Journal of Genetic Engineering and Biotechnology (2011) 9, 137–148

Academy of Scientific Research & Technology and
National Research Center, Egypt
Journal of Genetic Engineering and Biotechnology
www.elsevier.com/locate/jgeb

Identification and characterization of up-regulated genes
in the halophyte Limoniastrum monopetalum (L.)
Boiss grown under crude oil pollution
Ranya El-Bakatoushi *

Department of Biological and Geological Sciences, Faculty of Education, Alexandria University, El-shatby 21526, Egypt

Received 5 July 2011; revised 18 September 2011; accepted 10 October 2011
Available online 16 November 2011

KEYWORDS Abstract Differential display method was applied to transcripts extracted from leaves of Limonia-
Phytoremediation; strum monopetalum to identify genes that are differentially expressed in response to crude oil pol-
Limoniastrum monopetalum; lution. The results showed that 201 bands with different molecular sizes were differentially
Differential display; expressed in polluted plants. Ten cDNA bands were considered to be consistently over-expressed
Crude oil under crude oil stress and selected for sequencing. Comparative analysis of these cDNA sequences
allowed us to classify them into six categories: (1) enzymes increase its activity under petroleum
stress and were a good marker of petroleum stress (e.g. xanthine dehydrogenase, metallothionein
type 2, and arginine decarboxylase), (2) nitrogen metabolism (e.g. glutamine synthetase and amido-
phosphoribosyltransferase), (3) drought genes (e.g. CPRD2), (4) salinity stress (e.g. retrotransposon
protein), (5) plant growth (e.g. aminocyclopropane-1-carboxylic acid and ribulose-1,5-bisphosphate
carboxylase oxygenase), and (6) transport related genes like proton-dependent oligopeptide trans-
port (POT) family protein. Coincidently with the differential display results, the amount of the total
protein differed significantly between unpolluted and polluted plants (T = 3.687, P < 0.006). The
electrophoretic patterns (SDS–PAGE) for water soluble proteins revealed that 11 peptides with

* Tel.: +20 34293254; fax: +20 34865671.
E-mail address: ranyaelbakatoushi@yahoo.com

1687-157X ª 2011 Academy of Scientific Research & Technology.
Production and hosting by Elsevier B.V. All rights reserved.

Peer review under National Research Center, Egypt.
doi:10.1016/j.jgeb.2011.10.001

Production and hosting by Elsevier
138 R. El-Bakatoushi

different molecular masses disappeared and eight different peptides were synthesized in polluted
plants. The results of up-regulated genes identified in this study may explain the way that
L. monopetalum populations established on the crude oil polluted soil and vigorous vegetative
growth of adult plants.
ª 2011 Academy of Scientific Research & Technology. Production and hosting by Elsevier B.V.
All rights reserved.

1. Introduction its potential for phytoremediation. Resistant plants are usually
located growing on soils with underlying metal ores or on the
One of the major environmental problems today is hydrocar- boundary of polluted sites. The potential use of phytoremedi-
bon contamination resulting from the activities related to the ation at a site contaminated with hydrocarbons was investi-
petrochemical industry. Accidental releases of petroleum prod- gated. Plant growth was found to vary depending upon the
ucts are of particular concern in the environment. Hydrocar- species. Presence of some species led to greater total petroleum
bon components have been known to belong to the family of hydrocarbon (TPH) disappearance than with other species or
carcinogens and neurotoxic organic pollutants. Soil contami- in unvegetated soil.
nation with hydrocarbons causes extensive damage of the local Limoniastrum monopetalum (Plumbaginaceae) is a dwarf
system, since accumulation of pollutants in plant tissue may shrub of whitish-gray aspect inhabiting arid or saline, often
cause death or mutations [2]. The effect of oil in the soil on vas- coastal, environments [32]. In Egypt it is widely distributed
cular plants has been shown to be quite different. Previous along the Western Mediterranean costal land [13]. Former to
observations indicated that crude oil at a certain concentration contamination with crude oil, the natural population of L.
can stimulate plant growth [1,9,18]. This has been attributed to monopetalum was associated with Arthrocnemum macrostach-
the presence of substances such as naphthenic acids [7]. It was yum, Zygophylum album and Zygophylum suaedauinosa. After
reported that low level of oil pollution could be easily degraded contamination most of the species were eliminated except L.
by natural rehabilitation in soils, increase organic matter in monopetalum. Previous study of L. monopetalum populations
soil and improve the fertility, physical, and chemical properties revealed that the morphological characters between polluted
of the soil. Oil at both moderate and high levels is quite toxic and unpolluted populations were significantly variable. Plants
to all higher plants [5]. Shortly after surface application of oil, growing in the polluted sites were physically larger than that of
most plants lose their leaves, show losses in root viability, and the unpolluted sites. The study concluded that RAPD profiles
die. Initial recovery and revegetation have generally been from in L. monopetalum of unpolluted and polluted plants varied in
woody plants with protected buds or from vegetative regrowth band intensity, disappearance of bands, and appearance of
from surrounding non-oiled soils [23,38,39,60]. The toxicity of new PCR products and the difference were correlated to
petroleum hydrocarbon at higher concentrations has been sources of pollution [21]. However, the precise mechanism of
linked to displacement of nutrients and nutrient linkage [3]; the plant response to the toxicity of crude oil is not clear. It
reduction in available phosphorus and total nitrogen [8] and varies according to the degree of habitat disturbance and dif-
interference with soil chemotoxis by crude oil [49], ending with fers between different plants and among populations of the
growth retardation [58]. same species inhabiting different habitats. A better under-
Plants are involved, both directly and indirectly, in the deg- standing of the plant mechanisms growing in oil-contaminated
radation of petroleum hydrocarbons into products (e.g. alco- soil is necessary. This information would assist in the develop-
hols, acids, carbon dioxide, and water) that are generally less ment of phytoremediation as a viable alternative to mechanical
toxic and less persistent in the environment than the parent and chemical approaches in remediation of oil-contaminated
compounds [20]. Soil enzymatic activity which can be deter- soils.
mined quite promptly and precisely is a reliable indicator In this study, the differential display technique [34,35] was
reflecting the current biological state of the soil [63]. Accord- applied to transcripts extracted from unpolluted and polluted
ingly, the indirect role that plants play in the degradation of leaves of L. monopetalum plants. RNA fingerprinting using
petroleum hydrocarbons involves the release of enzymes from arbitrarily primed PCR (RAP) [61,62] allows the semiquantita-
plants. These enzymes are capable of transforming organic tive simultaneous comparison of the abundance of several hun-
contaminants by catalyzing chemical reactions in soil. Schnoor dred randomly sampled RNAs. The goal of this study was to
et al. [51] identified plant enzymes as the relevant agents in the identify and analyze up-regulated RNAs of L. monopetalum
transformation of contaminants mixed with sediment and soil. growing in soil containing crude oil. For more confirmation,
Isolated enzyme systems included dehalogenase, nitroreduc- on the translation level, the total protein was analyzed. The
tase, peroxidase, laccase, and nitrilase. For example, Aryl present work aims to contribute to basic knowledge on the
hydrocarbon hydroxylase is an enzyme found in mammals, mechanisms of tolerance of crude oil pollution in L.
fish, fungi, and vascular plant roots exposed to oil or related monopetalum.
hydrocarbons [22,38,45,46].
The molecular knowledge of uptake, biochemistry of PAH 2. Plant sample collection from unpolluted and polluted sites
stress responses in plant transformation and storage of toxic
metals and their derivatives in plants have led to promise bio- The study sites are located 120 km west of Alexandria in the
technological applications [11,17]. The first goal in phytoreme- Egyptian Western desert. Three populations collected from
diation is to find a plant species which is resistant to or sites affected by crude oil leakage (Western Desert Petroleum
tolerates a particular contaminant with a view to maximizing Company (WEBCO)). The oil content in the soil ranges
Identification and characterization of up-regulated genes 139

cycler (Eppendorf, Germany) programmed as follows: 40 cy-
Table 1 A list of the primers used in differential display
cles at 95 C for 1 min, 30–32 C for 1 min and 72 C for
showing the primer number, name and sequence.
1 min. Reaction was then incubated at 72 C for 10 min for fi-
Primer Primer Sequence nal extension. Two microliter of loading dye was added prior
number name to loading of 10 ll per gel slot. Electrophoresis was performed
P1 2 GGGTAACGCC at 80 V with 0.5· TBE as running buffer in 1.5% agarose and
P2 NAR51 TGCGCCGAATTATGCGG then the gel was stained in 0.5 lg/ml (w/v) ethidium bromide
P3 A2 GAAACGGGTGGTGATCGC solution and destained in deionized water. Finally, the gel
P4 a22 AGGAGG TGA TCC AAC CGC GTG GGG was visualized and photographed using a gel documentation
P5 bfs GTA GGA TGA GAT GAT system. Molecular sizes of cDNA bands in base pair were ana-
P6 ch15 GGY GGY TGG AAT GAR GG
lyzed using TotalLab version 1.11 software (Nonlinear
P7 ch25 GAY TTR GAT TGG GAA TAY CC
P8 p43 GACTTGTGGCCCCACATG
Dynamics Ltd., Durham, USA) in the presence of ladder
P9 p52 TAGAAGGTCAGCGCCTGGTC DNA marker 3000 or 10,000 bp.
P10 rapd2 ATGCCCCTGT
P11 B4 CGC TGT CGC C 3.4. Sequencing and sequence analysis
P12 R6 AAA GCT GCG G
P13 D AAA GAT GGC ATC ATC ATT CAA C Ten unique PCR-amplified products from polluted plants were
P14 R10 GAG AGC CAA C selected and considered significantly up-regulated. The selected
P15 R5 ATGCCC CTG T cDNA bands extracted and eluted from the gel using Gel
P16 R9 ACCGCCGAAG Extraction Kit (Koma biotech, Korea). The PCR products
were sequenced by using BigDye Terminator v3.1 Cycle
Sequencing kit (Applied Biosystems, Foster City, CA, USA)
and model 3130xl Genetic Analyzer (Applied Biosystems, Fos-
between 45 and 350 mg extract oil per gram of soil [28]. Three ter City, CA, USA). DNA sequences were analyzed and com-
unpolluted populations were collected representing control to pared to The Basic Local Alignment Search Tool (BLAST) of
each polluted site. Populations collected from oil unpolluted National Center for Biotechnology Information (NCBI)
sites were c1, c2, and c3 and from unpolluted sites 1, 2, and (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The DNA sequences
3. Because of the limited number of shrubs in the studied area, were compared to protein database using a translated nucleo-
one shrub was examined for each population. Shrubs collected tide (BLASTx) and were named according to the best BLAST
from three different polluted sites to study the common effect match. The Limoniastrum DNA sequences obtained in this
of oil on plants at different environmental interactions. work were submitted to the EMBL-Bank the accession num-
bers of which FR878032 to FR878040 and one to GenBank,
3. Material and methods the accession number JN121995.

3.1. RNA extraction 3.5. Protein analysis

Total RNA of L. monopetalum were extracted using total Total protein content per gm of dry leaves was determined
RNA kit according to manufacture’s instruction (Maxim according to the method described by Lowry et al. [40]. The
Biotech INC, USA). The RNA was dissolved in diethylpyro- identification and characterization of different molecular
carbonate (DEPC) treated water, quantitated spectrophoto- weights were obtained using one-dimensional sodium dodecyl
metrically and analyzed on 1% formaldehyde agarose gel. sulfate polyacrylamide gel electrophoresis (SDS–PAGE). Poly-
acrylamide slab gel (12.5) was carried out using the discontin-
3.2. Reverse transcription of RNA uous buffer system as described by Laemmli [33]. The banding
pattern, molecular weight, and band percentage were analyzed
Reverse transcription reactions were performed using oligo dT using TotalLab version 1.11 software (Nonlinear Dynamics
primer (5-TTTTTTTTTTTTTTT-3). Each 25 ll reaction mix- Ltd., Durham, USA) in the presence of protein molecular
ture containing 2.5 ll of 5· buffer with 2 MgCl2, 2.5 ll of weight marker.
2.5 mM dNTPs, 1 ll of 10 pmol primer, 2.5 ll RNA of 2 mg/
ml, and 0.5 ll reverse transcriptase enzyme. PCR amplification 4. Results
was performed in a thermal cycler (Eppendorf, Germany) pro-
grammed at 95 C for 5 min, 42 C for 1 h, 72 C for 10 min. 4.1. Differential display
cDNA was then stored at 20 C until used.
Differential display was used to ascertain the genetic variation
3.3. Differential display using 16 primers between unpolluted and polluted populations. Sixteen primers
were used to detect increased gene expression in polluted
Sixteen primers were used in the differential display analysis plants (Table 1). One or more of these bands might be ap-
(Table 1). The reaction mixture for differential display PCR peared as mRNA in the total RNA isolated from the leaves.
was carried out in total volume 25 ll containing 2.5 ll 10· The total number of cDNA bands (genes) resolved in 1.5%
buffer with MgCl, 2 ll 2.5 mM dNTPs, 1 ll 10 pmol, 1.5 ll agarose gel for both unpolluted and polluted plants was 269
cDNA and 0.2 ll (5 units/ll) Taq DNA polymerase (Promega, and 278 respectively (molecular size ranged from10 bp to
Germany). PCR amplification was performed in a thermal 5439 bp) (Appendix Table A1 and Fig. 1). There were 201
140 R. El-Bakatoushi

Figure 1 Differential display using 16 primer for L. monopetalum. Control c1, c2, and c3 and polluted plants 1, 2, and 3. M: 3000 bp
ladder DNA marker (from 3000 to 100 bp), or 1000 (from 1000 to 200). Arrows refer to the expressed bands due to the effect of crude oil.

similarity searches of ten sequenced cDNA against the NCBI
non-redundant nucleotide and peptide databases (nt/nr) al-
lowed their classification in different categories (Table 2): en-
zymes increase its activity under petroleum stress such as
cDNA9 which had 85% similarity to xanthine dehydrogenase,
cDNA3 showed 75%, similarity to metallothionein type 2 and
cDNA1 displayed 85% to arginine decarboxylase enzyme. En-
zymes or proteins involved in nitrogen metabolism cDNA8
displayed high similarity (100%) to glutamine synthetase
(cd.8.) and cDNA10 displayed 88% similarity to amidophos-
phoribosyltransferase. Drought genes like cDNA5 which dis-
played 56% to CPRD2 and cDNA2 had 85% similarity to
salinity stress retrotransposon protein. Enzymes that play an
important role at several stages of plant growth like cDNA4
displayed 71% similarity to 1-aminocyclopropane-1-carboxyl-
Figure 2 Number of disappeared and new transcripts of the L. ate oxidase and cDNA7 displayed 100% similarity to ribulose-
monopetalum polluted plants in the 16 primers used in this study 1,5-bisphosphate carboxylase oxygenase. Transport related
(p1–p16). genes like cDNA6 showed 87% similarity to proton-dependent
oligopeptide transport (POT) family protein.

bands with different molecular sizes differentially expressed in 4.3. Protein analysis
polluted plants (genes were turned on). Meanwhile, 179 bands
were disappeared in polluted plants (a gene was turned off) The amount of the total protein differed significantly between
(Fig. 2). Four bands with molecular sizes 351 bp (primer 16), unpolluted and polluted plants (T = 3.687, P < 0.006) (Table
791 bp (primer 13), 838 bp (primer 11) and 931 bp (primer 3). Fig. 3 showed that the total protein content increased in all
14) were common in both unpolluted and polluted plants. A polluted plants. The electrophoretic patterns (SDS–PAGE) for
band of 255 bp molecular size (primer 1) was detected only water soluble proteins of the two groups unpolluted and
in unpolluted plants. Generally the results of differential dis- polluted plants of L. monopetalum were illustrated in Fig. 4
play revealed that many down-regulated (turned off) and up- and Table 4. A total number of 28 protein bands, with molec-
regulated genes (turned on) were observed in polluted plants. ular weight ranging between 147.18 and 13.66 kDa were
recorded from the electrophenograms of the plants studied.
4.2. Identification of cDNAs at crude oil pollution The electrophoretic patterns of unpolluted and polluted plants
revealed the presence of higher number of peptides (19) in
After differential screening of leaves cDNA from polluted unpolluted plants ranged from 147.18 to 13.66 kDa, while 16
plants, 201 bands were expressed under crude oil pollution. peptides ranged from 141.08 to 14.83 kDa were recorded for
Ten cDNA bands were considered to be consistently expressed polluted plants. The mean percentage of polymorphic bands
under crude oil stress and selected for sequencing. BLAST for unpolluted plants was 30.88, while it was 22.78 in polluted
Identification and characterization of up-regulated genes 141

Table 2 Up-regulated cDNAs in leaves of Limoniastrum monopetalum growing under petroleum stress, identification, and functional
classification.
cDNAs Identity Length Accession No. reference Identity (%) Function
1 Arginine decarboxylase (Citrus trifoliate) 380 JN121995 85 Urea cycle and metabolism of amino
groups and glutamate metabolism
2 Retrotransposon protein (Oryza sativa 280 FR878032 85 Salinity stress responses
Indica Group)
3 Metallothionein type 2 (Limonium 311 FR878033 75 Detoxification of heavy metals
bicolor)
4 1-Aminocyclopropane-1-carboxylate 315 FR878034 71 Plant growth
oxidase (Saccharum officinarum)
ACC oxidase (Vigna radiate) 71
Aminocylopropane-1-carboxylate oxidase 71
(Vigna radiate)
ACC oxidase 4 (Lepidium sativum) 71
gibberellin receptor 1b (Lepidium sativum) 71
5 Cowpea responsive to dehydration 2 383 FR878035 56 Drought-inducible cowpea gene
(CPRD2)
6 Putative proton-dependent oligopeptide 230 FR878036 87 Transporter activity
transport (POT) family protein (Vigna
unguiculata)
7 Ribulose-1,5-bisphosphate carboxylase/ 249 FR878037 100 Plant growth
oxygenase large subunit (Limoniastrum
monopetalum)
8 Glutamine synthetase (Vigna mungo) FR878038 100 Metabolism of nitrogen
9 Xanthine dehydrogenase (Plumbago FR878039 85 Oxidative metabolism of purines
auriculata)
10 Amidophosphoribosyltransferase, FR878040 88 Catalyzes the first step of de novo purine
chloroplastic = glutamine nucleotide biosynthesis
phosphoribosylpyrophosphate
amidotransferase (Vigna aconitifolia)

Table 3 t-Test of protein content for unpolluted and polluted plants of Limoniastrum monopetalum.
Paired Differences t df Sig.
Mean Std. deviation Std. error mean 95% confidence interval of the difference
Lower Upper
Protein content polluted 0.25889 0.21064 0.07021 0.09698 0.42080 3.687 8 0.006
and unpolluted plants

Figure 3 Protein content (mg/g) in L. monopetalum leaves in Figure 4 SDS–PAGE profile of leaf proteins extracted from L.
unpolluted plants. Error bars are the standard deviation of three monopetalum. In the left lane M: molecular weight (MW) of
independent replicates. standard protein.
142 R. El-Bakatoushi

dynamic tissue processes, particularly when multiple, limited-
Table 4 Protein content (mg/g) in Limoniastrum monopetalum
sized samples are involved because DD-PCR allows for the
leaves of unpolluted and polluted plants at different sites.
simultaneous amplification of multiple arbitrary transcripts
Study site Unpolluted plants Polluted plants [56]. The results of differential display revealed that many
1 4.912273 ± 0.151934 11.71051 ± 0.348125 down-regulated (genes turned off) and up-regulated bands
2 14.07893 ± 0.573538 16.97366 ± 0.131579 (genes turned on) were detected. In the present study there
3 12.89472 ± 0.227901 13.42103 ± 0.131579 were 201 bands with different molecular sizes differentially ex-
pressed in polluted plants (genes were turned on). Ten unique
cDNAs were over-expressed in L. monopetalum polluted
plants. Similar observations were reported by Peña-Castro
plants. Peptides with a molecular mass 14.83 kDa occurred in et al. [47] who analyzed the mRNA expression profile of ber-
all polluted plants but were not found in unpolluted plants. mudagrass (Cynodon dactylon) growing under petroleum stress
Eleven peptides with different molecular masses disappeared and they isolated 24 unique cDNAs that are consistently over-
and eight different peptides were synthesized in polluted plants expressed in roots of bermudagrass.
(Table 5). From the assigned identities of the isolated cDNAs it can be
concluded that petroleum hydrocarbon stress induces a com-
5. Discussion plex and multifactorial molecular response. The group of the
most informative cDNAs corresponds to mRNA coding for en-
Differential display has been developed as a tool to detect and zymes or proteins regarding to the objective of this research was
characterize altered gene expression in eukaryotic cells [34], for cDNA9 xanthine dehydrogenase, cDNA3 metallothionein type
the identification of novel genes expressed in wound healing 2 and cDNA1 arginine decarboxylase. Xanthine dehydroge-
[56]. It is a powerful genetic screening tool for complicated nase belongs to the group of molybdenum-containing

Table 5 Rate of flow, molecular weight (M.wt.), and relative concentration (band%) of protein bands of unpolluted and polluted
Limoniastrum monopetalum plants.
Band No. Rf M.wt. (KDa) Band%
Limoniastrum monopetalum
Unpolluted plants Polluted plants
1 2 3 1 2 3
1 0.11 147.18 5.99 13.44 10.64
2 0.12 145.69 2.23
3 0.13 141.08 6.41 16.49
4 0.16 133.72 21.37*
5 0.17 131.60 22.89 24.38
6 0.19 127.85 15.53
7 0.34 91.10 6.12*
8 0.36 85.25
9 0.43 66.28 14.26*
10 0.45 61.88 42.81 15.61 16.29 46.25 33.36 44.29
11 0.47 57.06 31.36 33.52
12 0.59 38.02 12.33 7.15 11.76
13 0.60 36.72 3.35*
14 0.63 35.16 2.56 4.46
15 0.65 34.09 1.37 9.3 11.65 9.37
16 0.66 33.455 6.08 5.16 5.81
17 0.68 32.76 11.03 10.97
18 0.71 31.44 6.26
19 0.72 30.92 6.47*
20 0.75 29.17 1.31
21 0.77 27.78 0.67 0.71 2.96 1.66
22 0.79 26.06 3.44*
23 0.80 25.79 0.86 2.25 0.63 0.82 7.29
24 0.83 22.87 1.46 0.9 2.21
25 0.87 20.67 0.16
26 0.93 16.41 2.56
27 0.96 14.83 4.44 4.89 3.17
28 0.99 13.66 5.82 5.52
Number of individual specific bands 2 0 0 2 1 2
Percentage of polymorphic bands 28.57 39.28 32.14 32.14 28.57 25.00
Mean% of polymorphic bands 33.33 28.57
Total number of bands 19 16
Identification and characterization of up-regulated genes 143

hydroxylases involved in the oxidative metabolism of purines. is of special importance in meristematic cells as it provides
Xanthine dehydrogenase can be converted to xanthine oxidase the building blocks for DNA and RNA in those dividing
by reversible sulfhydryl oxidation or by irreversible proteolytic and elongating tissues [53]. In addition, purine nucleotides
modification [10]. It was reported that the high activity of xan- are precursors in the synthesis of a number of indispensable
thine enzyme in the leaf may be attributed to the involvement of coenzymes such as in NAD biosynthesis (from aspartate)
the enzyme in the metabolism of heterocyclic hydrocarbons [29], flavin biosynthesis (bacteria and plants) [6,24]. Moreover,
[25]. Metallothionein type 2 is involved in detoxification of hea- it has been demonstrated in legumes that purine metabolism is
vy metals and provides protection against oxidative stress. employed to assimilate nitrogen in form of ureides that are
Metallothioneins also participate in the uptake, transport, derivatives of inosine 50 -monophosphate (IMP), an branch
and regulation of zinc in biological systems and Zinc, in turn, intermediate in the de novo biosynthesis [48,52].
is a key element for the activation and binding of certain tran- The plants are growing in a petroleum-polluted environ-
scription factors [54]. A cDNA encoding type 3 metallothionein ment, soil particles are covered with a hydrophobic layer that
(PcMT3) was isolated before from the salt stressed leaf cDNA reduces water availability and augments the oxygen demand of
library of Porteresia coarctata (Roxb.) Tateoka, (wild rice) that soil microorganisms which causes anoxic and drought stress
grows well in the heavy metal laden estuarine soils [59] conse- and additionally, the hydrophobic nature of the pollutant also
quently, both cDNAs (3, 9) were good markers of petroleum causes a disruptive chemical stress. The stress signals are
stress in L. monopetalum. Arginine decarboxylase enzyme sensed and communicated by an array of signaling enzymes
belongs to the family of lyases, specifically the carboxy-lyases, that induce transcriptional control and protein turnover to fa-
which cleave carbon–carbon bonds. This enzyme participates vor the synthesis of enzymes acting to alleviate the harmful ef-
in urea cycle and metabolism of amino groups and glutamate fects induced by petroleum. It was suggested that oil cause
metabolism. It employs one cofactor, pyridoxal phosphate. dehydration in soil and this may be the cause of up-regulated
Recent studies have shown that polyamines (PAs) participate genes of drought and salinity. We identified two cDNAs (5, 2)
in the defense reactions protecting plants against environmen- that support this hypothesis; these are cDNA corresponds to
tal stresses. Increased synthesis of PAs, achieved via increased mRNA coding cowpea responsive to dehydration (CPRD2).
activities of the enzymes arginine decarboxylase (ADC) and The CPRD2 exhibited typical and significant responses to
S-adenosylmethionine decarboxylase (SAMDC). PA metabo- water stress, induction by dehydration and reduction in the le-
lism and oxidative damage were investigated in the aquatic vel of the transcript upon rehydration [41]. The other cDNA2
form of the liverwort Riccia fluitans L. exposed to the polycyclic corresponds to mRNA coding salinity stress retrotransposon
aromatic hydrocarbon (PAH) phenanthrene (PHEN). Expo- protein (Oryza sativa indica Group).
sure of Riccia fluitans plants to PHEN induced oxidative stress, Two of the cDNAs (4, 7) isolated in the present work
due to increased synthesis of PAs, achieved via increased activ- showed significant similarity with proteins and enzymes that
ities of the enzymes arginine decarboxylase (ADC) and S-aden- play an important role at several stages of plant growth like
osylmethionine decarboxylase (SAMDC) [16]. aminocyclopropane-1-carboxylic acid (ACC). ACC plays an
Two cDNAs (8, 10) showed significant identity with pro- important role in the biosynthesis of the plant hormone ethyl-
teins related to nitrogen metabolism. Glutamine synthetase ene [30,64]. It is synthesized by the enzyme ACC synthase from
(GS) is an enzyme that plays an essential role in the metabo- methionine and converted to ethylene by ACC oxidase [31].
lism of nitrogen by catalyzing the condensation of glutamate ACC oxidase catalyzes the last step in the biosynthesis of the
and ammonia to form glutamine [19]. Glutamine synthetase plant hormone ethylene. Bruce et al. [14] stated that stress eth-
uses ammonia produced by nitrate reduction, amino acid ylene is produced under petroleum and salt impacted land, fre-
degradation, and photorespiration [37]. The amide group of quently leading to diminished plant growth. cDNA7 encoding
glutamate is a nitrogen source for the synthesis of glutamine ribulose-1,5-bisphosphate carboxylase oxygenase (RuBisCO)
pathway metabolites [36]. The product of its activity, is an enzyme involved in the Calvin cycle that catalyzes the first
glutamine is donor of amino groups for biosynthesis of other major step of carbon fixation, a process by which the atoms of
amino acids, proteins, etc. GDH and GS play key roles in atmospheric carbon dioxide are made available to organisms
maintaining the balance of carbon and nitrogen in plant cell in the form of energy-rich molecules such as glucose. RuBisCO
[43]. Sadunishvili [50] found marked increase in GS activity catalyzes either the carboxylation or the oxygenation of
in the leaves of poplar (Populus deltoids), significant stimula- ribulose-1,5-bisphosphate with carbon dioxide or oxygen.
tion of GDH and GS activities in the leaves and roots of RuBisCO is very important in terms of biological impact
ryegrass and maize seedlings at benzene highest concentration. because it catalyzes the primary chemical reaction by which
cDNA10 corresponds to amidophosphoribosyltransferase inorganic carbon permanently enters the biosphere and
(Atase) is an enzyme that converts a phosphoribosylpyrophos- increasing the level of expression of RuBisCO subunits im-
phate (a-PRPP) into 5-b-phosphoribosylamine. The enzyme prove photosynthetic efficiency. The abundance of RubisCO
uses the ammonia group from the glutamine side-chain. This genes in a particular ecosystem indicates the potential capacity
is the committing step in de novo purine synthesis. ATase is for transcription/translation and subsequent carbon fixation
a member of the purine/pyrimidine phosphoribosyltransferase by representatives of the population. RuBisCO enzyme
family. This protein is a regulatory enzyme that catalyzes the controls both the reduction of CO2 and the oxygenolysis of
first step of de novo purine nucleotide biosynthesis [15]. Purine ribulose-1,5-bisphosphate. Thus, this protein and its catalytic
nucleotides are crucial compounds that are central to primary activity have vast agricultural and environmental significance
metabolism but are also connected to many facets of and all primary production is linked to the function of this
secondary plant metabolism. They are involved in many vital enzyme [27].
cellular processes which are essential for plant growth and The proton dependent oligopeptide transporters (POTs) are
development [12,65]. De novo purine nucleotide biosynthesis a large family of integral membrane proteins that use the
144
Table A1 Molecular sizes of cDNA bands in base pair of unpolluted (c1, c2, and c3) and polluted (1, 2, and 3) Limoniastrum monopetalum plants.
Primer1 776 720 700 641 619 593 500 488 477 465 443 428. 383 377 341 333 323 310 262 262 255 246 225 213 197 191 182 175 171 164 151 125 119
c1 – – – + – – – – + – – + – – – – + – – – + – + – – – – – + – – + –
1 – – + – – + – – – – – – – – – + – – – – – + – + – – – – – + – – +
c2 – + – – + – – + – – + – + – + – – – – – + – – + – – – + – – – – –
2 + – – – + – + – – + – – – + + – – – – – – – + – – – + – – – – – –
c3 – – – – – – – – – – – – – – + – – – – + + – + – – + – – – – + – –
3 – – – – – – – – – – – – – + – – – + + – – – + – + – – – – – + – –
Primer2 258 235 222 191 150 147 106 94 50 38 29 23 20
c1 – – – – – – – – + – – – +
1 – – – – – + – + – – + – –
c2 – – – – – – + – – + – – –
2 + – – – + – – – – – – + –
c3 – + – + + – – – – – – – –
3 – – + – – – – – – – – – –
Primer3 751 580 500 429 421 350 340 329 326 323 296 280 235 232 229 223 185 177 172 149 136 126 121
c1 – – – – – + – – – – – + – – + – + – – + – – –
1 – – – + – – – + – – + – + – – – + – – – + – –
c2 – – – – – + – – – – – + – – + – + – – + – – –
2 – – + + – – – – + + – – – – – – – + – – – – +
c3 – – – – – – – – + – – – – – – + – – + – – + –
3 + + – – + – + – – – – + – + – – – + – – – – –
Primer4 507 500 459 337 332 241 165 160 147 98 85 71 64 51 40 35 10
c1 – – – – + – – – – + – – – + – – +
1 – – – + – – + – – + – – – – – + +
c2 + – + – – + – + – – – + – – – – +
2 – + – – – – + – + + – – + – – – +
c3 – – – – – – – – – – + – – – + – –
3 + – – – – – – + – – – – + – – – –
Primer5 962 665 508 491 253 235 135 89 75 66 46 24 18.462 10
c1 – – – – – – – – + – + – + –
1 – – – – – – – – + – + – + –
c2 – – + – – + – + – – – + – –
2 – – – – + – – – – – + – – +
c3 – – – – – – – – – + – + – –
3 + + – + – – + – – – – + – –
Primer6 734 722 710 700 672 654 624 606 593 545 540 532 496 461 446 437 416 402 384 377 364 325 301 285 279 243 235 221 211 190 167

R. El-Bakatoushi
c1 – – + – – – – + – – + – – – + – – + – + – – – – + – – – – – –
1 – – – + – + – – + – – + + – + – + – + – – – – + – – – – – – –
c2 – + – – – + + – – + – – – + – – + + – – + – – + – – – + – – –
2 + – – – – – – – – – – – – – – – + – – – – – – – + – – – – – –
c3 + – – – + – + – – – – + – – – + + – – + – – – + – – + – – – –
3 – – – – – – – – – – – – – – – – – + – – + + – + + – – + + +
Identification and characterization of up-regulated genes
Table A1
Primer7 500 491 474 467 424 412 393 364 353 337 321 310 200
c1 – – + – – – + – – – + – –
1 – – – + – – + – – + – + +
c2 – – – + – – + – – + – – –
2 – – + – – + – – – + – – +
c3 – + – – – + – – + – – – –
3 + – – – + – – + – – – – –
Primer8 830 825 736 507 500 496 406 344 333 325 297 235 233 230 185 173 144 131 98 68 39 27 15
c1 – – – – – + – + – – – – + + + – – + + – – + –
1 – – – – – + – + – – – + – – – + + – – + + – –
c2 – + – + – – – – – – – – – – – – – – + – – – –
2 – – – – – – + – + – + – + – – – – – – + + – –
c3 + – – + – – – + – – – – – – – – – – + – – – +
3 – + + – + – – – – + – – – – – – – – + – – – +
Primer9 343 333 324 300 297 276 266 256 225 217 200 191 176 144 121 97 81 66 57 37 26 15
c1 + – – + – + – – + – + – – – + – – – + – + –
1 – – – – – + – – – + – + – – + – + – + – + –
c2 – – – – – – + – – + – – + – + – – – + – + –
2 – + – – – – – + + – – + – – – – + – + – + –
c3 – + – – + – – – – + – + – – – – – – – + – +
3 – – + – – – + – – + – – + + – + – + – – – +
Primer10 1227 1182 1164 862 839 767 733 655 634 600 589 559 540 514 454 450 435 427 409 390 364 359 349 343 327 318 286 281 214 189 182 176 163 155 140 132 122
c1 – – – – – – – – – – – – – – – – + – – – – – + – – + – – – – – + – – – – +
1 – – – – – – – – – – – – – – – – – + – – – + – + – – + – – – – – + – – – –
c2 – – – – – – – – – – – + – – – – – – – + – – – – – – + – + – – – – + – + –
2 – – + + + – + – – + – – – – + – – + – + + – – – + – – – – + –
c3 – + – – + + – – + – + + – + – – – – + – – – – + – – – + – + – – – – + – –
3 + – + + + – + – – + – – – + – – – – + + – – – – – – – + – – + –
Primer11 1586 1332 1229 1031 1001 950 839 838 812 801 790 770 823 755 718 699 679 597 464 441 346 297 273 249 150 140 130 125 120 100 40 26 11 10
C1 – – + – – – – + – – – – + – – – – + – + – – – – + – + – – + – – – –
1 – – – – + – + + + – – – – – – + – – – – – – – + – + – – – + + – – –
C2 + – – – – – + + – – + + – + – – – – – – + – – – – + + + – – – + + +
2 – – – + – – – + – + – – – – + – – – + – – + – – – + – – + – – – + +
C3 – + – – – – + + – – – – – – – – – – + – – + – – – + – – + – – – + –
3 – – – – – + – + – – – – – – – – + – – – – + – – – – + + – – – + +
Primer12 3917 3549 3549 998 996 977 953 698 651 628 605 395 349 326 186 163 70 23 20 15 10
1 – – + – + – + – – – + + – – – – – + + + –
2 – – – + – – – – – + – – – – – – – – – – –
3 – – – – + – – + – – – + – – + – – + + – +
4 + – – – + – – + – – – + – – – + + – + + –
5 – + – – + + – – + – – – – + – – – – + + –
6 – – – + – – – – + – – – + – – – – + – + –

145
146
Table A1 (continued)
Primer13 5439 5259 4567 3466 2913 2310 1575 1312 909 810 803 797 791 750 729 708 625 521 500 479 396 354 333 271 229 146 130 120 42 30 20
C1 + – – – – – + – + – – – + – + – – – – – – – – – – – – – – – –
1 – – + – + – – + – – – + + + – – – – + – – + – – – + – + – + +
C2 – – – – – – – – – – + – + – – + – – – – – – – – + – – – – + +
2 – + – + – – – + – – – – + – + – – + – – – – + – – + + – – + +
C3 – – – – – + – – – + – – + – – – + – – – + – – – – + – – – + –
3 – – – – – – – – – – – – + – + – – – – + – – – + – – – – + – –
Primer14 1669 1489 1339 1275 1217 1121 931 867 800 700 567 533 400 367 333 330 310 300 267 100 33 20 10
1 + – – – – – + + – – – – – – – – – + – – + + –
2 – – – + – – + – + – – – – – + – + – – – – + –
3 – + – – – – + – – – – – – + + + + – – – – + +
4 – – + – – – + – – – + – – – – – – – – – – + –
5 – – – – + – + – – – – + – – – – – – + – – – –
6 – – – – – + + – – + – – + – – – – – – + – + +
Primer15 921 842 789 737 632 579 553 447 421 395 316 237 211 158 132 120 79 26 22 20
C1 – – + – – + – – – – – + – – – – – – + +
1 – + – – – + – – – – + – – – – – + – – +
C2 – – – – – – – + – – – – + – – – – + + +
2 + – – + – – – – + – – – – + – – – – + +
C3 – – – – – – + – – – + – – – + + – – – +
3 + – – – + – – – – + – – – – + – – – – +
Primer16 4047 3863 3682 501 403 387 357 351 345 321 292 276 265 257 228 158 140
C1 – + – – – + – + – + + – + – – + –
1 + – – – – – + + – + + – – – – – –
C2 – + – – – – – + + + + – – – – + –
2 + – – – + – – + + – + – – – – – –
C3 – – + + – – – + – – + + – – + – –
3 – – + – – – – + – + – + – + – – +

R. El-Bakatoushi
Identification and characterization of up-regulated genes 147

directed proton electrochemical gradient to transport small [3] A. Amadi, A.A. Dickson, G.O. Maate, Water Air Soil Pollut. 66
peptides, amino acids and nitrate across cellular membranes (1993) 59–76 (doi:10.1007/BF00477060).
in both pro- and eukaryotic cells [55]. [4] G.O. Anoliefo, Forcadoes blend oil effect on respiratory
Environmental pollution induces synthesis of new proteins in metabolism mineral element composition on growth of Citrus
certain species of plants [57]. The increase in protein level is con- vulgarie (Schrad), Ph.D Thesis, Benin (1991) 6–30.
[5] G.O. Anoliefo, B.O. Edegbai, Agric. Forest. Fish 1 (2001) 1–25
sistent with the fact that one of the ways plants use to detoxify
(<http://www.uniben.edu.ng/sites/default/files/abstracts/>).
oxides of nitrogen in leaves is through the synthesis of protein [6] A. Bacher, S. Eberhardt, W. Eisenreich, et al., Vitam. Horm. 61
[44]. Therefore the increase of total protein content in all pol- (2001) 1–49 (<http://www.ncbi.nlm.nih.gov/pubmed/11153262>).
luted plants in this study could be due to the crude oil borne oxi- [7] J.M. Baker, Environ. Pollut. 1 (1970) 27–44 (doi:10.1016/0013-
des of sulfur and nitrogen [4]. An increased level of proteins and 9327(70)90004-2).
amino acids reflects on an efficient nitrogen fixation in plants un- [8] M.O. Baker-Coker, J.A. Ekundayo, Environ. Monitor. Assess.
der these environmental conditions which confirmed by the in- 36 (1995) 93–104, doi:10.1007/BF00546783 (<http://www.
crease of identified enzymes involving in nitrogen metabolism springerlink.com/content/p461v405084j0061/>).
in this study (cDNA8, cDNA10). The result was similar to result [9] J.F. Bamidele, O.M. Agbogidi, Nig. J. Sci. Environ. (2) (2000)
obtained by Hussien et al. [28]which suggested that the concen- 113–121.
[10] M.G. Battelli, E. Lorenzoni, Biochem. J. 207 (1982) 33–38
tration of the most amino acids measured in L. monopetalum in-
(<http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1153833/?tool=
creased in the shoots collected from the crude oil contaminated pmcentrez>).
sites. The study indicated that the polluted plants are able to ac- [11] S.J. Bizily, C.L. Rugh, R.B. Meagher, Nat. Biotech. 18 (2000)
tively accumulate a number of amino acids, depending on the 213–217.
type of environmental stress. Malallah et al. [42] reported similar [12] R. Boldt, R. Zrenner, Physiol. Plant 117 (2003) 297–304
observations in some desert plants growing near the blazing oil (<http://www.ncbi.nlm.nih.gov/pubmed/12654029>).
wells in Kuwaiti desert. The higher concentration of the selected [13] L. Bolous, Flora of Egypt, vol. 2, Al Hadara, Cairo, 2000.
organic metabolites in the plants growing in the contaminated [14] J.A. Bruce, M.C. Matthes, J.A. Napier, et al., Plant Sci. 173
site comparing to those in the non-contaminated one may be (2007) 603–608 (<http://dx.doi.org/10.1016/j.plantsci.2007.09.
due to differences in a number of receptors. The sensitivity of 002>).
[15] F.J. Deneke, B.H. McCown, P.I. Coyne, et al., Annu. Rev.
such receptors for the environmental signal cause differences
Plant Biol. 57 (2006) 805–836 (<http://www.ncbi.nlm.nih.gov.
in genetic expression which leads to differences in physiological pubmed.16669783>).
processes [28]. [16] J.B. David, Plant Cell Environ. 31 (2006) 1416–1431.
A strategy to gain basic biological insights from biotechno- [17] O.P. Dhankher, Y. Li, B.P. Rosen, et al., Nat. Biotechnol. 20
logical processes, such as petroleum phytoremediation, is the (2002) 1140–1145.
employment of plant functional genomic tools to study differ- [18] N.E. Edema, G.E. Okoloko, Bull. Sci. Assoc. Nig. 21 (1997) 15–18.
ential gene expression [26]. The genes identified in this work [19] D. Eisenberg, R.J. Almassy, C.A. Janson, et al., Cold Spring
could share valuable information for establishing metabolic Harb. Symp. Quant. Biol. 52 (1987) 483–90. <http://
process that are up-regulated in petroleum stress and explain symposium.cshlp.org/content/52/483.extract> doi:10.1101/
the synthesis of enzymes acting to lighten the harmful effects SQB.1987.052.01.055.
[20] J.B. Ewies, S.J. Ergas, D.P.V. Chang, E.D. Schroeder,
induced by petroleum besides enzymes control the plant
Bioremediation Principles, Mc Graw-Hill, 1998.
growth. The identified genes may explain the way thatL. [21] R. EL-Bakatoushi, M. Fawzi, W. Botros, Ecol. Med. 36 (2010)
monopetalum establish in oil contaminated soil with vigorous 75–81 (<http://ecologia-mediterranea.univ-avignon.fr/uploads/
vegetative growth of adult plants. The study may maximize media/Ecologia_mediterranea_2010-36_2.pdf>).
the potential of this species for its use in phytoremediation [22] B.G. Ferris, H. Chen, S. Puleo, et al., Am. Rev. Resp. Dis. 113
and rehabilitation programs of oil polluted soils. (1976) 475–485 (<http://www.ncbi.nlm.nih.gov/pubmed/
1267253?dopt=AbstractPlus&holding =f1000,f1000m,isrctn>).
[23] W. Freedman, T.C. Hutchinson, Can. J. Bot. 54 (1976) 2219–
2230 (<http://www.nrcresearchpress.com/doi/abs/10.1139/b76-
Acknowledgment 238?journalCode=cjb1>).
[24] S. Herz, S. Eberhardt, A. Bacher, Phytochemistry 53 (2000) 723–
I thank Prof. M. Fawzy, Department of Environmental 731 (<http://www.ncbi.nlm.nih.gov/pubmed/10783978>).
Sciences, Alexandria University, Egypt for recognizing the [25] R. Hille, Chem. Rev. 96 (1996) 2757–2816 (<http://
plant study sites and the Western Desert Petroleum Company www.ncbi.nlm.nih.gov/pubmed/11848841>).
[26] H. Holtorf, M.C. Guitton, R. Reski, Naturwissenschaften 89
(WEBCO) for facilitating samples collection.
(2002) 235–249. <http://www.plant-biotech.net/paper/
2002_03_26_pageproof.pdf>. doi:10.1007/s00114-002-0321-3.
[27] H.X. Howard, F.T. Robert, Appl. Environ. Microbiol. 62 (1996)
1913–1921 (<http://www.ncbi.nlm.nih.gov/pmc/articles/
Appendix A. See Table A1. PMC167970/>).
[28] H.S. Hussein, T. Norman, Environ. Int. 28 (2002) 127–135. <http://
www.sciencedirect.com/science/article/pii/S0160412002000168>.
doi:10.1016/S0160-4120(02)00016-8.
References
[29] A. Katoh, T. Hashimoto, Front. Biosci. 9 (2004) 1577–1586,
<http://www.ncbi.nlm.nih.gov/pubmed/14977569>.
[1] F.I. Achuba, Environment 21 (2006) 17–20. <http://
[30] H. Kende, Annu. Rev. Plant Physiol. 44 (1993) 283–307,
www.ncbi.nlm.nih.gov/pubmed/7817396>.
doi:10.1146/annurev.pp.44.060193.001435.
[2] P.J.J. Alvarez, T.M. Vogel, Appl. Environ. Microbiol. 57 (1991)
[31] H. Kende, Plant Physiol. 91 (1989) 1–4, doi:10.1104/pp.91.1.
2981–2985 (<http://alvarez.rice.edu/emplibrary/2.pdf>).
148 R. El-Bakatoushi

[32] K. Kubitzki, in: J.G. Rohwer, V. Bittrich, K. Kubitzki (Eds.), [49] E. Rosenburg, R. Legman, J. Rodriguez-Grau, et al., Waste
The Families and Genera of Vascular Plants, Springer, Berlin, Manage. Res. 11 (1993) 97–106. <http://wmr.sagepub.com/
1993, p. 523. content/11/2/97.abstract> doi:10.1177/0734242X9301100202.
[33] U.K. Laemmli, Nature (1970) 227–680, doi:10.1038/227680a0. [50] T. Sadunishvili, E. Kvesitadze, M. Betsiashvili, et al., Wor.
[34] P. Liang, L. Averboukh, A.B. Pardee, Nucl. Acids Res. 21 Acad. Sci. Eng. Technol. 57 (2009) 271–276, <http://
(1993) 3269–3275, <http://www.ncbi.nlm.nih.gov/pmc/articles/ www.waset.org/journals/waset/v57/v57-49.pdf>.
PMC309766/>. [51] J.L. Schnoor, A. Louis, Licht, et al., Environ. Sci. Technol. 29
[35] P. Liang, W. Zhu, X. Zhang, et al., Nucl. Acids Res. 22 (1994) 5763– (1995) 318–323.
5764, <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC310145/>. [52] K.R. Schubert, M.J. Boland, in: B.J. Miflin, P.J. Lea (Eds.), The
[36] S.H. Liaw, C. Pan, D. Eisenberg, Proc. Natl. Acad. Sci. USA 90 Biochemistry of Plants, San Diego, Academic Press, 16, 1990,
(1993) 4996–5000, <http://www.pnas.org/content/90/11/ pp. 197-282. <http://pmn.plantcyc.org/ara/reference/html>
4996.full.pdf>. [53] J.F. Senecoff, E.C. McKinney, R.B. Meagher, Plant Physiol.
[37] S.H. Liaw, I. Kuo, D. Eisenberg, Protein Sci. 4 (1995) 2358–2365, 112 (1996) 905–917, <http://www.ncbi.nlm.nih.gov/pubmed/
<http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2143006/>. 8938402>.
[38] A.E. Linkins, Science (1978). [54] A. Sigel, H. Sigel, R.K.O. Sigel, Metallothioneins and Related
[39] A.E. Linkins, R.M. Atlas, P. Gustin, Arctic 31 (3) (1978) 355– Chelators. Metal Ions in Life Sciences. 5, RSC Publishing,
365, <http://arctic.synergiesprairies.ca/arctic/index.php/arctic/ Cambridge, 2009.
article/view/2664>. [55] R.A. Skurray, I.T. Paulsen, The POT family of transport
[40] O.H. Lowry, N.J. Rosebrough, A.L. Farr, et al., J. Biol. Chem. proteins, Trends Biochem. Sci. 19 (1994) 404, <http://
193 (1951) 265–275, <http://www.ncbi.nlm.nih.gov/pubmed/ www.ncbi.nlm.nih.gov/pubmed/7817396>.
14907713>. [56] C. Soo, D.N. Sayah, X. Zhang, et al., Reconstr. Surg. 11 (2002)
[41] S.I. Luchi, K. Yamaguchi-Shinozaki, T. Urao, et al., Plant Cell 787, <http://www.ncbi.nlm.nih.gov/pubmed/12172140>.
Physiol. 37 (1996) 1073–1082, <http://pcp.oxfordjournals.org/ [57] L. Taiz, E. Zeiger, Plant Physiology, The Benjamin/Cummings
content/37/8/1073.abstract>. Publ. Co, New York, 1991.
[42] G.A. Malallah, M. Afzal, M. Kurian, et al., Environ. Int. 24 [58] F.V. Traven, Frontier Orbitals and Properties of Organic
(1998) 919–924. <http://www.sciencedirect.com/science/article/ Molecules, Elli Harwood Ltd., England, 1992.
pii/S0160412098000610>. doi:10.1016/S0160-4120(98)00061-0. [59] B. Usha, N.S. Keeran, M. Harikrishnan, et al., Biol. Plant 55
[43] B.J. Miflin, D.Z. Habash, J. Exper. Bot. 53 (2002) 979–987. (2011), doi:10.1007/s10535-011-0016-8.
<http://jxb.oxfordjournals.org/content/53/370/979.abstract> [60] R.W. Wein, L.C. Bliss, J. Appl. Ecol. 10 (1973) 671–682.
doi:10.1093/jexbot/53.370.979. [61] J. Welsh, C. Petersen, M. McClelland, Nucl. Acids Res. 19 (1991)
[44] M.T. Murray, G. Krohne, W.W. Franke, Proc. Nat. Acad. Sci. 303, <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC333594/>.
USA 89 (1992) 11–15, <http://www.pnas.org/content/89/1/ [62] J. Welsh, K. Chada, S.S. Dalal, et al., Nucl. Acids Res. 20 (1992)
11.full.pdf>. 4965, <http://www.ncbi.nlm.nih.gov/pubmed/1383934>.
[45] D.w. Nebert, H.v. Gelboin, J. Biol. Chem. 243 (1968) 6242– [63] J. Wyszkowska, J. Kucharski, E. Wadowska, Rost. Vyroba. 48
6249. (2002) 51–57.
[46] J.F. Payne, W.R. Penrose, Bull. Environ. Contam. Toxic. 14 [64] S. Yang, N. Hoffman, Annu. Rev. Plant Physiol. 35 (1984) 155–
(1975) 112–116. 189, doi:10.1146/annurev.pp.35.060184.001103.
[47] J.M. Peña-Castro, B.E. Barrera-Figueroa, L. Fernández- Linares, [65] R. Zrenner, M. Stitt, U. Sonnewald, et al., Annu. Rev. Plant
et al., Pl. Sci. 170 (2006) 724–731. <http://www.sciencedirect.com/ Biol. 57 (2006) 805–836, doi: 10.1146/annurev.arplant.57.
science/article/pii/S0168945205004115> doi:10.1016/j.plantsci. 032905.105421.
2005.11.004.
[48] H. Reinbothe, K. Mothes, Annu. Rev. Plant Physiol. 13 (1962)
129–151, <http://pmn.plantcyc.org/ara/refernce.html>.