JOURNAL OF CLINICAL MICROBIOLOGY, Oct. 2009, p. 3308–3312 Vol. 47, No.

10
0095-1137/09/$08.00⫹0 doi:10.1128/JCM.01071-09
Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Streptococcus pneumoniae DNA Load in Blood as a Marker of
Infection in Patients with Community-Acquired Pneumonia䌤
Remco P. H. Peters,1,2† Richard F. de Boer,3 Tim Schuurman,3‡ Sonja Gierveld,1 Mirjam Kooistra-Smid,3
Michiel A. van Agtmael,2 Christina M. J. E. Vandenbroucke-Grauls,1
Maike C. J. Persoons,4 and Paul H. M. Savelkoul1*
Departments of Medical Microbiology & Infection Control1 and Internal Medicine,2 VU University Medical Center, Amsterdam,
The Netherlands; Department of Research & Development, Laboratory for Infectious Diseases, Groningen,
The Netherlands3; and Department of Medical Microbiology, Scheper Hospital Emmen,
Laboratory for Infectious Diseases, Groningen, The Netherlands4
Received 2 June 2009/Returned for modification 8 July 2009/Accepted 4 August 2009

Direct detection of Streptococcus pneumoniae DNA in blood adds to culture results in the etiological diagnosis
of patients with community-acquired pneumonia (CAP). Quantification of the amount of DNA, the bacterial
DNA load (BDL), provides a measurement of DNAemia that may increase the understanding of the clinical
relevance of S. pneumoniae DNA in blood. We evaluated the S. pneumoniae BDL as a diagnostic tool in adult
patients with CAP. The BDL was determined in whole-blood samples collected simultaneously with blood for
culture from 45 adult patients with CAP. After DNA extraction, S. pneumoniae DNA was detected with specific
real-time PCR amplification, and the BDL was calculated with a standard curve. PCR and microbiological
results were compared, and the BDL was related to clinical and laboratory parameters. S. pneumoniae DNA was
detected in 10/13 patients with positive blood cultures and in 67% of patients with microbiologically confirmed
pneumococcal pneumonia. The positive predictive values of the receiver operating characteristic curves for the
BDLs for pneumococcal infection (100%) and pneumococcal bacteremia (69%) were higher than those for the
level of C-reactive protein (CRP; 43% and 23%, respectively) and the white blood cell count (WBC; 42% and
35%, respectively); the negative predictive values of these three parameters were in the same range (ⴞ90 and
ⴞ97%, respectively). The BDL was higher in patients presenting with systemic inflammatory response syn-
drome and in patients with bacteremia. Positive correlations were observed for the BDL with WBC, CRP level,
and length of stay. We conclude that the BDL supports the diagnosis of S. pneumoniae infection in patients with
CAP and provides a putative marker of the severity of disease.

Streptococcus pneumoniae is the most prevalent cause of culture methods in the etiological diagnosis of patients with
community-acquired pneumonia (CAP) in adults (1, 10). Iden- CAP, particularly for patients who received antimicrobial
tification of S. pneumoniae as a cause of CAP can be achieved treatment prior to sampling for culture (13, 26, 33).
with Gram stain microscopy, culture of respiratory tract sam- Several studies have evaluated the use of real-time PCR
ples, blood culture, PCR, and antigen detection testing (26). A assays for the detection of S. pneumoniae DNA in blood sam-
positive blood culture result provides a definite diagnosis. ples from patients suspected of infection with invasive pneu-
However, blood cultures have a low sensitivity for the confir- mococcal disease, with variable results (5, 14, 24, 31). These
mation of the pneumococcal etiology of CAP. This is due to studies all used blood culture as the reference standard. How-
the low prevalence of bacteremia in CAP, especially in uncom- ever, positive PCRs relate not only to bacteremia but also to
plicated cases, and the use of antibiotics prior to drawing blood detection of DNA from nonviable bacteria, i.e., within phago-
samples for culture (11, 18, 32). In addition, blood cultures cytes or due to the use of antibiotics. As such, it is understand-
usually require 1 or 2 days before results are available and thus able that most studies found cases with positive S. pneumoniae
may have limited impact on the initial choice of empirical DNAemia and negative blood cultures. In this study, we used
antimicrobial treatment (6, 29). PCR and antigen detection microbiologically documented S. pneumoniae infection as the
provide non-culture-based tools for the rapid identification of gold standard for evaluation of PCR results and hypothesized
S. pneumoniae in respiratory tract specimens, pleural aspirate that the bacterial DNA load (BDL) can be used to discriminate
samples, and blood samples (7, 8, 13). These tests can add to between patients with invasive infection and those with local-
ized infection.
The magnitude of bacteremia, as based on quantitative
* Corresponding author. Mailing address: VU University Medical blood cultures, relates to the severity of S. pneumoniae infec-
Center, Department of Medical Microbiology and Infection Control,
P.O. Box 7057, 1007MB Amsterdam, The Netherlands. Phone: 31 20 tion (2). A high bacterial count in blood samples from children
4440522. Fax: 31 20 4444313. E-mail: p.savelkoul@vumc.nl. with bacteremia is associated with an increased risk of devel-
† Present address: Perinatal HIV Research Unit, Khutšo Kurhula opment of more-serious disease (27). Also, a shorter amount
Project, University of the Witwatersrand, Tzaneen, South Africa. of time needed to detect positivity for blood cultures, suppos-
‡ Present address: Department of Medical Microbiology, Virology
Section, University Medical Center Groningen, Groningen, The Neth-
edly reflecting a higher initial bacterial load, is associated with
erlands. higher severity of disease (20). This relation between bacterial

Published ahead of print on 12 August 2009. concentration and severity of disease may also hold true for the

3308

glycoprotein B. Binax. autolysin A gene. we evaluated the S.8⬘-benzo-5⬘-fluoro-2⬘. were collected retrospectively from patients’ CFU equivalents/ml blood. d Minor groove binding probe with 2⬘. pneumoniae from blood culture.4. Foster City. This standard curve was generated after isolation of DNA blood samples for analysis of the S. PSI. The systemic inflammatory response syn- 25% for S.6. 14. If a PhHV-1 control failed. pneumoniae infection and 10% for pneumococcal bacteremia in drome (SIRS) was defined as described by Bone and colleagues (4). 3. where (9. Participating departments included the amplified again. Statistical analysis was performed with SPSS version 15. MGB. CAP was defined as an acute respiratory illness associated Whitney U test or Kruskal-Wallis test for continuous variables and the chi- with at least two of the following symptoms plus the presence of an infiltrate on square test or Fisher’s exact test for categorical variables. 100 ␮l of elution buffer. the emergency department. were included (Table 2). level of S. Six of the EDTA tubes (Becton Dickinson). coccal etiology when S. Standard two-by-two tables were calculated for sensi- analysis of the association among these variables. and auscultatory findings of ab- ables. a whole-blood sample was simulta- The BDL was calculated with a standard curve of S. the department of internal medicine. CA) with oligonucleotide primers and probes specific for S. and CURB-65 score are well-accepted clinical measures of the severity of pneumonia infection. pneu. we used 20 ␮l of DNA in a total reaction volume of 50 ␮l. pneumoniae lytA ACCGCTGGAGGAAGCACA GCCTGTAGCCATTTCGCCT AGACGGCAACTGGTACTc AGCGATTTTCTTCCAGCCTGT PhHV-1b gB polymerase GGGCGAATCACAGATTGAATC GCGGTTCCAAACGTACCAA CGCCACCATCTGGATd a Abbreviations: lytA. Blood samples were collected in blood culture bottles (BacT/Alert FAN) for routine culture. or respiratory tract sample. Comparison of groups was performed using the Mann- Clinical definitions. PCR results were defined as positive when amplification signals were observed Collection of patient samples and data. MATERIALS AND METHODS culture-negative whole-blood samples. Bacteremia was defined as the isolation ROC curves were calculated on the basis of an estimated disease prevalence of of S. as demonstrated by positive cultures of blood (n ⫽ Determination of the BDL. Microbiologically con- Genzyme Virotech. pneumoniae PCR assay was less than 5 CFU equivalents/PCR. Sequences of oligonucleotide primers and probes used for real-time PCRa Sequence (5⬘–3⬘) Microorganism Gene target Forward primer Reverse primer(s) Dye-labeled probe S. and no cross-reactions were observed. DNA amplification was done using a TaqMan 7000 system (Applied Biosys- infected children who died from invasive pneumococcal dis. con- neously and routinely collected and stored at ⫺20°C. pneumoniae (strain ATCC 6306) spiked with pooled. and throat (n ⫽ 1) samples. pneumoniae DNA in blood samples: the S.. according to the manufacturer’s instructions. (30). antibiotics within 48 h of admission. The analytical sensitivity of this S. If the PhHV-1 control reactions failed twice. c Minor groove binding probe with 6-carboxyfluorescein label and nonfluorescent quencher. treated to remove hemoglobin. pleural The positive predictive values (PPV) and negative predictive values (NPV) of the fluid sample. minor groove binding. patient.7-trichloro-5-carboxyfluorescein. tivity and specificity. and was approved by DNA from that sample was diluted 1:1 with phosphate-buffered saline and the local Medical Ethical Committee.4. 6-carboxyfluorescein.0 (MedCalc Software.0 time point of blood sampling for the BDL in order to obtain the best possible (SPPS Inc. (Qiagen. the care unit. The detection limit Clinical and laboratory data. Germany) and Mycoplasma pneumoniae (Virotech enzyme immunoassay. 28). Twelve patients (27%) had taken Wedel. This study was conducted during a and negative if such a signal was absent in the presence of an adequate ampli- 16-month period at the Scheper Hospital in Emmen. Chicago. The Hague. Chlamydia pneumoniae (sandwich enzyme-linked immunosorbent assay.7⬘. Prior to DNA isolation. 2009 S. 47. Medac. of whom 3 (7%) were admitted to the intensive care unit.VOL. thirteen patients with pneumococcal bacteremia also had a cine herpesvirus 1 (PhHV-1) used as an extraction and inhibition control (equal to 300 copies/PCR) were spiked with 200 ␮l of blood (30). Blood samples were positive culture of a sputum (n ⫽ 5) or throat (n ⫽ 1) sample. Mariakerke. When blood was drawn for culture upon clinical indication from sample was considered inhibited. Nine out of forty-five patients with . nonfluorescent quencher. pneumoniae BDL: samples from all adult from pooled. P values of ⬍0. The probe was modified into a minor groove binding probe.000 copies of pho. The pneu- patients with CAP (3. Germany). charts and were included only if they had been determined within 12 h of the Statistical analysis. 15). pleuritic chest pain. tems. DNA was then the last patient presented with classical symptoms and a chest extracted from the equivalent of 200 ␮l of blood with the QIAamp DNA minikit X ray of lobar pneumonia. including C-reactive protein (CRP) values and for the BDL in the blood samples was 5 CFU equivalents/PCR. Pneumonia was considered to be of pneumo- lyzed with MedCalc version 9. and eluted in moniae BDL was higher in human immunodeficiency virus. which serves a regional fication of the PhHV-1 internal control reaction. as determined by a dilution series of S. FAM. 17. Receiver operating characteristic (ROC) curves were designed and ana- normal breath sounds and rales. fever or hypothermia correlation (rs) was used to describe the relationship between continuous vari- (temperature of ⬍36 or ⬎38°C. NED. as described elsewhere (21). Rüsselsheim.000 CFU equivalents/PCR lowing inclusion criteria were used to select blood samples from these stored (strain ATCC 6306). NFQ. For each reaction. Emergo Europe.. and the intensive blood samples were retested. Serological analysis for CAP. microorganisms were identified with standard microbiological tech- niques. pneumoniae and PhHV-1 DNA (Table 1). PNEUMONIAE BDL IN BLOOD AS A MARKER OF INFECTION 3309 TABLE 1. firmed pneumococcal pneumonia was present in 18/45 (40%) The Netherlands) were done when indicated by the clinician. The SIRS criteria.7⬘. function in the rural. Gram stain microscopy and culture of sputum samples were performed Patient characteristics.05 were considered to be monia severity index (PSI) and CURB-65 score were used as described else- statistically significant. pneumoniae was isolated from a blood sample. gB. culture-negative blood samples spiked with the relevant amount of patients (⬎18 years of age) who were admitted with CAP (as defined below) and bacteria. Inc. Blood samples from 45 patients with according to standard microbiological principles (25). dyspnea. sputum (n ⫽ 10). adult patients with CAP.4. northeast area of The Netherlands. which equals 125 white blood cell counts (WBC). pneumoniae BDL as a primers and probes was evaluated for a large number of S. If the PhHV-1 amplification signal then was still insufficient.7-trichloro-5-carboxyfluorescein (NED) and fluorescent quencher. Belgium). patients admitted to these departments. Microbiological investigations. of patients. Germany) and the urinary antigen test for Legionella pneumophila (Binax NOW. After automatic detection of RESULTS growth. Blood samples for PCR were collected in 3 ml 13). The technical specificity of these In this study. ease than in survivors (5). IL). In case two blood samples had been obtained simultaneously from one had blood samples drawn for culture and PCR within 24 h of admission. Retrospectively. respectively). the average BDL for these samples was computed. pneumoniae DNA. Spearman rank a chest radiograph: cough. pneumoniae-related putative diagnostic tool and clinical marker of infection in species.8⬘-benzo-5⬘-fluoro-2⬘. 2. the fol- sisting of four 10-fold dilutions of a stock solution of 5. b As published by van Doornum et al.

1 (36. WBC. the control reactions failed for both blood samples from one pa- Gender (males/females) 12/6 17/10 Age (yr) 69 (24–84) 71 (32–85) tient who was excluded from further analysis.72 (0. Both patients had received an- No. pneumoniae etiology and that for the BDL for prediction of urosepsis caused by Enterococcus species. MICROBIOL. resulting in a PCR specificity of 100% for the S. respectively) and TABLE 3. as suggested higher than those of the WBC (42 and 35%. Heart rate (beats/min) 109 (64–150) 100 (60–130) pneumoniae etiology of CAP.5–40. WBC. of mortalities 2 (11) 3 (11) 12/18 (67%) of patients with pneumococcal pneumonia and for No.3 187 Sensitivity (%) 65 82 65 Specificity (%) 100 62 77 PPV (%) 100 42 43 NPV (%) 90 91 87 S.65–0. PCR results for all blood samples from patients with No.95) 0. The PPV of the BDL for S.91) Optimal cutoff value 225 16.56–0. served in the discriminative power for the BDL compared with enzae (n ⫽ 2). pneumoniae etiology of CAP and for the presence of patients had other bacteria isolated from sputum samples. S.92) 0. Six patients were S. PCR amplifica- Length of hospitalization (days) 12 (1–60) 9 (2–19) tion results generated from blood samples were positive for No.72–0. pneumoniae infection. receiving antibiotic 2 (11) 10 (37) treatment before admission pneumonia of nonpneumococcal or unknown etiology were Body temp (°C) 39.6) 39. in.63–0. and one patient had pneumonia related to S. pneumoniae bacteremia (P of 0. CLIN. pneumoniae bacteremia (Table 3).90) 0. pneumoniae infec- in nine cases. and and the WBC). pneumoniae bacteremia (69%) were done. but no cases of M.3310 PETERS ET AL. ROC curves were generated for the BDL. J. with abnormalities on 17 (95) 19 (76) auscultation determined for 43/44 patients with PCR amplification signals. PCR amplification results were (n ⫽ 18) (n ⫽ 27) generated with blood samples from 44 patients with CAP. pneumoniae or L.350 CFU equivalents/ml) for patients with disease. this patient was excluded from further quantitative as median values (ranges) for continuous variables. The microbiological etiology of CAP remained unknown for 18 patients (40%). pneumophila was tion (100%) and for S. Haemophilus influ. and CRP values for the predic- CAP (20%) had another presumed etiological diagnosis: six tion of S. Clinical characteristics of the study population by serological reaction. . No significant statistical difference was observed for clinical characteristics between patients with and analysis.82 (0. with cough 16 (89) 21 (78) two had positive PCR results.0 (35.68–0. Of the No. number of cells ⫻ 109/liter.3) and the WBC (P ⫽ 0. pneumoniae bacteremia AUC (95% CI) 0.3) negative. while no other patient with No. pneumoniae infection. with SIRS 17 (100) 17 (63) determined for one patient with bacteremic pneumococcal PSI (class) 3 (1–4) 3 (1–5) pneumonia because of partial inhibition of PCR (a positive CURB-65 score 2 (0–3) 2 (0–5) amplification result but with an inadequate inhibition control a Data are presented as numbers (percentages) for dichotomous variables and reaction). pneumoniae infection AUC (95% CI) 0.86 (0. pneumoniae infection.85) Optimal cutoff value 125 13.6 compared to the CRP level evaluated for C. 95% CI. TABLE 2.66–0. with mental status alteration 4 (22) 3 (11) Despite a positive amplification result. pneumoniae and M. Characteristic Pneumococcal Nonpneumococcal pneumonia pneumonia PCR amplification results. Systolic blood pressure (mm Hg) 130 (90–170) 130 (80–195) BDL for prediction of S. the BDL could not be No. and Moraxella those for the CRP level (P ⫽ 0. No difference was ob- cluding Pseudomonas aeruginosa (n ⫽ 3).8 187 Sensitivity (%) 75 67 83 Specificity (%) 97 87 77 PPV (%) 69 35 23 NPV (%) 97 96 98 a The units of measurement for the optimal cutoff values: BDL.4–40. Value for patients with: pneumophila were identified. ⬍125 to 2. with chest pain 6 (33) 7 (26) pneumococcal pneumonia had received antibiotics prior to No. BDLs were No. with COPD 8 (44) 12 (44) 10/13 (77%) of patients with S.7) for catarrhalis (n ⫽ 1). chronic obstructive pulmonary (range. mg/liter. pneumococcal pneumonia and ⬍125 CFU equivalents/ml for those with pneumonia with another cause.81 (0.79 (0. CFU equivalents/ml. CRP. urinary antigen testing for L. with dyspnea 13 (72) 19 (70) tibiotics ⬍48 h before admission. Serratia marcescens (n ⫽ 1). No. Two patients had C. 95% confidence interval. COPD. No. with cold chills reported 6 (33) 11 (41) sampling. The median BDL was 325 CFU equivalents/ml without a pneumococcal origin for CAP.80 (0.91) 0. with history of pneumonia 5 (28) 6 (22) (⬍5 yr) five patients with nonbacteremic pneumococcal pneumonia. pneumoniae bacteremia. ROC curve values for prediction of Streptococcus pneumoniae infection and bacteremia in patients with CAP Marker of infection values ROC curve parametera BDL WBC CRP S.

pneumoniae DNA in blood was 100% for pneumococcal etiology.VOL. describes of another origin (Fig. the to occur in patients with a PSI class higher than 2 (P ⫽ 0. the CRP level and the WBC in confirmation of the pneumococcal BDL was associated with the length of stay (rs ⫽ 0. mental status alteration (P ⫽ 0.001) and with the WBC (rs ⫽ 0. 23. 24). We performed a quantitative analysis of S. 23. Altogether. P ⬍ 0. No other associ. As such. The BDL had a good discriminative value for the S.82 and 0. pneumoniae DNA was detected in all three patients with bacteremia in a cohort of 28 patients with CAP and in 3/5 patients with a positive urinary antigen test and negative blood culture (14). moniae BDL in children with meningitis was reportedly com- tive) with blood culture results (7. pneumonia (5. AUC values of 0. pneumoniae meningitis (12). these data suggest a role for the DNA detected in whole-blood samples. P ⫽ origin of pneumonia. we showed that the S. pneumoniae infection (100%) In addition. P ⬍ 0. pneumoniae pneumonia. the WBC and CRP level. This prompts treatment for pneumococ- 0.e. ables. In that study. and the CRP level (48%). In another study. P ⬍ 0. and tion and relates to the severity of disease in adult patients with the level of CRP. a positive S. Presentation with SIRS upon admis. The PPV of (rs ⫽ 0. P ⬍ 0. DISCUSSION We observed a relationship between the BDL and several In this study. (55%) (16). pneumoniae BDL in clinical and laboratory markers of the severity of disease. while previous studies have focused on than 2. which may have introduced some bias. 47. 14. The dashed line indicates the lower detection limit. This confirms earlier findings where a higher S. 1).04). Finally. This was partially overcome by using a corrected disease prev- alence value in the calculation of the PPV and NPV of the ROC curves.68 and 0.43. for the prediction of bacteremia (33/42 of pneu- correlations were observed for the BDL with the CRP value mococcal origin) in 373 patients with CAP (17). and the BDL in duction of the BDL as a marker of infection enables clinical nonsurvivors was compared to that in survivors (5). We had a relatively high proportion of CAP pa- tients with bacteremia. which is higher than the level reported by Lorente et al.05). around 40%) and in patients with invasive pneumococcal disease (69%). The P value reflects the Kruskal-Wallis analysis of variance among and was higher than those reported for Malawian children with groups. In our study. the BDL for the prediction of S. pneumoniae origin of infection and for the presence of bacteremia. another study reported an association of the Neisseria into the clinical interpretation of a positive DNAemia. pneumoniae DNAemia value in blood samples excluded other causes of CAP in our setting. The BDL in our study was in concordance with the range of FIG. S. the BDL is likely to add to the in Table 2. and during bacteremia. 24.86 during infection parameters were in the same range (approximately 90 and 97%).01). In addi- prediction of S. 1. respectively).001). respectively) were higher than those of Association of the BDL with clinical and laboratory vari. follows: SIRS. The specificity of S. The intro. BDL also improves upon blood culture.55. which might be due to our small study population and possibly pneumoniae bacteremia compared to those in patients with relatively high discriminative values of the CRP level and the nonbacteremic pneumococcal pneumonia and with pneumonia WBC in our study: a recent study by Müller et al.04).08). equivalents. pneumoniae tients with invasive disease and in those with a PSI class higher DNA in blood samples. as blood samples is a diagnostic marker of pneumococcal infec. PNEUMONIAE BDL IN BLOOD AS A MARKER OF INFECTION 3311 sensitivity than that reported previously in adult CAP patients (i.30. Also.71 for the WBC and the CRP level. and CRP level (rs ⫽ cal infection regardless of the CRP level and the WBC results 0. This was not statistically different. This is a higher level of testing of BDL in identification of patients with high risk for . while the NPV were equally high for ations were observed between the BDL and the variables listed all three parameters. equiv. pneumoniae infection and helps gain insight tion. there was a tendency for higher BDLs if the BDL is above the defined cutoff value. In our meningitidis BDL with more-severe disease in children with study. a higher rate of PCR-positive results was observed in patients with bacteremia than in patients with nonbacteremic pneumonia. the BDL tended to be higher in pa- CAP. Distribution of the BDL in relation to the type of pneumo. the NPV of these of the ROC curves for the BDL (0. The values for the area under the curve (AUC) the CRP level (43 and 23%. 31). pared to those in children with pneumonia. In this respect. pneu- the diagnostic concordance of PCR (DNA positive or nega. a positive correlation was noted between the BDL in our study were much higher than those of the WBC (42%) and the length of stay (rs ⫽ 0.49. but it is lower than the level in a cohort of patients with suspected meningitis and/or septicemia (92%) (7.. S. As such. sion was associated with a higher BDL (P ⫽ 0. In patients with S.04). 77% of patients with bacteremia had S. BDLs described in another study of adult patients with CAP nia. pneu- moniae DNA was detected in 67% of patients with microbio- logically confirmed pneumococcal pneumonia. The S. mental status alteration upon admission. because the BDL can be available within a few hours compared to 1 to 2 days for blood culture.66. 14). 2009 S. pneumoniae BDLs were higher in patients with S. Positive respectively.

25. 1997. Antimicrob. Lewis. R. p. Smith. Fine. 2001. L. Templeton. Vandenbroucke-Grauls. Hedlund. and 12. Spellerberg. Gopal. Marsh. E. Microbiol. E. Pediatrics 76:901–904. Segura. presentation correlates with severity of disease. 20. Chest 27. Waterer. Pediatrics 7. J. Usefulness of aetiological tests for guiding antibiotic ther- R. 2006. A. Possibly. Agents 31:3–11. S. M. 2008. T. G. M. G. A. Chest 119:181–184. and the Dutch Thoracic Society. and J. R. R. Manual of clinical microbiology. I. Jeffers. A meta-analysis. and S. 2007. the IPD Study Group. 2002. Microbiol.. Musher. A. S.. Banda. monitoring of and M. and R. E. Peralta. 10. Infect. Monitoring of the course of pneumoniae in patients with community-acquired pneumonia. Infect. 7:10.. Ismail. M. E. 23. K.. Falguera. C. N. and M. and R. Simultaneous detection of Neisseria meningitidis. Thorax 55:133–137. 2003. Clin. A. and C. Peters. 69:699–702. P. 2006. R. N. Respir. Dis. 16. Quantitative detection of Streptococcus pneumoniae from sputum samples with real-time BDL can be used to support the choice between hospital ad. A. W. C. M. pneumonia. MICROBIOL. acquired pneumonia severity on presentation to hospital: an international opment of complicated disease (22). plication (19. 9. A. 2001. M. Plotkin. Med. M. Baron. Geneeskd. Groeneveld. J. Clin. Balmer. van Furth. M.. White. Improved diagnosis of the 1558. Fernandes. S. Mealha. Molyneux. L. Schein.. 2004. 1982. tococcus pneumoniae bacteremia. M. G. Aetiology of H. van den Broek. 2008. Weissfeld. biol. C. H. P.. Chest 122:2212– 2001. J.. Carrol. B. Landry.. PCR can add to detection of pneumococcal disease in Kaczmarski. Use of not exclude S. M. logistics. A. M. P. A. Ansorena. and W. E. pneumonia. As such. T. Mutha.) tection of Staphylococcus aureus and Enterococcus faecalis DNA in blood to 2. J. R. Niesters. J.. Edwards-Jones. R. 15. J. community-acquired pneumonia without defined underlying risks. D. Almeida. ical utility of the BDL will be the performance. Infect. Balk. L. J. and Bennett’s of S.. 38:3907. Sheppard. J. 53:189–195. G. 14. A. and C. Aleva. L. S. Valdecanas. Diagn. Jr. J. 2128–2147. A. G. Dis. J. J. T. Bohte.. W. lines for the use of innovative therapies in sepsis. Time to positivity in blood cultures of adults with Streptococcus 1. Nkhoma. Hanusa. 149:2501–2507. Feasibility of ical application and benefit of the S. Nogués. Garrido. Marsh. Waterer. Guide. turnaround Nusbaumer. J. J. Pierce. Prognosis and outcomes of patients with blood and CSF. Khan. Child. A. D. Dis. 2007. C. the course of the BDL G. Osterhaus. S. J. The influence of the severity of 11. J. 6. 30. Thorax 50:543–547. Chalasani. CLIN. Microbiol. W. Savelkoul. J. J.. Mayer. Bone. W. R. nostic accuracy of clinical and laboratory parameters in community-acquired vices. 26:416–422. W. G. O. Jurado. M. A. M. Definitions for sepsis and organ failure and guide. Nogués. Gierveld. Guiver. van Haeften. and G. Dutch Thoracic Society. microbial DNA in blood are largely unknown.. and G. Heath. L. Karalus. Guiver. Kalin. L. and W. Keil. M. with invasive pneumococcal disease. V. severe or complicated disease. 1996. R. Wunderink. A. 39:1553– P. Clin. M. S. M. Macfarlane. C. D. pneumoniae infection in patients with CAP and should principles and practice of infectious diseases. 412–429. P. Cerra. R. E. Kay. Boersma. Waterer.. N. S. 61:72–75. 6:79. and J. Pilot study evaluating C-reactive protein levels in the community-acquired pneumonia: a prospective study among adults requiring assessment of response to treatment of severe bloodstream infection. Sills. M. Streptococcus pneumoniae DNA in pleural fluid samples. Leuppi.. 95:78–82. Dis. Relationship between 108:932–936. K. C. line ‘diagnosis and treatment of community-acquired pneumonia’ from the 21. reaction. LaScolea. and L. p. Engl. N. BMC Infect. M. R.. Sabino. a acquired pneumonia.. I. 9th ed. Thorax 58:377–382. J. T. L. Christ-Crain.. H. Claas. S. Kearns.. B. Grace. M. BMC Infect. Kee. Müller. In P. C. Parkinson. J.). J. Usefulness of community-acquired pneumonia on the usefulness of blood cultures. Although the kinetics of derivation and validation study.). Dis. P. Smyth. Coelho.. K. 33. Singer. Rello. R. 2007. Like the CRP level. Dis. 41:576–580. M. 1992. van den Eeden. D. Danner. S. A. Rudolph. Jr. Microbiol. Dis. R. El-Halees. C. 45:3641–3646. Lujan. Harbarth. Mankhambo. 2000. J. Theerthakarai. and Streptococcus pneumoniae in suspected cases of 28. Thomson. Quantitative de- man. Diagn. S. M. A. Auble. C. C. M. Caballero. J. (In Ger. G. Scheltinga. . Brandt. J.. and C. Falguera. E. 4. and G. McGowan. M. Harrison. L. M. Rodriguez-Lera. a positive BDL value supports the diagnosis Mandell. Streptococcus. A. Infect. pneumoniae infection. A. Solera. B. B. Diagnosing herpesvirus infections by real-time PCR amplification and to identify low-risk patients with community-acquired pneumonia.. van den Broek. Clin. Black. J.. M. C. S. George. Bingisser. Murphy. Palladino. Graffelman. pneumoniae BDL in the real-time polymerase chain reaction in whole blood to identify Streptococcus treatment of patients with CAP. G. Merino. quantitative polymerase chain reaction for etiologic diagnosis of community- mission and outpatient treatment of CAP patients. The BDL provides a real-time quantitative polymerase chain reaction to monitor the evolution of putative quantitative marker for the severity of disease. Wheeler. R.. Tijdschr. 19. 31. H. A. T. Infect. In G. E. A. Infect. A quantitative LightCycler PCR to detect Streptococcus pneumoniae in Weissfeld. A. Int. Dellinger. In conclusion. ical Care Medicine. Molyneux. mococcal DNA loads are associated with mortality in Malawian children Murray. 2001. Sankey. R. R.3312 PETERS ET AL. 40:1855–1857. van Doornum. Clin. M. M. W. A. Carson. and B. Clinical utility of blood cultures in adult patients with apy in community-acquired pneumonia. 2007. Clin. large prospective study is highly warranted to define the clin. H. Steward. admission to hospital. 2005. I.. Giske. 2008. quantitative blood cultures in children with Haemophilus influenzae or Strep. J. Defining community- might be indicative of its response to treatment or the devel. etiology of community-acquired pneumonia with real-time polymerase chain 8. A. A. 18. Murray. M. ASM Press. C. C. M. Neter. Tamm. M. E. and P. 1985. community-acquired pneumonia. Hae- mophilus influenzae. T. Kay. E. Microbiol. and E. organization of the laboratory ser. Porcel. Important determinants for the potential application and clin. Infect. J. Microbiol. L. C. Freeman. K. R. M. Dis. Chest 101:1644–1655. Med. and P. Washington. Munoz-Almagro. L. Morris. while a negative BDL value does delphia. K. and M. Yealy. M. M. and M. Diagn. Ned. REFERENCES Roiz. L. G. Arch. J. M. Boersma. Strålin. Johansson. B. and J. A prediction rule 2003. Corless. Navarro. Fox. Bennett. Dolin (ed. Bell. L. A. and 26. and R. E. N. Palladino.. A. Hackett. and M. 32. Borrow. S. 42:1266–1273. J. Nonvalue of the initial microbiological studies in the management of 2216. Mueller. M. Clin. Jorgensen. Rubio-Caballero. Guldemeester. Alpert. High pneu. 2003. Streptococcus pneumoniae. R. Clin. Littenberg. 2000. blood culture for hospitalized patients who are receiving antibiotic therapy. D. 236:243–250. 1995. P. C. M. Kapoor. Phila- prompt targeted treatment. and W. A. Sullivan. Dis. S. Routine diagnose bacteremia in patients in the intensive care unit. M. J. 32:1651–1655. A. pneumoniae bacteremia. J. S. Microbiol. Castano. T.. Hogan. Lieberman. M. the S. 2000. merase chain reaction (PCR) in whole blood: a prospective clinical study. R. Dis. van der Eerden. B. Diagnosis of pneumococcal pneumonia by poly- the BDL under treatment certainly warrants further study. nonsevere community-acquired pneumonia.. M. Campos. Microbiol. D. M. E. Meningococcal bacterial DNA load at pneumonic patients receiving antibiotics at admission. 86:44–46. 47:407–414. 60:255–261. Ruiz González. E. the magnitude of bacteremia in children and the clinical disease.. Kapoor. Coley. JAMA 275:134–141. Lim. PA. C. D. A. 31:2661–2666. Lee. Micro- the BDL during treatment is another interesting potential ap. A. R. pneumoniae 13. Stolz. Diagnostic and prog- time of the assay. 2005. Moreira. Douglas. and E. van Agtmael. M. W. Pryce. Mandell. 17. 24. J. C. Med. T. G. W.. C. L. J. W. Hart. 1993. C. Guiver. Fein. DC. N. R. M. A. D. Gallego. Lorente. J. J. L. 22. S. Town. B. F. J.. Dis. W. Evaluation of the polymerase chain reaction method for detection of 29. P. J. A. J. for detection of Streptococcus pneumoniae DNA in clinical samples. Churchill Livingstone. A. J. meningitis and septicemia using real-time PCR. and E. Povoa. Marrie. Fine. A. López. Solis. A. 2002. Sibbald for the ACCP/SCCM Consensus Conference Evaluation of polymerase chain reaction for diagnosis of pneumococcal Committee from the American College of Chest Physicians/Society of Crit. W. J. A. Clin. Pfaller (ed. J. 1995. and 3. and M. and the costs. Autolysin-targeted LightCycler assay including internal process control 5. Brucella melitensis DNA load during therapy and post-therapy follow-up in patients with brucellosis. Knaus. 2005. 41:345–351. P. R. Hart.. Pediatr. Infect. J. Laing. rapid culture. Kaczmarski. 21).