You are on page 1of 4

UNIVERSIDAD EL BOSQUE

FACULTAD DE MEDICINA
INSTRUMENTACIN QUIRRGICA
BIOQUIMICA
-DANIELA MARTNEZ MACIAS
-MARA CAMILA RODRGUEZ SANTANA
1 DE MAYO DE 2017

TALLER DE REPLICACIN Y TRADUCCIN

1. Haga una comparacin entre la ADN polimerasa y la ARN polimerasa y diferncielas


en cuando a:
a.) estructura
b.) forma de activacin
c.) direccin de elongacin de la cadena
f.) necesidad de una hebra gua.
d.) forma de obtencin de la energa de la reaccin de elongacin

La ADN polimerasa es la enzima principal en el proceso de replicacin. Partiendo


de una cadena inicial o primer la ADN polimerasa es capaz de aadir nucletidos
complementarios a la cadena molde estableciendo enlaces fosfodister. La ADN
polimerasa slo puede catalizar el crecimiento de la cadena inicial en direccin 5'-
3'. La ADN polimerasa tambin se encarga de la reparacin del ADN asociada a la
replicacin.
2. Escribir las secuencias de los mARN sintetizados de los siguientes ADNs:

a.) 3- ATTGCCATGCTA-5

3- ATTGCCATGCTA-5
5-TAACGGTACGAT-3
ARNm 3-AUUGCCAUGCUA-3

b.) 5- AGCTACTTAACG-3

5- AGCTACTTAACG-3
ARNm 3-UCGAUGAAUUGC-5

c.) 3-GGACCTACGTT-5

3-GGACCTACGTT-5
5-CCTGGATGCAA-3

ARNm 3-GGACCUACGUU-5

3. Cules aminocidos pueden ser codificados de las siguientes secuencias de ARNm?

a.) 5- UUGCCUAUGGAUUGGAUG-3
b.) 3-AUGUAGGUAAAGGUAGGCC-5
c.) 3- AGCGCCAGUGACCAUGUA-5

4. Seale los errores del siguiente texto:


...el ADN es el cido nucleico ms abundante en la clula. Se encuentra,
exclusivamente, en el ncleo celular. Qumicamente, est formado por una cadena de
polinucletidos. Por el contrario, el RNA es el cido ribonucleico compuesto por A, T, C,
G y se encuentra en las clulas del mamfero en dos hebras complementarias entre
s..

5. Indique a qu tipo de cido nucleico corresponden las siguientes secuencias de


bases nitrogenadas (DNA o RNA):
a.) 5'-CCGATC-3: DNA
b.) 3'-GGATCC-5: DNA
c.) 3'-UACCGA-5: RNA
d.) 5'-ACCGGC-3: DNA

6. Escribe la secuencia de ARN resultado de la transcripcin del siguiente fragmento


de ADN

5-ACGTACAGC-3
3-TGCATGTCG-5
ARNm 5-ACGUACAGC-3
7. Qu Polipptido es codificado por el siguiente trozo de ADN?:

5-GAAGCAGTTTAC-3
----------- 3-CTTCGTCAAATG-5
ARNm 5-GAAGCAGUUUAC-3
glu- ala- val- tyr

8. Supongamos la hebra de ADN: 3'...AATACAAAT...5'. Durante la transcripcin de la


misma hay un error de tal manera que frente al nucletido de C se sita otro de
citosina (en lugar de uno de guanina). Se modificar la secuencia peptdica codificada
por esa hebra de ADN?

9. Una molcula de ADN posee un 60 % de nucletidos de T y A. Indique el porcentaje


de cada uno de los nucletidos que forman parte de dicho ADN.

10. Analice las siguientes afirmaciones y conteste:

a.) Tanto en procariotas como en eucariotas es posible obtener diferentes


polipptidos a partir de un mismo RNAm"

b.) En eucariotas no es posible acoplar los procesos de transcripcin con traduccin

11. Complete las siguientes oraciones, escogiendo entre las dos opciones propuestas
en cada caso:

a.) La replicacin y la transcripcin ocurren con la polaridad ___________ (5' a 3'; 3' a
5'). La replicacin es un proceso __________ (simtrico; asimtrico) porque ambas
hebras del DNA se replican. La enzima DNA polimerasa participa en ___________
(replicacin; transcripcin). Tambin es una enzima autocorrectora, puesto que
adems de la actividad cataltica de polimerasa posee la actividad de exonucleasa
de _________ (5' a 3'; 3' a 5').

b.) En la replicacin del DNA la hebra templada que posee la polaridad 5 en la base de
la horquilla y 3 en el punto de bifurcacin se llama hebra __________ (conductora;
retardada), por lo que el proceso de replicacin de esta hebra es ___________ (continuo;
discontinuo). La enzima que inicia la replicacin es la __________ (DNA polimerasa;
primasa), que acta brindando un fragmento de RNA que sirva de punto de partida
para la sntesis de la cadena polinucletidica.

c.) Usted tiene el siguiente RNAm:

5-
UCGGCUAUGGGGCUCUGCCGAAGUAGACGAGGGCGAUGGCGAAGACGAUAACCCGCCUAG
3
Esta hebra de RNA se obtuvo por ___________ (transcripcin; replicacin) de la hebra
___________ (codificadora; templado) del DNA, con la cual su secuencia es
complementaria. En cambio, la secuencia del RNAm es idntica a la hebra
___________ (codificadora; templado) del DNA.