disminución (superenrollamiento positivo o negativo. no profundo Estrecho. profundo Ancho. Doble hélice del ADN.3 A) 0. profundo Tipos de estructura secundaria de ADN. la inclinación y el giro de la molécula varía.7 A) 1. La molécula de ADN toma una estructura diferente según el microambiente en el que se encuentre. Es posible encontrar al ADN circular como una estructura relajada de las enzimas topoisomerasas.4 A) 0.5 A) 2. que mediante el corte tran- (figura 3-9A) o como una estructura superenrollada y más sitorio de una o ambas hebras introducen un aumento o compacta.4 12 Inclinación del plano de los 1. profundidad media Estrecho.8 A) Pares de bases por vuelta 11 10. profundidad media Plano.84 nm (1.

como la lisina y la arginina. debido a su alto contenido en aminoácidos básicos. soma de seis unidades mediante interacciones entre las H1 de cada nucleosoma. y además regula la accesibilidad a la información matina puede encontrarse activa de forma transcripcional. Niveles de empaquetamiento del ADN Asas cromatínicas Debido a la longitud del ADN genómico en las células euca- riotas (alrededor de 2 metros/célula) es necesaria su compac. La fibra de 30 nm se pliega y condensa aún más. la forma- empaquetamiento del ADN. en el empa- quetamiento del ADN se distinguen diferentes niveles de Cromosoma condensado organización. con grupos otra estructura. Esta estructura recibe el nombre de solenoide y ADN para que ocupe menor espacio en la células. Existen cinco tipos de histonas: H1. como la urea. donde cada La desnaturalización puede ocurrir por exposición de nucleosoma sería una perla y el ADN de enlace. de pH y enzimas. por ello. formando tación. La cro- men. las cuales se quepa dentro del núcleo de la célula. 1 400 nm de grosor. de manera que permita ocupar menos espacio y estructuras de asas amplias superenrolladas. Solenoide Los nucleosomas se compactan para formar un polinucleo- Figura 3-9. son altamente polares. regula la disponi- bilidad de la información génica. Las histonas son proteínas con carga positiva a pH fisiológi- co. entonces. este nivel el ADN está compactado unas 100 veces. lo segmento de ADN de aproximadamente 55 pb denominado que ocasiona la separación de las dos cadenas antiparalelas ADN enlace o linker (figura 3-10A). lo que facilita la formación de mida y el formaldehído. al mantenerse inaccesible por lo que se descompacta y entonces recibe el nombre de para los factores de transcripción. Las asas cromatínicas se compactan y forman un cromoso- ma condensado de 700 nm de espesor visible durante la Nucleosoma interfase. la adición de estos grupos modifica la unión de las histonas al ADN y. H2B. Los diferentes fragmentos de ADN presentes en el núcleo se asocian a Desnaturalización y renaturalización del ADN diversos octámeros y forman una cadena de nucleosomas La desnaturalización es la pérdida de la estructura helicoi- conocida como “cuentas de rosario” o “cuentas de collar” dal (estructura secundaria) característica de la molécula de por su semejanza con estas estructuras al observarse en el ADN. El ADN linker se aso. por tanto. eucromatina. Dos moléculas de histona H2A.30 PARTE I • Conceptos básicos de biología molecular A) B) de las histonas puede unirse de manera reversible a grupos acetilo. lo que se conoce como modifica- ciones epigenéticas. cia. H3 y H4. matina y dar origen a los cromosomas. Los niveles de empaquetamiento del ADN se presentan Un segmento de ADN de doble cadena de aproximadamen. con otra histona denominada H1 y ayuda al Los agentes desnaturalizantes. El extremo aminoterminal carbonilo de las bases nitrogenadas en la formación de . te 146 pb se enrolla dando 1. de 300 nm de grosor. la última etapa de la organización del ADN y llegan a medir H2A. El ADN se asocia con anclan sobre proteínas de andamiaje y dan lugar una hebra nucleoproteínas (histonas y no-histonas) para formar la cro. La función del nucleo.6 vueltas al octámero para for- mar una estructura llamada nucleosoma. La cromatina inactiva se encuentra en su for- ma compacta y se la conoce como heterocromatina. El proceso de desnaturalización ocurre por la rotura microscopio electrónico. que se describirá con amino y carbonilo que compiten con los grupos amino y detalle en la siguiente sección. Esta propiedad les permite aso. llamada solenoide. H2B. esquematizados en la figura 3-10B. Cromosomas mitóticos ciarse a la molécula de ADN de carga negativa (conferida Las cromátides hermanas visibles en la mitosis representan por los grupos fosfato). el cordón los ácidos nucleicos a agentes químicos o f ísicos. cambios con el cual están unidas estas perlas. H3 y H4 se asocian para formar un octámero de histonas. lo que genera una estructura más compacta. Entre cada nucleosoma queda un de los puentes de hidrógeno entre las bases nitrogenadas. sin que se altere la estructura primaria. metilo o fosfato. que se asemeja al mencionado collar de perlas. en permite que posiciones lejanas en la secuencia se aproxi. que se describen a continuación. ya que los enlaces soma es condensar el ADN en una fibra de 11 nm de ancho fosfodiéster no resultan afectados. genética y la expresión génica. conocida como cromatina. Moléculas de ADN circular. también forma una hebra de 30 nm.

y T. retira gradualmente el agente desnaturalizante. coidal del ADN puede vigilarse con la medición de su donde suele ser 10 veces más abundante que el ADN. La tempera. a diferencia de A y T. rompen los puentes de hidrógeno y catali- tura a la que se ha desnaturalizado el 50% de las moléculas zan la separación de las hebras mediante la energía liberada de ADN de la muestra que se está calentando. CAPÍTULO 3 • Ácidos nucleicos 31 Doble hélice de ADN Hebra de 10 nm Nucleosoma Histona H1 Solenoide Fibra de 30 nm H2B H2A H1 H3 H4 ADN ADN enlace Octámero de Nucleosoma histonas Cromosoma en metafase Asas cromatínicas 300 nm Cromosoma condensado (700 nm) Figura 3-10. y por Las topoisomerasas. las dos cadenas se vuelven a mayor Tm en comparación con una con alto contenido de A asociar por complementariedad de sus bases. Una plo. las girasas y las helicasas son enzi- lo tanto. Esto se debe a que G y C están unidas con tres puentes de hidrógeno. de forma actúan desenrollando el ADN circular presente en las bac- que las dos hebras se desenrollan hasta su separación total. terias. provoca la relajación del superenrollamiento. por hidrólisis de ATP. Niveles de empaquetamiento del ADN. sin embargo. Las girasas ta las fuerzas estabilizadoras de la doble hélice. También un pH extremadamente alcalino o ácido tiene una absorbancia relativa mayor que el ADN de cadena puede desnaturalizar el ADN. Las tura es el agente desnaturalizante más representativo: el topoisomerasas cortan una o ambas hebras del ADN. por lo que para disociarlas se requie- re una temperatura mayor. to puede dar lugar a la rotura de enlaces fosfodiéster. ya que el ADN de cadena sencilla hebras. mas que pueden desenrollar (desnaturalizar) el ADN. Por ejem- nen unidas las dos cadenas de la molécula de ADN. y las helicasas se unen al ADN cerca de la horquilla La temperatura de fusión (Tm) se define como la tempera. . de replicación. puentes de hidrógeno y dan lugar a la separación de las absorbancia a 260 nm. a la pérdida de la estructura primaria. doble en la misma longitud de onda. este tratamien. que lo están por dos ARN puentes de hidrógeno. senta el punto en que la energía aplicada es suficiente para El ADN desnaturalizado puede renaturalizarse si se romper la mitad de los puentes de hidrógeno que mantie. lo que calentamiento gradual del ADN hasta llegar a 100°C debili. La Tm repre. Es el ácido nucleico más abundante en la célula eucariota. La pérdida de la estructura heli. si una solución de ADN desnaturalizada por calenta- muestra de ADN con alto contenido de G y C tiene una miento se enfría lentamente.

El ARN suele ser monocatenario (una sola cadena). Estructura primaria y secundaria del ARN. además. terminación de la traducción. los ARN según la fun- ción que desempeñen en la célula se agrupan en: B) ARN heterogéneo nuclear C C G A Es un ARN también conocido como tránscrito primario. las señales necesarias para el inicio y la determinada por secuencia lineal de sus ribonucleótidos.32 PARTE I • Conceptos básicos de biología molecular Extremo 5´ Estructura secundaria del ARN A) O O P O La estructura secundaria está dada por el apareamiento de O secuencias complementarias en la misma cadena de ARN O C (asociación intracatenaria parcial) o por asociaciones inter- CH2 5´ catenarias. En eucariotes el ARNm pre- que se escriben siempre en dirección 5’-3’ (figura 3-11A). forma- O H ciones típicas. 4´ 1´ H H HH 3´ 2´ Tipos de ARN Extremo 3´ OH H Aunque químicamente son iguales. de UU C U G C C A U alto peso molecular. 3. como los O H tripletes de bases (véase el capítulo 6). génica para la formación de uno o varios polipéptidos (véa- se el capítulo 6). ARN mensajero (ARNm) en lugar de la 2-desoxirribosa del ADN (la presencia El ARNm sirve de molde para la síntesis de proteínas en el del grupo hidroxilo en el C2´ de la ribosa provoca que el proceso de traducción. ya que contiene la información ARN sea una molécula químicamente inestable). sin necesidad de maduración o modificacio- 1. La pentosa que constituye a sus nucleótidos es la ribosa. Las bases nitrogena- O P O das pueden interactuar a través de los átomos de hidrógeno O para unirse al esqueleto fosfodiéster de la cadena de ARN. 2. CH2 5´ 4´ 1´ H H HH Estructura terciaria del ARN 3´ 2´ La estructura terciaria del ARN no siempre se forma. senta características especiales: en su extremo 5’ muestra . los demás tipos de ARN que se encuentran en el citoplas- ma. Los ARN de transferencia (ARNt) O U forman una estructura terciaria característica: en disolu- CH2 5´ 4´ 1´ ción están plegados en forma de “L” compacta estabilizada H H HH por apareamientos de bases convencionales y por interac- 3´ 2´ ciones entre las bases de más de dos nucleótidos. en el caso de los ARN de doble cadena de ciertos 4´ 1´ H H HH virus. sólo O H surge cuando las condiciones celulares propician la interac- O P O ción entre bases nitrogenadas de diferentes regiones de una O misma molécula de ARN. nes postranscripcionales. en las cuales parte de la cadena de ARN es O P O complementaria y origina puentes de hidrógeno entre ésta O y la parte no complementaria da origen a un loop o asa de O A bases que no se unen como se aprecia en la figura 3-11B. Es el producto inicial de la síntesis de la A A G A C G G U A A GU ARN polimerasa en el proceso de transcripción. La complementariedad ocasional de bases en el ARN 3´ 2´ da origen a las estructuras de pasador (hairpin). que actúa 5´ como un importante dador y aceptor de hidrógenos. (véase el capítulo 5). En el A núcleo de las células eucariotas actúa como precursor de Figura 3-11. En las células procariotas. su Estructura primaria del ARN longitud es variable según la proteína para la que codifique Al igual que en el ADN la estructura primaria del ARN está y contiene. La fragmentación del ARNhn para formar otros tipos de ARN supone la maduración o el procesamiento del ARN En cuanto a su estructura tres características diferen. el tránscrito cian al ARN del ADN: primario actúa directamente como molde para la síntesis de proteínas. Contiene uracilo en lugar de timina. El ARNm se localiza en el citoplasma. o CH2 O G bien a través del OH del carbono 2’ de la ribosa.

un aminoácido que liberarán en el ribosoma durante el pro- deninas (cola poliA) de longitud variable (figura 3-12). y Ribosoma su peso molecular es de unos 2. Su estructura secundaria presenta un plegamien- dad en el proceso de traducción proteica.5 kDa. Éstos Figura 3-13. Estas ceso de traducción.8 S Sus estructuras secundaria y terciaria presentan un plega- miento complejo que le permite asociarse tanto a las proteí- 5S nas de los ribosomas como a otros ARNr y participar en el proceso de síntesis proteica. una capucha (cap) y en su extremo 3’. la timina. como la inosina. e incluso de esta molécula en el citoplasma y permitir su disponibili. ya que secuencias complementarias. 5. ya que van unidos a ribosomal.. y en donde se pueden distin- forma híbridos con residuos de poliuridinas (poli U) unidos guir regiones críticas. estructuras intrace- 28s lulares en que se realiza la síntesis de proteínas (figura 3-13). 18 S ARN de transferencia (ARNt) Las moléculas de ARNt tienen entre 75 y 90 nucleótidos. una cadena de polia. como la de unión al aminoácido y el a una resina empaquetada en el interior de la columna. CAPÍTULO 3 • Ácidos nucleicos 33 A) CAP 5 CGACCAUGAACGGAUACUGACAAGUUAUUGAGUGGAGGAUU AAAAAAAAAAAAAA-3´ ARNm Poli A CH2 NH2 N 7 6 5 8 7-metilguanosina 9 N 1 4 N 2 3 N O CH2 O 5´ O P O 4´ 1´ H H O H 3´ 2´ H B) O P O O OH O Secuencia del ARNm del Factor de crecimiento tipo insulina de humano (IGF1) O P O 1 ttttgtagat aaatgtgagg attttctcta aatccctctt ctgtttgcta aatctcactg O 61 tcactgctaa attcagagca gatagagcct gcgcaatgga ataaagtcct caaaattgaa CH2 O C 121 atgtgacatt gctctcaaca tctcccatct ctctggattt ctttttgctt cattattcct 5´ 2 4´ 1´ 181 gctaaccaat tcattttcag actttgtact tcagaagcaa tgggaaaaat cagcagtctt H H HH 241 ccaacccaat tatttaagtg ctgcttttgt gatttcttga aggtgaagat gcacaccatg 3´ 2´ 301 tcctcctcgc atctcttcta cctggcgctg tgcctgctca ccttcaccag ctctgccacg O OH 361 gctggaccgg agacgctctg cggggctgag ctggtggatg ctcttcagtt cgtgtgtgga 421 gacaggggct tttatttcaa caagcccaca gggtatggct ccagcagtcg gagggcgcct O P O 481 cagacaggca tcgtggatga gtgctgcttc cggagctgtg atctaaggag gctggagatg O 541 tattgcgcac ccctcaagcc tgccaagtca gctcgctctctg tccgtgccca gcgccacacc CH2 O A 601 gacatgccca agacccagaa gtatcagccc ccatctacca acaagaacac gaagtctcag 5´ 661agaaggaaag gttggccaaa gacacatcca ggaggggaac agaaggaggg gacagaagca 2 4´ 1´ HH 721 agtctgcaga tcagaggaaa gaagaaagag cagaggaggg agattggaag tagaaatgct H H 781 gaatgcagag gcaaaaaagg aaaatgaagg acaggaggat taaacagaca gaggcaagga 3´ 2´ 841 tgatgagaga ggagcagaca gcaagaatga aaagcagaaa atacaataga ggaaatgaag O OH 901 aaaagtaggc ctgctggagc tagatgatga tgtgatggaa atagaagta Figura 3-12. . etc. La presencia de la to complejo donde se encuentran zonas con apareamiento cola de poliA en el extremo 3´ facilita su purificación cuan. de secuencias complementarias y otras sin apareamiento de do se emplea cromatograf ía en columna de afinidad. Secuencia de un ARN mensajero. Se conocen unos 32 ARNt distintos y se encuentran en todas las células. Esquema de un ribosoma donde se observa el ARN intervienen en la síntesis de proteínas. la dihidrouridina. Suelen presentar bases nitrogenadas modificaciones tienen por objeto aumentar la vida media inusuales. ARN ribosomal (ARNr) ARNr El ARNr forma parte de los ribosomas.

Ejercicios de integración 5´ 3´ 1. G U U D C G G G C G A G G A A uno de unión para el sustrato y uno de unión para un cofactor U U que puede ser un ion metálico. Cuando las RNPsn se silenciar genes. miARN Se trata de moléculas de ARN de cadena sencilla de 21-23 brazo donde se ubica la secuencia del anticodón que reco. visible C en el microscopio electrónico. A D C U A G G A C siARN C G D U A G Moléculas de ARN de doble cadena de 20 a 25 nucleótidos A que a través de la vía de interferencia de ARN de células U I suprimen la expresión de un gen específico. Poseen. un sitio activo. y originalmente los describieron como parte del meca- ARNt nismo de regulación génica postranscripcional en plantas. cribió el grupo de Victor Ambros en 1993 como small cleoproteínas pequeñas nucleares (RNPsn) que se encargan ARNs. al igual que las enzimas. la unión del siARN con el ARNm produce la degradación enzimática Brazo del ARNm en células eucariotas de mamíferos y plantas. Ruvkun por la capacidad de los siARNs y miARNs para cen en el ARNm) (véase el capítulo 5). El miARN no es ARN pequeño nuclear (ARNsn) totalmente complementario a la secuencia del ARNm. El término micro-ARN fue introducido en 2001 por de eliminar intrones (fragmentos de ARNhn que no apare. formando las ribonu. Estructura secundaria del ARN de transferencia. Figura 3-14. nucleótidos en longitud encargadas de regular la expresión noce los codones del ARNm (figura 3-14). El siARN se une A A C a una secuencia complementaria del ARNm. Los ARNsn involucrados en G A C C G U A C C C maduración del ARNhn son un ejemplo clásico de ribozimas. En este proce. el ARNsn se asocia a proteínas. Escriba las características principales de la doble hélice T=A de ADN.34 PARTE I • Conceptos básicos de biología molecular 3´ Brazo aceptor unen al precursor del ARNm para eliminar los intrones se A forma un complejo ARN-proteína de gran tamaño. y que recibe el nombre de 5´ C espliciosoma (spliceosome). Originalmente los des- so. génica. en 1999. Los miARN se unen a una secuencia complementa- ria del ARNm y bloquean la traducción. U A G C Enzimas de ARN (ribozimas) Brazo D G C Estos ácidos ribonucleicos funcionan como catalizadores Brazo T C G C biológicos. Las anticodón descubrió el grupo de David Baulcombe en Inglaterra. en Es el ARN presente en el núcleo eucariote y está implicado este caso. C=G A=T G=C T=A C=G T=A C=G A=T G=C 3´ 5´ . el ARNm no se degrada pero tampoco puede uti- en los procesos de maduración del ARNhn. lizarse para la síntesis de proteínas.

Buenos Aires: Editorial sión génica. SiRNA... 1ª ed.. Viselli S. Kaiser C. 2011:379-497. et al.. Lippincott Williams and Wilkins.. 2011:395-465. Ferrier D. En: Harvey R. 2010:171-193.. Introducción a la 2008. . 3ª ed. 2006:101-123. Hopkin K. Almacenamiento y expresión de la informa. Karp G. Raff M... Biología celular y molecular. En: Lodish H Chandar N. Mencione el tipo de enlace que une la pentosa con el 4.5:181-188. Lodish H. la base nitrogenada.. Krieger M... editor. DNA y cromosomas. O CH2 O T 5 4 1 H H H H 3 2 O H O P O O CH2 O G 5 4 1 H H H H 3 2 Extremo 3´ OH H Bibliografía Alberts B. Dibuje la hebra complementaria de ADN con los puentes grupo fosfato y el tipo de enlace que une la pentosa con de hidrógeno correspondientes para cada base. En: Alberts B. Mecanismos genéticos moleculares básicos. (ed). De acuerdo con la estructura.. 1ª Médica Panamericana. Johnson A.. Biología molecular y celular.. Extremo 5´ O NH2 O P O 5 4 O 6 3 N CH2 O C 1 2 5 4 1 CH2 O N H H H H 5 O 3 2 4 1 H H H H O H 3 2 O P O O H O CH2 O A O P O 5 4 1 O H H H H 3 2 O H 3. ría Genética: conceptos. CAPÍTULO 3 • Ácidos nucleicos 35 2. técnicas y aplicaciones en ciencias de la ción genética. Barcelona: Lippincott Williams and Wilkins. Svoboda P. Luque J. Barcelona: salud. Matsudaira P.. ed. al. 2011:58-126. miRNA. En: Harvey R... Madrid: Harcout.. Organización del genoma eucariótico y expre. identifique las variantes de O P O la doble molécula de ADN: A.. 6ª ed. Bioquímica. Lewis J. Madrid: Editorial Médica Panamericana. México: McGraw-Hill. Herráez A. Biología Celular. 2001:10-88. Biología celular y molecular: conceptos y experimentos. RNA Biology. Scott M. 5ª ed. B y Z. piRNA. (ed). Berk A. Texto ilustrado de Biología Molecular e Ingenie- Harvey R. 5ª ed. editor. et Kutter C. Bray D.

se decía que podía se determina que la información genética se transfiere de ser: semiconservadora. ruro de cesio. existen dos isótopos de este átomo. que pueden distinguirse mediante técnicas de laboratorio. Se sintetiza una molécula totalmente puede dar lugar a otras idénticas. y confirmó la hipótesis semiconservadora. oxirribonucleótidos y. El experimento definitivo para dilucidar cuál de estas tres hipótesis era la correcta lo realizaron Meselson y Stahl Características generales en 1957. que todo su ADN también lo contenía. Las cadenas hijas constan bases. Se permi- con tres características que la definen y permiten entender tió que las bacterias se replicaran sólo una vez y se extrajo el el proceso: semiconservadora. Aunque el 14N es el isótopo más abundante en la naturaleza. por lo que tras la duplicación mación. ADN que se analizó por centrifugación en gradiente de clo- ralela. Capítulo 4 Replicación Jorge Fernando Floresvillar Mosqueda / José Guadalupe Macías Barragán Introducción Semiconservadora Una de las características más notables del ADN es su capa. por un lado. explicar el proceso de la replicación. las dos hebras antiguas juntas y. A este proceso se le llama polimerización. Solamente el carbono de la posición 3’ de la del ADN. conservadora y dispersora o dis- una célula a otra mediante el proceso de replicación del persante. la cadena de ADN sólo puede crecer en el 15N también es viable y es más pesado. En cada una de El objetivo de la replicación es el de conservar la infor. por lo complementario a la hebra molde según la Ley de Char. ya que forma parte de las bases nitrogenadas. que permite diferenciarlos. por esta razón. Se refiere a que en cada replicación una molécula de ADN cidad de replicarse. el nitrógeno es uno de los principales elementos en procariotes. que permite separar las moléculas por tama- 36 . Este experimento se realizó utili- consiste en la unión de un dNTP (desoxirribonucleótido) zando bacterias cuyo medio de cultivo contenía 15N. En principio. puede formar un nuevo enlace fosfodiéster con otro des. nueva. tiene la capaci. y pentosa posee un radical hidroxilo (OH) libre. Por ello. Después se les cam- gaff (véase el capítulo 1). dicho de otra manera. las dos hebras nuevas. 14N y 15N. mediante la acción de una enzima. añadir des. con el que por la otra. las dos hebras deberán separarse quedan. nueva. doble hélice permite comprender cómo dicha molécula • Conservadora. por otro. recién sintetizada conserva una de las cadenas originales y dad de formar copias de sí mismo. • Semiconservadora (modelo correcto). de fragmentos de la cadena antigua y fragmentos de la ciales. oxirribonucleótido y formar así la hebra creciente de ADN. copia de la original. según la complementariedad de • Dispersora o dispersante. característica que dirección 3’. después. construir ADN a partir de las dos hebras molde ini. La representación estructural del ADN en nales. La replicación se lleva a la otra es sintetizada de novo. Este La síntesis de las cadenas de ADN durante la replicación se experimento se basaba en dos premisas fundamentales: por lleva a cabo en dirección 5’ → 3’ tanto en eucariotes como una parte. La replicación del ADN cuenta bió el medio de cultivo por uno que contenía 14N. ADN. Esta etapa es Anteriormente existían tres teorías que trataban de un paso obligado para realizar la división celular. cabo en la fase de síntesis (S) del ciclo celular. y. sin perder su confor. las moléculas hijas se conserva una de las cadenas origi- mación genética. bidireccional y antipa.

ori ori ori Bidireccional La replicación del ADN en eucariotes es bidireccional. Esto plantea un problema: las cade- ADN ligero 14N nas tienen que crecer de forma simultánea a pesar de que 2a repl. semiconservadora y dispersante. con dos puntos de crecimiento que forman lo que se conoce como horquillas de replicación (figura 4-2). lo que sugirió que la molécula resul- sentido que avanza la horquilla de replicación se denomina tante estaba compuesta de 14N y 15N. La cadena que se sintetiza en el intermedio 14N y 15N. son antiparalelas. En ADN. incógnita la resolvieron los científicos japoneses Reiji Oka- A. se sintetizan las dos cadenas en ambos sen- tidos. La presencia de bases A:T facilita la separación de te. es decir. por lo que a la replicación se la considera multifocal (figura 4-3). y se ción en medio con 14N se observaron dos bandas. por lo que se afir- ma que la replicación es monofocal (figura 4-4). Se concluyó en que la replicación que una de las nuevas cadenas del ADN se sintetizaba en del ADN era un proceso semiconservador. Esta Figura 4-1. debido al gran tamaño del ADN. Esta replicación es bidireccional. experi. El resultado mostró una sola banda con un peso nucleótidos en eucariotes. líder o conductora (leading strand). lo que permite acortar el tiempo en el que se replica todo el las hebras y la formación de la burbuja de replicación. este sitio ORI permi- Hebra original pesado 15N te la replicación de todo el ADN circular. En la segunda replica- hebra adelantada. y el extremo 3’-OH libre es el punto a partir del cual se produce la elongación del ADN. al descubrir mento de Meselson y Stahl. cada cadena tiene el extremo 5’ ADN híbrido enfrentado con el extremo 3’ de la otra cadena. existen múltiples orígenes de replicación (sitios ORI). forma de fragmentos cortos que. ya que a partir del sitio de origen (ORI. b) los cromosomas de bacterias y virus existe un origen único ADN de replicación por molécula de ADN. conservadora. CAPÍTULO 4 • Replicación 37 a) Modelo Modelo Modelo Cadena semiconservativo conservativo disperso origen retardada Hebra madre 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ 1 a 3’ 5’ repl. La replicación en eucariotes controlan la replicación de una unidad de ADN llamada contiene múltiples sitios ORI. una de las cadenas debería sintetizarse en dirección 3’ → 5’. Su longitud suele variar entre 1 000 y 2 000 nucleótidos en las bacterias y entre 100 y 400 ño o peso. La replicación siempre se produce en sentido 5’ → 3’. . De esta for- ma. Replicación del ADN. zaki y Tsuneko Okazaki en la década de 1960. B. se denomi- nan fragmentos de Okazaki. Por ello. Los sitios ORI son secuencias específicas ricas A y T y Figura 4-3. Meselson y Stahl demostraron el mecanismo correcto de la replicación del ADN (figura 4-1 A y B). En organismos eucariotes. Figura 4-2. Teorías de la manera en que se replicaba el ADN. en su honor. que se replican simultáneamen- replicón. Discontinua ADN híbrido 1a N N 15 14 repl. Cebador Fragmento de Cadena 2a “primer” Okazaki continua repl. Replicación multifocal. una correspondiente a 14N (del ADN replicado en esta segunda división celular) y otra intermedia entre 14N y 15N de la ori ori ori mezcla ADN parental: ADN recién sintetizado. también llamados ARS en eucariotes).

dNTPs Cebador. por las nucleasas Rnasa H1 y sustituidos por ADN por quilla de replicación avance (cuadro 4-1). ADN nuevo con lo que se deshace el superenrollamiento. Primasa: es una enzima que sintetiza pequeños frag- mentos de ARN de entre 8 y 10 nucleótidos de longitud. De esta manera se per- mite el acceso a la cadena de ADN a todas las enzimas invo- Figura 4-4. la no entre las dos cadenas separadas por la helicasa y permi. cual es abierta transitoriamente por acción del factor de ten que se copien. Esta escisión selectiva permite al ADN liberar la tensión contorsional. strand ADN binding proteins en procariotes y RPA en Antígeno nuclear de células en proliferación (PCNA): eucariotes): evitan la formación de los puentes de hidróge. Procariotes Eucariotes Lugar Citoplasma Núcleo y mitocondria Número de orígenes de replicación 1 Núcleo 103 a 104 Mitocondria 2 Tiempo de replicación del genoma (h) ~0. Diferencias en la replicación entre procariotes y eucariotes. del ADN mediante la rotura de los puentes de hidrógeno Telomerasa: es una ribonucleoproteína con actividad que se establecen entre las bases nitrogenadas de las dos de ADN polimerasa dirigida por ARN (transcriptasa inver- cadenas del ADN.38 PARTE I • Conceptos básicos de biología molecular Topoisomerasas: son enzimas isomerasas que actúan sobre la topología del ADN. El Nick (falta de enlace establecida. dNTPs Formato Semiconservadora Semiconservadora Tasa de replicación 1 000 nucleótidos/s 100 nucleótidos/s . polimerasa (enzima que sintetiza ADN y que no puede aña- ging strand). se encarga de remover el ribonucleo- actúan en conjunto con una secuencia de ADN específica ya tido 5’ del fragmento de Okazaki. los cromosomas eucariotes). Rnasa H1: enzima encargada de retirar los cebadores de ARN durante la síntesis de los fragmentos de Okazaki y Proteínas que participan en la replicación en los procesos de reparación del ADN. single. que permite el alargamiento de los telómeros (extremos de Proteínas de unión a cadena sencilla (SSB. luego son degradados ADN molde para continuar hay que esperar a que la hor. La maquinaria encargada de la replicación del ADN es muy FEN1/RTH1: también llamada endonucleasa flap 1 compleja y está formada por un grupo de proteínas que (flap endonuclease 1). complementarios a sintetiza de forma continua por la ADN polimerasa. y para disponer de una cierta longitud de su acción. La unión de los cebadores al ADN tras que la que se sintetiza en sentido contrario al avance de proporciona un extremo 3´ necesario para que la ADN la horquilla se denomina hebra rezagada o retrasada (lag. mien. conocidos como cebadores o primers. al ser ARN. es un homotrímero que forma una estructura de toroide. el único lucradas en la replicación. Los cebadores.67 8 Proteínas implicadas ~30 Cientos ADN polimerasas 3 5 Inicio Origen único Origen múltiple Otros materiales Cebador. replication factor C). el cual en caso ORI de persistir detendría la replicación. pueden cortar o formar enlaces ADN viejo fosfodiéster ya sea una de las hebras (topoisomerasa I) o en las dos (topoisomerasa II) que forman el ADN. rrollará el proceso mencionando las enzimas involucradas. Replicación monofocal. cromosoma existente contiene un solo sitio de replicación ORI. Ligasa: enzima que cataliza la formación del enlace fos- Helicasa: enzima encargada de separar las dos hebras fodiéster entre nucleótidos contiguos. sellado por la ADN ligasa. un fragmento del ADN. replicación C (RFC. A este tipo de replicación se le llama monofocal. A continuación se describen las enzimas que fosfodiéster entre dos nucleótidos adyacentes) resultante es intervienen en el proceso de replicación y enseguida se desa. cuya síntesis se realiza de forma discontinua dir nucleótidos si no existe un extremo 3´libre) lleve a cabo o en fragmentos. lo que permite su Cuadro 4-1. Ocasiona superenrollamientos positivos sa) capaz de sintetizar una secuencia determinada de ADN a los lados de la burbuja de replicación. En eucariotes. acción de otra ADN polimerasa.

y le permite sintetizar la cadena de ADN. sólo tres tienen la actividad de ADN polimerasa: son las principales enzimas en este exonucleasa-3’ (pol δ. La polimerasa β (ADNpol β) no interviene en la repli. hebra que se está sintetizando. Como consecuencia de esto. La polimerasa I es la polimerasas involucradas en la replicación del ADN. Características de la polimerasa de procariotes. ADN Pol I ADN Pol II ADN Pol III Peso molecular (daltons) 109 000 90 000 900 000 Constitución Monómero Monómero Multímero asimétrico Polimerasas /célula 400 Desconocido 10 a 20 Actividad / función Polimerasa Sí Sí Sí 5’ a 3’/elongación Exonucleasa 3’ a 5’/correctora Sí Sí Sí Exonucleasa 5’ a 3’/reparación Sí No No . pero se cree que están involucradas sobre pinza que sostiene a la polimerasa en el extremo del primer todo en mecanismos de reparación y recombinación. vocado y añaden el correcto. δ y ε. En proca- nucleótidos en la dirección 5’ → 3’ siempre y cuando haya un riotes la ADN pol I presenta este tipo de actividad. del ADN mediante la formación de un cebador ARN. ADN mitocondrial. eliminan el nucleótido equi- rales correspondientes (desoxirribonucleótidos). Ninguna ADN polimerasa en terística importante de esta enzima es que añade los eucariotes presenta actividad de exonucleasa-5’. CAPÍTULO 4 • Replicación 39 Cuadro 4-2. γ. Existen otras polimerasas. como la mayoría de cación y está involucrada en la reparación de errores o daños los procesos celulares la replicación se ha dividido en tres en el ADN. La estructu. naria para la replicación de los procariotes. la direc. Las polimerasas δ y ε (ADNpol δ y ADNpol ε) son responsables Fases de la replicación de la mayor parte de la elongación de ambas hebras del ADN. esto es. sirviendo como una muy conocida. γ y ε). como las mite su libre desplazamiento por la misma. La polimerasa En el cuadro 4-2 se resumen las propiedades de la ADN α (ADNpol α). son capaces de corregir proceso. PCNA polimerasas ζ (theta). Para su estudio y mejor comprensión. de subunidades 4 1 4 isoformas 2 ¿? Peso molecular 165 a 185 40 125 125 210 a 230 Subunidad catalítica recircularización alrededor de la doble hélice del ADN a la β. elongación y terminación. η (eta) y ι (iota). β. también llamada primasa. una con una actividad específica: α. Una carac. las de procariotes. Propiedades de la ADN polimerasa de eucariotes. δ y ε están involucradas en la replicación del ADN nuclear. Son capaces de sintetizar nuevas cadenas de ADN a los errores cometidos al incorporar los nucleótidos a la partir de una hebra patrón o molde y las unidades estructu. α β γ δ ε Compartimiento celular Núcleo Núcleo Mitocondria Núcleo Núcleo Primasa asociada Sí No No No No Función biológica Replicación hebra Reparación del ADN Replicación del ADN Replicación hebra Replicación retardada mitocondrial conductora adicional Núm. De las 5 polimerasas. extremo 3’ disponible. A diferencia de lo observado en eucariotes. Cuadro 4-3. Es importante mencionar que las polimerasas α. cuya función no es interactúa con la ADN polimerasa. La polimerasa γ (ADN pol γ) lleva a cabo la replicación del ra toroide del PCNA alrededor de la cadena de ADN per. inicia la síntesis polimerasa en eucariotes y en el 4-3. sólo tres enzi- En eucariotes se han descrito por lo menos cinco ADN mas participan en la síntesis del ADN. fases: inicio. en la maqui- ción en la cual leerá la cadena molde de ADN será de 3’ → 5’. altura del extremo del primer en la cadena líder. cada única que tiene actividad de exonucleasa de 5’ a 3’.

las topoisomerasas (I y II) cortarán llamadas. la horquilla avanza. Cada burbuja de replicación posee dos horquillas de Como ya se ha mencionado. la síntesis se reali- ren. El proce- síntesis a partir de los desoxirribonucleótidos libres.40 PARTE I • Conceptos básicos de biología molecular helicasa primosoma hebra primasa molde proteínas SSB 3´ 5´ 3´ 3´ 5´ ión icac 5´ repl ADN polimerasa 3´ ARN cebador Hebra discontinua (fragmentos de Okazaki) Figura 4-5. ambas se replican en dirección de 5’ a 3’. ayudada por PCNA. proteínas de reconocimiento del sitio los enlaces fosfodiéster de la doble hélice y volverán a unir- de origen. la síntesis se realizará en forma continua. y en primera instancia. Para evitar que esta tensión impida el ricos en A y T y son reconocidos por una serie de proteínas avance de la horquilla. los orígenes de replicación se lla- la. a proceso de terminación es completar la síntesis de la cade- medida que avanza la horquilla. lo que permitirá que se desenrolle una vuelta si actúa la man secuencias de replicación autónoma (SRA). En eucariotes. la cadena líder. Inicio función del PCNA es mantener la ADN polimerasa en con- tacto con la cadena molde. lización de la replicación. Se observan las cadenas continua y discontinua. La na retardada y unir los fragmentos de Okazaki. se sabe que existen secuencias Una vez presente la maquinaria de inicio de la replica- de aproximadamente 300 pb que indican los lugares preci- ción. El proceso de replicación necesita. aumentando la tensión por delan- sos donde ha de comenzar la replicación. por lo so de elongación es similar en eucariotes que en procariotes tanto. la síntesis es diferente replicación. que se compensa por la unión de proteínas estabili- estos fragmentos. Terminación El final de la replicación se produce cuando la ADN polime- rasa δ llega al extremo del fragmento de ADN. con la finalidad de que la lea y Las zonas en el ADN donde se producen las burbujas de sintetice la cadena complementaria. Inicio de la replicación del ADN. topoisomerasa I y dos si lo hace la topoisomerasa II. Para esto. mientras que en el caso de la cadena con- zadoras RPA. La apertura de la síntesis discontinua es que para la síntesis de cada fragmen- doble hélice hace que las cadenas simples adquieran inesta- to de Okazaki se requiere de un cebador intercalado entre bilidad. replicación no son aleatorias. Estos sitios son te de la cadena. que las dos cadenas del ADN se sepa- por el contrario. La ADN polimerasa no puede iniciar la tinua es necesaria la presencia de un solo cebador. Uno de los pasos cruciales en el tidos uno por uno complementarios a la cadena molde. en la cadena retrasada. en conjunto. necesita que la primasa sintetice un cebador. Se produce Elongación entonces el desacoplamiento de todo el replisoma y la fina- Es el proceso por el cual la ADN polimerasa añade nucleó. A este pro- . una de las cuales se desplaza hacia la derecha y en cada una de las hebras de la horquilla de replicación. a par- (figura 4-6). Una de las consecuencias de la hidrolizará los puentes de hidrógeno. en otra hacia la izquierda. la helicasa se unirá a la cadena de ADN e zará en forma discontinua. tir del cual la ADN polimerasa incorporará los nucleótidos en forma complementaria a las bases de la cadena patrón (figura 4-5).

La dinámica de replicación que requiere de un continua va en sentido de la horquilla. y requiere la eliminación cadenas de ADN de síntesis retrasada recién sintetizadas. de los cebadores. elonga el extremo rasas. Por lo RNasa H1) encargado de eliminar el cebador de ARN. Elongación 3’ Figura 4-7. Los telómeros C T A ADN A G A C A son secuencias repetidas de 1-5 unidades T y G en una de pol las cadenas. los extremos de la hebra de síntesis retrasada de ADN. existe un sistema de nucleasas (FEN1/RTH1 + complementario a la secuencia de los telómeros. al retirar todos los cebadores de las ceso se lo denomina maduración. La fase final de la ter- minación de la replicación del ADN consiste en la replica- 5´ 3´ 5´ 3´ ción de los telómeros de las cadenas de ADN. CAPÍTULO 4 • Replicación 41 Cadena continua 3’ del fragmento adyacente y rellena el lugar que antes ocu- paba el cebador hasta alcanzar el extremo 5’ del fragmento ADN 5´ pol A G A C A contiguo. Función de la telomerasa en sus tres fases: elongación. De esta manera. Translocación TERC TTAGGGTTAGGGTTAGGGTTAGGGTTAG 5’ AATCCCAA CAAUCCCAAUC TERT 3. mos queda más corto. Por último. Para que esta maduración que contiene un fragmento de la secuencia de su ARN suceda. en la replicación de los telómeros actúan las telome- consecuencia la ADNpol δ. y por lo tanto. al no poderse situar un cebador más allá del final de la secuen- cia. Elongación de la replicación del ADN. o ADNpol ε. Elongación TP1 TERC TTAGGGTTAGGGTTAGGGTTAG 5’ AATCCCAA CAAUCCCAAUC Disquerina TERT TP1 TERC 3’ TTAGGGTTAGGGTTAGGGTTAG 5’ AATCCCAA CAAUCCCAAUC CAAUCCCAAUC TERT 3’ Disquerina TP1 2. la elongación del fragmento de ADN en cada una de las dos moléculas de ADN uno de los extre- adyacente para rellenar el espacio que quedó por la elimina. translocación y elongación. La telomerasa es una transcriptasa ción del cebador y la unión de los extremos resultantes para inversa formada por ARN (9 a 28 nucleótidos) y proteína formar una cadena continua. . C y A en la complementaria Cadena discontinua situadas en los extremos de los cromosomas eucariotes (los procariotes no poseen telómeros porque su ADN es Figura 4-6. que se unen por complementariedad de bases a los Disquerina 1. y la discontinua. La cadena circular). la ADN ligasa I sella la mella resultan- te uniendo el 3’-P del primer fragmento con el 5’-P del 3´ 5´ 3´ segundo. En tanto. al lado primer para polimerizar no permite completar la copia de contrario y siempre sintetizando en dirección 5’ a 3’. Replicación de los telómeros.

(OL) origen de hebra ligera. la telomera. de forma que existen dos orígenes de repli- rasa. sin que se comience la replicación de la nueva se encuentra alargado. lo que se conoce como transloca- más allá de su tamaño. ciada la replicación de la nueva hebra L. 5´ 5´ 5´ 3´ Hebra pesada (H) OH (H) (H) (H) OH Hebra ligera OH (L) 3´ 3´ (L) (L) 3´ 5´ OL Hebra pesada (H) Hebra ligera (L) (H) OH 3´ 3´ 5´ OL 5´ OL Figura 4-8. (L) hebra ligera. una vez que éste va hebra L. Por consiguiente. la síntesis es La telomerasa cataliza la elongación del extremo 3’ alar. añadiendo dNTPs y empleando como molde la do se han sintetizado aproximadamente dos tercios de la hebra de ARN de la propia telomerasa. antes que la de la nueva hebra H (figura 4-8). El acortamiento de los telómeros La replicación del ADN mitocondrial en mamíferos se ajus- se ha vinculado con el envejecimiento (figura 4-7). en 3) Una vez que se están añadiendo los dNTPs. ta al modelo del lazo de desplazamiento o lazo D. 4) La telomerasa elonga nuevamente el extremo 3’ saliente. se inicia la replicación o síntesis de la nue- mentaria y alarga el extremo saliente 3’. La telomerasa sólo está presente en células somáticas. nueva hebra L. (OH) origen de hebra pesada. tomando como molde el ARN de la ción. L. En primer lugar. El origen de replicación de la hebra L es diferente bases entre el ADN telomérico y el ARN de la telome. . una vez ini- 2) Con este apareamiento empieza la primera elongación. transcriptasa inversa. unidireccional y avanza desplazando a la otra hebra. y la ligasa sella la mella que queda en la elongación. La hebra. opuesta a la de síntesis de la hebra ligera sa se desliza sobre el extremo 3’ previamente elongado. Replicación mitocondrial sión celular correcta. Replicación del ADN mitocondrial. 6) En la segunda fase la ADN polimerasa α rellena la otra tiza la preservación de las largas secuencias teloméricas. y existe una hebra ligera (L) y otra pesada (H). presencia de la telomerasa en las células germinales garan. una sola dirección.42 PARTE I • Conceptos básicos de biología molecular telómeros y sintetizan los extremos de los cromosomas ción de secuencias. al de la hebra H. Se produce un apareamiento de hebra H. Además. el tiempo de vida de una célula y. 1) La telomerasa se une a su respectiva secuencia comple. Cuan- gado. por extensión. del organismo. desaparición de la enzima en las células somáticas condi- ciona la longitud de estas secuencias y puede alterar la divi. la síntesis de la nueva hebra L termina conservando la complementariedad gracias a la repeti. (H) hebra pesada. uno para cada una. Las dos El mecanismo de acción de la telomerasa se detalla a hebras del ADN mitocondrial se pueden diferenciar según continuación (figura 4-7): su densidad. cación diferentes. comienza la síntesis de la nueva hebra H. 5) Se vuelven a repetir los pasos de translocación y elonga- tejidos fetales y en ciertas células madre. En eucariotes la ción.

ADN polimerasa III. 2001:141-160. sí gracias a: c) Doble cadena de ADN y proteína. coli se distinguen entre b) ADN y proteína. Bibliografía Gardner E.. ADN ligasa.D. México: Editorial Médica Panamericana. cación de la mitocondria: d) Que una posee actividad de primasa y la otra no. ADN polimerasa III.J. ADN polimerasa I. Las ADN polimerasas I y III de E. Willey Liss. et al. d) Helicasa. b) β rante la replicación del ADN en procariotes en la hebra c) ζ retrasada es: d) γ a) ADN ligasa. CAPÍTULO 4 • Replicación 43 Preguntas de repaso 1. 2002:130-156. helicasa.. primasa. ADN. Snustad D. 5ª ed. 7ª ed. Luque J. Genes IX. La telomerasa es un complejo formado por: 3’ → 5’.. Biología molecular del gen. a) ARN y proteína. Lewin B. ADN polimera- y procariotes? sa III. d) Las ADN polimerasas eucariotes sintetizan ADN de 4. Texto ilustrado de Biología Molecular e Ingeniería Genética. Sudbury: Jones and Bartlett Publishers. 5. ADN polimera- c) Los procariotes poseen extremos teloméricos. c) Helicasa. ADN ligasa. 9ª ed. 2005:23-45..P. Bell SP. a) Los procariotes no requieren primasas. ADN poli- e) η merasa I. a) α 3.A. 2007:428-456. sa III. ¿En qué se distingue la síntesis de ADN entre eucariotes b) Helicasa. ción. Madrid: Harcourt. ADN polimera- b) Los eucariotes poseen múltiples orígenes de replica. a) Su distinta actividad de exonucleasa 3’ → 5’. primasa. ADN polimerasa I. d) Doble cadena de ARN y proteína. Principios de Genética. b) Su procesividad y la actividad de exonucleasa 5’ → 3’. primasa. Watson J.J. sa I. . Baker T. Herráez Á. primasa. Simmons M. Este tipo de ADN polimerasa está involucrada en la repli- c) Que una posee actividad de exonucleasa y la otra no. 2. La secuencia en la que las diferentes enzimas actúan du.

re de una regulación más precisa. ARNt o ARNr. teínas mediante el arreglo de los exones por el proceso de ductos funcionales que se sobreponen entre sí y que pueden corte y empalme alternativo. a la secuencia de nucleótidos de una de las común. que consis. El primer conjunto de genes situados en el mismo fragmento de ADN paso en la expresión génica es la transcripción. se transcribe generalmente un solo producto opuesta del ADN llamada cadena codificadora. represen. con la pre. abajo. y la numeración aumenta conforme se lismo y la identidad de las células. La mayoría de los genes tada en el dogma de la Biología Molecular. Los genes se sitúan a lo largo de cada cromosoma en una La región codificadora del gen también contiene regio- posición determinada llamada locus. El inicio del sitio de transcrip- generación de proteínas funcionales que definen el metabo. y ADN. se produce que transcurre de manera similar que en procariotas. que contiene la información necesaria para la síntesis es allí donde se encuentra la mayoría de regiones regulato- de un ARN funcional. Se estima que el núme. Las certeza acerca del número exacto. donde se encuentran las secuencias codificantes del nan genes (figura 5-2). Hacia el extremo 5’. es expresar la en procariotes están organizados en operones. conocida gen es una secuencia lineal de nucleótidos en la molécula de como corriente arriba. hn es el producto inmediato de la transcripción y consiste en un ARN que contiene las secuencias intrónicas y exóni- Estructura del gen cas. en la dirección opuesta. que se transcriben como una unidad y que generan varios te en la síntesis de una cadena de ARN complementaria y productos funcionales que participan en una vía metabólica antiparalela. ARN mensajero maduro. todavía no se tiene ARNm primario o heterogéneo nuclear (ARNhn). la de ARN (figura 5-1). denominadas intrones. y que ro de genes que se encuentra en la especie humana es de son retirados por medio del proceso corte y empalme del aproximadamente 23 000. es un cuando sucede una serie de modificaciones en el tránscrito proceso mucho más complejo. el gen. ribosomal (ARNr) y ARN transferencia (ARNt). cuyos extremos 5’ y 3’ no han sufrido ninguna modifi- cación. ción se denomina +1. esto es. regiones que codifican para el producto génico se conocen puesta por Gerstein y colaboradores lo describe como un como exones. que puede ser ARNm. en tiene la secuencia de nucleótidos idéntica a la cadena los eucariotes. la numeración se indica como —1. El producto final. nes que no serán traducidas. En proca- 44 . aun. Desde el punto de vista molecular. ARN El mecanismo de transcripción en células eucariotas. Capítulo 5 Transcripción Zamira Helena Hernández Nazará Transcripción nas y enzimas como la diversidad y la estructura de los genes son considerablemente mayores. Por el contrario. aunque también pueden existir unidades que codi- cadenas de ADN denominada cadena molde. Esta dirección se conoce como corriente que se copian en cada proceso de transcripción se denomi. La definición de gen pro. fiquen para un solo producto funcional. sin embargo. por lo que se requie- Una de las funciones de la doble cadena del ADN. y por lo tanto. un información contenida en el material genético. El tránscrito primario o ARN- estar localizadas en más de un locus en el ADN. mayor complejidad en su regulación. Las secuencias de ADN dirige al extremo 3’. génico (unidades transcripcionales monocistrónicas) con misa de que la timina se sustituye por uracilo en la molécu. Un solo gen puede sintetizar diferentes pro- conjunto de secuencias que codifican para potenciales pro. rias del gen (figura 5-3). Los genes eucariotes están constituidos por secuencias La transcripción es el paso previo y necesario para la regulatorias y codificantes. tanto el número de proteí. primario: modificaciones postranscripcionales.

El DPR (downstream promoter element) es un sión. no codificante. “+” y que no es polimerasa. La secuen- antiparalela a la molécula de ADN 5’ → 3’ a la que se le llama cia consenso denominada caja TATA. y pueden modificar la tasa de transcripción del 5´ 3´ Cadena Codificante. con sentido. CAPÍTULO 5 • Transcripción 45 ADNg +1 Inicio de la transcripción secuencias adyacentes a este promotor mínimo forman TTAGCTCCCGTTTAAAA parte de él. se loca- regulatoria indispensable para la transcripción del gen. Cuando existe una mutación en ma inmediata sin sufrir ningún proceso. se encuentra en la mayoría de denominada codificante. Gen: región del genoma que contiene la información necesaria para la síntesis de una molécula funcional o un rasgo particular. la ARN pol II (ARN polimerasa II) incluye el Inr y la caja hebra no informativa. los promotores y se localiza a –31 a –25 bp hacia el extremo 5’ del punto de inicio. Éste es el único elemento que se loca- liza en una dirección relativamente fija con respecto al pun- riotes. composición de ocho pb A-T. Figura 5-1. . hebra no molde. son los promotores. GEN DE LA INSULINA HUMANA. la caja TATA. Un tipo de secuencias de ADN regulatorias que no ya que la ARN pol II al ser activada se sitúa en otro sitio codifican para el producto génico. La transcripción sucede en la interfase del ciclo celular y sólo ocurre sobre la conformación de 10 nm de ADNg cuando hay mayor acceso de las enzimas a la eucromatina. también conocida como cadena gen.5 Núcleo GEN ENZIMA GEN PROTEÍNA GEN POLIPETIDO GEN UN ARN GEN PRODUCTO GÉNICO FUNCIONAL ADNg Corriente arriba Corriente abajo Promotor +1 Inicio de la transcripción Secuencias 5 basal reguladoras 3´ Intrón Exón Figura 5-2. pero regulan su expre. La molécula de ARN formada es complementaria y dor (Inr) localizada entre las posiciones –3 y +5. Transcripción: proceso de síntesis de ARN a partir Una secuencia consenso es la región conocida como inicia- de ADN. el sitio de inicio de la transcripción cambia. pero no son imprescindibles para la unión de la ARN informativa. A los promotores se les unen proteínas reguladoras ARNm ADNc conocidas como factores transcripcionales (transcriptional 5´ 3´ factors. Localización del Gen dentro del Genoma Cromosoma: 11. TF). y de secuencia idéntica a la cadena de ADN 5’ → 3’. también conocida como cadena transcripta. el ARN recién sintetizado no sufre modificaciones to de inicio. cuya función es regular (aumentar o disminuir) 5´ UUAGCUCCCGUUUAAAA 3´ 3´ 5´ la tasa de transcripción. El promotor mínimo es la región elemento común en los promotores TATA menos. La localización de genes en el cromosoma es el locus (singular). Locus: 11p15. (figura 5-4). Las liza de +28 a +32. “–” y antisentido TATA o el DPE. Aunque existe mucha diversidad ARN con sentido “+” La copia del ARNm en ADNc puede entre los promotores reconocidos por la ARN polimerasa II ser una cadena o doble cadena se pueden definir secuencias consensos comunes entre sí. Los promotores que carecen de caja TATA se postranscripcionales y se utiliza para la traducción de for. debido a su molde. transcripta El promotor basal es la secuencia mínima requerida AATCGAGGGCAAATTTT 5´ 3´ para la unión de la maquinaria basal de transcripción y para Cadena Molde. denominan TATA menos. loci (plural).

El número y la posición de estos elementos TFIIB TBP TFIID TFIID varían entre los promotores de los diversos genes. Pb: pares pueden activar o desactivar genes. elemento de respuesta para el TFIIB (BRE). como la mayo- ría de los ubicados en los genes procariotes y virales. A través de la transcripción de un gen se produce un ARNhn. que generalmente se encuentran a más de 200 pb río del promotor basal y los factores transcripcionales que se unen arriba (región 5’) del sitio de inicio de la transcripción. Figura 5-4. Promotor tenidas en promotores proximales. CAAT y el octámero son +1 ejemplos de estos promotores proximales. La uni- dad de transcripción se refiere a la interacción de todas las BRE TATA Inr DPE secuencias funcionales o estructurales posibles. te abajo). se les Promotor di denomina así ya que la maquinaria de transcripción basal se Potenciador stal –10 kpb Sile une de forma eficaz y la tasa de transcripción es elevada. Estas regiones son mucho más complejas y caja TATA (TBP). Otras regiones regulatorias que ayudan a los promoto- res débiles a iniciar la transcripción son los promotores dis. que se procesa para dar lugar a un ARNm. caja TATA (TATA). reconocidos por los factores transcripcionales específicos para favorecer la iniciación. que también se han localizado hacia el extremo 3’ (corrien. factor de unión a la codificadora. y factor transcripcional IID (TFIID). Esquema tales. promotor distal. –3 –32 –31 –26 –2 +4 +28 +32 pb ran durante el proceso de la transcripción. de bases. proximal Promotor –100 pb te a menos de 200 pb corriente arriba del sitio de inicio de Basal Intron es/Exones Silenciado r la transcripción. factor transcripcional IIB (TFIIB). así como el complejo proteico formado de enzimas y TF que se requie. Las regiones que controlan la transcripción de un elemento iniciador (Inr). potenciadores y aisladores. Este ARNm sale del núcleo y en el citoplasma se traduce para dar lugar a proteínas que. con un inicio de la transcripción menos –2 Kpb Aisladores frecuente.46 PARTE I • Conceptos básicos de biología molecular Corriente arriba Corriente abajo ADN 5´ –30 pb +1 inicio de la transcripción 3´ TATA ARNhn 5´ 3´ ARNm 5´ 3´ CAP 7mG POLIA Proteína funcional Polipéptidos Secuencias reguladoras Exones Intrones Figura 5-3. silenciadores. a través de diversos procesos de maduración. aun. como la mayoría de los promotores de genes eucariotes. Procesamiento del ARN. a él y los otros elementos involucrados: promotor proximal. localizadas generalmen. darán lugar a proteínas funcionales. elemento promotor corriente abajo gen no necesariamente tienen que estar cerca de la región (DPE). por lo que requieren secuencias accesorias con. Secuencias que regulan la transcripción. . Algunos promotores basales son fuertes. nciador ADNg Otros son débiles. Las cajas GC.

. cuya ARNr. que transcri- tando que factores transcripcionales inductores se unan ben diferentes tipos de genes en lugares específicos del al ADN. ARNt Nucleoplasma TFIII Figura 5-5. ARNm. ya que se encuentra vecino. lI y III. los silenciadores (silencers) son secuencias La enzima protagonista en este proceso es la ARN pol. En las células eucariotas los genes nucleares son 2. núcleo. Enzimas productoras de ARN. el La acción de un potenciador o un silenciador puede nucleolo. sin ser específicos de un determi- que inducen el superenrollamiento en la zona del promotor nado gen. CAPÍTULO 5 • Transcripción 47 Los potenciadores o secuencias amplificadoras (enhan. que la ADN pol. Las ARN pol de mitocondrias se aseme- rogéneo nuclear y evitando su maduración. donde transcribe los genes que codifican para los inhibirse por la presencia de secuencias aisladoras. Por otra parte. y favorece el inicio de la transcripción. Esta enzima sintetiza un único tránscrito.8S Nucléolo TFI ARN pol-II ARN. función es bloquear la transmisión de la señal de un sitio a cers) son secuencias cortas que potencian o aumentan la otro en el ADN e impedir el silenciamiento. La ARN pol I reside en una zona definida del núcleo. el ARNr Núcleo GEN ARN GEN ARN GEN ARN GEN ARN Pequeño Transferencia Mensajero Ribosomal nuclear ADN A ARN Pequeño ARNt ARNhn ARNr nuclear B ARNm D Factores Citoplasma Polimerasa Producto Génicos Localización transcripcionales C ARN pol-I ARNr grande: 28S. Creando señales que bloquean la traducción. nación. NRE) y pueden actuar de varias maneras: durante toda la unidad de transcripción: primero sobre el sitio de inicio indicado en el promotor basal. la ARN pol II. continúa en la 1. Modificando la estructura de la cromatina y evitando secuencia codificadora y finaliza en una secuencia de termi- que los genes sean activados. ARNsn Nucleoplasma TFII ARN pol-III ARN pequeño: 5S. el ARNt y el ribosomal 5s. el ARNm. dada la menor complejidad 4. Reclutando factores transcripcionales represores y evi- transcritos por tres tipos de ARN pol: I. sintetiza una cadena de ARN en dirección 5’ → 3’ al igual res o los elementos de regulación negativa (negative regula. La síntesis de todos los tipos de ARN se lleva a cabo en el núcleo por enzimas espe- cíficas donde la ARN pol I sintetiza el ARNr. Esta enzima actúa de manera continua tion elements. La mayoría de transcripción del gen de manera cooperativa con otras los potenciadores o silenciadores actúan sobre el promotor secuencias reguladoras y alteran la estructura del ADN. Después de su maduración son transportados al citoplasma para su función. basal y aumentan la unión de TF. vando así la expresión génica. e inacti- de los genomas de estos organelos (figura 5-5). Cada una reconoce promotores y TF con caracte- 3. que cortas de nucleótidos de dos tipos: los elementos silenciado. 18S y 5. lo que implica una aproxi- mación f ísica entre ambos y una flexibilidad en la molécula Tipos de ARN polimerasa de ADN. Alterando el proceso de corte y empalme del ARN hete- rísticas específicas. jan más a la ARN pol bacteriana. y la ARN pol III.

La más bien reguladora y se unen preferentemente a los pro. los genes tesis de los ARNt. voca una deformación en la estructura del ADN sin sepa- que puede ser activador o represor. La ARN pol III celular y éstos son los responsables de la expresión de genes se encuentra en el nucleoplasma y es la encargada de la sín. o TF de tejido específico. Esta unión pro- misma secuencia puede ser reconocida por más de un TF. por 11 TAF Factores transcripcionales (TF) (TBP associated protein). y los que actúan con la ARN pol III. En los promo- cibles.48 PARTE I • Conceptos básicos de biología molecular 45S. el precursor del ARNm y algunos ARNsn. transcripción y los otros factores 5’ y TF reguladores. conocida como unen al ADN en el promotor. En el sitio de ini- CTD). determi. Se sintetizan o activan bajo un estímulo y llamiento local. burbuja de transcripción se origina mediante un desenro- motores distales. Existen tres subunidades comunes para Proceso de transcripción las tres ARN pol: en primer lugar. tores que carecen de caja TATA. la TBP puede incorporar- se por asociación a otras proteínas que reconocen el ADN. El TFIID está formado. en factores transcripciona. El TFIIB es otro factor que se une de forma adyacente a TBP. La transcripción tiene lugar en el núcleo. en la modificación de como molde para la síntesis de ARN. para nando la iniciación. que puede ser altamente fosforilada en los residuos cio de la transcripción. de acuerdo con su función. Es el componente clave en el do. Los TF toman el nombre de la ARN pol formar el complejo mediador de la unidad transcripcional con la que actúan y. 28S y 5. posicionamiento de la ARN pol II y delimita la distancia les generales o basales y factores transcripcionales indu. Los TF se han clasifica. precursor de los ARNr 18S. TF III. elongación y termina- La producción de ARNhn por la ARN pol II requiere de una ción. los TF que actúan con la El TFIIA controla la capacidad de unión de TBP al ADN ARN pol I se denominan TF I. que se expresan constitutivamente. aunque una ADN por el surco menor donde lo dobla. Los TAF son subunidades dife- generales o basales rentes y pueden reconocer una variedad de promotores Son los requeridos para el inicio de la transcripción en tanto basales como distales. potenciador o silenciador proteína de unión específica de TATA (TATA binding pro- para el control de la expresión de los genes. regulación mucho más compleja. que se inicia en el sitio de unión de la ARN controlan la transcripción en tiempo y espacio. . Los TF indu. Las otras dos ja (burbuja de transcripción). rar las dos cadenas. Un gen con pol II. formando una burbu- los extremos del ARN y en la terminación. de factores de transcripción involucrados es mayor. y es muy importante en el inicio de la forma transitoria en dos cadenas sencillas y una se utiliza transcripción. El TFIIF es El conjunto de TF requerido para la expresión de un deter. cadena complementaria y forma nuevamente la doble héli- ce. liberando el ARN como una cadena sencilla de nucleóti- Factores transcripcionales dos (sólo los últimos 25 nucleótidos sintetizados forman complejo con el ADN). Estas proteínas desempeñan todos los promotores basales. Por lo tanto. ARNsn).8S. cibles. En cambio. el dominio terminal carboxilo (carboxy terminal domain. específicamente en la secuencia del promotor basal BRE y proporciona mayor superficie de Factores transcripcionales inducibles reconocimiento para el anclaje de la ARN pol II. de hacia el extremo 5’. La ARN pol II también se encuentra en el nucleoplasma y sintetiza las moléculas de ARNhn. En el caso de promotores débiles. forman el aparato básico (figura 5-6). en el corte y empalme. TBP). el ARNr 5S y otros pequeños ARN (small controlados por TF inducibles requieren de la formación de nuclear. interactúan con el ADN de La proteína TFIIH tiene actividad helicasa y contacta la misma manera que los TF generales. La TBP tiene la capacidad inusual de unirse al ADN reconociendo una secuencia específica. una subunidad grande. los TF son proteínas que se na del complejo del TFIID a la caja TATA. pero su función es con la ARN pol II. donde el número y el tipo El reconocimiento del promotor basal. desde el punto de inicio hasta la caja TATA. lo que le permite su anclaje a ésta. de transcripción. en este paso tiene un promotor que contenga secuencias reconocibles sólo lugar el ensamblaje de todas las proteínas necesarias para por los TF generales puede transcribirse en cualquier tipo iniciar la síntesis. un complejo mediador estimulado de forma aleatoria. los que actúan con la ARN y permite al TFIID reconocer la región que se extien- pol II. Se unen a la ARN pol para un papel fundamental en el nexo entre el aparato basal de formar un complejo que rodea el sitio de inicio. además de por la TBP. el medio de unión de la ARN pol II al complejo de trans- minado gen es particular para cada promotor. Éstos se unen al tein. TF II. cripción. Conforme la ARN pol avanza subunidades son las de reconocimiento de la secuencia de y copia el ADN. Como de la transcripción inicia con la unión de la primera proteí- se mencionó anteriormente. La reacción de transcripción se (generales y específicos) divide en tres etapas: iniciación. junto con ésta. el ADN ya copiado se vuelve a unir a su ADN y la del sitio catalítico. o preiniciación. la molécula de ADN se separa de de serina y treonina.

En la elongación. La ARN pol queda colocada sobre el sitio de inicio de la transcripción. TFIIH tiene actividad de helicasa y desnaturaliza al molde. Termi- nación: implica la formación de la señal de poliadenilación y Figura 5-6. desaparecer el híbrido ADN-ARN. en una serie de seis o más la caja TATA. se pueden unir TFIIH. En la transcripción del ARN se leería como la señal de polia- denilación que determina el final de la adición de 1. TFIIS (elonguina) participa en la reparación TATA 10 nucleótidos ARN en caso de que un nucleótido no sea apareado correctamente. A medida que la enzima avan. formación del complejo entre TFIIF y la ARN pol II. C. extremo 3’OH y en la región desenrollada se forma un Inicio D. además del proceso de edición ARN pol II se mueve a lo largo del ADN y sintetiza la que sucede sólo en algunos genes (figuras 5-7 y 5-8). tiene que procesarse de ne varias actividades: ATPasa. helicasa y cinasa. que fungirá como a TFIIH. CAPÍTULO 5 • Transcripción 49 A Complejo de preiniciación Elongación TBPTFIID D Iniciación P-TEFb. La terminación de la transcripción fosforilado en varias posiciones. la poliadenilación del extre- de la fase de elongación. B. La ARN pol II permanece de transcripción. Se presume que este proceso puede en el promotor mientras sintetiza los primeros nueve ser mucho más complejo. El complejo proteico TAT- a TFIID reconocer la región que se extiende hacia el extremo SF1 recluta el ayustosoma.40 CstF B P-P-P + 7mG 5’ nucleótidos ARN TBPTFIID metilasa 7mG5’ AAUAAAAA TATA +1 200 nucleótidos TFIIF Figura 5-7. interactúa el tránscrito de ARN. +1 hSPT5 es un factor de procesamiento del extremo 5’. Es importante mencionar que existe una super- libera. El extremo 5’ se modifica cuando el ARN es apenas un za sobre el ADN. Inicio. y se libera la ARN tiza pequeños fragmentos (menos de nueve bases) y los pol II. El inicio termina posición de eventos. El proceso fosforilación del dominio carboxiterminal (CTD) está de maduración incluye la adición de un capuchón de guani- implicado en el abandono del promotor basal y el inicio na modificada en el extremo 5’. simultáneos. Terminación. Se une TFIIE que recluta segmento de cadena sencilla de ADN. de tal manera que los procesos de cuando la enzima comienza a alargar la cadena y abando. ARN pol II. activando el complejo de preini- transcripción. TBP forma parte del TFIID. La ARN pol II se suelta de implica el reconocimiento de una secuencia que contie- todos los factores de transcripción. simultáneos. El inicio se refiere a la síntesis de los primeros nucleótidos a la cadena y la desintegración del complejo enlaces nucleotídicos de ARN. A. Cuando se añade el último enlaces. que evitan la termina- P-P-P ción prematura. la enzima mo 3’. además de los C factores de elongación PTEFb y TFIIS. que diversas formas para su maduración antes de exportarse del puede fosforilar el dominio CTD de la ARN pol II. El extremo CTD de la ARN pol II es 3. en la etapa de terminación AAUAAAAA y la adición de la cola de poli-A en preinicio la proteína de unión a la caja TATA. o ARNhn. Los procesos de elongación y terminación son cio y curvando la doble hélice. elongación. Iniciación de la transcripción.hSPT5 Terminación Corrector de errores Corte y Empalme (splicing) TATA +1 TFIIS TAT-SF1 TFIIB CPSF TFIIA Guanil transferasa 20 . Elongación: en esta etapa la ARN pol II se libera ARN pol II del promotor en presencia de TFEII y TFHII. el corte y empalme. nucleótido a la burbuja de transcripción se colapsa al rrencia de intentos abortivos. Elongación. por la adición de una . TFIIB proporciona una mayor superficie de reconocimiento para el anclaje de la ARN pol II. lo desenrolla para exponer un nuevo polímero de 20 a 40 ribonucleótidos. que se unen corriente arriba de la tarse al citoplasma (figura 5-7). El tránscrito primario. ambas se requieren para iniciar su movi- miento a lo largo del ADN y el abandono del promotor Procesamiento del ARN basal. en los que la enzima sinte. 5’. exponiendo la secuencia nucleotídica a la ARN pol II. TBP. El factor CPSF es específico de la poliadenilación. terminación y maduración del ARNhn son na el promotor con el complejo de iniciación (figura 5-6). adeninas contenidas en el tránscrito de ARN. cadena naciente de ARN. y vuelve a iniciar nuevamente. La fase de inicio puede retrasarse por la ocu. así como la separación del complejo de con el surco menor del ADN. se refiere a la síntesis de los primeros 10 enlaces híbrido ADN-ARN (figura 5-7) nucleotídicos del ARN. y sólo TBP queda unido a ne una región rica en GC. La fase de elongación requiere de las pro. TFIIA controla la capacidad de unión de TBP al ADN y permite El factor CstF participa en la escisión. Los nucleótidos se añaden de forma covalente al ADN. ción ya existe un ARNm maduro y listo para transpor- teínas TFIIE y TFIIH. que excepcionalmente continúa unido a la ARN pol II y tie. La núcleo y participar en el proceso de traducción. por lo que cuando termina la transcrip- 2. Una vez unida TFIIE.

al reconocer la secuencia AAUAAA presente en el ARNm. en este momento. y la unión de los exones es mediada por U5. Liberación de U1. respectivamente. e indican dónde se realiza- Exones U1 U2 5’ ARNm 3’ U4 U5 U6 rá el corte y el empalme. la adición U6. su metilación (enzima metil transferasa). por lo tanto. modificación del extremo 3’ con la adición de fosfodiéster nuevos. CPSF). 2. formando un nuevo enlace fosfodiéster hSPT5 unido al CTD de la ARN pol II. Las enzimas del proceso también conocido en 2’-OH de la última base del Marne. El CTD de la ARN pol II. es una riboproteí- con la formación del ayustosoma con ataque nucleofílico y na. 1. traducción y la generación de una proteína truncada. 1. La ARN pol II continúa añadiendo nucleótidos antes de tiva de una citosina metilada. sitio de empalme 5’ y 3’ (donante y Intrones receptor. La base modificada 7 metilguanosina (7mG) se añade del intrón. reacción de transesterificación el sitio donante 5’ libre La etapa de la terminación de la transcripción y la adi- se convierte en un nucleófilo que ataca el sitio receptor ción de la cola de poliadenilación (poli-A) en el extremo 3’ 3’. por inosina. Las tres el enlace fosfodiéster de una guanina conservada del enzimas son reclutadas por el factor de elongamiento sitio donante 5’. marse en más de una forma y generar variantes del ARNm 3’ transferasa por corte y empalme alternativo. En la segunda las ribosas (figura 5-8A). da como sitio de ramificación. los que pre. CstF) y el factor espe- Edición del ARN cífico de poliadenilación y escisión (cleavage and polyadenylation specificity factor. El tante mencionar que la cola de poli-A sólo se añade a los proceso de edición sólo se presenta en ciertos genes. codón de paro UAA. proteínas y 5 ARN nucleares pequeños (ARNsn). respectivamente). que se convierte en uridina colapsar la burbuja de transcripción. ayudado por U4. adición de la caperuza o casquete en el extre. U2. U5 y ción de un grupo fosfato (enzima ARN trifosfatasa). están íntimamente ligadas. U5 y U6. eliminación de intrones y empalme de exones (splicing). conoci- Figura 5-8. como U1. Existen dos sentan la señal de poliadenilación AAUAAA. ayudado por proteínas accesorias. nal del ARNm. por lo que la señal del codón CAA (enzima citidina desaminasa) y genera el de poliadenilación es clave para el proceso de termina. se produce el ataque nucleof ílico del nucleótido guanina (enzima guanilil transferasa). U4. Las regiones en el ARNhn C Eliminación de intrones 5’ ADN 3’ reconocidas por la maquinaria de corte y empalme son y empalme de exones 5’ E1 E2 E3 E4 E5 3’ secuencias conservadas de nucleótidos específicas que ARNsn limitan los exones y los intrones. B. Adición de alrededor de 200 residuos de adenina en el aminoácido importante por otro o codones de paro de la extremo 3’ por la enzima poli-A polimerasa. Los exones se empalman y liberan el lazo intrónico. Los exones y los intrones pueden empal- + 5’ AAUAAA AAAAAAAA3’ 2’-O-methyl. En algunos casos genera el cambio de un 2. lo escinden. es decir. de En este momento se libera U4 y entran en contacto U6 igual manera. A. mecanismos que median la edición: la desaminación oxida- 3. o el cambio de aminoácido adenina ción (figura 5-8B). transferidos La edición es una forma de modificación postranscripcio- desde CTD al ARNhn. algunos tejidos o en algunos tipos celulares. Es impor. en ARN generados por la ARN pol II. una tercera secuencia. La 7-metil guanosi- y una estructura llamada lazo intrónico. se encuentra en la secuencia mo 5’. el factor estimulante de la esci- sión (cleavage stimulation factor. Las reacciones se pueden dividir en tres etapas: transesterificación. y por de la adenina conservada en el sitio de ramificación en último. participa en el reclutamiento de las enzi- y U2. conocidos C. que prefiere aparearse con citosina (enzima . na queda unida a través de un enlace entre carbono 5’-5’ de 3. en tres pasos enzimáticos: la elimina- tres sitios de corte y empalme. eliminando un grupo como ayustosoma median dos reacciones de transesterifi- fosfato con la formación de un enlace entre carbono 5’-5’ de cación sucesivas donde se rompen y se forman dos enlaces las ribosas. Es remplazado por U6. El ayustosoma está formado por 150 la cola de Poli A en presencia de los factores CPSF y CstF. Formación de un plegamiento del ARN para acercar los 7-metil-guanosina.50 PARTE I • Conceptos básicos de biología molecular A Modificación del extremo 5’ Corte y empalme (splicing) OH OH H H H H El proceso de corte y empalme (splicing) consiste en la 5’ O B Modificación del extremo 3’ remoción de los intrones (las secuencias intragénicas no CH2 3’ 7mG 5’ CPSF codificadoras de la región codificadora) y el empalme de los P P P O CstF 5’ Guanilil exones (bloques de secuencias codificadoras para formar el transferasa ARNm maduro). Los complejos proteicos. El mas para la poliadenilación que sucede al encontrar secuen- ayustosoma es constantemente reciclado y reclutado cias de reconocimiento en el ARN tránscrito primario en por el CTD de la ARN pol II a través del TAT-SF1 (figu- tres procesos: ra 5-8C). Identificación de las secuencias donantes 5’ y sitio de ramificación por U1 y U2.

85:426-434. Biochem Cell Biol. Esquematiza (dibuja) la secuencia de eventos de la trans- a) Locus específico del ADN que contiene información y cripción.. Negotiating the nucleosome: factors that allow RNA elongation. 2011. colapso de burbuja de trans- necesarias para la función celular. corte de los multánea. Fededa J. corte de los intrones y c) Menor complejidad en la regulación. ¿Qué diferencias existen en la transcripción entre euca. Sci. Gerstein M. Biochim Biophys Acta. un diversos mecanismos por los cuales se puede controlar la codón de terminación que provoca la formación de una expresión de los genes (véase el capítulo 7). cripción y sitio de unión al ADN. Bruce C. no. no requieren procesamiento del ADN. Multiple links between transcription and splicing. post-ENCODE? History and updated RNA polymerase II CTD. Kornblihtt A.1809:34-45. requiere procesamiento del ARN. 2.. se realizan en el empalme de los exones. Genome Res. son genes policistrónicos.P.14:517-522. El ejemplo más representativo del proceso de edición es en el ARNm de la Las diferencias fenotípicas que caracterizan a las diferentes apoliproteína B (ApoB).15:99-106.Y. función de ATPasa y riotes y procariotes? helicasa.. ApoB-48. se realiza en el 5. cambiando el codón CAA por UAA. incluido el ser huma. Greenleaf AL.P. proteína truncada de tan sólo 48 aminoácidos denominada mecanismo propio de los mamíferos. ¿Cuál es la definición molecular que describe mejor un gen? 3. La inserción o deleción de una uridina dirigida por un ARN guía se ha observado en procariotes.. modificación del extremo 3’ con b) Se realiza en el citoplasma. Mattick J.10:1489–1498. c) Reclutamiento de las enzimas. CAPÍTULO 5 • Transcripción 51 adenosina desaminasa de acción sobre ARN. Cellular signals modulate alternative splicing. Pennisi E. be a gene. Pheasant M. 2007. RNA uridylyltransferases. Genomics. formación de la burbuja de la síntesis de ARN. RNA. Son funciones del dominio proteico CTD de la ARN pol II: b) Secuencia del ADN que contiene la información para a) Regulación negativa. 2006. se deben a la expresión diferencial lo que se lo conoce como ApoB-100. y ha cambiado Regulación de la transcripción los marcos de lectura para la traducción. Zheng D. Muñoz M. Este mismo gen en el de sus genes. Rozowsky J. en pueden regularse por el producto génico que interactúa con el que una citosina en la posición 2152 es desaminada y se otros genes o con el ambiente en tiempo y espacio.. transcripción y síntesis de ribonucleótidos. Korbel Phatnani H.R.S. 2004. De la Mata M. a pesar de produce una cadena polipeptídica de 100 aminoácidos. al ser tránscrito. Nechaev S. Du J. sufre un proceso de edición. a) Mayor complejidad en la regulación. ADAR). El desarrollo y el fenotipo de un organismo intestino. exones y empalme de los intrones. Raising the estimate of functional human Gu M. traducción y transcripción de manera si. b) Poliadenilacion del extremo 3’. 2007. et al. Cell Mol Life Sci. into capping and decapping mRNA. 2007..20:2922-2236. 2007. a) Superenrollamientos. ting the transition from transcription initiation into productive Armstrong J.. Science. son genes vierten en un ARNm? monocistrónicos.. Processing the message: structural insights sequences. Adelman K. citoplasma. ¿Cuáles son las modificaciones del ARNhn que lo con- núcleo.. Lima C. Genome Research. Curr Opin Struct Biol. Genes Dev. Existen convierte en U. Pol II waiting in the starting gates: Regula- 2005. Tarn W.316:1556-1557. 4.. Phosphorylation and functions of the J. DNA study forces rethink of what it means to 2007. almacenamiento para la descendencia. El ARNm sintetizado en el hígado células presentes en organismos multicelulares..17:669-681.17:1245-1253.O. Preguntas de repaso 1. una guanina metilada.S. c) Formación de estructuras secundarias. .J. Nogues G.62:2194-2203. J Biomed 2005. c) Secuencia del ADN específica de unión a proteínas b) Enzima metiltransferasa. What is a gene..D. polymerase II to elongate through chromatin. definition...B. Bibliografía Aphasizhev R.A. por tener el mismo genotipo.

bases (o varios) para la formación de cada uno de los 20 La cadena molde que la traducción requiere para su aminoácidos presentes en las proteínas y así poder descifrar inicio es el ARNm. codón. a 37°C de temperatu. agru- del cual desarrolla una lectura de la secuencia de nucleótidos par nucleótidos de dos en dos.). Esta información se almacena en el cro. así como también la pre. Esta expresión se da debido a que las instruccio- Traducción nes trasladadas del ADN al ARN y en especial del ARNm a Se conoce como traducción a la síntesis de una proteína de las proteínas se transmiten en forma de códigos. que a su vez puede expresarse como una proteína. se tienen 64 diferentes combinaciones posibles de tres sos factores traduccionales de manera coordinada y consu. necesario para traducir esta infor. tes. 61 de los cuales codifican para aminoáci- me gran cantidad de energía (aproximadamente el 80%. Código genético mación para la síntesis de una proteína funcional y específica. T). o por residuo de aminoácido) y rápida (incorpora aproxima. El modo de lectura del ARNm es igual al observado en la transcrip- Se sabe que las características físicas son heredadas de nues. traducción se la conoce como polimerización. en dos y tres marcan la terminación de la traducción. de igual forma. A la principal reacción de la de cáncer. 52 . pero seguiría siendo insuficiente. mediante la formación de enlaces mecanismo de replicación del ADN (útil para la perpetuidad peptídicos. de tal manera que permite crecer una cadena disposición a padecer y/o desarrollar ciertas enfermedades. adición secuencial de aminoácidos (según la información mosoma y se transmite de célula a célula mediante el genética). etc. G. que la célula interpreta durante el proceso de traducción. diferentes tipos zar en un extremo C-terminal. y se considera extremada. lo que conforma un triplete. ya que se dispone de cuatro bases diferen- que se realizan dentro de la célula. Capítulo 6 Traducción José María Vera Cruz / Bertha Adriana Álvarez Rodríguez Belinda Claudia Gómez Meda Introducción con una secuencia de 64 codones diferentes. nucleótidos (43). Si se representara cada aminoácido por un nucleó- Se llama traducción porque interpreta la información tido específico no se podrían formar los 20 aminoácidos contenida en el gen utilizando un código genético a través que están presentes en las proteínas. ra). permitiría formar hasta 16 contenidos en el ARNm. que representará un aminoácido o señal específica damente 15 aminoácidos por segundo. Esta conversión de información combinaciones posibles. se conoce como “decodificación”. el cual tiene como inicio el extremo 5’ y finaliza en el tros padres (estatura. que se codifica por el código genético el mensaje genético contenido en el ADN. principalmente el ARN mensajero (ARNm). Así. color de ojos). Este fenómeno es uno de los procesos más complejos De esta manera. a peptídica partiendo de un extremo N-terminal para finali- las que se denominan hereditarias (diabetes. extremo 3’. la forma en la que se codifica la información es en gru- mente exacta (con un error de aproximadamente 5 × 10–4 pos de tres nucleótidos. lo que forma de adenosín trifosfato [ATP] y 20% de guanoín trifos. en él participan numero. y esto se logra a través de la información con. acuerdo con la información genética y se emplea como El ADN está formado por cuatro bases nitrogenadas (A. Un gen contiene la información necesaria para transcribir- se en un ARNm. de la información genética) y se expresa a través de la trans- cripción mediante la obtención del ARN. C. permite asignar de manera adecuada un código de tres fato [GTP]) que la célula produce. uno tras otro. ción. que es la tenida en los genes. molde una molécula de ARNm.

y en general. 61 son utilizados para codificar a los 20 Cuadro 6-1. cada triplete. veces degenerada si. Por lo tanto.). CAPÍTULO 6 • Traducción 53 Segundo nucleótido la secuencia de nucleótidos del ARNm. debido a que de los 64 codo- tetizar proteínas a través del proceso de traducción. se lee en grupos de tres (CGU. de modo secuencial y sin interrupciones. Este códice del gen es el que se aminoácidos codificados por más de un codón (exceptuan- lee para traducir el mensaje genético por medio del complejo do los codones para los aminoácidos metionina y triptófa- traduccional. Leucina la expresión de una proteína está dada por el orden en que Paro G UUG UCG UAG UGG Triptófano Tercer nucleótido Primer nucleótido CUU CCU CAU CGU U se encuentran los nucleótidos en el ADN. la fila de la parte superior representa el segun- do nucleótido y la columna del lado derecho indica el tercer El código genético es redundante pero no ambiguo. no). de los codones. para U UUC UCC UAC UGC UUA UCA Serina UAA UGA Paro A convertirse en una secuencia de aminoácidos. Degeneración del código genético. ya que cada GUG GCG GAG GGG G codón tiene un significado único y los códigos se leen de Figura 6-1. base de la columna de la izquierda. para expresar una proteína. como sería el caso de la cada sección de la tabla. Representado por tripletes de manera continua y lineal. Entonces se dice que una base es cuatro nes y su significado. en la cual los codones que codifican para este ami- cha a izquierda y de arriba abajo. una característica del código genético es Este código genético es utilizado por la célula para sin. A AUC Isoleucina ACC AAC AGC C Treonina AUA ACA AAA Lisina AGA Argenina A AUG Metionina ACG AAG AGG G GUU G GUC GCU GAU Aspartato GGU U Características del código genético Valina GCC Alanina GAC GGC Glicina C GUA GCA GAA Glutamato GGA A El código genético es específico y continuo. donde nes que se conocen. la tercera base puede ser cualquiera de las cua- superior. omisión de ningún nucleótido en la lectura. Es una característica del código genético y se refiere a que existen más codones distintos de los necesarios para guardar la información genética. de manera tal que este nucleótido presenta una baja especificidad. para de esta manera formar cada triplete. que determina el Extremo 3’ Extremo 5’ Histidina C C CUC CCC CAC CGC CUA Leucina CCA Prolina CAA CGA Arginina A ordenamiento que se tiene al momento de ser transcrito a Glutamina CUG CCG CAG CGG G un ARNm y. de tal forma que no hay duplicación ni 20 aminoácidos que se encuentran en las proteínas eucariotas. etc. Código genético. que se organizan en orden de dere. UUU Fenilalanina UCU UAU Tirosina UGU Cistéina U C GAA. con cualquiera de las bases nitrogena- ción de una secuencia dada. sin cambiar el sentido de la lectura. tro bases nitrogenadas. en estos casos los codones se parecen entre sí y difieren sólo en el tercer nucleótido. por ende. el resultado es que combinaciones se fundamenta en elegir una de las bases de codifique el mismo aminoácido. Hay nucleótido de cada triplete. cada base puede pertene- nucleótidos que son utilizados para descifrar a cada uno de los cer sólo a un codón. define la secuencia de aminoácidos AUU ACU AAU Asparagina AGU Serina U que tendrá una proteína. Por esta razón. a fin de poder interpretar la informa. y por lo tanto La columna del lado izquierdo indica el primer nucleótido de no hay sobreposicionamiento. seguida de la base de la columna de la derecha. se lee primero la noácido deben contener GC como primera y segunda base. La forma de agrupar estas das presente en una posición específica. Número de codones que codifican Número de codones que codifican Aminoácido para el aminoácido Aminoácido para el aminoácido Metionina 1 Tirosina 2 Triptófano 1 Isoleucina 3 Asparagina 2 Alanina 4 Aspartato 2 Glicina 4 Cisteína 2 Prolina 4 Glutamina 2 Treonina 4 Glutamato 2 Valina 4 Histidina 2 Arginina 6 Lisina 2 Leucina 6 Fenilalanina 2 Serina 6 . esto es. el cual muestra de manera práctica los 64 codo. lo que Este sistema de códigos se denomina código genético se denomina “degeneración” de la tercera base en la mayoría (figura 6-1). es decir. que a su vez repre- U C A G senta la secuencia del ADN. después la base de la fila sin embargo. alanina. ser degenerado (cuadro 6-1).

en la cual secuencias secuencia de codones del ARNm. formación del complejo traduccional. tres. Organismo Codón Código nuclear Código mitocondrial Todos UGA Paro Trp Levadura CUX Leu Tre Drosophila sp. esta molécula se a la cadena peptídica naciente o creciente). es más correcto afirmar que el código sola hebra nucleotídica. observadas en mitocondrias y en algunos protistas. que se une de manera complementaria con el codón del peptídica. proporcionando cadenas del ADN. que son las estructuras cierto. tra en el asa central del ARNt. medido en Svedbergs (S) y. que pueden transportar el mismo aminoá. El código genético es casi universal. tras otro. que están agrupados de tres en tres de manera • Catalizar la transferencia del aminoacil-ARNt (ARNt secuencial. noacil-ARNt-sintetasa es la encargada de dicha unión. Cuando un aminoácido al citoplasma el mensaje contenido en el ADN a los sitios de puede ser traducido por dos. durante la síntesis de una proteína. Por tanto. se conoce que esto no es totalmente y forma parte de los ribosomas. 18S y La traducción ocurre en el citoplasma de la célula. los cuales determinan la secuencia de aminoáci. a la que se la llama cadena molde. de paro o sin sentido. citoplasmáticas responsables de la biosíntesis proteica. cuatro y hasta seis codo. de esta manera. síntesis proteica (los ribosomas). Los ARNt contienen en su la función de terminar la traducción de una secuencia secuencia al anticodón. con la 28S. con bases complementarias en genético es casi universal (cuadro 6-2). formado por tres El ARNr forma parte de los ribosomas. mo aminoácido que conforma la proteína en la cadena poli. unido a su aminoácido) al peptidil-ARNt (ARNt unido dos en la proteína. El dominio del anticodón está implicado de manera Otra característica del código genético es su universali. porque es el mismo para todos los organismos existentes. de terminación. mandan señales de paro para detener el proceso ARNm. por lo que en estos casos se observan dos o tres tar al aminoácido hasta el ARNr. Las moléculas de ARNt son de pequeño tamaño con mos”. Pre. con excepciones mínimas. en las posiciones 34. esto es. Se denomina según su coeficiente de sedimentación. Estos tripletes reciben el nombre de codones tídica naciente. anticodón del ARNt. es decir. en otros mamíferos y en ciertas bacte. los cuales están tipos de ARN. ya que se han encontrado excepciones en las mito. y subunidad mayor (figura 6-2). uno ARNt distintos. mensajero (ARNm). que una vez que se ha agregado el últi. condrias humanas. estos tripletes son conocidos como “sinóni. la interpretación de los codones tales como la iniciación de la transcriptasa inversa en los por aminoácidos era igual en todas las células de todas las retrovirus. Hoy por hoy. según las equivalen- específicas de ADN son copiadas a ARNm. especies. ya que hasta hace poco se consideraba que desde las elongación del ARNt y en las funciones alternas del ARNt. algunas regiones. un triplete de bases que se encuen- nucleotídica. los sitios donde interactúan el codón del ARNm con el senta una disposición de tripletes de nucleótidos o codones. el ARNr está formado por una rias. lo que le permite adquirir una estructu- ra secundaria especial. AGA Arg Ser Humano y bovino AUA Ile Met Humano y bovino AGA y AGC Arg Paro tipos diferentes de aminoácidos. que todas “leen” los genes de la misma El ARNr es el tipo de ARN más abundante en las células manera. En el proceso de traducción El ARNm es una molécula de ácido nucleico de cadena el ribosoma tiene dos funciones: sencilla que contiene la información genética almacenada en el ADN y su secuencia es complementaria a una de las • Permitir la unión del ARNm al ARNt. de transferencia (ARNt) formados por dos subunidades llamadas subunidad menor y ribosomal (ARNr). Componentes del complejo traduccional en organismos procariotas existen tres ARNr distintos: 5S. y no todos pueden ser reconocidos por el mismo estructura de bucles y son los ARN encargados de transpor- anticodón. nes diferentes. que transporta cias del código genético. 35 y 36. UGA y UAG) tienen un proceso que consume ATP. donde serán unidos. Como los otros ARN. 16S y 23S y en organismos eucariotas cuatro: 5S. con la finalidad de traducción e informar a la célula que la síntesis proteica de introducir un aminoácido específico a la cadena polipep- ha finalizado. Dicho de otro modo. Se le considera así. esto es. mediante enlaces peptídicos. bacterias hasta el hombre.8S.54 PARTE I • Conceptos básicos de biología molecular Cuadro 6-2. La enzima ami- cido. pero con diferentes anticodones. en Los tres codones restantes (UAA. siguiendo la obtiene mediante la transcripción. . 5. lejana en la discriminación entre las formas de iniciación y dad.

puesto que ambos codones codifican para leucina y una mutación de CUU por AUU reemplaza la leu- cina por isoleucina. una mutación de CUC por CUG no tie- Subunidad mayor ne ningún efecto. En cambio. Fenómeno de bamboleo La interacción codón/anticodón ocurre básicamente con la E P A teoría de complementariedad de base establecida por Wat- son y Crick. se puede unir a tres codones: aparean no sólo por acoplamiento de AU y de GC. lo que determina la especificidad de la interac- subunidades del ARNr y participan directamente en la ción codón/anticodón. cuando el ARNt que presentaba una inosina en la posición La interpretación de un codón requiere el principio de 3 podía reconocer los codones que terminaban con citosi- complementariedad de bases con el anticodón del aminoacil. mientras ción). 2 y 3 del codón con las bases 3. una vez que lo reglas originales del bamboleo sugirieron que el primer dejó en la cadena polipeptídica en formación. por lo tanto. se sabe que existen menos de 61 ARNt. el fases o estadios (cuadro 6-3): apareamiento de interacciones también puede influir en la introducción de bases especiales en ARNt. el sitio E (centro Dicho de otra manera. que expresa dos reglas: 1. un solo aminoacil- La biosíntesis de las proteínas se divide en las siguientes ARNt puede reconocer más de un codón. Pero algo más interesante se observó de la subunidad menor. Subunidad menor El reconocimiento se da entre la complementariedad de las bases 1. que comprende: para que los aminoácidos “similares” sean representados por – Inicio de la síntesis proteica. la tercera posición. sin embargo. es decir 61. Los dos primeros sitios se encuentran en ambas codón. anticodón 5’-IGC-3’. 2 y 1 del anticodón. En consecuencia. el ARNt-Ala de la leva- ARNt correspondiente. los Interacción codón/anticodón anticodones con un uracilo en la primera posición podían unirse con los codones que tenían adenina o guanina en La interacción codón/anticodón permite al ARNm. Los tripletes complementarios se dura. pero se permiten reacciones adiciona. El centro catalítico donde se genera este enlace se localiza en la subunidad mayor. uracilo o adenina. diri. Las bases tercera y segunda del anticodón forman puen- El ribosoma cuenta con tres sitios llamados A. donde se de formas ligeramente distintas (bamboleo o fluctua- se observa la elongación de la cadena peptídica. Por ejemplo. Así. esta hipótesis ocurre entre la ter- Eliminación o salida) es el lugar por donde saldrá del com. 5’-GCU-3’ y 5’-GCA-3’. se estableció la hipótesis de bamboleo o fluctuación. Es el encargado de sinte- tizar proteínas a partir de la información contenida en el ARNm. Debido a esto. un aminoácido relacionado. también el ribosoma controla el ambiente. na. de manera tal que el acoplamiento convencional ocurra en las primeras dos posiciones del codón. decodificación del ARNm. en especial por • Fase de activación de los aminoácidos. La primera base del anticodón puede orientarse o girar- es donde se localiza al peptidil-ARNt y. Fases de la traducción les en la tercera base. La tendencia • Fase de traducción. Estructura del ribosoma. Por ejemplo. peptídico. por lo que debería de existir igual número de anticodones que de codones. por lo que se deduce que un ARNt puede complementarse con más de dos codo- nes diferentes. CAPÍTULO 6 • Traducción 55 codones relacionados reduce al mínimo los efectos de muta- ciones. nucleótido del anticodón podía complementarse con más de un nucleótido en la tercera posición del codón. modificaciones en el anticodón o cerca de él. vados en las bases tercera y segunda. Para explicar este fenómeno por dos subunidades (mayor y menor). Las plejo ribosomal el ARNt sin aminoácido. Complejo molecular formado respectivamente (figura 6-3A). cera base del codón y la primera base del anticodón. . P y E tes de hidrógeno con las bases primera y segunda del (figura 1). para después trans. Además. la ferir este aminoácido al peptidil-ARNt y generar el enlace interacción codón/anticodón es más débil. Estas interacciones ocurren dentro con uracilo o citosina. podían unirse con los codones que terminaban la cadena polipeptídica. Estas uniones cual el aminoacil-ARNt (correspondiente a la lectura del presentan enlaces de hidrógeno diferentes a los obser- codón) entra al complejo traduccional. El sitio P (centro P o peptidilo) 2. Los que presentaban una guanina en la gir el orden de incorporación de los aminoácidos dentro de posición 3. Figura 6-2. para interaccionar con distintas bases en la que en el sitio A (centro A o aminoacilo) es el lugar por el posición tercera del codón (figura 6-3B). sino que 5-GCC-3’.

Estadios y componentes necesarios para la biosín. En el acople de la subunidad menor del ribosoma con el mite que un aminoácido pueda unirse a su ARNt específico. 6-5B). estable. 56 PARTE I • Conceptos básicos de biología molecular porta. complementarios. por ejemplo. Cada tipo de ARNt. la enzima. con la subunidad menor (figura 6-5C). tras ellos. El pri- de bases que no se dé por complementariedad. es posible que un apareamiento formación del primer enlace peptídico (cuadro 6-4). que se unirá en sentido invertido. Ya pirofosfato (PPi) y el segundo para la hidrólisis de PPi a dos formada esta unión. El Iniciación ARNm ARNr de la subunidad menor cuenta en su extremo 3’ con N-Formilmetionil-ARNt ARNr subunidad menor una secuencia que es toda o casi a toda complementaria a la ARNr subunidad mayor secuencia Shine-Dalgarno. En este procariotas. leucinil-ARNtLeu. Tres de los 64 posibles codones son reconocidos como codones de terminación de la de inicio (codón AUG). Los 61 codones restantes son reconocidos por los procesos para la formación del complejo traduccional y la ARNt individuales. ocurra en la mer paso que se realiza en el inicio es la unión de la subuni- posición del tercer codón. los siguientes entrarán por el sitio A. La purina a –3 y la guanina a +4 son los determi- GTP nantes principales. llamada secuencia Shine-Dalgarno. enzima aminoacil-ARNt-sintetasa y la hidrólisis de dos La lectura del codón se lee en dirección 5’ a 3’ por el moléculas de ATP (figura 6-4A). metionil-ARNt para la metionina. La secuencia de Kozak. el nucleótido 3’ del codón dad menor al ARNm (figura 6-5A). esto es. La iniciación termina cuando el complejo riboso- mal está completo y formada la unión codón/anticodón. el ARNt unido al aminoáci- do compatible con él se designa aminoacil-ARNtAA. Por ejem- ión d posic éntrico plo. encontrada en proca- ATP riotas. metionil-ARNt. la subunidad mayor forma el complejo ácidos fosfóricos inorgánicos (2Pi). uno para la remoción del anticodón. . como se observa en la tabla 4. en el e giro que “AA” corresponde a la sigla del aminoácido. IF-2 se asocia con GTP y se unen al metionil- proceso se libera un AMP + 2Pi y. En las bacterias esta unión se realiza cerca del codón de Cuadro 6-3. con ayuda de los IF. sólo bajo estas condiciones el ARNt iniciador es el Activación de los aminoácidos único ARNt que puede entrar por el sitio P. con la intervención de la enzima pirofosfatasa. actúa el eIF-4 para eucariotas y el IF-3 para y genera un aminoacil-ARNt cargado (figura 6-4B). para posteriormente Terminación Codón(es) de paro en el ARNm desplazarse hasta encontrar el codón de inicio situado en la Factores de liberación secuencia de Kozak. y así para todos ARNt los aminoácidos. 32 o más ARNt La secuencia Shine-Dalgarno. etcétera. Elongación Complejo de Iniciación (complejo ribosomal) aminoacil-ARNt específico para cada codón difiere de la anterior levemente y en ésta se incluye el codón Factores de elongación de inicio. Anticodón G A U Anticodón G A G exc 5’ C U A 3’ 5’ C U CU 3’ Codón ARNm Codón ARNm Inicio de la síntesis de proteínas La fase de iniciación no sólo es el reconocimiento del codón Figura 6-3. si el codón/anticodón son vuelve a utilizarse. La identificación del sitio P es mediada por la acción de los IF. es rica en purinas. factores de traducción llamados factores de iniciación (IF). lleva antepuesto el nombre del aminoácido que trans. sino que también incluye todos los traducción. Para las células eucariotas la secuencia específica en el Activación de los 20 aminoácidos aminoácidos 20 aminocil-ARNt sintetasa ARNm se llama secuencia Kozak. se une por complemen- Estadio Componentes esenciales tariedad a una secuencia en el ARNr de la subunidad menor. de 3’ a 5’. Una vez unido el ribosoma al ARNm a través del ARNr. inicio en donde una secuencia corta específica del ARNm tesis de proteínas. el ARNt iniciador entra al sitio P – Elongación de la cadena polipeptídica. con la asistencia de de ARNm y el nucleótido 5’ del anticodón de ARNt. El ARNt iniciador transportará una Los aminoácidos son activados mediante la acción de la metionina que no llevará a un grupo formilo. lo que facilita la unión y la colo- Factores de Iniciación cación del aminoacil-ARNt en la subunidad menor del GTP Mg+2 ribosoma (figura 6-3A). metionil-ARNtMet. y reconoce al codón AUG para iniciar la traducción (figura – Terminación de la síntesis de proteínas. leucinil-ARNt para el que transporta A B ARNt leucina. que ARNt con el complejo ribosomal. esta última reacción. se hidroliza el GTP y la unión se vuelve cido. lo que per. Hipótesis de bamboleo. encontrada en eucariotas. El mecanismo se inicia cuando el ribo- Mg+2 soma se une al extremo 5’ del ARNm. Por otro lado. Por tanto. localizada río arriba (extremo 5’) Mg+2 a 6 o 10 pares de base del codón de inicio en el ARNm. al unirse al aminoá.

b) Transferencia del aminoácido al peptidil-ARNt. noacil-ARNt correspondiente y adicionados al extremo carboxi-terminal de la cadena en crecimiento. EF-Ts y EF-G Factores de terminación (RF) eRF RF1. Diferencias entre procariotas y eucariotas. En el segundo paso. Proceso que requiere de la hidrólisis de ATP en dos reacciones secuenciales. palabras. la aminoacil-AENt sintetasa. IF-2. catalizada por la enzima peptidiltransferasa. la enzima cataliza la trans- ferencia del aminoácido a los OH (2’ o 3’) de la porción de ribosa del residuo de adenosina 3’ terminal del ARNt generando un aminoacil-ARNt activado.eIF-4B. Primero. Cuadro 6-4. que requiere de tres pasos para poración de nuevos aminoácidos. ciador se une con el radical amino (NH2) del aminoácido c) Desplazamiento del ribosoma.eIF-2B. Activación de los aminoacil-ARNt. ARNt iniciador Aminoacilación Aminoacilación y formilación Factores de iniciación (IF) eIF-2. la enzima une el aminoácido al fosfato del ATP con la liberación con- comitante de pirofosfato. Esto es llamado un intermediario aminoacil-adenilato. transportados por el ami- añadir un aminoácido. eEF-1βγ y eEF-2 EF-Tu. la reacción hacia delante es favorecida por la hidrólisis acoplada del PPi. IF-3 eIF-4G.eIF-3. El crecimiento de la cadena polipeptídica implica la incor- Es una reacción cíclica. el radical carboxilo (–COOH) del aminoácido ini.eIF-4A. CAPÍTULO 6 • Traducción 57 P B P AA AA Aminoácido de alta energía Aminoácido ATP AMP específico A Aminoácido Metionina AA 2 ATP Metionina 2 Pl + AMP ARNt específico P AT ARNt Sitio del aminoácido AA Aminoacil Sitio del ATP sintetasa Sitio de ARNt AMP AMP PNAt Inicio del ciclo 2 Pl + AMetionill -PNAt AA AA ARNt cargado Figura 6-4. Maquinaria necesaria para llevar a cabo la traducción de una proteína.eIF-5 y eIF-6 Factores de elongación (EF) eEF-1α. Elongación en la síntesis de proteínas siguiente mediante la formación de un enlace peptídico (figura 6-6). RF2 y RF3 . que se catalizan en la enzima. Aunque esta reacción es libremente reversible. Eucariotas Procariotas ARNr 80S 70S ARNr subunidad pequeña 40S 30S ARNr subunidad mayor 60S 50S ARNm Monocistrónico Mono y policistrónico Sitio de reconocimiento del ARNm Secuencia de Kozak Secuencia Shine-Dalgarno. en otras a) Decodificación del aminoacil-ARNt en el sitio A.eIF4E y IF-1.

que se transforma en un nuevo peptidil-ARNt. pero de un complejo originado por la proteína E C EF-G (en bacterias) o EF-2 (en eucariotas). por lo que se realizará tantas veces ARNt tiene en un anticodón y el ARNm un codón. Se utiliza una tercera proteína. Además. lo Subunidad menor que permite que la cadena peptídica que contiene el pepti- dil-ARNt forme un enlace peptídico con el aminoácido que forma parte del aminoacil-ARNt. que corresponde con el aminoácido Terminación de la síntesis de proteínas metionina en eucariotas y formilmetionina en procariotas. los cuales tienen como característica no codificar para ningún La decodificación requiere forzosamente de dos proteí. . lo que permite P Met Met que se realice un desplazamiento del ribosoma (tres nucleó- A E A tidos hacia el extremo 3’ del ARNm. ribosomal. imitan al ARNt y reconocen directamente el codón de ter- cuadro 6-3). La enzima que cataliza esta unión es Ty r la peptidil-transferasa.58 PARTE I • Conceptos básicos de biología molecular A terias) y EF-1a (en eucariotas). minación (cuadro 6-3). EF-Tu (en bac. Todos estos procesos están catalizados por los lla- mados factores de iniciación. por donde sale del ribosoma de la biosíntesis proteica. de tal manera que al final de un ciclo completo y la formación de un enlace peptídico. Este desplazamiento se da cuando el P A P centro P queda ocupado por un ARNt sin aminoácido. movimiento conocido 3’ AUG AUC 5’ 3’ AUG AUC AUA 5’ como translocación). El ARNm se une a la subunidad y el peptil-ARNt formado se coloca en el centro P. aminoácido. estos RF requieren de una EF-Ts TRY GTP EF-Tu-Ts EF-Ts EF-G EF-Tu-GTP M EF-Tu et Met TRY Met TRY GTP TR EF-TU Y E GTP GDP+Pi E E 3’ 5’ 3’ 5’ 3’ 5’ P A P A P A A B C Sar M M M et et et TR TR TR Y Y Y E E 3’ 5’ 3’ 5’ 3’ 5’ P A P A E P A F E D Figura 6-6. llamados factores de elongación (EF. se genera una hidrólisis que libera un ácido fosfó- ARNr rico del GTP y lo convierte en guanosín difosfato (GDP). El alarga- miento de polipéptidos se produce en forma cíclica. el sitio A estará libre de aminoácidos y se preparará para aceptar el aminoacil-ARNt entrante dictado por el siguiente codón del ARNm. pro- vocando la translocación ribosomal y colocando el ARNt Figura 6-5. requiere proteínas específicas llamadas EF. gracias a que el de un fenómeno cíclico. Fase de elongación: segunda etapa de la biosíntesis proteica. Se trata menor. asociada al aminoacil-ARNt Secuencia de Shine-Dalgarno Codón de inicio y con un GTP para formar un complejo ternario. En esta fase. Después se como aminoácidos se añadan a la cadena peptídica en cre- une la subunidad ribosómica mayor. Biosíntesis de proteínas (inicio): primera etapa sin aminoácido en el centro E. A éstos se asocia el aminoacil-ARNt. formándose el complejo cimiento. El primer codón que se traduce es generalmente el AUG. La terminación se observa cuando al sitio A lee alguno de los codones de paro o tripletes sin sentido del ARNm. Después de esto existe otra hidróli- B sis de GTP. los factores de liberación (RF) nas de unión al GTP. Cuando el 3’ 5’ A G G A G G A UC aminoacil-ARNt se une al codón del ARNm de forma ARNm A C C UC C correcta.

permite que se disocie la unión entre el ARNr y el queda libre y puede leerse de nuevo. b) Factores clase II. el ARNm tiempo. UAA y UGA) y se encuentran presentes en el ARNm. sintetizado se libere del complejo traduccional y. CAPÍTULO 6 • Traducción 59 Mat Mat Try Try Ts Ts Pro Pro Ch Ch Val Val Atm Atm LB LB Tm Tm Hls Hls A E A E RF1 GUA GUA 3’ 5’ 3’ 5’ C AU UGG C AU UGG P P Mat Try Ts Pro at M Try Ts ro Ch P Ch al m Val V At B Atm L Tm ls H LB Tm Hls E P A A E GUA 3’ 5’ 3’ 5’ C AU UGG P RF1 P A Figura 6-7. Tráfico o destino de las proteínas Cuando los RF reconocen correctamente el codón de También llamado topogénesis. Las señales para la terminación de la síntesis proteica son las mismas tanto en procariotas como en eucariotas. Esta nidad mayor) cambia el modo catalítico e hidroliza al pep- topogénesis se realiza en el citosol. el complejo traduc- mitocondrias. en donde participan tidil-ARNt. Biosíntesis de proteínas (terminación): tercera etapa de la biosíntesis proteica. aparato de Golgi. peroxisomas y lisosomas entre los más des- cional se disocia por un factor de reciclaje del ribosoma tacados). peptídica del ARNt. a la estructura ción específicos de codón (RF-1 y RF-2 para procariotas que se forma (como un rosario) se le llama polirribosoma y eRF-1 para eucariotas). Ya libre el péptido. lo que permite la liberación de la cadena varios organelos (retículo endoplásmico. Estas señales son codones de terminación (UAG. es muy fre- ARNm (figura 6-7). el centro de transferencia o de formación del enlace siguen las proteínas en la célula hasta alcanzar su localiza- peptídico dentro del ARNr (llamado dominio V en la subu- ción (intra o extracelular) donde ejercerán su función. cuente que antes de que finalice la síntesis de una proteína La terminación de la traducción requiere de dos RF: ya esté comenzando otra. al mismo Una vez finalizada la síntesis de una proteína. De hecho. Cuando esto se observa. también llamados factores de libera- forma simultánea. denominado factor de terminación (RRF en bacterias). y Las proteínas sintetizadas en la célula que son iniciadas permite con esto la reutilización del ARNr. también llamados factores de libera- ción no específicos (RF-3 en procariotas y eRF-3 en eucariotas) que une un nucleótido de guanina. molécula de GTP para permitir que el polipéptido recién de liberación y del ARNt para la siguiente síntesis proteica. Se refiere a la ruta que paro. con lo cual una misma molécula de ARNm está siendo utilizada por varios ribosomas de a) Factores clase I. requiere de factores de terminación (RF). de los factores por ribosomas libres del citosol como las proteínas nuclea- . o polisoma.

En este caso. naciente hacia el interior del retículo endoplásmico. Esta secuencia se divide en tres secciones: la prime. la segunda se encuentra en la parte central y La expresión de los genes en todos los organismos proca- consta de seis o siete aminoácidos hidrofóbicos. Los péptidos señales cuentan través de la membrana del retículo endoplásmico y el apara- con una secuencia corta de aminoácidos (13-60 aa). del ribosoma y la síntesis se reinicia. concluyen su síntesis en secuencia señal a menudo es eliminada de la proteína por dichos ribosomas para luego dirigirse al citosol. las citosólicas y las que están destinadas a cloroplastos. se disocia de la membrana del retículo endoplásmico y pue- péptido señal o etiqueta señal. nucleares. regulación de tales acontecimientos pueden conducir al cia señal sobresale del ribosoma y se une inmediatamente a desarrollo de una enfermedad. y la tercera riotas y eucariotas. Una vez completa la síntesis. Muchas proteínas llevan un péptido señal para que sean identificadas y transportadas por el aparato de Golgi hacia el lugar que corresponde Función del péptido señal Ejemplo de péptido señal Importación al RE -H3N-Met-Met-Ser-Fen-Val-Ser-Leu-Leu-Leu-Val-Gli-Ile-Leu-Fen-Trp-Ala- Tre-Glu-Ala-Glu-Gln-Leu-Tre-Lis-Cis-Glu-Val-Fen-Gln Retención en el lumen del RE -Lis-Asp--Glu-Leu-COO- Importación a la mitocondria -H3N-Met-Leu-Ser-Leu-Arg-Gln-Ser-Ile-Arg-Fen-Fen-Lis-Pro-Ala-Tre-Arg- Tre-Leu-Cis-Ser-Ser-Arg-Tir-Leu-Leu Importación al núcleo -Pro-Pro-Lis-Lis-Lys-Arg-Lis-Val Importación a los peroxisomas -Ser-Lis-Leu- Unión a la membrana a través de la unión covalente del extremo amino H3N. biológicos son regulados por modificaciones postraduccio- Mecanismo de acción.60 PARTE I • Conceptos básicos de biología molecular Cuadro 6-5. en la función. lisosomales y de secreción. que corresponde a las proteínas de secreción. res. La clave del escisión proteolítica de la peptidasa en el interior del retícu- proceso por el que las proteínas se dirigen a su sitio son las lo endoplásmico. es hidrófila y contiene de mecanismos (cuadro 6-4). ralizantes que aprovechan la energía de la hidrólisis del ATP para mantener la proteína total o parcialmente desnaturali- Péptido señal o etiqueta señal zada mientras atraviesa la membrana. de se necesita la intervención de una o más proteínas desnatu- mitocondria y de peroxisomas). entre las que se encuentran de volver a comenzar un nuevo ciclo. Un péptido señal es una secuencia de aminoácidos que permiten saber hacia dónde debe ser dirigida la proteína o qué función debe cumplir la misma. Algunas proteínas pueden atravesar la membrana del mientras que las proteínas que no presentan secuencias retículo endoplásmico después de su síntesis. to de Golgi. del grupo de Muchas cadenas polipeptídicas se modifican mientras los ARN citoplasmáticos pequeños o scARN. Modificaciones postraduccionales ra cuenta con uno o más aminoácidos básicos en el extre- mo N-terminal. en un grado En cuanto a su estructura. Secuencias típicas de péptido o etiquetas señal. El aspecto más destacable del tráfico intracelular es el El péptido señal y la región señal determinan el destino celu. Esto ocurre a lar correcto de las proteínas. Estos procesos requie. y las condiciones que interrumpen la secreción se inicia en los ribosomas citosólicos. La secuen. señal permanecen en el citosol (citosólicas. está controlada por una gran variedad se encuentra en la parte C-terminal. la partícula de reconocimiento de la señal (SRP) que se Diversos aminoácidos que forman la cadena polipeptí- encuentra en el retículo endoplásmico y se interrumpe dica sufren modificaciones químicas en sitios específicos. Como las modificaciones se realizan ya iniciada la brana) se une a la secuencia señal y. dos con frecuencia cerca del extremo amino (N-terminal) de la cadena que marcan a la proteína recién sintetizada (cua- dro 6-5). La SRP se disocia que pueden afectar la estructura o la función de la proteína. capacidad de presentar giros en la proteína y. Estas modificaciones se correlacionan con la estabilidad y la ren la hidrólisis de un GTP. la SRP es una ribonucleopro. En estas modi- . La mitocondrias o peroxisomas. momentáneamente la síntesis proteica. SecY y SecE). que dirige la proteína activas y otras que precisan ser modificadas. conocidas como secuencias señal.Gli-Ser-Ser-Lis-Ser-Lis-Pro-Lis- terminal al ácido mirístico. La mayoría de los procesos la zona reconocida y cortada por la peptidasa del líder. junto con una familia de traducción se denominan modificaciones postraducciona- moléculas llamadas proteínas Sec (SecA. les. menor. situa. Tras la traducción hay proteínas enzimáticas que ya son man el complejo de translocación. están unidas al complejo ribosomal o cuando finaliza su La proteína TRAM (translocación a través de la mem. for. las proteínas de membrana. La síntesis de proteínas de nales de las proteínas. teína formada por seis polipéptidos y un ARN. el ribosoma señales de clasificación. síntesis.

En ocurren como un mecanismo para regular la actividad bio- la mayoría de los casos. en el abundantes. y algunas metilaciones de nitrógeno adicionales se forilación es una de las modificaciones más importantes y encuentran en el anillo imidasólico de la histidina. estos dos últi- rales amino y carboxiloterminales. encontrado más de 150 modificaciones covalentes diferen- tes. eucariotas. Fisiológicamente. Uno de los efectos que presentan esta modifica. Este último es esencial para la trombi- rias para darle actividad a la proteína. Estas modificaciones se conocen para los siguientes Fosforilación aminoácidos: Ala. Carboxilación mente se separa el aminoácido metionina o aminoácido En los aminoácidos de algunas proteínas. estructura de la cromatina y en consecuencia de la actividad Dentro de las modificaciones covalentes. como en el asociación de iones o coenzimas (grupo prostético) en –CH+2 del aspartato (β-carboxiaspartato). fosforilaciones que ocurren en la síntesis de glucógeno y También se observa una acetilación en la lisina de la histona fosforilación del glucógeno en los hepatocitos. Gli. a un cambio de un aminoácido por otro en una proteína . un fosfato (o más de uno en N-terminal. Esta regulación se da en el Lis-20 de las H4. los ejemplos pertinentes son que las ción es el incremento de la resistencia a su degradación. que le hace responsable de la al glucagon que libera el páncreas. na como factor de coagulación por su acción quelante hacia Las proteínas pueden estar constituidas por una cadena el Ca+2. Tales modificaciones tienen un papel impor. a pesar de la acción de las La metilación postraduccional de las proteínas ocurre en chaperonas. en proteínas musculares y en el citocromo C. formar ésteres metilados. Leu. de los grupos R del glutamato y del aspartato también puede Los principales mecanismos de modificaciones postra. en metilarse en los grupos R-tioles de la cisteína. Las proteínas también pueden duccionales son los producidos en la etiqueta señal. Esta última modificación encendido o el apagado del proceso de división celular. provoca el modificación es el miristoil-CoA. La metilación algunos residuos de aminoácidos (glucosilación. También participan en proteínas estructurales del polipeptídica o por varias subunidades. to y del aspartato. se añade un grupo iniciador). plegamiento y reconocimiento. con más del 30% de proteínas modificadas por grupo guanino de la arginina y en los grupos R del glutama- este proceso. Algunas proteínas tienen el grupo de miristoil de 14 La versatilidad de la fosforilación de los grupos fosfato carbonos agregado a su N-terminal. el donador de grupos Las modificaciones postraduccionales son importantes metilo activado es la S-adenosilmetionina (SAM). Ile. y las proteasas deben Metilación degradar aquellas proteínas que. ocurren en la síntesis inhiben su actividad. en respuesta H4 de manera reversible. La subunidad catalítica de la proteincinasa una pequeña mutación en el material genético. Las manente y no se conocen enzimas en los mamíferos que proteínas glucosiladas pueden ser encontradas en los com. La carencia de vitamina K. El control de calidad del plegamiento carboxile de manera insuficiente durante la biosíntesis de de las proteínas para adquirir la estructura cuaternaria o con- aminoácidos. fosforila. y ocasiona la generación del síndrome hemo- formación tridimensional se lleva a cabo por chaperonas y rrágico. Las proteínas chaperonas tienen la función de ple- gar o replegar de forma correcta las proteínas recién sinteti- zadas (modificación postraduccional). ciones. En otros términos. las modificaciones a grupos funcionales (R) y cadenas late. De laciones más comunes están en la ε-amina de los residuos las casi 200 modificaciones distintas que se conocen. La gran mayoría de fosforilaciones Muchas proteínas están modificadas en su N-terminal. Todas estas modificaciones son necesa- (γ-carboxiglutamato). El donador para esta es un interruptor que. Las fosforilaciones que regulación de la condensación de la cromatina. que da lugar dependiente del cAMP (PKA) se encuentra miristoilado. que participa como cofac- den ser iguales o distintas. se encuentran transcripcional. no se pliegan de forma correcta. proteasas. El permite la asociación de la proteína modificada con las proceso de fosforilación también permite entender por qué membranas. de las histonas en el ADN es un regulador importante de la ción. considerando El Acetil-CoA es el donador del acetilo para estas reac. hidroxilación. la adición de uno o varios grupos químicos. Para el grupo R se han mos contienen monometil y dimetil-lisina. La metilación del oxígeno partimientos intracelulares. Las meti- para determinar la función y la actividad de la proteína. que la actividad de la fosforilasa se aumenta. etcétera) y la proteólisis. lógica de una proteína (regulación por modificación cova- lada y un grupo acetilo se agrega al nuevo aminoácido lente). Las modificacio- La fosforilación postraduccional es una de las modificacio- nes postraduccionales más importantes son: nes de la proteína más comunes que ocurren en las células animales y actúa casi siempre de forma reversible (fosforila- Acetilación ción y desfosforilación). CAPÍTULO 6 • Traducción 61 ficaciones participan remociones de aminoácidos (general. según donde ocurra. según provengan del mismo gen tor en la carboxilación del ácido glutámico. la fos. y estas últimas pue- hueso. Met y Val. puedan eliminar el grupo metilo. de lisina. La N metilación es una modificación per- tante en la estabilidad. y la carboxilo a la cadena lateral de un aminoácido. o del glutamato algunas enzimas. la metionina (iniciador) es hidroxi. permite que se o de genes diferentes. acetilación. los nitrógenos y en los oxígenos. se observa hasta en un 50% en proteínas de muchos casos) se agrega y después se quita.

62 PARTE I • Conceptos básicos de biología molecular participante en la división celular. Se refiere a la adición del grupo geranilo (10C) farnesil versal es el 3’-fosfoadenosil-5’-fosfosulfato (PAPS). la serina. como la oxitocina y la vasopresina. que son la base de las acciones antiinflamatorias de el RE. las proteínas. el palmitato (16C) y el estearato u oleato (18C). y las proteínas-G. reducen los lina. como se observa en el fibrinógeno y Prenilación (terpenos) en algunas proteínas secretoras. Las Modificación con lípidos cinasas catalizan la siguiente reacción: Acilación ATP + proteína ←→ fosfoproteína + ADP En general. Estas proteínas incluyen las extracelular de la proteína contra la degradación. C-terminal. el carboxilato de la cisteína se cadena proteica y en general no desempeña un papel en metila en una reacción que utiliza S-adenosilmetionina la regulación de la actividad de la proteína. lumen del RER. tienen amidación el na-disulfuro isomerasa. Se le da este nombre C-terminal. llamadas algunas proteínas. rio para la actividad biológica y no se utiliza como una de la vía biosintética del colesterol. Los grupos isoprenoides modificación regulatoria. Varias hormonas peptídi. Las proteínas que provocan la fosforilación son las cina- sas y las que eliminan los fosfatos son las fosfatasas. sintetizadas en ribosomas libres. la actividad de numerosos receptores del factor de ácidos grasos que se incorporan por acilación son: el mi- crecimiento es controlada por la fosforilación de la tirosina. forman- do un enlace éster con el grupo –OH. Las enzimas que se hidroxilan se identifican como prolil hidroxilasa y lisil Formación de puentes disulfuro hidroxilasa. son compuestos isoprenoides derivados. mantienen Algunas de las proteínas más importantes. una mala hidroxilación del las proliferen continuamente. Las proteínas hidroxiladas más Los enlaces de disulfuro se forman generalmente en el importantes son los colágenos. al perderse el sitio en el que se colágeno podría derivar en el desarrollo de escorbuto. que afecta a su grupo –OH. A es cualquier aminoáci- Una de las formas más comunes de modificación proteica do alifático (excepto alanina) y X es el aminoácido está representada por la glucosilación. que se unen e hidrolizan el GTP en Hidroxilación las cascadas de señalización intracelular. introduce un grupo fosfato para bloquear su actividad. Como un na un punto de anclaje en la membrana. llamada RAS. Estas modificaciones que dependen de la estatinas. como sucede en la fosforilación de se unen a residuos de cisteína en el extremo C-terminal de tirosina. Esto se debe al ambiente oxidante . lisina (se observa en 50% de las prolinas presentes en episodios inflamatorios. con algunos aminoácidos de la de unirse el grupo prenilado. y casi de los leucocitos y en las funciones inmunes de las células no se observan en proteínas intracelulares. Esta involucradas en la motilidad. por la enzima proteí- cas. por tanto. El donante de la amida para la amidación del C-terminal es la glicina. Debido a lo anterior. y en cisteína formando Sulfatación enlace tioéster con el SH. Para que la reacción de prenilación ocurra. esta reacción tiene lugar en proteínas citosóli- En células animales. incre- Aunque el nivel de fosforilación de la tirosina es menor. debido a que disminuyen la síntesis de farnesil vitamina C como cofactor incluyen hidroxilaciones de pro. cuyas fun- la solubilidad de las glicoproteínas y aseguran el plegamien. pirofosfato y geranil pirofosfato y. se observa en endoteliales. pero no en procariotas. colágeno) y la amidación del C-terminal. debido al fenómeno hidrof ílico de los azúcares. ciones dependen de la prenilación. ristato (14C). Se ha identificado una secuencia consenso común en el extremo C-terminal de las proteínas preniladas y se compo- Glicosilación o glucosilación ne de CAAX. cadenas laterales y/o los extremos del polipéptido. la activación y la proliferación modificación es frecuente en proteínas de membrana. su mentando su hidrofobicidad y proporcionando a la proteí- fosforilación es funcionalmente muy importante. El donador del sulfato uni. Los principales ejemplo. en las cadenas laterales de serina y treonina. Estas funciones modifican la respuesta inmune de muchas proteínas preni- La función de un gran número de hidroxilasas. es la de catalizar la incorporación de grupos –OH a los fármacos que inhiben las síntesis de colesterol. con la formación de un enlace tioéter (C-S- C). son aquellas que modu- to correcto de los dominios. donde C es cisteína. los debido a que se unen de manera covalente las cadenas de tres aminoácidos C-terminal (AAX) son retirados. por lo que dan la estabilidad lan la respuesta inmune. acompañado con déficit de vitamina C. Afecta las están sujetas a la fosforilación. los dos primeros. la treonina y la tirosina cas insolubles. como donante de metilenos. Sin embargo. silo son la proteína ligadora e hidrolizante de GTP. La modificación del sulfato en algunas proteínas ocurre en los residuos de tirosina. presentes en ladas. Después oligosacáridos (glicanos). es necesa. Puesto (15C) o el geranilgeranilo (20C) a proteínas receptoras. puede hacer que las célu. Otras de las proteínas modificadas con farne- eucariotas y virus. que que el sulfato es agregado de forma permanente. pero no en el citosol.

Muchas proteínas invo. donde se observa que las principales moléculas inhibidoras de la sín- Procesamiento proteolítico tesis de proteínas son los antibióticos. sobre todo. activadas al retirarles segmen- el otro. En la actualidad. y a los seg- cuando el potencial reductor de la célula falla. Hay excep- En todos los casos. ta de la elongación sobre la que actúan en: lucradas en una gama de procesos biológicos se sintetizan como precursores inactivos. citosólicas tienen residuos de cisteína próximos uno contra A las proteínas inactivas. aunque tam. residuos) → Insulina plasmáticos de las proteínas de la membrana. Varias proteí- nas forman enlaces covalentes mediante puentes disulfuro entre la cisteína de la misma cadena (intracatenaria) o con Inhibidores de la síntesis de proteínas otra de una cadena distinta (intercatenaria). tos de la cadena. se las denomina proproteínas. oxidan y mentos extraídos. y así inhibe de forma selectiva la síntesis de deben modificarse de esta manera: a todas se les deben reti. en el sitio A del ribosoma. Es un análogo del aa-ARNt Esparsomocina Elongación Inhibe la translocación Ácido fusídico Elongación Evita la liberación del EF-G. Esta característica de algunas nativa de la proteína de la desnaturalización. niendo. Inhiben la síntesis proteica en organismos eucariotas. un sinnúmero de moléculas actúan dete- lulares que en las extracelulares. uniéndose al complejo EF-G:GDP e inhibe al eEF-2 Toxina diftérica Elongación Inactiva al EF-2 de manera irreversible del retículo endoplásmico y al ambiente reductor del cito. los enlaces de disulfuro se encuentran. Su mecanismo se ve favorecido por la capacidad de diferen- bién se presenta la derivación de aminoácidos específicos. funcional c) Inhibición de la formación del enlace peptídico. b) Inducción de la presencia de errores en la lectura del Precursores inactivos → Proteólisis limitada → Proteína ARNm. rar algunas porciones de la cadena [metionina (o-Met)]. complicando o evitando la síntesis de una nueva gamiento y ayudan a la protección de la conformación proteína (cuadros 6-6 y 6-7). Los antibióticos pueden agruparse según la fase concre- después de emerger del ribosoma. moléculas se utiliza en el ámbito farmacéutico. favorecen un correcto ple. es el ponsables de la síntesis de proteínas. Proinsulina (84 residuos) → Propéptido (corte de 33 en proteínas secretoras. Un número de proteínas tico. propéptidos. que se activan en condiciones a) Inhibición del reconocimiento de un aminoacil-ARNt adecuadas mediante la proteólisis limitada. mecanismo más común de modificaciones. lisosomales. Efecto inhibidor en células eucariotas. Tripsinógeno → Tripsina e) Bloqueo de los factores de elongación. y en los dominios exo. Más de la mitad de los antibióticos actúan inhibiendo uno de organelos res- También llamada por algunos científicos recorte. Así. las flechas significan corte proteolí- ciones notables a esta regla. Actúan interfiriendo la activi- dad del peptidiltransferasa al bloquear la elongación. Molécula Etapa Descripción Pactamicina Iniciación Evita la unión del Met-ARNt con la ARNr subunidad menor Showdomicina Iniciación Impide la creación del complejo Met-ARNt Interferón Iniciación Inactiva al eE2 mediante una fosforilación Tetraciclinas Elongación Impide la unión del aa-ARNt al nivel del sitio A del ARNr Ricina Elongación Se une al ARNr subunidad mayor impidiendo la formación del complejo aa-ARNt: eEF-1a:GTP y posiblemente también al eEF-2 Ciclohexamida Elongación Inhibe a la enzima peptidiltransferasa Puromicina Elongación Forma una unión con el péptido creciente provocando una finalización temprana. Este tipo de enlaces se dan en menor cantidad en las proteínas intrace. el complejo ribosomal. proteínas en las bacterias sin afectar al huésped. CAPÍTULO 6 • Traducción 63 Cuadro 6-6. . accionan mecanismos celulares de respuesta. Quimiotripsinógeno → Quimiotripsina sol. que funcionan como los sensores de la oxidación. Por ejemplo: d) Inhibición de la translocación del peptidil-ARNt desde el sitio A al sitio P. ciar entre los procesos de traducción presentes en procario- Probablemente la gran mayoría de las proteínas maduras tas y eucariotas.

Efecto inhibidor en células procariotas. modi. impi- del ribosoma. . produciendo que se desacople rápidamente este les pequeñas y no permiten la entrada al aminoacil-ARNt al complejo. Por lo tanto. ción prematura de la síntesis del péptido creciente en célu- ribosoma. la bacteria comienza a sintetizar den que el ARNt “recién ingresado”. Esto se debe a que las bacterias transportan complejos de tetraciclina- Mg de forma “suicida”. lo que hace que el inicio no se pro. somal 70S inhibiendo la reacción de la peptidil transferasa. estreptomicina Ácido fusídico Elongación Evita la liberación del EF-G. no puede translocarse al sitio P. a la riotas como en procariotas. provocando Bloquean el paso de translocación e interfieren específica- errores en la lectura del ARNm. ribosomal. bosomas que están traduciendo el ARNm. Es decir. Inhibiendo de manera competitiva a la enzima lle-ARNt aminoácidos sintetasa. que Macrólidos y lincosamidas: se unen a la subunidad ribo- en concentraciones relativamente bajas se une a los polirri. Esta acción permite bloquear la translocación del complejo Tetraciclinas: interactúan con las subunidades ribosoma. salga del complejo una proteínas defectuosas. Tetraciclinas Elongación Impide la unión del aa-ARNt al nivel del sitio A del ARNr Kirromicina Elongación Evita la separación del EF-Tu del GDP impidiendo la salida del ribosoma Cloranfenicol Elongación Impide la unión del aa-ARNt con la enzima peptidiltransferasa. la tobramicina y la kanamicina. situado en el sitio A. uniéndose al complejo EF-G:GDP e inhibe al eEF-2. al distorsionar la estructura mente con la liberación del ARNt desacilado. Aminoglucósidos distintos a la Elongación Impiden la unión del EF-G al ARNr subunidad mayor. Otros aminoglucósidos. cosa que no ocurre en eucariotas. la puromicina y el ácido fusídico actúan tanto en células procariotas como en eucariotas. evitando su unión al complejo ARNm. al péptido naciente. Estreptomicina Iniciación Se une al ARNr subunidad menor de manera irreversible. el peptidil-ARNt cargado y ficando su estructura. Nota: Las tetraciclinas. Actualmente no se conoce alguna molécula que actúe a nivel de la terminación de la traducción. evitando la elongación y causando una termina- complejo ribosomal. del enlace peptídico En los cuadros 6-6 y 6-7 se enlistan algunas de las mo- Puromicina: en su estructura es similar al aminoacil-ARNt léculas con acción sobre la traducción. es decir. Bloqueo de los factores de elongación vocan una mala lectura del código genético. como la gentamicina. y cuando su concentración se incrementa puede inhibir la síntesis de Inhibición de la formación proteínas mitocondriales. pero in vivo no se observa este fenómeno. lo que duzca. las detiene la síntesis de proteínas. Inhibición de la translocación del peptidil-ARNt desde el sitio A Inductores de errores en la lectura del ARNm al sitio P Aminoglucósidos: principalmente la estreptomicina. amicacinas. procariotas.64 PARTE I • Conceptos básicos de biología molecular Cuadro 6-7. formando un peptidil-puromicina. mediante la formación de un un aminoacil-ARNt al sitio A del ribosoma enlace peptídico. con un efecto final bactericida. In vitro actúan tanto en ribosomas 70S como en las tanto procariotas como eucariotas. Neomicina y eritromicina: se unen a la subunidad 50S Cloranfenicol: inhibe a la enzima peptidil transferasa en bloqueando la translocación del complejo ribosomal. Inhibición del reconocimiento de cadena peptídica creciente. en el sitio A. tanto en células euca- de la tirosina. Es un análogo del aa-ARNt. y bloquea la fase de la transferencia peptídica de la elongación en la subunidad ribosómica 50S. evitan la asociación ribosómica al final de la fase de iniciación y pro. En vez que ha cumplido su misión al transferirse el aminoácido concentraciones mayores. 80S. se une a la subunidad 30S. modificando la entrada del fMet-ARNt y puede provocar errores de lectura en el ARNm. Inhiben la formación del complejo traduccional principalmente uniéndose a uno de los dos ribosomas (mayor o menor) Molécula Etapa Descripción Mupirocina Activación de los Impide la unión de IIe. Eritromicina Iniciación Impide la formación del complejo ribosomal (la unión del ARNr subunidad menor con el ARNr subunidad mayor) fijándose en el ARNr subunidad mayor. por lo cual se puede unir. Puromicina Elongación Forma una unión con el péptido creciente provocando una finalización temprana.

F. La glucosilación no enzimática de proteínas...J. 2004.32:D115-D119.E. Proteomics. tions..C.J. 2000... et al. Ferro Nalivaeva N..36(6):453- J. 2003. Castello P.A. N. European Molecu. The characterization of protein post-translational modi- González Flecha F. 461. Gagliardino J. . Londres: 1999 1-4:4595. CAPÍTULO 6 • Traducción 65 Bibliografía Apweiler R. Bairoch A.N. Boeckmann B. Wu CH..10(4):400–403.E.E. Acc Chem Res.. Rossi fications by mass spectrometry.. Meca. Turner A. nismo y papel de la reacción en la diabetes y el envejecimiento.. Haydon C. Regulation of p53 responses by post-translational modifica- Ciencia al Día Internacional. Barker W. Resing K. Nucleic proteins: Acetylcholinesterase as a model system. Xu Y. Post-translational modifications of S. Acids Res. Schweppe R. Lewis T. 2001....P. Ahn lar Biology Laboratory.3(2):1-17. Encyclopedia of Molecular Biology. 2003. UniProt: the Universal Protein knowledgebase.C.1:735–747.G.L.R. Cell Death Differ. Creighton T.S..

son muy diferentes. en tanto que uno eucariótico. Nivel pretranscripcional La estructura de los genes cambia cuando van a ser trans- Regulación de la expresión génica critos. como el ser humano. Traducción del ARNm. ¿qué determi. y concluye ADN. consta nas de unión al ADN que reconocen una secuencia especí- de millones de nucleótidos. ADN se desenrrolle y se separe de las histonas para que cen los ARNm y la estabilidad de las proteínas? pueda llevarse a cabo la transcripción. de varios billones. (ARNm) y. como una bacteria. 7. Se dispone de pruebas de que la 66 . Capítulo 7 Regulación de la expresión génica Adriana María Salazar Montes / Ana Soledad Sandoval Rodríguez Juan Armendáriz Borunda Introducción de un gen se inicia con el proceso de transcripción contro- lado por proteínas denominadas factores transcripcionales. octámeros de histonas para formar los nucleosomas. des- ner toda esa información. Degradación del ARNm. eucariota. una cola que se extiende por fuera de la doble transcribe en uno o varios ARN funcionales. con la traducción de una proteína individuo completo. la célula sólo expresa una frac. posteriormente. dif ícil pensar que estas dos células contienen el mismo 2. por ejemplo. Por esta razón. Así. Transcripción. Una neurona y un linfocito. se creía 3. Pretranscripción. Procesamiento del tránscrito primario de ARN. son distintas porque sintetizan diferentes ARN mensajeros 6. un cambio conformacional en la cromatina es el pri- Uno de los principios fundamentales de la biología celular es mer paso en la expresión génica. es necesario que el una célula? ¿Qué determina la frecuencia con que se tradu. de su inicio hasta su terminación. Transporte del ARNm al citoplasma. el cual contiene la información necesaria para crear con la producción de un ARN funcional y. madura y activa. Modificaciones postraduccionales. miles de moléculas diferentes y. Pero. lo que na los tipos y la cantidad de proteínas que se encuentran en impide la transcripción de los genes. ción de sus genes. A pesar de conte. Los factores transcripcionales son proteí- Un organismo procariótico. conformar un en el caso de los ARNm. lo que le otorga un fenotipo característico. La información genética de una célula está contenida en su regulados por señales recibidas por las células. La expresión de un gen se regula en diferentes niveles. mo genoma. que los genes se perdían cuando las células se diferenciaban. genoma como sucede en realidad. su siguientes: estructura y función difieren ampliamente. diferentes proteínas a partir del mis. por ende. Niveles de control de la expresión génica Aunque los diversos tipos de células en un organismo Los niveles del control de la expresión de un gen son los multicelular contienen la misma información genética. 4. Cada una de las his- El término expresión génica se refiere al proceso tonas que forman el nucleosoma tiene. cada uno de los 10 000 tipos de células que constituyen los organismos multicelulares expresan genes diferentes. en su extremo ami- mediante el cual la información codificada en un gen se noterminal. En el núcleo de una célula que la actividad y las propiedades de cada célula están deter. La expresión hélice de ADN (figura 7-1). fica y se requieren para el encendido y apagado de los genes. por lo que es 1. Ahora se sabe que las células de un organismo multicelular 5. el ADN se encuentra enrollado alrededor de minadas por las proteínas que contienen. con ello.

libe- ran el ADN del nucleosoma y dejan libre el promotor. llama. ria está expuesta a un medio rico en lactosa. En unidos al ADN en su secuencia blanco y que desempeñan ausencia de lactosa en el medio. que pierden su carga positiva. metilación de la histona H3 promueve la compactación de peño en una célula procariota es muy sencillo y en una la cromatina e inhibe la transcripción. es decir. Los genes Nivel transcripcional pertenecientes al mismo operón se prenden y se apagan al En el control de la expresión de un gen a nivel transcripcio. co mayor. como las bacterias. mismo tiempo. y se proteína interactúa con el ADN a través de enlaces. enlaces iónicos e interacciones encargadas de agregar residuos de acetilo a las lisinas en las hidrofóbicas que. mucho más complejo. puesto que la bacteria está obtenien- identificaron por primera vez en 1950 y están presentes do energía de otras fuentes. la expresión del . a la región de la cromatina destinada a la transcripción. (figura 7-2). precisamente. los factores transcripcionales encarga de metabolizar la lactosa para obtener energía. entonces. El operón más conocido y más motor. tilación de residuos de lisina en las histonas tiene un efecto Los factores transcripcionales se unen al ADN en el sur- opuesto. en la misma vía metabólica. a las histo. permite la unión de más factores transcripcionales. los genes del operón Lac se un papel fundamental en este control. Control pretranscripcional de la expresión génica. Control transcripcional en procariotes nas de los nucleosomas. entre ellas los factores transcripcionales. esta acetilación evita que las fibras de cro. silencer) en donde se unen diversas proteí. lo que La expresión de los genes de los organismos procariotes. aunque son enlaces débiles. Los elementos ADN que contiene los genes de las proteínas que participan CIS están constituidos por las secuencias en el ADN (pro. CAPÍTULO 7 • Regulación de la expresión génica 67 Ac Ac Ac Ac Ac Ac CH3 CH3 CH3 CH3 CH3 CH3 Me CP2 CH3 CH3 Histonas acetiladas ADN metilado Reclutamiento de Me CP2 Transcripción innaccesible Ac Ac Ac HDAC CH3 CH3 CH3 CH3 CH3 Me CP2 CH3 Reclutamiento de HDAC Desacetilación de histonas Cromatina activa transcripcionalmente Figura 7-1. alimento como uno de los factores más importantes. como forme el complejo basal de la transcripción. cuando la bacte- tanto en células eucariotas como en procariotas. mentaria a la superficie espacial de la doble hélice. La unión de un dad permite lograr una unión fuerte y altamente específica factor transcripcional al ADN recluta a una proteína. ensam. Los elementos los ejemplos clásicos de regulación génica. Un operón se define como un fragmento de nal intervienen elementos CIS y TRANS. estudiado es el operón Lac de Escherichia coli y es uno de nas. eucariota. la gran canti- histonas se denominan acetiltransferasas. Este operón se TRANS son. la para ser reconocidos por factores transcripcionales. Estas proteínas se encuentran apagados. la ace. Su desem. da coactivador. Las enzimas puentes de hidrógeno. Sin embargo. enhacer. El coactivador acetila. la mayoría de los genes relacionados con el metabolismo están agrupados en operones. Por otra parte. En las bacterias. ya que la conformación de la proteína es comple- matina se plieguen dejando expuestos segmentos de ADN. está determinada por las condiciones blándose la maquinaria de transcripción y dando inicio a ambientales en las que se encuentran la disponibilidad de este proceso (figura 7-1B).

La transcripción es. Específicos: se unen a sitios reguladores en genes espe- cíficos.68 PARTE I • Conceptos básicos de biología molecular ADN Promotor Operador Z Y A Núcleo 1 Transcripción Represor Lac Lac Lac Lac 2 Procesamiento de ARNm Represor Lac Citoplasma Lac AAAAAAA Promotor Operador Z Y A AAAAA 3 Transporte ARNm ARN polimerasa 6 Actividad de la proteína 4 Traducción 5 Degradación ARNm PHE Figura 7-3. que se transcriben constantemente. pretan e integran estas señales. denominados genes de Esto permite la transcripción del operón Lac y. 35) (figura 7-3). En presencia de en esta secuencia disminuye de forma espectacular la trans- lactosa en el medio. la β-actina y el ARN la lactosa (figura 7-3). el gen Z codi. y el gen A codifica les y aquellos que codifican para proteínas que participan para la enzima tiogalactósido transacetilasa. varios genes. Estos genes no contienen caja TATA. Este operón contiene tres genes. La transcripción de los genes la controla el promotor (véase Además del promotor. 1. el gliceraldehído expresión de los tres genes que actúan en el metabolismo de 3 fosfato deshidrogenasa (GA3PDH). Generales: comunes a todos los genes. Y Un mismo factor transcripcional puede controlar dife- y A (figura 7-3). ARNtphe AAA Ribosoma A A A estos promotores. que se encuentra En el funcionamiento normal del operón Lac. nocen en el ADN puede estar presente en el promotor de fica para la β-galactosidasa. ésta se une al represor y provoca en él cripción de los genes controlados por ella. una enzima que rompe el enla. Niveles de regulación de la transcripción. ribosomal 18S. entonces. responden a una variedad de (silencer). Estudios de mutagénesis inhibe su expresión. que se unen al promotor junto con la ARN polimerasa. operón Lac se activa. este represor dirigida han demostrado que el cambio de un solo nucleótido permanece unido al promotor del operón. ya que la secuencia que reco- lactosa que introduce a la lactosa en la célula. Los factores transcripcionales pueden CG GC A U U UUGCACG C dividirse en dos grupos funcionales: 5’ 3’ El ARNtphe se une al codón UUU Codón de la PHe 1. que elimina de en la regulación del ciclo celular. ce glicosídico de la lactosa y libera los dos monosacáridos Los primeros genes en estudiarse fueron los genes vira- que la constituyen (glucosa y galactosa). . la expresión constitutiva. En ausencia de lactosa. Todos estos genes contie- la célula los tiogalactósidos transportados a la célula junto nen una secuencia altamente conservada denominada caja con la lactosa. Algunos promotores son sencillos y están los genes eucarióticos se regula por otras secuencias en el regidos por una sola señal que controla la actividad de los ADN. El gen Y codifica para una permeasa de rentes genes al mismo tiempo. la transcripción de la mayoría de el capítulo 5). Figura 7-2. Existen genes un cambio conformacional e impide que se una al ADN. controlando así el encendi. con ello. existe una 25-35 pb corriente arriba del sitio de inicio de la transcrip- proteína llamada represor (un factor transcripcional) que ción (posición 25. Operón Lac. llamadas potenciadores (enhancer) o inhibidores genes. Mutaciones en los genes que codifican para factores trans- do y apagado de los genes. Z. cripcionales pueden ocasionar que éstos actúen activando controlada por los factores transcripcionales que se unen a o inactivando genes sin control. reconocidas por factores transcrip- Control transcripcional en eucariotes cionales especiales. pero sí regiones ricas en GC. TATA (timina-adenina-timina-adenina). que se localizan a cientos o miles de bases de dis- señales y actúan como pequeños procesadores que inter. Otros son complejos. tancia del sitio de inicio de la transcripción (figura 7-4). como por ejemplo.

expresión célula-específica o tejido-específica. A esto se le conoce como to de proteínas accesorias. Por otro lado. formando complejo con TFIIF se une carga negativa. bles expresados en esa célula. constan de dos estructuras α-hélice. que se ensamblan de manera coordi. unidas por una cadena corta de aminoácidos. deter- El hallazgo de que la ARN polimerasa eucariótica por sí sola minado por el grupo de factores transcripcionales induci- no puede iniciar la transcripción condujo al descubrimien. Estas proteínas nado (figura 7-5). si estimulan la transcripción de del operón Lac. hélice-asa-hélice. En este momento se liberan todos Fueron las primeras proteínas de unión al ADN que se los componentes del complejo de los factores generales de reconocieron. Potenciadores y silenciadores en el control de la expresión génica. lo que provoca un giro específico en Factores transcripcionales inducibles cada una de las α-hélice y facilita su unión al ADN. les de la transcripción. Después se ADN. unen al ADN tienen esta conformación. transcriptional factor. TFIIH TFIIE TFIIB TFIID ARN Pol II p La regulación de la transcripción en eucariotes es mucho más compleja que en procariotes. Una vez reunidos todos estos elementos. un mismo factor trans- necesarias para la acción de la ARN polimerasa II. conocidas como factores genera. Estas proteínas. la mayoría de las proteínas que se transcripción y se inicia la transcripción de un gen determi. TFIIE. TFIIA. principalmente por dos razones: TFIID ARN Pol II a) Los factores transcripcionales actúan a distancia del p sitio de inicio de la transcripción. y II. Las posibles estructuras que pueden obser- al promotor. Un solo gen de la transcripción. a la ARN polimerasa II). con su acción de helicasa. se ensamblan de forma coordinada su análisis conformacional y cristalográfico ha permitido en el promotor de los genes y asisten la unión y acción de la conocer que todos ellos presentan dominios con estructura ARN polimerasa. puede controlarse mediante la unión de varios factores nada y secuencial en el promotor de los genes y que son transcripcionales. El ensamblaje se inicia con la unión del similar que les permiten unirse al ADN o a otros factores factor transcripcional TFIID a la secuencia TATA en el pro. o como represores. TFIIF. por asociarse Debido a que los factores transcripcionales son proteínas. existe una serie de aminoácidos básicos (cargados incorporan los factores TFIIA y TFIIB. Estructura de los factores transcripcionales TFIIH y TFIIJ (TF. TFIIH y TFIIJ se acoplan después a varse en un factor transcripcional son cuatro: hélice-vuelta- este complejo. lo que HÉLICE-VUELTA-HÉLICE produce su activación. que tiene ARN polimerasa II. Un Es un grupo de factores transcripcionales que pueden ejemplo de este tipo de factor transcripcional es el represor actuar como activadores. transcripcionales y formar grandes complejos que regulan motor (formada por dos proteínas diferentes: TBP (TATA la expresión de los genes. TFIIB. En su región de contacto con el binding protein) y TAF (TBP associated factor). CAPÍTULO 7 • Regulación de la expresión génica 69 Represor TAFs TBP Enhancer Silenciador 5´ 3´ TATA or 3´ 5´ vad Acti Sitio de inicio de la Promotor transcripción TFIIH TFIIE TFIIB TFIID ARNPol II TFIIB P Promotor TATA TFIID +1 Figura 7-4. dedos de cinc y zipper de leucinas. requiere de la acción conjunta de un grupo de al menos 15 proteínas reguladoras denominadas factores generales los genes. Cada tipo celular Factores generales de transcripción tiene un patrón característico de expresión de genes. hélice. de hecho. TFIIE. cripcional puede unirse a los potenciadores de varios genes y controlar la expresión de todos ellos. . desenrolla el ADN y TFIIH fosforila la ARN polimerasa II en su dominio CTD. y sólo entonces la positivamente) que le facilitan su unión al ADN. si la inhiben. TFIID. b) La ARN polimerasa eucariótica (ARN polimerasa II) Figura 7-5. Maquinaria basal de transcripción. TFIIE.

los cua- lisina en los dos monómeros alternados cada siete u ocho les. los glucocorticoides y estrógenos. la proteína se produce pero permanece inactiva hasta manera. La mayoría de los La actividad de los factores transcripcionales se regula en factores transcripcionales inducibles actúan en complejos. que se facilita por la presencia de residuos de de anclaje de factores transcripcionales inducibles. Transcripción. Los es- teroides. la región regulado- ra es una secuencia de ADN de tamaño variable que con- Activación de los factores transcripcionales trola la velocidad de transcripción. generalmente serina o treonina del factor transcripcional. Entre los factores factor transcripcional y permite su traslado al núcleo y su transcripcionales que presenta esta estructura están los unión al ADN. Un tercer grupo de proteínas de unión al ADN está forma. uno o más potenciadores. Leu Leu Leu Leu Leu Leu 1. El factor transcripcional Oct-1 presenta esta activo con capacidad de migrar al núcleo y unirse al conformación. Regulación mediante potenciadores (enhancer) ZIPPER DE LEUCINAS En 1979 se identificaron ciertas secuencias de nucleótidos La mayoría de los factores transcripcionales con esta en los promotores de genes eucariotes a las que se les llamó estructura forman dímeros para lograr una unión más fuer. potenciadores (enhancer). al ser liposolubles. interactúan directamente con los factores gene- hidrofóbicas que mantienen unidas a las dos subunidades. se unen a su receptor en el Vuelta Hélice 3 citoplasma y lo activan. rales de la transcripción y la ARN polimerasa. Fosforilación. es aunque algunos lo hacen de forma individual. fosforilado sufre un cambio conformacional que libera el re una forma similar a uno o más dedos. para inducir El factor transcripcional AP-1 es un buen ejemplo de la transcripción. les y consiste en la adición de un grupo fosfato por una cinasa en aminoácidos predeterminados.70 PARTE I • Conceptos básicos de biología molecular A B cionales pueden activarse. 2. suprimen. Un ejemplo de este tipo de factor transcripcional es el receptor de esteroides. aun- que no recibe una señal de activación. Unión ligando-receptor. este tipo de estructura. Vuelta Hélice 1 3. El acoplamiento de varias otra α-hélice igual o más grande. lugar). Esta proteína es un heterodímero De esta manera. Aunado a esto. o dos encuentra inactivado por un inhibidor. Un factor requiere de la unión de un ligando para activarse. propiciando su transporte hacia el núcleo y su unión al ADN en los promotores de los Cvs Hi Cvs Hi Cvs Hi Zn Hi Cvs Zn Hi Cvs Zn Hi Cvs genes que contengan la secuencia de reconocimiento. El factor transcripcional NF-κB se activa receptores de esteroides. Estructuras de los factores transcripcionales. El factor transcripcional AP-1. por lo tanto. El factor transcripcional se sintetiza Leu asa asa Leu Leu Leu sólo cuando se necesita y se degrada rápidamente por Hélice 3 Hélice 4 proteólisis de tal manera que nunca se acumula. Es el mecanismo más común para la activación de la mayoría de los factores transcripciona- Figura 7-6. El factor transcripcional se do por una estructura α-hélice y una β-plegada. Fos y Jun. Liberación del inhibidor. El receptor se encuentra inactivo en el citoplasma. 5. El factor HÉLICE-ASA-HÉLICE transcripcional AP-1 es un ejemplo característico de Los factores transcripcionales que presentan esta estructura este mecanismo de activación. que adquie. constan de una α-hélice corta conectada por una horquilla a 4. Formación de complejos. ADN. que se describen en los siguien- Leu Leu Hélice 1 Hélice 2 tes párrafos. Sin embargo. mediante un cambio conformacional y formando una aminoácidos. a través de este mecanismo en donde la proteína que fun- y el factor transcripcional SP1 (de los descritos en primer ciona como inhibidor es llamada I-κB (figura 7-7). un mismo factor transcripcional . su mayoría por modificaciones postranscripcionales. atraviesan la membrana celu- C D Hélice 2 lar por difusión simple. Las lisinas les permiten realizar interacciones horquilla. formado por dos subunidades. De la misma decir. Estas secuencia sirve como sitio te al ADN. la región en el ADN que controla la formado por dos subunidades llamadas Fos y Jun (figura expresión de un gen está conformada por el promotor y 7-6). la mayoría de ellos activan la transcripción. formando homodímeros o proteínas da como resultado un factor transcripcional heterodímeros. hay que también algunos son proteínas represoras que la diversos mecanismos por los cuales los factores transcrip. es un ejemplo característico de DEDOS DE CINC este mecanismo de activación. Cuando éste es α-hélices unidas por uno o más átomos de cinc.

Monómero Formación de dímeros La atenuación de la transcripción en eucariotes puede ocurrir por distintos mecanismos. En este proceso la cadena de Transporte del núcleo al citoplasma. una citocina se cambia por un uracilo. Para poder salir del núcleo. con lo que se les postranscripcionales. VIH) las proteínas que se ensamblan Inactivación Fosforilación en el promotor determinan si la ARN polimerasa puede por inhibidor del inhibidor truncar la transcripción. la expre. lo que altera En organismos procarióticos. se cam- bia un nucleótido a la mitad de la molécula de ARNm. para constituir un ARNm maduro. los intrones se eliminan del tránscrito dejando exclusivamente los exones. la producción de una molécula de ARNm ACTIVACIÓN completa. sión de ciertos genes es inhibida por la terminación prema- tura de la transcripción. esto Atenuación de la transcripción origina el reemplazo de un aminoácido por otro. intrones (splicing). Un mismo tránscrito primario puede pro- Proteína Fosforilación cesarse de diversas formas. lo que da lugar a diferentes defosforilada de la proteína ARNm y. El tránscrito primario es aproximada- mente 10 veces más grande que el ARNm maduro. quier otra molécula que sale del núcleo. Cuando la célula requiere la proteína codi. descritos a continuación y que se genera un codón de terminación prematuro que produce una enlistan en el cuadro 7-1. intrones. proteínas diferentes. como cual- ARN recién sintetizada adopta una estructura que interac. la permeabilidad del canal de calcio. El ARN. a diferentes cadenas polipeptídicas. P P regiones que en unos tejidos se consideran exones y en otros. posteriormente procesados para producir una molécula de ARNm madura a través del proceso de corte y Receptor Unión al ligando empalme (splicing). lo hace a través del túa con la ARN polimerasa. cing alternativo. . la adición de la cadena naciente de ARN y reacomodan su estructura. la cola de PoliA en el extremo 3’ y la eliminación de los con lo que se permite la restauración de la transcripción y. el ARN sufre la transcripción. ficación en una o más bases en la secuencia del ARNm maduro que provoca cambios en el mensaje original. impide su avance e interrumpe complejo de poro. caso. tres modificaciones importantes: la adición del nucleótido ficada por este gen. el virus de inmuno- deficiencia humana. CAPÍTULO 7 • Regulación de la expresión génica 71 INACTIVO PROCESO DE ACTIVO por lo tanto. con lo que la secuencia original se altera hasta en El control en el inicio de la transcripción es la forma predo. un 50%. es decir. La Control postranscripcional modificación más frecuente es el cambio de citocina por uracilo. por lo que en cada tejido se realiza un pro- cesamiento diferente conocido como procesamiento o spli- Figura 7-7. por lo tanto. Algunos genes presentan secuencias ambiguas. en organismos eucariotes se pro- ducen ARN precursores llamados tránscritos primarios o pre-ARNm. un fenómeno conocido como Control del transporte de ARN atenuación de la transcripción. Estas proteínas pueden ser dife- P P rentes en distintas células y la célula puede controlar el nivel de atenuación de un gen en particular. En el segundo caso. En el primer gen en el paso de ARN a proteínas conocidos como contro. que origina en cada uno de ellos ARNm y cionales. En este procesamiento. algunas proteínas reguladoras se unen a modificado 7 metilgualnosina en el extremo 5’. existen otros mamíferos y sólo se ha observado en los genes de ApoB y de controles menos comunes que modulan la expresión de un la proteína del canal de calcio en el cerebro. sin embargo. Bloqueo de Separación Entrada al Control del procesamiento del ARN entrada al del complejo núcleo núcleo Durante la transcripción. versión truncada de la proteína. Mecanismos de activación de los factores transcrip. Edición del ARN puede formar parte de complejos que activan o inhiben la Este tipo de control postranscripcional se refiere a la modi- transcripción. En células infectadas por adenovirus o retrovirus (por ejemplo. El proceso de edición del ARNm es limitado en minante de regulación génica. como las bacterias.

72 PARTE I • Conceptos básicos de biología molecular

Cuadro 7-1. Mecanismos por los cuales puede ser regulada la expresión de un gen.

Sitio en la
célula donde
Mecanismo Acción se realiza Consecuencia
Pre-transcripcional Metilación de histona H3. Núcleo Inhibición de la Transcripción.

Pre-transcripcional Acetilación de histonas. Núcleo Inducción de la Transcripción.

Transcripción Unión de factores transcripcionales al ADN. Núcleo Dependiendo si el factor transcripcional es
inductor o inhibidor se estimula o se
inhibe la transcripción.

Atenuación de la El ARN naciente adquiere una conformación Núcleo No hay síntesis completa de la cadena de
transcripción especial que impide que la ARN pol continúe su ARN.
síntesis.

Procesamiento del ARN Eliminación diferencial de intrones y conservación Núcleo Un mismo ARNhn da lugar a ARNm
de exones. diferentes.

Edición del ARN Modificación de una o más bases en un ARNm Núcleo Cambio de uno o más codones en el ARNm
maduro. maduro.

Transporte del ARN Por señales específicas el ARN es exportado al De núcleo a No sale del núcleo y no se traduce.
citoplasma. citoplasma

Transporte del ARN El péptido señal induce el transporte del ARN al La falta del péptido señal hace que las
RER para la síntesis de proteínas de exportación proteínas se sinteticen en ribosomas libres
y permanezcan dentro de la célula.

Traducción Reconocimiento de secuencias específicas en el Citoplasma La ausencia de estas señales no permite
ARNm por factores de la traducción que se realice la traducción.

Adición de grupos Formación de proteínas compuestas Citoplasma Generación de proteínas funcionales y
químicos a proteínas activas.

Inhibidores de la Unión de proteínas inhibidoras al extremo 5´ del Citoplasma Inhibición de la traducción.
traducción ARNm

Degradación de ARNm Eliminación de la cola de poli A. Citoplasma Se degrada el ARNm y se detiene su
traducción.

Interrupción de la Modificación del marco de lectura que genera un Citoplasma Producción de proteínas truncadas.
traducción codón de paro prematuro.

Cuando una molécula de ARNm cruza por un poro ARNm procariotes y la secuencia kozak en eucariotes (véa-
nuclear y se introduce en el citoplasma, se encuentra con se el capítulo 6). Si el reconocimiento es deficiente, la subu-
los ribosomas, que la traducen en una cadena polipeptídica. nidad ribosómica ignorará el primer codón AUG y saltará
Si el ARNm codifica para una proteína de secreción o de hasta el segundo o el tercero. Este fenómeno, conocido
membrana, la presencia de un péptido señal en la región como búsqueda de escape, es una estrategia para producir
aminoterminal determina su transporte hacia el retículo dos o más proteínas diferentes en su extremo aminotermi-
endoplásmico. La célula reconoce este péptido tan pronto nal a partir de un mismo ARNm.
como sale del ribosoma; entonces, el complejo formado En ARNm virales la traducción se realiza usando este
por el ribosoma, el ARNm y la proteína naciente se dirige tipo de mecanismos. Estos ARNm cuentan con secuencias
a la membrana del retículo endoplásmico, donde la cadena de nucleótidos específicas, llamadas sitios internos, que no
polipeptídica terminará de sintetizarse. En otros casos son reconocidas por el ribosoma, y la traducción se inicia
la proteína entera es sintetizada por ribosomas libres en el en el segundo codón AUG.
citosol, y señales en su estructura la dirigen al sitio en la
célula en donde se necesita. Modificaciones postraduccionales.
Adición de grupos químicos a proteínas
Control de la traducción Otro mecanismo por el cual se puede regular la expresión
La traducción comienza cuando la subunidad pequeña del de un gen es la adición de diferentes grupos químicos a
ribosoma reconoce el codón de inicio (AUG) en el ARNm. cualquiera de los aminoácidos que conforman una proteí-
Los nucleótidos vecinos participan en este reconocimiento, na. Sin la adición de estos compuestos la proteína no se
en donde se encuentran la secuencia shine-dalgarno en convertirá en una proteína madura y funcional. Entre las

CAPÍTULO 7 • Regulación de la expresión génica 73

adiciones más comunes se encuentran las acetilaciones, núcleo. Su longitud es variada y cuenta con un promedio de
las carboxilaciones, las metilaciones, las hidroxilaciones y las 200 nucleótidos. Una vez en el citoplasma, esta cola se va
fosforilaciones. acortando con el tiempo. No se han observado colas de
menos de 30 adeninas, lo que sugiere que éste es el tamaño
Proteínas inhibidoras de la traducción mínimo requerido para mantener la estabilidad del ARNm.
La expresión de un gen puede inhibirse si la traducción se
bloquea mediante la unión de proteínas inhibidoras en el Interrupción de la traducción
extremo 5´ del ARNm cerca del sitio de inicio de la traduc- El proceso de síntesis de proteínas es automático, esto es,
ción. Este tipo de mecanismo se llama control negativo de la una vez iniciado debe terminarse. En casos especiales, un
traducción. proceso denominado recodificación traduccional puede
alterar el proceso de traducción. Los tipos de recodificación
Control de degradación del ARNm observados con más frecuencia son los cambios en el marco
de lectura y se observan sobre todo en virus; los retrovirus lo
Los ARNm en células bacterianas son muy inestables; su hacen de manera ordinaria. Estos virus producen un solo
vida media es de pocos minutos. En células eucarióticas el ARNm del cual se sintetizan tanto las proteínas de la cápside
ARNm es más estable, de alrededor de 30 minutos, aunque (proteínas Gag) como sus enzimas (transcriptasa inversa,
existen otros con vidas medias más largas, por ejemplo el de integrasas, proteasa y proteínas Pol). Como los virus necesi-
la β-globina tiene una vida media de 10 horas. Los ARNm tan más proteínas Gag que Pol provocan un ajuste en su
más inestables a menudo codifican para proteínas regula- ARNm e inducen la formación de un codón de terminación
doras cuya síntesis cambia rápidamente ante un estímulo. al finalizar la región Gag, asegurando que sólo se produzcan
La inestabilidad de estos ARNm se debe a que su secuencia las proteínas de esta región y eliminando temporalmente la
rica en A y U en la región 3’ no traducida (UTR) acelera la síntesis de las proteínas Pol.
eliminación de la cola de poli-A y, por ende, la degradación Existe un último mecanismo de control de la expresión
del ARNm. Otros ARNm son reconocidos en sus extremos de un gen: la presencia de moléculas de ARN complemen-
3’ UTR por endonucleasas que cortan el ARNm. Sin embar- tarias al ARNm que, al unirse a él, bloquean su transcrip-
go, la estabilidad de un ARNm cambia en respuesta a seña- ción. A este tipo de estrategias se le conoce como ARN
les extracelulares. antisentido o ARN de interferencia y regulan la expresión
Por ejemplo, el ARNm que codifica para las histonas, en de algunos genes tanto en células procariotas como euca-
la fase S del ciclo celular, periodo en el que se sintetiza el riotas (véase el capítulo 27, Terapia génica). Este mecanis-
ADN y se requiere de nuevas histonas para su empaqueta- mo se describió inicialmente en organismos inferiores, pero
miento, tiene una vida media de 1 hora; cuando termina la ahora se sabe que funciona en la mayoría de los organismos.
fase S, los ARNm se degradan en pocos minutos. De igual Los estudios experimentales con este tipo de moléculas
forma, si la síntesis de ADN es inhibida con algún fármaco, administradas exógenamente son de gran interés, ya que el
la acumulación de histonas libres induce la degradación bloqueo en la síntesis de una determinada proteína permite
de su ARNm. Por ello, la degradación del ARNm depende de entender su funcionamiento completo y comprender de
las señales que actúen en su extremo 3’, donde se encuentra la forma más integral su papel en los procesos evolutivos. Se
cola de poli-A. cree que las primeras células carecían de ADN y proteínas y
sólo contenían ARN. Estas células primitivas utilizaban el
Cola de poli-A mecanismo antisentido para regular sus funciones (cuadro
La adición de la cola de poli-A a un ARNm recién sintetiza- 7-1).
do ocurre en organismos eucariotes y se lleva a cabo en el

74 PARTE I • Conceptos básicos de biología molecular

Ejercicios de integración
1. La expresión de un gen en eucariotes se regula en dife- • En la regulación pretranscripcional participa la es-
rentes niveles: unos se realizan en el núcleo y otros en el tructura de la cromatina, donde la acetilación de
citoplasma. Indique cuáles suceden dentro del núcleo y las histonas desempeña un papel muy importante.
cuáles fuera de él. ______________________________________________
2. Indique si es falso o verdadero: • La temperatura y el medio ambiente son facto-
• Para la expresión de genes procariotes es necesario res clave en la expresión de genes en procariotes.
que el ARNm salga del núcleo y sufra el proceso de ______________________________________________
splicing ______________________________________ • Los operones son conjunto de genes presentes ex-
• La ARN polimerasa fosforila los factores transcripcio- clusivamente en mamíferos. ______________________
nales para que induzcan la expresión de los genes 3. Indique a qué tipo de organismo pertenecen las siguientes
______________________________________________ estructuras o procesos:

Eucariotes Procariotes

Operón Lac

Factores generales de la transcripción

Promotores

ARN polimerasa

Enhancer o potenciadores

Splicing (corte o empalme)

Histonas

Adición de la cola de poli A

Bibliografía
Alberts B., Johnson A., Lewis J., Raff M., Roberts K., Walter P. Con- Watson J., Baker T., Bell S., Gann A., Levine M., Losick R. Regu-
trol of gene expression. Molecular biology of the cell, 4ª ed. Nueva lación. Biología molecular del gen, 5ª ed. México, DF: Editorial
York: Garland Science, 2002:365-465. Médica Panamericana, 2005:370-491, 513-613.
Karp G. El núcleo celular y el control de la expresión génica. Biología Lewin B. Regulation of transcription: factors that activate the basal
celular y molecular, 6ª ed. México: McGraw-Hill, 2011:455-532. apparatus. Genes IX, 7ª ed. Nueva York: Oxford University Press,
Watson J., Baker T., Bell S., Gann A., Levine M., Losick R., Expre- 649-684.
sión del genóma Biología molecular del gen, 5ª ed. México, DF: Lodish H., Berk A., Zipursky S.L., Matsudaira P., Baltimore D.,
Editorial Médica Panamericana, 2006:370-491. Darnell J. Regulation of transcription initiation. Molecular cell
Pabo C.T., Sauer R.T. Transcription factors: structural families and biology, 4ª ed. WH Freeman and Company, 2000:341-403.
principles of DNA recognition. Ann Rev Biochem, 1992;61:1053-
1095.

Capítulo 8
Mutaciones

María Guadalupe Sánchez Parada / Belinda Claudia Gómez Meda

Introducción de la eficiencia de los mecanismos de reparación contra el
aumento en las lesiones al ADN. Cuando ambos factores
Todos los organismos están sujetos a sufrir cambios en su están incrementados, el resultado será una mayor genera-
ADN debido al metabolismo propio o por efecto del medio ción de mutaciones o mutagénesis (y carcinogénesis).
ambiente, lo que los hace presentar variabilidad genética Un gen tiene un rango de mutación normal, que se
dentro de una misma especie. Esta variabilidad se debe en expresa como el número de mutaciones nuevas por locus
gran parte a los procesos evolutivos a través del tiempo que por generación; este rango es de aproximadamente 1 × 10–6
involucran mutaciones estables. Estas mutaciones pueden mutaciones por locus por generación.
ser heredables si suceden en células germinales o desapare- Las mutaciones ocurren con mucha frecuencia, consti-
cer cuando el individuo muere, si se presentan en células tuyen la base de muchas enfermedades genéticas y heredi-
somáticas. Hugo de Vries, botánico alemán redescubridor tarias, e incluso del cáncer y de lo que se conoce como
de Mendel, describió por primera vez la presencia de muta- variación normal.
ciones en 1901. Posteriormente, Herman Joseph Muller
pudo relacionar la exposición a los rayos X con el aumento
de la tasa de mutaciones. Clasificación de las mutaciones
Las mutaciones pueden clasificarse desde diferentes enfo-
ques. Pueden ocurrir tanto en los genes como en los cro-
Mutación mosomas, en un tejido somático o en un tejido germinal, lo
que define una mutación somática y germinal, respectiva-
Aun cuando los procesos de replicación del material genéti-
mente.
co son muy precisos, no son perfectos, por lo que pueden
producirse errores que generan cambios. Una mutación es
Mutación germinal
una variación espontánea o inducida del genoma, un cam-
bio permanente y heredable en la secuencia del ADN, en Es aquella que ocurre en la línea germinal, las células sexua-
nucleótidos, o bien en la disposición del ADN en el genoma. les (óvulo y espermatozoide). Este tipo de mutaciones se
Estos cambios o mutaciones se deben a alteraciones de transmiten a la siguiente generación si una célula mutada
la información genética. Las consecuencias dependen participa en la fecundación. Las mutaciones germinales no
entonces del nivel de afectación: desde cambios en la dañan al individuo en sí mismo; esto es, un individuo con
secuencia nucleotídica, en los genes o los productos géni- un fenotipo normal y sin antecedentes familiares de altera-
cos, hasta en los tipos celulares involucrados. ciones fenotípicas puede ser portador de células germinales
Todos los seres vivos cuentan con sistemas de verifica- mutadas no detectadas, que sólo se detectarán si se incor-
ción y reparación de los procesos celulares. En el caso de la poran a un cigoto, de tal forma que al ser heredadas podrían
replicación del ADN existen sistemas de reparación especí- desencadenar una enfermedad.
ficos y bien coordinados, pero en ocasiones las lesiones del
ADN que escapan a esta verificación serán las causantes de Mutación somática
ocasionar mutaciones; por lo tanto, la efectividad de la Es aquella que ocurre en cualquier célula del cuerpo, excep-
lesión dependerá tanto de la tasa de división celular, como to en las células germinales, por lo que no se transmiten a la

75

76 PARTE I • Conceptos básicos de biología molecular

MUTACIÓN POR SUSTITUCIÓN DE BASE mutación puntual puede regresar a su secuencia original
mediante una mutación compensatoria, por medio de un
SECUENCIA ORIGINAL
3’ 5’
fenómeno denominado reversión; es decir, la aparición de
una segunda mutación que restaura parcial o totalmente el
A C G A A T G C T A C G A A T
fenotipo normal. Las mutaciones puntuales no se detectan
5’ 3’ con el microscopio, ya que el aspecto es igual en un cromo-
U G C U U A C G A U G C U U A soma portador de una mutación puntual que otro que porta
el alelo normal. Este tipo de mutaciones se detecta a nivel
Cis Leu Arg Cis Leu
molecular, mediante secuenciación directa del fragmento
de ADN alterado, que permite detectar cambios en un solo
SECUENCIA MUTADA nucleótido (véase el capítulo 17, Secuenciación).
3’ 5’ A continuación se presenta la clasificación de las muta-
A C G A A T G C T A C G T A T ciones puntuales.
5’ 3’
U G C U U A C G A U G C A U A Mutación por sustitución de bases
Se produce cuando en una secuencia de ADN se cambia un
Cis Leu Arg Cis lle
nucleótido por otro; por ejemplo, el cambio de un nucleóti-
Figura 8-1. Mutación por sustitución de un nucleótido. do de citosina por uno de timina. En esta clasificación se
incluyen las transversiones y transiciones mencionadas
anteriormente (figura 8-1).
descendencia, sólo a las células que se originen a partir de
ésta, y desaparece al morir el individuo. Si la mutación se Mutación por pérdida de nucleótidos o deleción
produce en un tejido cuyas células están en división, existe Se produce cuando en una secuencia de ADN se pierde un
la posibilidad de que surja un clon mutante que descontrole nucleótido y no se sustituye por ningún otro, por lo que se
la célula de tal forma que se pueda desencadenar una neo- modifica el marco de lectura abierto y, a partir de la muta-
plasia. En cambio, si la mutación ocurre en una célula que ción, la secuencia de nucleótidos (figura 8-2).
no volverá a dividirse, entonces su efecto será mínimo o
nulo (el mejor escenario posible). Mutación por inserción de nucleótidos
Las mutaciones que se producen en los casos de cáncer Se produce cuando en una secuencia de ADN se introducen
ocurren en aquellos genes denominados protooncogenes y uno o más nucleótidos que no pertenecen a dicha secuencia
genes supresores de tumores, que regulan la división celu- modificando el marco de lectura abierta alterando la
lar. Si estos genes mutan se induce un estado de división secuencias de aminoácidos a partir del sitio de la mutación
incontrolada que da lugar a un grupo de células denomina- (figura 8-3).
das tumor.
De acuerdo con la magnitud del material genético afec-
tado, las mutaciones suelen clasificarse en tres tipos: pun-
tuales o génicas, cromosómicas y genómicas. MUTACIÓN POR DELECIÓN DE BASE

Mutación puntual o génica SECUENCIA ORIGINAL
3’ 5’
Ocurre en un par de bases o en un número reducido de
A C G A A T G C T A C G A A T
bases adyacentes y puede deberse a modificaciones quími-
5’ 3’
cas del ADN que cambian una base nitrogenada por otra
diferente. La frecuencia con la que se ha descrito que suce- U G C U U A C G A U G C U U A
den estas mutaciones es en el orden de 1 × 10–10/par de
Cis Leu Arg Cis Leu
bases/división celular y 1 × 10–6/locus/generación. De
acuerdo con las bases sustituidas, las mutaciones puntuales SECUENCIA MUTADA
pueden clasificarse en dos grupos: transición (cambio de un 3’ 5’
nucleótido por otro de la misma clase; es decir, purina A C G A A T G C T A C G A T A
por purina o pirimidina por pirimidina), y transversión 5’ 3’
(cambio de un nucleótido por otro de diferente clase; es
U G C U U A C G A U G C U A U
decir, purina por pirimidina o pirimidina por purina). Tam-
bién pueden deberse a alteraciones durante el mecanismo Cis Leu Arg Cis Tir
de replicación del ADN, lo que provoca la incorporación de
una base errónea en una cadena sencilla de ADN. Una Figura 8-2. Mutación por deleción de un nucleótido.

CAPÍTULO 8 • Mutaciones 77

MUTACIÓN POR INSERCIÓN DE BASE MUTACIÓN POR INVERSIÓN DE BASE

SECUENCIA ORIGINAL
3’ 5’ SECUENCIA ORIGINAL
3’ 5’
A C G A A T G C T A C G A A T
A C G A A T G C T A C G A A T
5’ 3’
5’ 3’
U G C U U A C G A U G C U U A
U G C U U A C G A U G C U U A
Cis Leu Arg Cis Leu
Cis Leu Arg Cis Leu
SECUENCIA MUTADA
SECUENCIA MUTADA
3’ 5’
3’ 5’
A C G A A T G C T A C G A T A T A C G A A T G C T A C G A T A
5’ 3’
5’ 3’
U G C U U A C G A U G C U A U A U G C U U A C G A U G C U A U
Cis Leu Arg Cis Tir Cis Leu Arg Cis Tir

Figura 8-3. Mutación por inserción de un nucleótido. Figura 8-4. Mutación por inversión de un nucleótido.

Mutación por translocación de pares lo que propicia la terminación prematura de un polipépti-
de nucleótidos complementarios do, y da como resultado una proteína truncada (figura 8-6).
Se produce cuando en una secuencia se da un cambio de
Mutación de desplazamiento de marco de lectura
una purina por otra purina o una pirimidina por otra piri-
midina (en el caso de la transición) o de purina a pirimidina, Es aquélla en la que se añaden o eliminan (inserciones y
o viceversa (en el de la transversión). deleciones) un número determinado de bases diferente a
De acuerdo con el resultado en la secuencia de amino- tres, por lo que a partir del punto de la mutación, la lectura
ácidos de las proteínas, las mutaciones puntuales pueden del código genético se altera y propicia la adición de ami-
ser: noácidos diferentes a los que estaban codificados original-
mente (figuras 8-1 y 8-2).
Mutación neutra
Mutación de sentido equivocado
Es la que no tiene un efecto sobre el fenotipo, debido a que
el cambio en la secuencia de nucleótidos genera tripletes Es aquella en la que el cambio de codón que codifica para
que codifican para aminoácidos equivalentes como, por un aminoácido da como resultado uno de familia, grupo o
ejemplo, AAA (lis)→AGA (arg); ambos, aminoácidos bási-
cos. No hay tanta variación en las cargas y posibles enlaces MUTACIÓN SILENCIOSA
en el péptido resultante, aunque por la diferencia en la SECUENCIA ORIGINAL
estructura del aminoácido existirán ligeras variaciones en 3’ 5’
la estructura y la conformación final de la proteína, pero su A C G A A T G C T A C G A A T
función aún podría conservarse.
5’ 3’

Mutación silenciosa U G C U U A C G A U G C U U A

Es aquella en la que, a pesar de que existe una alteración en Cis Leu Arg Cis Leu
la secuencia de nucleótidos, no provoca cambios en el ami-
noácido que codifica. Esto sucede gracias a que el código SECUENCIA MUTADA
genético es degenerado y a que para algunos aminoácidos 3’ 5’
existe más de un codón, por lo que los cambios en los codo-
A C G A A T G C T A C G A A C
nes no modifican el resultado de la traducción (véase el
capítulo 6). (Figura 8-5). 5’ 3’
U G C U U A C G A U G C U U G
Mutación sin sentido Cis Leu Arg Cis Leu
Es aquélla en la que se cambia un codón que codifica para
un aminoácido por uno de terminación (UAG, UAA, UGA), Figura 8-5. Mutación silenciosa.

debido a una rotura doble. mosómico.1) (figura 8-7). polaridad diferentes que el original. Un ejemplo de inversión como orgánicas. al dar un giro de completos. siguiente: Mutación cromosómica MUTACIÓN POR INVERSIÓN Es aquella que involucra el reordenamiento cromosómico DE UN FRAGMENTO CROMOSÓMICO resultado de un cambio en la organización de segmentos Es aquella que ocurre cuando un segmento del cromosoma cromosómicos. Se trata de una deleción- inserción en la región (15q11q13) (figura 8-8). Su clasificación es la proteína. una 3 3 enfermedad que cursa con deficiencia mental. Mutación sin sentido. e incluso puede inhabilitar la se mediante análisis al microscopia. 8 8 MUTACIÓN POR TRANSLOCACIÓN 9 7 DE UN FRAGMENTO CROMOSÓMICO Se da por un cambio en la posición de un fragmento cro- Figura 8-7. El cambio en el péptido sí será evidente y drástico en su estructura. Un ejemplo es el síndrome de Prader-Willi. hipergluce- mia diabética e hipogenitalismo. es decir. Deleción cromosómica. existe intercambio de segmentos cro- . o la pérdida o ganancia de cromosomas se invierte en su orientación dentro de éste. INVERSIÓN CROMOSÓMICA MUTACIÓN POR DELECIÓN O PÉRDIDA DE UN FRAGMENTO CROMOSÓMICO Ocurre por la pérdida de un fragmento de cromosoma en 1 1 uno o varios sitios y se asocia con la ganancia en otro cro- 2 2 mosoma. una variante del síndrome del hombre lobo. Inversión de un fragmento cromosómico. Este tipo de mutaciones pueden detectar. que es una inversión en el cromosoma 8 (p11.78 PARTE I • Conceptos básicos de biología molecular MUTACIÓN SIN SENTIDO SECUENCIA ORIGINAL DELECIÓN CROMOSÓMICA 3’ 5’ A C G A A T G C T A C G A A T 5’ 3’ 1 2 1 U G C U U A C G A U G C U U A 3 2 Cis Leu Arg Cis Leu 3 SECUENCIA MUTADA 4 3’ 5’ 5 4 A C G A A T G C T A C G A C T 6 5 5’ 3’ U G C U U A C G A U G C U G A 6 7 Cis Leu Arg Cis CODÓN DE PARO 8 Figura 8-6. 9 Figura 8-8.2q23. 4 4 MUTACIÓN POR DUPLICACIÓN 5 5 DE UN FRAGMENTO CROMOSÓMICO 6 6 En esta mutación se produce una duplicación de un frag- mento cromosómico en uno o varios sitios de éste (figura 7 9 8-9). cromosómica es el síndrome de Ambras o hipertricosis universal congénita. y provoca anomalías funcionales tanto celulares 180°. y por ende. en su función y actividad final.

de bases (véase el capítulo 9). es decir. hay uno. etcétera. sino que sólo la induce. Translocación de un segmento cromosómico. influidas por el medio ambiente. en el material genético de las células vivas. Un ejemplo de translocación es la que ocurre en aproxi- crecimiento. táneas) o inducidas. Figura 8-10. La efectividad de HAPLOIDÍA una sustancia con capacidad mutagénica se determina por el aumento en la tasa de mutación espontánea que provoca. químico o biológico con la capacidad de o al genoma en su totalidad. Duplicación de un segmento cromosómico. tres o cuatro cro. mosómicos. CAPÍTULO 8 • Mutaciones 79 DUPLICACIÓN CROMOSÓMICA TRANSLOCACIÓN CROMOSÓMICA 1 I 1 2 II 2 1 2 3 III 3 3 4 IV 4 4 5 V 5 5 6 VI 6 6 4 1 I 5 2 II 6 3 III Figura 8-9. Éstas repre- madamente 5% de los pacientes con síndrome de Down: la sentan la base de la evolución. más frecuente es t(21q14q) (figura 8-10). Son sustan- brazos en un cromosoma en particular. ya que la Origen de las mutaciones mutación puede generarse en los mecanismos de repara- ción. tetraploidías (4n). ya sea en el mismo cromosoma. y se presentan como cias o agentes que tienen la capacidad de ocasionar cambios triploidías (3n). se encuentran las siguientes: Mutágeno POLIPLOIDÍA Un mutágeno es un agente que ocasiona que se incremente En esta mutación se produce un aumento en el número de la frecuencia en la que ocurren las mutaciones. . trisomía y tetrasomía. Mutaciones genómicas Mutaciones inducidas Son aquéllas en las que existe una segregación cromosómi. mutágenos. En esta mutación se encuentra una disminución en el Se ha descrito que más de la mitad de los carcinógenos son número de brazos en un cromosoma. es decir. cuando se cromosoma. los rayos ultravioleta. que afectan al número de cromosomas geno tanto f ísico. corregir este daño. Entre este tipo de mutaciones provocar mutaciones en una tasa mayor a la basal). Son aquellas provocadas por algún mutágeno (agente exó- ca errónea. respectiva. lo que no ocasiona directamente la mutación. entre Mutaciones naturales o espontáneas cromosomas homólogos o bien entre cromosomas diferen- Son aquellas que se producen en condiciones naturales de tes. al provocar alguna fractura nucleotídica o sustitución Las mutaciones pueden deberse a causas naturales (espon. dado que con la exposición se provo- mente). Un ejemplo de esta acción es el caso de mosomas (monosomía. ANEUPLOIDÍA La acción de los mutágenos debe entenderse por efecto directo que producen sobre la molécula de ADN o por las Es aquella en que se modifica el número de copias de un consecuencias que genera de forma indirecta. en lugar de haber dos copias de cada rebasa la capacidad de los mecanismos de reparación para tipo de cromosoma (lo normal). ca la formación de dímeros de timina.

protooncogenes en oncogenes). Esta individualidad es la base para la medicina tos pueden producir efectos adversos. de lo que Aunque existe modificación del triplete por alteración en la resultan diversas malformaciones orgánicas. • Inhibición enzimática. la deleción de un nucléotido que. la colchicina.80 PARTE I • Conceptos básicos de biología molecular De acuerdo con su naturaleza. ya que muchos loci se ciones. el • Falta de precursores. Estos compues. En el El proceso inicia cuando se producen alteraciones irre. pueden causar anormalidades morfológicas y versibles en la información genética que convierten genes funcionales. • Aberraciones cromosómicas: alteraciones en la canti- • Agentes químicos: compuestos que tienen la capaci. • Mutación: cambios en la secuencia nucleotídica en el zante. Carcinógenos • Características de la membrana alterada: desorganización del transporte a través de la membrana y su permeabilidad. entre otros. de la dieta. dad y estructura del ADN. sólo en algunos casos cambia en nes. SNP). un mismo compuesto actúa como tóxico y como tera. beta y gamma. Se desencadena como consecuencia de pruebas científicas. los hongos. • Alteraciones con las fuentes de energía: interferencia • Agentes biológicos: son organismos que tienen la con el ciclo del ácido cítrico o con la terminal del siste- capacidad de alterar la estructura del material genético ma de transporte de electrones. ADN. los virus. múltiples mutaciones que provocan un crecimiento anor- mal de las células hasta convertirse en masas de tejido En la organogénesis. • Alteración en la síntesis y función del ADN: trastornos en Ejemplos: los colorantes de acridina. inter. es otra situación en la que puede haber varia- Existen agentes que incrementan la frecuencia de las ción o diversidad genética. Pos. factores ambientales hacen que estas células La presencia de formas alélicas diferentes o polimorfismos. enzimas modificadas. Esta gran diversidad existente mutaciones en los organismos expuestos. como bioquímicos. y la acumulación de mutaciones ocasiona que esca. mico o las radiaciones electromagnéticas. dad de alterar la estructura del ADN al reaccionar direc. agentes alquilantes. El cáncer es un proceso genético en el que una serie de • Otros mecanismos: se ha sugerido una gran cantidad de mutaciones en secuencia dirigen a la malignización de una posibles mecanismos de los que se dispone de escasas célula en división. que pueden deberse a la sustitu- “monstruo”. el aminoácido que se codifica. Polimorfismos de un solo nucleótido prematurez e intoxicaciones neonatales. ácido nitroso. desde un punto de vista genético. y con frecuencia causan muerte en el útero. abortos. farmacológica y de vida perinatal denominados teratógenos. • Interferencia mitótica: trastorno en el ciclo celular. el los procesos de replicación. los mutágenos pueden tógeno. sin ser propiamente una mutación. Polimorfismos teriormente. • Agentes f ísicos: los agentes f ísicos son radiaciones que Los mecanismos conocidos o sugeridos de teratogenici- alteran la estructura y la secuencia del ADN. los teratógenos alteran el desarro- conocidas como tumores o neoplasias. tanto fisiológicos del futuro. tamente con ella o intercalarse entre los nucleótidos. al integrarse al ADN de este último. la nicotina. lo que las lleva a multiplicarse sin control. Estos agentes se entre los miembros de una población da como resultado el denominan carcinógenos o cancerígenos y pueden ser facto. el choque tér. el sulfato síntesis. si actúan cuando tiene lugar la embriogénesis. de cobre o el ácido fórmico. . y se enumeran a continuación: de ello son: la radiación ultravioleta. fieren en el desarrollo normal del embrión. Cada individuo cuenta con una constitución única Existen agentes químicos presentes en el ambiente con genéticamente determinada que le permite responder de capacidad de causar daño al ser humano durante el periodo manera diferente a la influencia ambiental. llo y pueden producir anomalías congénitas mayores. químicos o biológicos. con información genética alterada desarrollen más muta. en cualquiera de las etapas del desarro- llo. la formalina. químicos o biológicos. las partículas alfa. o la inserción de un nucleótido en la secuencia de ADN. tide polymorphisms. transcripción y traducción. capaces de inducir la iniciación del tumor. hecho de que estos individuos puedan sintetizar proteínas o res f ísicos. de su hospedero. etcétera. pos distintos. entre otros daños. normales en anormales (por ejemplo. viscosidades y presiones osmóticas. Ejemplos dad son complejos. los teratógenos (del griego. según la etapa en la que se produjo la exposición a ser f ísicos. periodo fetal. éste. Existen polimorfismos de un solo nucleótido (single nucleo- En particular. • Desequilibrio osmolar: alteraciones en la presión de los fluidos. la radiación ioni. caracterizan por tener cierto número de alelos comunes que pen a los mecanismos de reparación y a las restricciones de permiten caracterizar a una población respecto a fenoti- proliferación. que en ocasiones pueden estar asocia- das también a susceptibilidades para padecer alguna enfer- Teratógenos medad. secuencia de nucleótidos. teratos. sustratos y coenzimas para la bio- ácido bórico. En ocasio. las bacterias. el benzopireno. el LSD. y génesis. “producción”) son agentes químicos ción de un nucleótido por otro. en particular en el cerebro y los ojos.

4ª ed. gía molecular del gen. number of tandem repeats (VNTR). Thompson MW.H. 2006:422-513.V. Lewontin R. Overlap between mutagens and teratogens. de los organismos? 2..N. Miller J..H.A. Suzuki D.. ed. 1999:290-320. 1996:340-420.. Gann A. Suzuki D. 7ª ed. Lewis J. 1997.. MA: Jones & Bartlett Publishers. Ford J.R. ¿Cuál es el origen de las mutaciones? 3. que se utilizan como Preguntas de repaso 1.R. Madrid: McGraw-Hill Interamericana. Raff M. Bio. Embriología clínica.545-572.F. 4ª Griffiths A. Las repeticiones de secuencia las En el genoma existen regiones con repeticiones de secuen. Barcelona: Omega.J. 4ª Ferguson L. Witt Kolog. Montoya-Cabrera M. Biolo- Lewin B.. Moore K. México. Mutat Res. ed. Losick R.. Toxicología clínica.A. Persaud T. Genética en medicina. Genética.L. Walter P.. Johnson A.C. México.J. 2000:490- 590. 2001:215-310.B. 2002:250-320. Barcelona: Thompson & Thompson. Griffiths A. Baltimore.. Explique por qué las mutaciones por inserción o por de. Explique por qué en células germinales una mutación se transmite a la descendencia y en células somáticas no. Baker T. Mutat Res.H. Madrid: Médica Panamericana. ¿Qué importancia tienen las mutaciones en la evolución leción modifican el marco de lectura abierto. 10ª ed. . cuales oscilan entre 2 a 9 pares de bases son conocidas cias de 9 a 100 pares de bases conocidas como variable como short tandem repeats (STR)..... DF: logía molecular de la célula.F. 2004:192. Watson J. Miller J. Genes VI. McInnes R... McGraw-Hill Interamericana. Sloane R. 1992:225-350. ¿Cuál es la diferencia entre mutación y polimorfismo? 5. Nueva York: Oxford University Press. Madrid: McGraw-Hill. Lewontin R.396:1-8. Shepard T. Willard H. Masson. 5ª ed. 4. 1997... Lon- Bishop J. 2007. Sudbury. Catalog of teratogenic agents. Lewin B. teratogens. Gelbart W. Genes IX. 1992:322-430. Bell S. Levine M. Genetic toxicities of human dres: The Johns-Hopkins University Press. Bibliografía Alberts B.396:9-43. DF: Ed Francisco Méndez Cervantes. CAPÍTULO 8 • Mutaciones 81 Microsatélites marcadores moleculares. 234. Genética. Roberts K.

provocando transiciones de un par de bases GC por un par AT. base nitrogenada que no forma parte del ADN. Añaden grupos alquilo (etilo o plejos sistemas enzimáticos que buscan corregir las muta. Entre los componentes quí- pueden estar causadas por la exposición a agentes mutagé. no obstante. Son compuestos que se inter- Tipos de daño en el ADN calan entre los nucleótidos del ADN y producen adiciones Las lesiones en el ADN pueden ocurrir espontáneamente o de un solo par de nucleótidos. errores en el par de GC en un par de AT (figura 9-1A). ya que duran- sión celular. Estos factores consiguiente pérdida de un residuo de adenina o guanina. Las principales alteraciones que originan estos radi- tan con cambios fenotípicos y no presentan efectos adversos cales libres son la formación de una 8-oxo guanosina y el en el organismo. La depurinización consiste en la eliminación del enlace les e incluso por factores ambientales como la luz ultravio. Las modifica. proceso de la replicación del ADN. En todos los seres vivos el metabolismo normal aerobio vivencia del organismo. por lo que su persistencia se trata de evitar se reparan (figura 9-1B). que conducen a un daño genético importante. y el etidio. agentes químicos o la radiación ionizante. En condicio- El ADN está expuesto constantemente a agentes f ísicos. Agentes intercalantes. Agentes alquilantes. esta alterar la información genética del individuo. cierta información genética en la cadena de ADN recién sintetizada. peróxido de hidrógeno (H2O2) y radicales mecanismos complejos de reparación del ADN. micos intercalantes se encuentran la proflavina. En la mayo. La desamina- ción consiste en la pérdida de grupos amino. nes normales la desaminación de la citosina produce químicos o biológicos que pueden originar mutaciones y uracilo. es crucial y su modificación sería incompatible con la super. moléculas que causan daños oxidativos en el ría de las ocasiones los cambios en el ADN no se manifies. que se aparea de reparación del ADN. y ciertos tipos propensos a la alquilación es el oxígeno del carbono 6 de la de cánceres están relacionados con fallas en los sistemas de guanina formándose O6-metilguanina. produciendo así la conversión de un mos endógenos del metabolismo celular. Como consecuencia aparecen sitios apurínicos en el ADN ción. N-glucosídico entre la base nitrogenada y el azúcar. mediante mecanismos de reparación que implican com. Varias enfermedades humanas. ADN. modo incorrecto con la timina. Uno de los sitios más síndromes de inestabilidad cromosómica. La variabilidad genética también es necesaria te la replicación estos sitios no pueden unir una base com- para proporcionar adaptabilidad a las especies al cambiante plementaria a la purina original perdiéndose un nucleótido medio ambiente. ciertas infecciones vira. la depurinización y el daño oxida. base se aparea preferentemente con la adenina en lugar de ciones en el ADN pueden surgir por moléculas o mecanis. produce especies reactivas de oxígeno como los radicales tica lo más fielmente posible el organismo dispone de superóxido (O2). metilo) a las bases nitrogenadas y alteran su patrón de apa- ciones. Capítulo 9 Mecanismos de reparación del ADN Mayra Guadalupe Mena Enríquez / Lucía Flores Contreras Ana Soledad Sandoval Rodríguez / Juan Armendáriz Borunda Introducción se producen en el ADN de forma espontánea. hacerlo con la guanina. con la leta. La desaminación. Cuando estas adiciones se producen en un gen. hidroxilo. pero algunas mutaciones sí pueden llegar a glicol de timina que bloquean la replicación del ADN si no ser fatídicas. tivo de las bases nitrogenadas son algunos de los daños que puede producirse consecuencias importantes en la traduc- 82 . Para preservar la información gené. conocidas como reamiento bloqueando la replicación. e inclusive pueden provocar un descontrol en la divi. interfieren en procesos como la transcripción y la replica. la acridina nicos.

.. les con las bases convencionales. Además.. todo de timinas. lo que provoca errores frecuentes en el proceso de replicación... CAPÍTULO 9 • Mecanismos de reparación del ADN 83 A) A) H N Br O. dispone de diversos sistemas de reparación que se activan mientras que en su forma enólica lo hace con la guanina. Desaminación y daño oxidativo de las bases.. N N O O N N N N O Adenina Citosina Uracilo 5-BU en forma cetónica B) O O B) NH N 4 CH3 HN HN Br O- 3 6 O OH O 2 7 O 1 OH N N N H NH2 N. Esta enzima se une al enlace N-glucosídico que conducen a la formación de sitios dímero de timina y utiliza la energía de la luz para romper apurínicos. Este tipo de reparación no es muy común. duplicaciones y deleciones (véase el ya que hay algunos daños en el ADN irreversibles. La fo- capítulo 8). Sistemas de reparación del ADN na que contiene un bromo en el carbono 5. con lo que logra ADN. reparación por esci- se produce una transición GC-AT (figura 9-2). de producidos. reparación de emparejamientos erróneos (aparea- Energía ionizante... se incorpora la forma cetónica del bromouracilo. el 5BrU forma un par de base con la adenina. se produce Estos mecanismos de reparación se pueden clasificar en una transición AT-GC y si se incorpora la forma enólica cuatro categorías: reparación directa. mutaciones con cam. sión.. La radiación UV induce también directamente el daño en el ADN inmediatamente después transiciones GC–AT. transversiones. El 5-bromouracilo (5BrU) es análogo de la timi.. ya que altera la secuencia codificadora Figura 9-2. Análogos de bases. La exposición del ADN a la luz mientos incorrectos) y reparación de roturas de doble ultravioleta (UV) produce dímeros de pirimidinas. y transcripción. antiparalela (figura 9-3). En su forma Para minimizar el daño del material genético el organismo cetónica. responsables de efectos letales en la célula. bio de marco de lectura. cuando hay dos timinas consecutivas en la misma cadena de ADN. Si dependiendo del tipo de daño provocado en el genoma. sobre cadena. Debido a e impedir el uso del ADN como plantilla para la replicación que los análogos de bases presentan diferencias estructura. 5-BU en forma H cetónica Guanina ción de su ARNm. Son compuestos químicos con estructura similar a la de las bases nitrogenadas normales y den alterar la secuencia codificadora o reguladora de un gen se pueden incorporar al ADN en lugar de éstas. que vuelvan a formar complementariedad con la cadena nes ocasionan cambios permanentes en el ADN que pue. en su marco de lectura correcto. H N N dR dR 8-Oxo-hidroxiguanosina Glicol de timidina (8-Oxo-G) N N O. produce roturas del pirimidinas producidos por la luz UV. Otro tipo de enzimas que partici- . se aparean de forma in- correcta.. H N Figura 9-1. lo que Reparación directa interfiere con la unión normal de las bases nitrogenadas con La reparación directa involucra sistemas que eliminan la cadena complementaria. La radiación ionizante produce daño directo en torreactivación es el mecanismo de organismos procariotes las bases nitrogenadas del ADN e induce la gene-ración de mediante la enzima fotoliasa para reconocer los dímeros de especies reactivas de oxígeno. así como rompimientos en la doble cadena del los enlaces covalentes entre las pirimidinas. Análogos de bases.. La luz UV produce que se formen enlaces covalentes entre dos pirimidinas contiguas. H N H H N O H N N Desaminación N H. Estas lesio.

En Escherichia coli esta reparación la llevan a cabo cua- tro proteínas: UvrA. restauran la estructura original. El hueco que se genera por la rotura se rellena con A G T G T T C A C G ayuda de la ADN polimerasa I y. oxidación y desaminación. pan en este sistema de reparación son las alquiltransferasas. posteriormente. A G T G C G Reparación por escisión de nucleótidos El sistema de reparación por escisión de nucleótidos T C A C A A G T G C (nucleotide excision repair. radiación ionizante. UvrB separa la doble cadena de ADN. por último. Figura 9-4. con lo que se elimina la A G T G T T A C G base dañada. Reparación de dímeros de timina. UvrC se une a UvrB. UvrA y UvrB se unen para formar un complejo que se enzimas que eliminan los grupos alquilos de la guanina y encarga de reconocer las distorsiones en la cadena de ADN. Reparación por escisión de bases. Esta rotura genera sitios apurínicos o apirimi- dínicos reconocidos por una AP endonucleasa 1 (APE-1) T C A C A A G T G C que rompe el enlace fosfodiéster adyacente. El fragmento recién sintetizado forma el enla. la ADN polimerasa β adiciona los nucleótidos para rellenar el hueco generado empleando la cadena que no está dañada La endonucleasa corta el ADN como molde. a continuación. la ligasa sella la cadena que se sintetiza. una endo. La reparación se realiza hidrolizando el enlace glucosídico entre la base nitrogenada y el azúcar. sin la necesidad de alterar el Una vez que localizan el daño. Implica en primer lugar el reconocimiento del La polimerasa I rellena el hueco daño en la secuencia del ADN. BER) elimina del genoma las bases dañadas que se producen por alquilación. y la exonucleasa elimina los ce fosfodiéster faltante para su ligación gracias a la ligasa nucleótidos (figura 9-4). y el complejo corta a siete nucleótidos de Sistemas de reparación por escisión: reparación por escisión de bases y reparación por escisión de nucleótidos A G T G T T U A C G Reparación por escisión de bases El sistema de reparación por escisión de bases (base excision T C A C A A G T G C repair. generado y se liga el fragmento nucleasa hidroliza los enlaces fosfodiéster a cada lado y varios pares de bases de distancia de la lesión. esqueleto del ADN. Defectos en las proteínas de este T C A C A A G T G C sistema provocan el síndrome xeroderma pigmentosa (XP). UvrA se disocia del complejo. .84 PARTE I • Conceptos básicos de biología molecular Luz UV Dímero de T Fotoliasa A G T G T T C A C G A G T G T T C A C G A G T G T T C A C G T C A C A A G T G C T C A C A A G T G C T C A C A A G T G C Figura 9-3. y se elimina el fragmento de ADN de cadena sencilla que presenta la lesión. UvrB. UvrC y UvrD (UV resistant). NER) reconoce cualquier lesión que provoque una distorsión importante en la doble cadena del ADN. En este sistema intervienen las enzimas La glucosilasa elimina denominadas ADN glucosilasas. Posteriormente. de las cuales existen por lo la base dañada menos ocho tipos distintos específicos para cada lesión.

La radiación UV. CAPÍTULO 9 • Mecanismos de reparación del ADN 85 Distorsión en el ADN La glucosilasa a in gu ón 5´ 3´ restaura la base T T an la aci C T A G T T G C A C G C T A G A C G incorrecta d e xid G A C T G A O G A T C A A C G T G C A A G A T C T G C G A C T G A G A C T G A 3´ 5´ C T G A C T C T G A A T C T G A C T Unión con la adenina UvrA UvrB 5´ 3´ Figura 9-6. UvrB y UvrD. T T C T A G T T G C A C G C T A G A C G G A T C A A C G T G C A A G A T C T G C 3´ 5´ Realizan corte Sistema de reparación de los apareamientos erróneos UvrC UvrB 5´ 3´ Este sistema se basa en la reparación de las bases mal apa- T T C T A G T T G C A C G C T A G A C G readas y la corrección de los bucles que se producen en la cadena de ADN como consecuencia del deslizamiento de G A T C A A C G T G C A A G A T C T G C 3´ 5´ la polimerasa durante la replicación. respectivamente. En ausencia de daño. Por tanto. con actividad de endonu- C T A G T T G G A C G cleasa. Con ello. que como conse. UvrD. por lo que des- G A T C A A C G T G C A A G A T C T G C pués de que ocurra la replicación del ADN. una sustitución de C por A encuentran unidos a su represor LexA. La enzima Dam metilasa (ADN 5´ 3´ C T A G T T G C A C G T T C T A G A C G adenine methylation) se encarga de la metilación de la secuencia 5´-GATC-3´ en las dos cadenas. Este sistema de reparación también la lesión. Una base muy susceptible de oxidación por especies Este sistema responde a la acumulación de ADN de cadena reactivas de oxígeno (ROS) es la guanina. El ejemplo más clásico Liberan nucleótidos de este sistema de reparación es el que utiliza E. que en lugar de unirse a la citosina se unirá a una proteína RecA (recombination protein A) en procariotes. por acción de la ADN polimerasa I y la dos proteínas: la MSH y MLH. ayuda a libe. en el que participan tres proteínas: MutS. la radiación ionizante y algunos agentes químicos pueden provocar que las bases del ADN se oxi- Sistema SOS den. ligasa. aumentan los niveles de las pro- Las enzimas participantes en este sistema en procariotes teínas lexA. una enzima llamada ADN OGG1 recono. se rellena el hueco generado con el corte (figura 9-5). adenina y producirá un par erróneo G-A. y MutH tiene la capacidad de 3´ 5´ ADN polimerasa y ligasa discriminar la cadena que se tiene que reparar por el fenó- rellenan hueco meno de hemimetilación. lo que facilita su autoproteólisis. MutL permitirá que se forme el complejo de repara- 5´ 3´ ción y. UvrA. una helicasa. Una vez que se elimina el segmento con la base mal apareada. La pro- T T teína MutS reconoce las bases mal apareadas y se une a C A C G C T A ellas. Está cuencia se transforma en 8-oxo guanina (GO) u 8-hidroxi. esto ce a la adenina unida con la GO. recA. Posteriormente. mientras que la cadena de nueva Figura 9-5. El ADN de cadena en el genoma. activará MutH. la única cadena 3´ 5´ metilada será la parental. análogos de MutS y MutL. los genes SOS (save our soul) se nará. SOS (figura 9-8). que se une al ADN de cadena sencilla (ADNss) e interactúa En humanos. Un defecto en este sistema provoca ines- tabilidad cromosómica asociada a enfermedades como el Sistema 8-oxo guanina cáncer de colon. con el represor LexA. Este error ocasio. mecanismo de reparación que se activa en respuesta a SOS . Sistema de reparación GO. sencilla cuando el proceso de replicación se bloquea. integrado por más de 40 genes. síntesis no estará metilada y se reconocerá como la cadena que se ha de reparar. a su vez. coli. MutL y MutH. la polimerasa III añade la base distancia en dirección 5´ y cuatro en dirección 3’ del sitio de correcta (figura 9-7). que son activados por la guanina. puede encontrarse en células eucariotas. después de la replicación. Reparación por escisión de nucleótidos. el primer son mutM y mutY (metil-directed mismatch repair). elimina la base incorrecta induce la transcripción de los genes que contienen la caja (adenina) y la sustituye por la citosina correcta (figura 9-6). además producirá la rotura de la cadena donde se G A T C A A C G T G C A A G A T C T G C localiza la base mal apareada. error que si no se repara se transmitirá a la sencilla es una señal de activación para la proteína RecA siguiente generación como un cambio permanente. donde participan rar el fragmento y.

es la reparación por escisión de nucleótidos (NER). A continuación. RAD52. Reparación de los apareamientos erróneos. Con ello.86 PARTE I • Conceptos básicos de biología molecular La proteína MutS reconoce la base mal apareada. por secuencias homólogas. Con ayuda de al grupo de epistasia de RAD52 (radiation sensitive mutant RAD54 invade la hélice homóloga que sirve como molde 52). la proteína de replicación este sistema se induce por la necesidad de tener una copia A (RPA) se une al ADN de cadena sencilla e interactúa con de ADN correcta que sirva como molde para restaurar la RAD52. Si el sistema NER no es suficiente para la reparación BRCA2 (cáncer de mama 1 y 2). RAD51. RAD51 des- del ADN. éste es desplazado por BRCA2. ATM) que recluta el complejo MRN para que se una al ADN y. Además. por su acti- Reparación por recombinación homóloga vidad de exonucleasa 5’-3’. que atrae a RAD51. En este sistema Por último. cadena sencilla. RAD57. metila ambas cadenas 3´ 5´ cadena hija C T A G T T G C A C G A G C T A G A C G G A T C A A C G T G C T C G A T C T G C 5´ 3´ cadena molde Figura 9-7. primer paso para la reparación por recombinación homólo- ga involucra la activación del gen de la ataxia-telangiectasia Reparación de roturas de doble cadena mutado (ataxia telangiectasia mutated. En humanos. RAD51 se une a la cadena sencilla y forma una de reparación están involucrados los genes que pertenecen nucleoproteína filamentosa con el ADN. como RAD50. RAD55. recombination 11). procesa los extremos donde ocu- Es un sistema de reparación preciso que actúa durante la rrió el daño dejando expuestos los extremos 3´ en forma de fase S del ciclo celular. para restaurar el fragmento dañado (figura 9-9). información perdida en la cadena dañada. que tra. Durante el proceso de replicación. El DC dependiente de mutagénicos. se induce al sistema de reparación Umu. las concentraciones de LexA disminuyen y se empeña un papel primordial en los mecanismos de recom- expresan genes como sulA. La recombinación homóloga implica gas- pensable para el inicio del ciclo celular) y detiene la división to e hidrolisis de adenosín trifosfato (ATP) para el inter- celular. cambio de la cadena de ADN. intervienen otros genes. se une la MutL que activa a MutH para que corte en los sitios GATC de la cadena hija 3´ 5´ cadena hija C T A G T T G T A C G A G C T A G A C G G A T C A A C G T G C T C G A T C T G C 5´ 3´ cadena molde (Metilada) Eliminación de la base mal apareada y la polimerasa añade la base correcta T T G T A C G A G C T A G 3´ 5´ cadena hija C T A G A C G G A T C A A C G T G C T C G A T C T G C 5´ 3´ cadena molde La Dam metilasa. umuD y umuC (UV-induced binación homóloga para la reparación de roturas en la doble mutagenesis). RAD50 y NBS1 (Nijmegen breakage syn- tará de corregir el daño sin un encendido total de la vía drome 1). Alteracio- RAD59 y el complejo MRN formado por MRE11 (meitoic nes en las proteínas que participan en este sistema provo- . como BRCA1 y SOS. cadena del ADN. La proteína SulA se une a FtsZ (molécula indis.

FANCE. ataxia- Inicia la respuesta SOS telangiectasia. Existen al Muchas de las anomalías cromosómicas que generan enfer.3 a 1%. como roturas. medades en la especie humana aumentan con la edad. El síndro- Figura 9-8. caracterizada por un conjunto de malformaciones de los extremos es necesario el complejo ARTEMIS/ADN. La anemia de Fanconi es una enfermedad con heteroge- de reparación neidad no sólo clínica sino también genética. BLM es un miembro del complejo BASC y contiene otros miembros que participan en los procesos de Unión de extremos no homólogos reparación. ATM y el complejo MRN. ya que úni. caracterizados por una alta frecuencia de altera- G A C T G A del ADN ciones cromosómicas en edades tempranas. Estas proteínas participan can el síndrome de Bloom. que se describirán más adelante. replicación y recombinación. alteraciones Repara G A C T G A T T C C G A A G A el ADN esqueléticas y neoplasias. aunque estas cifras depen- Enfermedades humanas asociadas den del grupo étnico de que se trate así como del grado de al funcionamiento de los sistemas consanguinidad. me de Bloom lo causan mutaciones en el gen BLM. xeroderma pigmentoso. con una prevalen- PKcs. en la respuesta temprana al daño celular y promueve el pos- nente principal de este sistema es la proteína de cinasa terior reclutamiento de proteínas de reparación en las hor- dependiente de ADN (ADN-PKcs). aplasia medular progresiva. cadera y rodillas. dedos. Las células son hipersensibles a la luz UV. que consta de tres quillas de replicación. y predisposición tumoral –más de 60% de los saIV. Sistema SOS. La prevalencia de la anemia de Fanconi es de 1 a 5 está muy conservado evolutivamente. ción homóloga. Los síndromes clásicos de inestabilidad cromosó- mica son: síndrome de Bloom. KU80 y la subunidad catalítica ADN- PKcs. roturas cromosómi- C T G A C T A A G G C T T C T cas y reordenamientos. FANCD2. entre otras. BRCA1. cia de 80%. Entre las alteraciones más 9-10). pues FANCB. A nivel celular se presentan inter- cambios entre cromátidas hermanas. tétradas. Este sistema es uno de los que pueden participar cuando se RAD51. también existen síndromes de inesta- bilidad cromosómica cuyo patrón de herencia es autosómico Se bloquea la replicación recesivo. nacimientos por cada millón de habitantes y se encuentra con una frecuencia de 0. anemia de Fanconi. enanismo. manchas café con leche. frecuentes destacan la baja estatura. Estas subunidades reconocen los cortes en el ADN y Anemia de Fanconi mantienen los extremos en proximidad para su procesa. La expresión clínica de cada una de estas entidades es varia- G A C T G A proteinas RecA ble y se observa un incremento en la frecuencia de neopla- C T G A C T sias. que codifica una proteína de la subfamilia RecQ de las ADN helicasas dependientes de ATP. como PCNA. los cuales presentan anormalidades estructurales de los cromosomas. retraso mental leve e hipogonadismo en se ha encontrado en algunas procariotas. Se activan las proteínas Síndrome de Bloom RecA Presenta características clínicas. Este proceso se lleva a ciones renales y cardiacas. la hidroxiurea (HU) y agentes alquilantes. Es una enfermedad genética autosómica recesiva ligada al miento y reunión. cabo principalmente en mamíferos. lo que sugiere que varones. FANCC. antebrazos y el dorso de las manos. menos 11 genes diferentes involucrados en la FA (FANCA. fotosen- sibilidad. manchas café con leche. Para que se lleve a cabo el alineamiento sexo. anomalías esqueléti- camente une los extremos rotos. congénitas. también microcefalia. Sin embargo. con actividad de nucleasa y el complejo XRCC4/liga. lo que conlleva la pérdida cas en antebrazos. puentes intercromosómicos. replicación y reparación por recombina- anemia de Fanconi. malforma- de nucleótidos en el punto de unión. Este proceso puede tener varios errores. FANCD o BRCA2. que se encarga del paso final de la ligación (figura cánceres son hematológicos. . como eritema telangiectá- sico en la cara. CAPÍTULO 9 • Mecanismos de reparación del ADN 87 ADN los mecanismos de reparación tienden a fallar con más fre- polimerasa cuencia. Estas enferme- dades implican defectos en los mecanismos de reparación C T G A C T A A G G C T T C T G A del ADN. subunidades: KU70. El compo. También actúa producen roturas en la doble cadena de ADN. sin embargo. la ataxia-telangiectasia y la en la reparación.

se leucemias y carcinomas. inestabili- inestabilidad genómica y un riesgo elevado de presentar dad genómica y predisposición al cáncer. Reparación por recombinación homóloga. FANCJ. acortamiento telomérico y alto nivel de especies reacti- doble cadena mediante recombinación homóloga. defectos en los puntos de control del ciclo celu- papel de esta enfermedad en el procesamiento de roturas de lar. como p53 o . La ataxia-telangiectasia es causada por defectos en el Ataxia-telangiectasia gen supresor de tumor ATM. FANCI. doble cadena. inmunodeficien- cualquiera de los genes de anemia de Fanconi conllevan cia. hipogonadismo. envejecimiento prematuro. El descubrimiento de BRCA2 presenta inestabilidad cromosómica. A nivel celular.88 PARTE I • Conceptos básicos de biología molecular 5´ 3´ C T A G T T G C A C G T T C T A G A C G A G A T C A A C G T G C A A G A T C T G C T 3´ 5´ Doble cadena de ADN 5´ 3´ A C G T A G T A A T G C T A T C T A T C G T G C A T C A T T A C G A T A G A T A G C 3´ 5´ 5´ 3´ 3´ A C G T A G T A A T C T A T C G T G C A T G A T A G A T A G C 3´ 3´ 5´ 5´ 3´ C T A G T T G C A C G T T C T A G A C G A G A T C G T A G A T C T G C T 3´ 5´ Recombinación homóloga 5´ 3´ A C G T A C G T G C A T C T A T C G T G C A T C A T A T A G A T A G C 3´ 3´ 5´ 5´ 3´ C T A G T T G C A C G T T C T A G A C G A G A T C G T A A T G G A T C T G C T 3´ 5´ Reparación del fragmento 5´ 3´ A C G T A C G T G C A T C T A T C G dañado T G C A T C A T T A C G A T A G A T A G C 3´ 5´ 5´ 3´ C T A G T T T A A T G C T A T C T A T C G G A T C A A A T T A C G A T A G A T A G C 3´ 5´ Figura 9-9. FANCF. hipersensibilidad a las como uno de los genes de la anemia de Fanconi fortalece el radiaciones. En respuesta a las roturas de Es un síndrome genético con un complejo fenotipo clínico. Los defectos en neuronal progresiva. vas de oxígeno. FANCG. ATM fosforila rápidamente una serie de pro- Las principales características clínicas son degeneración teínas involucradas en vías de señalización. telangiectasia ocular. FANCL).

relacionadas con síndro. CAPÍTULO 9 • Mecanismos de reparación del ADN 89 Ruptura de ADN 5´ 3´ A C G T A G T A A T C T A T C G T G C A T C A T T A G A T A G C 3´ 5´ Se une KU70/80 5´ 3´ A C G T A G T A A T C T A T C G T G C A T C A T T A G A T A G C 3´ 5´ KU recluta a ADN-PKcs 5´ 3´ A C G T A G T A A T C T A T C G T G C A T C A T T A G A T A G C 3´ 5´ Finalmente Xrcc4/ligasa IV unen los extremos 5´ 3´ A C G T A G T A A T C T A T C G T G C A T C A T T A G A T A G C 3´ 5´ ADN reparado 5´ 3´ A C G T A G T A A T G C T A T C T A T C G T G C A T C A T T A C G A T A G A T A G C 3´ 5´ Figura 9-10. como elevada predisposición a desarrollar cáncer de piel. trastornos neurológicos y una pigmentoso. más una variante. por lo que las mutacio- una elevada sensibilidad a todas las fuentes de radiación nes en los genes XPA-XPG son las responsables de la ines- UV. . tabilidad genómica presente en los pacientes con xeroderma maturo. lesiones oculares. XPV. El xero- RAD50-MRE11-NBS1 y BRCA1. Mdm2. de los ocho genes XPA-XPG. Las personas afectadas presentan envejecimiento pre. Unión de extremos no homólogos. existen nueve subtipos clínicos de la enfermedad. así como otras proteínas de reparación. por lo tanto. derma pigmentoso es causado por defectos en uno o varios mes de inestabilidad cromosómica. Xeroderma pigmentoso Estos genes codifican para las proteínas que participan en Es una enfermedad cutánea multigénica caracterizada por los mecanismos de reparación NER. que incluyen varias manifestaciones cutáneas y neurológicas.

Madrid: Médica Panamericana. Sinha R. Sudbury: Jones & Bartlett Publishers. 3.4:338-344. Baker T. 4ª ed.. Programa de actualización continua para médicos generales.. 2008. Genes IX.. J Nucleic Acids. genesis in Escherichia coli. Johnson A. C. Academia Nacional de Medicina. Tyagi M. Mencione los agentes físicos y químicos que producen daños en el ADN. Inducible SOS response system of DNA repair and muta. Raff M. Gann A. Reparación directa Daños que involucran una sola base.. Biología Janion C.L. México.2010:592980. 7ª ed. Levine M.. Miller J. 2006. Losick R. 1999. Gelbart W. Relacione el sistema de reparación con el tipo de lesión que repara. Roberts K.. Barcelona: Omega.. .. 2004. Martín A. 5ª ed. Alteraciones en las proteínas que participan en el sistema las proteínas que participan en el sistema de reparación: por recombinación homóloga provocan: a) BER a) Síndrome de Bloom b) NER b) Síndrome de Down c) Sistema SOS c) Xeroderma pigmentoso d) Recombinación homóloga d) Ninguna de las anteriores Bibliografía Alberts B. DF: Intersistemas. Sistema SOS ADN glucosilasas Reparación directa Sistema UvrA.. Madrid: McGraw-Hill.. Int J Biol Sci.P. 2002.-52-54. El xeroderma pigmentoso está causado por defectos en 5.90 PARTE I • Conceptos básicos de biología molecular Ejercicios de integración 1. BRCA2 Recombinación homóloga LexA y RecA Reparación por escisión de bases (BER) Fotolipasa 4. Relacione el sistema de reparación con las enzimas que participan. Kumar A. Suzuki D. repair. 2007.P. 2. Richa. Walter P. Reparación por escisión de bases (BER) Bases mal apareadas. Lewis J. 2010.. Rastogi R. Lewin B... Bio. RPA.B. Reparación de apareamientos erróneos Daños por acumulación de ADN de cadena sencilla. 2ª ed. Recombinación homóloga Dímeros de timina.. Lewontin R. Watson J. molecular del gen.. Sistema SOS Roturas de doble cadena. Bell S.. mechanisms of ultraviolet radiation-induced DNA damage and Griffiths A. Genética. D Reparación por escisión de nucleótidos (NER) RAD51. B. Molecular logía molecular de la célula..

Parte II Metodología del ADN recombinante Contenido Capítulo 10 Manejo de muestras para estudios moleculares Capítulo 11 Extracción de ácidos nucleicos Capítulo 12 Electroforesis Capítulo 13 Enzimas de restricción Capítulo 14 Vectores de clonación y expresión Capítulo 15 Técnicas de hibridación Capítulo 16 Reacción en cadena de la polimerasa Capítulo 17 Secuenciación de ácidos nucleicos y microarreglos Capítulo 18 Polimorfismos y huellas de ADN .

.

De aquí surgen dos alternativas: estudio de ácidos nósticos. el establecimiento de diagnósticos. los resultados de un individuo puede ser cualquier célula nucleada. Capítulo 10 Manejo de muestras para estudios moleculares Jesús Javier García Bañuelos / Blanca Estela Bastidas Ramírez Elizabeth Gordillo Bastidas / Daniela Gordillo Bastidas Introducción dología utilizada. el monitoreo de tratamientos. la detección de bacterias y virus. La implementación y realización de las técnicas molecula. pronósticos y tratamientos certeros. Sin embargo. (ADN) o la expresión de sus genes (ARN) en una situación tras biológicas que serán sometidas a estudios moleculares. que no se ve afectado por la edad ni por variables metabóli- res debe llevarse a cabo por personal altamente capacitado cas. El conocimiento muestra no es el mismo. Sin que se obtengan no sólo dependerán de la prueba molecu. En la figura 10-1 se señalan algunos casos en los el conocimiento de los mecanismos normales y las alteracio. económica o costosa. tales: selección. Manejo de muestras Todas las células de un individuo poseen el mismo genoma. Por ello. El manejo de muestras implica tres pasos fundamen- aplican con diversos fines. entre otros. la meto. bien sea simple o sofisticada. obtener y preservar la muestra para obtener resultados fidedignos. Asimismo. sino también de la toma y conservación miento menos invasivo y la menor cantidad de riesgos e de la muestra de manera apropiada. En general el personal encar- recombinante incluyen los análisis en que el material de inte. así como proponer nuevas alternativas terapéuticas y preventivas. toma y preservación de la muestra. no será confiable si no se parte de una muestra Los estudios de biología molecular o tecnología del ADN manejada de forma adecuada. u órgano específicos. como la identificación de indi. viduos. interés. Además. el transporte y del procesamiento de la rés son los ácidos nucleicos: ADN y ARN. estos análisis permiten profundizar en exógenos. embargo. Estudio de ácidos nucleicos de un individuo Este capítulo pretende brindar al lector un panorama En un individuo se puede estudiar su estructura genómica general de los lineamientos básicos para el manejo de mues. por lo que es importante que cada de las características y propiedades de estas dos biomolécu. Estas metodologías se neos. Para este tipo de estudios la molécula de interés es el ADN genómico que se encuentra en el núcleo de las células. Selección de la muestra: ción de carga viral. específicos y nucleicos del individuo o detección de ácidos nucleicos actuales. Se explica cómo seleccionar. hay que elegir la muestra que involucre el procedi- lar que se emplee. ¿qué muestra debo estudiar? El análisis molecular constituye una herramienta indis. 93 . De este modo. gado de la toma. y el estudio de mutaciones y polimorfis- mos génicos. se mencionan ANÁLISIS DE LA ESTRUCTURA GENÓMICA algunos ejemplos específicos y las áreas de aplicación del DE UN INDIVIDUO análisis molecular. de una enfermedad. uno de los implicados en el proceso conozca los cuidados y las ha permitido la implementación de técnicas utilizadas en las consideraciones necesarios para evitar resultados erró- investigación y en la práctica médica. incomodidad para el paciente. la determina. Debe elegirse la muestra que contenga el ácido nucleico de pensable en el área de ciencias de la salud y establece diag. que pueden aplicarse los análisis moleculares y el tipo de nes de los procesos celulares que participan en el desarrollo muestra adecuado para tal fin. la muestra para estudiar la estructura genómica en el área de biología molecular.

Por esto. detectar polimorfismos exprese el gen de interés: si se expresa en leucocitos. en un embrión o en mienta económica. microorganismos. sino que cada tejido u órga. analizar mutaciones y establecer el diagnóstico de hígado. como tal. al alcance de todos. por ejemplo. la insulina se expresa en las tuberculosis es un buen ejemplo. o en estado de euforia o tristeza. genes en un momento determinado. tante. Las únicas células de este tejido que poseen de uso común. son los leucocitos. a partir de los que dicten o modifiquen estrategias de tratamiento clínico cuales es posible extraer ADN genómico. la muestra indicada será la biopsia del tumor. y si se expresa en tejido tumo- enfermedades genéticas. que brinde resultados núcleo. una biopsia del tejido sospechoso. microbiológico puede requerir hasta cinco semanas. Sin embargo. El análisis del ADN de una persona es importante. Para este análisis la molécula de interés es ARN mensajero (ARNm). y aún no supone una herramienta de diagnóstico plaquetas. ésta contiene glóbulos blancos. el motivo. por ejemplo. mien- tral.94 PARTE II • Metodología del ADN recombinante ESTRUCTURA EXPRESIÓN DETECCIÓN DE GENÓMICA GÉNICA GENOMAS EXTRAÑOS MUTACIONES POLIMORFISMOS VHB VHC FIBROSIS DIABETES DIABETES VIH QUÍSTICA CIRROSIS CIRROSIS PAPILOMA VIRUS HEMOFILIA CÁNCER CÁNCER M. una biopsia de hígado. la regulación temporal significa que tras que las técnicas moleculares permiten su detección en la expresión génica depende del momento metabólico en el 24 a 48 horas. y la regulación espacial representa la base del ADN procedente de cualquier fuente ajena al paciente. y por ende ADN. es recomendable que los estudios moleculares no individuo. ya La muestra de elección dependerá del tejido donde se que permite identificar individuos. Las técnicas de biología molecular permiten la detección cial y temporal. la mues- génicos de predisposición o protección a ciertas enferme. genómica de un individuo es sangre periférica con anticoa. El estudio de la expresión génica de un individuo revelará los cambios bioquímicos que experimenta el orga- Detección de ácidos nucleicos exógenos nismo en respuesta a una situación particular o momento ADN EXÓGENOS metabólico. la muestra génica resulta elemental en investigación para evaluar la dependerá de la historia natural del microorganismo infec- respuesta a una variable específica y contribuir al conoci. TUBERCULOSIS DISTROFIA DISTROFIA OBESIDAD MUSCULAR MUSCULAR ARTRITIS ADN/ARN exógeno ADN ARNm LEUCOCITOS SUERO LEUCOCITOS EXUDADO VAGINAL LEUCOCITOS DE SUERO LÍQUIDO SANGRE BIOPSIA CEFALORRAQUÍDEO PERIFÉRICA LÍQUIDO SINOVIAL Figura 10-1. glóbulos rojos y complejo. de la diferenciación celular. Por otro lado. rápida y específica. La expresión génica se regula de manera espa. tra será sangre periférica con anticoagulante. Por tal un anciano. Mycobacterium cabo su función. Selección de muestras para estudios moleculares. en la práctica médica. etc. en estado de ayuno o posprandial. sensible. por lo que constituyen una se expresan en todos los tejidos. La muestra de elección para el análisis de la estructura miento de la fisiología y patología humanas. Estudiar la expresión Para la detección de genomas exógenos. el estudio de la expresión de genes es gulante. si lo hace en el dades. es el resultado de la expresión de sus se apliquen en forma indiscriminada. ya que es una bacteria de células beta del páncreas. Esto significa que los genes no como bacterias y virus de ADN. de manera significativa. Sin embargo. la albúmina en los hepatocitos. el cultivo microbiológico es una herra- mo. ral. para la identificación de otros que se encuentre el individuo: en un individuo sano o enfer. por ejemplo. si se desea conocer qué tanto se expresa el gen de la telomerasa en ESTUDIO DE LA EXPRESIÓN GÉNICA DE UN INDIVIDUO un tumor de cáncer de pulmón. en la detección del virus de la hepatitis B . herramienta útil para el diagnóstico molecular de enferme- no expresa solamente los genes necesarios para llevar a dades causadas por microorganismos. la crecimiento lento cuyo diagnóstico mediante cultivo mielina en las células de Schwann del sistema nervioso cen.

En la toma de muestras para estudios moleculares deben Para la obtención de ARN el procesamiento debe ser. el dietilpirocarbona. por lo que es necesario que se dos nucleicos adecuado. de considerarse algunos factores y recomendaciones que se preferencia. material de vidrio y de metal puede someterse a temperatu- ra de 230°C durante 8 horas para inactivar nucleasas. su historia natural permite establecer que el espéci- men adecuado es suero procedente de una muestra de san. El ARN EXÓGENOS ácido etilendiaminotetracético (EDTA) es un quelante de La detección de ARN exógeno a través de estudios molecu. no es indispensable el estado de ayuno. por lo que se recomienda tomar de infección por el VHB en estadio no replicativo. ya que puede interferir en procedimien- (VHC) mediante estudios moleculares suponen una herra. que se someterán a estudios moleculares. los hongos y las células muertas de la piel son re del uso de equipos costosos. y se transfiere a un tubo nuevo Las nucleasas (ADNsas y ARNsas) son enzimas altamente y estéril. tomarse una muestra de sangre periférica en un tubo nue- vo. las la muestra? muestras pueden guardarse a 4ºC hasta por cinco días sin que afecte de manera significativa a la cantidad de ADN . El paquete globular se desecha de acuer- destine para análisis molecular. tos posteriores. La toma de cos. Si la muestra es sangre periféri. 20 minutos). estériles y desechables. ADN o ARN de biopsias La expresión génica constituye el fundamento de la diferen- Uso de guantes y cubrebocas ciación celular. Enseguida. debe VHC. estéril con anticoagulante. por lo que el estudio de la expresión génica Las ADNsas y ARNsas se encuentran en la saliva y en el de un individuo involucra la toma de una biopsia del tejido de sudor. como para llevar a cabo la bús- . CAPÍTULO 10 • Manejo de muestras para estudios moleculares 95 (VHB). ARNsas. gena (ARN del huésped). biopsia no es un procedimiento simple sistemático. la muestra se centrifuga a 3 000 rpm durante 10 Uso de material libre de nucleasas minutos. sia hepática podría servir tanto para evaluar el grado del cies de trabajo con agentes descontaminantes y utilizar daño hepático mediante el estudio de la expresión de colá- inhibidores de ARNsas. por todo el organismo a través del torrente sanguíneo. La muestra de elección dependerá. El suero se somete al proceso de extracción de áci- estables que degradan ARN. de inmediato. o bien se almacena a –20ºC hasta garantice la ausencia de estas enzimas en el material que se su procesamiento. No se recomienda nodeficiencia humana (VIH) y del virus de la hepatitis C el uso de heparina. es recomendable el ayu- no para evitar que la alta concentración de lípidos de la Se toman 3 ml de sangre periférica en un tubo seco. Para la obtención de ADN. de la historia natural de la partícu. calcio y es el anticoagulante empleado con más frecuencia. Es un método Limpieza total invasivo que representa un riesgo para el paciente y requie- Las bacterias. por ejemplo. ADN o ARN de glóbulos blancos la viral infectante. en el caso fuentes ricas en ARNsas. lares es una práctica continua en investigación. se sabe que éste es un virus hepatotrófico que al to de sodio (DEPC) u otros agentes ofrecidos por diversas replicarse produce lisis celular y que los virus se diseminan casas comerciales. La gre periférica sin anticoagulante. la Ambos pueden utilizarse para toma de muestras de sangre detección y la cuantificación del ARN del virus de la inmu. que deben ser nuevos. una biop- las muestras en un ambiente higiénico. como la reacción en cadena de la polimerasa mienta elemental en el monitoreo de su tratamiento. Anticoagulantes gulante para la obtención de suero mediante centrifugación. También puede realizarse la búsqueda de ácidos su cambio frecuente cuando se trabaja con ácidos nuclei. Se deja muestra interfiera con la extracción de los ácidos nucleicos. al igual que en la determinación de ADN. limpiar las superfi. sin embargo. como lo son puntas y tubos do con las normas sanitarias de seguridad para desechos de de plástico. como el fenol. casos específicos de aplicación clínica. (PCR). y en algunos Otro anticoagulante muy común es el citrato de sodio. la muestra de elección es sangre periférica sin anticoa. por lo que es obligatorio usar guantes y cubrebocas y interés. Tanto en el caso del VIH como en el del Para aislar ADN o ARN a partir de glóbulos blancos. EDTA o citrato de sodio. ca. nucleicos exógenos en un tejido específico. El material biológico contaminante. Se dispone de diversas sustancias que inhiben la cascada de la coagulación y que se utilizan en la toma de muestras. Por ejemplo. se separa el suero. para evitar la degradación por mencionan a continuación. por ello. cantidad de sangre dependerá del método de extracción de ácidos nucleicos que vaya a emplearse y de la cantidad Toma de la muestra: ¿cómo debe tomarse de éstos que se requiera. a temperatura ambiente el tiempo mínimo necesario para permitir la formación del coágulo (máximo. sino que debe realizarlo personal médico experto. ya que la ingesta de alimento no modifica la concentración ni la estructura de ADN o ARN de suero los ácidos nucleicos.

líquido cefalorraquídeo o líquidos de terior extracción de ADN pueden mantenerse a temperatura punción. deben mantenerse a –70ºC o en nitrógeno líquido. las biopsias se emplean generalmente utilizando métodos económicos y sencillos de extracción. a –20ºC frescas. las muestras debe permanecer en reposo total después del procedimien.96 PARTE II • Metodología del ADN recombinante queda del virus (ADN viral). Los tejidos contienen muestras no se procesan o conservan de forma adecuada ARNsas endógenas que pueden inactivarse a baja tempera. lo que los convierte en indetectables a la sensibi- nucleicos. se dispone de métodos comer- servación suelen ser más estrictos. oprimiendo el sitio de la punción durante por lo menos que se lleve a cabo la extracción de ARN. Uso de métodos comerciales gridad del ADN y el ARN aislados o dentro de las muestras En la actualidad. opción viable. La cuidadosa preservación de las muestras tas para evitar congelamientos y descongelamientos repetidos garantizará resultados fidedignos y la disponibilidad de que favorezcan la degradación de los ácidos nucleicos. hasta por 48 horas. las biopsias pueden mantenerse dentro Un resultado falso negativo surge cuando el ADN o el ARN de un ultracongelador a –70ºC. los ácidos nucleicos está dirigida a la inactivación de nuclea- sas. debido a un procesamiento inade- procesará para la extracción de ácidos nucleicos. y el paciente Siempre que la molécula de interés sea ARN. Pueden utili. ya Resultados falsos positivos que su temperatura se encuentra por debajo de los –196ºC. Finalmente. para indicadas en este capítulo. Preservación. es necesario tomar la muestra en recipientes nue. muestras no almacenadas de manera adecuada. por lo que los cuidados para su pre. estériles. 12 horas para evitar hemorragias y complicaciones. el sustancias que preservan la integridad de los ácidos nuclei- ARN es una molécula mucho más sensible a la acción de cos manteniendo las muestras a –20ºC. ambiente entre 15ºC y 25ºC. ¿Qué variables afectan debe llevarse a cabo la extracción lo más pronto posible. La preservación de El suero debe mantenerse a –70ºC o en nitrógeno líquido. o bien en nitrógeno líquido presentes en una muestra se degradan por acción de las por tiempo indefinido antes de la extracción de ácidos nucleasas. por lo que las principales variables que afectan la inte. . hasta to. Obviamen- zarse inhibidores de ADNsas. cuado y da como resultado la detección de ADN o de ARN go. ya que un método casero de extracción de ácidos interés en estudiar ARN. la estabilidad de los ácidos nucleicos? Los ácidos nucleicos son susceptibles de degradarse por las ARN o ADN en suero nucleasas existentes en todas las células. o indefinidamente a –70ºC. El ADN aislado puede ciales para la extracción de ácidos nucleicos de muestras no mantenerse viable a 4ºC durante varias semanas. el desarrollo de la biología molecular y la son la temperatura y el tiempo. ratura ambiente. que ofrecen un rendimiento aceptable a partir de durante varios meses y a –70ºC durante años. ADN o ARN para llevar a cabo ensayos por triplicado y ase- gurar resultados libres de errores. ARN. aunque también puede extraerse ADN exógeno o del paciente. denominados falsos positivos y falsos negativos. Sin embargo. Sin embar. los cuidados en el manejo de las biopsias están dirigidos principalmente a la preservación de ARN por ser Pueden obtenerse resultados no fidedignos cuando las una molécula fácilmente degradable. lidad del método molecular utilizado. Un resultado falso positivo se obtiene cuando una muestra y transportarlo en él hasta el sitio donde se almacenará o se contamina con otra. tura. aun Como ya se explicó. es decir. Una recomendación valiosa es colo. para estudiar la expresión génica. comercial. la congelación con nitrógeno líquido no siempre es una ajeno a la muestra problema. (figura 10-2). almace- Resultados falsos negativos nando la muestra a 4ºC hasta por un mes antes de aislar el ARN. nucleicos podrá tener un costo 100 veces menor que uno car la muestra desde el momento de la toma en varias alícuo. Asimismo. con las precauciones de limpieza y esterilidad varios días. cuando se tenga costo. o bien inhibidores de ARNsas. 4ºC y aun a tempe- nucleasas que el ADN. a 4ºC por vos. Se recomienda el uso de nitrógeno líquido para conge- lar el tejido inmediatamente después de su recolección. La toma de la biopsia hepática Fluidos biológicos debe dirigirse con un equipo de ultrasonido. garantizar la obtención de ADN en buena cantidad y de bue- na calidad utilizando métodos económicos de extracción. y existen algunas soluciones en el mercado para preservar la integridad del ARN en tejidos. cuando el ADN sea la molécula te esta diferencia en el rendimiento se refleja también en el en estudio. Sin Contaminación de muestras y degradación embargo. ADN de leucocitos Otros fluidos biológicos Las muestras de sangre para obtención de leucocitos y la pos- En el caso de orina. al ofrecer una cantidad y Biopsias una calidad de ácidos nucleicos buenas en la muestra. Debido a las características ingeniería genética han permitido el diseño de moléculas o fisicoquímicas y estructurales de los ácidos nucleicos.

indicando los cuidados especiales que requiere dicha muestra para obtener un resultado confiable en los análisis de biología molecular. por sus elevadas sensibilidad. especificidad y rapidez. anemia de células falciformes. receptor β-3-adrenérgico en artritis reuma. virus del papilo- para establecer tratamientos específicos. distrofia mentos para la preservación y mejoramiento de la salud. incurables. Asimismo. VHB. CAPÍTULO 10 • Manejo de muestras para estudios moleculares 97 CONTAMINACIÓN Y DEGRADACIÓN dad hepática. e) Terapia génica: los procedimientos moleculares han toide. Ejercicios de integración 1. Mycobacterium tuberculosis. muscular de Duchenne. etcétera. expresión de genes: ARNm tratamiento a padecimientos genéticos o adquiridos de albúmina en cirrosis. Describa en los recuadros el tipo de muestra de elección según la clasificación del material genético. los estudios moleculares han permitido la identificación de genotipos de microorganismos endémicos de una región a) Agentes infecciosos: VIH. Material genético Tipo de muestras posibles Cuidados especiales ADN exógeno ARN exógeno ADN endógeno ARN endógeno . ma humano (VPH). hecho posible el surgimiento de nuevas alternativas de d) Enfermedades adquiridas. d) Farmacología: el conocimiento de los procesos fisiológi- etcétera. A continuación se mencionan ACCIÓN DE NUCLEASAS FALSO NEGATIVO algunas de las disciplinas correspondientes a las ciencias de la salud: CONTAMINACIÓN DE MUESTRAS FALSO POSITIVO a) Infectología: los estudios moleculares se utilizan amplia- Figura 10-2. b) Epidemiología: la detección de polimorfismos génicos de susceptibilidad o protección en una población mediante Trastornos o agentes infecciosos estudios moleculares es de gran utilidad para la imple- detectados por estudios moleculares mentación de campañas de prevención. ARNm de albú- DE MUESTRAS mina en cirrosis. VHC. con mayor especificidad y menor enfermedades: apolipoproteína E en la enfermedad de cantidad de efectos colaterales. etcétera. cyp2E1 en cirrosis. etcétera. geno- c) Nutrigenómica y nutrigenética: el análisis molecular tipos del VHB. permite evaluar la interacción de los genes y los nutri- b) Enfermedades genéticas: fibrosis quística. ARNm de ApoA1 en enferme. cos y patológicos moleculares ha contribuido al diseño c) Polimorfismos génicos de predisposición o protección a de nuevos fármacos. Contaminación y degradación de muestras. Áreas de aplicación de los estudios moleculares Los estudios moleculares tienen utilidad en todas las áreas de las ciencias biológicas. diabetes mellitus tipo 2. Alzheimer. mente en la identificación de virus y bacterias.

49:1017-1044..10:906–910.. 2006. Int J Tuberc Lung Dis.D. Kretzler M.543:217-234. Toxicol Appl Pharmacol. Kuhl W.51:1250- Method for efficient storage and transportation of sputum speci.. Vaught J. mens for molecular testing of tuberculosis. A.. Berger E.Sample collection and processing Cold Spring Harbor Laboratory Press. Cancer Epidemiol Biomarkers Prev. un resultado falso positivo. Smith 2006. Marteau J. Biotechniques. Smith M.D. ción? c) Señale tres recomendaciones para la toma y preserva- ción de muestras para estudios moleculares. Schlöndorff D. Nueva York: epidemiology biomarkers .B. el tipo de muestra que debe seleccionarse y el tipo de ácido nucleico que debe analizarse. Russel D. 2001.. Liver biopsy. b) Mencione un ejemplo donde se aplique el estudio de la e) ¿Qué tipo de muestra emplearía para detectar una muta- expresión génica de un individuo. 2002.. Enfermedad Muestra biológica Ácido nucleico Tuberculosis VIH VHB Hemofilia Cirrosis hepática Preguntas de repaso a) Enliste las aplicaciones del estudio de la estructura genó.15:1582-1584.. Pfleger L. Molecular cloning. Xiao P. Gelbart T. Miki M. expression analysis in renal biopsies: A novel protocol for a high. 2005. Hepatology. Quantitative gene Mutat Res. 2005. Nelson R.. Molecular Sambrook J.T. Goodman Z.. 2003.C. Ashino Y.. profiling: A 15-month stability study.. de acuerdo con la afección que se necesita diagnosticar. considerations. Interference of heparin with the Holland N.206:261-268. Clin Chem. Describa en los recuadros de la tabla. tion and storage of human blood cells for mRNA expression Guio H. Eskenazi B. Rockey D.W..T.... processing.T. Bibliografía Beutler E. Holland N.. d) Explique la diferencia entre un resultado falso negativo y mica de un individuo. Visvikis-Siest S.1:6-8.H.. Saitoh H. Mohr S. .. Okayama H. 1252.. Ho A. collection and processing for molecular epidemiological studies.C... Caldwell S. Cohen C. Michele Pfister M. 2009.D...9:166. shipment. Collec- throughput multicenter application.98 PARTE II • Metodología del ADN recombinante 2. 1990. Bastaki M... Blood collection. 3ª ed. Kidney Int..B.61:133-140. Bastaki M. and storage. Biological sample polymerase chain reaction. et al. Frach K.

etcétera). reacción en cadena de la dos. como lípidos y proteínas. aunque ahora se sabe que La extracción de ácidos nucleicos es el primer paso para la también se encuentran en la mitocondria. orina. por ser larga. mente. se dispone nentes celulares. el ARN se ños moleculares elevados (> 150 kb) la técnica se dificulta. líquido cefalorraquídeo. Asimismo. • Técnica en que se utilizará el ácido nucleico extraído: lo que provoca que se someta a fuerzas hidrodinámicas que según el uso que vaya a tener el ácido nucleico los la disgregan. el ADN de doble cadena (ADNds) requerimientos de rendimiento. extrae para realizar una reacción de retrotranscripción y. pero conforme se requieran tama. pureza y tiempo de se comporta como una estructura rígida enrollada de forma extracción variarán acorde a la metodología que se vaya aleatoria. por su parte. • Fuente del ácido nucleico: cultivo celular. obtener fragmentos de Southern blot. es f ísicamente suero. procariotes o virus. DNAds. Consideraciones para la extracción • Organismo origen del ácido nucleico: mamíferos. regida por las repulsiones electrostáticas de las a aplicar. ARN mensajero (ARNm) o ARN ribosomal (ARNr). En cambio. En la actualidad. entre más larga la molécula. Al pipetear. el ADN y ARN reciben su nombre del hecho de ser moléculas con características acídicas (como la Elección del método de extracción carga negativa en soluciones acuosas) y haberse localizado inicialmente en el núcleo celular. etcétera. En solución. el ADN genómico suele extraerse ADN. ARN total. frágil. electroforesis y construcción de bibliote- cas genómicas. Los fragmentos deADN generalmente obtenidos por las posteriormente. más abundantes de múltiples metodologías de extracción. así. Para su estudio mayoría de los estudios en biología molecular y para las téc- los ácidos nucleicos deben aislarse del resto de los compo. se extrae para diag- 99 . lo que permite que los ácidos nucleicos. Southern blot. tejido (gene- La molécula de ADN con independencia de la estabilidad ralmente biopsia). pares de bases y el esqueleto de fosfatos cargados negativa- Northern blot. determinación de varian- ADN genómico es fácil. agitar o revolver el ADN se genera un flujo hidrodinámico que puede separar las dos cadenas de En el área médica. plan- de ácidos nucleicos tas. Por ello. tortuosa y con un peso molecular alto. PCR. como retrotranscripción. tes alélicas o clonación en vectores. para diagnóstico. • Tipo de ácido nucleico que se va a extraer: ADN de cadena sencilla (ADNss). nicas del ADN recombinante. La elección del método para estudios de niveles de expresión génica se extraerá de extracción suele realizarse en función de los siguientes ARN. clonación. una PCR que determine los niveles de técnicas de extracción deADN oscilan entre 100 y 150 kb y expresión génica en condiciones y momentos determina- son adecuados para Southern blot. El ADN mitocondrial. expectoración. Capítulo 11 Extracción de ácidos nucleicos Ana Soledad Sandoval Rodríguez / Abril Bernardette Martínez Rizo David Alejandro López de de la Mora Introducción polimerasa (PCR). dependiendo del objeto que los biólogos moleculares puedan seleccionar la técni- de estudio debe aislarse de preferencia el ADN o ARN. ADN. ca que más se ajuste a sus necesidades. mientras que para la búsqueda de modificaciones o criterios: alteraciones génicas. más débil la fuerza para su uso en procesos como una PCR cualitativa o requerida para esta rotura. química dada por su estructura helicoidal. sangre (leucocitos). Los ácidos nucleicos.

En el cuadro 11-1 se ejemplifica el Extracción de ADN por la ácido nucleico adecuado. se recomienda la extracción de ADN de leucocitos. así como para impedir cualquier contaminación con ácidos nucleicos exógenos. heces. que es una molécula orgánicos. Muco. raspado bucal. sa Suero. Selección de Leucocitos Biopsia Suero. con los reactivos y las muestras a 4°C antes y durante el proceso. muestras no invasivas frente a cualquier tipo de biospia o toma invasiva de líquido. Selección del ácido nucleico a extraer. estéril. muy diversas e incluyen procesamientos químicos y f ísicos vial. separación. sudor. y en te su extracción y la de componentes lipídicos con solventes particular en la extracción del ARN. líquido anmiótico. pero el aislamiento de este ADN conlleva un pro. fo. lavado y gentes con la posterior eliminación de las proteínas median- disolución. libre de ADNsas y ARNsas. la/virus que lo contenga. Las patologías se han agrupado en alteraciones genéticas. debe considerarse el por precipitación en soluciones alcohólicas. Se marca con una “X” la elección recomendada del ácido nucleico y fuente del mismo según la enfermedad de interés. técnica fenol-cloroformo Con independencia del tipo de muestra utilizada para la Esta técnica se fundamenta en la lisis total de las células y extracción. esto es. Suero. precipitación. Por acuerdos éticos. con nucleasas provenientes del ambiente (pelo. ya que son anuclea- dos. que las diferencian. semen. Las fuentes posibles de material para la extracción de Extracción de ADN los ácidos nucleicos son: leucocitos (sangre). purificación. orina. plasma bucal biopsia biopsia expectoración tipo de muestra ADN ADN ARN ADN ARN ADN ARN ADN ADN oral ARN viral bacteriano Distrofia musc. por la cantidad y la calidad del ADN obteni- Cuadro 11-1. orina. Todo el proceso debe reali- Fuente del ácido nucleico zarse en frío. así como la muestra de elección según el tipo de enfermedad que se desee diagnosticar. polvo). que se agrupan en el cuadro 11-2. sali- ceso específico. X X Alteraciones genéticas Duchenne monogénicas Anemia celular X X falciforme Hipercolesterole X X mia Def. Esto deja al ADN puro listo para su separación más lábil ya que es de cadena sencilla. esputo. etc. se prefieren las jas.100 PARTE II • Metodología del ADN recombinante nóstico de enfermedades mitocondriales o bien análisis el uso de guantes para impedir la degradación de la muestra evolutivo. que involucra lisis de sus estructuras subcelulares mediante el empleo de deter- la célula. de X X alfaaminotripsina Diabetes *X **X multifactoriales Enfermedades poligénicas o Cirrosis *X **X Cáncer *X **X Artritis *X **X reumatoide VHB X Enfermedades VHC X adquiridas VIH X Tuberculosis X Aspergillus X *Si se busca la mutación génica implicada en el desarrollo de la patología. y más empleada. es una técnica minuciosa. Es la técnica uso de material nuevo. **Si se investiga los niveles de expresión génica en determinado momento se optaría por una biopsia como fuente del ARNm. Durante la extracción de ácidos nucleicos. lada hasta justo antes de iniciar la extracción. conservando la muestra conge- En teoría el ADN/ARN puede obtenerse de cualquier célu. LCR. suero. líquido sino. va. líquido cefalorraquídeo. . enfermedades multifacto- riales y enfermedades adquiridas o infecciosas. solamente los eritrocitos no se consideran una fuente de ADN/ARN. plasma. Las técnicas comunes de extracción de ácidos nucleicos son biopsia. cada una presenta ventajas y desventa- lículo capilar. suero. biopsia.

La inactivación de nucleasas intracelulares previene la El primer paso en la extracción es la homogeneización del digestión enzimática de los ácidos nucleicos. La disgregación del tejido y su homogeneización se llevan a cabo en un buffer de lisis. esquematizados en la figura 11-1. RFLPs. como la extracción fenol-cloroformo. La lisis de eritrocitos suele realizarse por metodología. como las células vegetales. • El fenol es tóxico y caústico. para liberar el isoamílico. • El producto purificado requiere ser precipitado con de guanidina/fenol-cloroformo (ADN) • Permite el aislamiento de todo tipo de ácido alcaloides. • BrEf es cancerígeno. do. • Reproducible. Cromatografía por exclusión de tamaño • Tiempos de separación cortos y bien definidos. lo que • Indispensable el uso de material especializado. la electrofo- unas 200 a 1000 rpm. • Requiere una cantidad grande de muestra para • Material barato. ya que la heparina inter. que libera el ADN de las histonas con las que se encuentra empaquetado con solventes orgánicos y proteoliza proteínas celulares. y liberar el ácido nucleico de las células de donde se sas intracelulares en general se llevan a cabo en el mismo extraerá el ADN. Cuando la extracción se lleva a cabo a partir de células que funciona como antioxidante del fenol. solución desnaturaliza las proteínas (entre ellas las nuclea- bién es necesario retirar los eritrocitos. El alcohol isoamílico se emplea para reducir la fiere con enzimas como las polimerasas o las enzimas de espuma que puede generarse al agitar esta solución. rompen la tiene una relación 25:24:1 v/v para el fenol:cloroformo:alcohol pared celular y la membrana celular y nuclear. La lisis celular y la inactivación de las nuclea- nuclear. ineficiente (pérdida de muestra). SDS) capaces de romper las membranas celular y ADN y ARN. proceso conocido como purifi- homogeneización se lleva a cabo con un homogeneizador cación. De las diversas técnicas disponibles para la extracción de ácidos nucleicos. generalmente se añade hidroxiquinolina al 0. CAPÍTULO 11 • Extracción de ácidos nucleicos 101 Cuadro 11-2. Esta restricción. nucleico. y que ácido etilendiaminotetraacético (EDTA) como anticoagu. ya que por su alto sas) y mantiene la separación de la fase orgánica y acuosa contenido de hemoglobina y carencia de núcleo contami. • No hay pérdidas considerables de ADN. ya que la solución de lisis está compuesta por sales y debe ser lo suficientemente agresivo como para lograr la caotrópicas. tras la centrifugación de la muestra. ayuda a identificar la fase orgánica por el color amarillo que lante (EDTA 0. La eliminación de las . se emplean para cualquiera de los ácidos nucleicos (se realizan ligeras modificaciones para la extracción de ARN). adición de una solución hipotónica a base de cloruro de amonio. elimina el riesgo de contaminaciones esporádicas con rinasas. Cloruro de cesio ADN plasmídico • Excelente método para obtención de ADN • Laborioso y prolongado. plasmídico. • La recuperación del ácido nucleico purificado es (ADN o ARN) • Alta sensibilidad. Chelex (ADN) • Previene la degradación del ADN por sus • Se obtiene ADNes. sin dañar el ácido nucleico. quelante débil de iones metálicos. inactiva las ADNasas. Método Ventajas Desventajas Fenol/cloroformo (ADN) e isotiacianato • Buen rendimiento. se ma se realiza por 2 horas a 65°C. que secuestra cationes diva- fragmentación del tejido y la rotura de la membrana celular. para combinan estrategias tan diversas como la extracción/pre- el ARN se emplea un homogeneizador eléctrico que gira a cipitación. técnica del fenol-cloroformo. Los procedimientos comunes de lisis celular y su Lisis de las células y liberación del ADN fundamento se incluyen en el cuadro 11-3. El procedimiento de lisis celular es crítico paso. un detergente y proteinasa K. como el EDTA. le confiere.02% V/V). la centrifugación.1%. el cual no puede usarse para agentes quelantes. La incubación con la enzi. por lo tanto. que Extracción de proteínas y lípidos contiene sales. un inhibidor de sangre periférica. • Requiere eliminación de CsCl. Ventajas y desventajas de diversos métodos de extracción de ácidos nucleicos. En el caso de células con pared celu. la cromatograf ía. En el caso del ADN. lo que permite tejido y la lisis con detergentes (Triton o docedil sulfato lograr la obtención de fragmentos relativamente largos de sódico. Salting-out (ADN) • Reactivos inocuos. algunas como la extracción por cloruro de cesio se consideran ideales para ADN plasmí- dico. A continuación se describen los pasos que implica esta nan la muestra. Algunas otras. se prefiere el empleo de soni. se utiliza una solución que cadores. mediante ondas de sonido. que se emplearán en pasos subsiguientes. resis y la separación por afinidad.1 M al 0. Los métodos de purificación de ácidos nucleicos manual para evitar la rotura mecánica de la molécula. Para la extracción por la lar. obtener cantidades adecuadas de ADN. la retiran los restos celulares. • Alta pureza de los ácidos nucleicos. lentes y. se recomienda el empleo de tubos con parcial de ARNsas. ADN. • Requiere muy pocas manipulaciones. los cuales. Al concluir la lisis celular y la inactivación de nucleasas. Tam.

Es importante considerar que el procedimiento se debe realizar en frío (4°C) después de la digestión enzimática. Una vez extraído se almacena a temperatura de –80°C para su preservación adecuada por varios años. Esta técnica es ampliamente usada por su economía y facilidad. piedades de solubilidad particulares a) una fase orgánica En la interfase se ubican la mayor parte de las proteínas (fenólica) en la parte inferior del tubo de precipitado que debido a su contenido en aminoácidos hidrofóbicos e hidro- contiene lípidos. como se aprecia en la figura 11-2. . Extracción de ADN por la técnica fenol-cloroformo. ácidos nucleicos y otras pequeñas moléculas hidrosolubles.102 PARTE II • Metodología del ADN recombinante Homogenizar Proteinasa K Vórtex Incubar 65°C 2 hrs Centrifugar Centrifugar 4° C/8 Añadir fenol 4°C/15´ Vórtex cloroformo Colectar sobrenadante Fase acuosa Proteínas Fase fenólica Añadir OH Vórtex Reposar toda la absoluto noche –20°C Colectar sobrenadante Centrifugar Centrifugar Vórtex Decantar 4°C/25´ 4°C/25´ Lavar con OH Botón ADN 70% Leer en espectrofotómetro Decantar Resuspender en H2O Figura 11-1. proteínas y debris celulares. proteínas y componentes no hidrosolubles del homogena. que contiene los do celular se efectúa con la formación de dos fases con pro. acuosa en la parte superior (menos densa). y b) una fase fílicos. lo que permite el aislamiento de ADN de buena calidad para su uso en diversas técnicas moleculares.

El ADN es poco soluble en fenol. se requieren métodos más agresivos que destruyan también la pared celular. La separación de la fase acuosa sin tocar la fase fenólica o la capa de proteínas es un paso crítico en el proceso de extracción del ácido nucleico que determina la pureza con Disolución del ADN y adición de ARNsa que se aísla. ya que los áci. Después de los lavados. al menos. En la El botón de ADN obtenido en la precipitación se lava con extracción de ácidos nucleicos que involucra solventes orgá. la do. A su vez. El contenido de nicos. • Tejido animal y vegetal Procedimientos mecánicos suaves/mortero • Ruptura de las membranas por ultrasonido. Para facilitar la precipitación también suelen añadirse dos nucleicos son insolubles en soluciones alcohólicas. la cantidad que se requie- te suele estabilizarse con una solución amortiguadora de re para la precipitación es dos veces el volumen de la fase Tris que lo mantiene en un pH de 8. la evaporación del alcohol (espontánea o acelerada en un En la interfase entre ambas se localiza un acúmulo sólido de desecador). Si la cantidad del ácido nucleico en la muestra es baja. botón de ADN se disuelve en soluciones que aseguren su . NH4+) a la solución de ácidos nucleicos cargados negativamente. y la precipitación puede rea- lizarse a temperatura ambiente. cipitados con IprOH que con EtOH. que por su gran tamaño molecular forma una red que arrastra al ADN y facilita su precipita- Fase acuosa ción.7 veces el volumen de fase acuosa. La modificación del solamente 0. por lo que previamen. sin interferir en futuras reacciones.2 en esta solución puede favorecer la extrac. y el H2O (30%) permite la disolución de las sales presen- cual contiene proteínas y lípidos. se ha reporta- Precipitación de ADN do una mayor dificultad para disolver ácidos nucleicos pre- El ADN disuelto en la solución acuosa se precipita añadien. La finalidad de la lisis celular es romper las membranas para liberar los ácidos nuclei- cos para su solubilización en solventes adecuados. donde se ubica el ADN o ARN. Soluciones/soluciones hipotónicas • Producen un ambiente hipotónico. mientras que con isopropanol (IprOH) se demanda el ADN permanezca en la fase acuosa. Fase fenólica Lavado del ADN Figura 11-2. es posi- ble incrementar sus agregados utilizando algún compuesto inerte que se asocie a los ácidos nucleicos y aumente su pre- cipitación. y por lo tanto es determinante del índice 260/280 que Inmediatamente después de la evaporación del alcohol. • Bacterias • Tejido animal y vegetal • Cultivo celular • Biopsias Disrupción enzimática/ lisozimas • Debilita la pared celular al romper los enlaces que hay entre las • Bacterias moléculas del ácido N-acetilmurámico y la N-acetil glucosamina. se seca el botón. CAPÍTULO 11 • Extracción de ácidos nucleicos 103 Cuadro 11-3. tiempo de incubación menor.5. Sin embargo. dos ocasiones. según sea el caso. Procedimientos de lisis celular. do alcohol absoluto (isopropanol o etílico).0 a 8. el se obtenga. con un ción de ARN frente a la de ADN. Fases en la purificación de ácidos nucleicos. Cuando se emplea etanol (EtOH).5 a 5. como por ejemplo el glucógeno. En el caso de células con pared celular (ciertas bacterias y células vegetales). al emplear IprOH puede acelerarse el proceso. • Cultivo celular Sonicación/aplicación de ondas ultrasónicas • Biopsias • Bacterias • Cultivo celular Detergentes/SDS • Solubiliza las membranas celular y nuclear. Técnica/ejemplo Mecanismo Fuente Homogenización • Utiliza la fuerza física para romper las membranas. El SDS también participa • Bacterias en la desnaturalización de nucleadas y la disociación de complejos nucleoproteicos. la fase superior es tes. proteínas. cationes monovalentes (K+. ubicada en la parte inferior de tubo. al decantar el alcohol. La precipitación se favorece incubando a bajas tempe- raturas (–20°C). lo que permite la acuosa. etanol al 70% por. con el fin de generar sales insolubles en alcohol de fácil precipitación. Na+. lo que hace que acuosa. lo cual rompe la membrana celular. una vez que estos últimos son añadidos se forman dos alcohol de esta solución (70%) mantiene al ADN precipita- fases: la fase fenólica. lado. una centrifugación posterior permite la Proteínas obtención de una pastilla o botón del ácido nucleico en el fondo del tubo. Por otro pH de 8.

Un índice mayor que valores En el caso de los ácidos nucleicos. por lo que en este caso también se recomienda una valores. cutir en las técnicas en que se pretenda emplear el ácido nucleico. por lo La densidad óptica (OD) es la unidad de absorbancia y que si la relación 260÷280 es menor que 1. así. este índice no es infalible y la concentración de los ácidos nucleicos: puede modificarse si el pH del medio se modifica. como el espec- solución homogénea. mientras que la basicidad puede aumentarlo. evitar que el ARN interfiera en la cuantificación y en posteriores técnicas. Por otro lado. la acidez μg/μl de AN = OD a 260 nm × Dilución × constante / 1 000 puede hacer disminuir hasta 0. lo que puede reper- fluorometría. pero de sodio dibásico. con el fin de valorar la pure- solución que contenga moléculas suspendidas permite el za del ácido nucleico extraído.0 indica una rotura de las cadenas de los ácidos nuclei- equivale a 50 μg/ml de ADNds. así como solventes u otros componentes orgánicos emplea- Existen diversos métodos de cuantificación de ácidos dos en la extracción. 40 μg/ cos. los más usados son la espectrofotometría y la nantes de la solución de ácido nucleico. cuando ha pasado para valorar la pureza de los ácidos nucleicos con respecto por la muestra. cos (1 a 2 μM). b) 40 para ARN.104 PARTE II • Metodología del ADN recombinante preservación. Sin embargo. lo que evita cualquier interferencia cada ácido nucleico: a) 50 para el ADNds. y d) 37 para ADNss. un fotodetector mide la intensidad de luz a la contaminación con proteínas. es prácticamente imposible eliminar la Cuantificación de los ácidos nucleicos totalidad de las proteínas celulares que acompañan al ADN. nuevo proceso de extracción. En la canos a 1. que permite suficiente para lograr una disolución total del ADN. ácido nucleico extraído A pesar de que la técnica de extracción de ácidos nucleicos esté bien realizada. Constante: proveniente del valor teórico de OD para bonato (DEPC) al 0. por lo tanto. En la celda del espectrofotómetro un haz de luz atra- por lo común el índice de absorción 260÷280 nm se utiliza viesa la solución de ácidos nucleicos y. grandes de solución para cubrir la capacidad de las celdas La cantidad de solución para disolver el ADN debe ser míni. Los nucleótidos de de ácidos nucleicos a 260 nm entre la OD de interés. los cuales se presentan como contami- nucleicos. Mientras más luz absorba la muestra (absorban- tra entre 1. Debido a que el espectro de absorción de luz de Espectrofotometría estas moléculas es característico. presencia de proteínas hará disminuir este cociente. Algunos equipos per- se disuelve por pipeteo constante del botón hasta lograr una miten la lectura directa del ácido nucleico. 37 μg/ml de ADNss.2 (Na2HPO4).1%.15. Así. Para eliminar el ARN contaminante proveniente de la extracción. los Contaminación con proteínas: índice 260÷280 espectrofotómetros son los aparatos más utilizados para Dado que las proteínas (en particular los aminoácidos aro- determinar la concentración de ácidos nucleicos en solu- máticos) absorben luz a una longitud de onda de 280 nm. embargo.0. en una solución en fosfato nucleico que permita su empleo en técnicas posteriores. UV). cito- . Los estudios indican que la disolución trofotómetro NanoDrop™.8 la cantidad de tiene valores particulares para cada molécula específica en proteína en la muestra es alta y es conveniente realizar un una determinada longitud de onda por unidad de distancia. para el ARN el índice óptimo es de 2. de los espectrofotómetros. se estableció la siguiente fórmula para el cálculo de nueva extracción.5 μM a pH 5. ción. suelen manejarse diluciones ma para mantener una concentración adecuada del ácido 1:100 a 1:1000 del stock de ADN. sin aplica directamente en el aparato. y se considera que es un ácido nucleico de calidad insu- ml de ARN o 33 μg/ml de oligonucleótidos. donde la muestra no se diluye sino que se res condiciones que cuando se disuelve en agua estéril. como agua estéril y libre de ADNsas.0. ADN y ARN presentan la absorción máxima a una longitud de onda de 260 nm (luz ultravioleta. las ARNsas.50. la absorción en otras lon- gitudes de onda de la muestra de ácidos nucleicos se com- El fundamento de la espectrofotometría es que cualquier para con la absorción a 260 nm. Según estos ficiente. como el buffer Tris EDTA (TE). ya que valores cer- cia) mayor será la concentración de ácidos nucleicos. El ADN leer los nucleótidos sin interferencia.8 indican que la muestra contiene casi exclusiva- figura 11-4 se esquematiza el fundamento de la medición de mente ADN.8 y 2. una OD de 1 a 260 nm de 2. la solución de ADN se incuba por una hora Valoración de la pureza del a 37°C con ARNsas para. 1. para el cálculo de estos paso de un haz de luz a través de ella en proporción inversa índices se procede a dividir la OD obtenida para la muestra a la cantidad de moléculas que contiene. En donde: la composición de nucleótidos libres afecta también esta OD a 260 nm: absorbancia del ácido nucleico a 260 nm relación. se considera óptimo. La concentración de moléculas en un espectrofotómetro.3 unidades el índice. nucleótido se obtendría: guanina: 1. Cuando éste se encuen- absorbida. o bien Dilución: como se requieren volúmenes relativamente soluciones amortiguadoras. adenina: 4. ya que si se calculase el índice 260÷280 para cada de longitud de onda. usando volúmenes micrométri- del ADN en buffer TE preserva por mayor tiempo y en mejo. de las sales de las soluciones amortiguadoras y lo preserva de c) 33 para oligonucleótidos.2 a 0. se prefiere disolver el ARN en agua-dietil pirocar.

La luz será absorbida de manera proporcional de acuerdo a la concentración de la muestra. el ARN ten. por lo que su contenido de uracilos.51.001 a 1. restándola a la luz inicial emitida y generando así una lectura en unidades de absorbancia que oscila entre 0. por El fenol tiene un pico de absorbancia de 270 nm. uracilo: 4. Debido a índice que producen las timinas. La luz que no es absorbida por la muestra se mide por el detector. La luz UV o visible es emitida por una lámpara que a través de un condensador dirige los rayos hacia la muestra. Fundamento del funcionamiento del espectrofotómetro.00 y timina: 1. CAPÍTULO 11 • Extracción de ácidos nucleicos 105 Homogenizar Cloroformo frío Vórtex Incubar en hielo con Trizol Reposar toda la Añadir Centrifugar noche –20°C isopropanol 4°C/15´ Vórtex Colectar sobrenadante Centrifugar 4°C/25´ Decantar Vórtex Lavar con OH 70% Centrifugar Desecador Secar sin Decantar 4°C/15´ 2-3 tocar botón Botón ADN Resuspender con H2O Leer en Espectrofotómetro Homogenizar Figura 11-3. Contaminación con fenol: índice 260÷270 drá típicamente valores mayores que el índice 260÷280. por ello.47. que difieren notablemente del a 260 nm todavía absorbe gran cantidad de luz. sina: 1. . ubicada dentro de una celda de cuarzo (material que no interfiere con la absorción de la muestra).000.

ni de la se opta por esta opción.0-2. Extracción de ARN Esta técnica requiere de estándares de concentración conoci- La extracción de ARN de células eucariotas se lleva a cabo da. empleado para la extracción de ARN. que se traspasa a un nuevo tubo para su lava- absorbe luz de una determinada longitud de onda y emite luz do y precipitado. Para la cuantificación de extracción de ARN de células eucariotas existen dos posibi- ARN. Una centrifugación posterior a la ceptible a las interferencias por proteínas y contaminantes adición de la solución concentrada de sales precipita el presentes en la solución. que sobrenadante.106 PARTE II • Metodología del ADN recombinante este efecto solapante. péptidos. También se dispone de kits comer- posible degradación del ARN o ADN. la señal electrónica tejidos se disgregan en una solución de tiocianato de guani- para la misma concentración de una sustancia varía de un dina para lisar las células e inactivar las ribonucleasas endó- instrumento a otro. dación progresiva en los ácidos nucleicos. Las proteínas y otros contaminan- El ácido nucleico se mantiene en congelación (–80°C es la tes son retirados con lavados. Al realizar la es de aproximadamente 10 ng/ml. niveles de ARNm). pues se corre riesgo nico. como EDTA. que permiten purificar ARN total. carbohidratos y fenol. hechas con cuantificar de forma inadecuada las distintas capas de la cantidades elevadas de grupos dietil-amino-etil (DEAE). ADN en regiones ricas en AT. significa que la muestra está contaminada con iones fenola- tos o tiocianatos. El pH y la concentración de temperatura recomendada) hasta su empleo. y deja libre el ADN en el líquido del específica de colorantes fluorescentes al ácido nucleico. La desven- menos complejo y generalmente más barato la extracción de taja principal de esta técnica es que no proporciona infor- ARN total. Generalmente. La solución. En los fluorómetros. la contaminación con fenol (utilizado como que múltiples descongelaciones ocasionan una degra- en la extracción) sobreestima de forma significativa la con. concentrada de sales en lugar de solventes orgánicos para la lisis celular y la extracción de proteínas. El lisado celular se diluye con una solución alcohólica pos diferentes no pueden compararse. ARNr y ARN de emplearse RiboGreen. Es y emite a ~525 nm. lo que permite su separación de los áci- La cuantificación de ADN o ARN por fluorometría es 1000 dos nucleicos. La resina consiste en cuentas de sílica con superficie de no iluminar por igual todas las partes de la solución y hidrof ílica con tamaño de partícula reducido. es una solución en esta metodología radica en el empleo de una solución fenólica que absorbe luz UV tanto a 230 nm como a 270 nm. Esta metodología se basa en la unión debris y las proteínas. los tubos GenTegra™ ADN. También se dispone de méto- nucleicos sin contaminación fenólica presentan un índice dos comerciales para la preservación del ADN. por lo que mediciones hechas en equi- genas. Su sensibilidad ADN complementario (ADNc) en un vector.2. un colorante que absorbe a ~500 nm transferencia. La relación entre la concentración del ácido nucleico y la inten- sidad de emisión fluorescente es directamente proporcional. Para muestras puras de ácidos nucleicos el ín- dice 260÷230 se espera en el rango 2. para el diagnóstico de enfermedades una bis-benzimida que se intercala en la doble cadena de ocasionadas por virus de ARN o. y suele lidades: extracción de ARN total (ARNm. ARNt) y extracción oclusiva de ARNm. por lo que se centración de ácidos nucleicos. Las preparaciones de ácidos recomienda hacer alícuotas. Se recomienda medir y se coloca en una columna de resinas de intercambio anió- la fluorescencia en soluciones diluidas. El de extracción por fenol-cloroformo. la astringencia . compuestos aromáticos u otras Extracción de ADN por sustancias. que se excita en el espectro para análisis de expresión de genes o validar la clonación del UV (350 nm) y emite en el visible a 450 nm. muestras con un la técnica de salting OUT índice menor indican la presencia de contaminantes que Si bien muchos pasos y soluciones son comunes al método absorben a 230 nm. como son 260÷270 de alrededor de 1. estas soluciones se preparan veces más sensible que la espectrofotométrica. la principal diferencia TriZol™. para desarrollar estudios de expresión génica (análisis de los Los colorantes más empleados son el Hoechst 33258. purificación se basa en la interacción de estos grupos DEAE cargados positivamente con los grupos fosfatos (cargados Preservación del ADN negativamente) del ARN. Su sensibilidad es de 1 pg/μl. se realiza un pretratamiento con ADNsas. así controlan la unión del ARN a la columna. Es bien sabido sales de las soluciones amortiguadoras usadas en cada paso que a menor temperatura la preservación se prolonga. y a menos que el ARNm sea sumamente escaso mación de la pureza (como el índice A260:A280). Las células o ácido nucleico.2. La adición de una Fluorometría solución saturada de sales provoca la agregación de proteí- nas y debris celular. por lo que se requiere ciales basados en cromatograf ía de intercambio aniónico en realizar una electroforesis para comprobar la integridad del fase sólida. de una longitud de onda superior (de menor energía). en el caso de bacterias. contra el cual interpolar los valores de la muestra. y menos sus- a saturación con NaCl. que contienen una matriz quí- mica inerte que permite el almacenamiento del ADN seco y Contaminación con fenol y sales: índice 260÷230 a temperatura ambiente por días o meses sin hidrólisis u La absorción de luz UV a una longitud de onda de 230 nm oxidación.

con la finalidad de digerirla antes yección. Es muy importante tomar precauciones para evitar la componentes de la solución de lisis. CAPÍTULO 11 • Extracción de ácidos nucleicos 107 Cuadro 11-4.1%− . Los métodos comerciales para la extracción de ácidos Ambion). muy estables y que no requieren de cofactores para funcio. el ADN es retenido en la fase va por completo las ARNsas. dor eléctrico. El material de vidrio debe esterilizarse acuosa. tiza en la figura 11-3. sin embargo. homogeneización o vórtex vigoroso en un buffer de CsCl− es mayor. a 4°C por un mes rápidos y proporcionan una buena calidad del ácido nuclei- y a temperaturas bajo cero por tiempo indefinido. la calidad del ARN obtenido −de la cual se dice es zima. orgánica y en la interfase. nucleicos suelen basarse en cromatograf ía de intercambio Estas soluciones mantienen el ARN estable en el tejido a aniónico.® Otros métodos de extracción En el mercado se encuentran disponibles soluciones comerciales estabilizadoras para el ARN (RNAlater®. la microin. Esto hace lisis que contiene hidrocloruro de guanidina. dejando el ARN en la fase acuosa. mientras que el material solución fenólica empleada en la extracción del ARN es áci- plástico debe ser nuevo y estéril. a 25°C por una semana. La disrupción mecánica se emplea con más fre. puntillas y soluciones exclusivas para que en la extracción del ADN (formar las fases orgánica y trabajar con ARN. La disrupción de tejido congelado es similar a como se hace con ADN. de la lisis celular. El ARN unido a la Por otro lado. ya que no hay arrastre de fenol.1% N/A trabajo Proteinasa K N/A 10 μg/ml Homogeneizador Eléctrico Manual del lavado y la elución del ácido nucleico. La digestión con liso- embargo. o bien debe enjuagarse con da (pH 5 a 6). Los protocolos existentes extracción de ARN total se basan en una rápida inactivación de ARNsas endógenas. propanol y con ayuda de una centrifugación de manera neizador mecánico. tratar nidina es un potente desnaturalizante de proteínas con el agua y soluciones salinas con inhibidores de ARNsas capacidad de inhibir ARNsas. usando un homoge. para favorecer la extracción del ARN sobre la cloroformo. como bacterias y levaduras. del ADN. zimoliasa o lisostafina suele seguirse de una sonica- la equivalente a dos rondas de purificación con gradientes de ción. se recomienda se utilizan en la extracción del ARN con los mismos fines el empleo de pipetas. que permiten preservar la muestra sin congelarla. El proceso más frecuencia para lisar células que contienen envoltura o es rápido. acuosa mediante precipitación a baja temperatura con iso- cuencia para tejidos frescos o células. por ejemplo. sin cápsula. la disrupción enzimática se utiliza con columna se eluye con soluciones iónicas acuosas. especialmente en la técnica fenol cloroformo. Los métodos que la purificación por columna sea ideal para el ARN enzimáticos también pueden emplearse para tejidos euca- empleado en aplicaciones como la transfección. Diferencias entre extracción de ADN y ARN.2 Uso de inhibidores de ARNsas Tiocianato de guanidina N/A Agua libre de ARNsas para las soluciones de DEPC 0. El isotiocianato de gua- contaminación con ARNsas exógenas. la clonación y la secuenciación. aunque la cantidad de ARN suele ser limitada. riotes ricos en colágena. Si es posible. El fenol y el cloroformo por modificaciones covalentes. ya que la esterilización por autoclave no inacti. que inactiva las ribonucleasas utilizado en la extracción de ARN. son costosos respecto a los métodos con- . por lo que la clave Técnica de isotiocianato en la extracción es evitar su degradación por acción de de guanidina/fenol-cloroformo para ribonucleasas propias de la célula. llamada Trizol. La por calor seco por 4 horas a 150°C. Consideraciones especiales al trabajar con ARN La molécula de ARN es sumamente lábil. desnaturalizar proteínas e inactivar nucleasas). El isotiocianato de guanidina y el fenol se utilizan como nar. el ARN es purificado a partir de la fase enzimática. Para la lisis celular suele optarse por la lisis mecánica o Posteriormente. Los kits son 37°C por un día. Diferencias entre métodos ARN ADN Temperatura pH de solución fenol/cloroformo Estrictamente 4°C 5 a 6 Preferentemente 4°C 8. La homogeneización del tejido se realiza habitualmente en una solución comercial fenólica con tio- cionato de guanidina. co. Este proceso se esquema- más laboriosa y se recomienda el uso de un homogeneiza. El uso de inhibidores de ARNsas y el pH es crítico para favorecer la extrac- ción de ARN. Las principales diferencias entre la extracción de ADN y de ARN se resumen en el cuadro 11-4. ya que a pH ácido. por lo que es ampliamente −como el DEPC al 0. y emplean algún tipo de columna.

poros hidrof ílicos uniformes. Cromatografía de intercambio iónico Gradiente con cloruro de cesio Empleada por lo común para separar proteínas. exclusión de tamaño Esta técnica se fundamenta en la separación de ácidos Cromatografía de absorción nucleicos de acuerdo con su peso molecular. metabolitos y otros contaminantes se ambos materiales. vertido en un método alternativo que permite la concentra- cación de ambos ácidos nucleicos. migran más rápidamente que las de menor tamaño. columna. cuidando que los reactivos estén en refrigeración antes y durante su empleo. Este método es el prefe. Es una técni. rápida y reproducible. en las que se que el ácido nucleico cargado negativamente se retiene y requiere ARN alta pureza e integridad o para aislar ARN de permite que otras moléculas. se ha con- La centrifugación en gradientes de CsCl sirve para la purifi. aunque su uso principal es ción y la purificación de ADN de calidad. Es una metodología fundamentos de algunos métodos alternativos de extrac. entre los que se encuentran los métodos comerciales. La importancia de la calidad del ácido nucleico extraído ño no penetrarán en los poros del polímero. de manera rápida el aislamiento del ADN genómico y plasmídico. Extracción de ARN con fenol-cloroformo. Esta debe estar capacitado para observar las buenas prácticas de técnica es el fundamento de la purificación en gel de agaro. tras que proteínas. empleando Los ácidos nucleicos en solución se fijan de forma selectiva una columna empaquetada con una matriz de gel confor. que sí por lo que el personal que realice estos procedimientos son capaces de penetrar por los poros de la matriz. dejando los ácidos nucleicos retenidos en la creas. prolongada y que requiere de un equipo espe. mecánica y químicamente estables y con eliminan mediante lavados. vencionales de extracción. Los ácidos nucleicos interactúan con la resinas de cializado. en sílice o vidrio. carga positiva de las columnas de intercambio iónico. La extracción de ARN es una modificación de la extracción de ADN por fenol- cloroformo. ción empleados. como una ultracentrífuga. como proteínas o lípidos. por lo que es crucial para su uso posterior en técnicas moleculares. mien- mada por partículas poliméricas orgánicas o de sílice. como el pán. La principal diferencia es el empleo de inhibidores de ARNsas con la idea de impedir la degradación del ARN por las endonucleasas intracelulares de la muestra o presentes en el material. En esta sección se describen los sobre todo en la clonación de vectores. originan una red de nucleicos se recuperan con una solución hiposalina.00 nm ABSORBANCIA Amplificador Lectura Figura 11-4.108 PARTE II • Metodología del ADN recombinante Celda con 400-750 nm muestra Detector Luz blanca MONOCROMADOR UV <400 nm Lente Lámpara 0000. los ácidos un contenido bajo en grupos iónicos. usado tidad y una calidad adecuadas de ARN o ADN . Las moléculas de gran tama. laboratorio. los cuales se eluirán empleando condiciones que rompan su enlace con los compuestos iónicos de la resina Cromatografía por purificados. se tejidos con altos niveles de ARNsa endógena. por lo rido para la elaboración de genotecas de ADNc. condición indispensable para obtener una can- sa de un ácido nucleico de determinado tamaño. Posteriormente. de CsCl. eluyan primero. y con la misma eficacia que la extracción por gradientes ca laboriosa. Es importante mencionar que la extracción de ARN debe realizarse en todo momento en frío (4°C) para inhibir la acción de las ARNsas. en presencia de sales caotrópicas.

Valorar la pureza de la preparación de ácidos nucleicos qué estas moléculas. Russell D..A. Disponible en: http://www. (pdf ). CAPÍTULO 11 • Extracción de ácidos nucleicos 109 Ejercicios de integración 1. Calcular la concentración de ARN en μg/μl obtenida de una 4. de 0. RNeasy MicroKit English acid guanidinium thiocyanate-phenol-chloroform extraction. Molecular cloning: A laboratory manual. 1987. partiendo de 100 que favorecen que los ácidos nucleicos se queden en la mg de muestra.com/products/.qiagen. . 3ª ed. ácidos nucleicos y las proteínas. Dykes H. Sambrock J. Sacchi N.57. ¿Qué función tiene el detergente SDS frente a las mem- índice 260÷280. Miller D. Investigue y explique cuáles propiedades tiene el fenol centración de ADN fue de 350 ng/μl. explique por 2. además. Nueva York: Cold Spring Harbor. fase acuosa y no en la fenólica Bibliografía Chomczynski P.16:1215.162:156–159. 1988. ción de ácidos nucleicos? 3. Nucleic Acids Res. dure for extracting DNA from human cell. Polesky S.. Dibuje el espectro de luz infrarrojo. ¿qué pureza tiene la muestra? Explique branas y las proteínas de la célula en la técnica de extrac- la interpretación del resultado.31. Sample and assay technologies.. presentan un obtenida de una muestra cuya absorbancia a 260 nm fue máximo de absorción. Calcule la cantidad de ADN por gramo de tejido si la con. 6. Vol 1... visible y ultravioleta muestra diluida 1:25 que arrojó una absorbancia de 0. Según el 5. 2001. A simple salting out proce. Single-step method of RNA isolation by Quiagen. a esos nanómetros.D. mientras que a 280 nm fue de 0. Anal Biochem.F.185 e indique en su esquema en qué longitud absorben los leída a 260 nm.

purificación. Por lo tanto. inmediatamente sobre un molde de forma rectangular y en 110 . es decir. Este campo se genera dentro de una solución amortiguadora en la que se encuentra sumer- En biología molecular. con la migrarán hacia el polo positivo. miento generado por el campo eléctrico. electrolitos permite la transmisión de la corriente eléctrica. movi. ración. que pueden tener una carga positiva o negativa. La cáma- sistemático del análisis (separación. Sin dejar enfriar se vacía generación de un campo eléctrico alrededor de un gel don. como el dodecilsulfato de sodio (SDS). formando un gel altamente poroso. compuesto por polímeros que forman una especie de malla o fiere carga negativa. ración por tamaño de los diferentes componentes de la mues- El principio de la electroforesis consiste en la migración tra. el ánodo. que se enlistan de 50 a 60ºC. por lo que supone una parte importante del procedimiento manteniendo el pH estable al paso de la corriente. pueden desplazarse cuando se ven sometidas (figura 12-2B). en una electroforesis. En las cámaras de electroforesis vertical el polo las biomoléculas poseen una carga eléctrica cuya magnitud positivo se encuentra en la parte inferior de la cámara (figu- depende del pH del medio en el que se encuentran. en uno de los extremos consecuencia. En el finalidad de evitar perturbaciones mecánicas durante la sepa- caso de las proteínas se realiza pretratamiento con deter. A diferencia de las proteínas. los ácidos nucleicos sólo Gel poseen carga negativa. con ello se homogenizan las proteínas microporos tridimensionales a través de los cuales avanzan de la muestra y todas migrarán hacia el polo positivo. La mayoría de energía. una gran cantidad de técnicas que se gido el gel que contiene las muestras. que les con. y sólo las moléculas. gentes. como ra 12-2A) y en las horizontales. que se disuelve fácilmente en temperatura elementos que se describen a continuación. Geles de agarosa La agarosa es un polisacárido extraído de algas marinas que Elementos necesarios para una electroforesis tiene la propiedad de mantenerse en estado sólido a tempe- Para realizar una electroforesis se requiere de una serie de ratura ambiente. ra cuenta con dos polos que se conectan a una fuente de ción) de los ácidos nucleicos y las proteínas. debido a su esqueleto de fosfatos. Capítulo 12 Electroforesis David Alejandro López de la Mora / Ana Soledad Sandoval Rodríguez Introducción de se depositan las muestras. sólo de acrilamida. En ambos tipos de cámaras el polo positivo a un campo eléctrico hacia el polo de carga opuesta al de la se distingue con color rojo y el negativo con negro. se torna líquida y se solidifica cuando se enfría en la figura 12-1. lamida y para proteínas. prepara. se disuelve en una solución amortiguadora adecuada de la misma composi- Cámara de electroforesis ción y concentración que el buffer de corrimiento y se calien- La cámara de electroforesis es un dispositivo que permite la ta hasta formar una solución. según su peso molecular o tamaño. Los geles pueden ser de agarosa o poliacrilamida. lo que permite la sepa- se separarán por tamaño. Para la proporcional de las moléculas a través de un gel u otro tipo separación de ácidos nucleicos se usan geles de agarosa o acri- de matriz porosa. los ácidos nucleicos La muestra debe colocarse sobre un medio de soporte. Para elaborar el gel se pesa la cantidad de agarosa requerida. molécula. El soporte idóneo es un gel semisólido o gelatinoso. el alto contenido de realizan comúnmente requieren el uso de la electroforesis. según el peso molecular.

Cámaras de electroforesis. los poros de la matriz del gel depende de la concentración de agarosa utilizada y la concentración de agarosa es inver. según la concentración del mismo plásmido (figura 12-5). Por ello. La figura 12-4 representa la migra. ya que el polo positivo de encuentra en la parte inferior Buffer molecular 1KB de la cámara. aunque se trate cos con pesos moleculares variados. antes de una de agarosa que se emplee. El tamaño de electroforesis de ácidos nucleicos es de 0. Esto se puesto tóxico y permite realizar el análisis de ácidos nuclei. En el caso de ácidos nucleicos no lineari- zados. loro y químicamente inerte. Figura 12-1. electroforesis es importante la linearización y la elimina- ción es menor que el de los geles de poliacrilamida. CAPÍTULO 12 • Electroforesis 111 Cámara de A) electroforesis Peine para pocillos MIGRACIÓN DE LA MUESTRA Gel Transiluminador Fuente de poder B) 100 MIGRACIÓN DE LA MUESTRA Figura 12-2. Geles de acrilamida samente proporcional al tamaño del poro obtenido. Duran.5 a 2%. A) En las cámaras de Buffer de corrimiento Marcador de peso BUFFER Buffer de carga electroforesis vertical el corrimiento de la muestra sigue la gra- vedad. esto es. B) En la electroforesis horizontal debe cuidarse que el ánodo se coloque hacia el extremo del gel donde corren las muestras. con el que se pueden generar versa. La concentración de agarosa más utilizada para nucleico que se vaya a analizar (cuadro 12-1). ya que no es un com. En la imagen se aprecian los elementos que se requieren para el corrimiento electroforético y visualización del gel. como plásmidos circulares (conformación nativa). La acrilamida es un polímero sintético. la migración no sólo depende del peso molecular sino tam- uno de los extremos se coloca un aditamento en forma de bién del grado de empaquetamiento que presenten. poliacrilamida es el resultado de la polimerización química ción de las moléculas de ADN en un gel de agarosa. los ácidos nucleicos lineales con un peso poro de un gel de acrilamida está determinado por la con- molecular alto migran al ánodo más lentamente que los de centración total de acrilamida presente (acrilamida + bisa- menor peso molecular. termoestable. La agarosa tres conformaciones distintas de la misma molécula: la for- posee ventajas sobre la acrilamida. y vice. se visualizan donde se colocarán las muestras (figura 12-3). que generalmente se maneja en proporción de cos de peso elevado tardan más tiempo en atravesar los 19:1. Esto se debe a que los ácidos nuclei. poros de agarosa. El gel de nucleico es más lenta. crilamida). de lo contrario las muestras se salen del gel. ARN con estructuras secundarias o ADN de gran longitud. inco- a mayor concentración. Sin embargo. Regulando la concentración de ambas y su proporción . Elementos necesarios para una electroforesis. menor tamaño de los poros. de una mezcla de acrilamida y bisacrilamida. refleja en tres bandas de “tamaño” diferente. su poder de resolu. ción de estructuras secundarias por desnaturalización de la centración de agarosa se escoge según el tamaño del ácido muestra. El tamaño de te la electroforesis. por ejemplo. En la peine con la finalidad de generar los pocillos u orificios electroforesis de un plásmido. La con. la semirrelajada y una relajada. si los poros son pequeños la migración del ácido geles con un amplio intervalo de tamaños de poro. ma superenrrollada.

sa.0 100 pb a 500 pb nación del peso molecular de los fragmentos. El gel de acrilami- Cuadro 12-1. puede demostrar diversos patrones de corri- ebullición del solvente.112 PARTE II • Metodología del ADN recombinante AGAROSA A B C Figura 12-5. quedan en estado de radical libre y reaccionan moléculas de poliacrilamida enlazadas por sus grupos ami- no. o N. 4. La bisacrilami- merización vinílica en la cual se activan los monómeros de da. Se representa 2. Perfil electroforético de un plásmido. También es esencial léculas de acrilamida se unen cabeza con cola. Electroforesis de ácidos nucleicos. con el resultado de que las mo. La acrilamida es una neurotoxina. El gel se coloca de manera que los linearizado.8 500 pb a 15 kb 1. Preparación de un gel de agarosa.5 80 pb a 4 kb Figura 12-4.3 > 700 pb nucleico 0. La muestra se 6. la formación del gel requiere que de los geles de agarosa. Cuando la acrilamida se encuentra varias cadenas queden trabadas (lo que se consigue con la en disolución acuosa experimenta autopolimerización de bisacrilamida). antes de que se enfrié a menos de 50°C se coloca en una A) Plásmido superenrrollado.0 10 pb a 100 pb carga en los pocillos y se deja correr hacia el polo negativo. C) Plásmido cámara para formar el gel.0 500 pb a 1 kb molecular junto a las muestras para ayudar en la determi. Este compuesto polimeriza conjuntamen- te con la acrilamida y establece puentes entre las cadenas lineales de poliacrilamida.N’-metilenbisacrilamida.2 150 pb a 6 kb 1. Una vez obtenido el líquido de agaro. El cuadro indica las concentraciones de agarosa recomendadas según el peso molecular que se espera encon- trar en las muestras. por lo forma espontánea y lenta. siempre menores que la lizarse unas sobre otras. Concentraciones de agarosa para geles de ácidos Muestra nucleicos. Al aumentar la concentración de agarosa se reduce el poro del gel. que debe manejarse con precaución. miento electroforético según la conformación de la estructura. sino que se encuen- tra en estado viscoso debido a que las cadenas pueden des- se consiguen distintas porosidades. está compuesta por dos acrilamida.0 250 pb a 12 kb Gel 1. reducir la autopolimerización y la hidrólisis. En presencia almacenarla en un lugar refrigerado. Ladder Agarosa (%) Tamaño de banda Banda de ácido 0. Aunque la Figura 12-3. con lo que se evita su desliza- miento y conduce a la formación del gel. seco y oscuro para de un sistema generador de radicales libres se da una poli. rápidamente para formar polímeros de cadena larga.5 700 pb a 25 kb 0. El polímero en disolución no forma un gel. La agarosa molécula de ADN (en este caso un plásmido) tenga la misma es un polvo que para disolverse requiere calentarse hasta la longitud en pb. lo que permite la discriminación de Migración Patrón o fragmentos de menor tamaño. . para permitir que la muestra corra a lo largo del gel.0 100 pb a 3 kb un gel de agarosa en el cual se visualiza un marcador de peso 3. no reactivos. pocillos queden en el extremo donde se localiza en polo negati- vo de la cámara de electroforesis. B) Plásmido circular.

El tamaño del gel de apilamiento debe ser del doble de la altura del pozo donde se va aplicar la muestra.3. un Gel de gel de poliacrilamida de poro pequeño hecho de un amorti. La electroforesis con geles de acrilamida siem- pre se realiza en cámaras verticales. En el caso de los ácidos nucleicos. El buffer TBE contiene Tris Buffer de corrimiento base.8. cuando se hace. Al estar pretratadas con SDS. Los marcadores de peso molecular lamida recomendadas según el peso molecular que se espera están disponibles comercialmente en amplia variedad. lo que permite la discrimi. En el encontrar en las muestras. y se maneja a un pH de 7. Este gel se coloca sobre el gel de resolución. como buffer de corrimiento.8. El gel de concentración tiene un tamaño de poro grande empacamiento y se prepara con un amortiguador de Tris/HCl con pH Patrón o de 6. mantiene a las proteínas en donde la muestra se separa en sus componentes según su estado extendido.0 40 a 200 III y una escalera denominada 1 Kbase plus ladder. Estas condiciones pro. La adición de SDS a los geles de poliacrilamida fase superior donde las moléculas se concentran y una inferior es opcional. éstos pueden ser fagos o plásmidos sometidos a corte con nación de fragmentos de menor tamaño. Al aumentar la concentración de caso de marcadores de peso molecular de ácidos nucleicos.0 80 a 500 incrementos de tamaño gradual. 25 mM. Figura 12-6. resolución guador de Tris/HCl.5 1 000 a 2 000 denominadas escaleras. 12-6 se representa la electroforesis de proteínas en gel de acrilamida. a para la transmisión de la corriente eléctrica y mantiene un pH 8. El El buffer de corrimiento es de la misma composición y pH buffer TAE contiene Tris base. Una cuadro 12-2. de manera dependiente del porcentaje de acrilami. con un pH de 8. CAPÍTULO 12 • Electroforesis 113 da es capaz de soportar mayores voltajes que la agarosa y es susceptible de teñirse por varios procedimientos.5. ácido bórico y EDTA. el pH sin variaciones mientras se realiza el corrimiento. lo que facilita la movilidad electroforética peso molecular. En la figura 12-7 se pue- den ver las bandas que se obtienen de los fragmentos con 8. y también puede desteñirse en caso necesario. como es el fago Phi X174/Hae 12. La electroforesis de Muestra proteínas emplea geles de acrilamida de dos capas de gel a diferente concentración de acrilamida.0 6 a 100 serie de proteínas de peso molecular conocido (que van . El cuadro indica las concentraciones de acri. lo que les permite migrar hacia el dependa exclusivamente de su masa molecular. ajus- que el buffer con el que se prepara el gel de resolución. 192 mM. En la figura polo positivo con independencia de su carga inicial. Banda de ácido porcionan un ambiente para que las proteínas recubiertas nucleico con SDS se concentren.0 60 a 400 un marcador de uso común. Las proteínas se da utilizado para su preparación. Acrilamida (%) Pares de bases también puede tratarse de moléculas de ADN sintéticas 3. pueden emplearse TBE o TAE Marcador de peso molecular Son moléculas de ADN o de proteínas que permiten deter- minar por comparación el tamaño de los fragmentos de áci- Cuadro 12-2. un gel superior o concentrador y un gel inferior de separación o de resolu. Los 15. ácido acético y EDTA. SDS al 1% y glicina. Electroforesis de proteínas. Gel de Migración ción. En el gel de resolu- ción es donde las proteínas se separan de acuerdo con su tamaño. acrilamida se reduce el poro del gel. dos unidades de pH menor que el buffer de corri- Ladder miento hecho de Tris/SDS/glicina. Los geles de acrilamida pueden digerirse para extraer fracciones separadas (ban- das) o desecados para su exposición radiográfica y registro permanente. El buffer de corrimiento de electroforesis de sea de agarosa o de acrilamida. las proteínas se de la proteína mediante el gel y permite que la movilidad rodean de cargas negativas. enzimas de restricción que generan fragmentos de tamaño. Concentraciones de acrilamida para geles de dos nucleicos o proteínas contenidos en las muestras some- ácidos nucleicos.0 25 a 150 marcadores de peso molecular de proteínas suelen ser una 20. Éste proporciona el medio proteínas lleva Tris. ya tado a pH 8. porque contienen fragmentos con 5.2. como se describe en el corren en geles de acrilamida formados por dos fases. tidas a electroforesis.

Marcadores de peso molecular para ADN. también se dispone la interferencia del líquido. corre por unos minutos a bajo voltaje hasta que la muestra nantes que contienen un sitio de unión a inmunoglobulina entre en el gel y entonces se cubre del todo con el buffer de (Ig) G. En general emiten energía a 1. con la finali- tos sintéticos de ADN. las cuales pueden estar teñidas o corrimiento de tal manera que la parte superior del gel no coloreadas. la fuente de 300 energía se encuentra reflejada y no pasa a través de la mues- tra. Este amortiguador tiene como fin brindar peso. lo que facilita su depósito en el pocillo Electroforesis vertical y evita su salida del gel. densidad y color a la muestra. deberá añadirse beta-mercaptoe- 603 tanol a este buffer y habrá que calentar las muestras a 95°C por 5 minutos. desde el momento de cargar las es compatible con quimioluminiscencia.650 que emite energía fluorescente que permite visualizarla. aunque también existen 188 850 para 254 y 365 nm. Una vez cargada la muestra.000 una longitud de onda a 302 nm.000 turalizantes y reductoras. En la imagen el primer carril corresponde a las bandas que se obtie. muestra los fragmentos de una escalera formada por segmen. además. se de marcadores de peso molecular de proteínas recombi. ditiotritiol (DTT). Transiluminador ultravioleta 310 271.000 Mientras que el buffer de carga para proteínas contiene Tris-HCl. pH 6. el marcaje cromo.353 1. muestras en los pocillos como se ejemplifica en la figura génico y la fluorescencia. En el caso de que se deseen condiciones desna- 872 5. dad de evitar que se seque por el calentamiento inducido por el paso de la corriente eléctrica. Figura 12-7. El epi-iluminador es efectivo en geles muy densos. También existe la técnica denominada electro- anticuerpo primario o secundario empleado para la detec. se uti- 1:3 para ácidos nucleicos o 1:6 para proteínas. 12-8. foresis submarina. SDS.078 bromofenol. En esta técnica el buffer siempre debe cubrir el gel. Al momento de cargar las muestras en los pocillos. 12. excitando la molécula cromogénica 1. En los casos en que la electroforesis sea un paso se cubra de buffer para que los pocillos puedan llenarse sin previo para la técnica de Western blot.114 PARTE II • Metodología del ADN recombinante contiene Tris. permite. monitorear el corrimiento de la muestra en el gel. Para el corrimiento el buffer debe cubrir el gel.000 El transiluminador transmite luz del espectro ultravioleta a 234 través de la muestra. 480 nm) 400 generan la emisión visible por fluorescencia igual que el transiluminador pero. Los epitransiluminadores (365. lo que los 500 hace más flexibles. a diferencia de éste. El sitio de unión a IgG puede ser reconocido por un corrimiento. mientras el segundo carril Se lleva a cabo con gel de agarosa para ácidos nucleicos.281 2. 200 Una vez que se tienen los materiales necesarios existen 100 dos maneras de realizar la electroforesis: de forma horizon- tal y vertical. y suelen contar con un botón para baja/ alta intensidades por si se requiere una menor exposición 650 de la muestra a la luz ultravioleta.8. El 194 transiluminador es el sistema empleado con más frecuen- cia por ser simple y efectivo. glicerol y azul de 1. azul de bromofenol. Se emplea en relación Empleada exclusivamente con gel de poliacrilamida. y se llama submarina cuando la muestra se coloca con el gel Buffer de carga sumergido en el buffer. cantidad de muestra. El buffer de carga de ácidos nucleicos El gel debe estar contenido entre dos placas rectangulares . azul de xileno y glicerol. llenar parcialmente la cámara con líquido de desde 10 hasta 300 kDa). Algunos también permi- 72 ten la selección de entre dos longitudes de onda. Este sistema buffer de corrimiento. en la que la totalidad del gel se cubre con ción de la proteína buscada por Western blot. esto es. Electroforesis horizontal nen de los fragmentos con un marcador como es el fago Phi X174 digerido por la enzima Hae III. respecto a la liza para proteínas o ácidos nucleicos de pequeño tamaño. se puede optar por hacerlo en seco.

la movilidad de la Gel electroforesis dependerá únicamente de la longitud del ADN Cámara de (pb) y se representará en bandas (figura 12-10). Preparar un gel de agarosa o acrilamida a la concentra. qué concentración de agarosa es la más adecuada. CAPÍTULO 12 • Electroforesis 115 3. pb. y cuyo número es igual corrimiento al doble del número de pares de bases. Ejemplificación de electroforesis submarina. El buffer de la parte externa permite que el polo positivo cuente con la misma solución buffer que transmita la corriente a la parte inferior del gel. 4. Electroforesis vertical. muestra que se desee separar. Algunas A continuación. Son ideales para preparar Procedimiento general de una electroforesis geles analíticos de productos procedentes de técnicas de reacción en cadena de la polimerasa (PCR) u otras. se recomienda utilizar un gel de poliacrilamida que buffer en el que se encuentra embebido el gel y llena las permita esta resolución. Las agarosas con un punto de fusión cubetas o compartimientos del ánodo y el cátodo como se bajo permiten la preparación de geles a elevadas concentra- aprecia en la figura 12-9. Para la preparación del gel debe estandarizarse primero 1. según la ción requerida. ción en el pocillo. con una concentración de 0. de carga negativa. de bromofenol y azul de xileno) contenidos en el buffer de miento y retirado el peine que sirve de molde para la formación carga con el que se mezcló con la muestra previa a su coloca- de los pocillos. El avance electroforético se Figura 12-8. se exponen los pasos de los que consta una son capaces de separar fragmentos que difieren entre 10 y 20 electroforesis típica. a mayor voltaje mayor velocidad de corrimiento. Cargar las muestras en el gel. 20 a 25 ml son suficientes para las dimen- Buffer interno Buffe B Buffer externo Figura 12-9. Dado que la forma de la molécula de ADN siempre es la misma. ciones y se aconseja para obtener una buena separación de moléculas de ADN con < 1000 pb. Visualizar los ácidos nucleicos Pocillo Electroforesis de ácidos nucleicos El método más común para la electroforesis de ADN es ela- borar un gel horizontal de agarosa. 5. En esta cámara se aprecia cómo el gel de acrilamida ha quedado embebido en buffer de corrimiento en su extremo superior gracias a la colocación de amortiguador en la parte interna de la cámara. La monitorea a través de la visualización de los colorantes (azul muestra se coloca después de haber vertido el buffer de corri. Si los fragmentos de ADN son pequeños (menos de 50 pb) o bien se requiere discernir entre fragmen- tos de ácidos nucleicos con una diferencia de longitud de 1 a de vidrio donde la corriente eléctrica se genera gracias al 20 pb. de electroforesis.5 a 2%. El corrimien- electroforesis to se realiza a voltajes de entre 25 y 100 V. . 2. Realizar la corrida electroforética al voltaje pertinente. Mezclar las muestras a analizar con un buffer de carga El volumen de agarosa depende del tamaño de la cámara adecuado. La carga eléctrica de la molécula de ADN la otorgan Buffer de sus grupos fosfato.

La imagen Visualización de las muestras muestra fragmentos de ADN de mayor a menor tamaño (parte Para la visualización de los ácidos nucleicos se utiliza un superior hacia parte inferior) visualizados con un agente in- colorante fluorescente. el empaquetamiento del ADN. El bromuro de eti- dio. o puede incorporarse lue- Inmediatamente después de vaciar la agarosa a la cámara. el voltaje.5 mg/ml. el bromuro de etidio. Para el caso de Figura 12-11.5 a 1 cm por enci- ma del gel) y se retiran los peines. unos 30 minutos. respectiva- mente.5 cm (L × A × A). Fuente de poder. Este marcador también debe mezclarse con un buffer de carga. Hay múltiples factores que pueden afectar la migración del ADN. por lo menos. . La selección de las condiciones de de ADN genómico y plasmídico (> 2 kb) se recomienda corrimiento puede ser con un amperaje constante o bien a aplicar valores de entre 25 y 75 V. En geles de agarosa. se incorpora a la agarosa (0. por lo general. incubando el gel en una solución que lo debe insertarse el o los peines necesarios. como en este caso. el tama- ño de la molécula de ADN muestra. o bien cuando la muestra ha corrido por Menor intensidad lo menos tres cuartas partes del gel. En la figura 12-11 se apre. mA Una vez depositadas las muestras en los pocillos se pro- cede a la transmisión de la corriente eléctrica. como la concentración del gel utilizado. Se conectan V/A los cables de la fuente de energía de cada polo eléctrico a la STOP RUN/PAUSE VOLTS/AMPER cámara de electroforesis en el electrodo que le corresponda y se aplica un voltaje de acuerdo con el peso molecular de las moléculas de ADN que se va a separar. Durante el corrimiento se monitorea la migración de la muestra con colores que contiene el buffer de carga. Una vez solidificado el gel. que indica el amperaje. ADN y el ARN. Debido a esta propiedad es un agente muta- génico y debe manipularse con cuidado. que tiene la tercalante. Debe considerarse el uso de un marcador de peso molecular en. Las muestras se mezclan con el buffer de carga y se depositan cuidadosamente en los pocillos. etcétera. se recomienda fuente de poder donde se indica el miliamperaje a que está usar voltajes comprendidos entre 75 y 100 V. la composición del buffer de corrimiento. Movilidad de fragmentos de ADN. la contaminación con agentes intercalantes en la muestra. antes de permitir la solidificación. Se aprecia cómo la intensidad de la banda obser- vada es variable.5 y 1. mientras que la naranja cuando se expone a la luz ultravioleta (longitud de poliacrilamida. El bromuro de etidio fluorece de color en solidificar alrededor de 20 minutos. La imagen muestra una típica productos de PCR (entre 100 pb y 1. para la determinación del peso molecu- lar de la muestra. go del corrimiento. con su pantalla. el azul de xileno migra de manera similar a un fragmento de ADN de 4 kb.116 PARTE II • Metodología del ADN recombinante cia una fuente de energía. mientras que el azul de bromofenol se com- porta como un fragmento de 300 pb. lo que indica groso modo cuál fragmento se propiedad de intercalarse entre las bases nitrogenadas del encuentra en mayor cantidad y cuál en menor. Para muestras siendo corrida la muestra. uno de los carriles. evitando que se salgan y puedan entrar en otros pozos contaminando el pocillo contiguo. voltaje constante. se añade el buffer de corrimiento (TAE o TBE) a concentra- ción 1×. excepto cuando ya viene preparado V para su uso de la casa comercial en que se obtuvo. la temperatura del buffer de corrimien- Menor tamaño to (que puede aumentar demasiado si el voltaje es muy alto). Figura 12-10. La agarosa tarda contenga a 0.5 mg/ml) siones más comunes del gel: 8 × 6 × 0. Es importante que se estandarice el tiempo de electroforesis a fin de conseguir la mejor resolución posible. dentro del rango de 0.5 kb). La electroforesis se Mayor tamaño detiene cuando se considera que la muestra se localiza en la posición deseada. cubriendo perfectamente el gel (0.5%. donde Mayor intensidad se observa el color azul y el verde correspondientes a los colorantes azul de bromofenol y azul de xileno.

de lo contrario.N’. 1–2 ng de oligonu. aumento en su concentración disminuye la longitud media ta es más sensible que el bromuro de etidio. se debe de asegurar que los formado por dos geles de poliacrilamida (uno de resolución pocillos del gel estén totalmente cubiertos por el buffer. ción. composición y pH. por lo que es un puede detectar 60 pg de dsADN/banda. sumergir los geles en el tanque. un gel con. el SYBR®-Green es un fluoró. ya que un sos. absorción de 254 nm. y otro de compactamiento). según su tamaño. éste utiliza reactivos peligro. como polimerizadores en concentraciones del orden de 1 a muro de etidio.N. Su sensibi. para este procedimiento se recomienda el uso de guantes. El TEMED funciona como otro iniciador de geles de acrilamida una alternativa al bromuro de etidio es el polimerización. y 100 a 300 pg de ARN o ssADN/banda. no covalente a los ácidos nucleicos. se mezclarían. que difieren en su concentra- La señal fluorescente es proporcional a la cantidad de pro. Cabe recordar que en el caso de los geles de acrilamida En la actualidad. Por otro lado. Para los forma el gel. el ADN ra a partir de una solución al 30% de acrilamida-bisacrila- puede visualizarse con una luz ultravioleta en el rango de mida 19:1. por lo tanto. sin embargo. mutagénico y cancerígeno. Es . y B) Syber®-Green. mita la polimerización en un tiempo óptimo. se añade persulfato de amo- foro que se une con gran afinidad al surco menor del ADN nio (APS) y N. fluorescencia a 280. además. una solución de SDS. Con este colorante. Este colorante tiene una generando un patrón electroforético. para continuar con la del etidio es teratogénico. más barata a de la cadena de polímero y. Visualización de fragmentos de ADN. Estas fotografías son de un gel de agarosa donde la muestra fue visualizada por A) bromuro de etidio. la tinción con pla. Por ello. El gel de acrilamida se forma entre dos vidrios. En la figura 12-12 se aprecia una ticidad y le resta transparencia al gel. Las propiedades del gel resultante depen- nitrato de plata. debe utilizar- muestra visualizada por bromuro de etidio y otra por SYBR® se la menor concentración posible de catalizadores que per- Safe. El bromuro de merización total del primero. y el siste- Electroforesis de proteínas ma completo se sumerge en el buffer de corrimiento dentro El método más empleado para electroforesis de proteínas se de la cámara vertical de electroforesis. como el formaldehído. Ésta se mezcla con el buffer correspondiente y 470 a 530 nm. donde las moléculas de ADN migrarán. dos por una fase de separación visible a contra luz. que se une de manera el gel de resolución. y es unas 25 veces más fluorescente que el bro. SYBR®-Green con epiiluminación de 254 nm 10 mM. una excitación máxima a 502 nm y Para electroforesis de proteínas. SYBR® Safe. la acrilamida se prepa- una emisión máxima a 530 nm. El APS genera radicales libres. Por otro lado. disminuye su elas- largo plazo y menos tóxica. iniciador de la reacción de polimerización que finalmente cleótidos. es decir. como puede observarse en la figura 12-10. CAPÍTULO 12 • Electroforesis 117 A) B) Figura 12-12. el bromuro de etidio se ha sustituido por para ácidos nucleicos sólo se tiene una fase. Los geles están unidos pero limita- ducto. con longitud de emisión de 366 nm). conformada por un compuesto comercial.N’-tetrametiletilenodiamina (TEMED) bicatenario. den de la concentración de APS y TEMED. En el momento de lleva a cabo en un sistema discontinuo. en estado líquido. para lidad permite detectar aproximadamente 30 pg de ácido lograrlo deben prepararse por separado esperando la poli- nucleico por banda (según el grosor del gel). por lo que segundo.

una reacción fisicoquímica. La distancia mul. donde la presencia de determinada secuencia del ácido nucleico en una mezcla de moléculas se Visualización de las muestras distingue por su tamaño. de las cuatro reacciones de elongación con los dideoxinu- mientras que la tinción con plata incrementa este límite de cleótidos (véase el capítulo 17. se conectan los cables correspondientes de de las proteínas. de ácido acético antes de fotografiar o escanear. seguido de agua y posteriormente tiosulfato de sodio secuencia. El valor del amperaje o cortados con enzimas de restricción (mapa de restricción). el gel se seca para conservarlo. se realiza Algunas veces. También. corriente eléctrica (medida en amperios o miliamperios) comparar los tamaños de distintos tipos de ADN. y analizar productos de PCR. lo que permitirá la visualización de las ban.04% (llamada también formol al 35%). el gel se sumerge en un recipiente contenien. que correspondiente al flurocromo con que el producto está actúa como revelador. Inclu- desarrollar el color en el gel por incubación en soluciones sive. nor. con el cual se asegu. como residuos de glicosilación. para la identificación de moléculas parti- nas sobre grupos de ácido sulfónico. excep. La tinción de Coomassie Blue clásica. La muestra mezcla. Aquí se deja secar en condiciones ambientales da con el buffer de carga se deposita con cuidado en los poci. en consecuencia. en la que se rompen enlaces pep. color y todas las proteínas tienen características distintas de ra que los pocillos se limpien antes de cargar las muestras. se puede sensibilidad unas 50 veces. donde es posible la detección inme- riormente. secuenciación. con calor. que podrían retardar la migra- Una vez colocadas las muestras de proteínas en cada ción de las muestras. la electroforesis puede ser un proceso previo a te. la do el colorante azul brillante de Coomasie y se incuba por electroforesis se aplica para la identificación de fracciones unos minutos. considerar el uso de un marcador estándar de proteínas para Algunas proteínas pueden migrar anómalamente y apa- la medición del peso molecular de la muestra. En el caso de las proteínas. Asimismo. aislar y dependerá de la fuerza iónica del buffer. Después de este proceso se lava y se procede a la basan la detección de los fragmentos amplificados en una incubación en frío (4°C) en cloruro de plata al 0. tinción. como es el das de proteínas. entre otros. Se cubre el gel con un raturas elevadas (95°C). reactivos reductores (beta-mercaptoetanol) y tempe. Aplicaciones de la electroforesis tiplicada por 8-15 V permitirá determinar el voltaje del Algunos de los usos de la electroforesis para ácidos nuclei- corrimiento. que el que se obviará el uso del buffer de carga. sobre todo. ción con una sonda específica. Para el cálculo del voltaje es importante conocer la distancia en centímetros del gel des- de la parte superior hasta la parte inferior.118 PARTE II • Metodología del ADN recombinante común en los geles de acrilamida realizar un precorrimiento Muchas variables pueden influir en la intensidad del de unos 10 a 30 minutos a voltajes bajos.01%. haya llegado a los lími. la electroforesis es crucial en técnicas como la unión mecánica. pero. Secuenciación). Asimis- interacciones hidrofóbicas participan en este proceso de mo. electroforesis capilar. Por último. las técnicas de hibridación. esto someterse a los mismos tratamientos que la proteína. se coloca en una lámina de celofán hidrof ílico y no plas- (SDS). Para ello. Hay que el uso de desecadores de geles. o proteínas séricas. 25 a 30 mA. El proceso de coloración se basa en la caso de la electroforesis de globulinas. . El voltaje óptimo dependerá de la molécula cos en geles de agarosa son determinar los tamaños mo- que se piensa separar. con la selección de vol. analizar los fragmentos estandarizar este procedimiento. y suelen aparecer manchas difusas en todo el carril. tificado que cubra totalmente el gel. primero se deshidrata en glicerol-metanol y. proteicas o proteínas particulares por tamaño. puede deberse a que presentan modificaciones postraduc- to cuando se trate de un marcador previamente teñido. Para la preparación de la muestra de proteína. en cionales en su estructura. En el caso de traba. atracción electrostática del enlace peptídico de las proteí. el valor recomendado es de nes moleculares. se lava e incuba con carbonato de sodio al 2% en diata de los segmentos amplificados y su lectura por el láser formalina al 0. taje o amperaje adecuados. La electroforesis se realiza hasta que el coloran. donde tras un corrimiento electroforético malmente puede detectar bandas de proteína de 50 ng. que debe recer con un peso molecular mayor que el esperado. se incuba con soluciones marcado. como el Southern blot (ADN) o tes de la parte inferior del gel. poste. se recomienda leculares de los ácidos nucleicos. La tinción con plata consiste en deducir la secuencia del segmento de ácido nucleico. si existe desnaturalización pocillo del gel. el Northern blot (ARN). que tiñen la proteína culares empleando posteriormente una reacción antígeno- de color azul. que al final consigue desnaturalizar segundo celofán previamente remojado en agua y se sella la proteína hasta su estructura primaria. por aproximadamente dos días o se acelera el proceso con llos. los secuenciadores automáticos modernos emplean de metano al l40%: ácido acético al 10%. evitando la contaminación del pocillo contiguo. Asimismo. fosforilación y acetilación. Asimismo. la cual se confirma por hibrida- Si se requiere. luego metanolal una electroforesis capilar para el discernimiento de la 40%. los termocicladores en tiempo real al 0. recuperar fragmentos de ADN purificados para clonacio- jar con buffer Tris-SDS-glicina. las fuerzas de Van der Waals y las anticuerpo específica en la técnica de Western blot. visualizado como una línea azul.1%. posteriormen- tídicos y puentes disulfuro por acción de detergentes iónicos te. se considera que la proteína está degradada los electrodos a la fuente de energía.

Russell D. 6. En qué carril y qué peso molecular presenta la banda que tiene mayor concentración. CAPÍTULO 12 • Electroforesis 119 A B C D E 1650 pb 1000 pb 500 pb 300 pb 200 pb 100 pb Figura 12-13. del carril C. 1998. 8.. Explique su respuesta. Press. El sentido de corrimiento de las muestras con una flecha. En qué carril se localiza el marcador de peso molecular. The effects of electroendosmosis in agarose tory manual. En: Molecular cloning a labora- . que: 5.. Ejercicios de integración Basándose en la imagen de una electroforesis de agarosa 4. En qué carril y qué peso tiene la banda de menor con- para fragmentos de ADN representada en la imagen. Li X. Nueva York: Cold Spring Harbor Laboratory electrophoresis. De qué peso molecular es la banda de menor tamaño mente la misma muestra. Electrophoresis. De qué peso molecular es la banda de mayor tamaño del 7. 3ª ed. centración. 2001. 3. La polaridad correspondiente a cada extremo del gel. carril D.W. 2. indi. Gel electrophoresis of DNA and pulsed- field agarose gel electrophoresis. qué carriles contienen aparente- 1. Fang Y.19:1311-1213. Bibliografía Guo Y. Suponiendo que son muestras de ADN digeridas por enzimas de restricción.. Sambrook J.

coli. El ADN de la bacteria que produce la enzima Las enzimas de restricción presentan actividad endonu. virus con de ADN provenientes de humano. bacterias y demás capacidad de infectar a dichas bacterias. se sabe que todas las especies de bacterias sinte- ción clínica. existen 3’exonucleasas las que escinden enlaces en Las endonucleasas de restricción forman parte de la maqui- el extremo 3’ de la cadena. investigación básica y la clínica. y en En 1960. ciones virales. es decir. y reciben el nombre de exonucleasas si cortan los enlaces fosfodiéster de los nucleótidos en los extremos de las cade- Origen de las enzimas de restricción nas. Stewart Linny y Werner Arber aislaron. de restricción no se ve afectado por su propia enzima. exógeno en la célula bacteriana que produce dicha enzima. Estas endonucleasas se denominan enzimas de restric- miento o para su aplicación en el área de la medicina. ya cleasa. RFLP). así como en la construcción de doble cadena de ADN exógeno. que las bacterias metilan determinadas secuencias a su pro- diéster del ADN en una secuencia específica denominada pio ADN para diferenciarlo del ADN viral por medio de 120 . desde la determinación de polimorfismos de tizan uno o más tipos de endonucleasas capaces de hacer longitud de fragmentos de restricción (restriction fragment cortes en secuencias específicas de nucleótidos de una length polymorphism. de Haemophilus influenzae. la caracterización y el aislamiento de los cadenas de ADN genómico para manipularse y analizarse diferentes tipos de enzimas ha facilitado en la investigación en fragmentos más pequeños. tran las nucleasas. ya que han revolucio. una secuencia única de 4 a 8 nucleótidos. enzimas que metilaban moléculas de ADN y que ade- nado los métodos analíticos generando gran impacto en la mas cortaban un enlace fosfodiéster del ADN no metilado. este ADN vectores con ADN recombinante y clonación de secuencias “extraño” es el proveniente de los bacteriófagos. su regulación y su posterior correlación con el desarrollo de como la ligasa. son de origen bacteriano y cortan los enlaces fosfo. particular en las ciencias de la salud. Más tarde. En la dial para la ejecución de diversos ensayos útiles en investiga. virus. donde realizan el cleasas si son capaces de cortar el enlace fosfodiéster en corte. Así. Entre ción debido a que restringen la permanencia de un ADN las enzimas que modifican los ácidos nucleicos se encuen. aquellas capaces de cortar los Las enzimas de restricción empleadas con más frecuencia enlaces fosfodiéster que unen los nucleótidos de una cadena en la metodología del ADN recombinante suelen reconocer de ácidos nucleicos. especialmente en el diag. actualidad. en E. de técnicas de biología molecular en diversas áreas. Capítulo 13 Enzimas de restricción Jaime González Cuevas / Miriam Ruth Bueno Topete Introducción secuencia diana. denominada Hind I. restricción por Daniel Nathans Hamilton Smith. Las nucleasas se denominan endonu. nucleótidos localizados dentro de la cadena del ácido nuclei- co. microorganismos de interés para la generación de conoci. El empleo de las enzimas de las tareas del estudio de los genomas así como su expresión. El uso de estas enzimas como herramienta biotecnológica surgió de la necesidad de cortar las largas El descubrimiento. se caracterizó la primera nucleasa de nóstico de enfermedades. generalmente. Hoy por hoy es común la aplicación ADN recombinante. restricción y otras enzimas que modifican ácidos nucleicos. permitió desarrollar la metodología del diversas enfermedades. y 5’exonucleasas que rompen naria con la que cuenta la bacteria para defenderse de infec- enlaces fosfodiéster en el extremo 5’ de la cadena. en 1970. aislada Las enzimas de restricción son una herramienta primor.

). Las características de los diferentes tipos H = genero Haemophilus. la cons- rio en la doble cadena en cualquier secuencia del ADN y a trucción de moléculas de ADN recombinante implica el una distancia aproximada de 1000 pb del sitio de corte. restricción. II. Tipo de enzima Gasto energético Sitio de corte en el ADN Actividad de metilasa I ATP Aleatorio. a la especie. Un mapa de restricción se define como la serie de frag- R = cepa RV 13. de polimorfismos. aislada de la 5’ GGATCC 3’GATCC 3’ cepa “RY13” de E. Todas deberían indicar con una “R” por restricción o Estas enzimas reconocen una secuencia específica y cortan el una “M” por metilasa. mas. ej. la nomenclatura de las enzimas el corte de la doble cadena de ADN en el mismo sitio de de restricción se asigna según su origen bacteriano y se reconocimiento. mentos que se generan por el corte con determinada(s) I = primera endonucleasa aislada de esta cepa. un número para distinguir si hay más de una endonucleasa aislada de esa misma especie (p. La primera letra. Las enzimas de restricción son una herramienta básica en Eco RI: clonación e ingeniería genética. fuera de la secuencia diana. corresponde al mas son palindrómicas. Tres letras en cursiva que corresponden al nombre genética. el corte de ADN genó- . enzima(s). Estas delimitar las secuencias que se insertarán en el constructo enzimas necesitan adenosín trifosfato (ATP) para moverse a recombinante.. La cepa o estirpe. entre otros E = género Escherichia. EcoR. tirá la caracterización de la secuencia. También. ya que cortan el ADN en secuencias específicas científico de la bacteria de donde fue atraída (p. si la hubiese (p. en estudios de determinación clasificado en tipo I. fines. según la función de la enzima. Clasificación de enzimas de restricción Esta herramienta es sumamente importante para la clona- De acuerdo a su función las enzimas de restricción se han ción con vectores. igual en las dos cadenas de ADN. Aplicaciones de las enzimas de restricción III = tercera endonucleasa aislada en este organismo. una enzima metiltransferasa en bases específicas. en la secuencia diana. lo largo de la molécula de ADN desde el lugar de reconoci- ralmente son las reconocidas por sus propias enzimas de miento hasta el sitio de corte. para hacer mapas de restricción de plásmidos o geno- co = especie coli. Haemophilus influenzae (Hin). las otras dos. es decir. se utilizan. En números romanos. Las secuencias de reconocimiento de estas enzi- etc. Estas enzimas sólo tienen actividad de res- define basándose en las siguientes reglas: tricción no de metilación y son las utilizadas en ingeniería 1. De la misma manera. 3’ CCTAGG 5’CCTAGG 5’ 3. III. ej. de enzimas. Tipo III 4. son secuencias que se leen género. específicos en tamaño (y secuencia) y que per- miten emplearlos para la caracterización de dicho ADN. como la técnica de RFLP . según se pre- sente o no el sitio de corte de una enzima de restricción. actividad de Por ejemplo: metilasa y requieren de ATP para desplazarse a lo largo de la Hind III: molécula de ADN. de restriccioón se resumen en el cuadro 13-1. reconocidas. Requieren Mg2+ como cofactor y no requieren Escherichia coli (Eco). d = cepa DSM 11121. Asimismo. 25 a 27 pares de bases III ATP Sí corriente abajo de la secuencia diana. Tienen. se Tipo I puede establecer la variante alélica. Por ejemplo: Por ejemplo: 2. Tipo II Nomenclatura Son enzimas que reconocen secuencias específicas y hacen Por acuerdo internacional. in = especie influenzae. CAPÍTULO 13 • Enzimas de restricción 121 Cuadro 13-1. damente de 25 a 27 pares de bases corriente abajo del sitio de reconocimiento). de ADN. Sí II Específico. ADN de doble cadena fuera de la secuencia diana (aproxima- pero generalmente se omite. obvio empleo de las enzimas de restricción para definir y más tienen la función de metilar su propio genoma. ade. EcoRV). en mayúscula. EcoRI. al igual de las de tipo I. Características de las enzimas de restricción tipo III. No Aleatorio. coli). ya que el peso molecu- Las enzimas que pertenecen a este grupo reconocen una lar del fragmento o fragmentos de ADN generado(s) permi- secuencia específica de nucleótidos y hacen un corte aleato. ej.. que gene..

generados propician la unión específica entre segmentos diferentes de ADN. . es más manipulable cuando es digerido por estas mento de 3 a 5 bases de longitud. 13-2 las enzimas que generan extremos romos (SspI. y en la figura rentes respecto al eje de simetría de la secuencia de diana.GATC---3’ 3’CTAG 3’---CTAG ---5’ PovII Proteus vulgaris 5’CAGCTG 5’---CAG CTG---3’ 3’GTCGAC 3’---GTC GAC---5 SmaI Serratia marcescens 5’CCCGGG 5’---CCC GGG---3’ 3’GGGCCC 3’---GGG CCC---5’ HaeIII Haemophilus egytius 5’GGCC 5’---GG CC---3’ 3’CCGG 3’---CC GG---5’ AluI Arthrobacter luteus 5’AGCT 5’---AG CT---3’ 3’TCGA 3’---TC GA---5’ EcoRV Escherichia coli 5’GATATC 5’---GAT ATC---3’ 3’CTATAG 3’---CTA TAG---5’ KpnI Klebsiella pneumonia 5’GGTACC 5’---GGTAC C---3’ 3’CCATGG 3’---C CATGG---5’ PstI Providencia stuartii 5’CTGCAG 5’---CTGCA G---3’ 3’GACGTC 3’---G ACGTC---5 SacI Streptomyces achromogenes 5’GAGCTC 5’---GAGCT C---3’ 3’CTCGAG 3’---C TCGAG---5’ SalI Streptomyces albue 5’GTCGAC 5’---G TCGAC---3’ 3’CAGCTG 3’---CAGCT G---5’ SphI Streptomyces phaeochromogenes 5’GCATGC 5’---G CATGC---3’ 3’CGTACG 3’---CGTAC G---5’ XbaI Xanthomonas badrii 5’TCTAGA 5’---T CTAGA---3’ 3’AGATCT 3’---AGATC T---5’ mico que suele ser. según el organismo. se generan porque la enzima corta en cada cade. ya que no depende de cohesivas o romas. lo que origina condiciones idóneas de unión específica para la Tipos de cortes producidos por producción de ADN recombinante. del orden de millo. En la figu- pegajosos. y la unión entre fragmentos de ADN con cadena de ADN pueden generar dos estructuras o formas: extremos romos es más inespecífica. ra 13-1 se muestran las enzimas que generan extremos na de ADN entre nucleótidos localizados en posiciones dife. Los extremos romos se las enzimas de restricción generan porque la enzima corta en ambas cadenas de ADN sobre un mismo eje. Cortes cohesivos. BamHI. Estos cortes generan extremos monocatenarios en un seg- nes de pb. cohesivos o pegajosos (EcoRI. otro fragmento en monocadena con secuencia complemen- ción lación para la construcción de bibliotecas genómicas. como se muestra en el cuadro 13-2. pero cortados por la misma enzima. SmaI). taria. Los cortes cohesivos. por lo que dichos extremos son de Los cortes que realizan las enzimas de restricción sobre la doble cadena. HindIII). por lo que en esta fracción enzimas en fragmentos más pequeños.122 PARTE II • Metodología del ADN recombinante Cuadro 13-2. Enzima Bacteria origen Secuencia de reconocimiento Productos del corte EcoRI Escherichia coli 5’GAATTC 5’---G AATTC---3’ 3’CTTAAG 3’---CTTAA G---5’ BamHI Bacillus amyloliquefaciens 5’GGATCC 5’---G GATCC---3’ 3’CCTAGG 3’---CCTAG G---5’ HindIII Haemophilus influenzae 5’AAGCTT 5’---A AGCTT---3’ 3’TTCGAA 3’---TTCGA A---5’ TaqI Thermus aquaticus 5’TCGA 5’---T CGA---3’ 3’AGCT 3’---AGC T---5’ NotI Nocardia otitidis 5’GCGGCCGC 5’---GC GGCCGC---3’ 3’CGCCGGCG 3’---CGCCGG CG---5’ HinfI Haemophilus influenzae 5’GANTC 5’---G ANTC---3’ 3’CTNAG 3’---CTNA G---5’ Sau3A Staphylococcus aureus 5’GATC 5’--. también llamados la complementariedad de regiones monocadena. Los extremos así que se discuten en el capítulo de vectores de clonación. Esto permite un la falta de cadena complementaria facilita su interacción con manejo adecuados sin el riesgo de degradacióny manipula.

Ambas reconocen la secuencia 5´GGTAC3´ pero 3’---CCTAG G---5’ ASp718 corta el enlace entre GG mientras KpnI corta entre los nucleótidos AC. Familias de enzimas. Bgl II: 5’---A GATCT---3’ 3’---TCTAG C---5’ Esta característica favorece que dos fragmentos corta- Familias de enzimas de restricción dos con estas enzimas puedan recombinarse de manera Una familia de enzimas de restricción está formada por específica gracias a la complementariedad de sus bases en aquellas que no necesariamente reconocen la misma secuen. que reconocen las secuencias diana 5’GGATCC3’ y 5’AGATCT3’. cen la misma secuencia diana de ADN y cortan entre dife- rentes nucleótidos de dicha secuencia (por ejemplo. . Figura 13-3. los extremos cohesivos generados. como se describe en la figura 13-3. pero producen extremos cohesivos similares. Isoesquizomeros. respectiva- Se denomina isoesquizómeros a las enzimas de restricción mente. pero que generan extremos cohesivos idénticos: obtenidas de diferente especie bacteriana pero que recono- 5’GATC3’. como se muestra en la cia diana. Figura 13-4. Cortes cohesivos o pegajosos. CAPÍTULO 13 • Enzimas de restricción 123 Cortes “cohesivos o pegajosos” Isoesquizomeros G G T A C G A A T T C G A A T T C Asp718 EcoRI C C A T G C T T A A G C T T A A G G G A T C C G G A T C C G G T A C BamHI Kpnl C C T A G G C C T A G G C C A T G Figura 13-1. Cortes romos. Bgl II Bam HI G A T C T G G A T C C A A T A T T A A T A T T A SspI T T A T T T A T A A T T A T A A C G A C C A G G C C C G G G C C C G G G G A T C Smal G G G C C C G G G C C C C T A G Figura 13-2. Un figura 13-4. Asp718 BamH I: 5’---G GATCC---3’ y KpnI). Isoesquizómeros ejemplo de familia es: BamHI y BclII.

¿Cuáles son las condiciones de almacén y conservación 4. ya que concentraciones elevadas de sales y detergentes inhiben la actividad enzimática. ya que algunas enzi. al igual que muchas otras pro. se corre el riesgo de su degradación. el tarse demasiado. como albúmina. Sin embargo. se obtiene un listado de las muestra con otros ADN impide el buen funcionamiento posibles enzimas que reconocen la secuencia diana. En el caso del ADN genómico es necesa- enzimas de restricción rio conocer la secuencia completa con la que se va a trabajar Entre los factores que más afectan la actividad de las enzi. tro). Dichas condiciones están ajustadas para el volumen de reacción requerido. pueden disminuir su vida media y en consecuencia mientos de aditivos. etcétera. el tiempo no debe incremen- comercial. de acuer- Condiciones de almacenamiento y do a la tecnología que se requiere aplicar. Se realiza ingresando dicha secuencia a una base de datos especializada para estudios • La pureza biológica del ADN. Selección de la enzima de restricción Una unidad de enzima se define como la cantidad de enzi- adecuada ma requerida para producir la digestión completa de un microgramo de ADN sustrato en 60 minutos a la tempera- Todos los organismos cuentan con un mapa de restricción tura óptima de acción de la enzima. presentación comercial de la enzima (unidades de enzima por microli- Las enzimas de restricción. Eficiencia en el uso de las enzimas de • Modificaciones en el pH y temperatura de incubación. su actividad. El tiempo de incuba- que indica la posición donde se encuentran los sitios de ción de la reacción puede ser incrementado si la enzima corte para muchas de las enzimas conocidas. ATP. que son capaces de cortar dicho ADN. Se debe tener en conservación de las enzimas de restricción cuenta la temperatura óptima de acción. Contaminación de la de restricción y. la enzima tomando en cuenta las características experi- • Los contaminantes como detergentes y estabilizadores mentales ajustándose al objetivo perseguido. (docedil sulfato de sodio –SDS–. así como el número y tamaño de cada frag- mento generado. así como los posibles requeri- teínas. el sitio de corte. ciones óptimas de actividad de las enzimas de restricción disponibles comercialmente. como unidades por microlitro (u/μl). tiempo de incubación. se revisa el mapa de restricción. ácido etilendiaminote- traacético –EDTA–). Las hojas de instrucciones o insertos que facilita el provee- • El grado de metilación del ADN.124 PARTE II • Metodología del ADN recombinante Factores que afectan la actividad de las tipo de corte. deben conservarse a -20ºC. así que para evitar su congelamiento y Cantidad de enzima adecuada para un su consecuente pérdida de actividad son diluidas en un volumen determinado de glicerol. de esta manera. de la concentración de ADN en la muestra a digerir. al ser conservadas y manejadas de forma inadecuada fuera de su rango ideal de temperatura. Variaciones leves en estos parámetros inhiben enorme- restricción mente la actividad de las enzimas. pues aunque el ADN es una molécula cual ofrece un listado en orden alfabético de las enzimas resistente. ¿Cómo se determina la cantidad de enzima de restricción de las enzimas de restricción? para un ensayo? 2. La cantidad de enzima utilizada en una reacción dependerá tura posible. ¿Cómo se determina la enzima de restricción ideal para 5. Para usarlas se requiere ensayo un contenedor que asegure la menor variación de tempera. Se elige de las enzimas. por ejemplo. ¿Cómo se logra la mayor eficiencia en la actividad de las enzimas de restricción? . La con- centración de la enzima está descrita en la hoja de instruc- ciones del proveedor. el Preguntas de repaso 1. dor incluyen las características y descripción de las condi- mas son inhibidas por metilación en ciertas secuencias. ¿Aumenta la eficiencia de la actividad de restricción si se realizar un corte en una secuencia específica de ADN? rebasa el tiempo recomendado de incubación? 3. para conocer los sitios de corte y predecir el número y mas de restricción se encuentran: tamaño de los fragmentos. Cuando se utilizada está cerca de su fecha de caducidad y su actividad pretende realizar el corte en un plásmido conocido o está mermando.

2351 TGGTTCACGT AGTGGGCCAT CGCCCTGATA GACGGTTTTT CGCCCTTTGA AatII: 5’ G A C G T--C 3’ 2401 CGTTGGAGTC CACGTTCTTT AATAGTGGAC TCTTGTTCCA AACTGGAACA BspHI: 5’ T--C A T G A 3’ 2451 ACACTCAACC CTATCTCGGG CTATTCTTTT GATTTATAAG GGATTTTGCC 2501 GATTTCGGCC TATTGGTTAA AAAATGAGCT GATTTAACAA AAATTTAACG 1 CCTGCAGGCA GCTGCGCGCT CGCTCGCTCA CTGAGGCCGC CCGGGCAAAG 2551 CGAATTTTAA CAAAATATTA ACGTTTACAA TTTTATGGTG CACTCTCAGT 51 CCCGGGCGTC GGGCGACCTT TGGTCGCCCG GCCTCAGTGA GCGAGCGAGC 2601 ACAATCTGCT CTGATGCCGC ATAGTTAAGC CAGCCCCGAC ACCCGCCAAC 101 GCGCAGAGAG GGAGTGGCCA ACTCCATCAC TAGGGGTTCC TGCGGCCGCA 2651 ACCCGCTGAC GCGCCCTGAC GGGCTTGTCT GCTCCCGGCA TCCGCTTACA 151 CGCGTGGAGC TAGTTATTAA TAGTAATCAA TTACGGGGTC ATTAGTTCAT 2701 GACAAGCTGT GACCGTCTCC GGGAGCTGCA TGTGTCAGAG GTTTTCACCG 201 AGCCCATATA TGGAGTTCCG CGTTACATAA CTTACGGTAA ATGGCCCGCC 2751 TCATCACCGA AACGCGCGAG ACGAAAGGGC CTCGTGATAC GCCTATTTTT 251 TGGCTGACCG CCCAACGACC CCCGCCCATT GACGTCAATA ATGACGTATG 2801 ATAGGTTAAT GTCATGATAA TAATGGTTTC TTAGACGTCA GGTGGCACTT 301 TTCCCATAGT AACGTCAATA GGGACTTTCC ATTGACGTCA ATGGGTGGAG 2851 TTCGGGGAAA TGTGCGCGGA ACCCCTATTT GTTTATTTTT CTAAATACAT 351 TATTTACGGT AAACTGCCCA CTTGGCAGTA CATCAAGTGT ATCATATGCC 2901 TCAAATATGT ATCCGCTCAT GAGACAATAA CCCTGATAAA TGCTTCAATA 401 AAGTACGCCC CCTATTGACG TCAATGACGG TAAATGGCCC GCCTGGCATT 2951 ATATTGAAAA AGGAAGAGTA TGAGTATTCA ACATTTCCGT GTCGCCCTTA 451 ATGCCCAGTA CATGACCTTA TGGGACTTTC CTACTTGGCA GTACATCTAC 3001 TTCCCTTTTT TGCGGCATTT TGCCTTCCTG TTTTTGCTCA CCCAGAAACG 501 GTATTAGTCA TCGCTATTAC CATGGTGATG CGGTTTTGGC AGTACATCAA 3051 CTGGTGAAAG TAAAAGATGC TGAAGATCAG TTGGGTGCAC GAGTGGGTTA 551 TGGGCGTGGA TAGCGGTTTG ACTCACGGGG ATTTCCAAGT CTCCACCCCA 3101 CATCGAACTG GATCTCAACA GCGGTAAGAT CCTTGAGAGT TTTCGCCCCG 601 TTGACGTCAA TGGGAGTTTG TTTTGCACCA AAATCAACGG GACTTTCCAA 3151 AAGAACGTTT TCCAATGATG AGCACTTTTA AAGTTCTGCT ATGTGGCGCG 651 AATGTCGTAA CAACTCCGCC CCATTGACGC AAATGGGCGG TAGGCGTGTA 3201 GTATTATCCC GTATTGACGC CGGGCAAGAG CAACTCGGTC GCCGCATACA 701 CGGTGGGAGG TCTATATAAG CAGAGCTCGT TTAGTGAACC GTCAGATCGC 3251 CTATTCTCAG AATGACTTGG TTGAGTACTC ACCAGTCACA GAAAAGCATC 751 CTGGAGACGC CATCCACGCT GTTTTGACCT CCATAGAAGA CACCGGGACC 3301 TTACGGATGG CATGACAGTA AGAGAATTAT GCAGTGCTGC CATAACCATG 801 GATCCAGCCT CCGCGGATTC GAATCCCGGC CGGGAACGGT GCATTGGAAC 3351 AGTGATAACA CTGCGGCCAA CTTACTTCTG ACAACGATCG GAGGACCGAA 851 GCGGATTCCC CGTGCCAAGA GTGACGTAAG TACCGCCTAT AGAGTCTATA 3401 GGAGCTAACC GCTTTTTTGC ACAACATGGG GGATCATGTA ACTCGCCTTG 901 GGCCCACAAA AAATGCTTTC TTCTTTTAAT ATACTTTTTT GTTTATCTTA 3451 ATCGTTGGGA ACCGGAGCTG AATGAAGCCA TACCAAACGA CGAGCGTGAC 951 TTTCTAATAC TTTCCCTAAT CTCTTTCTTT CAGGGCAATA ATGATACAAT 3501 ACCACGATGC CTGTAGCAAT GGCAACAACG TTGCGCAAAC TATTAACTGG 1001 GTATCATGCC TCTTTGCACC ATTCTAAAGA ATAACAGTGA TAATTTCTGG 3551 CGAACTACTT ACTCTAGCTT CCCGGCAACA ATTAATAGAC TGGATGGAGG 1051 GTTAAGGCAA TAGCAATATT TCTGCATATA AATATTTCTG CATATAAATT 3601 CGGATAAAGT TGCAGGACCA CTTCTGCGCT CGGCCCTTCC GGCTGGCTGG 1101 GTAACTGATG TAAGAGGTTT CATATTGCTA ATAGCAGCTA CAATCCAGCT 3651 TTTATTGCTG ATAAATCTGG AGCCGGTGAG CGTGGGTCTC GCGGTATCAT 1151 ACCATTCTGC TTTTATTTTA TGGTTGGGAT AAGGCTGGAT TATTCTGAGT 3701 TGCAGCACTG GGGCCAGATG GTAAGCCCTC CCGTATCGTA GTTATCTACA 1201 CCAAGCTAGG CCCTTTTGCT AATCATGTTC ATACCTCTTA TCTTCCTCCC 3751 CGACGGGGAG TCAGGCAACT ATGGATGAAC GAAATAGACA GATCGCTGAG 1251 ACAGCTCCTG GGCAACGTGC TGGTCTGTGT GCTGGCCCAT CACTTTGGCA 3801 ATAGGTGCCT CACTGATTAA GCATTGGTAA CTGTCAGACC AAGTTTACTC 1301 AAGAATTGGG ATTCGAACAT CGATTGAATT CCCCGGGGAT CCTCTAGAGT 3851 ATATATACTT TAGATTGATT TAAAACTTCA TTTTTAATTT AAAAGGATCT 1351 CGACCTGCAG AAGCTTGCCT CGAGCAGCGC TGCTCGAGAG ATCTACGGGT 3901 AGGTGAAGAT CCTTTTTGAT AATCTCATGA CCAAAATCCC TTAACGTGAG 1401 GGCATCCCTG TGACCCCTCC CCAGTGCCTC TCCTGGCCCT GGAAGTTGCC 3951 TTTTCGTTCC ACTGAGCGTC AGACCCCGTA GAAAAGATCA AAGGATCTTC 1451 ACTCCAGTGC CCACCAGCCT TGTCCTAATA AAATTAAGTT GCATCATTTT 4001 TTGAGATCCT TTTTTTCTGC GCGTAATCTG CTGCTTGCAA ACAAAAAAAC 1501 GTCTGACTAG GTGTCCTTCT ATAATATTAT GGGGTGGAGG GGGGTGGTAT 4051 CACCGCTACC AGCGGTGGTT TGTTTGCCGG ATCAAGAGCT ACCAACTCTT 1551 GGAGCAAGGG GCAAGTTGGG AAGACAACCT GTAGGGCCTG CGGGGTCTAT 4101 TTTCCGAAGG TAACTGGCTT CAGCAGAGCG CAGATACCAA ATACTGTCCT 1601 TGGGAACCAA GCTGGAGTGC AGTGGCACAA TCTTGGCTCA CTGCAATCTC 4151 TCTAGTGTAG CCGTAGTTAG GCCACCACTT CAAGAACTCT GTAGCACCGC 1651 CGCCTCCTGG GTTCAAGCGA TTCTCCTGCC TCAGCCTCCC GAGTTGTTGG 4201 CTACATACCT CGCTCTGCTA ATCCTGTTAC CAGTGGCTGC TGCCAGTGGC 1701 GATTCCAGGC ATGCATGACC AGGCTCAGCT AATTTTTGTT TTTTTGGTAG 4251 GATAAGTCGT GTCTTACCGG GTTGGACTCA AGACGATAGT TACCGGATAA 1751 AGACGGGGTT TCACCATATT GGCCAGGCTG GTCTCCAACT CCTAATCTCA 4301 GGCGCAGCGG TCGGGCTGAA CGGGGGGTTC GTGCACACAG CCCAGCTTGG 1801 GGTGATCTAC CCACCTTGGC CTCCCAAATT GCTGGGATTA CAGGCGTGAA 4351 AGCGAACGAC CTACACCGAA CTGAGATACC TACAGCGTGA GCTATGAGAA 1851 CCACTGCTCC CTTCCCTGTC CTTCTGATTT TGTAGGTAAC CACGTGCGGA 4401 AGCGCCACGC TTCCCGAAGG GAGAAAGGCG GACAGGTATC CGGTAAGCGG 1901 CCGAGCGGCC GCAGGAACCC CTAGTGATGG AGTTGGCCAC TCCCTCTCTG 4451 CAGGGTCGGA ACAGGAGAGC GCACGAGGGA GCTTCCAGGG GGAAACGCCT 1951 CGCGCTCGCT CGCTCACTGA GGCCGGGCGA CCAAAGGTCG CCCGACGCCC 4501 GGTATCTTTA TAGTCCTGTC GGGTTTCGCC ACCTCTGACT TGAGCGTCGA 2001 GGGCTTTGCC CGGGCGGCCT CAGTGAGCGA GCGAGCGCGC AGCTGCCTGC 4551 TTTTTGTGAT GCTCGTCAGG GGGGCGGAGC CTATGGAAAA ACGCCAGCAA 2051 AGGGGCGCCT GATGCGGTAT TTTCTCCTTA CGCATCTGTG CGGTATTTCA 4601 CGCGGCCTTT TTACGGTTCC TGGCCTTTTG CTGGCCTTTT GCTCACATGT 2101 CACCGCATAC GTCAAAGCAA CCATAGTACG CGCCCTGTAG CGGCGCATTA . Identifique los sitios de restricción en la cadena en base a 2251 TCGCCGGCTT TCCCCGTCAA GCTCTAAATC GGGGGCTCCC TTTAGGGTTC la secuencia de nucleótidos de las siguientes enzimas de 2301 CGATTTAGTG CTTTACGGCA CCTCGACCCC AAAAAACTTG ATTTGGGTGA restricción. CAPÍTULO 13 • Enzimas de restricción 125 Ejercicios de integración Instrucciones: A continuación se presenta la secuencia de 2151 AGCGCGGCGG GTGTGGTGGT TACGCGCAGC GTGACCGCTA CACTTGCCAG ADN de un plásmido que consta de 4650 pares de bases. 2201 CGCCCTAGCG CCCGCTCCTT TCGCTTTCTT CCCTTCCTTT CTCGCCACGT 1.

1998. México.b. principles and Nelson D. Nueva applications of recombinant ADN. Bibliografía Glick B. 4ª ed. Biología molecular y biotecnología. 2000 p. Cox M. 250 p. Wood E. AatII + Marcador AatII BsphI BsphI 4000 p. 2ª ed.J. 2005. Genes VIII. Molecular biotechnology. 3000 p. 8ª ed. Lehninger Principles of Biochemistry.. . 100 p.J. Nueva Jersey: Pear.R. Upper Saddle River.b.. 500 p. En el siguiente esquema. Lewin B.b. El corte con las siguientes enzimas de restricción genera fragmentos de ADN los cuales serán analizados mediante electro- foresis en gel. DF: Addison Wesley Longman. 1000 p.. Pasternak J. 1998. Indique de manera aproximada de acuerdo a su peso molecular las bandas que estos segmentos de ADN generarían.126 PARTE II • Metodología del ADN recombinante 2. determine los pares de bases de los fragmentos resultantes después del corte y complete el mapa de restricción del plásmido.A.b. 2004. Press. Washington: ASM York: Freeman. d c 4650 bp a e b 3. son/Prentice-Hall.b.b.b. Smith C.

adaptaciones de procesos naturales de la genética microbia- na o eucariota. un producto de PCR o un ARN obtenido nar moléculas grandes de ADN y separarlas en fragmentos. producto de la retrotrans- el estudio del ADN. Cada uno de esos fragmentos se analizaba por separado y fue posible multiplicarlos a través de la técnica de reacción en cadena de la polimerasa (PCR. En la actualidad. mezclados con técnicas novedosas e ingenio. ya que gracias a ellas fue posible seccio. Los vec- multiplicar una secuencia específica. fagos. La dura. célula que capta el ácido nucleico se denomina célula trans- formada y esta variación en su genoma es hereditaria. genoma de la célula hospedera. y antes miento de secuencias y la obtención de grandes cantidades del advenimiento de la técnica de PCR era la manera usual de del ADN insertado o de la molécula recombinante. por transcripción in vitro. ya que era demasiado lar. el ADN era una molécula cuyo aná. 127 . los vectores se clasifican en vectores tricción ha sido posible la identificación. El inserto puede ser ADN obtenido de cualquier orga- noácidos en las proteínas o por su expresión en el ARN. Los vectores de expresión pueden ser plásmidos ducción de un fragmento de ADN denominado inserto o fagos (figura 14-1). Por nismo y puede permanecer como ADN genómico (ADNg). Capítulo 14 Vectores de clonación y expresión Ana Soledad Sandoval Rodríguez / Mayra Mena Enríquez Ana Laura Márquez Aguirre Introducción dentro de una molécula de ADN denominada vector. En esa clona molecular compuesta por ADN proveniente del época la secuencia de nucleótidos del ADN sólo había podi. nación se emplea para la producción de moléculas recombi. o clonación molecular. Gracias a la especificidad del reconocimiento de las secuencias que pueden ser cortadas por las enzimas de res. que puede replicarse de manera autónoma e independiente del Hasta la década de 1970. inserto y del vector. Vectores de expresión Los vectores de expresión son aquellos cuyo objetivo es pro- Clonación ducir un tránscrito (ARN) o la proteína producto de ese La clonación de ADN. es la intro. para producir moléculas de ADN recombinan. fagémidos. la clo. de millones de copias de una molécula recombinante o ga y estaba formada sólo por cuatro monómeros. El resultado es la obtención lisis era sumamente problemático. El termino clonación. ello. Los procesos técnicos que forman parte de la cadena (DNAds). tránscrito. clonación de fragmentos de ADN provenientes de diferentes organismos. en gran parte. Vectores de clonación te. indica el acto de producir Los vectores son de clonación si su finalidad es el almacena- muchas copias idénticas de una molécula de ADN. cósmidos y cromosomas artificiales bacterianos o de leva- nantes y para determinar sus funciones en el organismo. de ADN exógeno (de otro origen). cipción del ARN. Clasificación de vectores sas. do estudiarse indirectamente a través de la secuencia de ami. per se. el descubrimiento de las enzimas de restricción facilitó ADN complementario (ADNc). véase el capítulo de PCR). e Vectores de clonación incluso determinar la secuencia de sus nucleótidos por Un vector se define como una molécula de ADN de doble secuenciación. el aislamiento y la de clonación y vectores de expresión. tores de clonación suelen ser plásmidos. De acuerdo con su uso. con capacidad de albergar un fragmento metodología del ADN recombinante son.

las colonias de células transformadas expone a luz ultravioleta (figura 14-2). que expresa la proteína verde fluorescente que que contiene una serie de sitios únicos de reconoci. proporciona fluorescencia a la colonia celular cuando es miento para enzimas de restricción. con una amplia gama de posibilidades de insertar cualquier fragmento de ADN. que es una secuencia específica reconocida por diversas enzimas de restricción para poder insertar el ADNc del gen de interés y un marcador de selección. A) B) ción unidireccional. como el gen de la proteína verde fluores. Algunos vectores plasmídicos poseen un segundo marcador de selección. como parte de su más comunes presentes en el sitio de clonación múltiple estructura. aunque existen Replicación del vector en células Replicación del vector en células algunos plásmidos que contienen dos. el gen lacZ. B) Otro marcador de selección es el c) Sitio de clonación múltiple: es un fragmento de ADN gen GFP. Un vector de clonación contiene elementos como el origen de replicación. Vector de clonación y expresión. los siguientes elementos básicos comunes: de la mayoría de los vectores son para las enzimas EcoR a) Origen de replicación: es una secuencia en el ADN del I. Un vector de expresión se utiliza para producir una proteína recombinan- te y contiene. cente (green fluorescente protein. así como una secuencia de poliadenilación. la β-galactosidasa puede expresarse y generar una enzima funcional. Xho I y Kpn I (ver la figura 14-1). Así. es degradada por la enzima. coli y codifica la enzima β-galactosidasa. Marcadores de selección. un promotor y un sitio IRES (sitio de entrada interna al ribosoma). los marcadores de selección son únicos en los vectores. . Los sitios de restricción Todos los vectores de clonación poseen. Hind III. BamH I. lo que produce un color azul que permite identificar a las células que introdujeron el vector. un sitio múltiple de clonación (SMC). vector que provee un sitio único de reconocimiento a las proteínas que identifican el sitio de inicio de la repli- cación (ORI). como el com- puesto denominado X-gal (5-bromo-4-cloro-3-indolyl- β-D-galactopiranósido). GFP) que permite que Cuando la célula que contiene el plásmido se pone en contacto la célula transformada emitía fluorescencia cuando se con el reactivo x-gal. Los plásmidos se caracterizan por tener Ori Ori un solo sitio ORI en su genoma y realizar una replica. También existen marcadores. muy cercanos entre expuesta a la luz ultravioleta. Figura 14-2. además de los elementos mencionados. Elementos que forman un vector de clonación sí. que se encuentra en el operón Lac de E. Amp Amp SMC SMC b) Marcador de selección: es un gen que generalmente confiere resistencia a un antibiótico o genera un fenoti- Gen Gen po particular con el cual puede seleccionarse la célula tac Z GF P que incorporó el vector.128 PARTE II • Metodología del ADN recombinante Origen de replicación Promotor Bam HI GGGATCCTCTAGAGTCGACCTGCAGAAGCTT ció e ica d n Sitio múltiple de clonación pl n Ori CMV re rige ES Hind III O Xba I IR i Or Xho I Sitio múltiple SMC Bam HI Sal I SMC de clonación Am Xba I Am Marcador de Marcador de p EcoRI p selección A selección Poli Cola de Hind III Poli A Vector de clonación Vector de Expresión Figura 14-1. En general. A) El gen LacZ es un marca- dor de selección que codifica para la enzima β-galactosidasa. se tiñen de color azul. Si la célula que contiene el vector se pone en contacto con un sustrato de la enzima. Entre los genes Célula en contacto con X-gal Célula en expuestas a luz ultravioleta de selección más comunes se encuentran los de resis- Células azules Células fluorescentes tencia a ampicilina y kanamicina. cuando el vec- tor se replica dentro de la célula hospedera.

como medio de transporte de genes a otras bacterias. los cósmidos 45000 pb y los cromosomas artificiales más de 45000 pb. requieren para la replicación. Una de las características que se utilizan para la selección del vector de clonación es el tamaño del inserto que se quiera clonar. En estos el laboratorio con la finalidad de preservar sólo las caracte. Este tipo de vectores son particularmente biosintética de las bacterias. Fragmentos largos necesitan empaquetamiento en fagos I. y su genoma consiste de una molécula manera episomal en la bacteria. otras que no poseen de forma natural. el bacteriófago silvestre Plásmidos (virus natural) es modificado genéticamente. sus carac. lo que facilita el análisis de los insertos incorporados a sitios cos del bacteriófago (le permiten empaquetar el él. Dichas modi- ficaciones consisten en la adición de sitios de restricción Los plásmidos son pequeñas moléculas circulares de ADN específicos y la eliminación de aquellos genes que no se que se replican y se transmiten con independencia del cro. Vectores de clonación utilizados Tamaño del inserto Tipo de vector Método de introducción que se puede clonar Plásmidos Transformación química o por electroporación. por su capa- . lo que permite la incorpora- mosoma bacteriano. cromosoma independiente dentro de bacterias o levaduras. Para convertirlo en un vector. Al igual que los plásmidos. mación genética y pueden conferirle a la bacteria nuevas terísticas se resumen en el cuadro 14-1. los útiles para estudios de mapeo de cromosomas. La replicación y trans- cripción plasmídica depende de la maquinaria enzimática Cósmidos de la célula huésped. Las células se vuelven 15 000 pb competentes para incorporar el plásmido recombinante. Cromosomas artificiales Fragmentos de ADN de mayor tamaño (cientos de kiloba- Bacteriófagos ses) pueden clonarse en cromosomas artificiales de bacte- Los bacteriófagos son virus que infectan naturalmente bac. CAPÍTULO 14 • Vectores de clonación y expresión 129 Cuadro 14-1. rias (BAC) o levadura (YAC). Los cósmidos derivados del fago P1 pueden admitir que ofrecen una amplia variedad de posibilidades en cuanto 85 kb de ADN exógeno. denominados sitios cos. dos que se multiplican haciendo uso de la maquinaria respectivamente. Cósmidos y cromosomas artificiales Dependiendo del tamaño del inserto de ADN se puede utilizar cualquiera de los 45 000 pb métodos anteriores. esto es. por lo que se replican clonación. como El bacteriófago lambda es el fago más utilizado como la resistencia a antibióticos. contienen los genes de a las enzimas de restricción que se van a emplear para la selección y un sitio ORI del plásmido. que contienen secuencias complementarias mo plásmido. pBR322 y pGLO. Además. Características de los vectores de clonación. esquematizados en la figura 14-3. sin incorporarse en lineal de aproximadamente 45000 pb. De manera natural constituyen el ción de fragmentos de ADN de mayor longitud que los material genético móvil de las bacterias. división celular. Los plásmidos aceptan insertos de 15000 pb. donde funcionan plásmidos (de hasta 23 kb). 12 nucleótidos. Los plásmidos permanecen de vector de clonación. Los plásmidos usados Los cósmidos son vectores híbridos del ADN de un como vector en general están formados por de 2 a 5 kb de plásmido (proporciona la resistencia a los antibióticos) y los ADN. eliminar el ADN innecesario y añadirle aceptar insertos de hasta 45 kb. estos entre sí. Bacteriófagos λ Infección con fagos. Existen cientos de plásmidos disponibles comercialmente ADN). los plásmidos más utilizados se encuentran pBlueescript. casos. Cuando una bacteria se reproduce. que se replican como un terias y se comportan como parásitos intracelulares obliga. A continuación se detallan los vectores de clonación bacteriófagos se replican de forma autónoma. también pueden transmitirse a través de los pili entre las bacterias. cuyos extremos son su genoma. que utiliza para “circulari- plásmidos se transmiten a las células descendientes por dis. el bacteriófago lambda 23000 pb. Después del empaquetamiento in vitro del factor 23 000 pb recombinante en partículas del fago. Algunos estudios de análisis de ADN genómico requieren Los plásmidos han sido manipulados genéticamente en de la clonación de fragmentos de ADN grandes. y en ella puede haber múltiples copias del mis. zar” su genoma a través de la acción de una ligasa de la célu- tribución equitativa del citoplasma bacteriano durante la la huésped (ver la figura 14-3). Sin embargo. propiedades o desarrollarle procesos patológicos. como lo marcadores de selección de las clonas transformadas. pUC19. la longitud del producto que se va a insertar y los de manera independiente del genoma bacteriano. Los vectores de clonación tienen características específicas que los hacen ideales para la clonación. portan infor- más utilizados. Entre hacen los plásmidos. es recomendable utilizar los cósmidos ya que pueden rísticas deseables.

A) Un plásmido consta de componentes básicos como el sitio de clonación múltiple. secuencias teloméricas y de codificación para centró- meros. D) Un BAC. y sitio de clonación múltiple. B) Los fagos provienen de la modificación del genoma ADNds lineal de virus bacterianos. C) Los cósmi- dos.130 PARTE II • Metodología del ADN recombinante D) Sitio múltiple de clonación SMC Gen de nes par Factor F resistencia a CmR cloranfenicol Ge EcoRI Hind III Ori A) Origen de replicación Corte con enzimas de pBR322 restricción Amp Tet 4363pb Fragmento grande Ori de ADN Plásmido Ligación ADN Fago BAC B) Sall Eco RI recombinante 5´ 3´ 3´ 5´ Corte con enzimas Transformación 5´ 3´ 3´ 5´ ADN exógeno Ligación 5´ 3´ 3´ 5´ Colonias recombinantes ADN recombinante Empaquetamiento Agar con cloranfenicol E) Origen de CEN Centrómero replicación ORI Amp Amp Marcador de selección Te T ló m EL L Bacteriófago er TE o C) Corte con enzimas de restricción ADN recombinate TEL Amp ORI CEN Amp TEL TEL Amp ORI CEN Amp TEL Inserto de ADN cosL Ligación del gen de interés en el YAC TEL Amp ORI CEN Gen Amp TEL cosR cosL 5´GGGCGGCGACCT----3´ 3´----AGGTCGCCGCCC5´ YAC cosR Transformación Cósmido YAC recombinante Figura 14-3. un gene de resistencia y un sitio ORI. permite la ligación de fragmentos grandes de ADN que contienen secuencias de resistencia a antibióticos. o cromosoma bacteriano. Vectores de clonación. E) Los YAC se construyen a partir de la ligación de fragmentos de ADN de gran tamaño con genomas de levadura modificados que contienen genes de resistencia a antibióticos. Los vectores de clonación se han creado con la finalidad de contener y permitir la amplificación de fragmentos de ácidos nucleicos. combinan propiedades de los plásmidos con la presencia de los sitios COS del fago. . como su nombre indica.

Los vectores de expresión se emplean con dos finalidades: 6. Además. del vector (figura 14-5). También debe incluir secuencias de terminación de de manera tal que la complementariedad de los extre- la transcripción y de adición de cola de poliadelinación. un centrómero de levadu. Usualmente. y purifica mediante técnicas convencionales (figura También debe considerarse que la presencia de promotores 14-6). además de contar en su secuencia con ple del vector. liberar el fragmento de interés de la molécula de ADN completa. Preparación de células competentes. 2. Dicha secuencia es complementaria con el extremo el sentido opuesto (3’-5’). Se realiza usando la fos- (E. Para facilitar la clonación mentos básicos presentes en los vectores de clonación (ori. mina transfección y si el vector es un virus. Preparación del inserto de ADN que se va a clonar. transcriba y traduzca empleando la maquinaria PAC. tener una mismo. es decir. debe con. 100 a 1 000 kb. origen de replicación. Ligación del inserto y el vector. 14-4. Su capacidad de clonación es de 1. Asi- tituir un sistema de inducción simple y efectivo. entre otros. Preparación del vector para la clonación. ty plasmid) capaz de regular la distribución equitativa de La introducción del ADN recombinante tiene como plásmidos después de la división bacteriana. codón de inicio AUG de la traducción en los ARNm proca. La selección de la(s) enzima(s) que corten el Componentes de los vectores de expresión ADN es un punto crítico que determina la facilidad y la En su estructura los vectores de expresión poseen los ele. pero se han clonado seg. El inserto. ciencia de 50% en la clonación. posible modificación posrestricción del inserto. que el material acepta insertos de 150 a 350 Kb. insertar hasta 300 kb. Preparación del vector para clonación. como número de copias del plásmido. vector recombinante. pET161 con que se digirió el inserto y obtener un ADN lineal. fuertes en plásmidos con un alto número de copias origina 2. La banda correspondiente al inserto (que se verifica por minada por la fuerza del sitio de origen de replicación. Un BAC introducción de un vector a una célula eucariota se le deno- es un constructo derivado del plásmido F (functional fertili. el inserto deberá cortarse con la(s) misma(s) baja expresión basal y ser fácilmente transferible a otras enzima(s) o con unas que dejen los mismos extremos. característica deter. la de ADN de donde proviene. Debe tomarse en cuenta que la ción de nucleasas. Clonación molecular b) Desfosforilación del vector con la finalidad de impe- Usualmente. Algunos ejemplos de a) Corte con la(s) misma(s) enzima(s) de restricción vectores de expresión son los de la serie pcADN3. mos generados en el inserto coincida con los extremos pues con ello el tránscrito estará protegido de la degrada. con lo que se evita la necesidad de una por lo menos un promotor fuerte. ya que en la mitad de las IRES). pero también puede ser una célula eucariota. 3. incorporación de un inserto con extremos romos (véa- Otro factor importante presente en un vector de expresión se capítulo de enzimas de restricción) implica una efi- es el sitio de unión al ribosoma (internal robosome entry site. derivado del plásmido bacterial P1. cepas. propósito la transformación celular. eficiencia de la metodología. marcador de selección y sitio de de corte estén presentes en el sitio de clonación múlti- clonación múltiple). 4. Consiste en: interferencias en la viabilidad celular. se purifica y separa de la molécu- la maquinaria de inicio de la traducción. Un sistema similar denominado replique. cir la proteína codificada en la secuencia génica que portan 1. lo que se conoce resis en gel de agarosa (véase capítulo de electroforesis). se prefiere el uso de enzimas de restricción cuyos sitios gen de replicación. mediante una electrofo- siderarse la expresión basal del plásmido. La estrategia de clonación debe diseñarse para que el corte genere extremos con secuencias complemen- tarias a los extremos del inserto a clonar. con lo que su vida media se extenderá. La clonación de cualquier fragmento de ADN involucra Los YAC son cromosomas artificiales que contienen los siguientes pasos. pero en el otro 50% de las ocasiones la inserción será en riotes. (proteína recombinante). transducción. ra y un marcador de selección para su identificación en las células que los contengan. Se caracterizan por cons. que es la secuencia Shine-Dalgarno que precede el ocasiones el inserto va en el sentido apropiado (5’-3’). Identificación de las colonias celulares que contienen el generar el ARN producto de la transcripción o bien produ. genético se incorpore de manera extracromosómica y se mentos de hasta 700 kb. Preparación del inserto de ADN que se va a clonar. Los vectores de expresión son Involucra la digestión con enzimas de restricción para plásmidos o bien bacteriófagos. Transformación celular. cuya hibridación permite el ensamblaje de digestión enzimática. CAPÍTULO 14 • Vectores de clonación y expresión 131 cidad para almacenar fragmentos de gran tamaño. Vectores de expresión 5. y pDEST10. que el tamaño que presenta) se escinde del gel y se extrae origina plásmidos con un elevado número de copias per se. producto de la 3’ del ARNr 16S. coli). A la fatasa alcalina bovina de origen intestinal (CIP) o la . la célula hospedera del vector es una bacteria dir la autoligación del vector.1. tiene capacidad de enzimática de la célula huésped. los cuales se esquematizan en la figura telómeros.

3. c) Purificación del vector. Consiste en eliminar las par. Las más utilizadas son que en general se obtiene un ADN plasmídico de la ligasa de E. extracción de ácidos nucleicos). se realiza empleando columnas de resi. Linearización enzimática del vector ADN del vector Inserto de ADN 3. Ligación del inserto con el vector. por concentraciones de sales caotrópicas. Sin embargo. los restos de enzimas inactivadas mento largo de la polimerasa (fragmento Klenow). La ligación de un seg- También existe la posibilidad de purificar por la téc. fosfatasa bacteriana (BAP) que elimina los grupos menor calidad (véase el capítulo de métodos de fosfato 5’ de una cadena de ADN. la transformación de bacterias y la identificación de las colonias que contienen el vector recombinante. Para la . Otra estrategia de ligación consiste en el uso del frag- tículas de agarosa. preparación del inserto de ADN a clonar. quier enzima y los convierte en romos. Estrategia general de clonación. que y las sales provenientes de la reacción de digestión. “rellena” los extremos cohesivos generados por cual- En general. Unión del vector de clonación y el inserto de ADNcc del bacteriófago T4 4. Esto permite lo que la eficiencia de clonación disminuye. Una vez que se obtiene el vector recombinante. Preparación de células competentes ADN recombinante 5 y 6. Fragmentación enzimática Vector de clonación del gen a clonar ADN fuente 2. El procedimiento esquematizado consta de los siguientes pasos: preparación del vector para clonación.132 PARTE II • Metodología del ADN recombinante 1. como se una elución de la muestra en volúmenes pequeños mencionó previamente (ver la figura 14-5). los nas con alta afinidad al ADN en presencia de altas extremos romos en el vector no dirigen la inserción. sin embargo. mento de ADN exógeno a un vector involucra la forma- nica fenol:cloroformo modificada. colli selección de la clona recombinante Producción de la proteína Almacenar ADN del gen clonado Medio LB con agar + Ampicilina Figura 14-4. coli y la T4 ligasa de bacteriófagos. Transformación y Bacteria E. presenta el inconveniente y los residuos hidroxilo 3’. para obtener ción de enlaces fosfodiéster entre los residuos fosfato ADN plasmídico (evitando la extracción del ADN que se localizan en los extremos 5’ de la cadena de ADN genómico). Esta unión la cataliza in vitro de que para su realización consume mucho tiempo y una enzima denominada ligasa. ligación del inserto de ADN con el vector. puede utilizarse para producir proteínas recombinantes o para almacenar el ADN. de agua o buffer con baja concentración de sales.

Otro método para conferir competencia a las bac- ADN exógeno. o cohesivos con romos C). una explicación sostiene que la membrana bacteriana es mas de restricción. que carece que corresponde a una densidad celular de 5 × 107 cel/ de un mecanismo natural para la incorporación de ml). Sin embargo. terias es someterlas a lavados consecutivos por 4-5 se por diferentes métodos de laboratorio. Estrategias de clonación. Se desconoce el mecanismo exacto por el cual para inducir el estado de competencia. cohesivos con cohesivos B). y la elección veces con una solución de glicerol a 10%. Según el tipo de extremos que se generan con el corte por las enzimas de restricción del vector e inserto que se va a clonar. que este compuesto induce la competencia. agua para entrar a la célula. para obtener del método dependerá del procedimiento de transfor. lo que provoca que la célula 4. Para su replicación. consiste en tratar las bacterias con una solución de Con independencia del procedimiento empleado CaCl2. utilizada para este procedimiento es E. coli. lo que facilita la formación de poros y la entra- los vectores requieren encontrarse dentro de una célula. dependen del tipo de extremos generados por las enzi. da del ADN. células libres de iones y proteger a la membrana celular mación seleccionado. se pueden tener las siguientes opciones: clonación de extremos romos con romos A). El estado de competencia puede inducir. del daño que ocasionará la electroporación por la cual Uno de los métodos de competencia más utilizados se transformarán. Para lograr el estado de competencia por cualquiera de ración de células competentes. Este procedimiento se prefiere para células que debe prepararse para hacerla permeable a la entra. se abulte. deben considerarse para las ligaciones se describen en el de manera que los iones Ca++ se rodean de moléculas de cuadro 14-2. las células pue- . mas no a los iones calcio. da del vector recombinante.5 y 0. que se van a transformar usando precipitados de ClCa2. Las células competentes las técnicas se requiere que las células se encuentren en generalmente son células procariotas. proceso denominado gene. reacción de ligación existen diferentes protocolos. CAPÍTULO 14 • Vectores de clonación y expresión 133 A) ADN del plásmido ADN del inserto de interés B) ADN del plásmido ADN del inserto de interés Se utilizan enzimas de restricción que generan extremos romos Se utilizan enzimas de restricción que generan extremos cohesivos 5´ TGCCG GTCTTAGCCC GTCTA 3´ 5´ AACAC CTCATGACAC GGGAT 3´ 5´ TA AGCTTCGCCATC TCGAGC 3´ 5´ CA AGCTTAACTTGAC TCGAGC 3´ 3´ ACGGC CAGAATGGGG CAGAT 5´ 3´ TTGTG GAGTACTGTG CCCAT 5´ 3´ ATTCGAA GCGGTAGAGCT CG 5´ 3´ GTTCGA ATTCAACTGAGCT CG 5´ Se lineariza el plásmido Se libera el gen de interés Se lineariza el plásmido Se libera el gen de interés 5´ TGCCG GTCTA 3´ 5´ CTCATGACAC 3´ 5´ TA TCGAGC 3´ 5´ AGCTTAACTTGAC 3´ 3´ ACGGC CAGAT 5´ 3´ GAGTACTGTG 5´ 3´ ATTCGAA CG 5´ 3´ ATTCAACTGAGCT 5´ TGAC AC CT TGAC CTCA TAA CT Se realiza la ligación gen de interés con GA G TAC TGT G AG ATTCAACTG AG CT GT el plásmido CG C CA C G Se realiza la ligación gen de interés con TC TA T AC C AA TG GA G el plásmido CG GA GC C G T TA AT C) ADN del plásmido ADN del inserto de interés Se utiliza una enzima que genera extremos cohesivos y otra romos 5´ TAAA AGCTTCCATCAA TGCA 3´ 5´ TAAA AGCTTCCATCAA TGCA 3´ 3´ ATTTTCGA ACCTAGTT ACGT 5´ 3´ ATTTTCGA ACCTAGTT ACGT 5´ Se lineariza el plásmido Se libera el gen de interés 5´ TAAA TGCA 3´ 5´ AGCTTCCATCAA TGCA 3´ 3´ ATTTTCGA ACGT 5´ 3´ ACCTAGTT ACGT 5´ ATCAA TCC CCTAGT CT A T AG TG Se realiza la ligación gen de interés con GA AC CA G TC el plásmido T T AT A TAA Figura 14-5. La bacteria más la fase logarítmica de crecimiento (OD entre 0. Preparación de células competentes.7). Los requerimientos generales que permeable a los iones cloro.

. el inserto se purifica del resto de la molécula de ADN de donde proviene. Electroforesis de un inserto escindido con las enzimas Hind III y Xba I MPM Hind III y Xba I Hind III y Xba I Fragmento sin digerir 2. En la imagen. Extremos iguales Tratamiento con fosfatasa del vector Los sitios de restricción de las uniones entre el vector y linearizado. El fragmento de ADN es insertado en cualquier orientación en el vector recombinante. Para extraer el inserto de la agarosa. Inserto escindido Figura 14-6. enzimas de restricción. Extremos cohesivos diferentes Para una máxima eficiencia se Los sitios de restricción de las uniones entre el vector y requiere la purificación del vector el inserto de ADN son usualmente conservados. Cuadro 14-2. Después de la digestión enzimática con que es escindido el inserto del ADN de origen. Requerimientos para la clonación de insertos de ADN. un inserto es liberado empleando las enzimas Hind III y Xho I. después de la digestión con las dos El número de clonas no recombinantes es bajo. según los tipos de extremos generados por las enzimas de restricción que se emplean para el corte del inserto y vector. Los plásmidos recombinantes pueden acarrear copias en tándem del inserto de ADN. Los plásmidos recombinantes pueden acarrear copias en tándem del inserto de ADN.134 PARTE II • Metodología del ADN recombinante 1. Se corta la banda del Fragmento digerido inserto digerido 3. mediante una electroforesis en gel. el inserto de ADN son usualmente conservados. y en la electroforesis se visualiza el fragmento digerido. Purificación del fragmento Lisis de la agarosa Unión a columnas Lavados Elución 4. El fragmento de ADN es insertado en una sola orientación en el vector recombinante. Extremos acarreados por el inserto de ADN Requerimientos para la clonación Comentarios Extremos romos Alta concentración de ADN. Los requerimientos para la ligación del inserto de ADN con el vector de clonación serán particulares. Un corte de la agarosa a la altura de la banda del inserto digerido lo aísla del resto de la molécula de origen que no haya liberado el inserto. se purifica el ácido nucleico empleando técnicas comerciales de extracción y purificación de ADN por columnas iónicas. Purificación del inserto a clonar.

este método se aplicó para la introducción de ADN plasmídico a células bacterianas. Posterior- mente. ya que puede utilizarse en células eucario. Para identificar las bacterias transforma- riana consiste en la adquisición de ADN exógeno. . incrementa la permeabilidad de la membrana celular. así como para el estable- cepa de bacterias utilizadas. Entre los por los vectores. ya que se obtienen alrededor de 1 × 108 células ARNm mediante una reacción in vitro que sintetiza una pri- transformadas/μg de plásmido. complementaria a la obtenida de tas. aunque de otros organismos. generación de cultivos transgénicos resistentes a plagas o La eficiencia de este método es de 1 × 104 a 1 × 106 sequías. Es un método sencillo y cimiento de librerías genómicas o genotecas. ciencia de transformación. Otros marcadores de a) Transformación química: esta técnica está basada en selección se basan en la producción de moléculas fluo- estudios realizados por Mandel e Higa en 1970. como hormonas. este mera cadena de ADNc utilizando una ADN polimerasa con método es la mejor opción para plásmidos grandes de actividad de transcriptasa inversa. se sintetiza en una reacción de PCR células son resistentes a los métodos tradicionales de (véase capítulo de reacción en cadena de la polimerasa) o transfección y transformación. La producción de una del vector influyen de forma significativa en la efi. se aplica producción de proteínas eucariotas en bacterias (proteínas un breve choque térmico a 42ºC por 90 segundos que recombinantes). producen coloración en la λ por células bacterianas se incrementaba sustancial. Los componen. La bacterias. en los rescentes o bien en la producción de enzimas que. segunda cadena de ADNc. Además. Se tas y/o la pared celular en bacterias. y el término trans. Identificación de las colonias que contienen el vector 5. recombinante. producción de animales transgénicos capaces de células transformadas/μg de plásmido. mente en presencia de cloruro de calcio. Los bancos de ADNc se construyen a partir de secuencias de ciente. lo que permite la entrada del vector al citoplasma de la célula. pueden construir genotecas de ADN o de ADN. puede incrementarse utilizando otros cationes diva- lentes. Este proceso puede emplearse para la endocitosis a una célula competente. La electroporación no es exclusiva de las a ADNc se elimina con la adición de la enzima ARNasa H. Aplicaciones de la clonación molecular dimiento las células y el ADN plasmídico se incuban La clonación génica tiene múltiples aplicaciones y ha sido el en una solución hipotónica de CaCl2. con independencia del petencia en una solución acuosa con glicerol a 10%. Transformación en bacterias. que han proporciona una buena eficiencia de transformación permitido secuenciar por completo el genoma humano y el para muchos de los procedimientos de rutina. al que observaron que la incorporación de ADN del fago reaccionar con un sustrato. plásmido es resistente. la tetraci- química y la transformación por electroporación. 6. Si la transformación ha sido exi- be la introducción del ácido nucleico exógeno en una tosa las bacterias serán capaces de metabolizar el anti- célula por medio de un vector viral. vacunas. que forma un principal impulsor de la biotecnología y la metodología del complejo con el ADN que facilita su entrada por ADN recombinante. además. solo evento de transformación. el término transducción descri. lo que indicará que incorporaron el fección implica la introducción del material genético en vector (ver la figura 14-2). Por otro lado. La transformación bacte. impedir que al descongelarse se lisen. biótico y vivirán. Esta Genotecas de ADNc es la técnica de transformación bacteriana más efi. biblioteca de ADNc se esquematiza en la figura 14-8. para el cual el vectores a las bacterias. provenientes del genoma de un orga- poros en la membrana plasmática en células eucario. antibióticos. nismo. cilla del ADNc como templado. clonados en vectores para facilitar su estudio. Posteriormente. como el rubidio y el manganeso. este ADNc Debe considerarse que factores como la longitud de doble cadena se clona en un vector. b) Transformación por electroporación: consiste en la Genotecas aplicación de breves pulsos eléctricos de alto voltaje Una biblioteca genómica o genoteca es una colección de (> 1500 V/5 ms) a las células receptoras. CAPÍTULO 14 • Vectores de clonación y expresión 135 den almacenarse de forma indefinida sin perder su com. clina. para formar fragmentos de ADN. para método empleado para la misma. el cloramfenicol y la kanamicina. como la ampicilina. Los más utilizados son los genes de métodos más comunes se encuentran la transformación resistencia a antibióticos. misma que producir en su leche proteínas recombinantes (véase capí- varía dependiendo de la longitud del plásmido y la tulo de organismos transgénicos). cada colonia representa un las células empleando agentes químicos o f ísicos. Después de la Cabe resaltar que el termino transformación se transformación. colonia de células transformadas. las bacterias se siembran en cajas petri refiere a la introducción de material genético a través de con agar suplementado con el antibiótico. es el método de elección cuando las la retrotranscripción. El ARNm que no se copia hasta 50 kb. tes de la membrana se desestabilizan. Ambos procesos se empleando una DNAc polimerasa que utilice la cadena sen- esquematizan en la figura 14-7. que le das se utilizan marcadores de selección proporcionados confiere un nuevo fenotipo a la célula huésped. En este proce.

Transformación de bacterias. se siembran en agar con antibiótico del gen de resis- tencia que contiene el plásmido y se seleccionan las colonias resistentes que contienen el vector recombinante. Un choque térmico a 42 °C facilita la entrada del complejo ADN-CaCl2 a la célula. En la transformación por electroporación la diferencia estriba en que en lugar de un choque térmico se aplican pulsos eléctricos que desestabilizan la membrana celular y permiten la entrada del vector. . B) Transformación por electroporación. A) Transformación química. Para la transformación química se añade el plásmido deseado a las células químicamente competentes que se encuentran en una solución con CaCl2.136 PARTE II • Metodología del ADN recombinante Transformación química A) Choque térmico Adicionar medio LB a 42°C Centrifugar Clonas recombinantes Sembrar e incubar toda la noche a 37°C Eliminar medio B) Transformación por electroporación Plásmido Células Incubar Electroporación Adicionar medio LB competentes en hielo Centrifugar Agar con ampicilina Clonas recombinantes Sembrar e incubar toda la noche a 37 °C Eliminar medio Figura 14-7. Posteriormente. que junto con el vector forma un complejo insoluble. Se añade medio LB para que las células crezcan y se reproduzcan con el plásmido insertado.

nante. no presenta riesgos de de restricción para generar fragmentos con extremos com. En la actualidad. alterar la secuencia e introducir ese ADN exó. de los cuales se sintetiza el ADNc por retrotranscripción. La clonación molecular ha incrementado las perspecti- secuenciarlas. CAPÍTULO 14 • Vectores de clonación y expresión 137 Corte con enzimas Producción de proteínas recombinantes de restricción La clonación molecular ha permitido determinar la función Genoma Promotor E1 E2 E3 E4 de múltiples proteínas y generar proteínas recombinantes. y la dificultad en su aislamiento o purificación. ARNm 5´ AAAAA que han reducido los costos de producción de hormonas o proteínas requeridas en la terapéutica. Una ventaja ha construido la genoteca. la producción de proteínas recombinantes en plantas presenta la ventaja de que su disponibilidad es Genotecas de ADNg prácticamente ilimitada de biomasa. Asimismo. aminoácido. Esto permite el abaratamiento de costos respecto a (véase capítulo de técnicas de hibridación). estable de la proteína recombinante en semillas y tubércu- cuentes de identificación de clones recombinantes en una los. levaduras (Saccharomyces cereviceae. para la producción de organismos transgénicos (véanse mos e impulsó el desarrollo de la biotecnología. el uso de anti. Doble cadena 5´ AAAAA de ADNc 3´ TTTTT Las proteínas recombinantes se producen en bacterias (E. aunque esto impone una carga metabólica a las células bajando la velocidad de su Figura 14-8. pues una vez establecido el cultivo no se del organismo de interés. línea celular de riñon de hámster bebé Plásmido recombinante –BHK– y HEK293 de riñón de embrión humano). de las cuales previa- Síntesis ARNm 5´ AAAAA de ADN mente sólo se disponía de pequeñas cantidades por la esca- 3´ TTTTT sez de fuentes. subtilis). El ARNm remanente es degradado. Producción de una genoteca de ADN complementario. pero que se usan más en el organismo hués- ped. vegetales que producen vacunas comestibles. en tubérculos nas por la actividad biológica de la proteína. B. tomado un papel protagónico en las ciencias de la salud. complementario Degradación del ARNm La facilidad en la producción de las proteínas recombinan- ADNc de cadena 3´ TTTTT tes ha revolucionado el área biotecnológica. contaminación con patógenos animales. por lo que ciertas proteínas recombinantes ARNm. y la cadena complementaria También puede alterarse la secuencia del gen de interés sus- del ADN de cadena sencilla para formar un ADN de doble cadena tituyendo codones para los que hay ARNt poco frecuentes se sintetiza con ayuda de una ADN polimerasa. como por ejemplo para el antígeno de gracias a los adelantos de la metodología del ADN recombi. y aun a células germina. que ahora es sencilla un mercado dominante en el mundo de la biología molecu- lar y cubre más de 10% de toda la industria farmacéutica. Los métodos más fre. cierta manera. lo que facilita su conservación. que ha detalles en el capítulo de organismos transgénicos). sentó las bases para la clonación de organis- les. vas iniciales de la metodología del ADN recombinante y. Este ADNg se corta con enzimas requiere personal especializado. coli. Las genotecas de ADNc se construyen a partir de la secuencia de crecimiento. superficie del virus de la hepatitis B humana. existen ya biorreactores cuerpos frente a la proteína de interés o la selección de clo. . pueden resultar tóxicas para las células que las producen. Así. Para con el ADNc maximizar la expresión de las proteínas se emplean promo- tores fuertes que aseguren la expresión por arriba de 10% del total de las proteínas celulares. y los costos de produc- Para construir bancos de ADN es necesario aislar el ADNg ción son bajos. de geno a las células de un organismo. Los fragmentos de y reemplazarlos por aquellos que codifican para el mismo ADNc de doble cadena se clonan en el vector de elección. se rastrea el clon o clones que adicional es que las plantas permiten el almacenamiento portan el ADN con el gen de interés. transporte y distribu- genoteca son la hibridación usando alguna sonda marcada ción. células de insecto (Spodoptera frugiper- da-9) y células de mamífero (células de ovario de hámster chino –CHO–. u hojas de lechuga. Una vez que se terianas o secuencias de ADN oncogénicas. endotoxinas bac- plementarios a los del vector de clonación. Pichia pastoris). es posible separar regiones determinadas de ADN. otros sistemas de producción.

corte con enzima de restricción. linearización del 2.. Capítulo 13. coli. Sambrook J. las cua- Inserto Vector les también se emplean para cortar el vector al cual se Genoma de M. • Corte del inserto con enzima(s) de restricción • Purificación del vector • Transformación celular • Ligación inserto/vector • Selección del ARNm • Selección de la clona celular transformada • Purificación de la proteína recombinante • Expresión de la proteína recombinante • Conversión del ARNm a ADNc • Corte del vector con enzima(s) de restricción • Purificación del inserto 3. Berlín. En la imagen que se presenta inserte los siguientes térmi- Gen de colágena Fago nos donde crea conveniente: ADN recombinante. Serie Biotecnologías. Kimmel A. Genética y biomedicina molecular. Surzycki S. . 339-347. Orozco G. procedures. Genoma de M. vector. Londres: Academic Press. Heidelberg: Springer-Verlag. Basic techniques in molecular biology. Pregunta. Noriega Limusa. Fritsch E. musculus YAC ADN genómico. c) Dibuje la estructura de un extremo de un fragmento de ADN lineal producido por una digestión con PvuII. DNA cloning experimental 1987:161-522.138 PARTE II • Metodología del ADN recombinante Ejercicios de integración 1. 2000:298-319. 2001. 3ª ed. ADNc de miostatina BAC ligación. d) Dibuje la estructura producida al ligar el extremo de la parte (b) con el de la (c). Correlacione las columnas eligiendo el vector más indica. clonar en dos enzimas de restricción diferentes.R.L. Vol. tuberculosis pcADN 3. ADNc de insulina pGLO 4. Capítulo 14. lección de Textos Politécnicos.1 unirá el inserto? ¿Es la única forma posible? Comentar. E.. Pregunta.. Nueva York: CSHL Press. DNA Cloning methods in enzymology. inserto.F. ¿Es aconsejable preparar el inserto que se va a do para cada uno de los siguientes insertos. b) Dibuje la estructura resultante si la estructura deriva- da de la pregunta anterior se trata con una nucleasa que sólo degrada ADN monohebra. proteína recombinante. ¿Cuántos sitios de reconocimiento para la en- zima EcoRI existen en el plásmido pX si al analizar me- diante electroforesis en geles de agarosa el producto de la digestión produce 4 fragmentos de ADN de diferentes tamaños? Bibliografía Berger S. Co. general considerations. Vol 1. 352-373. colocando el número del 1 al 10 que corresponda. Molecular cloning: a labora- tory manual. Maniatis T. Guide to molecular cloning techniques. 152. transformación celular. a) Dibuje la estructura de un extremo de un fragmento de ADN lineal producido por una digestión con XhoI. Ordene cada paso necesario para la producción de una vector.

Dependiendo de su concentración genera poros de cierto mero debe localizarse. A menudo. La dio más detallado del ADN fue necesaria una metodología fase móvil es el medio amortiguado que permite la movilidad que permitiera obtener grandes cantidades de fragmentos de las moléculas cargadas hacia los electrodos correspon- específicos de ADN. como el agar-agar. que es aproximada- por este medio la fragmentación se produce al azar. no puede individualizarse. Antes de abordar cada metodología es importante mencio- En los últimos años. Los cromosomas. en ese contex. se lo debía cuando se someten a la influencia de un campo eléctrico aislar del resto del genoma ya que. La separación tiene lugar debido a la dife- codificada parecía estar más allá de toda esperanza. antes conocida como agarosa (originalmente obtenido de algas. Cuando los investigadores se enfrentaron por primera vez con el gran Electroforesis de ácidos nucleicos tamaño y la complejidad del ADN. Se hizo rente movilidad que presentan las macromoléculas cargadas evidente que para estudiar un gen individual. inaccesibles por otros métodos. Normalmente la concentración es de 0. Para avanzar hacia un estu. Dot blot e hibridación in situ. estructura y la función de los genes. se han desarrollado técnicas que han nar algunos aspectos básicos que facilitarán el entendi- permitido abordar el análisis y la manipulación del ADN de miento técnico de estas herramientas de la biología mo- una forma antes inimaginada. diciona la carga de un ácido nucleico. La tecnología del ADN lecular. sajero (ARNm) pueda manipularse de cualquier modo. Para localizar fragmentos específicos se utiliza la téc- Al revelar los numerosos métodos mediante los cuales las nica de hibridación de ácidos nucleicos. pero de composición más homogénea). en especial de los genes eucarióticos. naria. eliminan y transfieren informa. Para el aislamiento de un gen presencia de grupos fosfato en su estructura. ADN complementario (ADNc) o ADN obteni. pri. incluso los de las tamaño a través de los cuales migran los fragmentos de ADN células eucarióticas más simples. para el desarrollo de sus propias manipulaciones genéticas. La electroforesis en obtención de fragmentos específicos de ADN fue posible geles de agarosa se lleva a cabo en aparatos apropiados. mentos indispensables: la fase móvil y la fase estacionaria. La fase estacio- genómico. Estos fragmentos podían ser ADN dientes cuando se genera un campo eléctrico. de que un determinado fragmento de ADN o de ARN men. añaden. debido a la to. La cantidad de ADN.5 a 2%. el ADN debe fragmentarse. agarosa posee la propiedad de permanecer líquida a más de 139 . Entre las técnicas células procesan. los biólogos moleculares abrieron el camino Northern blot. del enlace fosfodiéster de las cadenas polinucleotídicas con- Si bien la rotura del ADN puede realizarse mecánicamente. la posibilidad de descifrar la información genética macromoléculas. cada gen representa una como consecuencia de su relación carga/masa. mediante un método desarrollado a partir de herramientas cámaras generalmente horizontales. de hibridación más comunes se encuentran Southern blot. como son la electroforesis de ácidos nucleicos y la recombinante ha hecho posible investigar más a fondo la definición de sondas. y requiere de dos ele- propias de ciertos organismos. nucleicos son moléculas cargadas negativamente. La mente igual al número de grupos fosfato. es un polímero de naturaleza gelatinosa dos a partir de oligonucleótidos sintéticos. incluso el del virus más La electroforesis es una técnica analítica de separación de simple. contienen una enorme o ARN. Slot blot. por lo que localizar un segmento especí. Capítulo 15 Técnicas de hibridación Miriam Ruth Bueno Topete / Jaime González Cuevas Introducción fico es como tratar de encontrar la proverbial aguja en el pajar. o soporte. La naturaleza o de fragmentos más pequeños. Los ácidos pequeña sección dentro de un cromosoma y. ción genética.

Los fragmentos de áci. Para el análisis molecular de un pacien- Corte con enzimas de restricción Electroforesis Fragmentos separados ADN genómico Fragmentos de ADN Película Papel absorbente Membrana Membrana Gel Autorradiografía Amortiguador Detección de la secuencia de interés Hibridación con la sonda marcada Figura 15-1. mediante su tinción con bromuro de etidio. Pueden sintetizarse y purificarse con relativa facilidad por instrumentos comerciales disponibles en la actualidad. es decir. Southern y es una estrategia estándar para analizar ADN cilla marcados con moléculas reporteras. Edwin Las sondas son segmentos de ADN o ARN de cadena sen. genoma de un ser humano. que permiten su fácil detección. el diagnóstico de mutaciones en enfermedades genéticas o dos nucleicos separados por electroforesis se visualizan la identificación de un polimorfismo). radioisótopos. Obtención del ADN genómico y digestión con enzimas de restricción. hasta miles de todas las técnicas de hibridación. complementarias. El diseño de Esta técnica se utiliza para determinar la presencia de la sonda. que se clo. como enzimas o previamente digerido con enzimas de restricción. En este procedimiento. carecen de núcleo. identificar “un solo gen” o “el Se basa en la aplicación de dos procesos fundamentales: fragmento de un gen”. Gran parte del éxito de este tipo de la desnaturalización o separación de las cadenas comple- estrategias moleculares depende de la especificidad de la mentarias del ADN y la hibridación o unión de dos cadenas sonda. es lo que le un gen o fragmentos del ADN específicos en una mezcla permitirá. Este fundamento es compartido por conocidas también como oligonucleótidos. Southern blot Fundamento Sondas La técnica de Southern blot la desarrolló. en 1975. Procedimiento técnico nen a partir de síntesis química o de plásmidos. transferencia. primero se aísla el ADN de cual- nan con la sonda de interés. La longitud de las sondas puede ir de 15 a 30 bases. La especificidad de la síntesis quier célula del organismo excepto de glóbulos rojos. hibridación específica con una sonda y detección de la secuencia de interés. ya que de la sonda dependerá del objetivo de estudio (por ejemplo. entre miles de fragmentos que forman parte del de ácidos nucleicos previamente extraídos. electroforesis.140 PARTE II • Metodología del ADN recombinante 50 °C y de formar un gel al enfriarse. . bases de nucleótidos. su secuencia nucleotídica. Esquema representativo de cada uno de los pasos involucrados en la técnica de Southern blot. un colorante que se intercala entre las bases del ADN y que emite fluorescen- cia cuando se irradia con luz ultravioleta. En términos generales las sondas se obtie.

La sustitución de uno o a lo largo de toda la cadena. los fragmentos se A G T C C A T G C T transfieren del gel a un soporte sólido. la ADN polimerasa 1 añade nucleótidos tras que el marcaje radiactivo es más corto (para 32P. a partir del hueco son muy pequeños. y los fragmentos más pequeños migran más rápidamente. proceso conocido como hibridación. lation.1 pg de ácido nucleico y las enzimáticas. como membranas de nitrocelulosa o de nailon. La sonda se pone en contacto con la membrana de nitrocelulosa y en aquellos lugares en donde la sonda encuentre su secuencia comple- mentaria se pegará. La eliminación de nucleótidos del extremo 5’ y la adición detectan hasta 0. su vida media es muy larga (meses). Actividad ADNsa 1. mediante un proceso químico. de 15 al extremo 3’ OH generados. el vacío o la electro- transferencia. para identificar uno o más frag. Las sondas pueden marcarse en un extremo nick a lo largo del ADN (nick translation). etc. En este momen- to el procedimiento no es informativo. 32P-dCTP). Es importante señalar que la finalidad de A la transferencia es crear una réplica de lo que se tenía en el Actividad ADNp gel. generalmente por OH tratamiento con álcalis. Por último. vellosidades corióni. En algunas ocasiones se utilizan geles de una de las dos cadenas de la sonda. la sensibilidad varía: las radiactivas tividad de exonucleasa 5’-3’. la cual se detectará mediante A G G* T C A T G C T un proceso de revelado con placas de rayos X. celulares. La OH sonda emitirá radiactividad. va incor- como ya se mencionó. que. o más de los nucleótidos que van a ser incorporados de nuevo mo puede utilizarse la enzima polinucleótido cinasa (que por nucleótidos marcados radiactivamente origina la formación introduce un único nucleótido marcado en el extremo 5’ de de moléculas marcadas (sondas). mien. . dirección hacia el electrodo positivo. dejado en la cadena deADN por la ADNsa 1. debido a que el frag- mento de interés se encuentra inmerso en millones de T C C A G G T A C G A fragmentos creados por las enzimas de restricción. Sin embargo. el ADN se desnaturaliza para obtener cadenas Actividad ADN sal sencillas. En este procedimiento electroforético. las muestras se someten a un campo porando nuevos nucleótidos por complementariedad eléctrico. A G G* T C* C* A T G* C* T Marcaje de las sondas T C C A G G T A C G A Las sondas pueden marcarse radiactivamente (en general Figura 15-2. de nuevos nucleótidos al extremo 3’ provoca el movimiento del entre 1 y 10 pg. Existen diferentes métodos para T C C A G G T A C G A C* la transferencia. Las moléculas de ADN separadas pueden visualizarse A G G T C C A T G C T mediante su tinción con bromuro de etidio. que suprime un nucleótido al azar con su carga/masa. Para marcar en un extre. A partir de ésta. una vez produce una pequeña rotura (nick) en una de las cadenas del marcada la sonda. tomando como molde la tiva (por sus grupos fosfato) todos se mueven en la misma otra cadena de ADN intacta. ahora en un soporte mucho más sólido. En el primer paso de la reacción la enzima ADNsa 1 Una ventaja de los sistemas enzimáticos es que. ADN. células de líquido amniótico. En este método se se digiere con enzimas de restricción y los fragmentos se combinan dos actividades enzimáticas: separan por electroforesis en geles de agarosa. Marcaje de una sonda del ADN por nick trans- con 32P) o enzimáticamente (biotina. La emisión de la sonda corresponderá únicamente al fragmento de T C C A G G T A C G A interés.). de acuerdo 1. Actividad de ADN polimerasa. como los fragmentos de ADN tienen carga nega- (entre los que están marcados). A continuación. miento de nick traslation (figura 15-2). T A G G* C C A T G C T mentos entre millones de fragmentos. CAPÍTULO 15 • Técnicas de hibridación 141 te. además. el ADN puede obtenerse de linfocitos. la la sonda) o la enzima transferasa terminal (que introduce extracción puede hacerse también de otras fuentes: cultivos varios nucleótidos marcados en el extremo 3’ de la sonda). que libera nucleótidos del 5’ del nick. En la figura 15-1 se observa un esquema de cada uno de los pasos involucrados en la técnica de Southern blot. “radiactividad”. Sin embargo. Poste- riormente. digoxigenina. de acrilamida cuando los fragmentos que se van a separar 2. Dicha enzima tiene. Una vez extraído el ADN. como la capilaridad. El marcaje en toda la sonda se realiza por el procedi- cas o cualquier órgano biopsiado. se utiliza una sonda específica marcada con alguna molécula reportera (por T C C A G G T A C G A ejemplo. como es una G* membrana. ac- días).

abundancia de especies del ARN en diferentes condiciones sión genética. que por su pequeño tamaño hibridan al azar a prácticamente comparten todos los demás pasos. la desnaturalización (aunque el ARN es de merasa 1 desde el lugar donde se unen los primers. La fijación se hace generalmente con vacío y en un mol- Diferencias con Southern blot de cuyo pocillo puede tener forma de punto (dot blot) o ser Es la contraparte del Southern blot y como ácido nucleico lineal (slot blot) (figura 15-4). 15-3). Por el método de Southern blot se observa claramente la dotación génica en caso de sujetos portadores y afectados por la enfermedad. normalmente análisis no requieren su fraccionamiento. puede formar estructuras secundarias). como rearreglos. utilizando como patrón diluciones seriadas Gel de electroforesis teñido Membrana de hibridación Normal portador afectado Kb 20 9 6 4 2 1 Figura 15-3. Sin embargo. separado por electroforesis y teñido con bromuro de etidio. El esquema de la izquierda representa el ADN digerido con enzimas de restricción. Northern blot según su peso molecular. la incorporándose nucleótidos en donde algunos van marca. cuantitativas. donde se observan las bandas que son reconocidas por la sonda. Al extremo del gel. Southern blot para el diagnóstico de anemia falciforme. Al añadir la enzima ADN poli. También se utiliza para detectar polimorfismos en los fragmentos de restricción de diversos genes. . dos radiactivamente hasta que finalmente se completa la cadena. experimentales o comparar condiciones clínicas normales deleciones y dosis génica en caso de portadores (figura o patológicas. El esquema de la derecha muestra el resultado de la hibridación. con esta técnica no se utilizan enzimas de restricción. se observa un marcador de peso molecular como referencia. En este caso el diagnóstico fue dirigido hacia una hemoglo- binopatía (anemia falciforme). Aplicaciones Es una herramienta muy útil para el estudio de los produc- Aplicaciones tos de la transcripción génica (ARNm) y de su regulación. no se realiza electrofore- sis. Dot/slot blot Tras el aislamiento y separación de los ácidos nucleicos. ya que las moléculas de ARN son más pequeñas y para su mers (secuencias cortas de oligonucleótidos. Es posible realizar deteccio- se utiliza ARN en lugar de ADN. una enfermedad autosómica recesiva. como son lo largo de toda la cadena). expresado en kilobases (Kb). van cadena sencilla. hexámeros. La técnica de Southern blot ha sido de gran utilidad para ya que se pueden estudiar las potenciales variaciones en la identificar genes asociados con enfermedades de transmi. e identificar mutaciones. transferencia y la hibridación con una sonda. A diferencia del Southern nes no sólo cualitativas (positivo o negativo) sino también blot. la electroforesis. éstos se aplican directamente a la membrana sin separarlos.142 PARTE II • Metodología del ADN recombinante Otro método para marcar sondas es el de random pri. es decir.

Normalmente se utiliza unión de una sonda con una secuencia complementaria de gelatina crómica. En la actualidad. polilisina o Vectabond® (producto comer- ADN o ARN dentro de un tejido. El procedimiento es muy complejo. A diferencia de Southern cial). modalidad conocida más relevantes. En la actualidad existe un tratamiento con anticuerpos monoclonales humanizados dirigidos específicamente contra el producto del gen HER2/ Hibridación in situ NEU que mejora el pronóstico y la sobrevida del paciente. en el cual deben conservarse los ácidos principales aplicaciones son la identificación de infecciones nucleicos lo más íntegramente posibles. o con biotina. usado. Antes de la hibridación. ya que el detalle Aplicaciones morfológico no se pierde. B) Soporte que se utiliza para realizar un slot blot. Figura 15-5. de la señal). Las ción del tejido. mantener la mor. Los principios de ambos fología del tejido y permitir una accesibilidad suficiente métodos son semejantes y el resultado final es el mismo: la para que la sonda penetre. Después de la fijación las secciones de tejido deben química se basa en la unión antígeno/anticuerpo. ción y la accesibilidad de la sonda) y se someten a una pos- de ahí el nombre de in situ (en el mismo lugar). donde los orificios se encuentran en forma de líneas. así como el estudio de El primer paso para la hibridación es la preparación y fija. Esquema de la visualización del dot blot y slot blot. que implican mal pronóstico.INEN dots slots HER-2/neu CEP 17 Figura 15-4. La hibridación in situ tiene un alto grado de resolución. expresión de genes (ARNm) a nivel celular y subcelular. donde los orificios están en forma de puntos. metas- tásicos. que permite la localización de secuencias génicas a nivel cro- mosómico. El gen HER2/NEU se encuentra localizado en el cromosoma 17q. Es un método histoquímico que emplea a la biología mo- lecular de la misma manera que la inmunohistoquímica uti- liza los métodos de la inmunología. determinando. Las sondas fijación con paraformaldehído (incrementa la especificidad que se utilizan para la hibridación in situ pueden ser radiac. la hibridación in situ no requiere de la HCl (que extrae proteínas e hidroliza parcialmente las extracción de ácidos nucleicos. virales en tejidos. se relaciona estrechamente con los estadios avanzados. . El tipo de soporte que se utiliza durante el proceso de fijación de los ácidos nucleicos en una membrana o filtro es lo que determina la forma en que se visualiza esta técnica molecular. sino que en el mismo tejido secuencias diana) y proteinasa K (que incrementa la penetra- se lleva a cabo el procedimiento de detección e hibridación. y su amplifica- de concentraciones conocidas del genoma que se está ción está presente en 25 a 30% de las neoplasias de mama. a diferencia de lo que ocurre con las modalidades radiactivas. da de una inclusión con parafina es el procedimiento más varse al microscopio. así como el mapeo cromosómico. con lo que se pueden detectar translocaciones y Aspectos técnicos otras alteraciones cromosómicas. por lo que tivas y no radiactivas. segui- identificación de componentes tisulares que pueden obser. A) Soporte que se utiliza para realizar un dot blot. Identificación del gen HER2/NEU en cáncer de mama por la técnica de FISH. Técnica de FISH. como hibridación in situ acoplada a un sistema de fluoro- cromos (FISH) (figura 15-5). La especificidad de la inmunohisto. CAPÍTULO 15 • Técnicas de hibridación 143 A) Dot blot B) Slot blot Laboratorio de Genética . las más relevantes únicamente se han mencionado algunos de los aspectos son las marcadas con fluorescencia. los tejidos se pretratan con blot y Northern blot. La fijación con formalina. mientras adherirse al portaobjetos y no deben desprenderse durante que la especificidad de la hibridación in situ se basa en la el procedimiento de hibridación.

donde se hibridan con das procedentes del cromosoma deseado.1) del banco de genes (http://www. ¿cuál técnica de D hibridación es la más adecuada para detectar el ARNm? 1 2 3 4 5 2. ¿Puede identificar cuáles individuos presentan el gen alterado? 1 2 3 4 5 6 Bibliografía Aussubel F. . Biotechnology: A guide to genetic engineering. Kingston R. 1998. Russell D. et al. 1ª ed. cientes con sospecha de presentar la infección. 2000. donde hibridan con una sonda mar. Springer. Seidman J. Castillo I.gov). Peters PM.G. una sonda marcada específica para un gen. ¿Puede responda lo siguiente: identificar cuáles individuos están infectados? ¿En qué posición del ARNm se unen las siguientes son- das? a) 5’agctctgctggatcggcatggag3’ b) 5’acgcggacccgcgggcgtctaaaatt 3’ ¿En qué exón se localizan estas secuencias? ¿Cuál es la secuencia complementaria de cada sonda? Según lo mencionado en este capítulo. Consulte la secuencia número del ARNm de NFkB 4. La siguiente fotografía muestra la hibridación de una son- da en el ADN digerido con enzimas de restricción de los miembros de una familia con alteraciones en el gen de distrofina. 2001. Ross J. a) La técnica permite localizar un segmento concreto de los fragmentos generados son marcados con radiacti. John Wiley & Sons.nih. La siguiente fotografía muestra la hibridación de una son- (NM_001077494.D...A. 2006. 1ª ed. b) Si el marcaje es de tipo quimioluminiscente la técnica cada específica para un gen. se denomina FISH. Short protocols in molecular biology. Moore D. se separan por electroforesis y se transfieren a eucariótico. editores.nlm.. Londres: Smith J. 5. separado por electroforesis y transferido a una membrana.. Nueva York: CSHL Press. situ? b) Se extrae ADN. Dubuque: William C. 4ª ed. Madrid: cloning: a laboratory manual. The condensed protocols.. que se separan por electroforesis y se con fluorescencia. c) Se utilizan fragmentos de ADN cortados con enzimas c) Consiste en detectar determinados ARNm marcados de restricción. 3.. Según la información allí reportada. Nucleic acid hybridization. 1993.. ¿Cuál de los siguientes enunciados es verdadero para la técnica Southern blot? a) Se extrae ARN celular. Essential techniques. Brent R. se hibrida con una son. ADN en una posición determinada de un cromosoma vidad.144 PARTE II • Metodología del ADN recombinante Ejercicios de integración 1. Brown Publishers. From molecular Carreño V... Principios de biología molecular. se digiere con enzimas de restricción. Nueva York: John Wiley and Sons. da en el ARNm del virus del papiloma humano en pa- ncbi.E. ¿Cuál frase es correcta para describir la hibridación in da marcada específica para un gen. Sambrook J.E. utilizando sondas de ADN marca- transfieren a una membrana. una membrana.

Para la PCR teóricamente se requiere de una sola molécula. La función de cada uno de estos elementos en la reacción se bas moleculares. no formar estructuras géiser. desoxinucleótidos (dNTP) para la La reacción en cadena de la polimerasa (PCR) se considera síntesis del producto de PCR y oligonucleótidos o primers. Con ello. por lo que debía suplementarse de iniciadores. tiene como función polimerizar una obtenerse por otros métodos hasta ese momento. la Taq ADN polimerasa es la enzima más ADN de manera rápida y económica. la técnica pudo hacerse más eficiente. coli se duplican hasta que los reactivos se agotan. Esta enzima es capaz reglas de la replicación. en cada ciclo de la ADN polimerasa. ción del siguiente nucleótido. pues dicha enzima soporta los 95°C. También. de reacción a temperaturas de 95°C. esto es. los cuales no podían empleada para la PCR. Esta téc. por complementariedad. Los embargo.5 U/reacción de PCR. de la bacteria Thermophilus aquaticus. en los laboratorios de CETUR Corporation. nueva cadena de ADN tomando como molde otra ya exis- nica se basa en una replicación exponencial in vitro de una tente. Fue desarrollada en 1986 por el Dr. de ADN o de ADNg. permitió el aislamiento de la Taq polimerasa ellos u otra parte de la cadena. nuevo después de cada paso de desnaturalización (95°C). En cada uno de los ciclos las moléculas riormente. La idea se fundamentó en la necesidad de obtener un gran número de copias de fragmentos específicos de En la actualidad. que se inactivaba con la La longitud del producto amplificado la delimitan los temperatura de 95°C. que le sirve de molde y. ya que requiere de un nucleótido con el extremo 3’ libre que proporcione el grupo OH para la adi. Mullis. una de las técnicas más sensibles y específicas de las prue. también llamados primers u oligonucleótidos. el descubrimiento de bacterias habitantes de los iniciadores deben ser específicos. con lo que se forma el enlace cuya secuencia sirva de molde para la amplificación. Capítulo 16 Reacción en cadena de la polimerasa Ana Soledad Sandoval Rodríguez / Jorge Fernando Floresvillar Mosqueda Alejandra Meza Ríos Introducción polimerasa. El ADN se puede obtener de cualquier Para que se lleve a cabo la PCR se requiere una cadena muestra biológica. Sin de cuyo diseño adecuado depende el éxito de la PCR. y la cantidad inicial de enzima añadida a la reacción es Características de la amplificación in vitro suficiente como para suplementar los 25 a 40 ciclos de ampli- y requerimientos necesarios para la PCR ficación. cofactores necesarios para la actividad correcta de la ADN polimerasa. mediante ciclos repetitivos. que constan de polimerasa capaz de soportar dichas temperaturas. en Esta- dos Unidos. que viven a temperaturas alrededor del punto de ebu- secundarias entre ellos ni hibridaciones inespecíficas entre llición del agua. Ante- tres temperaturas. la síntesis de la cadena sigue ADN molde la dirección 5’-3’. ya sea fosfodiéster. sintetiza la cadena antiparalela. y su tasa de error en La amplificación in vitro de la PCR se apega a las mismas la incorporación de bases es de 4 × 10-4. se requiere de una ADN tario (ADNc). lo que le hizo valedor del premio Nobel ADN polimerasa en 1993. La concentración de Taq polimerasa que se reco- mienda es de 1 a 2. esta necesidad se suplía con la adición de E. una enzima ADN de ácidos nucleicos proveen de moléculas de calidad adecua- 145 . se basa en una secuencia de polimerizar un promedio de 1000 nt/minuto. Debido a que en cada ciclo de la PCR se lleva la mezcla molécula de ADN genómico (ADNg) o ADN complemen. Kary describe a continuación y se enlistan en la figura 16-1. y la mayoría de las técnicas de extracción de ADNg o ADNc que sirva de molde.

mientras que concentraciones hibride en una secuencia exónica y el otro oligonucleótido . con mayor facilidad. se la PCR se requiere realizar una reacción previa: la retro. la ADN polime- actuales empleadas en la PCR permiten realizar la amplifica. dNTPs o desoxinucleótidos y oligonucleótidos para el inicio de la síntesis. según la 100 ng en el caso de ADNc o ADN proveniente de genes secuencia a la que dan origen. dCTP. al adicionar nucleótidos en él.4 y está compuesto por Tris-HCl y KCl. ya que un exceso de magnesio pro- Figura 16-1.5 a 25 μg de expresión de un ARN mensajero (ARNm) convertido a ADN. dGTP. Esta concentración debe optimizarse de manera experi- mental para cada PCR. Su función radica en pro- menos lábil que una cadena de ARN (cabe recordar que la porcionar un extremo 3’ libre al que se han de añadir los inestabilidad molecular del ARN es elevada por la presencia nucleótidos consecutivos mediante enlace fosfodiéster.146 PARTE II • Metodología del ADN recombinante COMPONENTES PARA UNA REACCIÓN DE PCR menores de 50 μM se consideran insuficientes para una sín- tesis adecuada. se utilizan para reconocer por complementariedad secuen- da para realizar la PCR. En la PCR convencional.3 a 1 μM/reacción. lleve a cabo la reacción en cadena de la polimerasa se requiere mientras que una baja concentración disminuye la produc- una cadena de ADNg o ADNc que sirva de molde. En la PCR la concentración óptima de los ini- ciadores es de 0. cantidad suficiente para sintetizar de 6. El tamaño de los productos a amplificar se nucleótido. Molde ADNds o ADNc Amortiguador Primers u oligonucleótidos La solución amortiguadora proporciona el pH y concentra- ciones de sales adecuadas para la correcta función de la Enzima ADN polimerasa ADN polimerasa. usa un par de iniciadores para delimitar los extremos del transcripción. Los iniciado- ción a partir de 300 ng de ADN genómico. como se aprecia en la figura 16-3. (figura 16-2). A partir de ellos. En cambio.0 y 2. una enzima ADN polimerasa. Si se quiere amplificar ARN. Estos reactivos se mezclan y se someten en Iniciadores el termociclador a los ciclos de amplificación. aunque se recomienda que cionarse en una concentración óptima de entre 50 y 200 sea entre 200 y 500 pb. la enzima. los primers se diseñan de tal forma que uno de éstos incorporaciones erróneas. El diseño adecuado de los iniciadores es la clave del éxito de una PCR. por lo que su polimerización originará la cadena 3’-5’ doble cadena (ADNds) en los ciclos posteriores de la PCR. Mn+2 o Mg+2 necesarios como cofactores para ción del amplificado. entonces. G. ori- partir de ARN. T. el PRIMER liza la síntesis de la cadena complementaria del ADNc. Los desoxinucleótidos libres. de amplificar. El ADNc puede que la ADN polimerasa requiere iniciar la síntesis partiendo manejarse. Componentes de la reacción de PCR. antes de cias blanco en el ADN molde. lo antisentido es complementario y antiparalelo a la cadena que permitirá la amplificación de la secuencia como ADN de 5’-3’. Para que se duce una amplificación inespecífica de productos de PCR. Este buffer maneja un pH de 8. El iniciador sentido es com- clonados en vectores. En caso de que se desee analizar la μM. con secuencia específica. cuando Diseño de iniciadores y su papel no forman cadenas de ácidos nucleicos. encuentra entre 100 y 1000 pb. dTTP) en la mezcla de reacción para poder sintetizar la nueva hebra del ADN.C O P O P O P O CH O O O O H H H H H H dNTPs El magnesio actúa como cofactor de la ADN polimerasa y Termociclador se suplementa a una concentración de entre 1. Es importante aclarar que en el caso de plementario y antiparalelo a la cadena 3’-5’ del ADN molde. se encuentran en su forma trifosfatada. con el mismo. o bien desde 25 a res reciben el nombre de sentido y antisentido. Las técnicas de un 3’OH preexistente. gina una cadena sentido (5’-3’). durante los primeros ciclos de la PCR se rea. estructura molecular necesaria para su en la especificidad de la PCR estabilidad y para proporcionar el grupo fosfato con el que Los iniciadores definen el tamaño del fragmento que se ha se formará el enlace fosfodiéster en la unión nucleótido. ya que un exceso favo- Desoxinucleótidos recería la formación de dímeros entre dos primers parcialmente complementarios. ya del grupo OH en el carbono 2’ de la ribosa). o bien de estructuras Para que la polimerasa lleve a cabo su función necesita que secundarias por complementariedad parcial de un primer existan desoxinucleótidos (dNTP: dATP. rasa inicia la polimerización en dirección 5’-3’. Cofactores (MgCl2) base Cloruro de magnesio O O O A. Los desoxinucleótidos trifosfatados deben adi.5 mM. que permite convertir el ARN en ADNc. la amplificación de ADNc obtenido por retrotranscripción a por lo que la polimerasa. producto que se desea amplificar. Cantidades mayores de 200 μM pueden producir ADNc. Estos oligonucleótidos.

de doble cadena que interfiere con el correcto alineamiento La secuencia y la longitud de los iniciadores es determi- del iniciador. Posible secuestro del extremo 3’ en los iniciadores turas secuestran el extremo 3’. Estos pasos se realizan mediante el cambio automático de temperaturas en un termociclador. CAPÍTULO 16 • Reacción en cadena de la polimerasa 147 ADN de interés PCR 3’ 5’ 5’ 3’ Desnaturalización 95ºC 3’ 5’ 5’ 3’ Alineación de primers 50ºC 3’ 5’ Primer Primer sentido 3’ 5’ antisentido 5’ 3’ 5’ 3’ 72ºC Extensión Figura 16-2. alineación y exten- sión. la cual se define complementariedad interiniciadores. sobre todo cuando estas estruc- Figura 16-3. Esquema convencional de un PCR. generando una estructura plegada de nucleótidos como se ejemplificó en la figura 16-3. b) Complementariedad de bases La secuencia de los iniciadores debe ser altamente espe- cífica para el gen de interés. el producto será de un tamaño dife- Iniciadores de PCR rente. generando dímeros que como aquélla a la que el 50% de los iniciadores se encuentra afectan la disponibilidad de los mismos en el PCR. También debe evitarse un diseño que permita 3’ CAAGGCATACCGGGATCGATT 5’ la complementariedad o la formación de estructuras secun- darias inter e intra-primers. Los ciclos del PCR constan de los pasos de desnaturalización. En la tempe- ratura de extensión la enzima polimeriza los dNTPs y forma la cadena complementaria basándose en el molde al cual hibridó el primer correspondiente. la ampli- ficación del producto del tamaño esperado asegura que sólo 5’ TGTACCGTTCCGTATGGCCC los ARNm se han amplificado. En caso deque se haya ampli- G ficado también una secuencia de ADNg. a) Estructura secundaria en 3’: generada por comple- mentariedad intrainiciador. en estructura de cadena lineal. Se procura un diseño tal que . mientras la temperatura de alineamiento proporciona las condiciones cinéticas favorables para la unión de los iniciadores con su secuencia complementaria. a) Estructura secundaria en 3’ lo haga en otra secuencia exónica. no adecuados como se aprecia en la figura 16-4. y procurar un contenido de 5’ TGTACCGTTCCGTATGGCCC 3’ nucleótidos G-C de 40 a 60% y una longitud óptima entre los 18 y los 30 nt. de esta manera. (proveniente de 3’ AAGGCATACCGGA contaminación de la muestra de ARN con ADN durante el proceso de extracción). La temperatura de desnatura- lización permite el rompimiento de los puentes de hidrógeno entre las cadenas del ADN. indispensable para la adición de PCR. ya que tiene secuencias intrónicas de por medio. b) Complementariedad de bases: producida por nante para su temperatura de fusión (Tm).

una posible hibridación. de los programas utilizados son Oligo 6. Amplificación final. que incluye los siguientes pasos: consideración el contenido de nucleótidos.0.nih. Cuando el molde de la reacción de PCR sea el ARNm (ADNc correspondiente). etc. Primer Desing®. Este software coteja similares para ambos primers y una eficiencia de amplifica. La Tm aumenta según la longitud del inicia. total o parcial. Almacenamiento temporal. 2. tomando en cuenta los parámetros mencionados. por lo que si éstos se diseñan para que hibriden en dos exones diferentes. sobre todo G y C.ncbi. compatible con la amplificación de Esquema de la PCR la generalidad de los fragmentos. el tamaño que genere el producto de amplificación será mayor cuando el molde sea la molécula de ADNg que contiene la secuencia interexónica. Inicio de la desnaturalización. 3. Primer Express®. En la actualidad.gov/Blast. Una vez diseñados. . por lo que un iniciador por debajo de las 18 nt hibridaría especificidad de los primers y su empleo correcto. requieren de Tm superiores a 65°C. Algunos • Temperatura de alineamiento. lo cual garantiza temperaturas de alineamiento http://blast. Existen muchos métodos En la figura 16-2 se presenta el esquema convencional de para calcular la Tm de los iniciadores. de la PCR. reportada en el Gene Bank que pudiera interferir con la dor. por esto. es decir un intrón.cgi). Diseño de iniciadores para la discriminación de ARNm y ADNg.148 PARTE II • Metodología del ADN recombinante Exón 2 Intrón Exón 3 5’ 3’ 3’ Exón 2 Intrón Exón 3 5’ Primer antisentido Corte y Empalme 5’ 3’ 3’ 5’ Exón 2 Exón 3 Primer antisentido Primer sentido 5’ 3’ 3’ MOLDE ADNg 5’ Primer sentido MOLDE ADNc MPM ADNg ADNc Exón 2 Exón 3 1000 pb 500 pb Exón 2 Exón 3 300 pb 100 pb Figura 16-4. • Temperatura de extensión. Por otro lado.nlm. el amplicón será de menor longitud por carecer de la secuencia intrónica. • Temperatura de desnaturalización. hibridación con otras secuencias (ARNm o génicas) reporta- ductos inespecíficos. Ciclos de amplificación. nales permiten el diseño semiautomatizado de los primers. En caso de de forma inespecífica en la cadena molde y originaría pro. amplificar. dos deben verificarse contra alineaciones inespecíficas en la 4. la Tm de ambos primers sea muy similar y no presente más misma secuencia blanco o bien en otras secuencias. con alguna secuencia ción adecuada. la longitud óptima está entre los 20 y 30 nucleótidos para que se obtenga una Tm entre 55 y 65°C. Los iniciadores definen el tamaño del fragmento que se ha de amplificar. emplean- de 5ºC de diferencia con la Tm del producto que se va a do el programa BLAST (Basic Local Alignment Search Tool. pero todos toman en una PCR. la longitud del primer y la concentración de Na+ en el tubo 1. iniciadores muy largos das en el banco de genes su diseño debe replantearse. muchos programas computacio. los oligonucleóti.

la más utiliza- ca. los equipos cuentan con Una vez terminados los ciclos designados para la PCR. o lo que es lo mismo. lo que alteraría las condiciones óptimas para la ADN polimerasa y Almacenamiento temporal la termodinámica de hibridación de los primers. se evita sión de los productos a los cuales se encuentra unida. en el cual la mayoría de los iniciadores hibridan. partiendo de 10 Desnaturalización copias de ADN molde. Esta temperatura se mantiene por 30 segundos. según la longitud del producto que se va P = (2)nT a amplificar. Inicio de la desnaturalización Es necesaria una temperatura de 95°C para la desnaturaliza. la una placa metálica a manera de tapa. Por ejemplo. en el caso del ADN genó. que distribuye la temperatura de manera homogénea da es de 72°C. es. mentaria y formen los puentes de hidrógeno con la cadena molde.8 × 1075 moléculas. lo que permite el acceso de los primers a la ficación exponencial. En el caso de la Taq polimerasa. que la concentración de los solutos se modifique. Extensión biar la temperatura de la muestra en cuestión de segundos. lo que descensos de temperatura relativamente rápidos. Dado que las PCR que se incuban son soluciones acuosas. Normalmente los rangos de temperatura que Amplificación final abarca el equipo van de 4 a 96°C. donde: Este ciclaje de temperatura se repite continuamente por P = número de moléculas producto de PCR. Bajo las condiciones y diseño de oligonucleótidos apro- . CAPÍTULO 16 • Reacción en cadena de la polimerasa 149 Estos pasos se llevan a cabo mediante el cambio auto. considerando la adición de 1000 nucleóti- dos en 60 segundos. al En esta fase. número de copias por cada ciclo mico. una PCR de 25 ciclos. permite conservar los productos de PCR hasta que se reti- ren los tubos de reacción del equipo. Así. de del número inicial de copias del molde de ADN (T). esto lar. Es el equipo en el cual se realiza la PCR. por peraturas siguientes: lo que se aplica la fórmula que indica que si se parte del • 95°C: desnaturalización por unos 30 segundos. 2250. En la figura 16-5 se presenta un esquema de esta ampli- rias del ADN. 1. dejando el extremo 3’OH disponible y listo para la adi- Termociclador ción de los nucleótidos consecutivos por la ADN polimerasa. Se produce a la temperatura óptima para el funcionamiento lo que por lo general se logra mediante calentamiento/ de la ADN polimerasa empleada. por lo que dependerá ésta enfriamiento por resistencia eléctrica de una placa metáli- para la PCR. Es capaz de cam. Teóricamente. Cada temperatura cumple con una fun. lo que permite que la polimerasa termine la exten- los tubos donde ocurre la reacción. producirá la cantidad de P = (2)25 × 10. el producto Ciclos de amplificación de PCR aumenta exponencialmente conforme al número de ciclos de PCR (n). ción específica. se genera la energía cinética necesaria para que los inicia- mático de temperaturas en un equipo diseñado para este fin dores busquen en las cadenas de ADN su secuencia comple- denominado termociclador. o el rompimiento de estructuras secundarias. 30 a 35 ocasiones. Esta temperatura se mantiene por cinco minutos al inicio de la PCR. el producto de PCR depen- Un ciclo típico de PCR convencional consta de las tres tem. T = número de copias inicial de la molécula molde. Para el Durante la programación de los ciclos de la PCR se progra- enfriamiento se generan flujos de aire frío. n = número de ciclos. en el según la expresión p = (2)nT ADNc. en cada uno de los ciclos de amplificación se duplica la cantidad de producto inicial. lo que permite ma también un ciclo final de 4°C por varias horas. doble de moléculas iniciales de ADN se obtendrá el doble • 55 a 60°C: alineación por 30 a 40 segundos. Sensibilidad de la técnica de PCR Alineación La PCR es una técnica altamente sensible y específica. Sin embargo. Cantidad del producto de PCR: ción de la doble cadena de ADN. durante tiempos programados en el rango de segundos a minutos. de producto: • 72°C extensión. cadena molde en sus secuencias complementarias. doble cadena de ADN y/o destruir las estructuras secunda. la cual se mantiene a temperatura de extensión (72°C) se mantiene por cinco 103°C para evitar la condensación del agua en las tapas de minutos. Se realiza a 95°C y tiene como objetivo desnaturalizar la o sea. la temperatura se encuentra en un rango entre 55 alcance de la mayoría de los laboratorios de biología molecu- y 60°C. De esta manera.

que se enlistan a continuación: Con el valor de intensidad relativa de los genes.1 073 741 824 copias Figura 16-5. a (hipoxanthine guanine phosphoribosyltransferase). como se empleado. genes constitutivos más empleados para este tipo de análisis ca. en la que el carril 3 muestra una de estos factores influirán en la calidad de la PCR. (beta-actina) y ARNr 18S (ARN ribosomal 18S) son los mers empleada se dispone de diversas variantes de la técni. Sin embargo. la optimización de las condiciones diversas muestras. ya que es indispensable para la viabilidad de la ción y producir falsos positivos. T = número de copias inicial de la molécula molde. el termociclador a cualquiera de las muestras contenidas en el gel. Esta técnica ha evolucionado desde su invención. La amplificación del producto de PCR sigue la fórmula P = (2)nT. Sin embargo. en experimentación es dif ícil obtener da se considera proporcional a la cantidad de producto estos resultados. gracias a los múltiples sistemas de detección. la calidad de la mues. donde: P = número de moléculas producto del PCR. Amplificación exponencial del producto de PCR. amplificado y su longitud se verifica interpolando contra un ra crucial en el desarrollo de una PCR. Ya que la expresión del gen constitutivo permanecerá El producto amplificado se visualiza mediante una banda relativamente constante. O bien una puede proporcionar un diagnóstico temprano.23 8 copias P = 2nT= 230 . banda tres veces más intensa que la banda del carril 1. de la banda del producto de PCR permite medir su intensi- tra que se va a amplificar. análisis se mide la intensidad relativa de la banda del produc- ca hace que la realización de una PCR sea una tarea para el to de PCR del gen de interés y de un gen constitutivo. La semicuantificación puede ser respecto de reacción.150 PARTE II • Metodología del ADN recombinante Amplificación exponencial 2n ADN molde Tercer ciclo . En cada ciclo se duplica la cantidad de producto inicial.25 32 copias Segundo ciclo . HPRT actualidad. Para este tipo de minarse su presencia. como se observa en la figura 16-7B. esta misma característi. ya que múltiples factores influyen de mane. β-actina variantes en los iniciadores y a la cantidad de pares de pri. piados se puede obtener una sensibilidad y una especificidad (ver el capítulo 12 Electroforesis). célula y esta expresión no se altera por la presencia de alguna enfermedad o variaciones en la condición fisiológica. La intensidad de la ban- de 100%. El análisis de imagen el diseño correcto de primers y sondas. En la GAPDH (gliceraldehido 3 fosfato deshidrogenasa). la concentración de reactivos.24 16 copias Primer ciclo . pues tan sólo semicuantificación de las muestras respecto a un gen cons- con pocas copias del genoma de un patógeno puede deter. la contaminación con tativa de las bandas de los productos de PCR obtenidos en otros productos de PCR. Esta sen. no varía entre los individuos ni durante el desarrollo (edad) y Modalidades de la técnica de PCR no se ve afectado por las condiciones del experimento. como la selección de marcador de peso molecular comercial de longitudes cono- un sistema adecuado de detección del producto amplificado. esta relación indica directamente . pero sibilidad es su principal característica y desventaja: una PCR la mitad de intensa que la banda de la muestra 2. n = número de ciclos. constante. el control de los inhibidores de la dad mediante software y realizar una medición semicuanti- reacción. El control y el manejo correcto de cada uno observa en la figura 16-7A. etc. Se especialista y que siempre deba tenerse cuidado de evitar un considera un gen constitutivo aquel que tiene una expresión acarreamiento de material que pueda contaminar la reac. la contaminación ambiental.22 4 copias Cuarto ciclo . los datos se normalizan respecto al gen constituido y se calcula un índice: PCR convencional Intensidad relativa del gen de interés Se basa en la detección del producto de amplificación intensidad relativa del gen constitutivo mediante una electroforesis en gel de agarosa o acrilamida. titutivo. cidas como se aprecia en la figura 16-6. por lo que el número de moléculas producto del PCR aumenta exponencial- mente conforme avance la reacción.

1 URA 0-95 URA 100 pb Figura 16-7. es aquella en la cual se mide la intensidad relativa de la banda del producto de PCR del gen de interés y de un gen constitutivo para cada una de las muestras. CAPÍTULO 16 • Reacción en cadena de la polimerasa 151 1 2 3 Preparar agarosa o RY BATTE acrilamida Pipetear muestras Agregar gel a la y marcador de PM cámara y buffer de corrimiento (negativo) 4 5 muestra M PM pb 12. se determina la relación gen de interés/gen constitutivo para cada muestra. Análisis de imagen de la banda del producto de PCR. La muestra corresponde a un producto de aproxi- madamente 300 pb.45 100 pb Muestra C2: 3/095 = 3. en el cual las bandas de los productos de PCR obtenidos de varias muestras se comparan respecto a cualquiera de las muestras contenidas en el gel. Visualización del producto de PCR mediante electroforesis en gel.1 = 5.83 100 pb Muestra C2: 6/1. MPM C1 C2 C3 A) MPM C1 C2 C3 B) 1000 pb 1000 pb Gen de interés 500 pb 500 pb 300 pb 300 pb 1 URA 6 URA 3 URA Muestra C1: 1/1. . En este gel el carril marcado MPM corresponde al marcador de peso molecular de 1 Kb plus ADN ladder. La intensidad de la banda se considera proporcional a la canti- dad de producto amplificado y su longitud se verifica interpolando contra un marcador de peso molecular comercial de longitudes conocidas.15 MPM C1 C2 C3 1 URA 6 URA 3 URA 1000 pb Muestra C2: 6 veces más que la muestra C1 Gen constructivo Muestra C3: 3 veces más que la muestra C1 500 pb 300 pb 1. A) Análisis semicuantitativo respecto a una muestra.000 850 650 500 400 300 300 200 100 Comparar bandas de muestras (positivo) vs marcador PM Corrimiento Figura 16-6.650 1. como en la imagen donde el carril 3 muestra una banda tres veces más intensa que la banda del carril 1. y dicha relación se compara entre muestras indicando cuál de ellas expresa más o menos el gen de interés normalizado contra el gen constitutivo.000 Afluente de energía 5.2 = 0.000 Marcador de PM 2. B) Semicuantificación respecto a un gen constitutivo.2 URA 1. La intensidad de la banda del producto de PCR se mide mediante un software.000 1. La detección del producto de amplificación mediante una electroforesis en gel de agarosa se observa como una banda. como se puede apreciar en el carril de muestra. los valores correspondientes a las bandas se observan en la columna pb (pares de bases). pero la mitad de intensa que la banda de la muestra del carril 2.

que se describen más adelante. el producto de PCR es cuantifi- sólo reporta si una muestra es positiva o negativa ante la cable.152 PARTE II • Metodología del ADN recombinante la variación entre muestras del gen de interés. Es decir. Los resultados de las muestras se traslapan a los valores de la curva y de esta PCR semicuantitativa manera se conoce la concentración de la muestra. como porcentaje de expresión. PCR cualitativa Esta modalidad de PCR permite detectar la presencia o PCR cuantitativa ausencia de un fragmento de ADN determinado. la expresión del gen constitutivo el índice que se obtenga nología de detección en tiempo real empleando los métodos indicará la expresión real del gen de interés y se reporta 2ΔΔCt. Permite conocer los niveles de expresión de un gen (ARNm) en particular. El producto de amplificación de la PCR anidada será por tanto de longitud más corta que el primer producto de PCR. tidad de un microorganismo o del ARNm de un gen en una nóstico de enfermedades infecciosas y sólo permite confir. cida del ADN que se quiere analizar. Para la cuantificación absoluta se amplifica al mis- mar la presencia o ausencia de un determinado agente mo tiempo una curva con muestras de concentración cono- patógeno. lo que permite reportar en números absolutos la can- presencia de un determinado ADN. Esto permite su compara- ción con otras muestras analizadas de la misma manera. y normaliza los niveles encontrados de este PCR múltiple (varias regiones o varios genes) gen con los encontrados en un gen de expresión constituti. Esta variante de la PCR es más sensible porque amplifica el ADN en dos rondas de amplificación con distintos pares de iniciadores en cada una. Esta forma de lizar una relación entre la expresión del gen de interés con semicuantificación es también posible realizarla con la tec. PCR anidada. que se expresa de manera constante en la célula. fragmento de ADN en una sola reacción de PCR con dos o ADN de interés 3’ 5’ 5’ 3’ a) Alineación del primer juego de primers 3’ 5’ Primer Primer sentido antisentido 5’ 3’ b) Alineación del segundo juego de primers 3’ 5’ Primer sentido Primer antisentido 5’ 3’ Figura 16-8. Se emplea para el diag. a) La primera reacción de PCR se realiza con un par de iniciadores que amplifiquen una región de ADN extensa. En esta modalidad de PCR. muestra. esto es. o el método 2ΔCt. . b) Una segunda PCR se realiza con el producto de amplificación de la primera PCR como molécula molde con otro par de iniciadores anidados. si una persona está o no infectada. Al rea. En este tipo de PCR se realiza la amplificación de más de un va.

Esta técnica se utiliza para el análisis simultáneo tidad de producto al final. La PCR múltiple o mul- de que diferente cantidad de material de inicio da lugar a una tiplex puede emplearse para la búsqueda de varias delecio- cantidad diferente de producto al final. Por lo tanto. será menor que la del primer produc. en caso de estar ausente. Los sistemas de detección por fluorescencia empleados za una PCR con un par de iniciadores externos para ampli. por tanto. En caso de La reacción de amplificación es la misma. pues más de una molécu- PCR selectiva (detecta genes la de bromuro de etidio puede unirse a un solo producto de silvestres o mutados) PCR y. además de que dife- nes. Mediante la detección de la fluorescencia liberada extracción del ADN del tejido. pero Es aquella en la que el producto de PCR se analiza después de presenta el inconveniente de que el diseño de los primers 25 a 35 ciclos en el punto previo a la saturación de la reacción. requiere un procesamiento posreacción. no se produce un PCR en tiempo real producto de PCR. a los investigadosres a diseñar una tecnología que solventa- tre del gen. que suele ser baja y no patógenos. ya que la emi- ciclador especial. tidad de ADN sintetizado en cada momento. . y la tinción de bro- muro de etidio es semicuantitativa. puede emplearse un agen- to de PCR (figura 16-8). Presenta el inconveniente ellos (hibridaciones inespecíficas). ra estos inconvenientes conocida como PCR en tiempo real. Esto se logra porque la PCR anidada (nested-PCR) temperatura óptima para la enzima AmpliTaq Gold® es de Esta variante de la PCR convencional proporciona mayor 60ºC. te intercalante denominado SYBERreen. está infectada por un patógeno. como SyberGreen o SyberSafe. Esta modalidad de PCR permite saber qué tipo celular pre. En la laminilla se añaden los durante la reacción de amplificación puede medirse la can- reactivos necesarios para la PCR y se colocan en un termo. Tiene la ventaja de que ahorra tiempo y reactivos. PCR en punto final lar). Después. o PCR anidada. por lo que. organismos genéticamente modificados. Cabe mencionar que para la técnica de PCR en tiempo real la temperatura de alineación y extensión es la misma. al amplificar las secuencias de alineación óptima a la misma temperatura permite que este ADN en dos rondas de amplificación con distintos pares de paso sea conjuntado y reduce el tiempo de reacción. La detección de las copias del producto de PCR resultan positivas. No requiere merasa. amplificar una región más pequeña (interna). ya que en lugar de tener orificios para sión de fluorescencia producida en la reacción es colocar tubos contiene ranuras para colocar las laminillas. mediante intercalados en el producto de PCR. tiene una precisión pobre y presenta una sensibilidad menor que la PCR en tiempo real. CAPÍTULO 16 • Reacción en cadena de la polimerasa 153 más juegos de primers (cada juego para un gen en particu. etcé- permite detectar pequeños cambios en la concentración. sondas específicas marcadas con fluorócromos amplificación sirve de molde para una segunda PCR con (sondas TaqMan) o bien agentes intercalantes fluorescen- otro par de iniciadores internos (primers anidados) para tes. Para la detección en tiempo real. se realiza al mismo tiempo que sucede la amplificación. por lo que ambos pasos se unifican. de la reacción. primero se reali. que contiene el segmento por fluoróforos (primers LUX —light uponextension fluoro- diana que se desea amplificar. Esto es. lo que cambia es homocigatos sólo una de las dos reacciones debe resultar el método de detección del producto amplificado y su tem- positiva. lo que aunado a un diseño de primers que permite su sensibilidad a la técnica. la longitud del producto de amplificación de la segunda PCR en tiempo real empleando SyberGreen PCR. un láser que detecta fluorocromos acoplados a los primers o a una sonda PCR in situ que hibrida en medio de los primers. que se degrada y libera Se realiza en una muestra de tejido embebida en parafina su fluorocromo por la acción exonucleasa 3’-5’ de la poli- (laminilla) o congelada y cortada en criostato. este producto de genic—). La detección en de múltiples marcadores moleculares asociados a alguna punto final también presenta las desventajas de que depende enfermedad. tera. iniciadores o primers en cada una. proporcional a la cantidad de producto de PCR formado. En este método. debe ser adecuado para que no se complementen entre mediante un gel de electroforesis. para la detección simultánea de varios agentes de la resolución del gel de agarosa. dos con los primers que amplifican la mutación. Para la PCR selectiva se diseñan primers capaces de hibri- dar solamente en secuencias con presencia de una muta- ción. mutaciones y polimorfismos en un solo gen o en rente cantidad de material de inicio da lugar a la misma can- múltiples. cuyos resultados deben coincidir con los obteni. en el caso de heterocigenos ambas reacciones poralidad. Esto permite conocer y registrar en todo momento la ciné- sente en un tejido expresa un determinado gen o cuál célula tica de la reacción de amplificación. en la PCR en tiempo real pueden ser iniciadores marcados ficar una región de ADN extensa. Como control se produce una PCR con Las desventajas que presenta la PCR en punto final llevaron primers diseñados para la amplificación de la forma silves.

láser. La sonda Taq. que capta el lector del equipo . 400 Man® empleada se diseña de manera que hibrida en algún μM de desoxicitidina trifosfato (dCTP). La desventaja estriba en que la unión. la mezcla de reac- amplificación se lleva a cabo en un termociclador que reali. previniendo la toda molécula de ADN de doble cadena se puede unir también contaminación de la reacción de PCR actual con ADN a dímeros de primers. En esta tecnología se emplea la ADN polimerasa (AmpliTaq Gold®). por lo que es poco específico. En la PCR en tiempo real la concentración relativa se obtie- Las sondas TaqMan se basan en el método FRET. Los dNTP empleados contienen dUTP en lugar de dTTP. Además. La sonda hibrida en la cadena molde del ADN que va a ser amplifica. La mezcla de reacción contiene uracil-N-glico- tiempo real con SYBERGreen se basa en que esta molécula es silasa (UNG) (AmpErase®). lo que da como resultado un incremento significa- método de cuantificación menos preciso que las tecnolo- tivo de la señal de fluorescencia que el láser detecta. Una vez que se separan dichas moléculas se emite la fluorescen- cia. sin iniciadores se encuentra marcado con un fluoróforo. que pudieran formarse. . Su empleo se esquematiza en la figu- amplificar fragmentos de entre 60 y 150 pb. cuan- embargo. Este ne interpolando todas las muestras en un punto umbral. PCR en tiempo real con SyberGreen. Al unirse a productos de PCR de reacciones previas. el fluorocromo ROX (conjugado de glicina de 5-carboxi-X-rodamina. Semicuantificación en tiempo da y libera su fluorocromo sólo cuando la sonda se degrada real con el método 2DDCt por la acción de exonucleasa 5’-3’ de la ADN polimerasa. a la vez. se considera un excitado. ción contiene una UNG para prevención de contaminación za. pero debi. amplificación con primers LUX se emplea una enzima Taq- Platinum® ADN polimerasa que se activa sólo después del PCR en tiempo real con sondas TaqMan hot-start inicial de la PCR (5 minutos a 95°C). Estas moléculas son dos tipos de fluorocromos. un donador y un aceptor. 800 μM de des- punto intermedio de la secuencia franqueada por el primer oxiuridina trifosfato (dUTP). Ya que durante los ciclos normales de PCR las do a su menor costo es ampliamente utilizado. 400 μM de desoxiguanina trifosfato utiliza una sonda marcada con fluorescencia. el fluoróforo se une al ADN referencia pasiva a una concentración final de 500 nM para de doble cadena de manera inespecífica y produce fluores. silenciado por otro fluorocromo o quencher (referencia pasiva). 400 μM de desoxiadenosina trifosfato (dATP). la reacción de manera que con la tecnología TaqMan. succinimidiléster) se incluye como muy utilizado por su bajo costo. Estos primers están diseñados para ROX y estabilizadores. será a lo largo de toda la molécula de El empleo de este tipo de sondas se esquematiza en la figura ADN de doble cadena. incluyendo los dímeros de primer 16-10. Las sondas TaqMan son cortas y para separar las dos moléculas fluorescentes nece- sitan la rotura de su estructura por la ADN polimerasa con actividad endonucleasa y así liberar la fluorescencia. La detección en nen dUTP. La enzima UNG degradados un agente intercalante en la doble cadena de ADN que se une de manera inespecífica. que se mantiene inactiva por la unión de un anticuerpo y se SyberGreen sin fluorescencia libera cuando la reacción se incuba a los 95°C iniciales de SyberGreen con fluorescencia desnaturalización. además de un juego de primers se 6 mM de MgCl2. el mix contiene Tris-HCl. En esta tecnología. al ser inespecífica. normalizar la fluorescencia entre reacciones por cualquier cencia (figura 16-9). por lo que los productos de PCR contie- Figura 16-9. sólo los ADN presen- tes en la muestra servirán de molde para ser amplificados. El uso de SYBERGreen implica un diseño muy cuidadoso de los primers con el fin de evitar la PCR en tiempo real con primers LUX formación de dímeros. UNG. KCl. la detección de fluorocromos mediante luz por acarreamiento. 1 μM de fluorocromo sentido y el antisentido. De la misma En esta tecnología (de Applied Biosystems). Asimismo. La sonda tiene ra 16-11. el fluoróforo es unirse a una sola molécula de ADNds.154 PARTE II • Metodología del ADN recombinante SyberGreen método consiste en la transferencia de energía fluorescente mediante resonancia entre dos moléculas. Para la gías con primers LUX o sondas TaqMan. La detección del producto amplifi- La PCR con primers LUX se fundamenta en que uno de los cado corresponderá a la intensidad de la fluorescencia. altas temperaturas inactivan la UNG. (dGTP). produciendo fluorescencia. y su principio se basa en que una molécula de alta energía cercana a otra de baja energía (quencher) promueve una transferencia energética sin emisión de fluorescencia. ya que varias moléculas de SYBERGreen pueden do el iniciador hibrida con la cadena blanco. endógenos. acoplado un fluorocromo en su extremo 5’. posible fluctuación asociada con variación en el volumen.

. ciclo de corte o cyclethreshold (CT). PCR en tiempo real empleando iniciadores LUX. El CT lo determina un software a un umbral pecto al gen constitutivo (ΔCT) se selecciona un grupo que de fluorescencia fijo (threshold) seleccionado por el analis. con un gen control endógeno (constitutivo). un valor menor cantidad de moléculas de ADN existentes (cuantificación o mayor lo que proporciona un valor semicuantitativo. to de las muestras. Estos valores pueden resto de los grupos se comparan con el grupo calibrador relacionarse con una curva estándar para determinar la tendrá el valor de 1 y el resto de los grupos. por tanto. El cálculo se realiza mediante la fórmu- la 2ΔΔCt relativo a un grupo que se considera calibrador. cuando el 5’ 5’ iniciador hibrida con la cadena blanco y se realiza la polimeri- Primer zación. El CT es el ciclo elegi. debe realizarse un procedi- miento conocido como normalización. para eliminar la variabilidad entre muestra y muestra. resultando en un incremento de la fluorescencia. La 5’ detección del producto amplificado se fundamenta en que uno Polimerización completa y 3’ 5’ emisión de la fluorescencia 3’ de los iniciadores está marcado con un fluoróforo. fluorescencia. Extintor o Quencher R Reportero fluorescente Figura 16-10. viduos diferentes. Donde: do por el usuario de la fase exponencial en donde la canti- ΔCT = CT promedio del grupo de muestras para el gen dad inicial de moléculas del gen de interés presentes en una de interés – CT promedio del grupo de muestras para el muestra es inversamente proporcional a la intensidad de gen constitutivo. el fluoróforo es excitado. después de la normalización de los datos res- una muestra. CAPÍTULO 16 • Reacción en cadena de la polimerasa 155 Sonda Taqman ADN 1 3’ Primer R sonda 3’ 5’ Alineación y polimerización 3’ 5’ 3’ 3’ 5’ 5’ 5’ 5’ Primer 2 Primer R R Primer marcado sonda 3’ 5’ 3’ 5’ 3’ 5’ Desplazamiento de hebra y 3’ actividad exonucleasa de la AND 5’ polimerasa sobre la sonda 5’ 5’ 3’ Primer Primer 3 R Primer R Primer 3’ marcado 5’ Escisión de la sonda y liberación 3’ 5’ 5’ 3’ del fluorocromo 5’ 3’ 5’ R No fluorescencia Primer 5’ 3’ R Fluorescencia Primer R Primer 3’ Figura 16-11. el cual está silenciado por otro fluorocromo tiva). lo que asegura que sólo ción experimental). funciona como calibrador del experimento y los datos del ta. El CT permite discriminar el comportamien- ΔΔCT = ΔCT grupo calibrador – ΔCT grupo de interés. como se expone en la figura 16-12. lo que es detectado por el láser. La cuantificación relativa puede utilizarse para deter- llamado extintor o quencher en el extremo 3’ de la sonda. La sonda tiene acoplado un fluorocromo absoluta) o con un grupo de referencia (cuantificación rela- en su extremo 5’. Para la cuantificación relativa debe habrá detección cuando un producto de amplificación haya tenerse en cuenta que todas las muestras provienen de indi- sido generado. Esta PCR implica el uso de una sonda que hibrida en algún punto intermedio de la secuencia franqueada por el par de primers sentido y antisentido. PCR en tiempo real con sondas Taqman®. ya que a un menor valor de CT existe mayor cantidad inicial de moléculas del gen de interés en Por tanto. La minar la expresión de los niveles de ARNm de un grupo de amplificación de la cadena donde la sonda está unida libera el fluorocromo sólo cuando la sonda es degradada por la acción células o tejidos respecto a una referencia (control o condi- exonucleasa de la ADN polimerasa.

El CT permite discriminar el comportamiento de las muestras. generalmente hexámeros formados de secuencias aleatorias de 6 nt. La realización consecutiva de una retrotranscripción y una PCR se conoce como RT-PCR. Debe asegurarse que la efi- ciencia de la PCR sea la misma para la muestra y para el Amplificación estándar. la tecnología en tiempo real alineación de los hexámeros por 10 min a 25°C y polimeriza- ción por la retrotranscriptasa a 37°C por una hora. se transcribe a ADN de secuencia complementaria al ARN. y basta con una hora a la ΔCT = CT promedio de la muestra para el gen constitu- temperatura óptima de la enzima para realizar la conversión tivo – CT promedio de la muestra para el gen de interés. necesarios para un funcionamiento óptimo de la retrotrans- diciones.156 PARTE II • Metodología del ADN recombinante tras. Estos hexámeros hibridarán con las secuencias complementarias a ellos. Slot blot. Para la reacción se requiere también un inhibidor de ARNsas (RNA- Semicuantificación en tiempo sin®. Una vez Para una PCR cuantitativa se emplea la metodología en obtenida la cadena de ADNc. el VIH y la hepatitis C). guadora proporcionará las condiciones de pH y cofactores tra se desea comparar frente a ella misma en diferentes con. “Threshold” seleccionado por el analista. G.2 35 amplificar un ARN específico para evaluar su expresión o Figura 16-12. así como para cuanti- en el caso particular de ARN se asume que la eficiencia de ficar ARNm de cualquier proteína expresada en un tejido. Las diferentes diluciones de la curva presentarán lineal CT proporcionales a la cantidad de muestra.6 25 30 32. RNAseout®). retrotranscripción ha sido la misma para todas las mues- . La transcriptasa inversa ya que a un menor valor de CT existe mayor cantidad inicial más empleada es la del M-MLV (Murine-Moloney leukemia de moléculas del gen de interés en una muestra. las muestras en un ciclo de corte o cyclethreshold (CT). Esta curva debe tener en cuenta que el ADN o te para detectar genomas virales compuestos por ARN (como ARN que se emplee debe estar diluido de manera precisa. Gráficas de PCR en tiempo real. se requieren primers. ensayos de la nucleasa) y se basa en el es aquel ciclo presente en cualquier punto de la fase exponen. del ARN a ADNc (para la M-MLV son 37°C). Además del ARN molde. Los dNTP (A. del gen de interés presentes en una muestra determinada es En la reacción de retrotranscripción una cadena de ARN inversamente proporcional a la intensidad de fluorescencia. con el objetivo de Valor de Ct Valor de Ct 15 20 Cycle 23. El CT es determinado por un software a un umbral de fluorescencia fijo virus). y mediante la fórmula de regresión lineal (y = mx + b). T) se emplearán en la síntesis das en tiempo real se realiza cuando no se desea tomar un de las cadenas de ADNc. Esta técnica es una variante de la técnica convencional de PCR. El CT Dot blot. La fórmula se aplica: criptasa. Los pasos de que consta esta reacción son desnaturalización del ARN a PCR cuantitativa mediante 70°C por 10 minutos para eliminar estructuras secundarias. cuando se pretende analizar secuencias de ARN. Este método se utiliza principalmen- conocida. por lo que se le denomina ADNc. Esta técnica es más sensible y rápida que otras de datos en la PCR en tiempo real se realiza interpolando todas técnicas de análisis de la expresión de genes (Northen blot. mientras que una solución amorti- grupo de muestras como referencia. en esta reacción no se requieren ciclos. muestra. La curva estándar se construye a partir de concentra- ciones conocidas de un plásmido que contiene clonado el Plateau cADN de la muestra a analizar. que se convertirá en ADNc. La interpretación presencia. A diferencia de lo que sucede en la PCR. 20 25 30 35 40 Cycle Retrotranscripción como paso previo a la PCR La retrotranscripción es una reacción para la conversión Threshold del ARN en ADNc y en general se lleva a cabo antes de una PCR. como cuando la mues. un componente enzimático que impide la real con el método 2∆Ct acción de estas enzimas que puedan estar presentes en la Este método de semicuantificación para muestras procesa. C. ésta se emplea como molde tiempo real y una curva con estándares de concentración para la técnica de PCR. uso de transcriptasa inversa de los retrovirus cuya función cial de amplificación en donde la cantidad inicial de moléculas es sintetizar ADN a partir de ARN (figura 16-13). que se localizan por azar en todos los ARN presentes en la muestra. y la influenza A. interpolando los Amplificación Threshold valores de las muestras en el gráfico obtenido se puede éxponencial conocer la concentración absoluta de las muestras.

Aplicaciones de la PCR una técnica indispensable para el diagnóstico médico. la PCR permite un diagnóstico temprano. Esto ha sido de gran ayuda para el diagnóstico y la mediante ADN finger-printing. En la reacción participa una trans- criptasa reversa que polimeriza los dNTPs. detección de mutaciones. detección de patógenos infecciosos (virus bacterias. Reacción de retrotranscripción. correlación de variaciones génicas con enfermedades. CAPÍTULO 16 • Reacción en cadena de la polimerasa 157 RT 1 2 3 Hexameros Transcriptasa Reversa ARN 4 5 6 cADN cADN cADN ARN Rnasa Figura 16-13. mutación conocida (diagnóstico) o bien mutaciones desco- ción. En na forense. hexámeros aleatorios de 6 nt que funcionen como iniciadores de la retrotranscripción e inhibidores de ARNsas mientras se realiza la síntesis del ADNc. Con ella se pueden amplificar segmentos que contienen una Los productos de PCR pueden utilizarse para la secuencia. entre otras genomas de patógenos es la aplicación diagnóstica más muchas aplicaciones. cuanto a las enfermedades adquiridas. la detección de sión génica o determinación de carga viral. nocidas que se secuenciarán y determinarán después de hongos). permite la detección aun de pocas copias del genoma. en medici. empleada de la PCR. Se requiere además del RNA molde que será convertido a ADNc. La PCR se encuentra al alcance económico de la mayoría de los laboratorios y en los últimos 20 años se ha convertido en . Una vez concluida la transcripción inversa el ARN será degradado por las ARNsas del medio y las moléculas de ADNc servirán de molde a la reacción de PCR. análisis de la expre. Debido a su alta sensibilidad. o huella deADN. Las moléculas de ARN son retrotranscritas a ADNc. lo que suele suceder en los periodos iniciales de la infección. amplificación de segmentos para su análisis una PCR. por lo tan- Diagnóstico como aplicación de la PCR to.

esporádica y en otras formas de c) En la siguiente esquematización de un gel de electro- demencia. y uno de ellos hibrida en la posición 91.. b) Escriba el amplicón de ADNds resultante. escriba el iniciador sentido Es de origen multifactorial. mediante la técnica de PCR y la posterior digestión con enzimas de restricción 150 pb de los productos de PCR. tar la agregación proteica e influir en el desarrollo de EP (Ramírez-Jirano L. por foresis indique con una banda dónde aparecería el lo que se propone que estos polimorfismos pueden afec. to a amplificar es de 65 pb.158 PARTE II • Metodología del ADN recombinante Ejercicio de integración 1 1. indicando conocidos como cuerpos de Lewy. 2006). La enfermedad de Parkinson (EP) se considera la segun. El fragmento del gen en el cual se encuentra la parte polimórfica de la α-sinucleína es: 100 pb 91 50 pb ↓ 5’.3’ . con alteraciones en los cuerpos de Lewy. se requiere la búsqueda del genotipo en pacien- tes con EP y en individuos sanos.CGCGGAAGTG AGGTGCGTCG GGGCTGCAGC 25 pb GCAGACCCCG GCCCGGCCCC TCCGAGAGCG TCCT- GGGCGC TCCCTCACGC CTTGCCTTCA AGCCTTCTGC . a) Si la secuencia del iniciador es de 20 pares de bases da enfermedad neurodegenerativa en cuanto a prevalen. do con EP dominante.J. 1. los extremos 5´-3´y la ubicación de los iniciadores sen- Diversos polimorfismos en este gen se han relaciona. Antisentido: plasma de las neuronas sobrevivientes hay inclusiones 5’– – 3’ proteicas de α-sinucleína. tido y antisentido. y el fragmen- cia. 2. por interacción de factores y antisentido: ambientales y uno o más genes que confieren susceptibi. MPM Muestra 116C-G. Para estudiar la posible vinculación del polimorfismo. codificada por el gen SNCA. Sentido: lidad. producto de PCR según su longitud. y afecta de 1 a 2% de las personas en edad madura. y se ha observado que en el cito. Los pacientes con esta afección presentan un 80% 5’– – 3’ de muerte neuronal.

Hilden: QIAGEN GmbH.A.C. 1995. 100 pb 4. Arden E. 2. La ___________ utiliza las cadenas sencillas de ADNc como molde para la síntesis de moléculas de cadena doble 50 pb 5. ¿Cuál paciente (o pacientes) es negativo a la infección? ción de las muestras contra una ___________ 3. curva tras procesar el suero de tres pacientes sospechosos de estándar ADN polimerasa. ¿Cómo interpreta el hecho de que la banda de P1 sea 10. De una reacción de retrotranscripción in vitro se obtie- ne: ___________ 2. ADNc MPM P1 P2 P3 1. La enzima ___________ elimina los residuos de uracilo del ADNss o ADNds previniendo que amplicones sirvan de molde en una PCR posterior.A.. Núm 2. Hunt M. en su sangre? 9.. ¿Cuál paciente (o pacientes) porta el genoma del VHB no se modifica con las condiciones experimentales.H.M. lumbia: University of South Carolina. 25 bp 7. Mackay I. La PCR cuantitativa requiere forzosamente la interpola. portar la infección. Interprete el siguiente gel obtenido Iniciadores.. PCR en tiempo real.K. . The Board of Trustees of the Co.. electroforesis. constitutivo. La visualización del producto de amplificación se realiza mediante una ___________ Bibliografía Edwards M. Kang J. Baylor College of Medicine. Ulber V. PCR strategies. Extracción de ___________ de la muestra es el primer paso para la realización de una RT-PCR 150 pb 3.. uracil-n. 8. Twieling G.. 2006. El ___________ se inserta en vectores de clonación y se someten al proceso de clonación. Se denomina gen ___________ a aquel cuya expresión 1. Karger S. 2011. 12. CAPÍTULO 16 • Reacción en cadena de la polimerasa 159 Ejercicio de integración 2 Ejercicio de integración 3 Complete las frases del tema de PCR. 13. Innis M. Multiplex PCR: advantages. La ___________ es una modalidad de PCR que emplea sondas TaqMan. Feb. Real-time PCR in virology. 11. A la temperatura de ___________ se destruyen estruc- turas secundarias del ADNc y corresponde a los 95°C. Nueva York: Academic Press. Gibbs R. Gelfand D. ARN. multiplex PCR. 6. 1999. Nucleic Acids Res.J. transcriptasa inversa. RT y modalidades La PCR para la detección del genoma del VHB genera un de PCR con las siguientes palabras: amplicón de 325 pb. Por la acción de la ___________ se obtiene una molécu- la de ssADNc. La modalidad de ___________ presenta el inconvenien. punto final. Sninsky J.30:1292-1305. Nitsche A.. developments Löffert D. Houston: Institute for Molecular Genetics. Real time PCR tutorial. desnaturalización... Optimizing of and applications. Los ___________ son los reactivos clave para una PCR específica. más intensa que la banda de P3? te de que la diferente cantidad de material de inicio da lugar a la misma cantidad de producto final debido a la saturación. 2002. glicosilasa.

en el contexto histó- A pesar del papel tan importante que desempeña la secuen. lo cual lo hace laborioso. primero. La electroforesis en gel en general se utiliza con pro- Sanger y Alan Coulson y los estadounidenses Alan Maxam pósitos analíticos. La des- de hebras o fraccionamiento equivalente por cada fragmen. La fragmentación específica del ADN es la base de este se llevan a cabo reacciones químicas para desprender com- método. la cual finalmente las separa por En los decenios de 1960 y 1970. para producir patrones específicos de rotura y observación ción química específica del ADN que describieron Maxam y mediante autorradiograf ía. debido La electroforesis es una técnica para la separación de sobre todo al tamaño tan grande de las moléculas de ADN moléculas según su movilidad en un campo eléctrico a tra- en las células. marca un fragmento de doble hebra producido por diges- ción sea un procedimiento rápido y de rutina en los labora. para purificar parcialmente moléculas antes de aplicar tánea dos procedimientos diferentes para determinar de espectrometría de masas. el desarrollo de los métodos bases a partir del punto de marcaje. Estos métodos sólo rasa (PCR). pero puede ser una técnica preparativa y Walter Gilbert. entonces. la fatos. uno de los residuos a lo largo de pocos pares de bases del da. vés de una matriz porosa. El procedimiento consiste en Gilbert. rico de la época. ción) de una determinada longitud en sus dos extremos. consultar el capítulo relacionado). La fragmentación selectiva de una cadena de ADN marcada se consigue con el uso de cuatro tratamientos quí- de Maxam y Gilbert micos independientes. tamaños moleculares y carga eléctrica. un punto débil en el esque- to de restricción estudiado. y la reacción es tan específica que permite dañar sólo modificación de una base. que a grandes rasgos pletamente la desoxirribosa de los enlaces 5’ y 3’ de sus fos- implican el marcaje radiactivo del extremo 5’ con 32P. se trata con fosfatasa alcalina para eliminar el fosfa- to terminal en su extremo 5’. pero requiere una separación dañan y después eliminan una base del nucleótido. desarrollado en cinco pasos. El reactivo específico para purinas es el dimetilsulfato. la eliminación de la base modifica. Este método tiene la ventaja de que puede “atacar” químicamente al ADN con reactivos que primero emplear ADN de doble hebra. son altamente res detalles. según la técnica que ción independientes. Capítulo 17 Secuenciación del ADN y microarreglos Belinda Claudia Gómez Meda / Guillermo Moisés Zúñiga González José María Vera Cruz / Bertha Adriana Álvarez Rodríguez Introducción gel de poliacrilamida. clonación o secuenciación de ADN (para mayo- requieren de pequeñas cantidades de ADN. 160 . oxirribosa expuesta es. para su determinación es relativamente reciente. confiables y han revolucionado la biología molecular. En la Antes del tratamiento químico que genera el corte. el equipo automatizado hace que la secuencia. leto de la cadena y es susceptible de roturas. se añade un fosfato Secuenciación marcado con 32P para producir una hebra marcada de forma Método químico o de degradación terminal. rotura de la cadena de ADN en la desoxirribosa modificada ADN. dos grupos de investiga. cada uno de los cuales está diseñado Es un método de secuenciación que depende de la degrada. y el análisis de la secuencia fragmentada por electroforesis en mientras que el reactivo para pirimidinas es la hidracina. Posteriormente. reacción en cadena de la polime- modo directo la secuencia del ADN. liderados por los británicos Frederick se use. y después. en 1977. tión con una enzima de restricción (fragmento de restric- torios (figura 17-1). se actualidad. El método está limitado por el poder de resolución del gel de poliacrilamida que. idearon de manera prácticamente simul. permitía secuenciar aproximadamente 100 cia de ADN en la materia viva.

leyendo de abajo hacia arriba (5’ → 3’). Cuando los fragmentos hidracina producirá roturas en posiciones ocupadas tanto marcados en su extremo se resuelven en gel de poliacrila. en cuatro reacciones en paralelo. mientras que para los resi. tal que en la autorradiograf ía sólo se miento de guaninas. ferencia las adeninas se liberan con un tratamiento suave oxirribosa despurinados de los grupos fosfato adyacentes con ácido diluido. o ácido fórmico para corte en bases álcali producirá un patrón de bandas oscuras correspon- púricas indiferenciado (A + G). diente a las adeninas y con bandas claras para las guaninas. que libera completamente los restos de des. El tratamiento que de preferencia rom. la reacción con ramente ácidas (HCl 0. con una en paralelo en la cual se suprime el rompimiento de lada es inestable y se rompe fácilmente. una para cada nucleótido. enlaces glucosúricos de las adenosinas metiladas son menos pe residuos guanílicos se basa en un álcali suave a 90°C estables que las de las guanosinas. luación de la intensidad de las bandas aisladas no es senci. que aparezca en ambas radiograf ías indicará rotura en la C. compara la información que contiene esta columna del gel . por citosina como por timina. Estrategia general de secuenciación de ADN.1 M). Subsecuentemente. ya que la eva. Las bandas oscuras se generan del rompi. CAPÍTULO 17 • Secuenciación del ADN y microarreglos 161 EXTREMO FIJO ATTCGTGAGACTACCG REACCIÓN REACCIÓN REACCIÓN REACCIÓN “A” “T” “G” “C” A AT ATTCG ATTC P P P P P P ATTCGTGA ATT ATTCGTG ATTCGTGAGAC ATTCGTGAGA ATTCGT ATTCGTGAG ATTCGTGAGACTAC A G G T T A A ATTCGTGAGACTA ATTCGTGAGACT ATTCGTGAGACTACCG ATTCGTGAGACTACC T C C A A T T P P P P A T G C P-P-P P-P-P P-P 5´ Iniciador dGTP ddCTP H La incorporación del OH OH análogo dideoxi detiene A A T G C C G T G la síntesis de la cadena T T A C G G C A C G T A Cadena molde Figura 17-1. el rompimiento con en sus enlaces 3’ y 5’. mientras que un enlace sólo presente en C + T representará lla. eliminarse calentando las hebras a pH neutro. dejando la La evidencia de corte de adeninas se basa en que los desoxirribosa libre. Cuando se débil contiene. La reacción se repite en pre- mida. la ria para la secuenciación. sin embargo.1 M). Los métodos de secuenciación se basan en la síntesis de ADN. comparan los patrones autorradiográficos de C y C + T. lo que permite que las adeninas se evidencien. la mitad de la información necesa. Este patrón de guanina/fuerte y adenina/ piperidina en posiciones ocupadas por citosinas. al menos. en la interpretación banda oscura (correspondiente a la marca del radioisótopo) de estos patrones puede haber ambigüedad. Los ddNTP pueden marcarse diferencialmente con fluorocromos de diferente color. Para determinar las bases de forma diferencial se la rotura en una T. Para el caso de detección de pirimidinas. duos adenílicos el tratamiento es a 0°C en condiciones lige. de manera tal que de pre- (NaOH 0. a fin de producir el paro de la reacción cuando un ddNTP se añada a la reac- ción. la autorradiograf ía contiene un patrón de bandas sencia de NaCl 2 M. na con la timina. las bases pueden guaninas. que se metilan cinco veces más rápido detectan fragmentos cortados mediante tratamiento con que las adeninas. Se obtendrá la secuencia de la cadena complementaria a la cadena molde por autorradiografía o fluorescencia. la sal suprime la reacción de la hidraci- oscuras y claras. Debido a que el enlace glucosídico de una purina meti.

secuencia de ambas hebras permite un chequeo más adecua- da débil en la segunda genera una A. En na es una G. cortando la base y dejando lee hacia arriba. información más que suficiente para la secuenciación. una banda fuerte en la do. el ADN se sólo se necesitan cuatro radiografías para establecer la corta con piperidina 0. da.162 PARTE II • Metodología del ADN recombinante 5’ 3’ ADN de doble cadena