You are on page 1of 12

Elder et al.

Gut Pathog (2016) 8:16
DOI 10.1186/s13099-016-0098-0 Gut Pathogens

RESEARCH Open Access

The Salmonella pathogenicity island 13
contributes to pathogenesis in streptomycin
pre‑treated mice but not in day‑old chickens
Jacob R. Elder1, Kim Lam Chiok1, Narayan C. Paul1, Gary Haldorson1, Jean Guard3 and Devendra H. Shah1,2*

Abstract 
Background:  Salmonella enterica serovar Enteritidis (S. Enteritidis) is a human and animal pathogen that causes gas-
troenteritis characterized by inflammatory diarrhea and occasionally an invasive systemic infection. Salmonella patho-
genicity islands (SPIs) are horizontally acquired genomic segments known to contribute to Salmonella pathogenesis.
The objective of the current study was to determine the contribution of SPI-13 to S. Enteritidis pathogenesis.
Methods:  We deleted the entire SPI-13 (∆SPI-13) from the genome of S. Enteritidis CDC_2010K_0968 strain isolated
from a human patient during the 2010 egg-associated outbreak in the US. The kinetics of infection of the wild-type
parent and the ∆SPI-13 were compared in orally challenged day-old chickens and streptomycin pre-treated mice. The
degree of intestinal inflammation and the survival of mutant strain within the avian (HD11) and murine (RAW264.7)
macrophages were also determined.
Results:  The deletion of the SPI-13 resulted in impaired infection kinetics of S. Enteritidis in streptomycin pre-treated
mice which was characterized by significantly lower (P < 0.05) viable counts in the ceca, liver and spleen, impaired
ability to induce intestinal inflammation and reduced survival within murine macrophages. Conversely, there were
no significant differences in the infection kinetics of ∆SPI-13 in day-old chickens in any of the organs tested and the
survival of ∆SPI-13 within chicken macrophages remained unaltered.
Conclusions:  The results of this study show that SPI-13 contributes to the pathogenesis of S. Enteritidis in streptomy-
cin pre-treated mice but not in day-old chickens and raises the possibility that SPI-13 may play a role in pathogenesis
and the host adaptation/restriction of Salmonella serovars.
Keywords:  Salmonella, Salmonella pathogenicity island, Salmonella Enteritidis, Pathogenesis, SPI-13, Host-specificity,
Chicken, Streptomycin pre-treated mice

Background Of these, SPI-1 and SPI-2 have been extensively charac-
Salmonella enterica subspecies enterica serovar Ente- terized. The current paradigm is that SPI-1 is required
ritidis (S. Enteritidis) is a major food-borne pathogen for invasion of the epithelial cells in the intestinal tract
that causes inflammatory diarrhea in immunocompetent whereas SPI-2 is required for survival in macrophages
patients, however poor immune response or co-infection and systemic spread (Reviewed in [5]). However, the
with malaria or HIV may result in invasive infections majority of the other SPIs are poorly characterized and
with severe systemic illness [1, 2]. The Salmonella pan- their contribution to the biology of Salmonella in general
genome has 23 annotated genomic islands [3, 4] that are and pathogenesis in particular remains unclear.
referred to as Salmonella pathogenicity islands (SPIs). SPI-13 was originally identified in S. Gallinarum (an
avian host-adapted serotype) by employing a negative
*Correspondence: dshah@vetmed.wsu.edu
selection screening approach which has been widely
1
Department of Veterinary Microbiology and Pathology, Washington used to identify genes that may contribute to in vivo fit-
State University, Pullman, WA 99164‑7040, USA ness of Salmonella [6]. In this approach, large numbers
Full list of author information is available at the end of the article

© 2016 Elder et al. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium,
provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license,
and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/
publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

enterica and S. 7]. which included: (1) streptomycin pre-treated SPI-13 is not monophyletic. only one study reported use of cantly lower than the mean G + C content (52 mol%) of S. Bold gene names indicate where transposon mutagenesis has resulted in in vivo fitness defects in chickens or mice [6. SEN—). 8. have a different SPI-13 gene com. intestines of these hosts. Typhimurium in orally that mutations within three genes (SG3012. STM—) and 287/91 (lower. Moreover. [8] screened a library contain- in orally challenged day-old chickens and demonstrated ing pools of >7700 mutants of S. we used two biologically relevant animal to some of the genes in SPI-13 which also suggests that models. genesis of Salmonella. that cause typhoid-like disease and SPI-13 and determining the effects of absence of SPI-13 are human-adapted. Gallinarum. Gallinarum 287/91 [13].1  mol%) signifi. Para. there are also SPI-13 gene content The specific objective of this study was to directly dem- differences within subspecies enterica serovars that seem onstrate the role of SPI-13 in S. gle organ and a single time point and only few have used 13 genes [7]. screens have been conducted using non-host restricted we screened a library of >4000 S. and calves and reported that SG3015) resulted in reduced organ colonization and insertion mutations in up to fifteen genes of SPI-13 competitive defects in vivo [6]. enterica subspecies could be related to host adapta. important to note that the negative selection of a mutant tiple recombination events in the evolution of the genus during such large-scale in  vivo screening assays could Salmonella. Salmonella or merely due stochastic loss of a mutant from a popu- bongori shares very few SPI-13 genes with S. Subsequent mapping and resulted in negative selection of these mutants in the bioinformatics analysis of these genes resulted in identi. To date. enterica subspecies enterica is associated with raises a possibility that SPI-13 may have a role in patho- warm-blooded host while S. modulation of gut inflammation and inter- Salmonella (NTS) serovars with broad host range [6. 1  Genetic organization of SPI-13 in S. enterica. The sequences downstream of tRNA genes are hot. Enteritidis mutant lacking the entire typhi A and Sendai. Serovars Typhi. bongori. Thus. pigs. It is surprising that SPI-13 appears to have undergone mul. although negative selec- S. SEN2976–SEN2977) resulted in negative spots for recombination in bacteria.e. nal organ colonization). Evidence of recombination events at this result from number of underlying factors. Enteritidis P125109 [13]. mutations in seven SPI-13 genes (SEN2961–SEN2964. employed in different studies are often limited to a sin- diarizonae. bongori and the other Sal. Chaudhuri et  al. To dissect the role of SPI-13 in Klebseilla pneumoniae and Yersinia pestis have homologs pathogenesis. few SPI-13 mutants fication of SPI-13 (Fig. Gene names are listed for P125109 (top. salamae. as well as differences between growth defects or because of impaired metabolic fitness subspecies and serovars within S. SEN2972. hosts. 9] and orally inocu- tRNA pheV with a G  +  C content (48. Enteritidis pathogenesis to be related to host adaptation. SG—). These include locus include insertion/deletion of segments of SPI-13 direct impact of the mutation on the pathogen-host resulting in distinct SPI-13 sequences observed between cell interaction or indirectly due to in  vivo competitive S. lated mice [10]. Enteritidis lation. Enteritidis as a model organism in which insertion the Salmonella genome. Interestingly. the negative selection-screening assays and strains representing the subspecies indica. Gut Pathog (2016) 8:16 Page 2 of 12 of mutants are pooled and screened for in  vivo fitness Since the original identification of SPI-13 in an avian defects (indicated by loss or lower recovery of a mutant) host-adapted S. Typhimurium LT2 [34] and S. Typhimurium were negatively selected in inter- reading frames (ORFs) representing a region adjacent to nal organs in intra-peritoneally [8. by constructing S. arizonae and houtenae also lack many SPI.  1) which includes eighteen open of S. it is therefore not selection in intra-peritoneally inoculated mice [11]. SG3014– infected chickens. intestinal colonization and position compared to the majority of the non-typhoidal invasion. Moreover. on kinetics of infection (i. LT2 (middle. The differences in gene content between natural route of infection. In the previous study. this has not been conclusively monella subspecies are associated with cold-blooded demonstrated. mouse (an established model for human intestinal Fig. S. 11] .Elder et al. Gallinarum (an avian NTS serovars in which several SPI-13 genes were iden- host-adapted serotype) transposon insertion mutants tified. few negative selection using animal or cell culture models. tion of SPI-13 mutants reported in the published studies tion as S.

chloramphenicol (Cm. Samples from CGAGAGTGTAGGCTGGAGCTGCTTC-3′). Food was with- reference strain P125109 (UK KanR) was also included held for 4  h prior to orogastric administration of 20  mg for comparison of infection kinetics in streptomycin of streptomycin (Sigma Aldrich. att_tn7KORv knowledge.373 and 3. carbenicil- outbreak [12]. Enteritidis CDC_2010K_0968 strain. The ΔSPI-14 and ΔSPI. one of the ΔSPI-13. The liver. tocols approved by Institutional Animal Care and Usage 13/14 mutants were included as control strains to com. (2) a k/o mutant of SPI-14 (ΔSPI-14). To the best of our GGAGCTGCTTC-3′). the medium was supple- a human patient in Ohio during the 2010 egg-associated mented with 1. three mice were sacri- sette encoded on the pKD4 plasmid amplified with the ficed. then treated with 0. SPI14KOFw (5′-TTTTAAGATAT enized. 3. lin (Cb.Elder et al. and the the liver. homogenized reverse primer SPI14KORv (5′-TGCATAACATGGATAA in sterile maximum recovery diluent (MRD.939. This cassette was inserted at the tn7 results of this study also point towards the possibility that attachment site (att_tn7. the kanamycin resistance cas. At days 5 and 7 post-infection (p. (3) a k/o mutant of both SPI-13 and SPI-14 Mouse infection experiments (ΔSPI-13/14) and.6 % (w/v) Bacto Agar (Difco). For the construction of WT KanR onate broth (TTB. SPI13KOFw (5′-TATAAACGGATG plate counts and section of the cecum was also collected for CGTGATC ATAATAAAG G C AGTAATAGTAAGT histopathological analysis (see below). 13 was replaced with the kanamycin resistance cas. 50 μg/ml). USA) overnight (16  h) at 37  °C with shaking at The S. USA) in 100  µl of sterile pre-treated mice [13]. but not in chickens. and cecum were collected for direct forward primer. Enteritidis and Methods E. (4) a kanamycin resistant derivative All animal experiments were performed following the pro- of the WT strain (WT KanR). homog- the forward primer.). Enrichment cultures were incubated sette was amplified using the forward primer. strain P125109 genome (NCBI GenBank accession: NC_011294). found between nucleotides SPI-13 is likely involved in host. att_ at 37 °C for 24 h prior to plating on XLT-4 media followed tn7KOFw (5′-AGCGCAGGTAGGCGTAGCACCTCTT by incubation for 24 h at 37 °C. this is the first study showing the direct evi. coli strains were grown in Luria–Bertani (LB) broth Bacterial strains and growth media (Difco.adaptation and propa. (5′-GGCCGTCGATAGACGGCCTTTTTTTGTGCGC dence that SPI-13 contributes to intestinal pathogenesis C G TG A C A G G C G C TG T TC T TATATG A ATATC of S.408) which lies in the intergenic gation of S. Intracellular counts T T TA AC AG TG TAG G C TG G AG C TG C T TC. The CTCCTTA-3′). Committee (IACUC). ΔSPI-14. 100 μg/ml).5  % Triton-X 100 to lyse epi- ATTGAATTATCAGATGCTCCATTCAAATGAGAGA thelial cells and release intracellular bacteria. The λ-Red recombinase system H2O. food was with- was used to construct ΔSPI-13. isolated from 200  rpm. female C57BL/6 mice were (see below). The sections were washed SPI-14 with the kanamycin resistant cassette using with sterile PBS to remove residual gentamicin. spleen. For each S. spleen. At 24 h post streptomycin treatment. mutant of SPI-13 (ΔSPI-13). plating of organ homogenates were samples enriched. ΔSPI-14. Gut Pathog (2016) 8:16 Page 3 of 12 disease) and (2) day-old chickens (the reservoir host and AGTCGCTCTTCAGCCACCATAGAGAGTGTAGGCT a major source of human infection). USA. and reverse primer.i. SPI13KORv (5′-CGCTACAGGT in sterile PBS to remove as much of the intestinal contents C AGAC G G C G C G GAG C TA ATGT T T T T TA AC G and extracellular bacteria as possible and then incubating AG G CTTTATC ATATGAATATCCTCCTTAG-3′). S. If TTB enrichment cultures . or ΔSPI-13/14 mutant strains. Only in the cases mutant was constructed by replacing SPI-13 in the pre. when no colonies were recovered from samples by direct viously constructed ΔSPI-14 mutant with the chloram. in the cecum were determined by washing the tissues 3× and reverse primer. was used as the wild-type (WT) par. serially AATGGGTAGTCATGCTAGCGAGATAAGACAATGA diluted and directly plated on XLT-4 media (Difco) with CATATGAATATCCTCCTTAG-3′). Neogen) prepared according to manu- and UK KanR strains. When appropriate. Unless otherwise noted. mice were orogastrically chal- and KanR WT strains following procedures described lenged with ~7 log10 CFU WT parent (WT KanR) strain or previously [14]. facturer’s directions. The streptomycin pre-treated mouse pare and confirm the role of SPI-13 in pathogenesis of model was used as previously described [15]. and cecum were weighed. ΔSPI-13/14 held for 4  h. Enteritidis in gastrointestinal environment of region between SEN3674 and glmS in the S. Enteritidis mice. Difco).3 ′ ) . For the ΔSPI-13 strain the entire SPI. for 30 min at 37 °C with gentamicin (200 µg/ml) to kill any The ΔSPI-14 strain was generated by replacement of remaining extracellular bacteria. 20 μg/ml) and ent strain for constructing following mutants: (1) a k/o kanamycin (Km. Enteritidis in streptomycin pre-treated mouse model experiment. The kanamycin resistant derivative of the acquired from Harlan laboratories. phenicol resistance cassette using the primers listed 500 µl of homogenate was used to inoculate 10 ml tetrathi- above for SPI-13 k/o.939. Enteritidis in streptomycin pre-treated mice. The ΔSPI-13/14 50  μg/ml kanamycin when appropriate. Subsequently. 7–8  week-old.

Cell infection was allowed to proceed (<1). At 2 and 20 h post infection.7 mouse macrophages (ATCC) were grown in tions were analyzed independently by two individuals D-MEM medium (Gibco. washed three times normal (<5). cells from Specific-pathogen-free (SPF) White Leghorn eggs were respective plates were processed identically as described acquired from Sunrise farms (Catskill.25  ×  105 cells per well and submucosa). a total combined score was calculated. 1 for epithelial tamicin treatment (200 μg/ml) for 30 min to kill extracel- desquamation. In plate-2 and plate-3. Titusville. USA) supplemented with 10  % blinded to the sample IDs to assign total inflammation fetal bovine serum (FBS. and 20  μg/ml gentamicin at 37  °C with 5  % [15]. except on 5 and 28 days the lowest CFU/g observed for that specific organ across p.5 log10 CFU log10 CFU counts in each organ were determined using . strain was added to each well (multiplicity of infection of 0 for normal (>28). 5–8 indicated significant uptake of each bacterial strain. Subsequently. Next. and 3 and grown for 16–24  h. If samples were negative at both time denum. Savannah. Each strain was tested in before transferring to a hatcher (1550 hatcher-GQF. the cells from plate-1 were washed ulceration. 14 and 28 p. they were plated again at 48 h. 3× with sterile PBS and lysed with 0. Enteritidis for 18  days in the egg incubator (Ova-Easy 190 Advance strains at 2 and 20 h was determined as follows: CFU at 2 Cabinet Incubator. If of ΔSPI-13 mutant and the WT parent strain. For the determination of viable bacterial homogenates were directly plated on XLT-4 media (Difco) counts in the small intestine. jejunum. GA) for 3  days following manufacturer’s instructions. liver. A portion of ceca and each segment of the described above. 1 for slight infiltration (6–20). Enteritidis based on the number of goblet cells per high power field. and ceca were collected for direct points 0 CFU/g was assigned for statistical analysis. small intestine were processed for determination of intracel- lular counts similar to as described for mouse experiments. The combined score of 0 was considered to indicate no The numbers of intracellular bacteria were enumerated inflammation.000g for 2 min. 3 for high infiltration (61–100). RAW264. Finally. respectively a sample was positive after 24 or 48 h of enrichment they at day-1 of age [16]. The sec. Gut Pathog (2016) 8:16 Page 4 of 12 were negative after 24 h. Bacterial strains were pelleted high power (400×) fields by using following scores: 0 for by centrifugation at 13. Organ plate counts. Infiltration of the lamina propia Enteritidis strains were sub-cultured in fresh LB medium by polymorphonuclear (PMN) cells was scored accord. Briefly. media was replaced with the lower concentration of gen- tamicin (20 μg/ml) followed by incubation for 2 h (plate-2) Chicken infection experiments and 20 h (plate-3). USA) supplemented with 10  % FBS at mucosa made up by the space between the tunica muscu. 2 for moderate edema (11–40 %). Subsequently. 3. and 3 for severe reduction at 250g for 5  min. 2 for ~20). and 9–13 indicated severe inflammation. when three birds were sacrificed. Briefly. Overnight (16  h) cultures of S. the score for percent submucosal edema (% CO2. NY) and incubated for plate-1. 4 via direct plate counts which served as a measure of total indicated slight inflammation. Gentamicin-protection assays were laris and the epithelial layer using following scores: 0 for performed as described previously [17]. The spleen. 42  °C with 5  % CO2.7 or HD11 cells were seeded in the diameter of the cross section of the intestinal mucosa three 48-well plates each with 1. FL) or 20 h/total uptake CFU × 100. 2 indicated minimal inflammation. Newly hatched SPF chicks Statistical analysis were transferred and housed in HEPA-filtered isolator Statistically significant (P  <  0. 2 for epithelial erosion and 3 for epithelial lular bacteria. Chickens were orally challenged with 8. Percent survival/replication of S. and 4 for severe (RAW264. duo- the experiment. Histological analysis Cecal sections from mice were embedded in paraffin wax Intra‑macrophage survival assays and stained with hematoxylin and eosin (H&E). 1 for slight reduction (11–28). the inflammation. for each no detectable edema. infections were synchronized by spinning the plates moderate reduction (1–10). segments from the duode- supplemented with 50 μg/ml kanamycin when appropriate.05) differences in mean cages.5  ×  106 (>100).i. GQF duplicates in at least three independent experiments. Integrity of the intestinal epithelium was scored as for 30 min followed by three washings with PBS and gen- follows: 0 no detectable loss of integrity. Sigma Aldrich. 7.i. 1 for detectable edema (0–10 % of experiment. Reduction in number of goblet cells were scored CFU/100  μl. USA). 1. Brinsea Products Inc. num. 3.7) or IMDM (HD11) to obtain 2. RAW264. ileum. 100  μl of each S.6 was achieved. 2  mM scores as described previously with minor modifications l-glutamine. HD11 chicken macrophages were grown in IMDM SE) was calculated from the proportion of the diameter of medium (Gibco. jejunum and ileum were pooled for both intracellular Samples found negative by direct plating were enriched as and total counts. 5. and grown for ~3 h at 37 °C with shaking at 200 rpm until ing to number of PMNs in the lamina propia per 10 OD600 of 0. manufacturer Co. four chickens were sacri- were assigned the limit of detection for this experiment as ficed at days-1. for severe edema (>40 %). 2 moderate with sterile PBS and resuspended in pre-warmed D-MEM (21–60).5  % Triton-X 100.Elder et al.

the WT KanR strain did not show any pheno. Enteritidis also reported that this model can be used for this serotype as well [15. Typhimurium as a model organism and have reported that a dose as low as ~2 log10 CFU is suf- ficient to efficiently colonize streptomycin pre-treated mice. but served inflammation by S. We also compared the kinetics of infection of compare means and identify statistically significant dif. or ΔSPI-13/14 strain and the kinetics in humans (Reviewed in [18]). were challenged with ~7 log10 CFU of the WT KanR. at least two out of three animals challenged with infection results in reduced diversity of the microflora ΔSPI-13 showed lower bacterial counts in the cecum in the gastrointestinal tract. and induction of acute cecal were constructed for an unrelated experiment.  2). SPI‑13 contributes to colonization of the intestine we also included ΔSPI-14 and ΔSPI-13/14 mutants that and internal organs. Enteritidis P125109 strain ferences between the four groups in subsequent mouse (UK KanR) which was originally isolated from a human experiment. we constructed an aminoglycoside resistant derivative of WT CDC_2010K_0968 strain (WT KanR) by introduc- ing kanamycin resistance cassette downstream of the tn7 Fig. widely used UK KanR as has been described previously tify statistically significant differences (P < 0.05) . Enteritidis in a This genomic site has been previously used for insertion streptomycin pre-treated mouse model. This in turn. Because the WT strain (CDC_2010K_0968) used in the current study is not naturally resistant to aminoglycoside. C57BL/6 mice were infected with 7 log10 CFU of the WT KanR or UK KanR WT strains. expected. As where only two mice were sacrificed in the UK KanR infected group. Most of the published studies have used aminoglyco- side resistant S. 20]. suggesting that the kinetics score were compared for the entire experiment using of infections of WT KanR strain are comparable to the two-way ANOVA with Tukey’s post hoc analysis to iden. WT KanR strain with that of S.  3). between glmS and SEN3674).i. and other organs (Fig. Bars represent of heterologous genes with no adverse effects on in vitro mean ± SEM of three mice for each time point except for day 7 p. Thus. 19]. The effects of absence of SPI-13 human intestinal disease which is characterized by acute became more evident on day 7 p. 20]. Limited number of studies have employed this model to study infection kinetics of ami- noglycoside resistant S. As expected. both strains colonized cecum to similar parameter as wells as mean combined inflammation levels in this model (Fig.Elder et al. in  vitro growth characteristics of these strains (data not A one-way ANOVA with Tukey’s post hoc was used to shown).. in the animals challenged with ΔSPI-13/14 mutant.i. ΔSPI-14. Gut Pathog (2016) 8:16 Page 5 of 12 Student’s t test for comparing the two means in the pre. compared with the parental WT or with ΔSPI-13.05) lower sively characterized and widely adapted as an improved model to assess the role of Salmonella genetic factors in causing enterocolitis [19]. In this experiment. Mean percent survival in mouse and chicken food-borne outbreak in the United Kingdom [13] and mouse macrophage survival assays were also compared has been used as a reference strain in published stud- using Student’s t test. Streptomycin pre-treated mice NTS infection in the conventional laboratory mice typi. resulted in optimal cecal colonization (CFU/g) of S. mutants in the cecum were significantly (P < 0. On day with high dose of streptomycin (20  mg) 24  h prior to 5 p. but ing in gastro-intestinal disease that closely resembles not the ΔSPI-14 mutant. we compared the pathogenicity of the Results and discussion WT KanR and the ΔSPI-13 mutant. Significant differences were determined with two-sample t test not typic differences when the in vitro growth kinetics were assuming equal variances (*P < 0. however a dose of ~7 log10 CFU has been more commonly used [15. pre-treatment of infection were determined on days 5 and 7 p. This trend was also observed nella to extensively colonize the intestinal tract result.i. In contrast. Subsequently. Enteritidis in streptomycin pre‑treated as additional controls to compare and confirm the role of mice SPI-13 in pathogenesis. 2  Pilot experiments determined that a dose of 7 log10 CFU attachment site (att_tn7. cally manifests as a systemic disease resembling typhoid ΔSPI-13. or in vivo phenotypes of WT Salmonella strains [21]. allows Salmo. Mean inflammation score for each ies. intracellular counts of the ΔSPI-13 as well as ΔSPI-13/14 streptomycin pre-treated mouse model has been exten. as the total as well as gut inflammation and diarrhea (Reviewed in [19]).05). sug- liminary mouse experiments (for determination of dose gesting that insertion of kanamycin cassette did not alter and comparing WT strains) and the chicken experiment. [15.i.

Enteritidis in streptomycin pre- for percent edema. suggesting significantly higher than mock infected control (Fig. infection ability to colonize internal organs. Significant differences were determined using a one-way ANOVA with Tukey’s post hoc for multiple comparisons (*P < 0. Gut Pathog (2016) 8:16 Page 6 of 12 than the WT KanR. In contrast. these data show that absence of SPI-13 results WT Kan-R however only the differences in the spleen in the reduced intestinal and internal organ coloniza- counts were statistically (P  <  0. By day 7 p. Additionally. infiltration of PMNs. Col- were lower in liver and spleen when compared with the lectively. and epithelial integrity. kinetics of ΔSPI-13/14 were similar to ΔSPI-13 whereas In addition to the impaired intestinal and internal infection kinetics of ΔSPI-14 were similar to the WT organ colonization.05) significant (Fig. the inflammation score adapted to the intracellular niche and survives within Fig. where in the ΔSPI-13/14 infected group where mean intracellular cecal counts from two animals were used.i. the counts of ΔSPI-13 and ΔSPI-13/14 different from the mock-infected controls (Fig.05) .i. 3  Deletion of SPI-13 but not SPI-14 results in impaired colonization of the cecum (a). reduced invasion of the intestinal epithelium (b). 4. the combined cecal inflammation Kan-R further confirming that SPI-13 indeed contributes score.  3).. among animal groups infected SPI‑13 contributes to survival in mouse macrophages with ΔSPI-13 and ΔSPI-13/14 mutant when compared Uptake by and survival/replication within the host mac- with WT Kan-R. However the kinetics of infection for the WT Kan-R and ΔSPI-14 challenged groups were with ΔSPI-14 remained similar to WT KanR. Salmonella is specifically mutant (Figs. compromised of the sum of the indidivual scores to the pathogenesis of S. that absence of SPI-13 significantly impaired the intesti. cells. 3). was significantly (P < 0. Similarly.05) lower on days 5 and 7 p. but the inflammation scores were not rophages is a critical step for Salmonella to colonize significantly different in animals challenged with ΔSPI-14 the internal organs of hosts. the inflammation scores for the ΔSPI-13 nal colonization and invasion of the intestinal epithelium and ΔSPI-13/14 challenged groups were not significantly (Fig. 5). and impaired colonization of the liver (c) and spleen (d).i. loss of goblet treated mice. Bars represent mean ± SEM of three mice for each time point except for day 7 p.Elder et al.  4). tion and significantly reduced intestinal inflammation in suggesting that ΔSPI-13 mutant was also impaired in its streptomycin pre-treated mice.  4).

our data corroborates with the previous reports and and found that the first ten genes in SPI-13 (SEN2960– shows that SPI-13 contributes to the intra-macrophage SEN2969) are predicted to encode putative proteins that survival of S.3  %) at 2  h has anti-inflammatory properties. Torres and oth- the ΔSPI-13 mutant (39. macrophages in response to immune responsive gene 1 tionally.  6). it has been previously reported that expression (IRG1) expression and recognized as a potent antimicro- of several SPI-13 genes is upregulated in S. in part. Itaconate is is produced by in impaired survival in murine macrophages [22]. decreased colonization of are likely involved in the metabolism of aromatic mon- internal organs by the ΔSPI-13 mutant could. Bars represent mean inflammation severity score ± SEM from three mice for each time point with the contribution from individual parameters indicated. deletion through formation of the Salmonella containing vacu. Typhimurium resulted degradation of itaconate [27]. Gut Pathog (2016) 8:16 Page 7 of 12 Fig. Significant differences were deter- mined using Tukey’s post hoc analysis of two-way ANOVA (NS not significant. pestis is likely tosed when compared with WT KanR (2. Moreover. of ripABC operon. was significantly (P < 0.i. Therefore we tested the survival of that SPI-13 is important for efficient replication in intra- the ΔSPI-13 mutant in mouse macrophages as this may cellular environment of phagocytic cells. in Y. responsible for production of butyrate. These authors sug- p. be oamines or related molecules such as itaconate and the attributed to its decreased systemic dissemination due to last gene (SEN2977) is a putative hexuronate transporter . Enteritidis. ****P < 0.4 %) showed significantly oxide by macrophages and thereby enhances intra-mac- (P  <  0. **P < 0. In contrast. Intra-macrophage survival assay showed that macrophage survival are contradictory. a more recent the WT KanR (24. pestis. ers [26] postulated that rip operon of Y.6 %). These data corroborate biochemical characterization of Rip proteins of Y. 4  Deletion of SPI-13 but not SPI-14 results in reduced cecal inflammation in orally infected mice. ***P < 0. rium during intra-macrophage infection [23.  3.01. pestis is also associated with decreased and transport Salmonella to the internal organs via the survival in mouse macrophages [25].9 %).4 %) was more readily phagocy. a molecule that the survival/replication rate of ΔSPI-13 (57. Interestingly. pestis with the previous report showing that deletion of a first showed that these proteins are more likely involved in gene of SPI-13 (STM3117) in S.05) lower survival at 20  h when compared with rophage survival of Y. which is homologous to SEN2961– ole (SCV).001. We performed bioinformatics analysis of SPI-13 genes fore. However. bial which inhibits the glyoxylate cycle of bacteria [28]. further suggesting circulatory system. There. the relate to the reduced internal organ colonization shown reports of potential mechanisms underlying for intra- in Fig. Similarly. 24]. Addi. Typhimu.0001) macrophages by avoiding phago-lysosomal fusion impaired survival in macrophages.Elder et al. Infected macrophages then act as vehicle SEN2963.05) lower than the WT KanR gested that butyrate reduces the production of nitric (609.3  %) (Fig. ΔSPI-13 (2. Thus.

Scale bar indicates 100 μm. Salmonella Enteritidis SPI‑13 does not significantly impair the intestinal colonization and organ colonization in chickens We were particularly interested in the contribution of SPI-13 to the pathogenesis in chickens because poul- try and poultry products have been implicated as the primary vehicles for the transmission of S. it with WT strain died during the course of experiment (1 is currently unknown which of these metabolic mecha. sample-processing to the level of inflammation observed with mock-infected controls. Enteritidis infection was observed in chickens inoculated with the ΔSPI-13 in intestinal and intracellular environment in mice. Significant differences were determined using two- sample t test not assuming equal variances (*P < 0. The results revealed Fig. Bars represent mean percent of each phenotype from three biological replicates ± SEM.i. Although intriguing.i. cecum. and small intestine up to 28  days p.i. Interestingly. the results show that absence research is needed to improve our mechanistic under. L lumen tinal samples from chickens challenged with WT result- ing in the killing of the bacteria released after cell lysis and subsequent negative isolation results.  7). edema (e). 30]. sug. Enteritidis. Therefore. spleen.05) in particular its link to intestinal infection and intra-mac- rophage survival of S.Elder et al.). we found no significant differences in the colonization of which is likely involved in uptake or hexuronate. on day-1 p. 5  The WT KanR strain produces severe inflammation of the that the total and intracellular counts in both cecum and cecum characterized by epithelial erosion and necrosis (er).i. two chickens challenged multiple metabolic substrates. Enteritidis to people [29. and 1 on day-4 p. standing of role of SPI-13 in Salmonella metabolism and Enteritidis to colonize the intestine and internal organs .5 log10 CFU of the WT parent or the ΔSPI-13 mutant strain and determined the kinetics of infection in the liver. Note that on day 1 p.. Gut Pathog (2016) 8:16 Page 8 of 12 Fig. 7). Similarly. and a reduction in the number of goblet not significantly different from the WT infected chick- cells (g) whereas the ΔSPI-13 mutant produces mild or more similar ens (Fig.i. Collectively. More mutant strain. error resulted in residual gentamicin in the small intes- Representative H&E stained cecal cross-sections are shown from each group on days 5 and 7 p. of SPI-13 did not significantly impair the ability of S. infiltration small intestine of chickens infected with ΔSPI-13 were of PMNs (p). however no mortality nisms play an active role during S. 1-day-old chickens with ~8.7 macrophages. spleen and liver between ΔSPI-13 mutant and WT par- gesting that SPI-13 is likely involved in metabolism of ent strain (Fig. 6  Deletion of SPI-13 results in increased uptake and reduced survival (2 and 20 h) in mouse RAW264. we infected two groups of 24.

Enteritidis and several of the tiple plausible explanations for this discrepancy. One-day-old chickens were orally infected with 8. Enteritidis differ in their 13 mutant will be needed to confirm and conclusively repertoire of pathogenicity factors [11. Each time point represents the mean + SEM of four chickens. It is also possible that SPI. small intestine (b). report in which S. Significant differences (P < 0. because S. Consequently. Enteritidis in chickens. The apparent demonstrate these differences in virulence in chicken. There are mul. liver (c). Mean total log10 CFU/g of tissue in the cecum (a). Typhimurium and S. we genes encoding metabolic functions are degraded in this employed individual strain infections whereas Chaudhuri host-adapted serotype making this serotype metaboli- et  al. Gallinarum in our previ- mutations within several SPI-13 genes were negatively ous study [6]. Serotype differences could also contribute to in subtle reduction of virulence of S. spleen (d). may adversely affect infectivity of S. First. however the difference in mortality raises of negatively selected mutants was reported by these a possibility that absence of SPI-13 may have resulted authors. Gallinarum in chick- resent false positives because a high false discovery rate ens. but does not affect infectivity of metabolically more . [8] employed mixed infection approach in which cally auxotrophic [13]. and mean intracellular log10 CFU/g of both strains in the cecum (e) and small intestine (f).05) were identified using two-sample t test not assuming equal variance for each time point of chickens. discrepancies between our results and previous studies old chickens. 31]. Salmonella Gallinarum is known to have selected in orally inoculated chickens [8]. 7  Deletion of SPI-13 does not significantly impact pathogenesis of S. Typhimurium mutants with insertion Enteritidis in this study and S. Gallinarum in chicken host and therefore its absence 13 mutants reported by Chaudhuri et  al.Elder et al. [8] could rep. Gut Pathog (2016) 8:16 Page 9 of 12 Fig. it is possible that reduced competitive fitness of the mutants could result SPI-13 genes partly fulfil the metabolic requirements of in their negative selection. Enteritidis in day. role of SPI-13 in metabolism could also explain the dif- Noteworthy is that our results contradict the previous ference in phenotypes observed in SPI-13 mutants of S. S. Determination of the LD50 of the ΔSPI.5 log10 CFU of WT (black bars) or ΔSPI-13 mutant (gray bars). more pseudogenes than S.

work is in progress to more rigorously define the island and deter- mine which genes within this island specifically contrib- ute to the pathogenesis and metabolism of S. One of ΔSPI-13 mutant was similar to WT at early (2 h) and plausible hypothesis is that SPI-13 may be important for slightly higher than WT at late (20 h) intracellular phase S. 7]. College of Veterinary Medicine. Enteritidis in chicken host is compensated with other Conclusions sources making SPI-13 dispensable in this reservoir host. In contrast. Seftenberg and S. Washington State the mean percent uptake and percent survival at 2 and 20 h post University. United States Department of Agriculture. the first six genes within SPI-13 are completely absent in S. 8). but does not appear to be imporant Previously. However. Pullman. The decreased range [6. host-specificity is linked to the potential role of SPI-13 in we tested the intra-macrophage survival of the ΔSPI-13 S. in the growth and/or survival of the mutant in chicken macrophages. USA. Enteritidis tions why SPI-13 is required for full virulence of S. WA 99164‑7040. This suggest that SPI-13 has a modular architechture [6. several Salmonella serovars such as Typhi. in con. . NP. Pullman. In contrast. Macrophages were infected at an MOI of ~20 and 1  Department of Veterinary Microbiology and Pathology. These data raise several interesting ques- SPI‑13 does not contribute to the survival of S. reduced have a different SPI-13 gene composition compared to inflammation and reduced colonization of the spleen and the majority of the other NTS serovars with broad host liver in streptomycin pre-treated mice.Elder et al. Further biochem. to the pathogenesis of S. USA. We chose to use the most inclusive description of SPI-13 for defining SPI-13 in the current study. Agriculture Research equal variances (*P < 0. we did on this island. because broad-host range Salmonella serovars are known ingly. However it is currently unknown if this genetic diversity within SPI-13 also contributes to differential virulence of Salmonella in different hosts and if it is associated with differential of metabolic dependence of Salmonella in different hosts. DS. Consequently. transposon insertion mutation in SEN2961 in its reservoir host. chickens? Is it is likely that SPI-13 was reported to result in impaired intra-cellular survival is a host-specific pathogenicity island? and if true. However. potentially nutrient-limited conditions encountered in trast to the previous report [32]. Enteritidis. Analyzed the data: JE. GH. Performed experiments: JE. Enteritidis’s ability to utilize monoamines and/or hexu- (Fig. In summary. this nutrient demand of S. Significant Health. Paraty- phi whereas S. USA. Enteritidis metabolism which may impact metabolic mutant strain and compared with the WT parent strain fitness of S. energy in  vivo. Interest. 8  Deletion of SPI-13 does not affect survival in HD11 chicken Author details macrophages.  8). Enteritidis which is character. Research is also needed to determine the not observe significant difference in the pathogenesis of potential role of such metabolic substrates in vivo during ΔSPI-13 mutant in chicken host and there was no defect Salmonella infection streptomycin pre-treated mouse. Enteritidis in avian macrophages [32]. Paratyphi A and Sendai and at least few NTS serotypes. 2 Paul Allen School for Global Animal infection was determined from three biological replicates. ized by decreased colonization of the cecum. KC. All authors read and approved the final manuscript. DS. These data suggest that the absence of SPI-13 ronates in hosts such as streptomycin pre-treated mouse does not result in impaired intra-macrophage survival of where these nutrients may serve as primary source of S. survival in murine macrophages that could limit dis- tify exact target metabolic substrates for genes encoded semination to the internal organs. GA 30605. colonization may be at least in part due to the decreased ical characterization of ΔSPI-13 will be required to iden. Enteritidis. 3 Egg Quality and Safety Research Unit. the intracellular survival different hosts or in the external environment [33]. Fig. Athens. our results show that SPI-13 contributes Finally. Authors’ contributions Conceived and designed experiments: JE.05) Service. More specifically. Gut Pathog (2016) 8:16 Page 10 of 12 efficient S. Enteritidis in the same host. the uptake (30 min) of ΔSPI-13 in HD-11 cells was to have diverse metabolism to support optimal growth in higher than its WT counterpart (Fig. Enteritidis in specific hosts? It is intriguing using chicken macrophage-like cells (HD11). is this of S. Typhi and S. 7]. Infantis have large inser- tions at the upstream end of SPI-13. Washington State University. Enter- in chicken macrophages itidis in murine host. WA differences were determined using two-sample t test not assuming 99164‑7040. The modular architechture of SPI-13 is intriguing.

Call DR. Clifton SW. Danino 6. Replication of Yersinia Wang J. Zaldívar M. Hinton JCD. Lan B. et al. Diard M. Guard J. Churcher Salmonella enterica serovar Enteritidis identifies genes that contribute to C. 2014. ary Bailey. Jacob 16. Contreras F. Program. Comparative genomics of Norbeck AD.1003456. Jantsch J. Hinton JCD. Watson M. Call DR. Balakrishnan A. Kim H-Y. Thompson A. 1. Global 19. Allard MW. Crume T.10:958–84. Boothe EJ. 2010. Bliska JB. Begum RH.81:1207–20. 5. 8. Wanner BL. structural and molecu- novel genomic islands that contribute to Salmonella virulence in mouse lar dynamics analyses of the potential virulence factor RipA from Yersinia systemic infection.97:6640–5. Perry RD. Stecher B. Langridge GC. Coleman JR. Potter Pathog. 25. Zhou X. Rausell A. Leiva LE. Shi L.and narrow-host-range Salmonella enterica Funding serovars in the streptomycin-pretreated mouse model. Bhonagiri-Palsikar V. Glenn J. Bowen AJ. Stones R. Eriksson S.7 macrophages identification of a novel protein that contributes to 2013. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Suar M.21(6):941–9. Marcus R. lyase affects virulence in coordination with Salmonella pathogenic.10:371–7. neous expression of three type 3 secretion systems. 2009. the replication of serovar Typhimurium inside macrophages.111:117–27. 2003. Fullerton mice by Salmonella enterica serovar Enteritidis involves additional genes KE. 4. Batz MB. Cell Microbiol. Ao TT. Enhanced susceptibility to Salmonella infection in compromises control of concurrent systemic non-typhoidal Salmonella streptomycin-treated mice. 2014. pone. 31. Chakravortty D. Identifica. Strain E. Santiviago CA. Genome-wide identification of Sankaran B.1128/ biology of macrophage infection by gene expression profiling of intracel- mBio. Mammina C. Zadora PK. Fookes M. 2010. Berg IA. Lucchini S. Fleig A. Lokken KL. The type VI secretion system encoded in Salmonella pathogenicity island 19 is required for Salmonella enterica serotype Gallinarum survival within infected macrophages. Infect Immun. 2013. 1962. Luo Y.297:241–9. study in five FoodNet sites. doi:10. Barrow PA. Infect Immun. Berberov EM.156:2770–81. et al.1371/journal. Köster W. Infection of 29. Miller CP.160:1999–2017. Salmonella enterica subspecies enterica serovar Enteritidis 3.245:56–83. lular Salmonella enterica. Jiménez JC. Morgan E. Thomson NR. Ahmad N. Clayton DJ. Virulence of broad. Evolution. Buckley AM. Nat Chem Biol. Purvine SO. Chae J-S.Elder et al. doi:10. doi:10. Adkins JN. 2013. two prevalent sero. Torres R. Pettengill J. analysis of Salmonella enterica serovar Typhimurium isolated from RAW vars associated with different livestock species in the UK. Mickael CS. Atwood BR.pgen. Connor Salmonella pathogenicity island 2 type III secretion system: role in intesti- TR. provides insights into evolutionary and host adaptation pathways. Kremer M. Vernikos G. Koch B. PLoS One. Ishii Y. Porwollik S. Eo S-K. Hardt W-D.75:1278–91. Salmonella pathogenicity islands encoding 2006. Shah DH. 2015. V. 11.1371/journal. pestis.12(10):1389–97. population 14 pathogens in food sources in the United States using attribution genetics and diversity among isolates of Salmonella Enteritidis PFGE data from outbreak investigations and expert elicitation. Rhen M. Blondel CJ. Danbara H. Microbiol (Read Engl). Ghelfi J. ity island 2 and phagosomal acidification. J Infect Dis. 2011.281:29131–40. We thank Dr. Salmonella nal colonization of chickens and systemic spread.0004. Desin TS. Addwebi TM. Feasey NA. Anderson BJ. Robinson KS. Davies HM.00579-12. Competing interests 2000. Contreras I. doi:10. Kaiser P.ppat. Swift RV. 24. Received: 29 February 2016 Accepted: 3 April 2016 17.1371/journal. Crump JA. Chaudhuri RR.93:871–81. Contreras I. Sasikaran J. et al. Watson KG. MBio. Michelucci A. Subramaniam Srikumaran for generously providing Genome Res. a assignment of roles for Salmonella Typhimurium genes in intestinal gene encoded in the pigmentation locus. Holden DW. Lee M-J. Proteomic Salmonella enterica serovars Derby and Mbandaka. 2013.151:3957–68. Mooney JP.0055254. Seth-Smith H.1371/journal. 12. Peters SE. virulence factors to intestinal colonization and systemic dissemination in 1-day-old chickens. colonization of food-producing animals. et al. Emerg Infect for Salmonella diarrhea: functional analysis of the microbiota. Proc Natl Acad Sci USA. Xavier MN. Goldmann O.3:549–59. 18. doi:10. Wegner A. Proc Natl Acad Sci. Eriksson-Ygberg S.102(36):12909–14. Hardt W-D. Quail MA. Chau JY.10(5):e1004049. 2008. Vernikos GS. Luckhart S. Hallsworth-Pepin K. 264. 9. Wheatley N. et al. Thompson A. Manes NP. et al. Lam P-KS. AA. White PL. 2005. Comprehensive pestis in interferon gamma-activated macrophages requires ripA. Shah DH. Tallam A.14:365. Schepmoes AA. Immune-responsive gene 1 protein 2014. Schroeder GN. Santiviago CA. Hensel M. McClelland M. 2007. 2011. Microbiol (Read Engl). Comparative genome . Infect Immun. infection via IL-10-mediated alteration of myeloid cell function. Blondel CJ.0025084. et al. pattern JEGX01.7:e1002191.80:839–49. During infection of tion of Salmonella Gallinarum virulence genes in a chicken infection epithelial cells Salmonella enterica serovar Typhimurium undergoes model using PCR-based signature-tagged mutagenesis. Washington State University.ppat. Alvarez SA.6(9):e25084.9:e1003456. 28. Keddy KH. 22. Lyszkowicz E. Medus C. 2001. PLoS Genet. links metabolism to immunity by catalyzing itaconic acid production. Ranking the disease burden of CE. Hoffmann S.pone.135:84–92. PLoS 2010. Bohnhoff M. Zheng J. Malaria parasite infection 20. BMC Genom. the Dis. J Biol Chem. Hapfelmeier S. On the evolutionary history. 14. Bacterial itaconate methylglyoxal detoxification by STM3117-encoded lactoylglutathione degradation promotes pathogenicity. Immunol Rev. Schaltenberg N. 2. Hansen-Wester I. Li C. Pleasance SJ. Gut Pathog (2016) 8:16 Page 11 of 12 Acknowledgements analysis of Salmonella Enteritidis PT4 and Salmonella Gallinarum 287/91 We gratefully acknowledge the technical assistance of Ngan Mai and Zach. Epidemiol Infect. van Diemen PM. 2002–2003. Weinstock GM. Transposon Mutagenesis of 13. Wang C. Bongaerts RJM. Hayward MR. bongori provides insights into the evolution of the Salmonellae. Hudson DL. Grabenstein JP. Pailot A. Wisner ALS. Hautefort I. Poult Sci. 15. Dynamics of growth and dissemination of References Salmonella in vivo. Bliska JB. Salmonella 27. Contribution of Salmonella Enteritidis Elder was supported by Poncin Trust Fellowship. Parker ML. Morris J. 26.8:e55254.47:103–18. Chaudhuri D. Rhen M. 2012. 2012. Pezoa D. Butler BP. RAW264. Chakraborty S. Stevens M. PLoS 21. Porwollik S. Lee J-H. Timme R. 2008. 2013. Long F. 2014.110:7820–5. Cordes T. Woodward MJ. Pujol C. FEMS Microbiol Lett. Pinto BI.7 cells. Dohnkova A. Andrews-Polymenis HL. Biochemical. Proc Natl Acad Sci. Binz T. This project was funded in part with the funds the Agricultural Animal Health 2006. Reiling N.18:1624–37. Jones MA. Pathog. Re-assessment of risk factors that are absent in the genome of serovar Typhimurium. PLoS One. Lucchini S. type III secretion systems. Tsolis RM. Haneda T. Moore MR. Angulo FJ. The authors declare that they have no competing interests.1004049. Davidson S. Mol Microbiol. Microbes Infect. 2005. 7. pathogen’s virulence factors. Gordon MA. Jansen VA. Datsenko KA. J Food Prot. and the host’s mucosal immune response. Keys 30. Stallmach T. Kwon J-T. Silva CA. Blondel CJ. Park J-H. Varma JK. Smallwood HS. Cell Microbiol. Pujol C. et al. for sporadic Salmonella serotype Enteritidis infections: a case-control 2012. Okada N. Ziemski M.1002191. Desai PT. Muller W. Windhorst D. Amaro RE. Unravelling the ary genomics of Salmonella enterica subspecies. Quezada CP. Shah DH. Toro CS.1371/journal. The streptomycin mouse model burden of invasive nontyphoidal Salmonella disease. Microbiol (Read a time-dependent transcriptional adaptation that results in simulta- Engl). doi:10. Wollam A. 10. McClelland M. Mottaz HM. College of Veterinary Medicine. Cheng P. Sanders M. Chim N. 23.74:632–44.

80:4203–15. 2001. 2002. Gaastra W. Complete genome sequence of Sal- 32.com/submit .Elder et al. Gut Pathog (2016) 8:16 Page 12 of 12 invasiveness in human and chicken cells and survival in egg albumen. van der Zeijst BA. 33. Nature. Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries • Our selector tool helps you to find the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research Submit your manuscript at www. Nature. 2012.440(7082):303–7. 34.biomedcentral. Clifton SW. et al. Robust Salmonella metabolism limits possibilities for new antimicrobials. Ballmaier M. Ali J. Meyer TF. Latreille P. McClelland M. van Putten JP. Porwollik S. Zhao Y. Sanderson KE. Courtney L. Bumann D. Selbach M. 2006. monella enterica serovar Typhimurium LT2. Arkesteijn G. Dante M. Infect Immun. Becker D. Mann M. Rollenhagen C. Jansen R. Spieth J. Identification of Genes Affecting Salmonella enterica serovar Enteritidis infection of chicken macrophages.70:5319–21. Infect Immun. Du F.413(6858):852–6.