You are on page 1of 9

Pathogens and Disease ISSN 2049-632X

RESEARCH ARTICLE

Temporal expression of agrB, cidA, and alsS in the early


development of Staphylococcus aureus UAMS-1 biofilm formation
and the structural role of extracellular DNA and carbohydrates
Rossella Grande1,2, Laura Nistico1, Karthik Sambanthamoorthy3, Mark Longwell1, Antonio Iannitelli2,
Luigina Cellini2, Antonio Di Stefano2, Luanne Hall Stoodley1,4,5 & Paul Stoodley1,5,6,7
1 Center for Genomic Sciences, Allegheny-Singer Research Institute, Pittsburgh, PA, USA
2 Department of Pharmacy, University G. dAnnunzio, Chieti-Pescara, Chieti, Italy
3 Wound Infections, Division of Bacterial and Rickettsial Diseases, Walter Reed Army institute of Research, Maryland, USA
4 Wellcome Trust Clinical Research Facility (WTCRF), Southampton General Hospital, Southampton, UK
5 National Centre for Advanced Tribology at Southampton (nCATS), School of Engineering, University of Southampton, Southampton, UK
6 Department of Microbial Infection and Immunity, Center for Microbial Interface Biology, Ohio State University, Columbus, OH, USA
7 Department of Orthopedics, Ohio State University, Columbus, OH, USA

The goal of Grande and colleagues was to investigate temporal expression of genes involved in early biofilm formation and
to investigate the production of extracellular DNA (eDNA) by Staphylococcus aureus. The data reported here indicate that
eDNA is important for early biofilm development, but that treatment with DNase I alone is not sufficient to cause complete
disruption of the biofilm. It is clear that other components (e.g., polysaccharides) play an important role in the structural
stability of biofilms, and combining DNase I and polysaccharide-degrading enzymes may hold broader promise as a
therapeutic approach.

Keywords Abstract
biofilm; Staphylococcus aureus; agrB; alsS;
cidA; eDNA; carbohydrate. Extracellular DNA (eDNA) is an important component of the extracellular polymeric
substance matrix and is important in the establishment and persistence of
Correspondence Staphylococcus aureus UAMS-1 biofilms. The aim of the study was to determine
Paul Stoodley, Center for Microbial Interface the temporal expression of genes involved in early biofilm formation and eDNA
Biology, Ohio State University, 716 Biomed- production. We used qPCR to investigate expression of agrB, which is associated
ical Research Tower, 460 W. 12th Ave., with secreted virulence factors and biofilm dispersal, cidA, which is associated with
Columbus, OH 43210, USA. biofilm adherence and genomic DNA release, and alsS, which is associated with cell
Tel.: 614 292 7826 lysis, eDNA release and acid tolerance. The contribution of eDNA to the stability of
fax: 614 292 9616 the biofilm matrix was assessed by digesting with DNase I (Pulmozyme) and
e-mail: pstoodley@gmail.com quantifying structure by confocal microscopy and COMSTAT image analysis. AgrB
expression initially increased at 24 h but then dramatically decreased at 72 h in an
Received 30 October 2013; revised 5 inverse relationship to biomass, supporting its role in regulating biofilm dispersal.
February 2014; accepted 6 February 2014. cidA and alsS expression steadily increased over 72 h, suggesting that eDNA was
Final version published online 11 March an important component of early biofilm development. DNase I had no effect on
2014. biomass, but did cause the biofilms to become more heterogeneous. Carbohydrates
in the matrix appeared to play an important role in structural stability.
doi:10.1111/2049-632X.12158

Editor: Tom Coenye

biofilms are embedded in extracellular polymeric substances


Introduction
(EPS), a mixture of macromolecules such as exopolysaccha-
Staphylococcus aureus is a leading cause of nosocomial rides, proteins and extracellular DNA (eDNA). These com-
infections including those associated with orthopedic ponents vary with bacterial strain, culture conditions and
implants (Otto, 2008; Papa et al., 2013). Biofilm formation biofilm age (Whitchurch et al., 2002; Steinberger & Holden,
confers antibiotic tolerance and protection from the host 2005; Allesen-Holm et al., 2006). Biofilm development is a
immune system making microbial biofilms difficult to remove multistep regulated process in which cellular adherence, EPS
(Fux et al., 2005; Hall-Stoodley et al., 2012). Bacterial cells in secretion and detachment of bacteria from the maturing

414 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al. eDNA and carbohydrates in S. aureus biofilm

biofilm are controlled by the regulation of numerous genes. Tryptic Soy Broth (TSB; Oxoid) supplemented with 0.6%
For example, the agr global regulator, a two-component NaCl (w/v) and 0.8% (w/v) glucose and incubated overnight
quorum-sensing system, controls cell detachment and the with shaking at 37 C. The overnight broth culture was
transition between planktonic and sessile lifestyles, diluted to an optical density of 0.1 at 650 nm (Spectronic
contributing to S. aureus survival via cell dispersal and 20D+, Thermo Fisher Scientific Inc. Waltham, MA). Two mL
colonization of new niches (Yarwood et al., 2004; Boles & of the diluted broth culture was inoculated into polystyrene
Horswill, 2008). The cidA gene, involved in cell lysis and Petri plates (Falcon) treated with either 200 lg mL1 of
eDNA release (Ranjit et al., 2011), is part of the cidR regulon synthetic DNase I (Pulmozyme/Dornase alfa) [1 mg mL1]
that also includes alsSD and in turn encodes a-acetolactate (Genentech Inc., San Francisco, CA) or 200 lL of Pulmo-
synthase and a-acetolactate decarboxylase, which are zyme buffer alone (8.7 mg mL1 NaCl, 0.15 mg mL1
responsible for the production of acetoin, an important CaCl2 (untreated controls) for confocal laser scanning
physiological metabolite secreted by many microorganisms microscopy (CLSM) analysis. For RNA isolation, 25 mL of
(Renna et al., 1993; Cho et al., 2013) for survival in acidic diluted broth culture was inoculated into Petri plates, and
environments (Yang et al., 2006). samples were incubated at 37 C, without shaking for
The presence of extracellular deoxyribonucleic acid 30 min to promote cell adhesion, followed by shaking for
(eDNA) in the slime layers of various halophilic bacteria 2, 24, or 72 h. These time points were chosen based on
was first described by Smithies and Gibbons (1955). Since those described by Mann et al. (2009). Medium containing
then, the role of eDNA as an important structural component DNase I or buffer alone was changed daily, and each
of the biofilm extracellular matrix in both Gram-negative experiment was performed in triplicate.
(Allesen-Holm et al., 2006; Harmsen et al., 2010) and
Gram-positive bacteria (Moscosco et al., 2006, Izano et al.,
Isolation of RNA
2008; Hall-Stoodley et al., 2008; Rice et al., 2007) has been
documented in multiple studies. These studies showed a For isolating total cellular RNA, S. aureus biofilms were
significant reduction in biofilm biomass upon the addition of removed using a cell scraper, and RNA was extracted as
DNase I to the culture medium, supporting the hypothesis previously described by Sambanthamoorthy et al. (2006).
that eDNA plays an important role in biofilm establishment Briefly, cells were harvested by centrifugation (5000 g for
and structural stability. The source of eDNA has been 5 min at 4 C) and resuspended in TES buffer containing
hypothesized to result from several mechanisms of DNA 100 lg lysostaphin mL1 (AMBI). The samples were incu-
release, such as the excretion of small vesicles from the outer bated at room temperature for 10 min and were then applied
membranes (Renelli et al., 2004; Manning & Kuehn, 2013), to a QiagenRNeasy Maxi column to isolate total bacterial
prophage-mediated cell death in Pseudomonas aeruginosa RNA according to the manufacturers directions. The
biofilms (Webb et al., 2004) and controlled cellular lysis optional on-column RNase-free DNase I (Qiagen) was used
during biofilm formation in S. aureus (Rice et al., 2007). to remove contaminating DNA. After isolation of RNA, traces
In this study, we evaluated the temporal expression of of contaminating DNA were further eliminated by treating
biofilm-specific genes: agrB, cidA, and alsS during RNA samples with RNase-free DNase I (DNA-free kit,
S. aureus UAMS-1 biofilm development. We used saline Ambion) and incubating at 37 C for 20 min. Samples were
and glucose concentrations to approximate those that might used immediately or stored at 80 C. The quality, integrity,
be encountered in an orthopedic implant patient suffering and concentration of the RNA were checked using an
from diabetes, an established risk factor for implant related Agilent 2100 Bioanalyzer (Agilent Technologies, Santa
infection (Lovati et al., 2013). Both glucose and salinity have Clara, CA) according to the manufacturers instructions,
been shown to play an important role in influencing the and RNA preparations were tested for contaminating DNA
effect of transcriptional regulators agr and rbf on the degree by no-reverse-transcriptase PCR reactions.
of staphylococcal biofilm formation (Lim et al., 2004; Boles
& Horswill, 2008). In addition, biofilms were treated with
Real-time quantitative PCR (qPCR)
DNase I (Pulmozyme, which is used to treat cystic
fibrosis-related lung infection) to test how effective eDNA Oligonucleotide primers and TaqMan probes (Fam-labeled
digestion was in preventing biofilm formation and destabi- TaqMan TAMRA probes) were designed with PRIMER EXPRESS
lizing the biofilm matrix. We also used a lectin cocktail to 2.0 software (ABI PRISM; PE Biosystems, Framingham, MA),
assess the distribution of carbohydrates in the matrix to to amplify gene fragments having an optimal size of
assess the relative contribution that they might play in 70180 bp (Table 1). The constitutively expressed gyrase
biofilm structure and stability. gene (gyr) was used as an endogenous control, as previ-
ously described (Goerke et al., 2000). Measurements of
relative levels of gene expression were performed by qPCR
Materials and methods as previously described (Sambanthamoorthy et al., 2006;
Hall-Stoodley et al., 2008). All qPCR reactions were per-
Bacterial strain and biofilm growth conditions
formed in triplicate from each of two independent experi-
Staphylococcus aureus UAMS-1, an oxacillin-susceptible ments, and the mean CT was used for analysis. Two-fold or
clinical strain obtained from the bone of a patient suffering higher changes in gene expression were considered
from osteomyelitis (Gillaspy et al., 1995), was grown in significant.

Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 415
eDNA and carbohydrates in S. aureus biofilm R. Grande et al.

Table 1 Oligonucleotide primers and TaqMan probes used in qPCR analysis of gene expression

Primer TaqMan probe


Gene Sequences 50 ?30 Sequences 50 ?30
agrB F: TGCAAAGTCTTCGATACTTTGTTACA TCTATTATAGGATTGATTTCCGTTGTTATTTATGCACCG
R: GGTATAGGTTGCTTTTTCGTTGCT
alsS F: AATGGTATGCAAACGCTTGGT AGCATTACCGTGGGCAATTTCAGCTG
R: GCGTATTAGGGCGCACAAGT
cidA F: GCATTGGTCCTGTCGTTTCA ACCAAACAGACCTTTCATAAAACCATCTTGCATTA
R: GGCAACGCTAGGATTTACAACAT

thresholding was used to eliminate residual noise in the


Confocal laser scanning microscopic analysis
image stacks. Prior to analysis, each thresholded image
To evaluate S. aureus UAMS-1 biofilm development with stack was visually compared with the original image files to
and without DNase I treatment using CLSM, biofilms were ensure that the settings had eliminated noise but not
removed at 2, 24, or 72 h and rinsed with Hanks balanced relevant data (Heydorn et al., 2000; Hall-Stoodley et al.,
salt solution (HBSS) with Ca+2 and Mg+2 to remove 2008). The biofilm parameters maximum thickness,
planktonic and loosely adherent cells. Samples were stained biomass, and roughness coefficient (which correlates with
either with the BacLight Live/Dead stain (Invitrogen, Carls- biofilm heterogeneity) were determined for each image
bad, CA) or with a fluorescent Alexa 488-labeled lectin stack, and total biomass was found by adding the green
cocktail and Syto59, as described (Hall-Stoodley et al., channel (EPS carbohydrates) and the blue channel
2008), and image stacks of S. aureus UAMS-1 biofilms
were taken randomly from five different fields. The carbo-
hydrate Alexa 488 lectin cocktail was excited with the (a)
488 nm laser, and the emitted signal was detected in
channel 1 (assigned green) with a detection window set to
500550 nm. The nucleic acid-specific stain, Syto59, was
excited with the 630 nm red laser line, and the channel 2
(assigned red) detection window set to c. 640660 nm, and
the gain and background adjusted until individual bacterial
cells were sharply defined with a minimum amount of noise
(random pixel speckles) between individual cells. At the
settings optimized for bacterial cells containing concentrated
nucleic acids, any signal from eDNA was too faint to be
detected. Therefore, the channel 3 (assigned blue) window (b)
was set to c. 660720 nm, which also detected emitted light
from the Syto59, and the bacteria were deliberately
over-exposed by turning up the gain to reveal signal for
the eDNA surrounding and in between bacterial cells. To
minimize flaring artifacts caused by the high gain, we
identified single isolated bacteria cells in multiple fields of
view, which did not appear to have associated eDNA
(identified by lack of signal). Using this iterative process, we
were able to differentiate signal from noise by frame
averaging, while maintaining a gain that resulted in sharply
defined edges to the signal optimized cells. The background (c)
was set to be at this minimum threshold for noise when all
signal was eliminated (i.e., gain turned to zero) where the
blue channel included signal from bacterial cells and eDNA.
Between two and six stacks were taken from between four
and seven independent replicate biofilm plates, providing an
n = 23 and n = 27 stacks per time point for the Pulmozyme
(DNase I)-treated samples and corresponding controls.

COMSTAT image analysis


Confocal image stacks for each sample, at each time point,
were analyzed using the LEICA LCS software, COMSTAT (16) Fig. 1 Temporal relative expression of agrB (a); alsS (b); cidA (c) genes
and IMARIS software (Bitplane; St. Paul, MN). COMSTAT in the biofilm.

416 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al. eDNA and carbohydrates in S. aureus biofilm

(bacteria + eDNA). The eDNA biomass was found by (Pulmozyme; 1 mg mL1) or buffer alone was added to
subtracting the red channel (bacteria) from the blue channel. biofilms on duplicate plates, incubated at 37 C for 90 min,
rinsed with HBSS, stained with BacLight kit and analysis
was performed by CLSM as previously described. Experi-
Cell viability assays
ments were performed in duplicate.
Colony-forming unit (CFU) enumeration and in situ Live/
Dead staining were carried out to evaluate bacterial cell
Statistical analysis
viability in S. aureus biofilms at 72 h and were evaluated as
described (Hall-Stoodley et al., 2008). CFUs were deter- Statistical analysis of the variance was performed using the
mined by rinsing the biofilms and removing adherent cells ANOVA program (EXCEL 2000; Microsoft). Differences were
from an area of 9.6 cm2 with a cell scraper (Corning Life reported as statistically significant for P < 0.05.
Sciences, Pittsburgh, PA). Each sample was resuspended
in 2 mL HBSS, vortexed, diluted, plated on TSA, and
incubated at 37 C.
Results
agrB, alsS, and cidA expression changes during biofilm
DNase I (Pulmozyme) treatment of preformed S. aureus development
biofilms
The expression of agrB, alsS, and cidA genes was evaluated
S. aureus biofilms were grown as previously described for a by qPCR at 2, 24, and 72 h of incubation in untreated
period of 72 h and rinsed three times with HBSS. DNase I S. aureus biofilms to evaluate the expression of these genes

(a) (b)

(c) (d)

(e) (f)

Fig. 2 CLSM representative images of


biofilm development of DNase I-treated and
non-treated (control) S. aureus UAMS-1
samples stained with lectin cocktail (green)
and Syto 59 (red and blue) after 2, 24, and
72 h of incubation. Images are compressed
z series, where multiple xy planes from top
to bottom of the biofilm are combined.
DNase I-treated samples: (b) (2 h); (d)
(24 h); and (f) (72 h). Controls: (a) (2 h); (c)
(24 h); (e) (72 h). Scale bar = 47 lm.

Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 417
eDNA and carbohydrates in S. aureus biofilm R. Grande et al.

as a function of time during biofilm development. The statistically significant (P > 0.05) in DNase I-treated biofilm
expression of agrB initially increased by over a factor of 10 cultures. However, biofilms grown in the presence of DNase
at 24 h and then significantly (P < 0.05) decreased by a I had a significantly greater (P < 0.05) maximum thickness
factor of over 10 000 at 72 h (Fig. 1a). In contrast, the and roughness coefficient (P < 0.05) compared with
expression of both alsS and cidA steadily increased over time untreated controls after 72 h (Fig. 5), indicating greater
to c. 20 and 90 fold, respectively, after 72 h (Fig. 1b and c). surface heterogeneity. These data are consistent with the
visual inspection of the confocal images, which showed
greater heterogeneity in patchy tower formation in the
S. aureus biofilm structure differed over time in
DNase I grown biofilms. Both biofilms showed a reduction
DNase-treated samples
in biomass of c. 50% or greater between 2 and 24 h, with a
Bacterial cells were adherent to the surface and exhibited no subsequent increase after 72 h.
difference in biofilm structure between control and DNase
I-treated samples following 2 h of incubation (Fig. 2a and b).
DNase I (Pulmozyme) digestion on preformed biofilm
At 24 h, although there was a reduction in biomass (by
did not affect the concentration of viable S. aureus
volume), the reduction in biomass was observed in both
biofilm cells
untreated and DNase-treated samples (Fig. 2c and d).
However, differences in biofilm architecture between treated Assessment of biofilm CFU cm2 together with in situ
and untreated samples were evident at both 24 and 72 h of viability assessment with the BacLight Live/Dead assay at
incubation (Fig. 2e and f). DNase I-treated samples con- different time points demonstrated no significant differences
sisted of biofilms characterized by towers, heterogeneously between controls (P > 0.05), and DNase I-treated samples
dispersed among voids with a few bacteria juxtaposed on a indicating that DNase I treatment alone did not adversely
background of carbohydrate visualized by bound lectin affect cell viability, which was 7.0  0.9 CFU cm2 and
(Fig. 2f). eDNA was detected both in untreated and treated 6.6  0.6 CFU cm2 in the control and DNase I-treated
samples inside the biofilm (Fig. 3) with undigested eDNA biofilms, respectively, at 72 h.
inside carbohydrates structures bound by lectins (Fig. 4c, d
and e), which may have protected it from DNase digestion.
The distribution of eDNA in both treated and untreated
Discussion
biofilms was heterogeneous, as illustrated by comparing Biofilm formation results from a multistep process that is
Fig. 3a, which was in an area with relatively little eDNA regulated over time by several genes. Our data showed that
compared with the areas shown in Fig. 1. agrB gene expression originally increased by over tenfold at
COMSTAT analysis indicated that after 24 h, the number of 24 h but then dramatically decreased from that level by over
total cells, carbohydrate EPS, and eDNA biomass was not 10 000 fold at 72 h. The biofilm biomass (cells, EPS, and

(a) (b)

(c) (d)
Fig. 3 CLSM representative image of S.
aureus UAMS-1 control (DNase I
untreated) 24 h biofilm showing localized
carbohydrate and eDNA in the EPS. (a)
Lectin cocktail (green fluorescence) and (b,
c) Syto 59 (red and blue). Carbohydrates
are colored in green; bacterial cells in red
and eDNA plus cells in blue. (d) Overlay of
the three channels, the blue shadow
around the cells visualized the eDNA
released by the cells. Scale bar = 9 lm.

418 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al. eDNA and carbohydrates in S. aureus biofilm

(a) initial attachment, followed by a second phase of growth


(Kroukamp et al., 2010) with subsequent oscillations
between detachment and growth (Lewandowski et al.,
2007). It is thought that these oscillations occur due to
detachment caused by fluid shear, nutrient depletion, and
degradation at the base of the biofilm followed by regrowth,
but agrB expression data suggest that in S. aureus UAMS
the early oscillation might be part of a regulated develop-
ment. qPCR data correlated well with fluctuations in the
biofilm biomass, suggesting that it is not just the presence or
absence of agrB, that plays a role in the biofilm develop-
ment, but also the temporal expression of agr genes(Otto,
2001, 2008).
Studies using agr knockouts showed that agr is capable of
differentially affecting glucose-induced biofilm on polysty-
rene surfaces under static conditions (Vuong et al., 2000)
and occurs by two major functions of the agr system: (1)
repression of adhesin production thereby preventing attach-
(b) (c) ment to surface and (2) increased expression of d-hemol-
ysin, which via its detergent-like and protease function
negatively affects biofilm maturation. Significantly, the
presence of glucose represses the expression of agr and
generates a low pH, establishing an acidic environment
(Regassa & Betley, 1992; Regassa et al., 1992; ONeill
et al., 2008). This is in accordance with agrB expression,
which demonstrated a significant decrease coupled with an
increase in alsS expression over time. This gene belongs to
(d) (e)
the bicistronic operon alsSD which encodes the enzymes
acetolactate synthase and acetolactate decarboxylase that
function collaboratively to convert pyruvate to 2-acetolactate
and then acetoin, the latter eventually being converted by
acetoin reductase to 2,3-butanediol. The production of
acetoin and 2,3-butanediol has been shown to be important
for acid tolerance in a number of bacterial species (Kovac-
ikova et al., 2005). When S. aureus is grown on glucose,
lactic acid is the end product of fermentation (Gardner &
Fig. 4 CLSM representative image of Staphylococcus aureus UAMS-1 Lascelles, 1962). Although our system was aerated, micro-
biofilm treated with DNase I at 24 h of incubation. (a) Carbohydrate electrode studies have demonstrated that biofilms formed by
structures (green) associated with clustered cells (red) and eDNA (blue). aerobic or facultative bacteria consume oxygen at the
Scale bar = 16 lm; (b, c, d) images represent the green, red, and blue periphery of the biofilm, leaving the inside of biofilm towers
channels that detect carbohydrates, cells, and cells plus eDNA, microaerophilic or anaerobic with resulting localized build-up
respectively. (e) Overlay of the three channels. Scale bar = 5 lm. of acid in the interior of biofilm clusters (Von Ohle et al.,
2010). It is possible that a similar mechanism may explain
the increased levels of alsS expression as the biofilm
eDNA) was inversely correlated with agrB expression, as developed. Our results are consistent with the observations
expected as the agr operon regulates dispersal from biofilms that alsS was expressed at higher levels when S. aureus
(Yarwood et al., 2004; Boles & Horswill, 2008). It was not was subjected to mild acid treatment (Weinrick et al., 2004)
clear why the newly attached bacteria would initially exhibit highlighting the adaptation pattern of S. aureus to persist
an increase in agr expression, which would suggest an within a biofilm by surviving an acidic biofilm environment
increase in secreted virulence factors, increased dispersal associated with carbohydrate metabolism (Beenken et al.,
and subsequent reduction in biomass at only 24 h, 2004). Acid tolerance within the biofilm has also be shown to
particularly when increasing cidA and alsS expression be important in Streptococcus mutans (Kovacikova et al.,
suggested that eDNA release was rising. Rather, the 2005; Welin-Neilands & Svensater, 2007), Vibrio cholerae
expected response would be that after initial attachment, and in other biofilm forming pathogens, which either live in
planktonic bacteria would immediately begin the phenotypic an acid environment or generate low pH from fermentation
shift to the early-stage biofilm phenotype in which secreted acids deeper in the biofilm where oxygen levels are low. The
virulence factors would be suppressed while initiating the localized production of acid and anaerobic conditions in
process of matrix building and biofilm formation. However, it biofilms growing on indwelling devices such as orthopedic
is not uncommon to see a natural reduction in biomass after implants, surgical sutures and meshes and intravascular

Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 419
eDNA and carbohydrates in S. aureus biofilm R. Grande et al.

Fig. 5 COMSTAT analysis of the temporal


behavior of S. aureus UAMS-1 treated with
DNase I and untreated biofilms in terms of
cell biomass, EPS biomass, eDNA
biomass, cells plus eDNA biomass, and
cells plus eDNA roughness. Each value
plotted is the mean of data from 27 image
stacks acquired randomly in three
independent experiments at 2, 24, and 72 h
of incubation.

catheters may therefore have clinical relevance in terms of suggests that eDNA in the biofilm was stabilized (Steinber-
antibiotic tolerance and resistance to host clearance. DNase ger & Holden, 2005) or protected by the other EPS
1 also has an optimal activity in a pH range of 6.57.0 components such as carbohydrates. These conditions have
(Yasuda et al., 2004), and pH gradients within the biofilm been previously demonstrated to inhibit the activity of
might result in more effective eDNA degradation only on the DNase I (Ramsey et al., 1993).
outer parts of the biofilm. Taken with data from other studies, which have shown
The increased expression of alsS gene over time is also in that eDNA is important for the mechanical stability of
accordance with the expression of cidA. The production of staphylococcal biofilms (Mann et al., 2009), our data sug-
acetoin, due to the expression of the als operon, is linked to gest that the relative contribution of eDNA to overall stability
the control of apoptosis (Yang et al., 2006), and cidA may be growth and strain dependant and is consistent with
increases murein hydrolase activity contributing to bacterial other studies demonstrating that although the biofilm matrix
cell lysis, DNA release and biofilm development (Rice et al., contains significant amounts of eDNA, it is not necessarily
2007). Despite the steady increased expression of cidA and dispersed by DNase (Lappann et al., 2010; Grande et al.,
alsS, which suggest eDNA release increased during biofilm 2011; Shields et al., 2013). However, we did find evidence
formation, DNase I (Pulmozyme) treatment did not show that eDNA plays a role in biofilm morphology. These data
promise in disrupting S. aureus biofilms, as it did for agree with those of Tetz et al., 2009 who showed that
pneumococcal biofilms (Hall-Stoodley et al., 2008). Further- biofilm morphology was modified in the presence of DNase I
more the results of the present study differ from those of in seven different Gram-negative and Gram-positive species
Rice et al., 2007 who showed that DNase I treatment including S. aureus, although the numbers of CFU remained
significantly decreased S. aureus UAMS-1 biofilms by unchanged, and the biofilm biomass was reduced by 33
sixfold relative to untreated biofilm and may be due to the 50% depending on the species. They concluded that the role
different culture conditions used in this study. A possible of eDNA in structure was not clear, but they did demonstrate
explanation of this discrepancy is the difference in glucose increased antibiotic efficacy with combined treatments,
and salt concentrations. We used a salt concentration of consistent with other studies (Kaplan et al., 2012; Jakubov-
1.1% to more closely represent physiological conditions ics et al., 2013). While DNase I has been used to demon-
inside the body (isotonic saline is 0.9%) and approximate strate the role of eDNA in biofilm stability in staphyolococcal
the orthopedic environment, whereas Rice et al. (2007) biofilms, there are potential therapeutic applications for
used 3.5%, which is more consistent with skin concentra- treating infections. However, further studies are required to
tions. Salt concentration is important in S. aureus biofilms assess the efficacy of DNase I to disrupt biofilms grown
and appears to stimulate biofilm growth (Whitchurch et al., from different strains, over longer time periods and under a
2002; Steinberger & Holden, 2005; Allesen-Holm et al., range of physiological glucose and salt concentrations.
2006). Moreover, the resistance of biofilm to degradation by Incubation times and concentrations also need to be
DNase I after an initial growth period (Weinrick et al., 2004) optimized.

420 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
R. Grande et al. eDNA and carbohydrates in S. aureus biofilm

In our studies, we concluded that carbohydrates in the pathogenesis of staphylococcal osteomyelitis. Infect Immun 63:
EPS were also present and may have played an important 33733380.
structural role. Carbohydrates and surface proteins involved Goerke C, Campana S, Bayer MG, Do ring G, Botzenhart K & Wolz
in adherence are known to be important in the EPS matrix C (2000) Direct quantitative transcript analysis of the agr regulon
of Staphylococcus aureus during human infection in comparison
and biofilm establishment (Toledo-Arana et al., 2001;
to the expression profile in vitro. Infect Immun 68: 13041311.
Hall-Stoodley et al., 2008; Vergara-Irigaray et al., 2008). Grande R, Di Giulio M, Bessa LJ, Di Campli E, Baffoni M, Guarnieri
Poly-b (1,6)-N-acetyl-D-glucosamine (PNAG) is a surface S & Cellini L (2011) Extracellular DNA in Helicobacter pylori
polysaccharide involved in biofilm accumulation and evasion biofilm: a backstairs rumour. J Appl Microbiol 110: 490498.
of the host immune system in S. aureus and S. epidermidis Hall-Stoodley L, Nistico L, Sambanthamoorthy K et al. (2008)
(Izano et al., 2008; Babra et al., 2013), and it has been Characterization of biofilm matrix, degradation by DNase treat-
demonstrated that dispersin B, a PNAG-degrading enzyme, ment and evidence of capsule downregulation in Streptococcus
was capable of detaching S. epidermidis biofilm, while pneumoniae clinical isolates. BMC Microbiol 8: 173.
DNase I primarily affected S. aureus biofilms (Izano et al., Hall-Stoodley L, Stoodley P, Kathju S, Hiby N, Moser C, Costerton
2008). Our data suggest that multiple EPS components JW, Moter A & Bjarnsholt T (2012) Towards diagnostic guidelines
for biofilm-associated infections. FEMS Immunol Med Microbiol
need to be targeted to effectively disrupt biofilms.
65: 127145.
In conclusion, our data support the hypothesis that biofilm Harmsen M, Lappann M, Knchel S & Molin S (2010) Role of
development is a multifactorial process associated with the extracellular DNA during biofilm formation by Listeria monocyt-
differential expression of genes over time during biofilm ogenes. Appl Environ Microbiol 76: 22712279.
development. Composition of the S. aureus biofilm matrix Heydorn A, Nielsen AT, Hentzer M, Sternberg C, Givskov M, Ersbll
appears to be complex. Subsequently, the addition of a BK & Molin S (2000) Quantification of biofilm structures by the
single degradative enzyme such as DNase I may not cause novel computer program COMSTAT. Microbiology 146: 23952407.
sufficient disruption to S. aureus biofilms to have clinical Izano EA, Amarante MA, Kher WB & Kaplan JB (2008) Differential
potential. However, treatment of S. aureus biofilm with a roles of poly-N-acetylglucosamine surface polysaccharide and
mixture of DNase I and other enzymes, capable of digesting extracellular DNA in Staphylococcus aureus and Staphylococcus
epidermidis biofilms. Appl Environ Microbiol 74: 470476.
biofilm carbohydrate polymers within the matrix, may be
Jakubovics NS, Shields RC, Rajarajan N & Burgess JG (2013) Life
more promising. after death: the critical role of extracellular DNA in microbial
biofilms. Lett Appl Microbiol 57: 467475.
Authors contribution Kaplan JB, LoVetri K, Cardona ST, Madhyastha S, Sadovskaya I,
Jabbouri S & Izano EA (2012) Recombinant human DNase I
P.S. and L.H.S. contributed equally to this work. L.N. and decreases biofilm and increases antimicrobial susceptibility in
K.S. contributed equally to this work. staphylococci. J Antibiot 65: 7377.
Kovacikova G, Lin W & Skorupski K (2005) Dual regulation of genes
involved in acetoin biosynthesis and motility/biofilm formation by
References the virulence activator AphA and the acetate-responsive LysR-type
Allesen-Holm M, Barken KB, Yang L, Klausen M, Webb JS, regulator AlsR in Vibrio cholera. Mol Microbiol 57: 420433.
Kjelleberg S, Molin S, Givskov M & Tolker-Nielsen T (2006) A Kroukamp O, Dumitrache RG & Wolfaardt GM (2010) Pronounced
characterization of DNA release in Pseudomonas aeruginosa effect of the nature of the inoculum on biofilm development in flow
cultures and biofilms. Mol Microbiol 59: 11141128. systems. Appl Environ Microbiol 76: 60256031.
Babra C, Tiwari J, Costantino P, Sunagar R, Isloor S, Hegde N & Lappann M, Claus H, van Alen T, Harmsen M, Elias J, Molin S &
Mukkur T (2013) Human methicillin-sensitive Staphylococcus Vogel U (2010) A dual role of extracellular DNA during biofilm
aureus biofilms: potential associations with antibiotic resistance formation of Neisseria meningitides. Mol Microbiol 75: 1355
persistence and surface polysaccharide antigens. J Basic 1371.
Microbiol 2013 May 17. doi: 10.1002/jobm.201200557 [Epub Lewandowski Z, Beyenal H, Myers J & Stookey D (2007) The effect
ahead of print]. of detachment on biofilm structure and activity: the oscillating
Beenken KE, Dunman PM, McAleese F, Macapagal D, Murphy E, pattern of biofilm accumulation. Water Sci Technol 55: 429436.
Projan SJBlevins JS & Smeltzer MS (2004) Global gene expres- Lim Y, Jana M, Luong TT & Lee CY (2004) Control of glucose- and
sion in Staphylococcus aureus biofilms. J Bacteriol 186: 4665 NaCl-induced biofilm formation by rbf in Staphylococcus aureus.
4684. J Bacteriol 186: 722729.
Boles BR & Horswill AR (2008) agr-mediated dispersal of Staph- Lovati AB, Drago L, Monti L, De Vecchi E, Previdi S, Banfi G &
Romano  CL (2013) Diabetic mouse model of orthopaedic
ylococcus aureus biofilms. PLoS Pathog 4: e1000052.
Cho S, Kim KD, Ahn JH, Lee J, Kim SW & Um Y (2013) Selective implant-related Staphylococcus aureus infection. PLoS One 8:
production of 2,3-butanediol and acetoin by a newly isolated e67628.
bacterium Klebsiella oxytoca M1. Appl Biochem Biotechnol 170: Mann EE, Rice KC, Boles BR, Endres JL, Ranjit D, Chandramohan
19221933. L, Tsang LH & Smeltzer MS (2009) Horswill AR & Bayles KW
Fux CA, Costerton JW, Stewart PS & Stoodley P (2005) Survival (2009) Modulation of eDNA release and degradation affects
strategies of infectious biofilms. Trends Microbiol 13: 3440. Staphylococcus aureus biofilm maturation. PLoS One 4: e5822.
Gardner JF & Lascelles J (1962) The requirement for acetate of a Manning AJ & Kuehn MJ (2013) Functional advantages conferred
streptomycin-resistant strain of Staphylococcus aureus. J Gen by extracellular prokaryotic membrane vesicles. J Mol Microbiol
Microbiol 29: 157162. Biotechnol 23: 131141.
Gillaspy AF, Hickmon SG, Skinner RA, Thomas JR, Nelson CL & Moscoso M, Garca E, L opez R (2006) Biofilm formation by
Smeltzer MS (1995) Role of the accessory gene regulator (agr) in Streptococcus pneumoniae: role of choline, extracellular DNA,

Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved 421
eDNA and carbohydrates in S. aureus biofilm R. Grande et al.

and capsular polysaccharide in microbial accretion. J Bacteriol Steinberger RE & Holden PA (2005) Extracellular DNA in single-
188(22): 778595. and multiple-species unsaturated biofilms. Appl Environ Microbiol
Novick RP & Geisinger E (2008) Quorum sensing in staphylococci. 71: 54045410.
Annu Rev Genet 42: 541564. Tetz GV, Artemenko NK & Tetz VV (2009) Effect of DNase and
Otto M (2001) Staphylococcus aureus and Staphylococcus epide- antibiotics on biofilm characteristics. Antimicrob Agents Chemo-
rmidis peptide pheromones produced by the accessory gene ther 53: 12041209.
regulator agr system. Peptides 22: 16031608. Toledo-Arana A, Valle J, Solano C, Arrizubieta MJ, Cucarella C,
Otto M (2008) Staphylococcal biofilms. Curr Top Microbiol Immunol Lamata M, Amorena B, Leiva J, Penade  s JR & Lasa I (2001) The
322: 207228. enterococcal surface protein, Esp, is involved in Enterococcus
Papa R, Artini M, Cellini A, Tilotta M, Galano E, Pucci P, Amoresano faecalis biofilm formation. Appl Environ Microbiol 67: 45384545.
A & Selan L (2013) A new anti-infective strategy to reduce the Vergara-Irigaray M, Maira-Litra n T, Merino N, Pier GB, Penade  s JR
spreading of antibiotic resistance by the action on adhesion-med- & Lasa I (2008) Wall teichoic acids are dispensable for anchoring
iated virulence factors in Staphylococcus aureus. Microb Pathog the PNAG exopolysaccharide to the Staphylococcus aureus cell
63: 4453. surface. Microbiology 154: 865877.
Ramsey BW, Astley SJ, Aitken ML et al. (1993) Efficacy and safety Von Ohle C, Gieseke A, Nistico L, Decker EM, deBeer D & Stoodley
of short-term administration of aerosolized recombinant human P (2010) Real-time microsensor measurement of local metabolic
deoxyribonuclease in patients with cystic fibrosis. Am Rev Respir activities in ex vivo dental biofilms exposed to sucrose and treated
Dis 148: 145151. with chlorhexidine. Appl Environ Microbiol 76: 23262334.
Ranjit DK, Endres JL & Bayles KW (2011) Staphylococcus aureus Vuong C, Saenz HL, Gotz F & Otto M (2000) Impact of the agr
CidA and LrgA proteins exhibit holin-like properties. J Bacteriol quorum-sensing system on adherence to polystyrene in Staph-
193: 24682476. ylococcus aureus. J Infect Dis 182: 16881693.
Regassa LB & Betley MJ (1992) Alkaline pH decreases expression Webb JS, Lau M & Kjelleberg S (2004) Bacteriophage and
of the accessory gene regulator (agr) in Staphylococcus aureus. J phenotypic variation in Pseudomonas aeruginosa biofilm devel-
Bacteriol 174: 50955100. opment. J Bacteriol 186: 80668073.
Regassa LB, Novick RP & Betley MJ (1992) Glucose and nonmain- Weinrick B, Dunman PM, McAleese F, Murphy E, Projan SJ, Fang Y
tained pH decrease expression of the accessory gene regulator & Novick RP (2004) Effect of mild acid on gene expression in
(agr) in Staphylococcus aureus. Infect Immun 60: 33813388. Staphylococcus aureus. J Bacteriol 186: 84078423.
Renelli M, Matias V, Lo RY & Beveridge TJ (2004) DNA-containing Welin-Neilands J & Svensater G (2007) Acid tolerance of biofilm
membrane vesicles of Pseudomonas aeruginosa PAO1 and their cells of Streptococcus mutans. Appl Environ Microbiol 73: 5633
genetic transformation potential. Microbiology 150: 21612169. 5638.
Renna MC, Najimudin N, Winik LR & Zahler SA (1993) Regulation Whitchurch CB, Tolker-Nielsen T, Ragas PC & Mattick JS (2002)
of the Bacillus subtilis, alsS, alsD, and alsR genes involved in Extracellular DNA required for bacterial biofilm formation. Science
post-exponential-phase production of acetoin. J Bacteriol 175: 295: 1487.
38633875. Yang SJ, Dunman PM, Projan SJ & Bayles KW (2006) Character-
Rice KC, Mann EE, Endres JL, Weiss EC, Cassat JE, Smeltzer MS ization of the Staphylococcus aureus CidR regulon: elucidation of
& Bayles KW (2007) The cidA murein hydrolase regulator a novel role for acetoin metabolism in cell death and lysis. Mol
contributes to DNA release and biofilm development in Staphy- Microbiol 60: 458468.
lococcus aureus. P Natl Acad Sci USA 104: 81138118. Yarwood JM, Bartels DJ, Volper EM & Greenberg EP (2004)
Sambanthamoorthy K, Smeltzer MS & Elasri MO (2006) Identifica- Quorum sensing in Staphylococcus aureus biofilms. J Bacteriol
tion and characterization of msa (SA1233), a gene involved in 186: 18381850.
expression of SarA and several virulence factors in Staphylococ- Yasuda T, Takeshita H, Iida R, Ueki M, Nakajima T, Kaneko Y, Mogi
cus aureus. Microbiology 152: 25592572. K, Kominato Y & Kishi K (2004) A single amino acid substitution
Shields RC, Mokhtar N, Ford M, Hall MJ, Burgess JG, ElBadawey can shift the optimum pH of DNase I for enzyme activity:
MR & Jakubovics NS (2013) Efficacy of a marine bacterial biochemical and molecular analysis of the piscine DNase I family.
nuclease against biofilm forming microorganisms isolated from Biochim Biophys Acta 1672: 174183.
chronic rhinosinusitis. PLoS One 8: e55339.
Smithies WR & Gibbons NE (1955) The deoxyribose nucleic acid
slime layer of some halophilic bacteria. Can J Microbiol 8: 614
621.

422 Pathogens and Disease (2014), 70, 414422, 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved