See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/300373736

Police dogs from Albania as indicators of
exposure risk to Toxoplasma gondii, Neospora
caninum and vector-borne pathogens of
zoonotic and veterinary concern

Article · April 2016
DOI: 10.1016/j.vprsr.2016.03.004

READS

52

6 authors, including:

Enstela Shukullari Sven Reese
Agricultural University of Tirana Ludwig-Maximilians-University of Munich
12 PUBLICATIONS 47 CITATIONS 99 PUBLICATIONS 682 CITATIONS

SEE PROFILE SEE PROFILE

Cornelia Silaghi
University of Zurich
95 PUBLICATIONS 1,103 CITATIONS

SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate, Available from: Cornelia Silaghi
letting you access and read them immediately. Retrieved on: 29 June 2016

Rickettsia conorii are of zoonotic concern and asymptomatic dogs http://dx. Dhimiter Rapti c..VPRSR-00011.5%. et al. Veterinary Parasitology: Regional Studies and Reports (2016). Tirana 1000. infantum.2% of the serum samples. E. Leishmania infantum [PCR. Anaplasma spp. and veterinarians. L. canis and haemotropic mycoplasmas.6%.⁎ a Faculty of Veterinary Medicine. T. 17.004 2405-9390/© 2016 Elsevier B. Rickettsia conorii (IFAT). Anaplasma spp.. Hepatozoon canis [PCR]. sven.Rehbein@Merial.de (S.03. The occurrence of and tourism in the region can be expected over the coming years several vector-borne pathogens as well as Mycoplasma haemocanis (lonelyplanet. 1. Germany b Merial GmbH. Rehbein). D. IFAT]. Histology and Embryology. 12. Toxoplasma gondii Anaplasma spp. [PCR.03. No of Pages 12 Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx Contents lists available at ScienceDirect Veterinary Parasitology: Regional Studies and Reports journal homepage: www.org/10. Most vectors of these patho- gens benefit from the typical Mediterranean climate of the coastal ⁎ Corresponding author at: Institute of Parasitology. Baseline data on the presence of and/or exposure and antibodies against Toxoplasma gondii and Neospora caninum in the to vector-borne pathogens in dogs from the whole country should be blood of client-owned dogs under veterinary care from Tirana was re- ported recently only (Hamel et al. but all samples were negative for DNA of E. detected in the blood of four and two dogs.5% of the 103 dogs that were seropositive for at least one vector-borne patho- gen. immitis antigen was detected in 11. from Tirana and coastal areas of Ehrlichia canis. Faculty of Veterinary Medicine.1016/j. All rights reserved. canis..de (C. infantum. immitis than dogs from North Albania (5. http://dx.vprsr. The Dirofilaria immitis overall seroprevalences were: SFG rickettsiae (ELISA).4%. 2011). 83101 Rohrdorf-Lauterbach.0%. Winterthurerstrasse 266a. Cornelia Silaghi a. Albania was recommended as one of the top travel Hepatozoon canis and Dirofilaria immitis was reported (Lazri et al.004 .05) for exposure to T. various vector- Available online xxxx borne pathogens of zoonotic and veterinary concern (SFG rickettsiae [ELISA. SFG rickettsiae Dirofilaria immitis [ELISA]).. gondii and N. Neospora caninum and vector-borne pathogens of zoonotic and veterinary concern Carina Schüle a.doi. In the year 2011. Sven Reese d. DNA of L. Leopoldstr. 8057 of the territory of Albania is mountainous with continental climate Zürich. Germany a r t i c l e i n f o a b s t r a c t Article history: Knowledge on the prevalence of the zoonotic and animal pathogens in dogs from Albania is thus far limited. IFAT]. gondii. Kathrinenhof Research Center. and L. Vetsuisse Faculty. All rights reserved. C.4%.. 2016). but also to dogs and other animals (Beugnet and nine health worldwide.schuele@gmx. 71. 2010).ch (C. Rapti). Shukullari). infantum and Anaplasma platys was Anaplasma spp.1016/j.V. IFAT]. 5. National Centre for Vector lowland of Albania facing the Adriatic and Ionian Seas.. Thereafter. Enstela Shukullari c. University of Zürich. Keywords: Ehrlichia canis [PCR. Veterinärstr.. 31.2016. immitis. Sam- Received 15 December 2015 ples were collected from 119 police dogs which were deployed throughout Albania and which were living in Received in revised form 3 March 2016 close relationship with humans. Steffen Rehbein b. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. Co-exposure to up to five vector- borne pathogens was found in 51. Direct and/or indirect methods were used to examine 119 whole blood and Accepted 18 March 2016 117 serum samples for the protozoans Toxoplasma gondii (IFAT) and Neospora caninum (IFAT). There was no difference in the geographical distribution of exposure to any other pathogen.V. Germany c Universiteti Bujqësor. 80539 München. Climate and environmental changes affecting Marié. © 2016 Elsevier B. Neospora caninum and vec- tor-borne pathogens. Babesia spp. IFAT]. 2009. Introduction very helpful to monitor trends in the occurrence of vector-borne infec- tions and thus estimate infection risks not only to travellers. Switzerland. Steffen. 13.org/10. 2009). H. L. Rapti and Rehbein. 61.. cornelia. Please cite this article as: Schüle. E-mail addresses: carina.. caninum and a range of zoonotic vector-borne bacterial and protozoan pathogens.. dhimiterrapti@yahoo. Ludwig-Maximilians-Universität München.com tioned studies. Age was found to be a risk factor (p b 0.com/locate/vprsr Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii.. Seven dogs Neospora caninum were PCR-negative and seronegative for all tested pathogens. D. enstelashukullari@gmail. Reese).vprsr. IFAT]. N.9%.0% and Babesia canis. Hamel et al. caninum.046). Schüle). 70% Entomology. Significantly more dogs from South Albania (24. Anaplasma phagocytophilum and (D. Ludwig-Maximilians-Universität München. Babesia Leishmania infantum spp.0%. pet-owners Vector-borne infections are of growing concern for human and ca. destinations worldwide by the ‘lonely planet’.com and dogs from these areas have not been included in the aforemen- (S.doi.3%) had antigen of D. p = 0. 80802 München. 2009). [PCR.reese@lmu. respectively. However. Results of this study indicate a considerable risk of infection for dogs and/or humans with T. SFG rickettsiae. the occurrence in dogs regions are discussed as possible reasons (Beugnet and Marié.com (E. data regarding the occurrence of vector- the occurrence and abundance of vectors as well as travelling with borne pathogens other than Babesia canis and Leishmania infantum dogs and their translocation from endemic regions into non-endemic in dogs from Albania was lacking. 8-12. SH1. 12. Walchenseestr. gondii.5%. Until 2008.2016. and haemotropic mycoplasmas [PCR]. Kodër Kamëz. Silaghi).elsevier. infantum. Fakulteti i Mjëksisë Veterinare. Anaplasma spp. Albania d Institute of Anatomy. 3. so an increase of travel 2008. 65.silaghi@uzh. canis.

..2 C. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx Please cite this article as: Schüle.1016/j.. Veterinary Parasitology: Regional Studies and Reports (2016). Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. Neospora caninum and vec- tor-borne pathogens.org/10.. Schüle et al. C.2016..doi.vprsr. http://dx.03.004 . et al.

canis) were used. Anaplasma spp. caninum grouped to areas: dogs deployed in south Albania (S. N. canis and haemotropic mycoplasmas. infantum school of Tirana until they were 12–14 months old. Hamburg.1.. 1995). Albania (N. infantum) were considered as positive. A total of 119 IgG [Anti-Dog IgG (whole molecule)-FITC antibody produced in rabbits.. canis (1:64 to 1:512).. Germany). fluorescent conjugated anti-dog Tirana and all but one (Berat) of the 12 counties of Albania. USA] at a 1:64 dilution was used. canis.. and the HotMaster Taq DNA Polymerase 2. B.03. cycle conditions and controls for each dogs was considered appropriate to verify. MegaScreen® FLOUTOXOPLASMA gondii. For the detection of DNA of Babesia spp. EDTA–blood and 117 serum samples were collected from the animals at Sigma-Aldrich®. ≥1:40 (E. canis. Due to their close relationship to humans. conventional PCRs were carried gen Test Kit.4. n = 43) and dogs that were deployed B. not screened for D. As working dogs are an essential factor of police work. phagocytophilum and L. To obtain information of association between results Fig. infantum and B. caninum and the vector-borne pathogens R. The dogs had L. manufacturer's instructions. Germany) for Babesia spp.).. gondii and N.). these dogs may TaqMan® Universal PCR Master Mix (Applied Biosystems. Anaplasma platys. Germany). Darmstadt. 1 and 2). n = 36) (Figs. The samples were dilutions of 1:50 (T. Positive controls for T. conorii in Tirana. Munich every three months. Hamburg. using the Qiagen HotStarTaq Polymerase Kit (Qiagen.org/10.0 and PCR run. caninum. conorii.240. canis. Material and methods IFAT test-kits [MegaScreen® FLOURICKETTSIA con. Pathogen detection by PCR An ELISA containing purified Rickettsia rickettsii antigen which also reacts against antigen of R. L. Darmstadt. Hilden. n = 58) and old dogs (N 7–10 years.vprsr. africae. Germany) manufacturer's instructions. the geographical analysis these dogs were grouped as follows: dogs Titres of ≥1:50 (Anaplasma spp. Commercial 2. Fullerton. Germany).. Black lines divide non-Tirana (NT) Albania into areas – south Albania (S) + north Albania (N) or coastal Albania (C) + interior (I) – while dogs based in the city of Tirana (T) form a separate group. Neospora caninum and vec- tor-borne pathogens. NT. canis). for which both EDTA– 1:40 (E. Positive and negative controls were included in every Statistical analyses were carried out with IBM SPSS Version 22.doi. For screening. B. Antibodies All dogs included in this study (n = 119) were trained in the police against L. using 2009. After electrophoresis in a 2% agarose gel containing GelRed™ Bias for Windows Version 10. for dogs (N3–7 years. Quantity and quality of the extract. Germany) kit for E. For pathogen prevalence and exposure. gondii. conorii (1:64 to 1:1024).. caninum and three age-groups: young dogs (10 months–3 years. 1:2048 and 1:1280 were provided by the diagnostic centre of Neostomosan® (transmethrin plus tetramethrin) washings at least the Institute of Comparative Tropical Medicine and Parasitology. was used for testing 116 serum samples for IgG-antibodies cial kit according to the manufacturer's instructions (QIAamp DNA against SFG rickettsiae [Canine Spotted Fever Rickettsia EIA IgG Anti- MiniKit. these ani..9 years).. Anaplasma spp. Anaplasma spp. Prevalence of ex- posure was analysed as follows: T vs. St Louis.04. conorii)... Qiagen. C. and if indicated. a commercial ELISA kit [DiroCHEK® canine Heartworm Anti- haemotropic mycoplasmas and H. Erlangen. 87 males and 32 females. USA). 1. out of the 117 samples one was not screened for antibodies of the dogs in each of the groups was similar (median age ranged from against Spotted Fever Group (SFG) rickettsiae and another one was 4. n = 74). They were considered clinically healthy at the as positive controls and negative serum samples for the respective path- time of blood sampling. For all tests. their annual health check in the spring of 2013.7 years. Schüle et al. Fuller Laboratories. USA] was used according to the out on a MASTERCYCLER® gradient (Eppendorf. gondii. USA] according to the ed DNA were evaluated with a spectrophotometer (NanoDrop® 1000. practised prevention measures.. Of the dogs examined. E. canis. Hayward. caninum and R. Animals FLOUBABESIA c.3. platys and L. infantum were tested by an in-house IFAT with L. to change PCR assay. an average age of 4. The age distribution Tirana. 2012). Consequently. The 117 dogs. Rickettsia slovaca and Rickettsia DNA was extracted from the EDTA–blood samples with a commer. (1:50 to 1:800). adult Anaplasma spp. phagocytophilum and the ulated areas. Eppendorf. parasites T. immitis antigen. Hörbranz. Veterinary Parasitology: Regional Studies and Reports (2016). none-Tirana (NT. D. infantum serum samples with corresponding titres of 1:10. The aim of this study was to evaluate the percentage-prevalence of infection and/or seroprevalence of 2. E. canis and L. The assessment of (Applied Biosystems. Serum analyses T. SFG rickettsiae and Rickettsia conorii. 1:64 (R. http://dx. Synbiotics Corp. MegaScreen® FLOUNEOSPORA c. conorii. Levin et al. canis. conorii. the amplified PCR-products were analysed the exact 95% confidence interval was computed using the Clopper and under UV-light. the TaqMan® Gene Expression Master Mix (Applied Biosystems. S vs. A. Table 1 summarizes the re- the prevalence of vector-borne and other parasitic pathogens in these spective target genes.2. haemotropic mycoplasmas and various vector- borne pathogens in police dogs from Albania with attention to the Serum samples of 117 dogs were analysed by indirect fluorescent occurrence of co-infections and co-exposure as well as the potential antibody tests (IFAT) to detect IgG antibodies against the coccidian association to the geographic location of the dogs in the country.3 to 4. All dogs were treated routinely with N1:800. n = 38 Because of shortage of serum from two dogs deployed in the city of dogs) and in the interior (I. Germany) for H. Austria) were used. or ≥1:64 (R. Hilden. For detection of antigen of adult female Peqlab. n = 23). 2. N. The dogs sampled were deployed in the capital ogens as negative controls.2016. N and C vs. 116 were pure bred German shepherds were included in the test-kits. Police dogs often operate in public places. Real-time PCRs were conducted to detect DNA of Pearson method. MegaScreen® 2. None-Tirana dogs were sub. they have contact with many people and are often kept in densely pop. B.004 . Samples with blood and serum were available were stratified for data analysis into positive reactions were diluted serially for T. To minimize the impact in the counties. Germany) for A.. C. gondii. canis (1:40 to 1:640) and for L. For E.. I. caninum. Statistical analyses (5-Prime. therefore also be used as sentinel animals for potential zoonotic infec. a cut-off titre of 1:100 for T. frozen at − 20 °C until analysed. MegaScreen® FLOUEHRLICHIA c. gondii and N. MegaScreen® FLOUANAPLASMA ph. canis and and 3 were Labrador retrievers. Darmstadt.. primers. infantum. fast real-time PCR cycler according to the manufacturer's instructions mals generally receive appropriate veterinary care. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. infantum on the Applied Biosystem 7500 tions. n = 37). N. canis) and 1:32 (L. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx 3 could provide suitable reservoirs for these pathogens (Otranto et al. For E. immitis. infantum. for R. Neospora caninum. of false positive results. deployed in the city of Tirana (T. infantum. canis and A. or dogs deployed in the coastal parts (C. only 115 dogs were screened with all serological tests. n = 36). N. et al.1016/j. Please cite this article as: Schüle. n = 37) and north was defined.] (MegaCor. body Kit. gondii. Geographic distribution in Albania of the police dogs tested for antibodies to Toxoplasma gondii. San Diego. Then they were promastigotes extracted from cell culture used as antigens (Mancianti deployed to police stations throughout the country or they remained et al. (Biotium.

1016/j. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx Please cite this article as: Schüle. Schüle et al.2016. C..4 C. et al.org/10.. http://dx.vprsr.004 . Veterinary Parasitology: Regional Studies and Reports (2016).. Neospora caninum and vec- tor-borne pathogens.doi.. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii.03..

phagocytophilum DNA from cell Courtney et al. B.1) for E. canis.2. CI 55.. were one year old or younger. CI: 0.4) of the samples tested positive for D.03.3 Ionita et al. caninum and 3.7–93. canis.7%.6). positive R.. Ehrlichia canis and Leishmania infantum.5%. et al. Candidatus M. CI: 62. age or geographical location of the 3. Germany. CI: 80.. Exposures to the other pathogens were: 31. gondii and N. In case of significant differences associated with the geographical all examined pathogens.1. ences were found with respect to the exposure to SFG rickettsiae.1–18. Total 11.. 18S rRNA gene Hep-R_rev: CTTATTATTCCATGCTGCAG 34 cycles: 95 °C 1:128. Direct pathogen detection by PCR for B. five were from Tirana and five location of the dogs. 12% (CI: 6. Ebersberg.3) for L. for antibodies against T.. canis plasmid-DNA pEC-3.2–5. caninum and almost 90% (103/ tion of the concurrent exposure to T. tion of exposure of the dogs to multiple pathogens. sidered because only four dogs were seropositive. gondii and/or N. p30-10-gene E. 18S rRNA gene BN2: TAGTTTATGGTTAGGACTACG 40 cycles: 94 °C DNA from bovine EDTA-blood (2006) 30s 1:100 dilution 54 °C 30 s 72 °C 40 s 72 °C 5 min Hepatozoon canis Hep-F_for: ATACATGAGCAAATCTCAAC 94 °C 2 min pEX-A-Hepatozoon canis Inokuma et al.9–8. gondii (p ≤ 0. 60 °C 30 s TTTTCGCAGAACGCCCCTACCCGC-BHQ1 a Eurofins MWG Operon.2016.3) were seropositive for antibodies against vector- vector-borne pathogens. borne pathogens.6–73. 3. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx 5 Table 1 PCR and real-time PCR methods used for investigating police dogs from Albania for vector-borne pathogens.000. Veterinary Parasitology: Regional Studies and Reports (2016). platys. divergens Casati et al. 12% (CI: 6. Anaplasma spp. 17. 16S rRNA gene EPlat-117r: CCATTTCTAGTGGCTATCCCATACTACT 40 cycles: 95 °C 30 s canine (2005) EPlat-55p-S1: FAM-TGGCAGACGGGTGAGTAATGCATA 60 °C 30 s EDTA blood GGA-BHQ1 1:10 dilution Anaplasma phagocytophilum ApMSP2f: ATGGAAGGTAGTGTTGGTTATGGTATT 50 °C 5 min A.05). Please cite this article as: Schüle.6–73. S vs. The most prevalent findings were antibodies against SFG rickettsiae IFAT and SFG rickettsiae ELISA results were combined as ‘SFG rickettsiae (ELISA) (71. platys and female dogs revealed no statistically significant differences for any (1.. Details of seroprevalence percentages ac- (3.4). and Dirofilaria immitis antigen. http://dx. Black lines di- vide non-Tirana (NT) Albania into areas – south Albania (S) + north Albania (N) or coastal Albania (C) + interior (I) – while dogs based in the city of Tirana (T) form a separate group. Comparison of seroprevalence percentages in male methods resulted in two dogs that tested positive for A. NT.000. which thus confirmed the diagnosis of A. CI: 0. infantum and T. Msp2 gene ApMSP2r: TTGGTCTTGAAGCGCTCGTA 95 °C 10 min culture (2004) ApMSP2p-FAM: TGGTGCCAGGGTTGAGCTTGAGATTG 40 cycles: 95 °C 15 s 1:10. platys DNA from Teglas et al.5%. Differences at p ≤ 0. Results spp.4%..1016/j.vprsr. infantum DNA from cell culture Mary et al.7–19.canisp30-ANYR: GAGGAGCATCATTAATACTACAGGAGTT 95 °C 10 min 1:1000 dilutiona (2013) E.4) and four dogs that tested positive for L.0%. the corresponding endpoint titres are presented in Fig. All 119 samples were negative for DNA of E.5–26. 1:256.000 dilutiona (2002) 30s 57 °C 30 s 72 °C 90 s 72 °C 5 min Mycoplasma haemocanis/ OHOK1_for: ATGCCCCTCTGTGGGGGATAGCCG 94 °C 2 min pEX-A-Mycoplasma Watanabe et al. CaB2_for: CTGGGAAACTAGAGCTTCGCGAGC 35 cycles: 94 °C 45 haemominutum (2003) haematoparvum OOCBr1_rev: ATGGTATTGCTCCATCAGACTTTCG s. The Fisher's exact test was also used to assess the associa. Kinetoplast-DNA Lsh-kR: CCACCCGGCCCTATTTTACACCAA 40 cycles: 95 °C 30 s 1:1000 dilution (2004) Lsh-kp: FAM.9% (CI: 11. conorii (IFAT) (61.1– positive’. phagocytophilum. 2. M. For the evalua. Neospora caninum and vec- tor-borne pathogens. CI: 55. haemocanis and Candidatus Mycoplasma haematoparvum. the odds ratio [OR] was calculated.canisp30-ANYM2: FAM-CAGGTATCTTCTCAAATTT-NFQ 40 cycles: 95 °C 15 s 60 °C 1 min Leishmania infantum Lsh-kF: CTTTTCTGGTCCTCCGGGTAGG 95 °C 20 s L..5) 3.05 were considered signif. canis.5) and R. conorii.4% (CI: 0. Fig.000 dilution 16S rRNA gene 58 °C 45 s pEX-A-Mycoplasma haemofelis 72 °C 45 s 1:2. Target Primers 5′–3′ Cycle Positive control Reference conditions Conventional PCR methods Babesia spp.6) of the dogs were seropositive were made.000 dilution 60 °C 1 min Ehrlichia canis Ecanisp30-ANYF: TGGATACTACCATGGCGTTATTGG 50 °C 2 min E.000. The A. Schüle et al. Geographic distribution in Albania of the police dogs tested for antibodies to Anaplasma spp.9) for Anaplasma 3.048. Prevalence of exposure was analysed as follows: T vs. Seven dogs were seronegative and PCR-negative for icant. N and C vs. infantum of the investigated pathogens. at first all three age groups were compared simultaneously and afterwards pairwise comparisons Altogether 65% (76/117.4–79.4). Babesia spp. CI: 52. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. canis was not con- H.doi. gondii antibodies (65.000 dilutiona 72 °C 5 min Real-time PCR methods Anaplasma platys EPlat-19f: CGGATTTTTGTCGTAGCTTGCTAT 95 °C 20 s Genomic A. C.6% (CI: 23.2% (CI: 6. Of these dogs.3) for N.7–19. C. (serological tests only) and gender. I.. Serum analyses dogs.9–8. immitis Screening 119 EDTA blood samples for pathogens by molecular antigen (Table 2). Significant differ- A. L.3–40. For age. canis. followed by T.004 . infantum.org/10. BJ1: GTCTTGTAATTGGAATGATGG 95 °C 5 min Genomic B. caninum and to two 117. 70. Fisher's exact test was applied. platys positive samples were negative for cording to the three age groups are shown in Table 2.

conorii (IFAT) results was seen (Hamel et al. We determined 65% of the canine serum samples positivity to Anaplasma spp. caninum was also seropositive sions and severe disease especially in immunocompromised individuals for T..7) were the most of the range of data reported worldwide (Dubey. 63.3%. ocular le- Any dog that tested seropositive for N.. Discussion Albania (p = 0. C.046.2–34. 2010).03. A significant correlation be. No statistically significant geographical difference was found for exposure to any other pathogen (Figs. In previous studies. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. and E. conorii (23. Both Please cite this article as: Schüle. CI: 41. The simultaneous presence of antibodies against two cial dry dog food. gondii.5% out of the 103 dogs that were seropos. Exposure to all other pathogens was found in dogs de. but raw meat consumption cannot be fully excluded. spp.. conorii 2007).7–26. 2010)..1. E.9% (30/116).3. et al.. gondii and a significant association for the exposure to these two (Dubey. immitis was significantly lower in North Albania than in South 4. conorii (IFAT) (Table 3). 3. pathogens or more. Exposure to more than one and up ing oocysts. The police dogs from Albania are fed with commer- (p = 0. ces dogs may contribute to the spread of infection (Lindsay et al. CI: as seropositive demonstrating an exposure level on the upper limit 18. and R. Neospora caninum and vec- tor-borne pathogens. Anaplasma spp. it can be responsible for congenital death. Schüle et al. due to their coprophagic habits and rolling in fae- to five agents was found in 51.01).. CI 11. Toxoplasma gondii and Neospora caninum. IFAT endpoint titres for antibodies to Rickettsia conorii. pathogens (including T. canis...5–32. The sexual enteric cycle takes place only in felids excret- parasites was found (p = 0. Veterinary Parasitology: Regional Studies and Reports (2016). / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx Fig. ployed in each region of Albania (Figs. canis and B. gondii infections usually cause no or only mild clinical manifesta- 3. as risk factor for Toxoplasma seropositivity in women from Albania. T. Occurrence of co-exposure to pathogens tions in warm blooded animals and humans worldwide (Dubey. 1 and 2). itive for at least one vector-borne (53/103. exposure to R. Ehrlichia canis.004 .org/10. Bobic et al.1016/j.6) had antibodies against four from Korcё. canis.9% (28/117).002). However. Of the 115 dogs which were analysed for exposure to all eight Macedonia and Serbia (Djurkovic-Djakovic et al. and SFG rickettsiae (25.4). 2003). Leishmania infantum. Anaplasma with Toxoplasma oocysts in the environment of the police dogs. 4. Three B.. vector-borne pathogens was statistically significant for the following The high seroprevalence may also be indicative of a high contamination pairings: Anaplasma spp. 1997.4–61. CI: 16. 21 dogs (18. gondii and N. However. http://dx. Antibody Frenkel et al. 2010). 2010. A similar expo- commonly observed combination (Table 3). 2016). The prevalence of D. 1 and 2). Details of the multiple exposures Consumption of poorly cooked meat and soil exposure were identified to vector-borne pathogens are presented in Table 4.. caninum. OR = 5.2% of cats from Tirana and nearly 50% of and SFG rickettsiae was combined as ‘SFG rickettsiae positive’ in this pregnant women from Albania had antibodies against T. gondii T.doi.6 C.vprsr. sure level was found in client-owned dogs from Albania recently tween SFG rickettsiae (ELISA) and R..8) or R.2016.6). canis seropositive dogs were from Shkodra and one was calculation).

.2%) (2. a significant association of exposure to these agents was N.. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii.7%) (2.1%c p = 0. 2016) who examined client- though we defined a higher cut-off titre in our study than most owned dogs from Albania. Aslantas 2008) indicating horizontal transmission being more important than et al. old dogs. adult dogs.4%) (2.6%) p = 0..7% p = 0.7%) p = 0. Silva et al. Greece (21.. and should not account for when using cut-off titres of 1:100 (Dubey 4.5%b 91.002 (IFAT) (76/117) (17/36) (38/58) (21/23) Neospora caninum 12% 5. (IFAT) (25. Veterinary Parasitology: Regional Studies and Reports (2016). the occur- otes being the only definitive host known to excrete oocysts (McAllister rence of cross-reaction cannot be excluded but co-infections have to be et al. Aslantas et al.7%) (12. (%).vprsr.03d (IFAT) (14/117) (1/36) (7/58) (6/23) Dirofilaria immitis 11.9%) pb = 0.35 p = 0. 2005.6%c p b 0.5% 56. 2007). Vector-borne pathogens SFG rickettsiae Rickettsia conorii Anaplasma spp.2% 2.6%) (4. Seropositivity and oocyst shedding however are mulative exposure risk over time and long-lasting antibody persis. Collantes-Fernandez et al.2.7% 12% 26%c p = 0.7%) (6.5% p = 0.2016. 2005).doi. C..5% 41. caninum and Lindsay. caninum and T. Seropositive dogs Young dogs Pathogen Adult dogs Old dogs All dogs (10 months Fisher's exact testa (Method) (N3–7 years) (N7–10 years) –3 years) Toxoplasma gondii 65% 47. Consistent with other studies.02 N = 13/116 N = 9/117 N = 7/117 N = 5/117 N = 2/117 Leishmania infantum (IFAT) (11.2% (Kostova et al. young dogs vs.2%) (7. caninum causes abortions in bovines worldwide with dogs and coy. age to be a risk factor (Capelli et al. http://dx. 2010.8% 13. young dogs..05.. caninum seroreactivity of 12% considered as well (Yildiz et al.10d (ELISA) (13/116) (1/36) (48/58) (4/22) a Comparison of the three age groups..6%) (8. 2010.004 .4% Not done (IFAT) (4/117) (0/36) (3/58) (1/23) Leishmania infantum 12% 2.. 2014. 2005).02 (IFAT) (37/117) (5/36) (23/58) (9/23) Ehrlichia canis 17.. The N.. C..6%) (1.3%c p = 0. Ehrlichia canis Babesia canis Leishmania infantum (method) (ELISA) (IFAT) (IFAT) (IFAT) (IFAT) (IFAT) Na = 30/116 N = 28/117 Anaplasma spp.8% 18.3% 65. Neospora caninum and vec- tor-borne pathogens. Thus.55 p = 0. 1977)). Toxoplasma gondii and Neospora caninum as well as for Dirofilaria immitis antigen in Albania according to age group.3%) (0. 31.6% 39..1016/j.9%) p = 0... Azevedo et al. 2011) and very similar to Maggi et al.9% 13. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx 7 Table 2 Details of dogs tested for exposure to vector-borne pathogens.07 N = 11/115 N = 10/116 N = 3/116 N = 5/116 N = 1/116 N = 1/116 Dirofilaria immitis (ELISA) (9. b p b 0.5% 12% 21.. rates are among the highest seroprevalence levels in cats and in the police dogs from Albania was within the range reported in humans from Eastern European countries (Silaghi et al.9%) (0. 2004). Al. 2009. rological cross reactions between N. 2011) and support our findings. Rasmussen and Jensen.13 p = 0. (Vaclavek et al.2% of the dogs older negative within a year while others had persisting high titres over years than seven years were seropositive which supports a pattern of cu. 1996).8%d 39. Gondim et al. Please cite this article as: Schüle. Similar re.59 p = 0.2% 65.03. et al. d p b 0.15 p = 0. 1998. a statistically significant vertical transmission.7% p = 0..7% 95. not correlated (McAllister et al.8% (Chambouris et al.5%) (13.04 N = 18/116 N = 16/117 N = 14/117 Ehrlichia canis (IFAT) (15. b p-Values for testing the association of concurrent exposure with Fisher's exact test. we did other authors.07 p=1 p = 0. Some infected dogs were shown to become sero- difference among the age groups was seen: 91.08 p = 0.13 p = 0.. distinctly lower percentage-prevalence was reported not find a significant correlation of exposure level and age (Azevedo from Serbia (41% (Sibalic. 2007).7% 13. c p b 0. Some other authors reported et al. the findings of Hamel at al.18 (IFAT) (14)/117 (2/36) (7/58) (5/23) SFG rickettsiae 71. Wanha et al.38 p=1 a N = number of seropositive dogs for two pathogens/number of dogs tested. other studies in Europe (Dubey and Schares. In agreement with previous reports. 1999)). (Hamel et al. 2007). adult dogs vs.4% 0% 5. Although se- tence (Cabezon et al. gondii rarely occur. 2005..2–30...66 (IFAT) (72/117) (21/36) (38/58) (13/23) Anaplasma spp.9%) (23. observed as reported previously (Vaclavek et al.3%) (1. Table 3 Occurrence of co-exposure to vector-borne pathogens detected by serological methods in police dogs from Albania. N.001 (ELISA) (83/116) (15/36) (46/57) (22/23) Rickettsia conorii 61.1% 4.. sults were recorded in Turkey (62%–94%) (Icen et al. 2005.06 p = 0. 2004.0%) (4.37 p = 0... 1989)) and Bulgaria (11.7%d 80. 1996.6% 13.09 (IFAT) (21/117) (5/36) (8/58) (8/23) Babesia canis 3.. Bobic et al. 1999).8% 34.. Schüle et al.0004 N = 4/116 N = 3/117 N = 2/117 N = 3/117 Babesia canis (IFAT) (3. 1998.06 p = 0... Lindsay et al.05.0%) p = 0.58 p=1 p = 0.5% 58. 2009).org/10.05. old dogs vs.2% p = 0.

the present study was within the lower half of the range obtained in Tomanovic et al. platys share the same tick vector (Socolovschi et al. Human infections with (Tsachev et al. 2013). 1995) revealed a considerably against SFG rickettsiae and/or Anaplasma spp. 2000). 2005a. platys. canis infections in mountainous areas) has been reported (Parola et al. Cross reactions be- regional variability in the seroprevalence of R. conorii IFAT-positive. rickettsioses (with- et al.. Nyindo et al. 2002) and Little. canis cannot study. aeschlimanii and R. et al.. significant differences between the age groups were observed be fully excluded (Waner et al. Hamel R. rhipicephali. R.. Bulgaria (37. (2009) reported a seroprevalence of 50% in dogs from suburban tered in Greece (Germanakis et al. Mircean et al.... Li = Leishmania infantum. 2012). 2012).. However. and Croatia (Punda-Polic et al. and compared to adult and old dogs.and/or R. 2001. Waner dogs in order to minimize the transmission of the pathogen and/or to et al. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. C. platys and Babesia vogeli share Please cite this article as: Schüle. Espejo et al. Kontos et al.. Spotted Fever Group rickettsiae in other Southeast European countries (Hamel et al... against SFG rickettsiae in dogs. 2004). The high exposure level to R. 2005.. Therefore. Rickettsia monacensis. Anaplasma spp. 2009).vprsr. 1995). 2012). 1997. 1998) as well as short or long antibody per- Number of police dogs from Albania that tested seropositive for multiple vector-borne sistence were seen (Tesouro et al. 2012.. Ap + Ec 1 Romania and Greece (Dyachenko et al. 2004. 2012.3%) was found in dogs 4.. Ec = Ehrlichia canis. police offi- Samardzic et al. phagocytophilum and E.. A. the main vector of A. 2009). 4.7%) (Hamel et al. Stefanovska et al. R. seroreactivity to R.9% in et al.3.. conorii IFAT-results (Parola et al...6% which may explain why Ec + SFGR + Di + Li 1 A. Bc = Babesia canis. 2011.004 . areas in Tirana. sibirica mongolitimonae. conorii only was evaluated Apart from the possible occurrence of serological cross reactions. Latrofa et al.. canis have been described. Serbia (Radulovic et al. canis and Anaplasma spp. As in other Consistent with our findings high seroprevalences for antibodies studies (Ebani et al. 2006). 2003). Rickettsia sibirica mongolitimonae. Dogs seropositive for two pathogens 34 Ap + SFGR 18 Di + SFGR 6 Infections of dogs with A. Pathogensa Number of dogs 4. are known to cause fe.03. 1993). 2006). 2009) while lower percentage-prevalence (3.. As observed in other studies.. http://dx. canis infections are mainly of veterinary concern (Harrus et al.. Rhipicephalus sanguineus (presumed vector of Dogs seropositive for four pathogens 5 Ec + Ap + SFGR + Li 2 A. This Allison and Little. the detection of A. Dogs seropositive for three pathogens 12 Ap + Ec + SFGR 7 Andersson et al. and one case report of canine granulocytic ana- Ap = Anaplasma spp.. pathogens. 2012). 1991. Rickettsia rhipicephali. except R. 1997). However. 2013) and only recently for the first time in client- Ap + SFGR + Li 3 owned dogs from Albania (Hamel et al. helvetica and Rickettsia aeschlimanii has been detected in ticks from Greece E. 2003. 2013. 2003). 2008) implicate an existing infection-risk for dogs in the region.doi. 2006).. 2014) explaining an association between these 2003).. conorii and A. been isolated from ticks from Albania previously (Christova et al. Harrus et al.. 2013). All E. In the present occurrence of cross reaction of SFG rickettsiae and E. 2010. and the graphical variability was observed in the present study. canis. 2009. plasmosis from Bulgaria (Tsachev et al. platys cause canine Ec + SFGR 4 granulocytic anaplasmosis and canine cyclic thrombocytopenia.2%) (Jensen et al. et al. 2013).4% to 8. conorii were regis.. As German one of the highest seroreactivities in humans from Europe (up to 23% shepherd dogs appear to be more susceptible to E. Croatia (Punda-Polić et al.5. phagocytophilum and A.... were recorded seroreactivity in the police dogs was significantly lower in young dogs in Greece (Mylonakis et al. of Macedonia (18. one of 34 patients with suspected Crimean Congo Haemorrhagic Fever was diagnosed serologically with rickettsiosis (Papa et al. 2013). platys (Santos et al. 2006. tween A. canis antibodies was associ- disparity may be explained by underlying infections of other Rickettsia ated significantly with seropositivity to B.. 2012. serological cross reactions between most mem- out specification) were documented as subject of mandatory reporting bers of the order Rickettsiales have also been described (Allison and in Albania with an annual average of 33 cases (Kakarriqi. conorii whereas no geo. Tsachev et al. conorii seropositivity.. Anaplasma spp.. slovaca.1016/j. and both association to age (Punda-Polić et al.7%) (Stefanovska et al..4.org/10.. The overall Anaplasma spp.. The situation in the human population in Albania is largely un- two pathogens which has also previously been found (Solano-Gallego known.. 2013). Pavlovic et al. other SFG rickettsiae may correctly diagnose and treat the disease (Mylonakis et al. Egenvall et al. Mylonakis et al. canis ettsia massiliae. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx Table 4 to age (Segura-Porta et al. R. platys infections in dogs Bc + SFGR 1 from South Eastern Europe were reported previously from Croatia. Psaroulaki 1997. no age or gender disposi- Psaroulaki et al.5%) brile illness in humans (Parola et al. Serological cross reaction be... Di = Dirofilaria immitis. conorii and/or A. phagocytophilum and A. Psaroulaki et al. Allison and Little.. Veterinary Parasitology: Regional Studies and Reports (2016). 2001. tion risk for humans in Albania.. sero- prevalence was 31. (Psaroulaki et al. Thus..2016.. phagocytophilum-IFAT results may result from exposure to A. 1998. 2013). All studies from Romania (0. Serological cross reactions exist for Italy (Pennisi et al... SFGR = SFG rickettsiae ELISA. Psaroulaki et al. E.. 2016) and Romania a (Hamel et al... 2008.. on almost 25% of them. Schüle et al. In most studies. 1995) and no association co-infections are likely as E. 2004). Nonetheless. Harrus and Waner..... Detection of E.. 2011.. 2008). Kachrimanidou et al. canis seropositive dogs had antibodies A survey from Croatia (Punda-Polić et al. 2012. Rick. 2005b). than other breeds (Harrus et al. Ec + SFGR + Di 1 (2009) examined dogs from Albania for ectoparasites and found Ap + SFGR + Di 1 brown dog ticks. be responsible for positive R. species. over the period of 1960 to 2001. A similar seroprevalence (40%) was reported re- cently in semi-domesticated dogs from Albania (Hamel et al.6%. 2015). 2013. was only 0. for SFG rickettsiae antibodies but not for R. In Serbia.. Xhaxhiu et al. 1980). ranging from 52% to 72%.. 2003. The seroprevalence level of 17.. 2006) and Greece (41.... 2013). phagocytophilum in canine Ap + Ec + SFGR + Li + Bc 2 Total 53 blood samples from Albania (Hamel et al. phagocytophilum in Europe Ec + Ap + SFGR + Di 1 (Carrade et al... 2005b) and Croatia (Sardelic et al.. The infestation rate with Ixodes Ec + SFGR + Di + Bc 1 ricinus however. platys)..8 C. 2012. phagocytophilum DNA was not detected in the blood of the police Dogs seropositive for five pathogens 2 dogs. conorii and Rickettsia helvetica have R. cers and veterinarians should take appropriate measures for these tween different Rickettsia species occurs (Pennisi et al... A. positive other SFG rickettsiae in the police dogs from Albania implicates an infec- A. 2012). tion was found (Jensen et al. 2002). the former Republic these SFG rickettsiae. Parola et al. re- Li + SFGR 4 spectively (Greene and Craig. Neospora caninum and vec- tor-borne pathogens. DNA of R.

Thus false nega- gender and age dispositions in L. none of the A total of 3. 2011).. Hamel et al. Lazri or feeding prey infested with ticks (Baneth. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx 9 the same vector tick. canis and B. Velo et al.. a seroprevalence of 21. immitis infected dogs were detected in a survey from the more (4. too (Papadopoulou et al. Schüle et al. Instead of the expected decrease in preva- considered that all police dogs were raised in Tirana where the infection lence from west to east (Genchi et al. Maia et al. 2001. Hamel et al. Haemotropic mycoplasmas three of the four PCR-positive dogs had high antibody-titres and one dog was seronegative. 2013). Comparable prevalence rates (7% to 24%) were reported from Balkan countries.doi. in a study from neighbouring Greece (Tennant et al..2016. Tasić et al. vogeli has been proved in dogs from Albania with B. The regular feeding (Yamane et al. Rapti and Rehbein. 2008. 2012).. 2001).7%) (Stefanovska et al. but authors. 2010).9%) (Atwell et al.6% found (Manna et al. 2014). canis IFAT is however not entirely species specific sence of H.. Lazri et al.6% to 10. Rapti and Rehbein. Bizgha et al.. haemocanis which agrees with our findings (Hamel et al. 2010. 2008. 2009. C.8. 2003).. Simpson et al.3% of the dogs as seropositive (Hamel et al. 2005. H.. Serbia.9% and 13. 1991).. Courtney and Zeng..... sanguineus ticks as indicated B. sanguineus ticks... 2001) and antigen of immature dogs (b 1 year) and old dogs (N9 years) (Athanasiou et al. however. 2007) while in the Greek prefecture 1999.. the occurrence of M. the former Yugoslav Republic et al.6%) (Lazri et al. However.004 . The presence of both of the police dogs were exposed to R. canis through direct and/or indirect detection of several pathogens which being more often identified (Lazri et al. most likely while grooming 9. 2005) and Spain (Rapti and Rehbein. Chargui Canine haemotropic mycoplasma infection rates in Mediterranean et al. 2005). 2008). R. canis from the police dogs are unclear. 2006). 2009.org/10.. Please cite this article as: Schüle. haematoparvum. 1993). Lazri et al. 1975...4%) et al.. a with L.2%) and specific- lice dogs had L.10. which borders south Albania. 2012). 2009. With higher average temperature and less rainfall in the south. Thus adults can be detected only 5–6 months after infection.8% of ca- 4. In contrast. apparently healthy dogs were examined 2012).03. canis nine blood samples that mainly originated from not well cared-for dogs in Albania (Hamel et al. 2008). 2012). Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. infantum could have taken place.1%–96.0%–95.. Seroconversion can occur months or even several years after infection (Oliva et al... 2009. Selby (Fisa et al. In accordance with our findings. vasorum and D.. Bulgaria and Macedonia (Hamel et al. 2005).. 1980). The regular washings with Neostomosan® have apparently no conditions differ between north and south Albania and are likely to affect effect on the exposure of the police dogs to the vectors of L. Consistent with several other This matches with a survey from Greece (Athanasiou et al. immitis Dogs are known as the main reservoir for L. 2008.vprsr. 2012) and Greece (20–24.... infantum ex. B.. immitis in as other studies from Albania with dogs of unknown or lower level of the intermediate host.6..... Athanasiou et al.. 2009). 2012. 2009. infantum antibodies. most dogs that are infected Hamel et al. 4. 2010. there is evidence that the majority duced the positive IFAT results can be provided.5% and 40% (Novacco bone marrow) is considered more sensitive than from blood samples et al. skin.. It should...2%. are known or thought to be transmitted by R. 1988. northern Croatia (Živičnjak et al.. 2003.. Based on blood sample screening. The DiroCHEK® shows a high sensitivity (73. M.. g. Stefanovska et al. Others found PCR being more sensitive (Wang et al. et al. Cricko et al. H..2% is in the range discussed as factor for increasing human visceral leishmaniasis in of 3% to 13. Georgieva et al. infantum are abundant in country. (2016) found also that microfilariae in three D.. 2008. In fact. of the dogs with commercial dog food likely prevents them from feeding PCR-positive.3% in the exposure level to L. dogs could be even higher than the detected prevalence of 11. Athanasiou et al. 2007).. 2008). canis et al. climatic 2003).5% which was established in previous studies from western Albania (Velo et al. sanguineus. infantum remain asymptomatic but the development of a chronic seropositive dogs and adult D. and no difference terranean part of Albania and 1–5 in the inland with a more continental in the geographical distribution was observed. It also IFAT has a high specificity and sensitivity to evaluate L. 2008. None of the police dogs showed clinical Albania (Hamel et al. canis was detected in 17% or 52... Neospora caninum and vec- tor-borne pathogens. Groves 4. 2011. 2016). 2012).. and the stray dog population was The D. Reasons for the ab- et al.4% of the police dogs from Albania showed positive police dogs from Albania was PCR-positive. lymph nodes and countries were reported to range between 2. in this study. Strauss-Ayali et al... Competent vectors of significant increase in prevalence from north to south was observed L. mented for the district and city of Tirana (Velo et al. 2009. immitis specimen were detected in the course of the disease is not uncommon (Baneth et al. Jensen et al. haemocanis observed more dogs being positive by indirect than by direct methods or Cand... 1999) where a significantly higher seroprevalence in male et al. the prevalence level in the police dogs (12%) with dogs from other 2011). In two previous studies. Veterinary Parasitology: Regional Studies and Reports (2016).. infantum 4. immitis-antigen rarely occur (Schnyder and Deplazes. Seropositive police of heartworm generations in mosquitoes was 5–10 in the coastal Medi- dogs in Albania were deployed in nearly all counties. has to be considered that cross-reactions between Angiostrongylus posure especially in clinically suspect dogs (Maia and Campino. In the present study. the predicted annual average (Papadopoulou et al. sanguineus (Socolovschi et al. 2009. 2004).. and their occurrence was docu. 2006). PCR from tissue samples (e. D.7. immitis- with L. similar or higher exposure levels have been reported the Kosovo. However. 2008. of prey infested with ticks.. Dogs presumably get infect- B. 2005. 2005. Tasić from Croatia (15%) (Živičnjak et al. However. L. 2009). http://dx. infantum the occurrence of the mosquitoes and the development of D. immitis prevalence in the police dogs of 11. worm burdens or infections with male worms only can reduce the sensi- 2005). The B. canis IFAT results. observed lower prevalence in very young tivity of this method (Courtney and Zeng. only few care veterinary found similar or even lower percentage-prevalence D.. significantly more old po.9. Early infection can only be diagnosed by PCR or other more invasive direct methods...1016/j.. 2005)... An increase of seropositivity with ity (94. Studies performed earlier in Albania demonstrated ed by ingesting infected R. infantum was found with respect to gender. in dogs from Albania was demonstrated recently (Hamel et al. C. be climate (Genchi et al. Pavlovic of Macedonia (34. 2008..6-fold higher chance for dogs from south Albania to test positive. 2012. some authors No sample from the police dogs was PCR-positive for M. Compared to young dogs. dogs was recorded. no significant difference was seen with regard to gender or age differs from studies from Croatia (Živičnjak et al. with a 5. Hamel et al. Concerning climatic conditions. Mettler et al. 4. 2008). No police dogs in this study were Babesia spp. was detected (Athanasiou et al. 2010).. Lazri et al. Based on serology no significant difference Ioannina. 2012) including a prevalence of 10.. therefore no information as to which species may have in. infantum infections in dogs remain tive results are possible and the real D. immitis-infection rate of the police unclear. infantum for human in- fection (Dantas-Torres. signs related to canine leishmaniasis. Low age was reported in other in another study. Comparing right ventricle of one dog from Albania only recently (Xhaxhiu et al.

D. Comparison of heartworm antigen test kit performance in rickettsiae. S. A. 1999. Keci. 4.K. R. C. 3).. Zeidner. Sero. Hamel. 42–45. M.. D. H.. 49. Toxoplasmosis in Serbia: time for an action Disclaimer plan.org/10.Z. immitis-positive for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. Harrus. M. Greece. Riera.. Seroprevalence and risk factors associated with Neospora caninum infection in different dog populations in Spain.S. Shukullari. E. Shimoda.R. northeast region of Brazil. 110.. Portús. Ozyurtlu. 149. (Eds. Res. Res. 34.. M. Laci.. In this study. McAllister. 129. Pereira-Bueno. Parasitol. 196. S. 360–363. Emerg. L. 34. S. Eur. Kass. Parasites leishmaniosis — new concepts and insights on an expanding zoonosis: part one. D. M.. Ferroglio. Zanaj.. E.. Transmission of Ehrlichia canis of Dirofilaria immitis antigen in dogs.... Int. Aust. J. L. lice dogs may be considered as sentinels for the risk of exposure of their Cricko.P.. than dogs deployed in north Albania. Parasitol.. Haouas. Fisa. Kostelnik. Ferrer. 2013.. V. phasis on Leishmania (Leishmania) infantum and Leishmania (Viannia) braziliensis... 2008.H... and spotted fever group rickettsiae in ticks from southeastern Europe... St Louis. Courtney. F. Jensen. 2013.. Blood pathogens Trends Parasitol. Egenvall.. J.. I.. G. Dobesh. 2004.E. C. 1). 109–113. E. Bertelloni. 3164–3168.. Kontos. Any refer- Parasitol. Albania.. O. M. Nardelli. Silaghi. M.F. Parasitol. L. Waner. D. Cabezon.P. Italy. C.A. N. C. 159–161.. Turkiye Parazitol... Dubey.. Silaghi. French. Vet.2016. Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia Bizgha. Sci. Bourdeau. S. 317–322. S. Lindsay.... Bul..G. and an epidemiological investigation of prognostic indi- consumption remains the major risk factor for Toxoplasma infection in Serbia. Daugschies. Environ. D. Font. Epidemiological aspects on vector-borne Baneth. 20. Vet.E. 2013. of the respective owner(s) or brand(s) or trademark(s). Wien. 2003.. 2009.). S. V.. pp. spp. Gomis. S. 2002. Rehbein.L. Analysis of the 18S rRNA as sentinels of Leishmania infantum. St Trop. M. M. Vet. 2013.. Ann. 4.K. Toxoplasma gondii. 2001.. First evidence of Anaplasma platys and Hepatozoon canis co-infection in a dog from Georgieva. 1991. Gern. 90–108. 2006. dirofilariosis (heartworm disease) in carnivores.. cators for the disease. A.S. J. Nikolic. MO. 3.I. 2007.I..D.. 344–346..M. A review of Neospora caninum and neosporosis.. D.. Sager. E. An evaluation of the Dirochek test for detection Groves. 2011. H. Gomez-Bautista.J. O. Parasitol.. Angelakis. K. Balzer.. Rodrigues. Craig. N.. 1537–1545. 2001. A. M. N. Med. G. Ozdemir. Castillejo. Pavlidou. 141. 1975. Zemlicka.. 161–162. Espejo. Tamba.F. Mezhoud. Ohno.. 163. D.. 2009. Bujg. Millan. Scand. D. V.. J. F. Carrió. 2013...H. 50. R. M. Bornstein. Veterinary Parasitology: Regional Studies and Reports (2016). 127–144. http://dx. C.. R. B.. distribution of the zoonotic pathogens T. P.. Aguiar.F.. Epidemiological Background of Infectious Diseases in Albania Chargui. F. Epidemiology of canine leishmaniosis in Catalonia (Spain): the example of the Priorat focus. F. A.S. Dubey. Pantchev. 1989. Undercooked meat spective study of 100 cases.. Vectors 5. H.. Bademkiran. This document is provided for scientific purposes only.. Alvarez-Garcia.V. Simsek. and leishmaniosis among dogs in Ankara.. Massung. Djurkovic-Djakovic. Res. M. 1996. 1505–1508. Kusi. 121 (Suppl.. 2002. 13. A.. B. 67.. 2009. E. Lahmar. 96. 2012. 324–330. 2000. Dis.L. sectional sero-epidemiological study of canine leishmaniasis in Greek mainland. Gennari. Psaroulaki. Kёrkime mbi leishmaniozёn kanine nё Shqipёri. and seroprevalences of parasitic and other infectious agents. E. Belegu. Piffaretti. Für die Reisemedizin bedeutungsvolle sis: a review. Klin. A. 6–10. Shoukri. Schüle et al. Dis. J. S. 152. O. 123 (Suppl. Med.. 107.... D.. 1176–1177. I. et al. Gorcii. Antibodies to Rickettsia statistical advice and Dietmar Hamel for the critical comments on the conorii in dogs: seasonal differences. Guesmi.. Dyachenko.. Canine Hamel. Saridomichelakis. a similar history were examined at their actual locations throughout Frisuelos. Parasitol... Velo. Kusi. Diakou. K. Pol. Huxsoll. Zeng.. Med. Harrus. Gunnarsson. N. 115.N.. A study on the incidence and diagnostics of Romania—a case report. 2–6.E. E.. S. J.. C.. D.. T. Kirikova. O.A. S..... G.1016/j. F. Presence of potentially pathogenic Babesia 84. Intern. C. Pfister. S. S. E.. Klun. 137–148. Vet.doi.. L... Segura. V. IFAT and in vitro culture in the detection of Leishmania and Infectious Diseases. 2011. E.. Sykes. Ozkan. Almeria. only and is not intended for a commercial purpose or to dilute the rights 180. 19–25. 106. Z. Cascone. J. M. Cringoli. J. 24.. G. 2004.. Klin. Clin. M.. Listeriozisin Seroprevalansı. M. 1997. Canine granulocytic anaplasmo. Alegre.. B. M. 2010. Visser.. Baldock. Z. Schouls. 187–191. S. Hepatozoon canis infection.. D... Parasitol. Conclusion Christova. 292–293. B. Ivanov.. C.A. K. Vet. 79. Parasite 16. Craig.. S. sp. 139–146.. Solano-Gallego.E. 291–295. gene sequence of a Hepatozoon detected in two Japanese dogs... Ann.. Kinetics of Toxoplasma infection Diyarbakır Bölgesindeki Sahipsiz Köpeklerde Toxoplasmosis. A. 122.. Survey for canine leishmaniosis.004 . Gondim.. G.. J. Pathol. H. Barbuceanu. Little.. Papa. Müller. are definitive hosts of Neospora caninum. Klun. Yazar.M. A. I. Bobic.. C.W.C. 65. Toxoplasmosis of Animals and Humans.L. 2005. Parasitol. First detection Chambouris. Chochlakis. Ticks Tick Borne Dis.. Neosporosis in animals—the last five years. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. Pietrobelli. Use of PCR. gondii. Carrade. 65–69. Dis.. 2009. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx 5.. 71–76..-L.S.vprsr. Parasitol. Dennis. Parasitol... 123. Exp. Dubey. Ragozo. Parasitol. 2016. 2010. Parasitol. Vet. D. J.M. Leishmaniasis ve in the Balkans.. Suppl.... S. A. Derg. 187–192. B. Wochenschr.. Knaus. Souliou. Infect. C. Atwell. 22. K... Marié. Pitt. Shken.. J. Aslantas. I. J.L.. Appl. 2003.. B. Baneth. A.A.. manuscript. M. Anaplasma and Ehrlichia species. Bulg. Parasitol. C. G. M. canis): an overview.. Kilic. Seroepidemiology of leptospirosis.. 1–59. Gállego.. D. Serological and molecular survey of Acknowledgment Anaplasma phagocytophilum in Italian hunting dogs.. Parasitol. arthropodenübertragene Infektionen bei Hunden in Griechenland. L. Vet. C. 2004. J. K. Chitimia. Prakt. 2010.M.. Turchi. G. toxo. V. Am.. 2012.03. Microbiol. Z.. Germanakis. A. E . 42. Hedhammar.S. J..10 C. Parasitol. Emerging arthropod-borne diseases of companion animals 489–499. E. Hamel. Babur. Rickettsia plasmosis. 2005. Vet.. R. K. C. 32. Infectious Diseases of the Dog and Cat.. Tirana. P. Vet.. 265–271.. Djurkovic-Djakovic. I. handlers to pathogens and as indicators for the presence of pathogens in Dantas-Torres. Zur Toxoplasmose der of Rickettsia slovaca in Greece. Instituti i Shëndetit Publik. Clin. J. Rec. C. Microbiol. Vet. F..L. A cross.. Geogr. Silaghi.. J. Rapti. Aisa. V.. Vet. Okuda. Dogs as possible mechanical car- riers of Toxoplasma. M. D.. 292–296. Vet. Eleviser Saundres. Azevedo.F. Rinaldi. Anim. J. M.... Hunde in Griechenland. for human in Ixodes ricinus in Switzerland. Wochenschr. Icen.P. 133. Stünzner. L. Is heartworm disease Andersson. 2012. Coyotes (Canis latrans) Athanasiou. G. Waner....... Cerri. Res. 2006.. Onishi. with em- their environment.. police dogs belonging to one breed mainly and sharing Collantes-Fernandez.. Infect... 19-22. Meyersen. 2011. 2006... Albania.. Pathol.. D.. Neospora caninum and vec- tor-borne pathogens. Rallis. Bobic. Vet. Clin.. Serra.. A. Batista.J. Parasitol. R.. A. J. J.. C. Vet.. A. di Regalbono. M. 298–305. CRC Press. O. S. First case of Anaplasma platys infection in a dog from Croatia. K. 2008. Adv. Turcitu. E..A. and vector-borne pathogens in client-owned dogs in Albania..E.. Vasconcellos.. W. Epidemiol. Dr.. Schares. ence to a brand or trademark herein is for informational purposes Dubey. Sixl. Scala. Köck. L. Natural and experimental canine infec- a low endemic area in Tunisia. Clin. Allison. Vet. Capelli. B. The role of dogs as reservoirs of Leishmania parasites. J.V. I. Nikolic. Lindsay. Kakarriqi. B. Font..... J.. R. 289–292. Borjesson. Parker.. C. P.. Molecular evidence for bac- epidemiological survey of Neospora caninum infection in dogs in north-eastern terial and protozoan pathogens in hard ticks from Romania. 143–148. A. aeschlimannii infection in a man. po. dogs de. R. Anaplasma spp.. Mortarino. 19. 937–940. and Borrelia their excellent technical assistance. Lescai. Parassitologia 49. T. L...C. Celebi. Turkey. We would like to thank Claudia Thiel and Andrea Mihalkov for Artursson. Boca Raton. S... 87–97. Dis. dogs having low heartworm burdens.. Silaghi. Koutinas. in Europe.. 20. Straubinger. SFG Courtney. Parasitol. Agric. D. to dogs by ticks (Rhipicephalus sanguineus). Res. Kennel dogs Inokuma.. A. Rapti.M. 42. Pfister. Vet. 2010. Stefanache.. tions with a Greek strain of Ehrlichia platys..... Bella.. Acta Greene. I. 2010. from Tirana..M. J. T.. M.. M. Klun.. M. Pfister. Alves. Dhamo. J. 65–70. Y. Sebek.W. 9. Vet. Environ. Please cite this article as: Schüle.. 430–438. and Neospora caninum in Ma. J.. J.. Mitrea. really spreading in Europe? Vet.B. 2013.. Amyx. J. Kachrimanidou. 101–105.. 12. Infection infections in stray and pet dogs from Romania and Hungary with focus on Babesia Diseases of Dogs and Cats. 1988. Vet. A..P.S. A.. 2007. Vet.. R. Wien. A. However. 698–704. References Frenkel. 227–230. (1960–2001) and Their Prevention and Control in the Context of Natural Disasters H. Babur. A. Ortega-Mora. In: Greene. Klement. A. 2003. infantum were found. Tierarzt Casati. Vet.N. Hamel.. 51–56. T. D.P. Ebani.T. Infect. 187.. Elsevier Saunders. Papadopoulos. Canine monocytic ehrlichiosis: a retro- Bobic. Pfister. Diagnosis of rickettsial diseases in dogs and cats. C. G. Djurkovic-Djakovic.. jorca Island.. Beugnet. Spending much time outdoors. Rehbein. 1993.. 317–319.. Sero-prevalence of granulocytic Ehrlichia spp.J. Carola Sauter-Louis for the burgdorferi sensu lato in Swedish dogs 1991–94.... E. T. Antoniadis... 93–96. 2005. 231–236.. N. 442–446.W. 1129–1141. L.. Tselentis. Eur.. Gállego.D.. Vujanic. Ionita. and their fur as a source of infection of young children. Spain. B. 535–542. infantum infection in dogs and evaluation of the prevalence of canine leishmaniasis in Kontos. F.. Seroepidemiology of Toxoplasma gondii and Detection of Babesia canis subspecies and other arthropod-borne diseases in dogs Neospora caninum in dogs from the state of Paraíba. H.. Med.. 83. 23.. H. Louis. T. Genchi. O. Considerable exposure rates without difference in geographical 148–151. 7. D. Miro. L.. conorii and L. Multiplex real-time PCR ployed in south Albania tested more frequently D... 1999. M. J. Acarol. Med.. Q. Babba. A. Infect. Sheridan. Identification of Borrelia burgdorferi sensu lato.. Ben Abdelhafidh. MO.. D. Agric. A. K. J. Bonnett. W. Parasite 17. Int.. M. Foley. S. Vet. 36..

Breitschwerdt. Selby. Lloret. Teglas. Henk. S. Infect. Marinkovic. Incidence and time course of Leishmania infantum infections examined by Vet.. and nested-PCR techniques in a cohort of naïve dogs ex. Casey. C.. 2010.. J. Jugosl. B. Dumitrache. D. serologic. Evaluation of enzyme. Pagano. A. 2012. Brown.. Acta Parasitol. Simultaneous de- arthropodenübertragenen Parasiten bei Hunden im Kosovo und in Albanien unter tection of “Rickettsia mongolotimonae” in a patient and in a tick in Greece. Stefanovska. Dubey. C. Sainz. Real-time quanti- Parola. O.. Borne Zoonotic Dis... Bino. Scoulica.. T..D. C. O. Vet. Spain... 12. Pelagic. T. Hair.. M. 5249–5255. 120. Trends Parasitol. Antoniades.. D. besonderer Berücksichtigung der Leishmanieninfektionen.. Foglia Manzillo.. D. McGuire.. anaplasmosis and borreliosis in dogs in Serbia. 2008. J. Transmission of Rickettsia conorii Nyindo. P. Petrovec.. Am. Res. L. 143..E. Papadopoulos. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx 11 Kostova. Babalis. Evalua- 2010. 2012. M. L. 279–282... J. Assoc. 441–443. 43. 2014. Diestre-Ortin.. M. K.S. Vet.D. Milutinovic. A.. M. phagocytophilum in a dog in Bulgaria.. Shukullari. Tselentis. A. J.. T.... Hungary 77. V.S. Dis. Levin. Croat. Z. Kouris. Méd. Cross-reactions of sera from dogs infected with McAllister. S. Mircean..S.vprsr.P. Segura-Porta. D.. haemotropic mycoplasmas Mylonakis. B. J. T. V.... Hamel. Microbiol. 14.Y.L. agnosis of Neospora caninum infection in dogs: optimization of cut off titers and inhibi- Novacco. Campino.. Capelli. Vet.... Bitam. J.. 2005b. B. L. and Silaghi.. Santos. Surveil. J.M. Studies on the presence of an.. Romania. Lascombe. 630–634. Exp. Grimm. Gikas. J. J. Mihaljica. 13–21. A. 44. 2006. Papadopoulou.. 2008... B... A. E.. Rossi. M. Djuricic. Psaroulaki.. Rapid communication: dogs are definitive hosts of Neospora caninum.03.B. F. Toxoplasma gondii oocysts by dogs... Punda Polic. I. M. 330. N. Wochenschr. 231–244. H. D. V.E. Gikas. J. 111–115. and Vaclavek. Parola.. and two rapid spotted fever group rickettsiae in human beings and dogs from an endemic area of tests (immunochromatographic-dipstick and gel tests) for serological diagnosis of mediterranean spotted fever in Catalonia. Otranto. Curcin. 645–649. Giannelli. Serbia.E. A. Llull. Papadimitriou. J. V. I. Prevalence of some vector borne diseases in posed to three consecutive transmission seasons... L. diseases of zoonotic concern: part two. C. 274–287.. Simpson. Marinova. Foley. Lindsay.. Clin. Gramiccia.. conorii in naturally infected Rhipicephalus sanguineus. Psaroulaki. Dubey. Vet. Kocan.. 2009.. Tasker. 32.W. Lutz. I. Prevalence of Dirofilaria immitis in pet and stray dogs in Belgrade area in period lence of Ehrlichia canis infection among privately-owned dogs in Bulgaria. some areas of Serbia. Mahan. 2009. Eur. 103. A.. Sanfeliu-Sala. and other arthropod-borne pathogens in cats from Albania... R. Vet. Pennisi. 2013. 2007. M. Barker. Sardelic. Prevalence of antibodies against Rickettsia conorii. Kontos... Microbiol.. 2007. Samardzic. 1995.. Gonçalves. 3317–3319. 562–564..D. T.G. 1078. 62. M. 59. pp.. Rapti. Tsachev. B. 395–398. Bradarić. Parasitol. 2. 2005. Preva. F. 52. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. 2012–2013. 297–298. Y.. Please cite this article as: Schüle. Mineo.. Fournier. Small Anim. 212–216. D. J. J. J. Pavlovic. Grgic.. Giannelli. V.F. 389–392. 2003. I. 250–254. Koutinas. Gonen. T. L. Exp. Pantchev. N. 142. tative polymerase chain reaction detection of haemoplasmas in healthy and un- M. 41. Sci. disease in Guatemalan cattle and horses. K.. M. R.. Bacellar.R..S.. 2013.org/10. Seroprevalence and geographic distribution of Dirofilaria immitis and tick. M. Psaroulaki... D. 159. Marinkovic... D. Neospora caninum and vec- tor-borne pathogens. Bobojianni. Ticks Tick Borne Dis. S... 345–349. 11.. L. A. 53–60. S. New Microbiol. 36. Volpe. nine dirofilariasis in Vojvodina. Chochlakis. Marsilio. 1473–1479. Bozovic. G. Vukov. Vet.. B. First detection of spotted fever group Rickettsiae in ticks in Serbia..P. D... Lombardo. Molecular detection of tick.I. 943–946. 73. L. B.. I. P. Reale. Bradaric. Serological Anaplasma phagocytophilum antigens in dogs from the Stretto di Messina area survey of Neospora caninum in dogs in the Czech Republic and a long-term study of (Italy).) 12. J.... Kusi. D. S.. Brown. Muñoz-Espin. 2012. Foley...004 . Dumon. fections in Mediterranean countries and analysis of risk factors for infection. Quantification of Leishmania infantum Croatia. T. Eur. Maggi..L. V. V.. Persistence of antibodies to Rickettsia 657–702. Gentilini. Ilić. I. Angiostrongylus vasorum in commercially available Dirofilaria immitis test kits. 54–58.. 174–184. Parasitol. 1537–1541.. Prevalence and geographical distribution of canine hemotropic mycoplasma in.. Tselentis. Kernif.. Ramada.. S. Dentico. 13–18. L. A. Dantas-Torres.. 328–329.A. dogs in R. A. Res. 1995. ical and molecular survey of Anaplasma species infection in dogs with suspected Manna. Germanakis. T. Appl... Schinaia... Jaffe. A. Osso. M. Seroprevalence of canine heartworm (Dirofilaria immitis) in- response to infection. 62. C. Jolley. L. J. Babesia canis. M. Cozma.. 219–224. Epidemiol.. G. R. P. 27–33.. B.. N. Wien. R.. 28.. I. A. Wolf. 40.and flea-borne rickettsial emerging zoonoses. Stankovic. E. Clin. Mihalca. P. T. lence of ehrlichiosis[sic]. borne infections (Anaplasma phagocytophilum. Program & Abstract Book EMOP XI. G.. Infect. P. Res. B. C. A. Hofmann-Lehmann. Novak. Dantas-Torres. A.W. tion studies of cross-reactivity with Toxoplasma gondii. Vet.G. Carito. K.. Tesouro. DNA by a real-time PCR assay with high sensitivity. P. Strauss-Ayali. First detected case of Anaplasma Pennisi.S. Butler. Deplazes. A. Vet. D. et al... Wills. 2006. A. Milojkovic. Chronic canine ehrlichiosis (Ehrlichia canis): a retrospective Silva. Y. Psaroulaki. Tennant. 43... 25... Bytyci. Maia. 25–29 July 2012. Program & Tselentis..V. F.. Cell-mediated and humoral immune responses of German shepherd dogs and (Suppl. C. C. Vector Borne Zoonotic Dis. Clin. Veterinary Parasitology: Regional Studies and Reports (2016). R.lonelyplanet. Sci. Núncio. 37.doi. 15 1980..G. J. 2008... dynamics of antibodies. Am. M. 158. Stephenson. G. J. M. N. Diagnosis of canine Rasmussen. Capri. 2005. 3.. J. Anim. 1297–1302. L. fection in Albania. Tselentis.. Papadogiannakis.. S... Y. Avsic-Zupanc. tick-borne rickettsiae.. G.. Terzin.. Raoult. E. Ortuño-Romero. Vectors 7. Acad.. Parasit. Z. A.P. 169–176. H.. Antibodies to spotted fever group rickettsiae in dogs in Croatia. Giljanović. P. V. 33–35. A serological Oliva.M. conorii in dogs.. Gjino. A. Fokida in Central Greece. M..L. Simovic. Gyorke. Some epidemiologic features of canine neosporosis in leishmaniasis: conventional and molecular techniques using different tissues. Ledina. A. Borrelia burgdorferi sensu lato... Soc.. F. A. 142–144... Tick. Chaniotis.. Res.. Bitam. F... Survey of Toxoplasma gondii and Neospora caninum. J... P. Alexandre. Lazri. H. G. 59. Evaluation of serological tests for the di- study of 19 natural cases. Y. E.. Breitschwerdt. Rehbein. Santos. Ragiadakou. Socolovschi. D. E.L. Bino. J. 2014. 44. Campino. N. N. H. Hell. D. J. A. Kovacevic. worm infection. D. Vet. Y. 1998.M.O. Mancianti... Bacellar... Germanakis. N. S. Managing canine vector-borne Romania. Clin. D. Camp.H. A. Lobato. Pract. T. Domestic dogs (Canis familiaris) as reser.R.. C. Edelhofer. http://dx.. C. 2011.. Masucci. Y. E. 1999.S. study of exposure to arthropod-borne pathogens in dogs from northeastern Spain. Jensen. Socolovschi. K.. Lein. assay in Leishmania-infected dogs treated with meglumine antimoniate and allopuri.A.. Clin.E. Velo. Gravino. L. First isolation and borne pathogens in Rhipicephalus sanguineus group ticks... Greece.B.... Radulovic. Analysis of pathogen co-occurrence in host- Abstract Book EMOP XI. 50. 978–980. Zemtsova... 1977.C.. Ann..A. Faraut. Dubey. Acarol. Helps. N. Microbiol.. lonia. Filipe. J..M.. Farkas. Scoulica. Tomanovic..... Tselentis. 2009. B. 2012.. 189. J. Dimitrijević.. B. 1318–1322. 849. M. 2005a. Joachim.. 319–321. S. P.. Res. Pavlovic. G. Incidence of Toxoplasma gondii infection in man and in various animals in 2012. Gradoni. K. Ticks. F.. B. A. B.. R. Torina. Raoult. parasitological. I. R. 8. Available at: 2002.. E. 2008.. 191–196. Risk factors associated with canine heart- 5515–5519.. Punda-Polic. Corwin. Vet. 143. 2003. E. 8. Sousa. Abdad. Eur. C. Vet. P.. 2006. D... Carson. M. D. 28–33. D.. D. Parasitol. V.. 179. Dis. Bradaric.. for Neospora caninum. 258..... D..F. 1980. Gaunt.. 1729–1733. G..S. 1991.. 40. Di Muccio. Dis. Raoult. Mechanical transmission of Punda-Polić.. Cluj. Appl. 1998. Microbiol. 41. N. Scand.. Basho.. L.. G.. E.E. J. Polizopoulou. V. Vet.D. Lako. R. 25 September 2015).. 52. Ioannidis... A.. M.. Parasitol.1016/j. Bulg. Schüle et al. Y. Lindsay.. 57.. 25-29 July 2012. an immunofluorescent-antibody test. Vet. Vitale... infantum DNA in dogs. Polymerase chain re- Papa. Tomanovic. W. Infect.. A. Prevalence of antibodies to linked immunosorbent assays. Gikas. Detection and identification of spotted fever group rickettsiae in ticks collected http://www. J.. P.. P.B. Hegarty. D. Vet.. K. C.. 5. J.. Parasitol.. 177. J.. Lombardo. Curcin. Microbiol. 107.. M..A. Mineo. S. Terzi. Zarkov.. D. M. 164. Schnyder. Stenos. E. Parasitol. Res. A... Epidemiol. J. Acad. Jodies. Vét... Vector Borne Zoonotic Dis. Spyridaki. J. Vet. M. Picillo..M.. A. Parasitol.. lonelyplanet. Int..A. Clin. L. E. 234–244. Ehrlichia canis) in dogs from Romania. 469–492.. M. Microbiol. Falcone. P. M. 2009. Flaming.N.. Rehbein.. Kostoula.2016.. Ehrlichia canis. A. 82. P. tion of Rhipicephalus sanguineus as a potential biologic vector of Ehrlichia platys.. Dhimolea. F. Knaus. Panagiou. D.L.M. Tasić. R.. Breitschwerdt. 119–127. Duh. Rec.. 89–92. Petkovic. Mediannikov. Solano-Gallego. de Antonio. 315–318. Rev. Ann. Kontos. Update on tick-borne healthy dogs from Central Macedonia. 131. C. Parasitol. F. Duncan.. 481–485. 2008. Latrofa. 2005. 176. B. Infect. 2011: Top 10 countries for 2011: Europe's got the goods... Cluj. L. Ticks and tick-borne Parola. Clin. Am. Serolog- Parasitol. Billinis... Blagburn.M. I. Vet... Ristic. S.. Font-Creus. Koudela.. V. E. rickettsioses around the world: a geographic approach.. M. Poli. 28. G. T.N. for the detection of Leishmania Crimean Congo haemorrhagic fever cases in Albania. Infektionen mit Psaroulaki. D.. H.. V. 35–41.. Tasić. tion in Northwestern Greece. D. Leontides. I. R. Vectors 5. J. Petrov. Willi. Radulovic.. E. Vet. (Larchmont. Mrljak. Matern.. J. Vector Borne Zoonotic Dis. A. 2004. Med... Z... Mettler. I... R.. Sebesta. Sibalic. D. Deplazes.. symptomatic and asymptomatic Leishmania infections in dogs. G. M.. Solano-Gallego. Ristanovic. Seropreva- 2014. G.. C. L. S.. F. Hosp. I. S.... S. Davoust. Gligic. Microbiol. Pavone.. Suspected action using noninvasively obtained samples. V. Klin. 2011. C. Clin. Infect. Pfister. A. 42.. Antic. M.S. T.. M. A. Med.M. Scalone. Survey of ca- 2005. Parasitol. 2012. Med..... Tselentis. Assoc. Vector lance of toxoplasmosis in pregnant women in Albania. Klismanic.L. Maia. V. T. V. and indirect immunofluorescence for the diagnosis of canine leishmaniosis. Real-time PCR tickborne disease in Portugal. Miladinović-Tasić.. Microbiol. Cakic.com/europe/travel-tips-and-articles/76175 (accessed on in southern Croatia.... 168–171. 3558–3559. A... Comparison between an enzyme. A. Burshtain. Hurkova. Otranto. genotypic identification of Rickettsia conorii Malish 7 from a patient in Greece. fourth European Dirofilaria and Angiostrongylus days (FEDAD).. Acarol.. Y.. V.L.. Paddock.. First isolation of Rickettsia conorii from human blood in Mary. Kochevski. Halacheva... Budapest. First iso- tibodies against Toxoplasma gondii in dogs and the role of cats in the distribution of lation and identification of Rickettsia conorii from ticks collected in the region of toxoplasmosis. 24. F. Macedonia. J. J.. Baneth. and Coxiella burnetii in the Greek Island of Cepha- voir hosts for Rickettsia conorii.. Hayes Jr. Ivic. Microbiol. Denmark.... 2004.. M. 1999.. 389–399. 276–284. Meli. Confirmation that the dog is a definitive host 11. Vet. seeking adult hard ticks from Serbia.. 1998... L. Filipov. Tsachev.. B. M.. Lindsay. 1997. J. Vodrazka. Ivanovic. Fournier. J. E. Chochlakis. L. N.M. Cristóvão. Z. C. Z. P. S...R... Ticks Tick Borne Dis. F. S. Trilar. Human and canine leishmaniasis in asymptomatic and symptomatic popula. Rev. G.M.Y. Parasitol. Milutinovic. Killmaster. J. 327–333. 2004.L. A. I. 595–604.. Dimitriou.. Carrapico. Antoniadis.. Sedlak.. 367–376. Psaroulaki. beagles to experimental infection with Ehrlichia canis. Methods for diagnosis of canine leishmaniasis and immune Rapti. Am. Prevalence of antibodies to Rickettsiae in dif- linked immunosorbent assay using a detergent-soluble Leishmania infantum antigen ferent regions of Serbia.. Kakoma. 2006.. 2009.. N.. p. Parasitol.. A. 2–4 July. Luksic. C... nol. M..B. W.. 2008. Casal-Fábrega.. 26. A. D. J. Klišmanić-Nuber... 1996. Ceci. 2008. Labruna. Duscher. Curcin. Dumler... B. E.S... C.... Huxsoll.. Raoult..A. O. Milas. A. 228–235. Hegarty. 2).

Schüle et al.. L. Parasitol. Martinkovic... Yamane.. of Haemobartonella felis in domestic cats in Japan employing sequence-specific poly- ceral leishmaniasis in Albania: retrospective analysis of cases during 1997 to 2001 merase chain reaction (SS-PCR)... Hisasue. C.. 54. Hasegawa. 131. Waner. Res.004 . Keysary.C. Thomford. Albania. Sci.. M. Entomological and parasitological study on Knaus.. Vet. V. Zagreb.... Neospora caninum and vec- tor-borne pathogens. D... Beck. T. C. Z. 1577–1587. Tsuchiya. M. 2001. D. Barić-Rafaj.. 128.2016. Matijatko. Khoury. 105. L.A. Abstr.. D.. Lindner. Veterinary Parasitology: Regional Studies and Reports (2016).. B. 69. Mrljak. Edelhofer. Parasitol.. M. Yang. Yamada. Babur.. Martinković. T. Kučer. Parazitol... 2005. 35–43.. Bongiorno. Yildiz. M. E. S.. Am. Principal intestinal parasites of dogs in Tirana. K.Y. 2011. K. N. S. R... R. phlebotomine sandflies in central and northern Albania.. P.A.. H. Kusi. Visser. 45–49. Maroli. G. R.org/10.. Gramiccia... M. Wanha. Hashizaki. S. Y. N. R... in dogs.A. S. Parasite 12. Živičnjak. M.. Pano.. Y.12 C.. A seroepidemiologic survey of canine visceral leishmaniosis against Neospora caninum and Toxoplasma gondii in dogs and foxes in Austria..W. Gardner.B. Y. H. F. Signif. Živičnjak. 22–25 Feb 2007. C. Wang. Rinaldi. 1–15.. Police dogs from Albania as indicators of exposure risk to Toxoplasma gondii. Res.. Gradoni... Bark. Recrudescence of vis. T.. L. J.vprsr. I. Dubey. Seroprev- Wang. E. E. Prevalence of antibodies Ž. 1579–1584. I. J. Jongejan. 65. 2005... Velo. S.M. J. Vet.. 2003. S. K. Trop.. Cornelissen.. Vet. 2003.. Maroli.T. Gao. Mihaljević.. V. Conrad.. asites of dogs and cats in Albania.. Visser.. 1111–1114. S..1016/j. Xhaxhiu... Gradoni. Ogata. S. and results of an entomological survey carried out during 2001 in some districts. 208. Marinculić. T. A. Yagci. Gurcan. M. M.... 2011. http://dx. Rehbein. Bino. Chen. The prevalence of canine alence of Neospora caninum and coexistence with Toxoplasma gondii in dogs. I. Rapti. Ectopar- Trans.. M. 1993. face it. 97.. 341–353. Soc.. R. Derg. Rehbein. 116–119.. H. Turkiye Leishmania infantum infection in western China detected by PCR and serological tests. Parasitol. Hyg. M. T. Ha... C. R.. A.. Res. Karaca.. T.. I. / Veterinary Parasitology: Regional Studies and Reports xxx (2016) xxx–xxx Velo. 2007.. 2009. Ocal. Vet. Parasitol. Parasitol. Harrus. 33.. M.. 2009.03.. 288–290. Kuli-Lito. A. F. 189–193. C.P.W.. Hisamatsu.. Canine dirofilariosis in Croatia: let's Watanabe.. Med. F.. Dimitrova. J. D. Postoli. Parasitol. Bino. Prosl. Evalua- icance of serological testing for ehrlichial diseases in dogs with special emphasis on tion of the indirect fluorescent antibody test for diagnosis of Babesia gibsoni infections the diagnosis of canine monocytic ehrlichiosis caused by Ehrlichia canis.H.. K.. Rapti. Di Muccio..T. M... Furuichi. Vet. Vectors 4. Kusi. First European Dirofilaria Days. Levy. Gabler-Eduardo. 35 Please cite this article as: Schüle. Molecular detection and characterization p. Xhaxhiu. J. Knaus.... M. S. E. Med.. 95... Kondi. Ogi. Paparisto..doi. 2005. Yasa Duru. among apparently healthy dogs in Croatia. Croatia. A. G. et al.