You are on page 1of 41

5.

ACIDOS NUCLICOS Y GENETICA MOLECULAR

1. COMPOSICIN QUMICA.
2. NUCLEOTIDOS DE INTERS.
3. ESTRUCTURA.
ESTRUCTURA PRIMARIA.
ESTRUCTURA SECUNDARIA.
ESTRUCTURA TERCIARIA.
ESTRUCTURA CUATERNARIA.
4. TIPOS DE ACIDOS NUCLEICOS:
TIPOS DE ADN.
TIPOS DE ARN:
ARN RIBOSMICO.
ARN MENSAJERO.
ARN DE TRANSFERENCIA.
ARN HETEROGNEO NUCLEAR.
5. REPLICACIN DEL ADN.
MECANISMO.
CORRRECCIN DE ERRORES.
TELOMEROS Y TELOMERASA
AGENTES MUTAGNICOS.
6. SINTESIS DE PROTENAS:
TRANSCRIPCIN
TRADUCCIN.
REGULACIN DE LA EXPRESIN GNICA
7. MUTACIONES.
TIPOS.
MUTACIONES Y EVOLUCIN
MUTACIN Y CANCER
8. PROTEOMA Y PROTEOMICA
9. EPIGENOMA HUMANO
10. EJERCICIOS DE SELECTIVIDAD DE BIOLQUMICA

1. COMPOSICIN QUMICA.
Los cidos nucleicos son unas biomolculas fundamentales, ya que en ellas reside la informacin
hereditaria de los seres vivos, aunque no son tan abundantes como las protenas.
Estn formadas por los siguientes bioelementos: C, O, H, N, P.
Se constituyen a partir de unas unidades bsicas, que se repiten y a partir de las cuales se forman las
cadenas de cidos nucleicos, son los NUCLETIDOS.
Vamos a estudiar en primer lugar cul es la estructura qumica de estas unidades.
En la formacin de los nucletidos intervienen tres tipos de sustancias:
1. El cido fosfrico
2. Una pentosa, que puede ser la ribosa o la desoxirribosa, ambas en configuracin.
3. Bases nitrogenadas, que pueden ser de dos tipos:
Timina especfica del
ADN y uracilo
Bases pricas: Adenina, Guanina.
Bases pirimidnicas: Citosina, Timina, Uracilo. especfico del ARN.

Las bases pricas derivan del anillo de purina y las pirimidnicas del anillo de pirimidina.
Se diferencian unas de otras en los grupos funcionales que aparezcan en estos anillos.

66
La pentosa se une a la base nitrogenada mediante un enlace N- glucosdico, entre los siguientes
tomos: en el caso de que sea una base prica entre el C1de la pentosa y el N9 de la base nitrogenada;
cuando es una base pirimidnica entre el C 1de la pentosa y el N 1 de la base nitrogenada, formndose un
NUCLESIDO.

Estos se nombran aadiendo al nombre de la base el sufijo osina, cuando es una base prica y el sufijo
idina, cuando es una base pirimidnica, por ejemplo: adenosina, timidina.
Al nuclesido se le une la molcula de cido fosfrico, mediante un enlace ster- fosfrico,
formndose un NUCLETIDO.
Los nucletidos se nombran aadiendo al nombre del nuclesido, fosfrico, por ejemplo: adenosn fosfato,
timidn fosfato; o bien llamndolos cidos, por ejemplo: cido adenlico, cido timidlico.
Los nucletidos tienen un fuerte carcter cido, debido a su unin con el cido fosfrico, que cuando se
encuentra en disolucin est ionizado, con carga negativa.

2. NUCLEOTIDOS DE INTERS.
Los nucletidos son molculas que tienen una gran importancia biolgica, ya que adems de formar
parte de los cidos nucleicos, llevan a cabo algunas funciones fundamentales en los seres vivos.

Molculas acumuladoras de energa


Existen molculas capaces de acumular energa en ciertos enlaces de manera que pueda ser utilizada con
posterioridad en el momento preciso. Estas molculas son fundamentalmente el ATP (adenosn
trifosfato) y en menor medida el GTP (guanosn trifosfato).
Cuando existe energa disponible una molcula de ADP la emplea en formar un enlace de alta energa (~)
con un tercer grupo fosfato para formar ATP. Este enlace es altamente energtico, lo que quiere decir que
para su formacin se requiere una cantidad considerable de energa (7 kcal/mol) y su rotura liberar
tambin esta energa en su momento.
Por ello, el sistema ADP/ATP constituye una forma de almacenar la energa liberada en reacciones
biolgicas exotrmicas.

Molculas con funcin coenzimtica

67
Como hemos visto al estudiar las vitaminas, ciertos dinucletidos unidos a vitaminas intervienen como
coenzimas en algunas reacciones enzimticas:
Nicotinamn adenn dinucletido (NAD+): es un derivado de la vitamina B3 o nicotinamida. Actan
como deshidrogenasas que participan en el metabolismo oxidativo de glcidos y protenas.
Nicotinamn adenn dinucletido fosfato (NADP+): es igual que el anterior pero fosforilado.
Flavn adenn dinucletido: es un derivado de la riboflavina o vitamina B 2. Son deshidrogenasas que
participan en la respiracin celular.
Adenosn monofosfato cclico (AMPc)
Esta molcula acta como intermediario entre molculas que llegan a la clula desde otros lugares
(hormonas, neurotransmisores) y procesos que deben desencadenarse en su interior, por ello se le
denomina segundo mensajero y es de gran importancia en la respuesta celular.

NAD+ NADH + H+ AMPC

Actividad1:
Escribe un nucletido que forma parte del ADN y otro del ARN qu diferencias hay entre ellos?

Actividad2:
Qu es un enlace fosfodiester? Pon un ejemplo.

Actividad3:
Tiene alguna semejanza el enlace nucleotdico con otros enlaces existentes en algunas molculas?

Actividad4:
Sabras explicar por qu suele denominarse al ATP moneda energtica?

Actividad5:
Por qu los cidos nucleicos tienen carcter cido?

3. ESTRUCTURA
o ESTRUCTURA PRIMARIA

La estructura primaria se corresponde con la unin de nucletidos entre s, para formar una larga
cadena de polinucletidos.
68
La unin se establece entre el OH que ocupa el C3de un nucletido con el OH del cido fosfrico del
nucletido siguiente que se encuentra en la posicin 5, mediante un enlace ster fosfrico, liberndose
una molcula de agua, llamado enlace nucleotdico.
En la estructura primaria, como suceda en las protenas, es muy importante el orden en el que se unen los
nucletidos a lo largo de la cadena, es decir, la SECUENCIA DE NUCLETIDOS.
Si observara una cadena de ADN, por ejemplo, nos daramos cuenta que el esqueleto de la cadena es
siempre igual, es decir, una sucesin de pentosa y cido fosfrico continuamente, y que lo nico que varia
a lo largo de la cadena son las bases nitrogenadas, es por ello que lo que marca las diferentes secuencias
es la disposicin de las diferentes bases a lo largo de la cadena.
Esta estructura primaria es comn tanto para el ADN como para el ARN, una cadena lineal de nucletidos
unidos entre s.

Antes de continuar con el resto de las estructuras vamos a hacer un cuadro con las diferencias entre un
cido nucleico y otro.

CARACTERSTICA ADN ARN


PENTOSA: desoxirribosa PENTOSA: ribosa
COMPOSICIN
BASES: A, G, C, T. BASES: A, G, C, U.
Formado por dos cadenas de Formado por una cadena de
nucletidos. Estructura compleja, nucletidos. Estructura
ESTRUCTURA alcanza hasta la estructura sencilla llega hasta la
cuaternaria terciara, pero de manera
reducida.
Ncleo celular, mitocondrias y Ncleo y citoplasma.
LOCALIZACIN cloroplastos
TAMAO Elevado peso molecular. Bajo peso molecular
Lleva la informacin hereditaria Cumple las rdenes que
FUNCIN de los organismos. dicta el ADN, ya que este no
puede salir del ncleo.

ESTRUCTURA SECUNDARIA.
Esta estructura se alcanza cuando se unen dos cadenas de nucletidos entre s.
Lo hacen de tal manera que se enfrentan dos cadenas de manera antiparalela, una cadena en la direccin
5 3y la otra 3 51, adems las bases se colocan tambin enfrentadas pero de una manera particular,

1
El prima significa que el carbono pertenece a la pentosa.
69
de tal forma que la A se enfrente con la T, y la C se enfrente con la G, cumpliendo el principio de
equivalencia que se resume:

A =T
G=C BASES PRICAS = BASES PIRIMIDNICAS

As, segn el principio de equivalencia, siempre que en una cadena halla una A en la complementaria
habr una T, y siempre que en una halla C en la complementaria habr G; de tal manera que conociendo
la cantidad de una de las bases en la molcula conoceremos la proporcin de las restantes.
Esto se cumple nicamente cuando la molcula conste de dos cadenas de nucletidos.
Entre la Adenina y la Timina se establecen 2 puentes de hidrgeno y entre la Citosina y la Guanina se
establecen 3 puentes de hidrgeno, debido a las atracciones polares que se pueden formar entre estas
bases.
Estos enlaces son los nicos que mantienen unidas las dos cadenas, en toda la molcula de ADN.

Una vez que se ha formado la doble cadena, esta sufre un giro en el espacio adoptando una
configuracin en hlice, que sera la forma ms estable de presentarse en el espacio, descrita por
Watson y Crick2.
Esta hlice puede girar hacia la derecha siendo en este caso dextrgira o puede girar hacia la izquierda,
siendo levgira y denominada Z, ya que adopta una forma en zig- zag, la ms comn es la dextrgira y
plectonmica, es decir como si estuvieran trenzadas, lo cual significa que para desenrollarlas tendran que
girar una con respecto de la otra.
2
Por este descubrimiento les dieron el premio Nobel.
70
Adems los pares de bases pueden presentarse horizontales con respecto al eje de la molcula
denominada forma B o bien inclinados con respecto al eje denominada forma A. Ambas formas son
estables, la forma B cuando la humedad es alta y la A cuando es ms baja.
En una misma cadena de ADN, nos podemos encontrar con los tres modelos, dependiendo de la misin
que realice el ADN, parece por ejemplo que la Z est relacionada con seales especficas en el proceso de
transcripcin y autoduplicacin del cdigo gentico.
Con respecto a la hlice decir que tiene unas medidas determinadas:
Una vuelta de hlice completa mide 34 A 3, el dimetro mide 20 A y la distancia entre un par de bases y el
siguiente mide 3,4 A.
El ADN depositario de la informacin gentica
Durante mucho tiempo se crey que los genes deban ser protenas, puesto que eran mucho ms
complejas y variadas que las sencillas molculas de ADN, compuestas tan solo por cuatro nucletidos
distintos y la teora del tetranucltido (errnea) supona que cualquier regin del ADN era exactamente
igual a otra, por lo que o poda contener genes distintos.
La primera prueba de que los genes estaban formados por ADN procede de los experimentos de
transformacin bacteriana realizados en 1928 por F. Griffith.
Griffith comprob que una cepa bacteriana de Steptococcus pneumoniae que es inocua cuando se inyecta
en ratones, se transforma en virulenta, capaz de provocar la muerte de estos si previamente ha estado en
contacto con bacterias virulentas muertas y destruidas por el calor. Estos cultivos de bacterias destruidas
por el calor contenan un factor transformante (ADN) que transformaban algunas bacterias inocuas en
bacterias virulentas, matando a los ratones inoculados.
En 1952 Alfred Hershey y Martha Chase comprobaron de manera irrefutable que ese material era ADN y
no protenas.
Una vez conocida la naturaleza qumica del gen, el siguiente paso fue descubrir su estructura, para
conocer como estn codificados los mensajes genticos. Maurice Wilkins y Rosalind Franklin demostraron
mediante anlisis cristalogrfico, que el ADN es una molcula muy larga, delgada y helicoidal. E.
Chargaff comprob que la cantidad de adenina era igual a la de timina y la de citosina igual a la de
guanina.
Con toda esta informacin J. Watson y F. Crack publicaron en 1953 el modelo de la doble hlice de ADN
en la revista Nature, que hemos estudiado anteriormente.

Actividad6:
Representa (ayudndote de las frmulas anteriores) un fragmento de ADN con tres nucletidos y seala
sus extremos 5 y 3.

Actividad7:
Qu significa que las cadenas son antiparalelas? A qu se llama extremo 5?

Actividad8:
Si una molcula de ADN posee un 30% de guanina, qu proporcin del resto de bases tendr?

Actividad9:
La elaboracin del modelo de Watson y Crick fue posible gracias a ciertos descubrimientos previos.
cules fueron dichos descubrimientos?.

3
Un nm = 10 9 m.
71
Actividad10:
Compara la estructura qumica de la ribosa y de la desoxirribosa y seala si hay algn detalle diferente que
pueda justificar el hecho de que el ADN pueda adoptar estructuras ms compactas y estables que el ARN.

Activiidad11:
En la purificacin de un fragmento de ADN se ha perdido una porcin de una de las dos hebras quedando
la secuencia de bases nitrogenadas como se indica a continuacin. Completa lo que falta y explica en que
te basas para reconstruirla.
ATTACC.
TAATGGGCCGAATTTGGGCCTTAATAGG

Actividad12:
Si el cido nucleico que se estuviera purificando fuera de ARN podras reconstruir el fragmento de
cadena perdida? Qu datos necesitaras para poderla reconstruir?

ESTRUCTURA TERCIARIA.
La estructura terciaria se adquiere cuando la doble hlice se asocia a protenas con el fin de alcanzar un
nivel mximo de empaquetamiento.
Las protenas a las que se asocia son histonas y protaminas debido al carcter cido del ADN y al
bsico de estas protenas.

Vamos a tratar primero el caso particular de las protaminas: el ADN se asocia a protaminas cuando debe
empaquetarse en la cabeza de los espermatozoides, lo hace porque, estas protenas son muy bsicas y
ms pequeas que las histonas y permite reducir al mnimo el espacio que ocupe el ADN en estas clulas
tan pequeas. La estructura que adquiere es prcticamente una estructura cristalina. Cada especie tiene
sus protaminas.

Veamos ahora como se asocia a las histonas en el ncleo celular (por tanto clulas eucaritas) para dar
lugar a la fibra de cromatina, que es como se encuentra el ADN en el ncleo en interfase, es decir,
cuando no se est dividiendo.
Primero se forma una partcula ms o menos esfrica formada por la unin de 8 histonas denominada
octmero, alrededor del octmero la hlice de ADN da dos vueltas formando lo que se denomina
partcula nuclear, si aadimos a esta partcula nuclear el ADN que lo separa de otra partcula nuclear o
ADN espaciador, tendramos un nucleosoma.
De tal manera que la cadena se convierte en una estructura que tiene el aspecto de un collar de perlas y
que se denomina FIBRA DE CROMATINA DE 10nm en su forma laxa, ya que el dimetro de la cadena al
enrollarse alrededor del octmero a aumentado de 20 A a 100 A a la vez que la cadena se acorta.
A continuacin la partcula nuclear se asocia a otra histona, la denominada H 1, formando lo que se
denomina un cromatosoma, que acortar todava ms la cadena, pero sin modificar su dimetro, formara
la FIBRA DE CROMATINA DE 10 nm en su forma condensada.
A partir de la fibra de cromatina de 10 nm condensada, se produce el siguiente nivel de empaquetamiento,
en el que 6 cromatosomas se enroscan sobre s mismos para formar una estructura en forma de
solenoide, en la que en su eje se sitan las molculas de histona H1, lo que hemos conseguido es una
fibra ms gruesa pero ms corta tambin, que se denomina FIBRA DE CROMATINA DE 30 nm.
En forma de fibra de cromatina de 10 nm y de 30 nm es como se encuentra el ADN cuando el ncleo est
en interfase, formando una mezcla de ambas estructuras, segn las necesidades de sntesis del ADN.

72
El ARN tambin puede formar una estructura en doble cadena, pero complementndose las bases dentro
de la propia cadena, formando bucles y tambin puede asociarse a histonas, pero en cualquier caso,
siempre partiendo de que est formado por una sola hebra de nucletidos.

ESTRUCTURA CUATERNARIA
Esta estructura la alcanza el ADN cuando debe llegar a formar los cromosomas para comenzar la
divisin celular, para ello debe empaquetarse hasta unos niveles muy superiores.
Veamos como lo consigue:
La fibra en solenoide se enrosca formando una especie de lazo que se denomina bucle, estos bucles se
agrupan aproximadamente en nmero de 5 6 para formar una roseta, las rosetas se enroscan
nuevamente para formar un rodillo y ya una sucesin de rodillos nos daran un cromosoma.
El empaquetamiento es mximo, deshidratndose la molcula y condensndose de tal manera que
pasamos de tener que observarla al microscopio electrnico a observarla al microscopio ptico.
Los pasos seran resumidos como sigue:

BUCLES ROSETA RODILLO CROMOSOMA

Para que esta estructura se mantenga unida y organizada colaboran distintos tipos de protenas, muchas
de ellas todava sin describir.

DESNATURALIZACIN DEL ADN


Cuando el ADN se somete a una temperatura de 100 C se separan sus dos cadenas y se
desnaturaliza.
Cuando se le somete a un cambio brusco de pH se rompen los puentes de hidrogeno.
Se denomina T de fusin (Tm) a aquella en que el 50% de la doble hlice est separada.
La T de fusin depende de la composicin de bases del ADN, puesto que las molculas ricas en parejas
de G- C poseen un valor ms elevado, ya que su unin se realiza mediante 3 puentes de hidrogeno y la
unin de T- A se hace mediante 2 puentes de hidrogeno, se necesita por tanta ms energa para romper la
unin C-G.

73
Si una solucin de ADN desnaturalizada se enfra lentamente puede renaturalizarse la doble hlice o parte
de ella, al reunirse las cadenas. Esta posibilidad permite formar hbridos de ADN, al enfriar lentamente
mezclas de los ADN desnaturalizados de distintas especies; Esto se ha aplicado al estudio de la similitud
gentica entre diferentes grupos taxonmicos, por ejemplo el ratn y el ser humano tienen un 25% de
semejanzas.

ADN DE BACTERIAS
Su ADN es una doble hlice circular y la dificultad se encuentra en cmo empaquetar una macromolcula
tan larga en un espacio tan reducido, ya que el ADN llega a medir un milmetro y la bacteria mide una
micra4.
La solucin se encuentra en generar torsiones en la doble hlice, que responde a la tensin mediante el
superenrrollamiento; es decir, el cromosoma bacteriano se pliega como una superhlice en forma de
ochos y da lugar a una serie de bucles que le permiten ocupar un espacio mnimo.

4. TIPOS DE ACIDOS NUCLICOS


TIPOS DE ADN
Aunque el modelo de doble hlice bicatenario y lineal es el ms frecuente, siendo exclusivo de las clulas
eucariotas y presentndose tambin en muchos virus, existen otros tipos moleculares:

ADN BICATENARIO CIRCULAR: cuya doble hlice se cierra en anillo. Lo presentan las bacterias y se
halla tambin en mitocondrias y cloroplastos de las clulas eucariotas.
ADN MONOCATENARIO: es el formado por una sola hebra de nucletidos. Es muy raro y solo ha sido
descubierto en algn tipo de virus bacteriofagos, tanto en su forma lineal como circular.

TIPOS DE ARN
El ARN adems de las bases citadas puede tener otras, como bases metiladas: metilguanina, metilcitosina
o derivados de bases como la seudouridina o la inosina.
Aunque posee una cadena sencilla, forma lazos o bucles, que resultan del apareamiento de bases
complementarias dentro de la misma cadena, dando as zonas de doble hlice, tambin puede asociarse a
protenas formando entonces una estructura terciaria.

ARN MENSAJERO

Su misin es la de transmitir el mensaje gentico recibido del ADN, ya que el ADN est recluido en el
ncleo de donde no puede salir y ese mensaje gentico tiene que ser expresado en los ribosomas que
estn en el citoplasma, de tal manera que se necesita una molcula que acte como intermediario.
Su vida media es corta.

4
Micra = 10-6 m
74
En procariotas el extremo 5 posee un grupo trifosfato.
En eucariontes en el extremo 5 posee un grupo metil-
guanosina unido al trifosfato, y el extremo 3 posee una
cola de poli-A.

En los eucariontes se puede distinguir tambin los


exones, secuencias de bases que codifican protenas y
los intrones, secuencias sin informacin. Un ARNm de
este tipo ha de madurar (eliminacin de intrones) antes
de hacerse funcional. Antes de madurar, el ARNm recibe
el nombre de ARN heterogneo nuclear (ARNhn ).

El mensaje gentico viene expresado por la secuencia de bases en el ADN y para pasar la informacin al
ARNm se sintetiza una molcula complementaria en sus bases a un fragmento del ADN que contenga
informacin para sintetizar una protena, lo que denominamos GEN, de tal manera que:

CMO ADN - A- C- EL
SE INTERPRETA G- CDIGO
G- T- A-GENTICO?
A- G- C- T- T-
En la dcada de los 40, tras las investigaciones llevadas a cabo por Beadle y Tatum en el hongo
ARN - U- G- C- C- A- U- U- C- G- A- A-
Neurospora crassa, demostraron que la mutacin de un gen provoca la prdida de la actividad de una
enzima necesaria para la sntesis de un producto. Despus de numerosos trabajos enunciaron la
hiptesis un gen- una enzima: cada gen controla una enzima y por lo tanto, es responsable de una
reaccin bioqumica que, a su vez controla una funcin metablica; puesto que una enzima puede estar
formada por varias protenas, el concepto se ampli a un gen-una protena.
Esta relacin un gen-una protena qued establecida definitivamente cunado se descubri la clave que
relaciona la secuencia de nucletidos del ARNm, transcrito del gen correspondiente, con la secuencia de
aminocidos de la protena. Esto se pudo realizar gracias al descubrimiento- como veremos a
continuacin- por parte de Severo Ochoa de la enzima polinucletido fosforilasa y los trabajos en los
aos 60 de los equipos de Severo Ochoa, Khorana y otros.
Con todo ello se lleg a la conclusin que veremos, de que los aminocidos estn codificados por tres
letras (nucletidos) que reciben el nombre de tripletes o codones en el ARNm, establecindose la
correlacin entre estos y los aminocidos en le cdigo gentico.
Cmo se interpreta entonces el cdigo gentico es decir como se lee el mensaje contenido en el ADN y
por extensin en el ARN, o es decir, como se relaciona la secuencia de bases en el ADN con la
secuencia de aminocidos en la protena.
Podramos pensar que a cada tipo de base le correspondera un aminocido distinto, en este caso solo
podramos formar protenas formadas por aminocidos distintos y como sabemos las protenas se forman
a partir de 20 aminocidos diferentes, podramos pensar tal vez que las bases se leen tomndolas de dos
en dos, en este caso tendramos combinaciones de cuatro bases tomadas de dos en dos es decir, 4 2 = 16,
todava nos faltaran 4 aminocidos. En realidad se hacen combinaciones de las cuatro bases tomadas de
tres en tres, es decir, 43= 64, a estas unidades de tres bases se las denomina CODONES O TRIPLETES
de esta manera tenemos los 20 aminocidos diferentes y nos sobraran bastantes, de tal manera que un
mismo aminocidos puede ser codificado por varios codones distintos, de tal forma que al cdigo gentico
se le denomina degenerado.
El descifrado del cdigo gentico lo comenz Severo Ochoa gracias al descubrimiento de una enzima,
la polinucletido fosforilasa, que era capaz de tomar nucletidos y unirlos sin necesidad de tener una
molcula molde de la cual copiar, utiliz para sus experimentos ribonucletidos para formar ARN, ya que
son molculas ms manejables, comenz colocando en la mezcla un solo tipo de nucletido, por ejemplo
U, de tal manera que se formara una larga cadena formada solo por U y luego expresando esta molcula
obtuvo una cadena de protenas formada solo por un tipo de aminocidos, de esta forma dedujo que el
triplete UUU se corresponde con el aa fenilalanina, el poli A daba un polipeptido de lisina (AAA), el poli C
daba un polipeptido de prolina (CCC).
El siguiente paso fue sintetizar ARN a partir de mezclas de 2 ribonucletidos en cantidades variables, lo
que permiti aclarar algunos codones ms, pero el descifrado completo se realiz sintetizando pequeos
ARN de 3 ribonucletidos, que se unan espontneamente al ribosoma. Comprobando con aa marcados
radiactivamente cual de ellos se una al ribosoma se complet el descifrado.
75
De tal manera que el cdigo gentico consta de 64 codones, en el cual los aa vienen codificados por varios
codones excepto la metionina (AUG) y el triptfano (UGG) que vienen codificados por un solo codn.

ARN A- U- G- C- C- U- G- A- A- U- U- C- G- -

Codn 1 codn 2 codn 3 .......

Aa1 Aa2 Aa3 .......

Metionina Prolina Glutamato ..........

CARACTERSTICAS DEL CDIGO GENTICO

Es un cdigo universal, ya que todos los seres vivos


se rigen por el mismo (salvo en el ADN mitocondrial,
en donde el codn UGA da triptfano en lugar de ser
mudo y AUA da metionina en lugar de dar isoleucina)
y no es ambiguo, ya que cada codn significa
siempre el mismo aminocido.
Todas las combinaciones de tripletes o codones
tienen sentido, se leen siempre de izquierda a
derecha (5 3). El cdigo gentico carece de
solapamientos, es decir, los tripletes se colocan uno
a continuacin de otro y no comparten ninguna base;
y adems es unidireccional.
Adems el cdigo es degenerado, ya que, hay
distintos codones que se corresponden con el mismo
aminocido, esto es debido a lo que se denomina el
balanceo de la tercera base en el anticodon del ARNt
que puede ser defectuoso siendo estricto el
apareamiento solo de las dos primeras bases.

ARN DE TRANSFERENCIA
Tiene tambin una sola hebra pero adquiere estructura secundaria por la formacin de puentes de
hidrgeno entre las bases complementarias formando bucles y asas, presenta as mismo entre 7 a 15
bases poco comunes, como pseudouracilo o Timina.
La misin es la de transportar los aminocidos en el citoplasma hasta los ribosomas, colocndolos como
indique el ARNm.
Cada aa tiene un ARNt especfico que se une por medio de un enlace ster en el extremo 3 a su grupo
hidroxilo terminal.
En su extremo 3 hay una secuencia de bases constante, en esta se une el aminocido fosforilado: CCA.

76
Tiene un brazo, en donde aparecen tres bases,
denominadas ANTICODN, que son
complementarias de un codn del ARNm y el
anticodn se corresponde con un aminocidos
especfico situado en el mismo ARNt.
El bucle D, es el lugar de unin con la enzima
aminoacil-ARNt-sintetasa, que reconoce al
aminocido especfico.
El bucle TC, es el sitio de unin al ribosoma.
El brazo aceptor, formado por los extremos 3 y 5,
es el lugar de unin del aminocido, al grupo OH de
la secuencia CCA del extremo 3

De esta manera los aminocidos pueden ser llevados y colocados en el orden preciso que marca el ARNm.

ADN A G A C T T G C A - ......
ARNM U C U G A A C G U - .......

Ser Glu

ARN RIBOSOMICO
Son molculas de diferentes tamaos, con estructura secundaria y terciaria en algunas regiones de su
molcula, que forman las subunidades de los ribosomas. Es el ms abundante en la clula.

ARN NUCLEAR
Se encuentra en el ncleo. Es el precursor de los ARNr, en los que se transforma despus de eliminar
secuencias no codificantes y romperse en molculas ms pequeas.

Actividad13:
Cul es la funcin del ARN mensajero? y del ARN de transferencia?

Actividad14:
Si comparas la sntesis de protenas con la construccin de un edificio qu tipo de ARN representara el
papel del arquitecto? y el del albail que coloca los ladrillos que levantan la pared? qu molcula se
correspondera con los ladrillos?

Actividad15.
Esta molcula representa un esquema del ARNt:
a) Identifica los extremos 3 y 5 .
b) a qu codn se unir?
c) Qu aminocido transportar? (utiliza el
cdigo gentico)

77
Actividad16:

Teniendo en cuenta las diferencias entre el ADN y el ARN qu nucletido ser ms abundante en la
clula UTP o dTTP? y el dUTP y TTP?

Actividad17:
Qu modalidad de ARN presenta las molculas ms grandes? Y las ms pequeas?

Activiadad18:
Qu modalidad se caracteriza por no presentar a penas regiones con bases apareadas? y con bases
atpicas?

Actividad19:
En la purificacin de unas molculas de ARNt se obtiene un fragmento cuya secuencia de bases es la
siguiente:
AUACGCUAUCAGA
UAUGCGAUAGUCU
Puede encontrarse en ese fragmento la secuencia del anticodn? Razona tu respuesta.

Actividad20:
Qu crees que ser ms fcil, separar las dos hebras de una molcula de ADN o separar los nucletidos
que componen cada hebra. Razona tu respuesta.

Actividad21:
La temperatura a la cual se separan las dos hebras de ADN se denomina punto de fusin. Tendr el
mismo punto de fusin un ADN en el que predomina la base guanina que otro ADN donde hay abundante
adenina? Razona tu respuesta.

Actividad22:
Observa las dos siguientes secuencias de bases de fragmentos de ADN. Intenta construir un fragmento de
ADN hbrido, uniendo con una raya las bases que establezcan puentes de hidrgeno entre ellas.
ATTTACGCGGCTGCATT ATTAACGCGGCAGGCTT
TAAATGCGCCGACGTAA TAATTGCGCCGTCCGAA

78
5. REPLICACIN DEL ADN

MECANISMO
Nombremos en primer lugar las hiptesis que han intentado explicar cmo se duplica o replica el ADN:
Hiptesis dispersiva: la molcula de ADN se fragmenta, se replica cada fragmento y se renen de
nuevo para dar una molcula que sera una mezcla.
Hiptesis conservativa: de cada una de las hebras del ADN se copia una cadena nueva y
posteriormente las dos hebras originales se renen de nuevo y las dos hebras nuevas se unen.
Hiptesis semiconservativa: de cada una de las dos hebras originales se copia una nueva y
posteriormente se unirn una hebra original con una copia. Esta es la forma correcta.

MODELO DE REPLICACIN IN VIVO DEL ADN.

La enzima que lleva a cabo la replicacin del ADN es la ADN POLIMERASA, esta enzima tiene unos
requerimientos especficos para trabajar, que le imponen restricciones:
Solo aade nucletidos en la direccin 5 3.
Necesita para poder a empezar a copiar y unir nucletidos un molde de ADN al cual copiar.
Necesita un pequeo trocito de ARN al cual unir los nucletidos, ella no puede empezar a unir los
nucletidos sin tener ya una pequea cadena ya formada.
Utiliza nucletidos trifosfato.

Sabiendo estas necesidades de la enzima y sabiendo tambin que la molcula de ADN est formada por
dos hebras antiparalelas, se plantea un problema en la cadena del ADN que va en la direccin 5 3
porque aqu la enzima estara trabajando en la direccin contraria, y sin embargo las dos hebras se
observa que se van replicando.
Este problema se solucion gracias a un investigador llamado Okazaki, que descubri unos pequeos
fragmentos de uno 1000 a 2000 nucletidos, en los que se detectaban unos pocos ribonucletidos, as se
poda explicar como se copia esta cadena, siendo de forma discontinua en la direccin 5 3y la otra
cadena de forma contina, y tambin quedaba solucionado el problema de que la enzima necesitara una
cadena de ARN a la cual unir los nucletidos. A estas pequeas cadenas se las denomina fragmentos de
Okazaki.

Veamos ahora como se lleva a cabo el proceso:


Las cadenas del ADN estn unidas por puentes de hidrgeno, que debemos romper para facilitar la
separacin de las cadenas para ser copiadas, esta separacin la lleva a cabo las enzimas HELICASAS,
tambin sabemos que la molcula de ADN est girada en hlice y debe deshacerse, la eliminacin del giro
lo llevan a cabo las enzimas TOPOISOMERASAS, por ltimo para evitar que las dos hebras vuelvas a
reunirse y formar los puentes de hidrgeno se colocan unas protenas llamadas SSB, que estabilizan las
cadenas sencillas.
Una vez que las cadenas estn separadas, se puede empezar el copiado:
1. La enzima ARN POLIMARASA sintetiza la pequea cadena de ARN que le va a servir de cebador a la
ADN polimerasa III, denominamos a la cadenita PRIMER.
2. La ADN POLIMERASA III utilizando como primer dicho fragmento llamado primer, va alargando la
cadena aadiendo nucletidos que se encuentran fosforilados. La cadena se sintetiza en el sentido que se
abre la horquilla de replicacin, lo hace de forma continua. En la cadena complementaria se sintetizar un
fragmento de Okazaki.
79
3. A continuacin interviene la ADN POLIMERASA I, que degrada el fragmento de ARN y rellena el hueco
colocando desoxirribonucletidos.
4. Finalmente la ADN LIGASA unir los dos extremos, tanto en la cadena continua como los sucesivos
fragmentos de Okzaki que se van formando, en la cadena discontinua.

Cuando se observa como se produce la replicacin se ve que la cadena continua va ms rpida que la
discontinua, esto es debido a que cada vez que se forma un fragmento de Okazaki hay que realizar todo
este proceso como si se comenzara la sntesis de nuevo cada vez, formando el primer y todo el resto de
pasos y sin embargo en la continua solo se realizar una vez.
Hebra continua
HORQUILLA DE REPLICACIN Direccin de la replicacin
Fragm. De Okazaki

5 3

5
3 3 5

80
REPLICACIN EN EUCARIOTAS

Es similar a la de los procariontes, es decir, semiconservativa y


bidireccional. Existe una hebra conductora y una hebra retardada
con fragmentos de Okazaki. Se inicia en la burbujas de
replicacin (puede haber unas 100 a la vez). Intervienen enzimas
similares a los que actan en las clulas procariontes y otros
enzimas que han de duplicar las histonas que forman parte de los
nucleosomas. Los nucleosomas viejos permanecen en la hebra
conductora.

CORRECIN DE ERRORES

81
La actividad de la ADN polimerasa debe ser exacta, rpida y fiel, pues
la vida entera y su continuidad de generacin en generacin dependen de la exactitud y precisin con que
se transmite la informacin, es decir, de la fidelidad de la duplicacin del ADN.
La seleccin de los nucletidos por la ADN pol. Y su actividad autocorrectora, constituyen mecanismos
de prevencin de errores, pero, an as, se comete un error de apareamiento por cada 10 millones de
bases.
Esta precisin podra resultar suficiente para una bacteria, cuyo genoma contiene 3 millones de pares de
bases, pero resulta insuficiente para el genoma humano que contiene 3. 10 9 pares de bases.
Un error por cada diez millones de bases supondra 300 equivocaciones en cada duplicacin del ADN
humano, y teniendo en cuenta que durante el desarrollo embrionario a partir del zigoto el genoma humano
se duplica casi mil billones de veces, se producira una acumulacin de trescientos mil billones de errores,
lo que evidentemente, es incompatible con la vida, pues la informacin inicial pronto se perdera como
consecuencia de las divisiones celulares.
Por ello, para aumentar todava ms la precisin de la duplicacin, existe una maquinaria enzimtica que
corrige los posibles errores cometidos por el ADN pol en ADN recin sintetizados (correccin
postreplicativa), con lo que la exactitud de la rplica alcanza la increble perfeccin de un error por cada
diez mil millones de bases (1010). Esta correccin se realiza por medio de un conjunto de enzimas
agrupados en un complejo multienzimtico que detecta el nucletido mal emparejado, lo elimina y regenera
la secuencia correcta, del siguiente modo:

Para detectar el nucletido mal emparejado, el aparato de correccin debe reconocer la cadena
recin sintetizada, donde se encuentra el error y diferenciarla de la cadena molde. Ambas cadenas son
complementarias, pero mientras que la cadena molde tiene metiladas las adeninas de las
secuencias GATC, existe un lapso de tiempo durante el cual las adeninas de estas secuencias en la
cadena rplica permanecen sin metilar, y es en este intervalo cuando acta el complejo
multienzimtico y detecta los posibles errores.
La eliminacin se realiza mediante una endonucleasa que corta el segmento en el lugar donde se
encuentra el error.
Por ltimo, la secuencia correcta se regenera cuando la ADN pol I rellena el hueco utilizando como
molde la cadena original, y por ltimo una ligasa unir los fragmentos.

TELOMEROS Y TELOMERASA
Los cromosomas eucariotas son lineales y tienen en sus extremos unas regiones denominadas
telmeros, con secuencias repetitivas del tipo, TTAGGGTTAGGG cuando se replica el ADN lineal, los
extremos 5 de los telmeros, no se pueden replicar, ya que cuando se eliminan los cebadores o primer del
extremo 5 de cada una de las hebras recin sintetizadas, el hueco que queda no puede ser rellenado por
la enzima ADN polimerasa, ya que no encuentra extremos hidroxilos 3 libres sobre los que aadir
nucletidos.
Esto implica que a medida que una molcula de ADN se replica, se va acortando, hasta llegar a una
cantidad crtica. Esta prdida deja al descubierto los extremos de los cromosomas que se unen unos a
otros y produce la imposibilidad de la replicacin. Este acortamiento de los telmeros est relacionado con
el envejecimiento celular y la muerte programada o apoptsis de las clulas.

El acortamiento de los telmeros puede se remediado mediante una enzima, la telomerasa, que repara
este dao y hace a las clulas inmortales, es el caso de las clulas embrionarias y las tumorales.
La telomerasa en una ribonucleoprotena que acta como transcriptasa inversa, ya que tiene una hebra
de ARN con la secuencia apropiada para actuar como molde para la sntesis de la secuencia telomrica de
ADN que se aade en los extremos 3 de cada cromosoma para evitar su acortamiento en cada proceso de
replicacin.

82
Actividad23:
Los investigadores George Beadle y Edgard Tatum sometieron esporas de del moho rojo Neurospora
crassa a la accin de rayos X. Posteriormente comprobaron que en algunos casos, los mohos procedentes
de esas esporas irradiadas no eran capaces de desarrollarse en el medio de cultivo habitual si no
agregaba a dicho medio un aminocido determinado, el cual era distinto segn los casos:
a) Qu efecto tuvieron los rayos X sobre la espora del hongo?
b) A qu crees que se debe el hecho de que algunos mohos no pudieran crecer en el medio de cultivo
habitual?
c) Por qu crecen bien cuando se suplementan el medio de cultivo con el aminocido?
d) qu se demostr con este experimento?

Actividad25:
Cules son los pasos por medio de los que Griffith demostr la existencia de una sustancia que despus
se llam factor transformante?

Actividad26:
Describe la hiptesis semiconservativa de la replicacin del ADN.

Actividad27:
El siguiente esquema representa un proceso llevado a cabo en una bacteria:
a) De qu proceso se trata?
b) qu errores pueden
apreciarse en este
esquema?
c) compltalo aadiendo lo
que falta.
d) sera correcto el
esquema si se tratara de una
clula eucariota? Por qu? 83
Actividad28:
Seala en el dibujo de la burbuja de replicacin los extremos 3 y 5 de cada cadena de nucletidos e
indica la cadena adelantada y la cadena retardada. Qu diferencia hay entre una burbuja y una horquilla
de replicacin?

Actividad29:
A qu se llama ARN cebador o primer? Cmo se sintetiza? Qu son los fragmentos de Okazaki?

Actividad30:
Cules son las enzimas que estn implicadas en la replicacin del ADN?

Actividad31:
Escribe la secuencia de una cadena con la que, mediante las reglas de la complementariedad, podra
formar una doble hlice el segmento de ADN indicado. Sera contina o discontinua su sntesis? Razona
tu respuesta.
5 ATTCTTGGCATTCGC 3

Actividad32:
Describe las caractersticas y la importancia del cdigo gentico, as como el contexto histrico y los
autores que contribuyeron a descifrarlo.

AGENTES MUTAGNICOS
El ADN es un compuesto que se encuentra sometido continuamente a las agresiones de sustancias
qumicas, tanto de nuestro propio metabolismo como del exterior. Tambin agentes fsicos alteran el ADN.

Efecto de la temperatura:
Las clulas humanas por el mero hecho de encontrarse a 37C, pierden diariamente y de forma
espontnea una 5.000 bases pricas (A y G) en un proceso denominado despurinizacin, por rotura del
enlace N- glucosdico.

84
Radiacin ultravioleta procedente del sol:
Esta radiacin induce la formacin de enlaces covalentes
entre dos bases pirimidnicas sucesivas en la misma
cadena, lo que da lugar a los dmeros de Timina y de
citosina; como consecuencia de ello se rompen los puentes
de hidrogeno que mantenan con sus correspondientes
bases complementarias y la doble hlice se desorganiza
alrededor de los dmeros.
Estos dmeros pueden repararse fotoqumicamente, pues
las clulas poseen unas enzimas que pueden activarse por
la accin de la luz ultravioleta. Los enfermos de xerodermia
pigmentosum, que produce un escoriamiento de la piel al
contacto con la luz, no tienen esta enzima que repara los
dmeros de Timina.

Metabolitos reactivos:
Algunos residuos del metabolismo, sobre todo los radicales libres derivados del oxgeno, son
compuestos altamente reactivos y capaces de inducir lesiones en el ADN.

Radiaciones ionizantes:
Se conoce con este nombre a determinadas radiaciones electromagnticas de longitud de onda muy corta
y por ello altamente energticas, como los rayos , los rayos X y los flujos de neutrones y protones
originados en los reactores nucleares, que al colisionar con los tomos y las molculas que encuentran en
su camino, los transforman en iones y radicales muy reactivos, capaces de atacar a numerosas molculas
de las clulas, entre ellas al ADN, produciendo rotura de sus cadenas.

Las consecuencias derivadas de su accin dependen de la intensidad y el tiempo de exposicin a la


radiacin, pues sus efectos son acumulativos; si esta es muy intensa llegan a romperse los cromosomas y
se produce la muerte de las clulas.
Son ms sensibles las clulas que se encuentran en divisin que las que no se dividen; por ello cuando se
aplica radioterapia en el tratamiento contra el cncer, la radiacin destruye preferentemente a las clulas
cancerosas, que estn continuamente dividindose, y deja intactas las restantes clulas del organismo.
S la radiacin afecta a una mujer embarazada, se producen mutaciones en el ADN del feto que pueden
ocasionar la aparicin de malformaciones en el recin nacido, de ah que nunca se utilicen rayos X como
mtodo de exploracin en las mujeres gestantes.

Radiacin corpuscular: partculas y .


Estas partculas se emiten en los procesos de desintegracin de istopos radiactivos, y sus efectos sobre
el ADN son similares a los producidos por las radiaciones o los rayos X, que ocasionan la rotura de las
cadenas de ADN.
El caso ms grave sucedido ltimamente es del accidente nuclear de Chernobyl.

Sustancias qumicas:
Constituyen una autentica legin de sustancias habitualmente utilizadas y que nos rodean.
El benzopireno y otros hidrocarburos policiclicos, que son molculas planas que al intercalarse entre
los pares de bases establecen puentes, mediante enlaces covalentes, entre las dos hebras del ADN; el
cido nitroso, que provoca la desaminacin de la citosina y la adenina; los agentes alquilantes (gas
mostaza), que introducen grupos alquilo (metilo, etilo) en las bases del ADN y alteran la replicacin.
Como la mayora de estos agentes mutagnicos favorecen el desarrollo de tumores carcinognicos.

6. SNTESIS DE PROTENAS: EXPRESIN DEL CDIGO GENTICO

La informacin gentica del ADN debe descodificarse para poder ser utilizada por la clula, ya que el ADN
como tal tiene una escasa accin sobre el funcionamiento de los organismos, por ejemplo, el gen 5de la
hemoglobina no puede llevar oxgeno, lo hace la protena que se sintetiza a partir de dicho gen.
No todos los genes almacenan informacin para sintetizar protenas, algunos se transcriben para dar lugar
a molculas como el ARNr o el ARNt que colaboran en la sntesis de protenas.

5
Gen: recuerda que es la secuencia de ADN que contiene informacin para sintetizar una protena.
85
Los avances en las distintas ramas de la biologa y de los distintos tipos de ARN, permitieron a Francis
Crack enunciar en 1970 el denominado dogma central de la Biologa molecular, hoy perfectamente
demostrado y completado hasta el esquema que aparece a continuacin:

Los genes estructurales son los que formarn protenas y son los nicos que se transcriben y se
traducen, produciendo ARNm. Existen genes que se transcriben pero no se traducen, que darn lugar a
molculas de ARNr y ARNt. As mismo existen genes reguladores, que ni se transcriben ni se traducen,
que actan como signos de puntuacin en la expresin gnica.

La expresin del cdigo es universal, es decir, igual para todos los seres vivos, pero existen algunas
diferencias entre las clulas eucariotas y procariotas:
El ADN en procariotas es de fcil acceso para la transcripcin, mientras que en eucariotas est
asociado a histonas para formar la cromatina y debe desempaquetarse para acceder a l, por lo tanto
es de difcil acceso.
En procariotas hay un solo tipo de ARN polimerasa para sintetizar cualquier tipo de ARN; en eucariotas
existen tres tipos: ARN pol I para ARNr , ARN pol II para ARNm, y ARN pol III para ARNt.
Los organismos procariotas tienen un ADN desnudo disperso en el protoplasma celular de tal
manera que la transcripcin y la traduccin tienen lugar seguidas y en el mismo sitio.
Los organismos eucariotas tienen el ADN en el ncleo y el lugar de sntesis en el citoplasma, de tal
manera que, la transcripcin tiene lugar en el ncleo y despus en el citoplasma sucede la traduccin.
Los genes en procariotas llevan informacin para ms de una protena, policistrnicos y en eucariotas,
llevaninformacin para una sola protena, monocistrnicos.

Los genes en procariotas son unidades continuas, es decir, un segmento de ADN contiene toda la
informacin para la sntesis de una protena; sin embargo en los eucariotas, los genes se encuentran
fragmentados: cada gen consta de segmentos con informacin llamados exones y segmentos sin
informacin llamados intrones.
Adems tanto en los eucariotas como en procariotas hay secuencias que no se traducen pero que
desempean un papel fundamental en la regulacin de la expresin gnica, ya que constituyen seales
de inicio y final de un gen.

TRANSCRIPCIN
En el proceso de transcripcin se forma una cadena de ARN cuya secuencia de bases nitrogenadas es
complementaria a una de las hebras de ADN.
Este proceso lo realiza una ARN polimerasa, que tiene los siguientes requerimientos:
o Une nucletidos mediante enlace fosfodiester, en sentido 5 3, es decir los nucletidos
se van aadiendo uno a uno en el extremo 3 de la cadena en crecimiento.
o Utiliza nucletidos trifosfato.
o Se fija a regiones especficas del ADN, llamadas regiones promotoras, para comenzar su
accin a partir de ese punto.
86
o Necesitan un molcula de ADN que utilizar como molde para realizar la sntesis de ARN,
formando una molcula de ARN cuyas bases sern complementarias a dicha hebra del ADN,
siempre la hebra en direccin 3 5, denominada hebra molde (a la otra, 5 3 se
denomina hebra informativa).
El proceso es similar en clulas procariotas y eucariotas, aunque existen diferencias entre ambas.

Transcripcin en procariotas
En las clulas procariotas existe una nica ARN polimerasa. Esta, para poder reconocer la secuencia
promotora del ADN, donde debe fijarse y comenzar la transcripcin tiene que unirse al factor sigma (),
tras lo cual cambia de conformacin y puede unirse a la regin promotora, una secuencia rica en bases de
T y A (TATAATG). Una vez realizada la unin el factor se separa, listo para volver a comenzar.
La ARN polimerasa fijada en el ADN produce el desenrollamiento de una vuelta del la hlice y comienza la
sntesis del ARN en direccin 5 3.
La sntesis termina cuando la polimerasa llega a una zona del ADN denominada seal de terminacin,
que tiene una secuencia rica en G y C. en esta fase interviene el factor rho () una enzima con actividad
ATPasica, que reconoce esta secuencia.
Este proceso sucede en los procariotas en el citoplasma, y una vez formado este ARNm puede de
manera inmediata comenzar la siguiente fase de traduccin, de hecho antes de que termine la
transcripcin puede comenzar la traduccin, ya que este no necesita maduracin y el compartimento de
sntesis es el mismo.

Transcripcin en eucariotas

Las ARN polimerasas o ARN pol en eucariotas son de estructura compleja y se han descrito 3 tipos
fundamentales:
ARN POL I que sintetiza el ARNr.
ARN POL II que sintetiza el ARNm.
ARN POL III que sintetiza el ARNt, las histonas y otras funciones.

En el proceso de transcripcin en eucariotas existen algunas diferencias con procariotas:


El proceso tiene lugar en el ncleo, incluida la maduracin posterior del ARNm.
Para la sntesis del ARN es necesario que el ADN este desespiralizado y que las histonas no
bloqueen el acceso de las enzimas.
Existe al igual que en procariotas una regin promotora, con dos tipos, la llamada caja TATA (o de
Hogness) y la CAAT. Junto a estas existen otra serie de secuencias que ayudan en el proceso de
transcripcin. As mismo, existe una regin que indica el final de la transcripcin, (TTATTT).
En lugar del factor sigma, existen otros factores que ayudan a la localizacin y unin de la enzima al
promotor, denominadas factores basales.
La ARN polimerasa procariota no requiere factores de transcripcin. Las eucariotas requieren la
presencia de factores de transcripcin basales y su actividad es regulada por factores de transcripcin
especficos.

87
Durante y despus de la transcripcin, los ARNm deben sufrir modificaciones para ser funcionales, se
denomina maduracin:
o Cuando se han unido 30 ribonucletidos, se aade al extremo 5 una caperuza de 7-metil-
guanosina trifosfato, que protege al ARNm de su degradacin y es lugar de reconocimiento para
el inicio de la traduccin.
o En el extremo 3 del ARN recin sintetizado, se une una cadena de 200 nucletidos de A,
llamada cola de poli-A, formada por la enzima poli-A polimerasa. Interviene en la maduracin
posterior y en su transporte desde el ncleo.
o Se debe producir la eliminacin de los intrones y la posterior unin de los exones. En este
proceso intervienen un conjunto de ribonucleoprotenas pequeas nucleares (RNPpn),
llamadas en conjunto, espliceosoma. Puede darse la unin de los exones consecutivos como
se encontraban en el gen, o hacerlo en una ordenacin alternativa. As mismo, puede
producirse la eliminacin o introduccin de bases, o transformacin de unas bases en otras.
Todo ello produce una amplificacin de la expresin gnica, ya que un solo gen puede dar
lugar a protenas distintas segn la maduracin post-transcripcional que se lleve a cabo.

RETROTRANSCRIPCIN O TRANSCRIPCIN INVERSA

Se crea que no se poda violar el dogma central de la biologa molecular y que por tanto la informacin
solo flua desde el ADN, pero se descubri que los virus de ARN, como el SIDA, pueden producir ADN
polimerasa dependiente de ARN, llamada transcriptasa inversa o retrotranscriptasa, y es capaz de
sintetizar una cadena de ADN complementaria del ARN vrico.
Otra modificacin del dogma central fue el descubrimiento de ciertos pequeos virus de ARN que pueden
autorreplicar su ARN, segn lo cual el ARN puede actuar de molde y sintetizar otra molcula idntica a l.

SIDA

El Virus La envoltura es una bicapa lipdica derivada de la clula


El Virus de la Inmunodeficiencia Humana es el agente
huspedetiolgico
donde se del Sndrome
insertan de la Inmunodeficiencia
las glucoproteinas con 72
Adquirida (SIDA). El VIH est clasificado en la familia Retroviridae
proyecciones externas.y Contiene
pertenece lasaprotenas
la subfamilia
viralesde los
lentivirus. Se distinguen dos tipos de VIH, VIH-1 y gp120, gp 41 y el
VIH-2 siendo gp17.
VIH-1La ms
nucleocpsida
importantecentral
debidooacoresu
potencial patognico mayor, reflejado en la rpidaen cuyo interiorde
diseminacin se su
encuentra
infeccin el material
por todogentico y lasEl VIH-
el mundo.
enzimasde
1 infecta clulas CD4+ (es decir, que poseen el receptor necesarias
membrana para la replicacin
CD4) viral.inmune,
del sistema En algunas
publicaciones la cpside icosadrica es considerada
conduciendo a una profunda depresin de la inmunidad natural. Sin embargo, este virus tambin puede una
tercera capa. El genoma es un ARN de cadena nica
infectar otras clulas, incluyendo clulas neuronales.
constituido por 2 hebras idnticas de polaridad
positiva. Existen genes encargados de codificar los
Estructura del VIH componentes de la partcula vrica (genes estructurales) y
de regular la expresin de los mismos (genes
reguladores).
El VIH-1 est formado por una partcula esfrica de 80-100 nmDe conlosuna
genes estructurales
estructura en dosel gen GAG
capas: codifica las protenas deln de ARN en ADN es una
caracterstica principal de los retrovirus y se lleva a cabo
mediante acciones enzimticas secuenciales (ADN
polimerasa y ribonucleasa de la transcriptasa inversa).
Luego de la conversin a la doble hebra de ADN, sta es
integrado al genoma de la clula husped como 88
provirus.
Ciclo Vital del VIH

El VIH es un virus, ms bien, como se ha sealado, un Retrovirus. Este no puede replicarse o completar
su ciclo fuera del cuerpo, necesita una clula (clula Husped) a partir de la cual obtener los elementos
(aminocidos y nucletidos) necesarios para su reproduccin.
El Ciclo replicativo del VIH est compuesto por diversas etapas relacionadas temporalmente. Entre
stas se distinguen la adsorcin, fusin e internalizacin del virin; transcripcin inversa e
integracin, latencia,expresin temprana de genes reguladores; expresin tarda de genes
estructurales y enzimticos; morfognesis y salida del virin.

Adsorcin, fusin e internalizacin del virin.

El primer evento entre el VIH y la clula Blanco es la interaccin de la protena viral gp120 y el receptor
CD4 de los linfocitos T CD4, la cual se debe a una afinidad muy alta entre ambas protenas. Adems se
han descrito otros receptores para la gp 120, como son los Fc de las inmunoglobulinas y los receptores de
complemento usados por complejos antgeno-anticuerpo con o sin fijacin del complemento.
Las clulas susceptibles de ser infectadas con VIH son aquellas que expresan el receptor CD4 o Fc
directamente; o bien, las que no los expresan en condiciones normales, pero s tras la infeccin con otro
virus. La regin responsable de la fusin de membranas se encuentra en la gp 41.
Luego de ocurrida la fusin del virus con la clula husped, ocurre la inyeccin del material gentico viral
y de la transcriptasa inversa del mismo.

Transcripcin Inversa e integracin

Despus de la entrada, se inicia la replicacin mediante la transcripcin inversa, por la trasncriptasa


reversa contenida en el Virin, generndose la primera cadena de ADN a partir del ARN viral. Para la
sntesis de la segunda cadena es necesaria la accin de la ribonucleasa H que degrada parcialmente el
molde ARN viral. As se genera el ADN de doble cadena que se integra en el ADN celular mediante la
enzima integrasa viral.

Morfognesis y Salida

El montaje se lleva a cabo por partes, la ribonucleoprotena se agrega en el citoplasma formando el


nucleoide con el ARN y las protenas de gag y pol. Posteriormente se desplazan a la membrana celular
donde se recubren de la membrana lipdica y las glicoproteinas de superficie adheridas a la misma, y
ocurre el desprendimiento del virin.

Despus de desprenderse el virus de la clula se genera la rotura de los precursores de la nucleocpside y


las enzimas por medio de la proteasa, produciendo as el virin infeccioso.

Latencia

89
Despus de la integracin del provirus se produce la latencia viral. Aproximadamente el 1% de los
linfocitos CD4+ estn infectados y uno por mil expresa ARN viral. La activacin celular mediante estmulos
antignicos, es decir, por algn microorganismo o clula extraa u otro elemento extrao mediante
citocinas o mitgenos, genera la sntesis de factores de transcripcin celulares, que activan la transcripcin
de diferentes genes celulares. Sin embargo, estas protenas estimulan simultneamente la transcripcin
del provirus latente en la clula. Por otra parte, en los linfocitos T en reposo se puede encontrar una forma
de VIH-1 que sera un nucleoideo retrotranscrito en forma incompleta.

Actividad33:
Define el dogma central de la Biologa molecular.

Actividad34:
Indica las enzimas que llevar a cabo el proceso de transcripcin de los genes que codifican para las
histonas y el ARN ribosmico.

Actividad35:
Qu son los exones y los intrones?

Actividad36:
Qu se aade en el extremo 5 de los ARNm de eucariotas? Por qu?

Actividad37:
Por qu se dice que las molculas ARNt actan de intrpretes del cdigo gentico?

90
Actividad38:
En qu proceso acta la ARN polimerasa ADN dependiente? Qu caractersticas tiene esta enzima?
Pon un ejemplo de algn organismo que la presente.

TRADUCCIN
La traduccin consiste en la sntesis de la protena, para lo cual los aminocidos han de disponerse en el
orden adecuado que define la secuencia de codones del ARNm.
Los aminocidos son transportados al lugar de sntesis por el ARNt en el orden que indica el ARNm.
Las molculas de ARNt actan como sistemas intermediarios o interpretes entre la secuencia de
nucletidos y la secuencia de aminocidos, ya que adems de llevar unido un aminocido especfico en su
extremo 3, reconocen los nucletidos del ARNm gracias a su antiodn complementario del codn
correspondiente.
El proceso es semejante entre procariotas y eucariotas.
ETAPAS:

1. Activacin de los aminocidos:


Para cada uno de los 20 aminocidos hay una enzima especfica: aminoacil- ARNt- sintetasa, y al menos
un ARNt especfico.

La enzima y el aminocido especfico, utilizando ATP, forman un complejo y liberan fosfato, es decir, para
llevar a cabo esta unin se necesita energa, que es aportada por el ATP y el AMP resultante,
permanecer unido al complejo. A continuacin la enzima une el aminocido al ARN t por su extremo 3,
quedando activado y liberando la molcula de AMP.
La enzima queda libre para poder volver a activar otro aminocido.

ATP AA

AMINOACIL- ARNt- SINTETASA


PP AA- AMP ARNt

ACTIVACIN DE LOS
AMINOACIDOS
AMP ARNt- AA

Esta operacin debe realizarse cada vez que un aminocido debe de unirse a su ARN t especfico, y cada
vez que un aa tiene que participar en la formacin de la cadena de protena.
Se denominan isoaceptores a los diferentes ARNt con anticodones distintos que aceptan el mismo
aminocido.
2. Inicio de la sntesis:
Se produce la unin de la subunidad pequea del ribosoma con el ARNt iniciador unido a la
metionina, con la ayuda de factores de iniciacin y la energa el GTP.
A continuacin la caperuza (7- metil- guanosina trifosfato) ayudada por ciertos factores producen la
unin de la subunidad menor con el ARNm.
La subunidad pequea se desplaza por el ARNm en sentido 5 3 hasta llegar a la secuencia AUG,
en este momento se produce la unin al codn AUG del ARNt especfico, cuyo anticodn es UAC.
Una vez que se ha producido esta unin, se produce el acoplamiento de la subunidad mayor del
ribosoma.
Queda formado el complejo de iniciacin, la maquinaria activa de la sntesis.
Adems de los factores de iniciacin interviene
Los laribosomas
energa deltienen
GTP. dos lugares
Este ARNt es el nico que puede unirse a estereoespecficos
la subunidad pequea edonde
incorpora pueden
metionina, este ser por tanto
el primer aminocido de todas las protenas (aunque luego puede ser eliminado
colocarse los codones y los ARN s lat protena no comienza
por l). complementarios, son los denominados:
sitio A o aminoacil y sitio P o peptidil,
el primer ARNt (el de la metionina) se 91
coloca en el sitio A.
3. Alargamiento de la cadena:
Consiste en ir alargando la cadena de aa, segn el orden de los codones.
El ribosoma se va a mover sobre la cadena de ARNm, de tal manera que el codn que se encontraba en el
sitio A ahora se encuentra en el sitio P, y en el sitio A aparece otro codn nuevo, que se corresponder con
otro aa.
A este lugar A se acercar el ARN t cuyo anticodn sea el complementario del codn que hay en el sitio A y
por supuesto llevar unido ya su aa correspondiente.
Una vez que en los dos sitios hay aa, la enzima peptidil transferasa, llevar a cabo la unin entre los
dos aa, mediante un enlace peptdico, uniendo el aa que ocupa el sitio P sobre el que ocupa el sitio A.
Como consecuencia el ARNt localizado en el sitio P queda sin aa y abandona este lugar, quedando el sitio
P vaco, entonces el ribosoma vuelve a moverse sobre la cadena de ARN m, y lo que ocupa el sitio A se
desplaza y ocupa ahora el sitio P y en el sitio A se localizar un nuevo codn y entonces el proceso vuelve
a empezar.
Intervienen factores de alargamiento. La energa proviene del GTP.

4. Terminacin.
El proceso contina hasta que el ribosoma llega a un codn mudo de terminacin. La terminacin la
provocan factores de terminacin, que reconocen los codones mudos situados en el lugar A y lo ocupan
provocando el desprendimiento de la cadena polipeptdica recin formada, y la disociacin del ribosoma,
quedando finalizada la sntesis.

5. Procesamiento de las protenas


Las cadenas polipeptdicas formadas se van plegando de manera espontnea segn se van
sintetizando, dependiendo de su secuencia de aminocidos. Para evitar posibles errores y facilitar el
92
plegamiento correcto la clula dispone de las protenas chaperonas; adems colaboran en el transporte
de protenas entre el citoplasma y los orgnulos.
Una vez finalizada la sntesis las protenas suelen sufrir ciertas modificaciones: cortes proteolticos,
formacin de distintos tipos de enlaces, adicin de grupos prostticos o modificacin de ciertos
aminocidos
Las protenas que van a ser exportadas a otros lugares de la clula llevan una seal, llamada pptido
seal, que no es otra cosa que una secuencia de unos 20 aminocidos, en la regin prxima al N-
Terminal y que indica a las chaperonas donde debe ir esa protena, a una mitocondria, al exterior

DIFERENCIAS EN LA TRADUCCIN EN PROCARIOTAS Y EUCARIOTAS

En eucariotas la envoltura nuclear y la maduracin que sufren los ARNm impiden su traduccin inmediata.
El ARNm es "ledo" despus de que haya abandonado el ncleo a travs de los poros nucleares. La
traduccin es por lo tanto post-transcripcional.

Transcripcin, maduracin y traduccin en eucariotas Transcripcin y traduccin en procariotas

En procariotas la traduccin es simultnea a la transcripcin, esto es, mientras se est terminando de


transcribir el extremo 3', el extremo 5' libre del ARNm se asocia a un ribosoma y al ARNt iniciador
comenzando la traduccin.

REGULACIN DE LA EXPRESIN GNICA.


Es obvio que la clula slo debe producir aquellas protenas que sean necesarias. Deben existir, pues,
ciertas seales que controlen la expresin de cada gen, bien en el momento de la transcripcin, bien en el
de la traduccin; esto es lo que se conoce como regulacin de la expresin gnica.
Esta regulacin difiere sustancialmente entre procariotas y eucariotas, ya que los procariotas son
siempre unicelulares y una sola clula debe desempear todas las funciones.
Diferencias:
1. En bacterias (y tambin levaduras y eucariotas unicelulares) el control se emplea para adaptarse a los
cambios medioambientales y as obtener el mximo de los nutrientes presentes, en eucariotas
pluricelulares, en los que el medio que rodea a la clula es relativamente constante, el control se
relaciona directamente con la especializacin celular.
2. En bacterias el tipo de control que se lleva a cabo es tanto positivo (estimuladores de la expresin)
como negativos (inhibidores). En eucariotas predomina, con alguna excepcin, claramente el control
positivo.
3. Adems en eucariotas pluricelulares tenemos que empezar distinguiendo entre genes constitutivos o
de mantenimiento que se estn constantemente expresando (son entre 5.000 y 10.000) porque su
informacin codifica para protenas involucradas en procesos vitales bsicos; y, genes con expresin
diferencial, que se expresan dependiendo del estadio del desarrollo del ser vivo, del tejido de que se
trate y de la fase del ciclo celular en que se encuentra la clula (s se trata de una clula con capacidad
proliferativa).

Vamos a estudiar como ejemplo de regulacin el OPERN DE LA LACTOSA en procariotas descrito por
Jacob y Monod:

93
Un opern es un conjunto de genes que codifican para protenas diferentes implicadas en procesos
bioqumicos estrechamente relacionados, todos estos genes se localizan en el cromosoma, unos cerca de
otros, con el fin de que la regulacin se realice de manera coordinada.

En cada opern hay varios tipos de genes:


Genes estructurales: E1, E2... que codifican para protenas, participantes en determinado proceso
bioqumico.
Genes reguladores: (R), que codifican para la sntesis de una protena represora (que se puede
encontrar en su forma activa o inactiva)
Adems hay dos tipos de regiones:
El promotor: (P) donde se une la ARN polimerasa y decide el inicio de la sntesis.
El operador: (O), que se encuentra entre el P y los genes estructurales y es donde se une la protena
represora cuando se debe impedir la sntesis de un ARN impidiendo para ello la unin de la ARN
polimerasa.

Esquema de los componentes de un opern

El opern lac inhibido

El opern lac activado

El opern lac est formado por tres genes estructurales dispuestos en serie(z, y, a). La transcripcin de
estos genes da origen a una molcula de ARNm que codifica para la tres enzimas que participan de la
misma va metablica. En ausencia de lactosa el represor se enlaza al operador e impide a la ARN
polimerasa insertarse en el sitio promotor con lo cual se interrumpe la transcripcin. El represor ejerce su
influencia mediante control negativo, puesto su interaccin con el ADN inhibe la expresin del opern.
En presencia de lactosa, este disacrido se une a la protena represora, provocndole un cambio
conformacional e incapacitndola para unirse al ADN del operador. En estas condiciones, se transcriben
los genes estructurales, apareciendo en el citosol las enzimas que degradarn a la lactosa. En este
ejemplo de opern el represor solo puede unirse al operador en ausencia del inductor.
Existen otros tipos de operones en bacterias, como por ejemplo el opern triptofano, el que se
caracteriza por ser un opern reprimible.
El opern triptofano consiste en cinco genes estructurales que codifican para las enzimas involucradas en
la biosntesis del aminocido triptofano. Dichos genes se agrupan en una unidad de transcripcin con un
solo promotor y un operador. Un gen regulador se localiza fuera del opern y codifica para la sntesis de
una protena represora. Esta protena difiere del represor lac en que se sintetiza en forma inactiva siendo
incapaz de unirse al operador.

94
En ausencia de triptfano, la ARN polimerasa se une al promotor y transcribe los genes estructurales en un
ARNm policistrnico. Esto es posible pues el represor inactivo no logra unirse por si solo al operador .

El opern triptfano activado

En presencia de triptfano en el medio circundante, el aminocido (molcula denominada co-represor) se


une a la protena represora constituyendo el complejo represor/co-represor. Dicho complejo reconoce a
la zona operadora a la que se fija, impidiendo a la ARN polimerasa transcribir los genes estructurales

El opern triptfano inhibido

Actividad39:
Diferencia entre los siguientes pares de trminos: traduccin/transcripcin; codn/anticodn

Actividad40:
En la hemoglobina humana, la cadena beta tiene una longitud de 146 aminocidos Cul es la longitud
mnima (en n de nucletidos) del ARNm necesario para sintetizar esta protena?

Actividad41:
Teniendo en cuenta el cuando del cdigo gentico estudiado anteriormente, responde a las siguientes
cuestiones:
a) En un segmento de ADN la secuencia de bases es 3 TACAAGTTTGGTTACTTGC5 Cul sera la
secuencia de bases en la cadena de ARNm?
b) Si se tiene el siguiente pptido: arg-lys-pro-met y se sabe que las molculas de ARNt empleadas en su
sntesis tiene los siguientes anticodones:
3-GGU-5; 3-GCU-5; 3-UUU5; 3-UAC5
Determina la secuencia de nucletidos del ADN para la cadena molde del gen que codifica este pptido.

Actividad42:
Describe la formacin del complejo de iniciacin de la primera etapa de la traduccin en la sntesis de
protenas.
95
Actividad43:
Dada la siguiente secuencia de pares de bases de un ADN que ser transcrito y traducido en un pptido,
escribe la secuencia de bases del ARNm. Proporciona los anticodones de los ARNt necesarios y dime la
secuencia del pptido correspondiente formado.
CCGTACGCCTTTCAGGTT
GGCATGCGGAAAGTCCAA

Actividad44:
Identifica los procesos que se muestran en la figura e indica en qu tipo de clula se producen con arreglo
a lo representado:

Actividad45:
Qu diferencias existen entre el funcionamiento de un opern en el sistema inducible y el el represible?

7. MUTACIONES
El concepto de mutacin fue introducido por Hugo de Vries a principios de siglo al observar en sus
estudios sobre plantas que con cierta frecuencia se apreciaban caractersticas distintas en los
descendientes con respecto a sus progenitores. Aunque no fue acertado en este calificativo para la
mayora de los casos, supuso un paso importante en la comprensin de las leyes que rigen la
transmisin de la herencia al suponer que se deban a un cambio brusco en los genes.
Las mutaciones son cambios estables y heredables en el material gentico de una clula; estos
cambios pueden manifestarse externamente o no dependiendo de los genes a los que afecte.

TIPOS DE MUTACIONES
Las diferenciamos atendiendo a distintas caractersticas:

Por su origen:
Mutaciones espontneas: se producen sin la intervencin aparente de ningn factor fsico o qumico
externo. Se producen en todas las especies con una frecuencia < al 0,2 %.
Mutaciones inducidas: son producidas por la accin de algn factor externo, son los agentes
mutagnicos que ya conocemos.

Por su comportamiento gentico:


Mutaciones dominantes: si su expresin domina sobre otro gen, es decir, la mutacin se expresar
en el organismo que la posea.
Mutaciones recesivas: si su expresin es dominada por otro gen, es decir, aunque exista la
mutacin no se expresar.
96
Por su efecto sobre el individuo:
M. Inocuas: que no producen ni perjuicio ni beneficio al organismo que las lleva.
M. Beneficiosas: proporcionan alguna ventaja.
M. Perjudiciales: producen algn tipo de perjuicio al individuo que las lleva; son las ms numerosas
y podemos distinguir:
Patolgicas: producen una enfermedad.
Teratolgicas: produce malformaciones.
Letales: producen la muerte. En este tipo es importante distinguir entre m. letales dominantes o
recesivas, ya que, si son recesivas, el individuo no sufrir ningn efecto, ya que como no se
expresa no sufrir la muerte; pero si son dominantes, el organismo morir en la fase de huevo o
en las primeras fases del desarrollo embrionario, en ningn caso permiten que el embrin llegue
a termino.
Estn producidas por la alteracin de la estructura o la
Segn la naturaleza de la alteracin: composicin qumica de un gen al alterarse una sola base.
El gen mutante ser una variacin del gen original, al que
Mutaciones gnicas o puntuales: denominamos silvestre. Mediante este mecanismo se han
. obtenido a lo largo de la evolucin versiones nuevas de un
mismo gen que denominamos alelos. Ello confiere a este
tipo de mutaciones gran importancia en la evolucin de las
especies.
Un caso importante de mutacin gnica es el causante de la
anemia falciforme o drepanoctica, que se caracteriza porque
quienes la padecen presentan eritrocitos deformados, en forma
de hoz. Para que se presente esta deficiencia es suficiente con
que se d en una o en las dos cadenas que conforman la
hemoglobina, la sustitucin de un aminocido de cido
glutmico por una valina

Mutaciones segn su efecto sobre las protenas:


Segn sea el efecto de la mutacin sobre la secuencia de la protena codificada por el gen mutado, se
distinguen las siguientes clases:
o Mutaciones silenciosas: cuando la sustitucin de una base por otra no provoca un cambio en
secuencia de la protena por el gen mutado. Puede ser que el cambio afecte a un intrn o bien
que el triplete mutado codifique para el mismo aminocido.
o Mutaciones que cambian el sentido: la sustitucin de una base por otra afecta a una regin
exnica, el ARNm transcrito estar modificado y se producir el cambio de un aminocido por
otro. Estas pueden ser de dos tipos:
Mutacin neutra o conservadora: porque el aminocido cambiado sea muy parecido al
original y las consecuencias en la protena no son a penas apreciables en su funcin.
Mutacin no conservadora: el aminocido sustituido se produce en un lugar fundamental
de la protena- sitio activo o dominio estructural- perdiendo totalmente su funcin
biolgica.
o Mutaciones que cambian el marco de la lectura: se produce cuando tiene lugar la insercin o
deleccin de un nucletido en ambas cadenas, producindose el cambio de sentido en el que
se leern las bases y alterando toda la secuencia de los aminocidos desde el lugar de la
mutacin. Solo en le caso de que se produzca el cambio en tres bases no se producir el
cambio de sentido.
o Mutacin sin sentido: tiene lugar cuando la sustitucin, insercin o deleccin transforma un
triplete codificante en uno de terminacin, por lo que cesar la sntesis de la cadena y por lo
tanto afectar gravemente a la estructura y funcin de la protena.

Mutaciones cromosmicas:
Son cambios en la estructura normal de los cromosomas, la secuencia de nucletidos en el ADN es
alterada y como consecuencia tambin el mensaje transmitido al ARNm al efectuarse la transcripcin.

97
Son cambios por la prdida o ganancia de una parte del cromosoma o por algn cambio en el orden de
la secuencia de nucletidos.
Durante la meiosis los cromosomas sufren roturas y uniones, lo cual facilita una mayor diversidad en el
reparto de los genes de un individuo entre los cromosomas presentes en sus gametos; esto puede
motivar la aparicin de errores. Hay cuatro tipos:

Deleccin:
Se produce al perderse una parte del cromosoma y, por consiguiente, se pierde parte de la informacin
gentica. La prdida puede afectar a un extremo del cromosoma (deficiencia) o a una porcin central
(intercalar), y en cualquier caso puede manifestarse claramente en el fenotipo del individuo afectado.
Cuanto mayor sea la porcin perdida, mayor ser el nmero de genes perdidos y ms importantes sus
efectos.

Un caso muy conocido es el sndrome de maullido de gato o de Lejeune, que se debe a una deleccin
en el cromosoma 5 y que causa retraso fsico y mental de por vida y que emiten sonidos semejantes a
los de un maullido de gato al no tener bien desarrolladas sus cuerdas vocales.

Duplicacin:
Se presenta cuando un cromosoma tiene alguna fraccin repetida, lo que supone un aumento de
tamao y de los genes contenidos en el cromosoma afectado.
Puede producirse a la vez una deleccin y duplicacin durante la meiosis, como sucede en el sndrome
de la duplicacin deficiente que afecta al cromosoma 3, y que produce: crneo cnico, paladar alto y
hendido, cuello y miembros cortos, nariz proyectada hacia delante...

Translocacin:
Es un cambio de orden en la secuencia de nucletidos, que se puede producir en un cromosoma o entr
e dos cromosomas no homolgos; esto sucede cuando los cromosomas se rompen y luego se unen de
manera incorrecta.

Un caso de translocacin entre el cromosoma 15 y el 21, apareciendo la mayor parte del 21 unido al
15, puede causar en los humanos un tipo de sndrome de Down, ms conocido como mongolismo
Inversin:
Se produce cuando un cromosoma se rompe y despus alguna de las porciones resultantes se vuelve
a unir, pero con el orden de su secuencia invertido.
Esto no supone prdida de informacin pero puede dificultar o impedir la funcionalidad de los genes,
ocasionando alguna enfermedad.

Mutaciones genmicas:
Son mutaciones que afectan al genma, es decir, al nmero de cromosomas de alguna o de todas las
clulas de un individuo.
stas se suelen producir por error en la separacin (disyuncin) de los cromosomas durante la mitosis
o meiosis. Como consecuencia de la no disyuncin de los cromosomas, puede obtenerse gametos con
toda la dotacin cromosmica del individuo (clula diploide), con algn cromosoma de ms o de
menos.
Lo normal es que los gametos sean haploides, si un gameto, diploide por error se une a otro haploide
normal, se formar un cigoto triploide; si los dos gametos son diploides, se formar un cigoto
tetraploide.
Las clulas e individuos que tienen ms de dos veces su nmero haploide de cromosomas de
denominan poliploides.
El poliploidismo se da de forma natural y con bastante frecuencia en vegetales, de la misma o de
diferente especie, y ha sido utilizado en experimentos de laboratorio para obtener especies en las que
se mejore alguna de sus propiedades, de modo que soporten mejor la sequa o sean ms resistentes a
las plagas. En animales no suelen ser viables las clulas poliploides, pueden darse en animales muy
inferiores.

Por errores en la disyuncin de los cromosomas homlogos durante la mitosis o meiosis puede
suceder que las clulas tengan algn cromosoma de ms o de menos, en estos casos se trata
de aneuploidias y pueden verse afectados uno o ms cromosomas: si falta un cromosoma se habla de
monosoma (2n 1) y si hay un cromosoma de ms es una trisoma (2n + 1).
98
En los humanos son bastante conocidas algunas aneuploidias que pueden ser tanto de autosomas
como de cromosomas sexuales, y en muchos casos son causa de muerte temprana; por tener un
grupo de caractersticas o sntomas representativos que aparecen simultneamente se denominan
sndromes.

ANEUPLOIDIAS EN LOS AUTOSOMAS

SNDROME MUTACIN CARACTERSTICAS

Trisoma del par Ojos oblicuos, retraso mental, cabeza ancha y cara redondeada.
Sndrome de Down
21

Sndrome de Trisoma del par Boca y nariz pequeas, deficiencia mental, lesiones cardiacas,
Edwards 18 membrana interdigital.

Trisoma del par Labio leporino, paladar hendido, deficiencias cerebrales y


Sndrome de Patau cardiovasculares.
13

ANEUPLOIDIAS EN LOS CROMOSOMAS SEXUALES

SNDROME MUTACIN CARACTERSTICAS


Sndrome de Uno o ms cromosomas X en Sexo masculino, esterilidad, deficiencias mentales y
Klinefelter exceso algunos caracteres sexuales 2 femeninos.
Sndrome de Turner Monosoma del cromosoma Sexo femenino, esterilidad, baja estatura, trax
X ancho.
Sndrome de triple X Tres cromosomas X Sexo femenino con rganos genitales atrofiados,
(XXX) fertilidad limitada.
Sndrome de la doble Dos cromosomas Y Varones de elevada estatura, agresivos, bajo
Y (XYY) coeficiente mental.

LAS MUTACIONES Y LA EVOLUCIN


La evolucin es el proceso mediante el cual las poblaciones modifican sus caractersticas genticas en
el transcurso del tiempo.

La gran diversidad de los seres vivos actuales permite aceptar que en ella pueden haber influido
cambios genticos heredables, afirmados por una seleccin natural y por el azar. Los genes pueden
cambiar y las mutaciones que favorecen la supervivencia de los individuos tienden a perpetuarse.

El conjunto de genes de una poblacin, formado por todos los alelos de genes que poseen los
individuos que la conforman, constituye el pool gnico de la misma. La presencia de una combinacin
favorable de alelos en un individuo favorece su supervivencia y, como consecuencia, su reproduccin,
con lo que la frecuencia de esos alelos entre los miembros de la poblacin tiende a aumentar.

El intercambio de alelos entre individuos de distintas poblaciones (flujo gnico) es causante de una
mayor variabilidad de genes entre los miembros de una poblacin y disminuye las diferencias entre las
poblaciones implicadas; el flujo gentico acta en sentido contrario a la seleccin natural, dificultando la
aparicin de nuevas especies.

Los principales agentes de variabilidad y diversidad gentica son la recombinacin gentica y la


mutacin.
La recombinacin gentica consiste en una reordenacin de los genes ya existentes en la poblacin,
que puede traducirse en la aparicin de nuevos genotipos, pero no nuevo material hereditario.
Las mutaciones, por el contrario, permiten la paricin de genes que antes no existan, por lo cual las
posibilidades biolgicas se amplan enormemente. Se produce as una evolucin molecular que se
reflejar en las caractersticas biolgicas de los individuos.

99
Evolutivamente, las mutaciones ms importantes son las que actan de forma repetida sobre un
determinado gen (mutaciones gnicas recurrentes) y favorecen cambios rpidos (a escala evolutiva).
La importancia de las mutaciones se pone de manifiesto durante la adaptacin de una poblacin a un
entorno nuevo. En estos casos, la presin selectiva aumenta mucho y favorece la supervivencia de
aquellos individuos que portan las mutaciones adaptativas favorables.
Las mutaciones cromosmicas tienen un gran inters en los procesos evolutivos, ya que puede
originar la evolucin de una molcula a partir de una original por duplicacin de fragmentos del gen.
(Hemoglobina).
Las mutaciones genmicas contribuyen a la evolucin, sobre todo en especies vegetales, que las
toleran mejor que los animales

MUTACIONES Y CANCER
El cncer se origina por la transformacin de clulas normales en clulas cancerosas o tumorales,
clulas que han recuperado la capacidad de divisin prcticamente ilimitada (totipotencia).
Las clulas tumorales pierden el control general del ciclo celular al que estn sometidas todas las clulas,
convirtindose en clulas casi embrionarias, con capacidad de divisin ilimitada, forman como
consecuencia una masa de clulas que recibe el nombre de tumor.
Despus de un tiempo algunas de estas clulas pueden abandonar el tumor primario, a travs de los
sistemas linftico o sanguneo e incorporarse en otros tejidos generando tumores secundarios, dando
lugar a lo que se denomina metstasis.

Para que se produzca un cncer no es suficiente una sola mutacin, sino un conjunto de mutaciones y
alteraciones en una nica clula, que por multiplicacin clonal se van amplificando, hacindose cada vez
ms peligrosos.
En primer lugar es necesario que determinados agentes mutagnicos causen mutacin en la
secuencia de unos genes, llamados proto-oncogenes, que estn relacionados con la activacin
de la divisin de las clulas normales, transformndolos en oncogenes, que producen, o bien
exceso de un protena normal, o bien una forma muy activa de una protena mutada, que promueve
al crecimiento sin control de la clula.
Puede suceder que la mutacin no sea en la parte estructural del gen, sino en secuencias
reguladoras del propio gen, o por insercin de un promotor muy potente como consecuencia de la
recombinacin gnica; o bien por la accin de un retrovirus que inserte un oncogn en el
cromosoma.
En segundo lugar es necesario que se produzca una mutacin en los genes supresores de
tumores, cuya funcin es detener la divisin celular. Estos genes se activan cuando las clulas
presentan graves alteraciones en su ADN y les inducen suicidio celular o apoptsis. Las clulas
tumorales tienen inactivados estos genes, por lo que no se suicidan ante sus alteraciones.
Adems tienen activada la telomerasa, la enzima que repara el acortamiento del telmero, que
sucede cada vez que una clula se divide, adquiriendo as, la inmortalidad propia de las clulas
embrionarias.
Adems es necesario que produzcan alteraciones que permitan la formacin de vasos
sanguneos que irriguen y nutran las clulas cancerosas y les permitan abandonar el tumor
primario y provocar la metstasis.

El cncer es un enfermedad gentica, porque su causa es debida a mutaciones de diversos genes, pero
generalmente, no es hereditaria, ya que las mutaciones aparecen en clulas somticas, solo ser
hereditario, si la/s mutaciones aparecen en clulas germinales (vulos o espermatozoides). Puede suceder
que se hereden ciertos genes mutados, y por tanto, la predisposicin gentica a padecer ciertos tipos
de cnceres, si se producen nuevas mutaciones producidas por agentes mutgenos ambientales.

Para prevenirlo, debemos evitar el tabaco, el alcohol y mantener una dieta alimentaria saludable que nos
va a evitar la accin de los radicales libres que produzcamos de forma natural en las mitocondrias.
Para ello debemos mantener una dieta baja en caloras, pero sin carencias, rica en alimentos frescos,
frutas y verduras de distintos colores, sin exceso de coccin, pues nos van a aportar distintos tipos de
nutrientes, pescados azules, pequeas cantidades de frutos secos (ricos en oligoelementos y cidos
grasos piliinsaturados), aceite de oliva virgen, lo que es en fin una dieta mediterrnea. Evitar las carnes
rojas, los embutidos ya que contienen demasiada sal, las salazones, las frituras, las grasas animales
saturadas y por supuesto no tomar un exc3so de glucosa que dan lugar a productos que causan agentes
mutagnicos y se acumulan adems en forma de grasa.
100
8. PROTEOMA Y PROTEMICA

El principio de Badle y Tatum de un gen-una enzima parece ser que se ha quedado obsoleto. Actualmente
se sabemos que hay genes que codifican para mas de una enzima, y hay enzimas para cuya sntesis se
requiere ms de un gen, adems hay caracteres que requieren de la accin de ms de una enzima. Todo
esto nos lleva a pensar que para conocer los caracteres de un organismo no basta con conocer sus genes,
sino que habr que conocer tambin sus protenas.

De la misma manera que hablamos del genoma como el conjunto de genes presentes en un organismo,
hablamos actualmente de proteoma como el conjunto de protenas presentes en un organismo. La
protemica es la ciencia que estudia el proteoma de los organismos.
No existe una correspondencia biunvoca entre los genes y las protenas. Por ejemplo, si en la especie
humana se estima que hay 23.000 genes, tambin se estima que hay del orden de 108 de protenas.

La razn de que hay ms protenas que genes es triple:


los splicing o eliminacin de los intrones, como ya hemos comentado, los exones pueden
unirse de varias formas, e incluso no unirse todos, dando lugar a diferentes secuencias de
protenas, y todo esto dependiendo de las condiciones fsico qumicas en que se encuentra la
clula.
La maduracin postraduccional, como hemos comentado todo tipo de cambios que puede
presentar la cadena de aminocidos, despus de ser traducida, eliminacin de algn aminocido,
unin de grupos protticos, unin a otras cadenas de aminocidos para alcanzar una estructura
cuaternaria... todos estos cambios pueden ser diferentes en diferentes condiciones de la vida
celular.
La tercera razn es la presencia de genes polimrficos, son genes que pueden presentar
variaciones en la secuencia de nucletidos que no afectan a la funcionalidad de la protena que
codifican, pero si la secuencia de aminocidos.
Los dos primeros fenmenos nos hablan de que un individuo puede presentar protenas diferentes en
momentos diferentes de su vida, el tercero nos habla de la variabilidad de protenas entre los distintos
individuos de una especie.

9. EPIGENOMA HUMANO

El epigenoma es el conjunto de secuencias de ADN que contienen informacin epigentica capaz de


controlar directamente nuestros genes.

Una de los descubrimientos mas interesantes ha sido descubrir que cuando comparamos nuestro genoma
humano con el de otras especies como el chimpanc, el parecido es enorme, del 99%. Lo que nos hace
humanos no es la aparicin de nuevos genes sino la combinacin original de secuencias reguladoras,
localizadas en esa parte del genoma oculto, capaz de controlar la expresin de los genes activndolos y
modulando su funcionamiento.
Esta capa informativa oculta, que es capaz de controlar la expresin de nuestros genes, es tambin
heredable y se denomina epigentica.
La epigentica es el conjunto de cambios en el ADN, reversibles y heredables que no afectan a la
secuencia de nucletidos de los genes, pero s son capaces de alterar su expresin, haciendo que
unos se expresen y otros no en funcin de las condiciones medioambientales.

La epigentica estudia las modificaciones heredables de la funcin gnica que se producen sin que haya
habido un cambio (una mutacin) en la secuencia del ADN.

Los componentes epigenticos pueden sufrir cambios y ser modelados por el ambiente en el
transcurso de nuestra vida: por las enfermedades, el estilo de vida, los hbitos alimentarios, etc. As, por
ejemplo, dos gemelos que tienen el mismo ADN, si crecen y se desarrollan en ambientes distintos, algunas
de sus molculas pueden resultar alteradas de diferente manera, provocando que algunos de sus genes
estn activos en un gemelo y en el otro no, lo que al cabo de los aos podra alterar su apariencia y su
comportamiento.
Las mutaciones genticas son irreversibles, pero los patrones epigenticos son reversibles y se pueden
modificar con el paso de los aos en funcin del ambiente, por lo que pueden influir en el envejecimento y
en el desarrollo de enfermedades como el cncer.
101
Los mecanismos por los que se produce la herencia epiegentica y mediante los que se decide
que genes se expresarn y cuales no, son de distintos tipos y vamos a destacar algunos como: *patrones
de metilacin del ADN, *la acetilacin, fosforilacin y metilacin de las histonas.

Actividad46:
Cuando el mecanismo de replicacin del ADN no funciona de forma correcta se producen errores en la
molcula de ADN
a) qu nombre reciben dichos errores?
b) cmo se producen?
c) Describe las consecuencias que estos errores tienen para el individuo y la relacin existente con
algunos factores ambientales.

Actividad47:
Indica las diferentes consecuencias que pueden darse si una mutacin se produce en una clula somtica
o en un gameto.

Actividad48:
Por qu la mayora de las mutaciones son recesivas?.

Actividad49:
Por qu son menos perjudiciales las translocaciones que las delecciones cromosmicas?

Actividad50:
Define y diferencia los siguientes pares de conceptos: trisoma/ triploida; autopoliploida/alopoliploida.

Actividad51:
Por qu son importantes las mutaciones en la evolucin?

Actividad52:
Qu es un oncogn? Cmo influyen las mutaciones en el desarrollo del cncer?

102
10. EJERCICIOS DE SELECTIVIDAD BIOQUMICA

1. El agua es la molcula ms abundante en la materia viva.


a) Explique dos propiedades del agua (1 punto)
b) Explique dos funciones del agua en los seres vivos (1 punto)

2. En relacin con las sales minerales:


a) Explique las formas en que se pueden encontrar las sales minerales en los seres vivos, ponga un ejemplo de cada
una de ellas e indique su funcin (1 punto)
b) En relacin con la clula explique los siguientes trminos: medio externo isotnico, medio externo hipertnico,
medio externo hipotnico, e indique en qu consiste la smosis (1 punto).

3. Los glcidos son biomolculas que desempean diversas funciones esenciales par el organismo.
a) Enumere dos tipos diferentes de glcidos y ponga un ejemplo de cada uno de ellos (0,5 puntos).
b) Enumere dos tipos de asociacin entre glcidos y otras biomolculas (0,5 puntos).
c) Explique dos de las funciones que desempean los glcidos en el organismo y ponga un ejemplo de glcido en
cada una de ellas (1 punto)
3 (bis). Las siguientes figuras corresponden a dos molculas, obsrvalas y contesta a las siguientes preguntas:

a) de qu molculas
se trata?
b) Qu es un
carbono asimtrico?
Poseen alguno estas
molculas?
c) qu tipo de enlace
aparece en la
molcula 2? Tiene
poder reductor?
d) Cul es la funcin
de estas molculas y
su inters industrial?

4. Con relacin a la clula vegetal:


a) Explique la composicin qumica de la celulosa (0,5 puntos)
b) Indique a qu grupo de biomolculas pertenece la hemicelulosa (0,5 puntos).
c) Indique la localizacin de la celulosa en dicha clula (0,5 puntos).
d) Cite dos biomolculas presentes en las clulas, vegetales o animales, con idnticas caractersticas qumicas a los
anteriores (0,5 puntos).

5. En relacin con los glcidos:


a)Indique si los siguientes compuestos: Sacarosa, almidn, glucgeno y lactosa son disacridos o polisacridos (1
punto)
b)En relacin con los compuestos indicados en el apartado anterior, indique en qu tipo de clula, animal o
vegetal, se encuentran los homopolisacridos y cul es su funcin (1 punto)

6. Los lpidos constituyen un grupo de biomolculas estructural y funcionalmente muy heterogneo.


a) Describa la estructura general de dos tipos diferentes de lpidos (1 punto).
b) Indique cuatro funciones que desempean los lpidos en el organismo (1 punto).

7. Los fosfoglicridos son lpidos complejos que poseen un comportamiento anfiptico.


a) Explique su composicin qumica y haga referencia al tipo de enlaces entre sus componentes (1 punto).
b)En qu estructura celular se localizan de forma mayoritaria los fosfoglicridos?. Explique el "comportamiento
anfiptico" y su importancia en la organizacin de esa estructura (1 punto).

8. Dada la frmulas siguiente contesta a las preguntas:

a) de qu tipo de molcula se
trata?
b) qu tipo de enlace seala la
flecha?
c) Indica las propiedades de
solubilidad de esta molcula
d) qu funciones llevan a cabo
en los seres vivos? 103
9. Los triacilglicridos o grasas son utilizados en la alimentacin humana.
a) Explique su composicin qumica (0,5 puntos).
b) Explique la diferencia, desde el punto de vista qumico, entre los aceites (grasas lquidas a temperatura
ambiente) y los sebos (grasas slidas a temperatura ambiente) (0,5 puntos).
c) Explique en qu consiste la saponificacin (0,5 puntos).
d) Mencione dos grupos de lpidos insaponificables (0,5 puntos).

10. Relacionado con los lpidos:


a) Explica qu es un lpido saponificable (0,5 puntos)
b) Explica la composicin qumica de los fosfoglicridos (fosfolpidos) (1 punto)
c) Cite la funcin biolgica ms importante de los fosfolpidos e indique su disposicin en la clula. (0,5 puntos)

11. Con relacin a las enzimas y vitaminas:


a) Explique los siguientes trminos: enzima, cofactor, coenzima y vitamina (1 punto)
b) Cite dos vitaminas mencionando en cada caso una anomala carencial, e indique si son liposolubles o
hidrosolubles (1 punto).

12. En relacin con la estructura de las protenas:


a) Defina en qu consiste la estructura primaria de una protena (0,5 puntos).
b) Mencione dos tipos de estructuras secundarias y seale qu tipo de enlaces mantienen estas estructuras (0,5
puntos).
c) Explique en qu consiste la estructura cuaternaria de las protenas y mencione un ejemplo (0,5 puntos).
d) Indique cmo se denomina el proceso por el que una protena pierde su estructura terciaria o globular y cite
una causa que lo desencadene (0,5 puntos).

13. Cmo afectara a la funcin de la hemoglobina y mioglobina un cambio brusco en el pH de la sangre?

14. Dado el esquema siguiente:


a) Qu tipo de enlace se
observa en l?
b) tiene ese enalece capacidad
de rotacin? Raznalo.
c) Son estos enlaces
responsables de la estructura
secundaria?. Raznalo.

15. con respecto a la frmula adjunta, contesta:

a) De qu tipo de molcula se
trata?
b) cules son sus unidades
estructurales?
c) De qu macromolcula forma
parte?
d) en qu orgnulos celulares se
localiza dicha macromolcula?

16. Con relacin a los ARN de clulas eucariticas:


a) Indique las clases de ARN que conozca (0,75 puntos).
b) Explique la funcin de cada uno de ellos (0,75 puntos).
c) Explique brevemente el proceso de maduracin del ARN (0,5 puntos).

17. Observa el esquema adjunto y responde:


a) A qu clase de molcula
corresponde?
b) Qu tipo de conformacin
espacial adquiere?
c) Qu elementos estructurales se
destacan en esta conformacin?
d) qu funcin desempea esta
molcula?
104
18. En relacin con el cido desoxirribonuclico (ADN):
a) Cul es la composicin qumica del ADN? (0,5 puntos).
b) Indique la importancia biolgica de la estructura primaria del ADN (0,5 puntos).
c) Explique el modelo de la doble hlice de ADN (Watson y Crick) (1 punto).

19. El dogma central de la biologa molecular se puede representar esquemticamente de la siguiente manera: ADN
ARN protena.
a) Indique las diferencias que existen entre la composicin y estructura del ADN y del ARN (1 punto).
b) Indique el nombre de los procesos ADN ARN y ARN protena e indique en qu parte de la clula eucaritica se
producen (0,5 puntos).
c) Mencione tres tipos distintos de ARN y cite el proceso que permite el paso de ARN a ADN (0,5 puntos).

20. .- Con relacin a la biosntesis de protenas en clulas eucariticas:


a) Mencione el nombre del proceso e indique su localizacin celular (0,5 puntos).
b) Indique el nombre de la molcula que lleva el codn y el nombre de la molcula que lleva el anticodn (0,5 puntos).
c) Indique la funcin del ARN transferente en este proceso y explique la relacin entre su estructura y su funcin (1
punto).

21. La siguiente secuencia de ADN corresponde a un fragmento de un gen:


3' GGCAATATCCGA 5'
a) Indique la secuencia de nucletidos de su ARNm y la polaridad de la secuencia (0,5 puntos).
b) Mencione el nmero mximo de aminocidos que se sintetizarn en el proceso de traduccin (0,5 puntos).
c) Introduzca una mutacin puntual (gnica) en la secuencia de ADN e indique una posible consecuencia de la
mutacin en la secuencia de aminocidos de la protena (0,5 puntos).
d) Explique dos posibles efectos de la mutacin puntual para la clula (0,5 puntos).

22. En la replicacin del ADN:


a) Qu significa que la replicacin del ADN es semiconservativa? (0,5 puntos).
b) Qu significa que la replicacin del ADN es bidireccional? (0,5 puntos).
c) Explique las semejanzas y diferencias en la sntesis de las dos cadenas de ADN en una horquilla de replicacin (1
punto).

23. La expresin de los genes es un proceso universal de todos los seres vivos.
a) Cul es la naturaleza molecular de los genes? (0,5 puntos).
b) Explique los dos procesos fundamentales que tienen lugar en la expresin de un gen (1 punto).
c) En los organismos eucariticos dnde tienen lugar los dos procesos anteriores? (0,5 puntos).

24. La siguiente secuencia polinucleotdica corresponde a un fragmento del inicio de un gen de una cepa bacteriana:
3' TACAATTCCCGGGCAACACAC 5'
a) Escriba la secuencia de bases del ARN mensajero que se puede sintetizar e indique su polaridad (0,5 puntos).
b) Cul es el nmero mximo de aminocidos que puede codificar este fragmento? (0,5 puntos).
c) Qu caractersticas del cdigo gentico ha utilizado para determinar el nmero de aminocidos? (0,5
puntos).
d) Si se detectara una variante de la cepa que produjera un polipptido de cinco aminocidos, cmo pudo
producirse la variante? (0,5 puntos).

25. En relacin con la expresin de la informacin gentica:


a) Cite y defina los dos procesos que tienen lugar en la expresin de la informacin gentica (1 punto).
b) Dnde tienen lugar los procesos anteriores en clulas procariotas y eucariotas (1 punto).

26. La transcripcin y la traduccin son procesos fundamentales en la clula eucariota.


a) Defina y distinga entre ambos procesos e indique en qu parte de la clula se produce cada uno de ellos (1
punto).
b) Nombre los tipos de ARN que intervienen en la traduccin y explique la funcin de cada uno de ellos.(1 punto).

27. Con relacin a la biosntesis de protenas en clulas eucariticas


a) Mencione el nombre del proceso e indique su localizacin celular (0,5 puntos).
b) Indique el nombre de la molcula que lleva el codn y el nombre de la molcula que lleva el anticodn (0,5 puntos).
c) Indique la funcin del ARN transferente en este proceso y explique la relacin entre su estructura y su funcin (1
punto).

105
28. Un determinado fragmento de ADN tiene la siguiente secuencia de nucletidos en una de las cadenas: ...3
TTCCAGCAT...5

a) Cul debe ser la secuencia de nucletidos de la otra cadenas? Marque los extremos 3y 5 (0,5 puntos)
b) Si la enzima ARN polimerasa lee este segmento de ADN Cul debe ser la secuencia de nucletidos de la cadena
de ARN mensajero?. Marque los extremos 3y 5(0,5 puntos)
c) Defina los siguientes trminos de mutaciones puntuales (gnicas): mutacin silenciosa, y mutacin de cambio de
sentido. Indique las consecuencias que tendran estas mutaciones en la secuencia de aminocidos codificada (1
punto)

29. Con relacin al proceso de replicacin del ADN:


a) Nombra las protenas y enzimas que intervienen en la etapa de desenrrollamiento y apertura de la doble hlice y
explique sus funciones (1,5 puntos)
b) Explique dos diferencias en el proceso de replicacin del ADN en organismos procariotas y eucariotas (0,5 puntos)

30. Con relacin a la etapa de iniciacin de la sntesis de una cadena polipeptdica (primera etapa de traduccin):
a) Qu elementos constituyen el complejo de iniciacin (1 punto)
b) Qu elementos constituyen un ribosoma completo y funcional? (1 punto)

31. En el proceso de replicacin del ADN bacteriano (Eschericia coli):


a) Explique el significado de los siguientes trminos: replicacin semiconservativa y replicacin bidireccional (0,5
puntos)
b) Explique brevemente el mecanismo de la sntesis del ADN en la cadena retardada (1,5 puntos)

40. Con relacin a las mutaciones.


a) Defina qu es una mutacin puntual (gnica) e indique el proceso celular responsable de la aparicin de este tipo
de mutaciones (0,5 puntos).
b) En la siguiente secuencia de nucletidos de una cadena de ADN: 3ATGCCA 5
introduzca una mutacin puntual y seale el tipo de mutacin producido (0,5 puntos).
c) Defina qu es una mutacin cromosmica y ponga un ejemplo (0,5 puntos).
d) Establezca la relacin entre mutacin y evolucin (0,5 puntos).

106