You are on page 1of 10

ACTIVITY

BIOINFORMATICS

OBJECTIVES

At the end of the activity, the student should be able to:


1. utilize basic bioinformatics tools in mining and analyzing genomic and proteomic data; and
2. apply the existing data in determining the structure and function of proteins.

INTRODUCTION

Bioinformatics is a field of study that makes use of mathematical and computational algorithms
to collect, store, manipulate, and model data for analysis and visualization. It has become a vital tool
in varied areas of research, especially in the fields of medicine, environment, biochemistry, and
microbiology.
In this activity, the students will be introduced to different bioinformatics tools such as BLAST,
PDB, UniProt and PyMOL. Each pair will be assigned a human cDNA sequence. Using the available
online tools and databases, they will identify the protein product of the cDNA sequence. After which,
they will mine the data, analyze it, and submit a report presenting all the data they have gathered
regarding their protein.

EXPERIMENTAL DETAILS

Determining the Protein Product


1. Open Basic Local Alignment Search Tool (BLAST).
Note: BLAST is an algorithm used to compare different biological sequences, such as amino
acid sequences of proteins and nucleic acid sequences of DNA. It then makes use of rigorous
statistics to compare regions that are statistically similar.
(Link: https://blast.ncbi.nlm.nih.gov/Blast.cgi)
2. Click blastx.
Note: The BLAST algorithm has diverse functions. You can perform Nucleotide BLAST to
identify unknown nucleic acid sequences or you can also do Protein BLAST to identify
unknown amino acid sequences. However, since you are given the cDNA sequence and you
want to determine the protein product, you must perform blastx.
3. Input the cDNA sequence into the query box.
Note: The cDNA sequence given to you is in FASTA format. In this format, the nucleotides or
amino acids in the sequence are represented using their single letter codes.
4. Click BLAST to begin searching for protein products that match the cDNA sequence in your
query.
5. Once the search results arrive, you will be given a list of sequences that produced significant
alignments, each with their corresponding percent sequence identity.
Note: The following terminologies:
Sequence alignment refers to the arrangement of biological sequences (DNA, RNA, or
protein) and the identification of regions of similarity. It may aid in the determination
of functional, structural, and/or evolutionary relationships between different sequences.
Sequence identity refers to the degree of correlation between ungapped sequences that
are exactly matched.
Sequence similarity refers to the degree of resemblance between two sequences such
that when they are compared, they have some properties in common but not necessarily
identical.
1
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
Sequence homology refers to the exact match between sequences. Two sequences may
be either homologous or not. There is nothing in between! If two genes are the same,
they are called homologs.
6. When you click on one of these proteins, you will be directed to its amino acid sequence,
showing the alignment between your query and the protein being investigated. To obtain more
information about the protein, click on the Sequence ID. Copy any information that is essential
to your report.

Getting to Know Your Protein Product


Protein Data Bank (PDB)
1. Open Protein Databank (PDB).
Note: PDB is an online resource that stores known information about the 3D structure of
proteins, nucleic acids, and complex assemblies to help researchers better understand and
visualize these biological molecules.
(Link: http://www.rcsb.org/pdb/home/home.do)
2. Input the protein name or ID into the query box to search for your protein. If no search result
is found, use UniProt as presented in the steps below.
3. Once the search is complete, you will be given a list of results for your protein obtained from
different research studies. Click the most appropriate one to obtain more information about
your protein, such as its x-ray diffraction data and its ligands.
4. Download the PDB file.
5. Open PyMOL.
Note: Make sure you have successfully downloaded PyMOL from http://pymol.org/edu/
beforehand. The Educational-use-only PyMOL is a free software that aids in the molecular
visualization of proteins.
6. Open the PDB file of your protein using PyMOL.
7. Once the PDB file is open, you can now view the 3D structure of your protein. You may twist
and turn your protein molecule with the aid of your mouse or keypad. You may also view the
amino acid sequence of the protein using the Display function. An important function in
PyMOL is that it can allow you to zoom into the catalytic site of your protein molecule (if it is
an enzyme).
Note: Your instructor will demonstrate to you how to operate the PyMOL software.
8. Take screenshots of your protein molecule.

UniProt
1. Open UniProt.
Note: UniProt is a freely accessible database of amino acid sequences and some basic
information of a certain protein.
(Link: http://www.uniprot.org)
2. Input the sequence ID or protein name into the search box.
3. Click for the link under the column Entry. This alphanumeric link refers to the protein ID.
4. Once the page has fully reloaded, the function, regions, enzyme regulation and some other
useful information about the protein can be seen. Obtain information needed from here.
5. Tick the circle beside RCSB PDB under the 3D structure databases section.
6. Open the link under the PDB entry column.
7. Proceed as steps 4-8 of the PDB section.

WRITTEN OUTPUT

Each pair must submit a one-page report (with proper citations) containing the following information:
1. Protein ID/Name
2. Cellular location/s
2
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
3. Protein Structure (screen shot/screen capture)
4. Protein Activity/Function
5. Amino acid residues responsible for binding or catalysis (screen shot/screen capture)
You may also use other existing online bioinformatics tools given below:
NAME FUNCTION WEB ADDRESS
NCBI Genome tools and database http://www.ncbi.nlm.nih.gov/
Pubmed Biomedical literature http://www.ncbi.nlm.nih.gov/pubmed
BLAST Sequence search and alignment http://blast.ncbi.nlm.nih.gov/Blast.cgi
EMBL-EBI Bioinformatics http://www.ebi.ac.uk/services
ExPASy Protein informatics http://www.expasy.org/
Protein Database of 3D structures of
http://www.rcsb.org/pdb/home/home.do
Databank biomolecules
PyMOL 3D visualization http://www.pymol.org/
DeepView PDB viewer http://spdbv.vital-it.ch/
KEGG Database for biological function http://www.genome.jp/kegg/
cDNA SEQUENCES ASSIGNMENT
Pair No. cDNA Sequence
1 GGGAGAAGCCGAGGGCAGCTTAGCCACGGCCGGTTCCCGTTCCCTCCAGGACGCGAGGGTCGCCTTGGGT
GGGGAACCGCGACCGGGCGAGGACCTATCCCGGTGTGGGGCTTCCCGATTTCGAAAGAATCTCGCTGCAC
CCCCGCCCAGAGTTCAGACCAAGCGAAAAGTTATTTGAGAGGCCTCGGGGGCGCGGGGTGAGGAGTCGTG
GCGGAGGCCTTGGTCGGGGCGCCGTGGATATCCCCGAGTCACCGCGTCCCTCTCCTGCAGCTCCCGCGTC
GCTGGGAGGAGCGAGGGAGCGAGCGGGAAGGGGTCTAGCTGGCCTTTGCTCGGCCCTCCCCAGCGCCCGG
CTTTGAACCCGCCCTGCACTGCTGTCTGGGCGGGTCCGGGGACTCAGCACTCGACCCAAAGGTGCAGGCG
CGCGAGCACAACCCATGGCTGCGCTGGGCTGCGCGAGGCTGAGGTGGGCGCTGCGAGGGGCCGGCCGTGG
CCTCTGCCCCCACGGGGCCAGAGCCAAGGCCGCGATCCCTGCCGCCCTCCCCTCGGACAAGGCCACCGGA
GCTCCCGGAGCCGGGCCTGGTGTCCGGCGGCGGCAACGGAGCTTAGAGGAGATTCCACGTCTAGGACAGC
TGCGCTTCTTCTTTCAGCTGTTCGTTCAAGGCTATGCCCTGCAACTGCACCAGTTACAGGTGCTTTACAA
GGCCAAGTACGGTCCAATGTGGATGTCCTACTTAGGGCCTCAGATGCACGTGAACCTGGCCAGTGCCCCG
CTCTTGGAGCAAGTGATGCGGCAAGAGGGCAAGTACCCAGTACGGAACGACATGGAGCTATGGAAGGAGC
ACCGGGACCAGCACGACCTGACCTATGGGCCGTTCACCACGGAAGGACACCACTGGTACCAGCTGCGCCA
GGCTCTGAACCAGCGGTTGCTGAAGCCAGCGGAAGCAGCGCTCTATACGGATGCTTTCAATGAGGTGATT
GATGACTTTATGACTCGACTGGACCAGCTGCGGGCAGAGAGTGCTTCGGGGAACCAGGTGTCGGACATGG
CTCAACTCTTCTACTACTTTGCCTTGGAAGCTATTTGCTACATCCTGTTCGAGAAACGCATTGGCTGCCT
GCAGCGATCCATCCCCGAGGACACCGTGACCTTCGTCAGATCCATCGGGTTAATGTTCCAGAACTCACTC
TATGCCACCTTCCTCCCCAAGTGGACTCGCCCCGTGCTGCCTTTCTGGAAGCGATACCTGGATGGTTGGA
ATGCCATCTTTTCCTTTGGGAAGAAGCTGATTGATGAGAAGCTCGAAGATATGGAGGCCCAACTGCAGGC
AGCAGGGCCAGATGGCATCCAGGTGTCTGGCTACCTGCACTTCTTACTGGCCAGTGGACAGCTCAGTCCT
CGGGAGGCCATGGGCAGCCTGCCTGAGCTGCTCATGGCTGGAGTGGACACGACATCCAACACGCTGACAT
GGGCCCTGTACCACCTCTCAAAGGACCCTGAGATCCAGGAGGCCTTGCACGAGGAAGTGGTGGGTGTGGT
GCCAGCCGGGCAAGTGCCCCAGCACAAGGACTTTGCCCACATGCCGTTGCTCAAAGCTGTGCTTAAGGAG
ACTCTGCGTCTCTACCCTGTGGTCCCCACAAACTCCCGGATCATAGAAAAGGAAATTGAAGTTGATGGCT
TCCTCTTCCCCAAGAACACCCAGTTTGTGTTCTGCCACTATGTGGTGTCCCGGGACCCCACTGCCTTCTC
TGAGCCTGAAAGCTTCCAGCCCCACCGCTGGCTGAGAAACAGCCAGCCTGCTACCCCCAGGATCCAGCAC
CCATTTGGCTCTGTGCCCTTTGGCTATGGGGTCCGGGCCTGCCTGGGCCGCAGGATTGCAGAGCTGGAGA
TGCAGCTACTCCTCGCAAGGCTGATCCAGAAGTACAAGGTGGTCCTGGCCCCGGAGACGGGGGAGTTGAA
GAGTGTGGCCCGCATTGTCCTGGTTCCCAATAAGAAAGTGGGCCTGCAGTTCCTGCAGAGACAGTGCTGA
GCTGAGTCTCCGCCTTGCTGGGGCTTGTCCTAGAGGCTCCAGCTCTGGCACAGTGGTTCCTGGCTGCTGC
CATGTCTCAGATGAGGAGGGAGAGAAGGAGGCCGCCAGACTCGAGAGGTGGGAGGAACTCCTTGCACACA
CCCTGAGCTTTTGCCACTTCTATCATTTTTGAGCAACTCCCTCTCAGCTAAAAGGCCACCCCTTTATCGC
ATTGCTGTCCTTGGGTAGAATATAAAATAAAGGGACTTTTATTTCTTATTGGAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAA
2 AGGCACACTCTACCACCATGAATCCACTCCTGATCCTTACCTTTGTGGCAGCTGCTCTTGCTGCCCCCTT
TGATGATGATGACAAGATCGTTGGGGGCTACAACTGTGAGGAGAATTCTGTCCCCTACCAGGTGTCCCTG
AATTCTGGCTACCACTTCTGTGGTGGCTCCCTCATCAACGAACAGTGGGTGGTATCAGCAGGCCACTGCT
ACAAGTCCCGCATCCAGGTGAGACTGGGAGAGCACAACATCGAAGTCCTGGAGGGGAATGAGCAGTTCAT
CAATGCAGCCAAGATCATCCGCCACCCCCAATACGACAGGAAGACTCTGAACAATGACATCATGTTAATC

3
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
AAGCTCTCCTCACGTGCAGTAATCAACGCCCGCGTGTCCACCATCTCTCTGCCCACCGCCCCTCCAGCCA
CTGGCACGAAGTGCCTCATCTCTGGCTGGGGCAACACTGCGAGCTCTGGCGCCGACTACCCAGACGAGCT
GCAGTGCCTGGATGCTCCTGTGCTGAGCCAGGCTAAGTGTGAAGCCTCCTACCCTGGAAAGATTACCAGC
AACATGTTCTGTGTGGGCTTCCTTGAGGGAGGCAAGGATTCATGTCAGGGTGATTCTGGTGGCCCTGTGG
TCTGCAATGGACAGCTCCAAGGAGTTGTCTCCTGGGGTGATGGCTGTGCCCAGAAGAACAAGCCTGGAGT
CTACACCAAGGTCTACAACTATGTGAAATGGATTAAGAACACCATAGCTGCCAATAGCTAAAGCCCCCAG
TATCTCTTCAGTCTCTATACCAATAAAGTGACCCTGTTCTCACTGTCAAAAAAAAAAAAAA
3 AGAGTCATCCAGCTGGAGCCCTGAGTGGCTGAGCTCAGGCCTTCGCAGCATTCTTGGGTGGGAGCAGCCA
CGGGTCAGCCACAAGGGCCACAGCCATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAAT
GCGACGGGTGTGGTACGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCA
TGCTGGCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTACGTCAC
CGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCCGTGGCTGACCTCTTC
ATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCATGGATACTTCGTCTTCGGGCCCACAG
GATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGCGGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGC
CATCGAGCGGTACGTGGTGGTGTGTAAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATG
GGCGTTGCCTTCACCTGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACA
TCCCCGAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAACGAGTC
TTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTTTTCTGCTATGGGCAG
CTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCAGCCACCACACAGAAGGCAGAGAAGG
AGGTCACCCGCATGGTCATCATCATGGTCATCGCTTTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGC
ATTCTACATCTTCACCCACCAGGGCTCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCC
AAGAGCGCCGCCATCTACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCA
CCACCATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACGGAGAC
GAGCCAGGTGGCCCCGGCCTAAGACCTGCCTAGGACTCTGTGGCCGACTATAGGCGTCTCCCATCCCCTA
CACCTTCCCCCAGCCACAGCCATCCCACCAGGAGCAGCGCCTGTGCAGAATGAACGAAGTCACATAGGCT
CCTTAATTTTTTTTTTTTTTTTAAGAAATAATTAATGAGGCTCCTCACTCACCTGGGACAGCCTGAGAAG
GGACATCCACCAAGACCTACTGATCTGGAGTCCCACGTTCCCCAAGGCCAGCGGGATGTGTGCCCCTCCT
CCTCCCAACTCATCTTTCAGGAACACGAGGATTCTTGCTTTCTGGAAAAGTGTCCCAGCTTAGGGATAAG
TGTCTAGCACAGAATGGGGCACACAGTAGGTGCTTAATAAATGCTGGATGGATGCAGGAAGGAATGGAGG
AATGAATGGGAAGGGAGAACATATCTATCCTCTCAGACCCTCGCAGCAGCAGCAACTCATACTTGGCTAA
TGATATGGAGCAGTTGTTTTTCCCTCCCTGGGCCTCACTTTCTTCTCCTATAAAATGGAAATCCCAGATC
CCTGGTCCTGCCGACACGCAGCTACTGAGAAGACCAAAAGAGGTGTGTGTGTGTCTATGTGTGTGTTTCA
GCACTTTGTAAATAGCAAGAAGCTGTACAGATTCTAGTTAATGTTGTGAATAACATCAATTAATGTAACT
AGTTAATTACTATGATTATCACCTCCTGATAGTGAACATTTTGAGATTGGGCATTCAGATGATGGGGTTT
CACCCAACCTTGGGGCAGGTTTTTAAAAATTAGCTAGGCATCAAGGCCAGACCAGGGCTGGGGGTTGGGC
TGTAGGCAGGGACAGTCACAGGAATGCAGAATGCAGTCATCAGACCTGAAAAAACAACACTGGGGGAGGG
GGACGGTGAAGGCCAAGTTCCCAATGAGGGTGAGATTGGGCCTGGGGTCTCACCCCTAGTGTGGGGCCCC
AGGTCCCGTGCCTCCCCTTCCCAATGTGGCCTATGGAGAGACAGGCCTTTCTCTCAGCCTCTGGAAGCCA
CCTGCTCTTTTGCTCTAGCACCTGGGTCCCAGCATCTAGAGCATGGAGCCTCTAGAAGCCATGCTCACCC
GCCCACATTTAATTAACAGCTGAGTCCCTGATGTCATCCTTATCTCGAAGAGCTTAGAAACAAAGAGTGG
GAAATTCCACTGGGCCTACCTTCCTTGGGGATGTTCATGGGCCCCAGTTTCCAGTTTCCCTTGCCAGACA
AGCCCATCTTCAGCAGTTGCTAGTCCATTCTCCATTCTGGAGAATCTGCTCCAAAAAGCTGGCCACATCT
CTGAGGTGTCAGAATTAAGCTGCCTCAGTAACTGCTCCCCCTTCTCCATATAAGCAAAGCCAGAAGCTCT
AGCTTTACCCAGCTCTGCCTGGAGACTAAGGCAAATTGGGCCATTAAAAGCTCAGCTCCTATGTTGGTAT
TAACGGTGGTGGGTTTTGTTGCTTTCACACTCTATCCACAGGATAGATTGAAACTGCCAGCTTCCACCTG
ATCCCTGACCCTGGGATGGCTGGATTGAGCAATGAGCAGAGCCAAGCAGCACAGAGTCCCCTGGGGCTAG
AGGTGGAGGAGGCAGTCCTGGGAATGGGAAAAACCCCA
4 GAGCGGACGGGCTCATGATGCCTCAGATCTGATCCGCATCTAACAGGCTGGCAATGAAGATACCCAGAGA
ATAGTTCACATCTATCATGCGTCACTTCTAGACACAGCCATCAGACGCATCTCCTCCCCTTTCTGCCTGA
CCTTAGGACACGTCCCACCGCCTCTCTTGACGTCTGCCTGGTCAACCATCACTTCCTTAGAGAATAAGGA
GAGAGGCGGATGCAGGAAATCATGCCACCGACGGGCCACCAGCCATGAGTGGGTGACGCTGAGCTGACGT

4
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
CAAAGACAGAGAGGGCTGAAGCCTTGTCAGCACCTGTCACCCCGGCTCCTGCTCTCCGTGTAGCCTGAAG
CCTGGATCCTCCTGGTGAAATCATCTTGGCCTGATAGCATTGTGAGGTCTTCAGACAGGACCCCTCGGAA
GCTAGTTACCATGGAGGATCACATGTTCGGTGTTCAGCAAATCCAGCCCAATGTCATTTCTGTTCGTCTC
TTCAAGCGCAAAGTTGGGGGCCTGGGATTTCTGGTGAAGGAGCGGGTCAGTAAGCCGCCCGTGATCATCT
CTGACCTGATTCGTGGGGGCGCCGCAGAGCAGAGTGGCCTCATCCAGGCCGGAGACATCATTCTTGCGGT
CAACGGCCGGCCCTTGGTGGACCTGAGCTATGACAGCGCCCTGGAGGTACTCAGAGGCATTGCCTCTGAG
ACCCACGTGGTCCTCATTCTGAGGGGCCCTGAAGGTTTCACCACGCACCTGGAGACCACCTTTACAGGTG
ATGGGACCCCCAAGACCATCCGGGTGACACAGCCCCTGGGTCCCCCCACCAAAGCCGTGGATCTGTCCCA
CCAGCCACCGGCCGGCAAAGAACAGCCCCTGGCAGTGGATGGGGCCTCGGGTCCCGGGAATGGGCCTCAG
CATGCCTACGATGATGGGCAGGAGGCTGGCTCACTCCCCCATGCCAACGGCTGGCCCCAGGCCCCCAGGC
AGGACCCCGCGAAGAAAGCAACCAGAGTCAGCCTCCAAGGCAGAGGGGAGAACAATGAACTGCTCAAGGA
GATAGAGCCTGTGCTGAGCCTTCTCACCAGTGGGAGCAGAGGGGTCAAGGGAGGGGCACCTGCCAAGGCA
GAGATGAAAGATATGGGAATCCAGGTGGACAGAGATTTGGACGGCAAGTCACACAAACCTCTGCCCCTCG
GCGTGGAGAACGACCGAGTCTTCAATGACCTATGGGGGAAGGGCAATGTGCCTGTCGTCCTCAACAACCC
ATATTCAGAGAAGGAGCAGCCCCCCACCTCAGGAAAACAGTCCCCCACAAAGAATGGCAGCCCCTCCAAG
TGTCCACGCTTCCTCAAGGTCAAGAACTGGGAGACTGAGGTGGTTCTCACTGACACCCTCCACCTTAAGA
GCACATTGGAAACGGGATGCACTGAGTACATCTGCATGGGCTCCATCATGCATCCTTCTCAGCATGCAAG
GAGGCCTGAAGACGTCCGCACAAAAGGACAGCTCTTCCCTCTCGCCAAAGAGTTTATTGATCAATACTAT
TCATCAATTAAAAGATTTGGCTCCAAAGCCCACATGGAAAGGCTGGAAGAGGTGAACAAAGAGATCGACA
CCACTAGCACTTACCAGCTCAAGGACACAGAGCTCATCTATGGGGCCAAGCACGCCTGGCGGAATGCCTC
GCGCTGTGTGGGCAGGATCCAGTGGTCCAAGCTGCAGGTATTCGATGCCCGTGACTGCACCACGGCCCAC
GGGATGTTCAACTACATCTGTAACCATGTCAAGTATGCCACCAACAAAGGGAACCTCAGGTCTGCCATCA
CCATATTCCCCCAGAGGACAGACGGCAAGCACGACTTCCGAGTCTGGAACTCCCAGCTCATCCGCTACGC
TGGCTACAAGCACCGTGACGGCTCCACCCTGGGGGACCCAGCCAATGTGCAGTTCACAGAGATATGCATA
CAGCAGGGCTGGAAACCGCCTAGAGGCCGCTTCGATGTCCTGCCGCTCCTGCTTCAGGCCAACGGCAATG
ACCCTGAGCTCTTCCAGATTCCTCCAGAGCTGGTGTTGGAACTTCCCATCAGGCACCCCAAGTTTGAGTG
GTTCAAGGACCTGGCGCTGAAGTGGTACGGCCTCCCCGCCGTGTCCAACATGCTCCTAGAGATTGGCGGC
CTGGAGTTCAGCGCCTGTCCCTTCAGTGGCTGGTACATGGGCACAGAGATTGGTGTCCGCGACTACTGTG
ACAACTCCCGCTACAATATCCTGGAGGAAGTGGCCAAGAAGATGAACTTAGACATGAGGAAGACGTCCTC
CCTGTGGAAGGACCAGGCGCTGGTGGAGATCAATATCGCGGTTCTCTATAGCTTCCAGAGTGACAAAGTG
ACCATTGTTGACCATCACTCCGCCACCGAGTCCTTCATTAAGCACATGGAGAATGAGTACCGCTGCCGGG
GGGGCTGCCCTGCCGACTGGGTGTGGATCGTGCCCCCCATGTCCGGAAGCATCACCCCTGTGTTCCACCA
GGAGATGCTCAACTACCGGCTCACCCCCTCCTTCGAATACCAGCCTGATCCCTGGAACACGCATGTCTGG
AAAGGCACCAACGGGACCCCCACAAAGCGGCGAGCCATCGGCTTCAAGAAGCTAGCAGAAGCTGTCAAGT
TCTCGGCCAAGCTGATGGGGCAGGCTATGGCCAAGAGGGTGAAAGCGACCATCCTCTATGCCACAGAGAC
AGGCAAATCGCAAGCTTATGCCAAGACCTTGTGTGAGATCTTCAAACACGCCTTTGATGCCAAGGTGATG
TCCATGGAAGAATATGACATTGTGCACCTGGAACATGAAACTCTGGTCCTTGTGGTCACCAGCACCTTTG
GCAATGGAGATCCCCCTGAGAATGGGGAGAAATTCGGCTGTGCTTTGATGGAAATGAGGCACCCCAACTC
TGTGCAGGAAGAAAGGAAGAGCTACAAGGTCCGATTCAACAGCGTCTCCTCCTACTCTGACTCCCAAAAA
TCATCAGGCGATGGGCCCGACCTCAGAGACAACTTTGAGAGTGCTGGACCCCTGGCCAATGTGAGGTTCT
CAGTTTTTGGCCTCGGCTCACGAGCATACCCTCACTTTTGCGCCTTCGGACACGCTGTGGACACCCTCCT
GGAAGAACTGGGAGGGGAGAGGATCCTGAAGATGAGGGAAGGGGATGAGCTCTGTGGGCAGGAAGAGGCT
TTCAGGACCTGGGCCAAGAAGGTCTTCAAGGCAGCCTGTGATGTCTTCTGTGTGGGAGATGATGTCAACA
TTGAAAAGGCCAACAATTCCCTCATCAGCAATGATCGCAGCTGGAAGAGAAACAAGTTCCGCCTCACCTT
TGTGGCCGAAGCTCCAGAACTCACACAAGGTCTATCCAATGTCCACAAAAAGCGAGTCTCAGCTGCCCGG
CTCCTTAGCCGTCAAAACCTCCAGAGCCCTAAATCCAGTCGGTCAACTATCTTCGTGCGTCTCCACACCA
ACGGGAGCCAGGAGCTGCAGTACCAGCCTGGGGACCACCTGGGTGTCTTCCCTGGCAACCACGAGGACCT
CGTGAATGCCCTGATCGAGCGGCTGGAGGACGCGCCGCCTGTCAACCAGATGGTGAAAGTGGAACTGCTG
GAGGAGCGGAACACGGCTTTAGGTGTCATCAGTAACTGGACAGACGAGCTCCGCCTCCCGCCCTGCACCA
TCTTCCAGGCCTTCAAGTACTACCTGGACATCACCACGCCACCAACGCCTCTGCAGCTGCAGCAGTTTGC
CTCCCTAGCTACCAGCGAGAAGGAGAAGCAGCGTCTGCTGGTCCTCAGCAAGGGTTTGCAGGAGTACGAG

5
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
GAATGGAAATGGGGCAAGAACCCCACCATCGTGGAGGTGCTGGAGGAGTTCCCATCTATCCAGATGCCGG
CCACCCTGCTCCTGACCCAGCTGTCCCTGCTGCAGCCCCGCTACTATTCCATCAGCTCCTCCCCAGACAT
GTACCCTGATGAAGTGCACCTCACTGTGGCCATCGTTTCCTACCGCACTCGAGATGGAGAAGGACCAATT
CACCACGGCGTATGCTCCTCCTGGCTCAACCGGATACAGGCTGACGAACTGGTCCCCTGTTTCGTGAGAG
GAGCACCCAGCTTCCACCTGCCCCGGAACCCCCAAGTCCCCTGCATCCTCGTTGGACCAGGCACCGGCAT
TGCCCCTTTCCGAAGCTTCTGGCAACAGCGGCAATTTGATATCCAACACAAAGGAATGAACCCCTGCCCC
ATGGTCCTGGTCTTCGGGTGCCGGCAATCCAAGATAGATCATATCTACAGGGAAGAGACCCTGCAGGCCA
AGAACAAGGGGGTCTTCAGAGAGCTGTACACGGCTTACTCCCGGGAGCCAGACAAACCAAAGAAGTACGT
GCAGGACATCCTGCAGGAGCAGCTGGCGGAGTCTGTGTACCGAGCCCTGAAGGAGCAAGGGGGCCACATA
TACGTCTGTGGGGACGTCACCATGGCTGCTGATGTCCTCAAAGCCATCCAGCGCATCATGACCCAGCAGG
GGAAGCTCTCGGCAGAGGACGCCGGCGTATTCATCAGCCGGATGAGGGATGACAACCGATACCATGAGGA
TATTTTTGGAGTCACCCTGCGAACGATCGAAGTGACCAACCGCCTTAGATCTGAGTCCATTGCCTTCATT
GAAGAGAGCAAAAAAGACACCGATGAGGTTTTCAGCTCCTAACTGGACCCTCTTGCCCAGCCGGCTGCAA
GTTTGTAAGCGCGGGACAGA
5 GGGGTGTGTGCGGGGGGCCGGAGGCGGCGGCTGTCAGAGTCGGCTCAGCCTGCGCCGGGGAACATCGGCC
GCCTCCAGCTCCCGGCGCGGCCCGGCCCGGCCCGGCTCGGCCGCCTCAGACGCCGCCTGCCCTGCAGCCA
TGAGGCCCCCGCAGTGTCTGCTGCACACGCCTTCCCTGGCTTCCCCACTCCTTCTCCTCCTCCTCTGGCT
CCTGGGTGGAGGAGTGGGGGCTGAGGGCCGGGAGGATGCAGAGCTGCTGGTGACGGTGCGTGGGGGCCGG
CTGCGGGGCATTCGCCTGAAGACCCCCGGGGGCCCTGTCTCTGCTTTCCTGGGCATCCCCTTTGCGGAGC
CACCCATGGGACCCCGTCGCTTTCTGCCACCGGAGCCCAAGCAGCCTTGGTCAGGGGTGGTAGACGCTAC
AACCTTCCAGAGTGTCTGCTACCAATATGTGGACACCCTATACCCAGGTTTTGAGGGCACCGAGATGTGG
AACCCCAACCGTGAGCTGAGCGAGGACTGCCTGTACCTCAACGTGTGGACACCATACCCCCGGCCTACAT
CCCCCACCCCTGTCCTCGTCTGGATCTATGGGGGTGGCTTCTACAGTGGGGCCTCCTCCTTGGACGTGTA
CGATGGCCGCTTCTTGGTACAGGCCGAGAGGACTGTGCTGGTGTCCATGAACTACCGGGTGGGAGCCTTT
GGCTTCCTGGCCCTGCCGGGGAGCCGAGAGGCCCCGGGCAATGTGGGTCTCCTGGATCAGAGGCTGGCCC
TGCAGTGGGTGCAGGAGAACGTGGCAGCCTTCGGGGGTGACCCGACATCAGTGACGCTGTTTGGGGAGAG
CGCGGGAGCCGCCTCGGTGGGCATGCACCTGCTGTCCCCGCCCAGCCGGGGCCTGTTCCACAGGGCCGTG
CTGCAGAGCGGTGCCCCCAATGGACCCTGGGCCACGGTGGGCATGGGAGAGGCCCGTCGCAGGGCCACGC
AGCTGGCCCACCTTGTGGGCTGTCCTCCAGGCGGCACTGGTGGGAATGACACAGAGCTGGTAGCCTGCCT
TCGGACACGACCAGCGCAGGTCCTGGTGAACCACGAATGGCACGTGCTGCCTCAAGAAAGCGTCTTCCGG
TTCTCCTTCGTGCCTGTGGTAGATGGAGACTTCCTCAGTGACACCCCAGAGGCCCTCATCAACGCGGGAG
ACTTCCACGGCCTGCAGGTGCTGGTGGGTGTGGTGAAGGATGAGGGCTCGTATTTTCTGGTTTACGGGGC
CCCAGGCTTCAGCAAAGACAACGAGTCTCTCATCAGCCGGGCCGAGTTCCTGGCCGGGGTGCGGGTCGGG
GTTCCCCAGGTAAGTGACCTGGCAGCCGAGGCTGTGGTCCTGCATTACACAGACTGGCTGCATCCCGAGG
ACCCGGCACGCCTGAGGGAGGCCCTGAGCGATGTGGTGGGCGACCACAATGTCGTGTGCCCCGTGGCCCA
GCTGGCTGGGCGACTGGCTGCCCAGGGTGCCCGGGTCTACGCCTACGTCTTTGAACACCGTGCTTCCACG
CTCTCCTGGCCCCTGTGGATGGGGGTGCCCCACGGCTACGAGATCGAGTTCATCTTTGGGATCCCCCTGG
ACCCCTCTCGAAACTACACGGCAGAGGAGAAAATCTTCGCCCAGCGACTGATGCGATACTGGGCCAACTT
TGCCCGCACAGGGGATCCCAATGAGCCCCGAGACCCCAAGGCCCCACAATGGCCCCCGTACACGGCGGGG
GCTCAGCAGTACGTTAGTCTGGACCTGCGGCCGCTGGAGGTGCGGCGGGGGCTGCGCGCCCAGGCCTGCG
CCTTCTGGAACCGCTTCCTCCCCAAATTGCTCAGCGCCACCGACACGCTCGACGAGGCGGAGCGCCAGTG
GAAGGCCGAGTTCCACCGCTGGAGCTCCTACATGGTGCACTGGAAGAACCAGTTCGACCACTACAGCAAG
CAGGATCGCTGCTCAGACCTGTGACCCCGGCGGGACCCCCATGTCCTCCGCTCCGCCCGGCCCCCTAGCT
GTATATACTATTTATTTCAGGGCTGGGCTATAACACAGACGAGCCCCAGACTCTGCCCATCCCCACCCCA
CCCCGACGTCCCCCGGGGCTCCCGGTCCTCTGCATGTCTCAGGCTGAGCTCCCTCCCCCGCGGTGCCTTC
GCCCCTCTGGGCTGCCAATAAACTGTTACAGCCAAAAAAAAAAAAAAAAAAAAAA
6 TCCCAGACAGAACCTACTATGTGCGGCGGCAGCTGGGGCGGGAAGGCGGGAGCTGGGGGCGCTGGGGGCG
CTGCGGCCGCTGCGGCCGCTGCAGCCGCTGCAGCGCCAGGGTCCACCTGGTCGGCTGCACCTGTGGAGGA
GGAGGTGGATTTCAGGCTTCCCGTAGACTGGAAGAATCGGCTCAAAACCGCTTGCCTCGCAGGGGCTGAG
CTGGAGGCAGCGAGGCCGCCCGACGCAGGCTTCCGGCGAGACATGGCAGGGCAAGGATGGCAGCCCGGCG
GCAGGGCCTGGCGAGGAGCGCGAGCCCGCGGCCGCAGTTCCCAGGCGTCTGCGGGCGCGAGCACGCCGCG

6
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
ACCCTGCGTGCGCCGGGGCGGGGGGGCGGGGCCTCGCCTGCACAAATGGGGACGAGGGGGGCGGGGCGGC
CACAATTTCGCGCCAAACTTGACCGCGCGTTCTGCTGTAACGAGCGGGCTCGGAGGTCCTCCCGCTGCTG
TCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCAGAACATGGGCATCGGCAAGAACGGGGACCT
GCCCTGGCCACCGCTCAGGAATGAATTCAGATATTTCCAGAGAATGACCACAACCTCTTCAGTAGAAGGT
AAACAGAATCTGGTGATTATGGGTAAGAAGACCTGGTTCTCCATTCCTGAGAAGAATCGACCTTTAAAGG
GTAGAATTAATTTAGTTCTCAGCAGAGAACTCAAGGAACCTCCACAAGGAGCTCATTTTCTTTCCAGAAG
TCTAGATGATGCCTTAAAACTTACTGAACAACCAGAATTAGCAAATAAAGTAGACATGGTCTGGATAGTT
GGTGGCAGTTCTGTTTATAAGGAAGCCATGAATCACCCAGGCCATCTTAAACTATTTGTGACAAGGATCA
TGCAAGACTTTGAAAGTGACACGTTTTTTCCAGAAATTGATTTGGAGAAATATAAACTTCTGCCAGAATA
CCCAGGTGTTCTCTCTGATGTCCAGGAGGAGAAAGGCATTAAGTACAAATTTGAAGTATATGAGAAGAAT
GATTAATATGAAGGTGTTTTCTAGTTTAAGTTGTTCCCCCTCCCTCTGAAAAAAGTATGTATTTTTACAT
TAGAAAAGGTTTTTTGTTGACTTTAGATCTATAATTATTTCTAAGCAACTAGTTTTTATTCCCCACTACT
CTTGTCTCTATCAGATACCATTTATGAGACATTCTTGCTATAACTAAGTGCTTCTCCAAGACCCCAACTG
AGTCCCCAGCACCTGCTACAGTGAGCTGCCATTCCACACCCATCACATGTGGCACTCTTGCCAGTCCTTG
ACATTGTCGGGCTTTTCACATGTTGGTAATATTTATTAAAGATGAAGATCCACATACCCTTCAACTGAGC
AGTTTCACTAGTGGAAATACCAAAAGCTTCCTACGTGTATATCCAGAGGTTTGTAGATAAATGTTGCCAC
CTTGTTTGTAACAGTGAAAAATTGAAAACAACCTGGAAGTCCAGTGATGGGAAAATGAGTATGTTTCTGT
CTTAGATTGGGGAACCCAAAGCAGATTGCAAGACTGAAATTTCAGTGAAAGCAGTGTATTTGCTAGGTCA
TACCAGAAATCATCAATTGAGGTACGGAGAAACTGAACTGAGAAGGTAAGAAAAGCAATTTAAAGTCAGC
GAGCAGGTTCTCATTGATAACAAGCTCCATACTGCTGAGATACAGGGAAATGGAGGGGGGAAAGCTGGAG
TATTGATCCCGCCCCCCTCCTTGGTTGTCAGCTCCCTGTCCTGTGTGTGGGCGGAACATAGTCCAGCTGC
TCTATAGCAAGTCTCAGGTGTTTGCAGTAAGAAGCTGCTGGCATGCACGGGAACAGTGAATGCCAAACAC
TTAAAGCAATTCGATGTTTAAGTATGTAAGTTCTTTTTTTTTTAGACAGCGTTTCGCTCTTGTTGCCCAG
GCTAGCATGCAATGGTGTGACCTCGGCTTACTGCAACCTCCGCCTTCCCAGATTCAAGCGATTCTCCTGC
CTCAGGCTCCCAAGTAGCTAGGACCAGGTGCGCGCCACCACGCCCGGCTAATTTTTGTATTTTGTATTTT
TAGTAGAGATGGGGTTTCACCATGTTGGTCAGGCTAGTCTCGAACTCGTGACCGCAAGCGATTCACCCAC
CTCAGCCTCCCAAAGTGCTGGGATTACCGGCTTGAGCCACCACACCCGGCACATCTTCATTCTTTTTATG
TAGTAAAAAGTATAAGGCCACACATGGTTTATTTGAAGTATTTTATAATTTAAAAAAATACAGAAGCAGG
AAAACCAATTATAAGTTCAAGTGAGGGATGATGGTTGCTTGAACCAAAGGGTTGCATGTAGTAAGAAATT
GTGATTTAAGATATATTTTAAAGTTATAAGTAGCAGGATATTCTGATGGAGTTTGACTTTGGTTTTGGGC
CCAGGGAGTTTCAGATGCCTTTGAGAAATGAATGAAGTAGAGAGAAAATAAAAGAAAAACCAGCCAGGCA
CAGTGGCTCACACCTGTAATCCCAGCGCTTTGGGAGGCTAAGGCAGGCAGATCACTTGAGACCAGCTTGG
GCAACATGGCAAAGCCCCATCTCTACAAAAAACACAAAAATTAGCTGGGCATTGTGGCGCACACCTGTAT
TCCCATCTAGTCAGGAAGCTGAGATGGAAGAATTAATTGAGCCCACGAGTTCAAGGCTGCAGTGAGTCGT
GATTGTGCCACTGCACTCCAGCCGGGGTGACAGAAGAGACCTTGTCTCGAAAAGGAATCTGAAAACAATG
GAACCATGCCTTCATAATTCTAGAAAGTTATTTTCAACTGATAAATCTATATTCACCCAAATAATCAAGG
GTGAAGGTAAAATAATACATTTTTAGACAAGCAAAGACTCAGGGGTTACCTCCATGTGCCCTTTTTAGGG
AAGCTGTTGGAGAAAATACTCCAGCAAAATGAAGGAGTACACAAACCAGAGAATGACATGAATCCAGCAA
ATAGGATCCAACACAGGCAATATTCCAGCTATGGAGCTAGCTTTAAAAAGGAACAGTAAAAATATTAATC
GGTTAGCTGGGTGGAATGGCCCATGCCTGTAGTCCCAGCTACTCAGGAGGCTCAGCAGCAGGACGACTTG
AGCCCAAGAGTTCCAGACCAGCCTGGCCACCTTAGTGAGATCCCTTCTCTTAAAAATAATAACTTATTGC
CAGATTTGGGGCATTTGGAAAGAAGTTCATTGAAGATAAAGCAAAAGTAAAAAAAAAAAAAAAAAAAACA
AGGGGAAAGGGTTGGTTAGGCAATCATTCTAGGGCAGAAAGAAGTACAGGATAGGAAGAGCATAATACAC
TGTTTTTCTCAACAAGGAGCAGTATGTACACAGTCATAATGATGTGACTGCTTAGCCCCTAAATATGGTA
ACTACTCTGGGACAATATGGGAGGAAAAGTGAAGATTGTGATGGTGTAAGAGCTAAATCCTCATCTGTCA
TATCCAGAAATCACTATATAATATATAATAATGAAATGACTAAGTTATGTGAGGAAAAAAACAGAAGACA
TTGCTAAAAGAGTTAAAAGTCATTGCTCTGGAGAATTAGGAGGGATGGGGCAGGGGACTGTTAGGATGCA
TTATAAACTGAAAAGCCTTTTTAAAATTTTATGTATTAATATATGCATTCACTTGAAAAACTAAAAAAAA
ACAATAATTTGGAAAAACCCATGAAGGTAACTAACGGAAGGAAAAACTAAGAGAATGAAAAGTATTTGCC
TCTGGAAAGAACAACTGGCAGGACTGTTGTTTTCATTGTAAGACTTTTGGAGCCATTTAATTGTACTTAA
CCATTTTCATCTATTTCTTTAATAAGAACAATTCCATCTTAATAAAGAGTTACACTTGTTAATAAGTAAA

7
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
AAAAAAAAAAAA
7 GAGCAGGAAATGCCGAGCGGCGCCTGAGCCCCAGGGAAGCAGGCTAGGATGTGAGAGACACAGTCACCTG
CAGCCTAATTACTCAAAAGCTGTCCCCAGGTCACAGAAGGGAGAGGACATTTCCCACTGAATCTGTCTGA
AGGACACTAAGCCCCACAGCTCAACACAACCAGGAGAGAAAGCGCTGAGGACGCCACCCAAGCGCCCAGC
AATGGCCCTGCCTGGAGAACATCCAGGCTCAGTGAGGAAGGGTCCAGAAGGGAATGCTTGCCGACTCGTT
GGAGAACAATGAAAAGGAGGAAACTGTGACTGAACCTCAAACCCCAAACCAGCCCGAGGAGAACCACATT
CTCCCAGGGACCCAGGGCGGGCCGTGACCCCTGCGGCGGAGAAGCCTTGGATATTTCCACTTCAGAAGCC
TACTGGGGAAGGCTGAGGGGTCCCAGCTCCCCACGCTGGCTGCTGTGCAGATGCTGGACGACAGAGCCAG
GATGGAGGCCGCCAAGAAGGAGAAGGTAGAGCAGATCCTGGCAGAGTTCCAGCTGCAGGAGGAGGACCTG
AAGAAGGTGATGAGACGGATGCAGAAGGAGATGGACCGCGGCCTGAGGCTGGAGACCCATGAAGAGGCCA
GTGTGAAGATGCTGCCCACCTACGTGCGCTCCACCCCAGAAGGCTCAGAAGTCGGGGACTTCCTCTCCCT
GGACCTGGGTGGCACTAACTTCAGGGTGATGCTGGTGAAGGTGGGAGAAGGTGAGGAGGGGCAGTGGAGC
GTGAAGACCAAACACCAGATGTACTCCATCCCCGAGGACGCCATGACCGGCACTGCTGAGATGCTCTTCG
ACTACATCTCTGAGTGCATCTCCGACTTCCTGGACAAGCATCAGATGAAACACAAGAAGCTGCCCCTGGG
CTTCACCTTCTCCTTTCCTGTGAGGCACGAAGACATCGATAAGGGCATCCTTCTCAACTGGACCAAGGGC
TTCAAGGCCTCAGGAGCAGAAGGGAACAATGTCGTGGGGCTTCTGCGAGACGCTATCAAACGGAGAGGGG
ACTTTGAAATGGATGTGGTGGCAATGGTGAATGACACGGTGGCCACGATGATCTCCTGCTACTACGAAGA
CCATCAGTGCGAGGTCGGCATGATCGTGGGCACGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAAT
GTGGAGCTGGTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACCGAGTGGGGCGCCTTCGGGGACTCCG
GCGAGCTGGACGAGTTCCTGCTGGAGTATGACCGCCTGGTGGACGAGAGCTCTGCAAACCCCGGTCAGCA
GCTGTATGAGAAGCTCATAGGTGGCAAGTACATGGGCGAGCTGGTGCGGCTTGTGCTGCTCAGGCTCGTG
GACGAAAACCTGCTCTTCCACGGGGAGGCCTCCGAGCAGCTGCGCACACGCGGAGCCTTCGAGACGCGCT
TCGTGTCGCAGGTGGAGAGCGACACGGGCGACCGCAAGCAGATCTACAACATCCTGAGCACGCTGGGGCT
GCGACCCTCGACCACCGACTGCGACATCGTGCGCCGCGCCTGCGAGAGCGTGTCTACGCGCGCTGCGCAC
ATGTGCTCGGCGGGGCTGGCGGGCGTCATCAACCGCATGCGCGAGAGCCGCAGCGAGGACGTAATGCGCA
TCACTGTGGGCGTGGATGGCTCCGTGTACAAGCTGCACCCCAGCTTCAAGGAGCGGTTCCATGCCAGCGT
GCGCAGGCTGACGCCCAGCTGCGAGATCACCTTCATCGAGTCGGAGGAGGGCAGTGGCCGGGGCGCGGCC
CTGGTCTCGGCGGTGGCCTGTAAGAAGGCCTGTATGCTGGGCCAGTGAGAGCAGTGGCCGCAAGCGCAGG
GAGGATGCCACAGCCCCACAGCACCCAGGCTCCATGGGGAAGTGCTCCCCACACGTGCTCGCAGCCTGGC
GGGGCAGGAGGCCTGGCCTTGTCAGGACCCAGGCCGCCTGCCATACCGCTGGGGAACAGAGCGGGCCTCT
TCCCTCAGTTTTTCGGTGGGACAGCCCCAGGGCCCTAACGGGGGTGCGGCAGGAGCAGGAACAGAGACTC
TGGAAGCCCCCCACCTTTCTCGCTGGAATCAATTTCCCAGAAGGGAGTTGCTCACTCAGGACTTTGATGC
ATTTCCACACTGTCAGAGCTGTTGGCCTCGCCTGGGCCCAGGCTCTGGGAAGGGGTGCCCTCTGGATCCT
GCTGTGGCCTCACTTCCCTGGGAACTCATCCTGTGTGGGGAGGCAGCTCCAACAGCTTGACCAGACCTAG
ACCTGGGCCAAAAGGGCAGCCAGGGGCTGCTCATCACCCAGTCCTGGCCATTTTCTTGCCTGAGGCTCAA
GAGGCCCAGGGAGCAATGGGAGGGGGCTCCATGGAGGAGGTGTCCCAAGCTTTGAATACCCCCAGAGACC
TTTTCTCTCCCATACCATCACTGAGTGGCTTGTGATTCTGGGATGGACCCTCGCAGCAGGTGCAAGAGAC
AGAGCCCCCAAGCCTCTGCCCCAAGGGGCCCACAAAGGGGAGAAGGGCCAGCCCTACATCTTCAGCTCCC
ATAGCGCTGGCTCAGGAAGAAACCCCAAGCAGCATTCAGCACACCCCAAGGGACAACCCCATCATATGAC
ATGCCACCCTCTCCATGCCCAACCTAAGATTGTGTGGGTTTTTTAATTAAAAATGTTAAAAGTTTTAAAC
ATGAAAAAAAA
8 AGCGCGGTGAGTTTGAAACTGCTCGCACTTGGCTTCAAAGCTGGCTCTTGGAAATTGAGCGGAGAGCGAC
GCGGTTGTTGTAGCTGCCGCTGCGGCCGCCGCGGAATAATAAGCCGGGATCTACCATACCCATTGACTAA
CTATGGAAGATTATACCAAAATAGAGAAAATTGGAGAAGGTACCTATGGAGTTGTGTATAAGGGTAGACA
CAAAACTACAGGTCAAGTGGTAGCCATGAAAAAAATCAGACTAGAAAGTGAAGAGGAAGGGGTTCCTAGT
ACTGCAATTCGGGAAATTTCTCTATTAAAGGAACTTCGTCATCCAAATATAGTCAGTCTTCAGGATGTGC
TTATGCAGGATTCCAGGTTATATCTCATCTTTGAGTTTCTTTCCATGGATCTGAAGAAATACTTGGATTC
TATCCCTCCTGGTCAGTACATGGATTCTTCACTTGTTAAGAGTTATTTATACCAAATCCTACAGGGGATT
GTGTTTTGTCACTCTAGAAGAGTTCTTCACAGAGACTTAAAACCTCAAAATCTCTTGATTGATGACAAAG
GAACAATTAAACTGGCTGATTTTGGCCTTGCCAGAGCTTTTGGAATACCTATCAGAGTATATACACATGA
GGTAGTAACACTCTGGTACAGATCTCCAGAAGTATTGCTGGGGTCAGCTCGTTACTCAACTCCAGTTGAC

8
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
ATTTGGAGTATAGGCACCATATTTGCTGAACTAGCAACTAAGAAACCACTTTTCCATGGGGATTCAGAAA
TTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATC
TTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTG
GATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAA
TGGCACTGAATCATCCATATTTTAATGATTTGGACAATCAGATTAAGAAGATGTAGCTTTCTGACAAAAA
GTTTCCATATGTTATATCAACAGATAGTTGTGTTTTTATTGTTAACTCTTGTCTATTTTTGTCTTATATA
TATTTCTTTGTTATCAAACTTCAGCTGTACTTCGTCTTCTAATTTCAAAAATATAACTTAAAAATGTAAA
TATTCTATATGAATTTAAATATAATTCTGTAAATGTGTGTAGGTCTCACTGTAACAACTATTTGTTACTA
TAATAAAACTATAATATTGATGTCAGGAATCAGGAAAAAATTTGAGTTGGCTTAAATCATCTCAGTCCTT
ATGGCAGTTTTATTTTCCTGTAGTTGGAACTACTAAAATTTAGGAAAATGCTAAGTTCAAGTTTCGTAAT
GCTTTGAAGTATTTTTATGCTCTGAATGTTTAAATGTTCTCATCAGTTTCTTGCCATGTTGTTAACTATA
CAACCTGGCTAAAGATGAATATTTTTCTACTGGTATTTTAATTTTTGACCTAAATGTTTAAGCATTCGGA
ATGAGAAAACTATACAGATTTGAGAAATGATGCTAAATTTATAGGAGTTTTCAGTAACTTAAAAAGCTAA
CATGAGAGCATGCCAAAATTTGCTAAGTCTTACAAAGATCAAGGGCTGTCCGCAACAGGGAAGAACAGTT
TTGAAAATTTATGAACTATCTTATTTTTAGGTAGGTTTTGAAAGCTTTTTGTCTAAGTGAATTCTTATGC
CTTGGTCAGAGTAATAACTGAAGGAGTTGCTTATCTTGGCTTTCGAGTCTGAGTTTAAAACTACACATTT
TGACATAGTGTTTATTAGCAGCCATCTAAAAAGGCTCTAATGTATATTTAACTAAAATTACTAGCTTTGG
GAATTAAACTGTTTAACAAATAAAAAAAAAAAA
9 CCTTTTTGCTGTACATAAGCTGCCCATTCCCCCTCCAGCCTGTGGTACCCAGTCCTCAGGTGCAACCCCC
TGCGTGGTCCTCTGTGGCAGCCTTCTCTCATTCAGAGCTGGGTTGCAGCAGCTCAGACAATCCTTACCAT
GTGAAAGGAGGAATGACTGTCATGGCATGAAAAAAGCATCACTATGAAAAAGAAAACTCAGTAGAAGATA
ATGGCAAGTCCAGACTGGGGATATGATGACAAAAATGGTCCTGAACAATGGAGCAAGCTGTATCCCATTG
CCAATGGAAATAACCAGTCCCCTGTTGATATTAAAACCAGTGAAACCAAACATGACACCTCTCTGAAACC
TATTAGTGTCTCCTACAACCCAGCCACAGCCAAAGAAATTATCAATGTGGGGCATTCCTTCCATGTAAAT
TTTGAGGACAACGATAACCGATCAGTGCTGAAAGGTGGTCCTTTCTCTGACAGCTACAGGCTCTTTCAGT
TCCATTTTCACTGGGGCAGTACAAATGAGCATGGTTCAGAACATACAGTGGATGGAGTCAAATATTCTGC
CGAGCTTCACGTAGCTCACTGGAATTCTGCAAAGTACTCCAGCCTTGCTGAAGCTGCCTCAAAGGCTGAT
GGTTTGGCAGTTATTGGTGTTTTGATGAAGGTTGGTGAGGCCAACCCAAAGCTGCAGAAAGTACTTGATG
CCCTCCAAGCAATTAAAACCAAGGGCAAACGAGCCCCATTCACAAATTTTGACCCCTCTACTCTCCTTCC
TTCATCCCTGGATTTCTGGACCTACCCTGGCTCTCTGACTCATCCTCCTCTTTATGAGAGTGTAACTTGG
ATCATCTGTAAGGAGAGCATCAGTGTCAGCTCAGAGCAGCTGGCACAATTCCGCAGCCTTCTATCAAATG
TTGAAGGTGATAACGCTGTCCCCATGCAGCACAACAACCGCCCAACCCAACCTCTGAAGGGCAGAACAGT
GAGAGCTTCATTTTGATGATTCTGAGAAGAAACTTGTCCTTCCTCAAGAACACAGCCCTGCTTCTGACAT
AATCCAGTAAAATAATAATTTTTAAGAAATAAATTTATTTCAATATTAGCAAGACAGCATGCCTTCAAAT
CAATCTGTAAAACTAAGAAACTTAAATTTTAGTTCTTACTGCTTAATTCAAATAATAATTAGTAAGCTAG
CAAATAGTAATCTGTAAGCATAAGCTTATGCTTAAATTCAAGTTTAGTTTGAGGAATTCTTTAAAATTAC
AACTAAGTGATTTGTATGTCTATTTTTTTCAGTTTATTTGAACCAATAAAATAATTTTATCTCTTTCAAA
AAAAAAAAAAAA
10 ACTTCAAAGCAAAATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCA
AATACACAACAAGGACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAAT
GTGAGCGATATTTAGCTCCGAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAAT
TTACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTTAGCTATAAATTATGCACAAGATCTGGA
AATGAAGATGAATTTAGAAACATGGTGACTAGATGTAACAATGTTGGGGTTCGTATTTATGTGGATGCTG
TAATTAATCATATGTGTGGTAACGCTGTGAGTGCAGGAACAAGCAGTACCTGTGGAAGTTACTTCAACCC
TGGAAGTAGGGACTTTCCAGCAGTCCCATATTCTGGATGGGATTTCAATGATGGTAAATGTAAAACTGGA
AGTGGAGATATCGAGAATTACAATGATGCTACTCAGGTCAGAGATTGTCGTCTGACTGGTCTTCTTGATC
TTGCACTGGAGAAGGATTACGTGCGTTCTAAGATTGCCGAATATATGAACCATCTCATTGACATTGGTGT
TGCAGGGTTCAGACTTGATGCTTCCAAGCACATGTGGCCTGGAGACATAAAGGCAATTTTGGACAAACTG
CATAATCTAAACAGTAACTGGTTCCCTGCAGGAAGTAAACCTTTCATTTACCAGGAGGTAATTGATCTGG
GTGGTGAGCCAATTAAAAGCAGTGACTACTTTGGTAATGGCCGGGTGACAGAATTCAAGTATGGTGCAAA
ACTCGGCACAGTTATTCGCAAGTGGAATGGAGAGAAGATGTCTTACTTAAAGAACTGGGGAGAAGGTTGG

9
Institute of Chemistry
University of the Philippines, Diliman, Quezon City
GGTTTCGTACCTTCTGACAGAGCGCTTGTCTTTGTGGATAACCATGACAATCAACGAGGACATGGGGCTG
GAGGAGCCTCTATTCTTACCTTCTGGGATGCTAGGCTGTACAAAATGGCAGTTGGATTTATGCTTGCTCA
TCCTTACGGATTTACACGAGTAATGTCAAGCTACCGTTGGCCAAGACAGTTTCAAAATGGAAACGATGTT
AACGATTGGGTTGGGCCACCAAATAATAATGGAGTAATTAAAGAAGTTACTATTAATCCAGACACTACTT
GTGGCAATGACTGGGTCTGTGAACATCGATGGCGCCAAATAAGGAACATGGTTATTTTCCGCAATGTAGT
GGATGGCCAGCCTTTTACAAATTGGTATGATAATGGGAGCAACCAAGTGGCTTTTGGGAGAGGAAACAGA
GGATTCATTGTTTTCAACAATGATGACTGGTCATTTTCTTTAACTTTGCAAACTGGTCTTCCTGCTGGCA
CATACTGTGATGTCATTTCTGGAGATAAAATTAATGGCAATTGCACAGGCATTAAAATTTACGTTTCTGA
TGATGGCAAAGCTCATTTTTCTATTAGTAACTCTGCTGAAGATCCATTTATTGCAATTCATGCTGAATCT
AAATTGTAAAATTTAAAATTAAATGCATGTCCTC

REFERENCES
Barbara, M. J. Engaging Students in a Bioinformatics Activity to Introduce Gene Structure and
Function 2013, 14 (1), 107109.
Bioinformatics, Nature.

10
Institute of Chemistry
University of the Philippines, Diliman, Quezon City