You are on page 1of 147

1

Universidade de So Paulo
Faculdade de Sade Pblica

Vigilncia Entomolgica de mosquitos (Diptera,


Culicidae) como estratgia de Vigilncia Ambiental em
Sade no Rio Grande do Sul, Brasil

Jder da Cruz Cardoso

Tese apresentada ao Programa de Ps-


Graduao em Sade Pblica para obteno do
ttulo de Doutor em Sade Pblica

rea de Concentrao: Epidemiologia

Orientadora: Profa. Dra. Maria Anice Mureb


Sallum

So Paulo
2010
2

Vigilncia Entomolgica de mosquitos (Diptera,


Culicidae) como estratgia de Vigilncia Ambiental em
Sade no Rio Grande do Sul, Brasil

Jder da Cruz Cardoso

Tese apresentada ao Programa de Ps-


Graduao em Sade Pblica da Faculdade de
Sade Pblica da Universidade de So Paulo
para obteno do ttulo de Doutor em Sade
Pblica

rea de Concentrao: Epidemiologia

Orientadora: Profa. Dra. Maria Anice Mureb


Sallum

So Paulo
2010
2

expressamente proibida a comercializao deste documento, tanto na sua forma


impressa como eletrnica. Sua reproduo total ou parcial permitida
exclusivamente para fins acadmicos e cientficos, desde que na reproduo
figure a identificao do autor, ttulo, instituio e ano da tese.
2

Para Melissa e Eduardo,


com todo meu amor.
2

AGRADECIMENTOS

Agradeo sinceramente Profa. Dra. Maria Anice Mureb Sallum, pela orientao,
ensinamentos e confiana depositada ao longo desses anos.

Mrcia Bicudo de Paula e Aristides Fernandes pelas identificaes taxonmicas


dos exemplares do litoral.

Aos professores Jos Maria Soares Barata, Dlsio Natal, Almrio Castro Gomes e
Eunice Bianchi Galati por terem me direcionado para a entomologia mdica.

Aos Doutores Mrcia Bicudo de Paula, Walter Ceretti Jr., Paulo Urbinatti e Mauro
Marrelli, pela amizade e companheirismo.

Aos professores do Departamento de Epidemiologia pelas disciplinas que muito


contriburam para minha formao, especialmente ao Prof. Eliseu Waldman pela sua
sabedoria, didtica, simplicidade e respeito ao tratar os alunos.

Aos colegas de curso com quem compartilhei momentos de angstia e descontrao,


especialmente, Andr Wilke, Bianca Schmid, Fernanda Cavallini, Rafael Moreira,
Raquel Queiroz, Renata Couto, Roberto Hoffmann, Evelyn e Daniel Arajo.

Aos funcionrios Jos Estorniolo Filho e Mrcia Ribeiro, da Biblioteca/FSP e


Paschoal Peduto, Rodrigo Sportello e Daniel Flores, da informtica do HEP, pela
gentileza com que sempre me atenderam.

A todos os amigos que adotaram e deram alguma forma suporte ao estrangeiro em


So Paulo: Dr. Rodrigo Mantovani, famlias Galizia, Barata e Natal e membros da
Repblica do Gato Preto, Rodrigo, Flvio e Hugo.

Agradeo aos colegas do Instituto Evandro Chagas, GT-Arbovrus e CGLAB pelo


apoio ao trabalho desenvolvido pela Vigilncia Ambiental do Rio Grande do Sul.

Fundao Estadual de Pesquisa Agopecuria do RS pelo apoio logstico para as


pesquisas no Litoral Norte e ao Parque Nacional da Lagoa do Peixe pela autorizao
para monitoramento em suas dependncias.
3

comunidade de Maquin, principalmente aos moradores que permitiram as coletas


em suas propriedades e aos agentes da Secretaria Municipal de Sade Ivan dos
Santos e Edenir Saucedo Jr, que apoiaram a fase inicial do trabalho.

Ao Laboratrio Central de Sade Pblica pela contribuio e envolvimento da Seo


de virologia no armazenamento e envio do material para pesquisas de arbovrus.

direo do Centro Estadual de Vigilncia em Sade e Diviso de Vigilncia


Ambiental em Sade pela confiana depositada em mim e no trabalho proposto.

Agradeo aos colegas de municpios, Coordenadorias Regionais de Sade e CEVS


que contribuiram com as aes de campo, especialmente, Pedro Aquino, Valter
Menezes, Jorge Wilson, Leandro Pinto, Hlio Jacques, Fernando Ferreira, Acelino
dos Santos, Valdir Lopes e Carlos Noll.

Aos colegas de trabalho pela convivncia diria, apoio, incentivo e companheirismo,


principalmente, Edmilson dos Santos, Marco Almeida, Daltro da Fonseca, Carmen
Gomes, Silvania Ramos, Ana Tartarotti, Nathlia Flores, Thuani Braga, Renata Leo,
Ariadne Kerber, Lcia Mardini, Cleonara Bedin, Maria Amlia, Carmem Estima,
Ivone Menegolla, Geisa Meireles, Luciana Sehn, Fernanda Mello e Glnio Rosa.

Devo agradecer tambm aos Drs. Ricardo Ott e Marcelo Batesini, s Dras. Ana Ott e
Luciane Crossetti e aos colegas Marco Almeida e Ivone Menegolla pelas valiosas
discusses e sugestes ao trabalho.

A todos os meus queridos amigos e familiares pelo incentivo, especialmente meus


pais, Luiz e Marlene (devo tudo a eles!), meus irmos, cunhados e sobrinhos pelo
carinho e apoio irrestrito.

Agradeo ao meu amado indiozinho pelos sorrisos que me renovavam o nimo.

Quero muito agradecer a minha esposa Melissa Rodrigues Martins pela pacincia,
dedicao e suporte nas ocasies mais complicadas. Tambm gostaria de me
desculpar pelos momentos de ausncia no convvio em famlia.

Sou grato a todos que contriburam para que eu chegasse at aqui.


4

RESUMO

Cardoso J da C. Vigilncia Entomolgica de mosquitos (Diptera, Culicidae)


como estratgia de Vigilncia Ambiental em Sade no Rio Grande do Sul, Brasil
[tese de doutorado]. So Paulo: Faculdade de Sade Pblica da USP; 2010.

Introduo: O estudo dos insetos em virtude da nocividade ou benefcio que


oferecem ao homem objeto da entomologia aplicada. No Brasil, a incorporao da
entomologia pela sade pblica vem ocorrendo de forma gradual at os dias de hoje.
A vigilncia entomolgica surge como uma ferramenta que possibilita sistematizar
informaes sobre os insetos, com a finalidade de conhecer aspectos biolgicos e
ecolgicos que permitam definir o papel vetorial, predizer o risco de exposio da
populao humana aos vetores e fornecer bases tcnicas para aes de controle das
espcies de interesse. Embora existam meios legais para tornar a Vigilncia
Entomolgica uma prtica contnua e abrangente, essa ainda no uma realidade no
Rio Grande do Sul. Objetivo: Demonstrar a importncia da entomologia em sade
pblica, atravs das prticas de Vigilncia Entomolgica de mosquitos (Diptera,
Culicidae), vinculadas rotina da Vigilncia Ambiental em Sade. Mtodos: Entre
dezembro de 2006 e dezembro de 2008 foram realizados estudos mensais, abordando
aspectos ecolgicos da fauna em uma rea de Mata Atlntica do litoral norte do
Estado, empregando armadilhas CDC e aspirador de Nasci. Em novembro de 2008,
no noroeste, foram realizadas investigaes entomolgicas em reas com circulao
de vrus da febre amarela, utilizando rede entomolgica associada a aspirador tipo
frasco e, em julho de 2006, aes de monitoramento do vrus do Nilo Ocidental em
refgio de aves migratrias no sul do Estado, com uso de aspirador de Nasci.
Resultados: O trabalho possibilitou detectar 23 novos registros de mosquitos para o
Rio Grande do Sul. As coletas continuadas mostraram uma distribuio sazonal das
espcies, sendo o perodo de outubro a maio o mais indicado para atividades de
levantamento e monitoramento da fauna. O papel vetorial de Haemagogus
leucocelaenus foi comprovado j que o vrus da febre amarela foi novamente
detectado nessa espcie. Outra importante contribuio foi o primeiro isolamento do
vrus da febre amarela em Aedes serratus, sugerindo o papel dessa espcie como
5

vetor secundrio do vrus. Concluses: A Vigilncia Entomolgica forneceu


informaes e indicadores que ampliam as perspectivas sobre a capacidade e
competncia vetorial de algumas espcies de mosquitos do Rio Grande do Sul,
evidenciando a importncia dessa ferramenta.

Descritores: Sade Pblica, Vigilncia em Sade, entomologia, mosquitos vetores


6

ABSTRACT

Cardoso J da C. Entomological Surveillance of mosquitoes (Diptera, Culicidae)


as a strategy of the Health Environmental Surveillance in Rio Grande do Sul
state, Brazil [Thesis]. So Paulo (BR): Faculdade de Sade Pblica da USP;
2010.

Introduction: The study of insects, due to the damage or benefit they give to humans,
is an object of applied entomology. In Brazil, the incorporation of entomology by
public health has been occurring gradually until today. The Entomological
Surveillance appears as a tool that provides the organization of information about the
insects, aiming to know biological and ecological aspects that allow the definition of
the role of vectors, the prediction of the risk of exposure of the human population to
the vectors, and the provision of technical foundation in the control of key species.
Although there are legal ways to turn the Entomological Surveillance in a continuous
and broad practice, this is not real in Rio Grande do Sul. Objective: To demonstrate
the importance of the entomology in public health through the practice of
Entomological Surveillance of mosquitoes (Diptera, Culicidae), linked to the routine
of the Health Environmental Surveillance. Methods: Between December 2006 and
December 2008 systematic studies were carried out and focused on ecological
aspects of the fauna in an Atlantic Forest area on the north coast of the state, using
CDC traps and Nasci vacuum. In November 2008, in the northwestern region,
entomological investigations were performed in areas with circulation of the yellow
fever virus, using an entomological net associated with a bottle-type vacuum. In July
2006, monitoring of the West Nile virus in a refuge of migratory birds was carried
out using a Nasci vacuum. Results: The study promoted the detection of 23 new
records of mosquitoes for Rio Grande do Sul State. Systematic sampling
demonstrated a seasonal distribution of the species, with the period between October
and May adequate to activities related to fauna surveying and monitoring. The role of
Haemagogus leucocelaenus as a vector was demonstrated since the yellow fever
virus was again detected in this species. Another important contribution was the
discovery of the first isolate of the virus in Aedes serratus, suggesting a role of this
7

species as secondary vector of the virus. Conclusions: The Entomological


Surveillance gave information and indicators that broadened perspectives on the
vector capacity and competency of determined mosquito species in Rio Grande do
Sul, highlighting the importance of this tool.

Describers: Public Health, Health Surveillance, entomology, mosquito vectors


8

APRESENTAO

A sociedade tem se desenvolvido s custas da degradao ambiental que


proporciona condies ao desenvolvimento de insetos que podem atuar como vetores
de agentes causadores de doenas, as quais se voltam contra a prpria populao.
Nos ltimos anos, o registro de casos humanos de doenas infecciosas cujo agente
transmitido por vetores biolgicos - conhecidas como doenas metaxnicas - bem
como a deteco desses patgenos na natureza, tem levado a Secretaria da Sade do
Estado do Rio Grande do Sul a implantar diversas estratgias de vigilncia entomo-
epidemiolgica, visando a preveno e controle dessas doenas.
Este trabalho pretende demonstrar a importncia da entomologia aplicada
sade, atravs da Vigilncia Entomolgica de mosquitos incorporada e desenvolvida
pela Vigilncia Ambiental em Sade do Rio Grande do Sul.
A metodologia utilizada e os resultados obtidos constam nos quatro
manuscritos resultantes, os quais seguem normatizao das revistas para as quais
foram ou sero submetidos. Para facilitar a leitura e evitar uma disparidade de estilos,
a apresentao dos artigos foi uniformizada e as figuras foram includas no corpo do
texto. Todos os manuscritos trazem consigo, conceitos e atribuies da Vigilncia
Entomolgica e so resultantes da pesquisa no servio.
a) Aspectos ecolgicos de mosquitos (Diptera, Culicidae) em uma rea de
Mata Atlntica no litoral norte do Rio Grande do Sul, Brasil: Nesse artigo uma
comunidade de culicdeos do municpio de Maquin caracterizada atravs de
ndices de riqueza, abundncia, dominncia, identificao de espcies vetoras,
distribuio temporal e influncia de fatores climticos sobre a fauna.
b) Novos registros e potencial epidemiolgico de algumas espcies de
mosquitos (Diptera, Culicidae) no Rio Grande do Sul, Brasil: apresenta uma lista
de espcies encontradas pela primeira vez no Estado e discute o potencial
epidemiolgico de algumas espcies identificadas no municpio de Maquin.
c) Isolamento do vrus da Febre amarela em mosquitos (Diptera,
Culicidae) de reas epizoticas do noroeste do Rio Grande do Sul, Brasil:
resultado de uma investigao entomolgica realizada durante epizootia de febre
amarela nos municpios de Caibat e Coronel Barros. O papel de Haemagogus
9

leucocelaenus como vetor principal no Rio Grande do Sul confirmado e, pela


primeira vez, verifica-se a infeco natural de Aedes serratus pelo vrus.
d) First record of Culex (Culex) brethesi (Dyar) (Diptera, Culicidae) in
Rio Grande do Sul state, Brazil: resulta de uma ao da Vigilncia Entomolgica
de arbovrus realizada no municpio de Mostardas, localizado na poro central da
Plancie Costeira do Estado.
2

NDICE

1 INTRODUO................................................................................................................................ 12
1.1 ENTOMOLOGIA NA SADE PBLICA ................................................................................ 14
1.1.1 Entomologia em sade no Rio Grande do Sul .................................................................. 18
1.2 VIGILNCIA ENTOMOLGICA ............................................................................................ 19
1.3 FAMLIA CULICIDAE .............................................................................................................. 20
1.3.1 Subfamlia Anophelinae ................................................................................................... 21
1.3.2 Subfamlia Culicinae ........................................................................................................ 22
1.3.3 Culicidae no Rio Grande do Sul ..................................................................................... 22
1.3.4 Importncia em Sade Pblica.......................................................................................... 26
2 JUSTIFICATIVA ............................................................................................................................ 33
3 OBJETIVOS .................................................................................................................................... 36
3.1 OBJETIVO GERAL .................................................................................................................... 36
3.2 OBJETIVOS ESPECFICOS ...................................................................................................... 36
4 RESULTADOS ................................................................................................................................ 37
4.1 ASPECTOS ECOLGICOS DE MOSQUITOS (DIPTERA, CULICIDAE) EM UMA REA
DE MATA ATLNTICA NO LITORAL NORTE DO RIO GRANDE DO SUL, BRASIL .......... 37

4.2 NOVOS REGISTROS E POTENCIAL EPIDEMIOLGICO DE ALGUMAS ESPCIES


DE MOSQUITOS (DIPTERA, CULICIDAE) NO ESTADO DO RIO GRANDE DO SUL,
BRASIL.............................................................................................................................................. 70

4.3 ISOLAMENTO DO VRUS DA FEBRE AMARELA EM MOSQUITOS (DIPTERA,


CULICIDAE) DE REAS EPIZOTICAS NO NOROESTE DO RIO GRANDE DO SUL,
BRASIL.............................................................................................................................................. 86

4.4 FIRST RECORD OF CULEX (CULEX) BRETHESI (DYAR) (DIPTERA, CULICIDAE) IN


RIO GRANDE DO SUL STATE, BRAZIL...................................................................................... 107

5 CONSIDERAES FINAIS........................................................................................................... 114


6 REFERNCIAS ............................................................................................................................... 121
ANEXO A Tcnicas de coleta ........................................................................................................ 133
ANEXO B Localizao das reas de coleta ................................................................................... 134
ANEXO C Ambientes de coleta ..................................................................................................... 135
ANEXO D Revista Brasileira de Entomologia: Normas para publicao ..................................... 136
ANEXO E Revista da Sociedade Brasileira de Medicina Tropical: Normas para publicao ....... 138
ANEXO F Emerging Infectious Diseases: Normas para publicao ............................................. 141
ANEXO G Neotropical Entomology: Normas para publicao ..................................................... 142
ANEXO H Guia de campo: Vigilncia Entomolgica de mosquitos (Diptera, Culicidae) ............ 144
ANEXO I Curriculum Vitae ........................................................................................................... 145
12

1 INTRODUO

As relaes entre os insetos e o homem ocorrem desde os primrdios da

humanidade. No incio serviam de alimento ao homem primitivo sendo mais tarde

vistos como fontes de riqueza, atravs da produo do mel e seda. So citadas

referncias a insetos, seda ou mel que constariam de antigos textos chineses, hindus,

rabes e hebreus (MACHADO, 1987).

Entomologia o nome dado parte das cincias biolgicas que estuda os

insetos. uma palavra formada pelo radical grego entomo, cujo significado, em

latim, corresponde a insecta, isto , dividido, segmentado (CARRERA, 1991).

A entomologia pode ser dividida em bsica ou pura quando estuda insetos

sem preocupaes de ordem econmica ou importncia para o homem. J a

entomologia aplicada ou econmica estuda os insetos sob o ponto de vista de sua

utilidade ou nocividade (CORSEUIL, 2001).

Foi somente na primeira metade do sculo XIX que a entomologia foi

individualizada como cincia e surgiram as Sociedades de Entomologia de Paris em

1832, de Londres em 1833 e de Stettin, na Alemanha, em1887 (MACHADO, 1987).

Embora os efeitos danosos dos insetos fossem conhecidos h mais de 1000

anos antes de Cristo, somente no final do sculo XIX inaugurada a entomologia

mdica. Em 1878, Patrick Manson comprovou que mosquitos do gnero Culex eram

responsveis pela transmisso do helminto Wuchereria bancrofti (Cobbold, 1877)

causador da doena conhecida como elefantase. Logo depois, em 1880, Alphonse

Laveran, mdico do exrcito francs, encontrou plasmdios causadores da malria no

sangue de soldados doentes na Arglia. Entre 1898 e 1900, Giovani Batista Grassi e
13

um grupo de pesquisadores italianos provaram que mosquitos do gnero Anopheles

Meigen, 1818 transmitiam os plasmdios da malria. Em Cuba, Carlos Finlay

props, em 1880, que mosquitos transmitiam o vrus da febre amarela, embora seus

esforos no tenham sido levados em considerao. No entanto, foi aproveitando

suas observaes que Walter Reed, chefe da Comisso Norte-Americana de Febre

Amarela, provou em 1900, que o vrus amarlico era transmitido por Stegomyia

fasciata, mosquito hoje conhecido como Aedes aegypti (Linnaeus, 1762). As

investigaes de Walter Reed e sua equipe concluram que a febre amarela seria

melhor controlada eliminando os mosquitos e protegendo os doentes de suas picadas

(CARRERA, 1991; ROSEN, 1994).

Esses achados impulsionaram novos estudos para provar a transmisso de

agentes etiolgicos por outros grupos de artrpodes. Entre 1906 e 1946, diversos

pesquisadores conseguiram demonstrar o papel vetorial de carrapatos, piolhos,

pulgas, flebotomneos e mosquitos. Os pioneiros da entomologia mdica dividem

com os bacteriologistas os crditos pela grande contribuio que deram a Sade

Pblica moderna (ROSEN, 1994).

H pouco mais de cem anos a entomologia mdica passou a interessar direta

ou indiretamente, a comunidade cientfica mundial. Foram aprofundados estudos

sobre taxonomia, biologia, ecologia e etologia. Iniciaram o estudo das cadeias de

transmisso, que evoluiria para o estudo dos ecossistemas de transmisso e as

tentativas de elaborao de modelos matemticos. Os avanos da entomologia

mdica foram extremamente importantes para o desenvolvimento da epidemiologia

(MACHADO, 1987).
14

1.1 A ENTOMOLOGIA NA SADE PBLICA

No incio do Brasil-repblica eram comuns as divergncias entre as teorias

tradicionais, que atribuam a origem das epidemias aos miasmas, e as idias da

medicina moderna, baseadas nos conceitos da bacteriologia e fisiologia

desenvolvidas na Europa. Mesmo com a resistncia de algumas faculdades de

medicina, um novo campo do conhecimento, voltado para o estudo das doenas e

desenvolvimento de formas de atuao em surtos epidmicos comeou a se desenhar

no Brasil: a medicina pblica, higiene ou sade pblica (BERTOLLI FILHO, 2004).

O sculo XX foi marcado por diversas transformaes na sade pblica. A

populao passa a ser vista como capital humano necessrio aos interesses

produtivos da nao, motivando os governos a elaborarem planos de combate s

enfermidades que reduziam a vida til da populao. O Estado deixa de atuar

somente em pocas de surtos epidmicos, estendendo o cuidado a todos os setores da

sociedade por todo tempo. Os higienistas passam a ocupar cargos na administrao

pblica com objetivo de atuar na fiscalizao sanitria, retificao de rios para evitar

enchentes, drenagem de pntanos, destruio de viveiros de ratos e insetos, reforma

urbanstica e divulgao de regras bsicas de higiene. Para dar suporte s aes dos

higienistas, so estruturados institutos de pesquisas em algumas cidades, com

destaque para os Institutos Butant, Biolgico e Bacteriolgico (mais tarde

denominado Adolfo Lutz), em So Paulo, e Instituto Oswaldo Cruz no Rio de Janeiro

(BERTOLLI FILHO, 2004)

As principais endemias brasileiras mantidas por mosquitos no sculo XX

foram febre amarela, dengue, filariose e malria. Em 1930, a cidade de Natal, no Rio
15

Grande do Norte, registra infestao pela espcie africana Anopheles gambiae Giles,

1902, que logo comea a ser associado a epidemias de malria. A erradicao dessa

espcie alcanada em 1940, fazendo com que pases infestados por Aedes aegypti

utilizassem os mesmos mtodos na tentativa de erradicar o vetor da febre amarela

urbana e dengue. Aps a erradicao em 1955, vrios focos de Aedes aegypti foram

detectados e rapidamente debelados em vrias localidades. Entretanto, em 1976, a

partir de um foco na Bahia, na capital Salvador, o Brasil foi reinfestado de tal forma,

que a presena dessa espcie verificada em praticamente todos os Estados

brasileiros. Alm de Aedes aegypti, em 1986 foi introduzida outra espcie com

potencial para transmitir o vrus da febre amarela e dengue: Aedes albopictus (Skuse,

1894) (NOBRE et al., 1994).

Em 1946, a alta prevalncia de filariose bancroftiana verificada em Belm do

Par, revelou a importncia dessa doena como problema de sade pblica, sendo

Culex quinquefasciatus Say, 1823 o vetor incriminado. Entre 1951 e 1958 exames de

infeco natural nas fmeas adultas eram realizados concomitantemente aos

inquritos hemoscpicos de prevalncia. Nas reas endmicas o controle qumico do

vetor foi empregado no incio, mas foi abandonado pela ausncia de inseticida eficaz

e alto custo das aplicaes semanais de larvicidas (ROCHA e FONTES, 1998).

MARQUES e GUTIERREZ (1994) apresentam os principais registros

histricos da luta anti-malrica nos ltimos cem anos. Oswaldo Cruz esteve na

Amaznia entre 1905 e 1913, tendo estabelecido as bases para a profilaxia da doena

na regio. Em 1913, Carlos Chagas descreveu a epidemiologia das doenas

transmissveis na Amaznia e demonstrou a extrema gravidade da malria nas


16

populaes rurais. Diversos servios, regulamentaes e aes de controle, incluindo

o combate ao vetor, foram incorporados pelo Ministrio da Sade, criado em 1953.

At a criao do Sistema nico de Sade (SUS), o Ministrio da Sade,

desenvolveu quase que exclusivamente aes de promoo da sade e preveno de

doenas, como campanhas de vacinao e controle de endemias (BRASIL, 2003).

Como resultado de amplo debate do setor sade, a Constituio Federal de

1988 criou o Sistema nico de Sade, pautado pelos princpios de universalidade,

eqidade, integralidade e organizado de maneira descentralizada, hierarquizada e

com participao da populao (BRASIL, 2003). Em seu artigo 196, o texto

constitucional cita que a sade direito de todos e dever do Estado, garantido

mediante polticas sociais e econmicas que visem reduo do risco de doena e de

outros agravos e ao acesso universal igualitrio s aes e servios para sua

promoo, proteo e recuperao (BRASIL, 2000a).

As atribuies do SUS relacionadas epidemiologia, preveno e controle de

doenas, nas trs esferas de governo, foram regulamentadas pela portaria n

1.399/99, que no seu artigo 2, item XX, cita como competncia dos Estados, a

coordenao de aes de Vigilncia Entomolgica para doenas transmitidas por

vetores, incluindo a realizao de inquritos entomolgicos (BRASIL, 1999).

A publicao da portaria 1.399/99 desencadeou o processo de

descentralizao da sade. A partir desse momento, aes de preveno e controle de

endemias como dengue, malria, doena de Chagas, entre outras, at ento sob

responsabilidade da Fundao Nacional de Sade (FUNASA), foram transferidas

para Estados e Municpios (BRASIL, 2003).


17

MACIEL FILHO et al. (1999) ao descreverem o processo histrico de

construo e definio dos indicadores de Vigilncia Ambiental em Sade (VAS), a

conceituaram como o processo contnuo de coleta de dados e anlise de

informao sobre sade e ambiente, com o intuito de orientar a execuo de aes

de controle de fatores ambientais que interferem na sade e contribuem para a

ocorrncia de doenas e agravos, demonstrando que o conhecimento das condies

ambientais locais ou regionais e das atividades socioeconmicas so de extrema

relevncia para o estabelecimento de medidas de preveno aos agravos e eliminao

dos riscos potenciais e existentes.

Em 2001, a portaria 1.399/99 foi regulamentada pela instruo normativa n

1/01-FUNASA/MS, a qual define as competncias da Unio, Estados, municpios e

Distrito Federal na rea de VAS. Entre as vrias atribuies do Estado figuram a

promoo, coordenao e execuo de estudos e pesquisas aplicadas na rea de VAS

e coordenao das aes de monitoramento dos fatores ambientais de risco sade,

entre os quais, a vigilncia de vetores (BRASIL, 2001a).

O objeto da VAS a exposio como determinante de agravos. Portanto o

foco tradicional da vigilncia dos agravos deve ser deslocado para a vigilncia de

fatores coletivos de risco (BARCELLOS e QUITRIO, 2006). A avaliao de riscos

como ferramenta para a VAS deve ser contextualizada realidade local e baseada em

abordagens integradas e participativas (FREITAS, 2002).

Embora a instruo normativa n 1/05 da Secretaria de Vigilncia em Sade

(SVS/MS) tenha apresentado alteraes na organizao da VAS, suprimindo os

fatores ambientais biolgicos de risco sade de suas competncias (BRASIL,

2005a), o Estado do Rio Grande do Sul estruturou sua Vigilncia em Sade


18

mantendo a configurao prevista na instruo normativa n 1/01. Assim, no decreto

44050/05 que criou o Centro Estadual de Vigilncia em Sade (CEVS), a Vigilncia

Ambiental em Sade inclui na sua rea de atuao os fatores ambientais biolgicos,

representados por vetores, hospedeiros, reservatrios e animais peonhentos (RIO

GRANDE DO SUL, 2005a).

1.1.1 A Entomologia em Sade no Rio Grande do Sul

No Rio Grande do Sul a descentralizao dos programas nacionais de

controle da doena de Chagas, febre amarela e dengue ocorreu em 2000, quando a

Coordenao de Polticas de Controle de Zoonoses e Vetores (CPCZV), rgo que

originou a atual Diviso de Vigilncia Ambiental em Sade (DVAS), assumiu as

aes relacionadas a essas endemias, at ento executadas pela FUNASA (TORRES,

et al. 2001).

Atualmente, a Vigilncia Entomolgica dos artrpodes de importncia em

sade pblica est associada aos programas nacionais e estaduais desenvolvidos pelo

CEVS, em virtude da possibilidade de ocorrncia ou da existncia de agravos

causados localmente por esses vetores.

Assim sendo, a vigilncia do Aedes aegypti e Aedes albopictus est inserida

no Programa Nacional de Controle da Dengue (BRASIL, 2001b; BRASIL, 2002); as

diretrizes das aes de controle de Triatoma infestans Klug, 1834 e outros

triatomneos esto sugeridas no Consenso Brasileiro em Doena de Chagas

(BRASIL, 2005b); os borrachudos so trabalhados pelo Programa Estadual de

Controle do Simuldeo (RIO GRANDE DO SUL, 2002); os flebotomneos so


19

abordados pelo Projeto de Vigilncia Ambiental da Leishmaniose Tegumentar

Americana (RIO GRANDE DO SUL, 2005b; SANTOS et al., 2005) e os vetores da

febre amarela silvestre esto sendo monitorados atravs do Projeto de Vigilncia em

Febre Amarela (RIO GRANDE DO SUL, 2003; TORRES et al. 2003; TORRES et

al. 2004).

1.2 VIGILNCIA ENTOMOLGICA

O estudo de insetos de interesse em sade pblica proporciona o

conhecimento da biodiversidade, distribuio geogrfica, comportamento, entre

outras caractersticas, com a finalidade de tentar controlar suas populaes e desta

forma elimin-los ou mant-los em um nvel no qual a probabilidade de causar danos

ou transmitir patgenos seja mnina. Tambm importante conhecer o risco

ocasionado pelo contato homem-vetor no tempo e espao. Dessa forma, pode-se

conhecer o risco e quantificar a populao de vetores atravs de monitoramentos ou

vigilncia constante (PERU, 2002).

Atualmente, no contexto da Vigilncia Ambiental em Sade, a Vigilncia

Entomolgica pode ser entendida como a contnua observao e avaliao de

informaes originadas das caractersticas biolgicas e ecolgicas dos vetores, nos

nveis das interaes com hospedeiros humanos e animais reservatrios, sob a

influncia de fatores ambientais, que proporcionem o conhecimento para deteco de

qualquer mudana no perfil de transmisso das doenas. Tem a finalidade de

recomendar medidas de preveno e controle de risco, atravs da coleta


20

sistematizada e consolidao de dados em um sistema de informao (GOMES,

2002).

A ecologia de vetores o pilar central da Vigilncia Entomolgica e est

entre suas principais linhas de investigao (DONALSIO e GLASSER, 2002). As

aes de Vigilncia Entomolgica podem ser estabelecidas e direcionadas para um

grupo de espcies, situao em que amostras representativas da fauna podem ser

coletadas com a mesma tcnica, na mesma ocasio amostral, otimizando recursos e

oferecendo informaes importantes para a vigilncia, dependendo da capacidade e

estrutura laboratorial (KENT et al., 2001; MOORE et al., 1993) ou para uma nica

espcie vetora conhecida, como Aedes aegypti, por exemplo (DONALSIO e

GLASSER, 2002).

Dentre as atribuies da Vigilncia Entomolgica destacam-se a

identificao de espcies ocorrentes em determinada regio; caracterizao de

situaes ambientais e climticas que favoream a proliferao de vetores e

disseminao de patgenos; deteco de espcies alctones e identificao de

indicadores e fatores de risco epidemiolgico atribudos aos vetores para que se

possa interferir previamente bloqueando os surtos possveis (GOMES, 2002).

1.3 FAMLIA CULICIDAE

Segundo HARBACH e KITCHING (1998) a famlia Culicidae composta

pelas subfamlias Anophelinae e Culicinae, reunindo aproximadamente 3450

espcies (SALLUM et al., 2000; CONSOLI e LOURENO-DE-OLIVEIRA, 1994);


21

pouco mais de 1000 na Regio Neotropical (PAPAVERO e GUIMARES, 2000;

FORATTINI, 2002); e em torno de 450 no Brasil (GUIMARES, 1997; WRBU,

2010).

1.3.1 Subfamlia Anophelinae

Os anofelneos so vulgarmente chamados de mosquito-prego e mosquito-

agulha, devido posio, quase em ngulo reto com o substrato, que os adultos

assumem quando em repouso (FORATTINI, 2002).

A subfamlia Anophelinae constituda pelos gneros Anopheles Meigen,

1818 com distribuio em todo o mundo; Bironella Theobald, 1905 presente apenas

na Regio Australiana e Chagasia Cruz, 1906 restrito Regio Neotropical

(CONSOLI e LOURENO-DE-OLIVEIRA, 1994; FORATTINI, 1996). Pertencem

ao gnero Anopheles os subgneros Anopheles Meigen, 1818, Cellia Theobald, 1902,

Kerteszia Theobald, 1905, Lophopodomyia Antunes, 1937, Nyssorhynchus

Blanchard, 1902 e Stethomyia Theobald, 1902, todos com representantes na regio

neotropical, exceto Cellia (FORATTINI, 2002).

Existem aproximadamente 450 espcies de Anophelinae (SALLUM et al.,

2000); 96 na regio neotropical, sendo 92 de Anopheles e quatro de Chagasia

(FORATTINI, 2002); e pouco mais de 60 no Brasil (WRBU, 2010).


22

1.3.2 Subfamlia Culicinae

Constitui o maior grupo de Culicidae, abrangendo cerca de 3000 espcies

(CONSOLI e LOURENO-DE-OLIVEIRA, 1994), distribudas em 11 tribos,

constitudas por 38 gneros, sendo 34, dentre os relacionados por HARBACH e

KITCHING (1998) e quatro, em funo dos trabalhos de REINERT (1999),

HARBACH e PEYTON (2000) e REINERT (2000a, 2000b). O txon Phoniomyia

Theobald, 1903, citado por HARBACH e KITCHING (1998) como gnero, foi

considerado por JUDD (1998) como subgnero de Wyeomyia Theobald, 1901. A

Regio Neotropical conta com 908 espcies (PAPAVERO e GUIMARES 2000),

inseridas em 22 gneros e 09 tribos (FORATTINI 2002). GUIMARES (1997)

registra, para o Brasil, pouco mais de 370 espcies, representando 40,8% das

ocorrncias neotropicais.

1.3.3 Culicidae no Rio Grande do Sul

A maioria dos trabalhos realizados no Estado, sobre a famlia Culicidae,

foram efetuados at a dcada de 60, quase sempre abordando aspectos qualitativos,

buscando identificar distribuio e ocorrncia local de espcies envolvidas em

endemias nacionais de malria (MARQUES e GUTIERREZ, 1994), filariose

(ROCHA e FONTES, 1998), febre amarela e dengue (NOBRE et al., 1994). A

seguir, so apresentados esses estudos, citando os primeiros registros de culicdeos

para o Rio Grande do Sul, com as denominaes ento utilizadas:


23

PERYASS (1908) refere em sua tese intitulada "Culicdeos do Brazil", a

ocorrncia de apenas duas espcies de mosquitos no Estado: Danielsia tripunctata e

Stegomyia calopus, respectivamente sinnimos de Aedes fluviatilis (Lutz, 1904) e

Aedes aegypti Linnaeus, 1762. Posteriormente, em 1921, o mesmo autor em trabalho

sobre "Os Anophelineos do Brasil" aponta para o Rio Grande do Sul as seguintes

espcies: Cellia argyritarsis, Cellia braziliensis, Cellia albimana e Myzorhynchella

lutzi, no indicando, porm, as reas de coleta (PERYASS, 1921).

LUTZ et al. (1918), em viagem cientfica pelo sul da Amrica do Sul,

coletaram na cidade de Rio Grande Culex albifasciatus e Aedes aegypti. O encontro

de exemplares de Aedes aegypti, embora j citado para o Estado, foi considerado de

grande relevncia epidemiolgica, j que esses mosquitos eram responsveis pelos

surtos de febre amarela urbana que acometiam as populaes humanas naquela

poca.

PINTO (1932) citou a ocorrncia de oito espcies, sendo Psorophora

varinervis Edwards, 1922, registrada pela primeira vez no Brasil. O autor ressaltou a

resistncia que as espcies do Rio Grande do Sul apresentam ao frio de 8C negativos

durante os meses de inverno.

PRIMIO (1935) relata os resultados de vrias coletas realizadas em Porto

Alegre e interior do Estado. Em outubro de 1932, o autor coletou nas dependncias

da Santa Casa de Misericrdia de Porto Alegre um espcime de Anopheles

tarsimaculatus (Goeldi, 1905) que, de acordo com LANE (1953), sinnimo de

Anopheles aquasalis Curry, 1932, espcie encontrada nas plancies litorneas desde o

norte do Brasil at o sul do Estado de So Paulo. No ano seguinte, outro exemplar foi

encontrado no interior de sua residncia, na rua Venncio Aires, prximo ao centro


24

da Capital. Em suas buscas no interior do Estado, Raul di Primio e Csar Pinto

coletaram 15 espcies de culicdeos.

PRIMIO (1937) ressaltou a importncia dos meios de transporte na

disseminao de vetores e possveis hospedeiros, pelo interior do Estado. Neste

mesmo trabalho, foram abordadas questes como a presena de vetores dos agentes

causadores da febre amarela, dengue, filariose e malria, salientando a endemicidade

das duas ltimas doenas e alertando para a possibilidade de ocorrncia de surtos no

Estado. O autor tambm relatou a epidemia de febre amarela ocorrida em Rio Grande

no ano de 1900, matando 26 pessoas e citou que a resistncia dos insetos ao frio e

contigidade de reas com pases vizinhos tambm so fatores epidemiolgicos

importantes.

NETTO (1940) registra 31 espcies de culicdeos, sendo 18 coletadas em

Porto Alegre, no intradomiclio. Desse total, 16 ainda no haviam sido encontradas

no Estado.

Posteriormente, PINTO et al. (1940) acrescentam Sabethoides albiprivatus,

ou conforme classificao de LANE (1953), Sabethes melanonynphae Dyar, 1924,

aos achados de Netto.

COUTINHO (1947) cita a presena de Anopheles strodei Root, 1926, e de

Anopheles fluminensis Root, 1927 nos municpios de Torres e Osrio.

FERREIRA (1964) assinala a presena de Anopheles antunesi Galvo &

Amaral, 1940, Anopheles parvus (Chagas, 1907), Anopheles rondoni (Neiva e Pinto,

1922), Anopheles albitarsis Lynch Arriblzaga, 1878, Anopheles argyritarsis

Robineau-Desvoidy, 1827 e Anopheles triannulatus (Neiva & Pinto, 1922), sem

relatar as regies onde as encontrou.


25

Pesquisas visando estudar os efeitos de larvicidas para o controle de

culicdeos foram levadas a efeito por RUAS-NETO e SILVEIRA (1989) e RUAS-

NETO et al. (1994), sendo que, neste ltimo, citaram a ocorrncia de outras trs

espcies: Culex saltanensis Dyar, 1928, Culex inflictus Theobald, 1902 e Culex

bigoti Bellardi, 1861.

VIANNA et al. (1996a,b) estudaram aspectos biolgicos como oviposio,

longevidade e viabilidade de Culex quinquefasciatus em condies ambientais no

municpio de Pelotas, regio sul do Estado.

Diante dos escassos estudos sobre culicdeos no Rio Grande do Sul e da

necessidade de resgatar informaes divulgadas em publicaes com acesso limitado

devido ao tipo de documento (tese ou relatrio) ou pelo fato de serem antigos e com

abrangncia local, CARDOSO (2003) recuperou e reuniu registros bibliogrficos e

de colees, inventariando a fauna de Culicidae. Alm disso, realizou coletas

mensais nas onze zonas fisiogrficas do Rio Grande do Sul, durante um ano. Esta

contribuio permitiu atualizar os conhecimentos sobre as espcies ocorrentes no

Estado, de maneira a excluir, da lista de txons, citaes equivocadas e acrescentar

24 novos registros aos anteriores, com nomenclatura atualizada e apontamentos de

distribuio geogrfica. Este trabalho possibilitou, tambm, implantao de duas

colees representativas de Culicidae, uma agregada ao acervo do Museu de Cincia

e Tecnologia da Pontifcia Universidade Catlica do Rio Grande do Sul

(MCT/PUCRS) e outra no Instituto de Pesquisas Biolgicas - Laboratrio Central de

Sade Pblica do Rio Grande do Sul (IPB-LACEN/RS).

SANTOS (2003) ao atualizar a distribuio geogrfica de Aedes albopictus

no Brasil registrou a ocorrncia desta espcie no Rio Grande do Sul. Esta


26

contribuio foi esclarecedora, j que as informaes sobre esses mosquitos

constavam apenas nas bases de dados do Programa Nacional de Controle da Dengue,

sem citaes na literatura.

VASCONCELOS et al. (2003) relataram os resultados obtidos durante estudo

epidemiolgico em rea de febre amarela silvestre compreendida pelos municpios

de Garruchos e Santo Antnio das Misses e, na oportunidade, apontaram

Haemagogus leucocelaenus (Dyar & Shannon, 1924) como vetor secundrio do vrus

no Cone Sul, j que Haemagogus janthinomys Dyar, 1921 considerado o vetor

principal no Brasil, no foi verificado na regio.

Aos inventrios de fauna realizados por CARDOSO et al. (2004, 2005) foram

adicionados trs novos registros por GOMES et al. (2008). Naquele momento, a

fauna de Culicidae do Rio Grande do Sul era composta por 74 espcies, sendo 16 de

Anophelinae e 58 de Culicinae.

1.3.4 Importncia em Sade Pblica

A importncia sanitria dos mosquitos, seja por atuarem como vetores

biolgicos de patgenos ou pelo incmodo causado pela picada, est relacionada

com o hbito hematofgico das fmeas (FORATTINI, 2002).

Na epidemiologia, vetor biolgico a denominao dada a hospedeiro que

possibilita ao parasito desenvolver parte do seu ciclo de vida e acessar um novo

hospedeiro. A sobrivncia ou aumento da densidade populacional do parasito

depende obrigatoriamente de passagem pelo organismo do hospedeiro (FORATTINI,

2004).
27

Os anofelneos englobam as espcies vetoras dos plasmdios da malria

humana, doena a qual est exposta, em vrios graus, 40% da populao mundial, ou

seja, mais de dois bilhes de pessoas em cerca de 100 pases (FORATTINI, 2002).

Somente nas Amricas 203 milhes de pessoas vivem em reas de risco em 21 pases

(OPS, 2002).

No Brasil, a malria um grave problema de sade pblica na regio da

Amaznia Legal, composta pelos Estados do Acre, Amap, Amazonas, Par,

Rondnia, Roraima, Tocantins, Mato Grosso e Maranho, onde ocorrem

aproximadamente 99,5% dos casos registrados no Pas. A alta incidncia do agravo e

seus efeitos debilitantes sobre a populao comprometem as capacidades individuais,

trazendo conseqncias negativas para o desenvolvimento econmico da Regio.

Na regio extra-amaznica, ocorrem casos autctones espordicos em reas

focais restritas, destacando-se os municpios localizados s margens do lago da usina

hidreltrica de Itaipu, reas cobertas pela Mata Atlntica nos Estados do Esprito

Santo, Minas Gerais, Rio de Janeiro, So Paulo e Bahia; a regio Centro-Oeste, nos

Estados de Gois e Mato Grosso do Sul, e a regio Nordeste, nos Estados do Piau,

Pernambuco e Cear (BRASIL, 2005c).

No Rio Grande do Sul os primeiros casos de malria autctone foram

registrados entre os anos de 1928 e 1929, nos municpios de Torres e Osrio, sendo

Plasmodium vivax (Grassi & Feletti, 1890) a espcie observada em todos os casos

agudos da doena (PRIMIO, 1931). A doena permaneceu no Estado, de forma

endmica, at o ano de 1968, quando foi declarado como rea no malrica por uma

comisso de avaliao composta por membros da Organizao Mundial de Sade

(OMS), da Campanha de Erradicao da Malria (CEM) e da Superintendncia de


28

Campanhas de Sade Pblica (SUCAM), setor Santa Catarina, responsvel pelas

aes de controle da doena no Rio Grande do Sul (BARATA, 1973). Esse mesmo

autor salienta a necessidade de monitoramento de Anopheles cruzii Dyar & Knab,

1908 e Anopheles bellator Dyar & Knab, 1906 (espcies do subgnero Kerteszia,

vetoras no sul do Brasil, que se criam em guas acumuladas nas bromlias), a fim de

evitar o restabelecimento de transmisso, principalmente nos municpios de Torres e

Osrio que apresentam uniformidade ecolgica com o resto da regio de bromlia-

malria, particularmente a do sul de Santa Catarina.

A subfamlia Culicinae rene mosquitos de grande interesse para a sade

pblica por atuarem como vetores de arbovrus importantes, causadores de doenas

como dengue e febre amarela, alm de encefalites severas. Neste grupo tambm

esto espcies que transmitem microfilrias, causando a doena conhecida como

elefantase, bem como aquelas capazes de provocar grande incmodo s populaes

humanas (FORATTINI, 2002).

A palavra arbovrus tem origem na expresso inglesa artrhopod-borne viruses

que significa vrus transmitidos por artrpodes (FORATTINI, 2002). Esses agentes

virais so veiculados a hospedeiros vertebrados, mantendo o vrus na natureza em

ciclos complexos, envolvendo principalmente mosquitos e carrapatos como vetores e

mamferos e aves como hospedeiros (FIGUEIREDO, 2007).

No Brasil j foram isolados em torno de 200 arbovrus (TRAVASSOS DA

ROSA et al., 1998) dos quais 36 so patognicos ao homem. Desses, cinco so

importantes para a sade pblica por causarem mortes ou doenas severas. Os vrus

Dengue (DEN), Febre Amarela (YF), Mayaro (MAY), Oropouche (ORO) e Rocio
29

(ROC) esto associados a 95% de todos os casos de arboviroses registrados no Pas

(VASCONCELOS et al., 1998).

A dengue ou febre de quebra ossos, uma doena febril aguda causada por

um arbovrus pertencente ao gnero Flavivirus, famlia Flaviviridae, com quatro

sorotipos conhecidos (DEN1, DEN2, DEN3 e DEN4). Pode ser de curso benigno ou

grave, dependendo da forma como se apresente: infeco inaparente, dengue

clssico, febre hemorrgica do dengue (FHD) ou sndrome do choque do dengue

(SCD). A transmisso, nas Amricas, ocorre atravs da picada de mosquitos Aedes

aegypti infectados em humanos susceptveis (BRASIL, 2000b).

Em abril de 2007, o Rio Grande do Sul registrou seus primeiros casos de

dengue autctone, em municpios da regio noroeste (Giru, Horizontina, Tuparendi

e Trs de Maio) e norte do Estado (Erechim). Foram notificados 1384 casos

suspeitos de dengue, dos quais 268 foram confirmados. A epidemia foi controlada

em maio do mesmo ano, quando o ltimo caso foi registrado. O sorotipo circulante

isolado foi DEN tipo trs, o mesmo identificado em outras regies do pas, no

mesmo perodo (RIO GRANDE DO SUL, 2009a).

A febre amarela ocorre de forma endmica nas regies tropicais das Amricas

e frica e assim como a dengue, uma doena febril aguda causada por um

Flavivirus (NOBRE et al., 1994). Nas Amricas, a forma urbana da doena envolve

mosquitos da espcie Aedes aegypti e o homem. J no ciclo silvestre o vrus

transmitido, principalmente, por espcies do gnero Haemagogus e Sabethes a

Primatas No Humanos. O homem no vacinado contrai a doena ao entrar na mata e

ser picado por mosquitos infectados (VASCONCELOS, 2003). Os ltimos casos

humanos de febre amarela silvestre no Rio Grande do Sul ocorreram na dcada de


30

1960 (NOBRE et al., 1994). VASCONCELOS et al. (2003) apontam o importante

encontro na regio noroeste do Estado, entre abril e maio de 2001, de exemplares de

Haemagogus leucocelaenus, naturalmente infectados com o vrus amarlico,

responsveis pela morte de dezenas de bugios da espcie Alouatta caraya

(Humboldt, 1812).

A Emergncia de Sade Pblica de Interesse Nacional (ESPIN) evento com

risco de propagao de doenas para outras Unidades Federadas (CARMO et al.,

2008) - iniciada em outubro de 2008 registrou at abril de 2009 epizootias em 136

municpios totalizando mais de 1600 Primatas No Humanos mortos nas regies

noroeste, centro e norte do Estado, caracterizando um evento sem precedentes, pela

rapidez de deslocamento do vrus, nmero de animais atingidos e rea de

abrangncia. Na populao humana foram 28 casos notificados, 18 confirmados e

sete bitos. As medidas de preveno, atravs da vacinao foram realizadas em 293

dos 496 municpios gachos (RIO GRANDE DO SUL, 2009b).

A Febre do Nilo Ocidental (FNO) causada por um vrus RNA, membro da

famlia Flaviviridae, gnero Flavivirus, enquadrado no complexo antignico do vrus

da encefalite japonesa que inclui os vrus Saint Louis, Rocio, Ilhus, entre outros

(PETERSEN e ROEHRIG, 2001). Esta infeco ocasiona a morte de aves urbanas e

silvestres e eqinos. No homem produz quadro febril que pode evoluir para uma

meningite aguda, encefalite e bito. A famlia Culicidae rene o maior nmero de

espcies onde o vrus foi isolado, representando os artrpodes vetores que merecem

maior ateno dos programas de vigilncia deste vrus. No Brasil grande a

preocupao com a possibilidade de entrada do vrus, em virtude da migrao de

aves silvestres oriundas do hemisfrio Norte. As espcies do gnero Culex,


31

especialmente Culex quinquefasciatus, juntamente com Aedes scapularis (Rondani,

1848) e Aedes albopictus, devido a algumas caractersticas especficas como

antropofilia, zoofilia, sinantropia, competncia e capacidade vetorial e ampla

distribuio, podem apresentar papel relevante na transmisso deste arbovrus

(NATAL e UENO 2004).

Para detectar a introduo do Vrus do Nilo Ocidental (VNO) no pas, LUNA

et al. (2002) sugerem que a vigilncia ambiental do vrus seja realizada atravs dos

vetores e reservatrios (aves). Alm de tentar identificar o vrus nos mosquitos, as

aes de Vigilncia Entomolgica devem caracterizar as possveis espcies vetoras,

considerando aspectos de abundncia, diversidade, ornitofilia e capacidade de

domiciliao, utilizando vrias tcnicas de coleta em ambientes urbanos e silvestres.

A filariose bancroftiana, causada pelo helminto Wuchereria bancrofti uma

infeco frequentemente assintomtica, mas muitas vezes causa perturbaes no

sistema linftico ocasionando diversas manifestaes clnicas, entre as quais a

elefantase de pernas, braos, mamas e escroto, principalmente (PESSOA e

MARTINS, 1988). Sua transmisso se d pela picada do mosquito Culex

quinquefasciatus (pernilongo ou murioca) infectado com larvas do parasita

(BRASIL, 2009). Na dcada de 1950 foram realizados inquritos hemoscpicos e

entomolgicos em diversas cidades brasileiras, mas pelo encontro de mosquitos com

formas infectantes do parasito, a transmisso autctone foi comprovada em 11

cidades, entre as quais Porto Alegre (ROCHA e FONTES, 1998). Desde ento, uma

srie de aes foram implantadas/implementadas com o propsito de combater a

endemia resultando, atualmente, em um foco endmico no Brasil restrito ao Recife e

trs cidades prximas: Olinda, Jaboato dos Guararapes e Paulista (BRASIL, 2009).
32

As estratgias para o controle vetorial da filariose devem priorizar o

saneamento, levantamento, mapeamento e caracterizao dos criadouros; a execuo

de intervenes fsicas e biolgicas; e a vigilncia e monitoramento do controle

(MEDEIROS et al., 2003).


33

2 JUSTIFICATIVA

No Brasil, a legislao vigente evidencia o papel da Vigilncia Ambiental em

Sade como rea de atuao do SUS alm de recomendar e permitir a incorporao e

sistematizao das aes de Vigilncia Entomolgica na rotina dos servios de

vigilncia.

At a dcada de 1960, as precrias informaes reunidas sobre algumas

espcies de mosquitos ocorrentes no Rio Grande do Sul resultaram de investigaes

de doenas que afetavam o pas, como febre amarela, malria e filariose e que

refletiam no Estado.

Nos ltimos 40 anos, os servios de sade e a academia desenvolveram reas

de atuao para atender s demandas de Sade Pblica prioritrias no Estado. No

entanto, a ausncia de doenas causadas por agentes transmitidos por mosquitos no

permitiu ao Rio Grande do Sul adquirir e acumular experincias bem como organizar

os servios para a Vigilncia Entomolgica de mosquitos, exceo feita ao controle

de vetores da dengue, desenvolvido por todos os municpios do RS, desde 2000.

Ainda assim, os servios de sade tm pouco entendimento sobre os conceitos e

atribuies da Vigilncia Entomolgica. Tanto a estruturao quanto a

operacionalizao dos servios, muitas vezes, so limitadas por questes

burocrticas, tcnicas ou financeiras que resultam em equipes, geralmente

temporrias, no permitindo uma continuidade e aquisio de experincia nas

atividades de campo. Identificaes direcionadas para vetores-alvo (como Aedes

aegypti), sem analisar informaes referentes s outras espcies da fauna associada,

limitam o aprendizado em taxonomia. Nas Universidades locais, percebe-se que no


34

se constituram grupos de pesquisa em Entomologia em Sade Pblica nem cursos de

formao e capacitao profissional para suprir eventuais necessidades do Estado e

municpios.

Vrios estudos tm demonstrado que alteraes antrpicas no ambiente

proporcionam mudanas no comportamento de populaes primitivas tornando-as

dominantes, bem como favorecem sucesses na fauna, devido a adaptaes de outras

espcies ao ambiente artificialmente modificado (LUZ et al., 1987; CONSOLIM et

al., 1991; TEODORO et al., 1994; LOPES e LOZOVEI, 1995; SILVA e LOZOVEI,

1996; CALADO e SILVA, 2001); outros discutem que a interferncia humana no

ambiente, pode culminar na reemergncia de agravos (FORATTINI, 1998; 1999;

2000). Esses fatores caracterizam a grande importncia epidemiolgica dos

mosquitos, em virtude do papel vetorial que muitas espcies podem desempenhar

devido proximidade de convivncia com as populaes humanas.

HUTCHINGS et al. (2002) consideraram a necessidade de melhor

conhecimento da ecologia e distribuio geogrfica das espcies como ferramenta

para entender a epidemiologia das doenas transmitidas por mosquitos.

O presente trabalho proposto em virtude da importncia da Vigilncia

Ambiental em Sade como rea de atuao do SUS; da necessidade de planejar,

gerenciar e executar aes de competncia da Vigilncia Ambiental em Sade no que

tange aos fatores ambientais biolgicos relacionados aos vetores; da possibilidade de

estruturar a Vigilncia Entomolgica como instrumento de predio para ocorrncia

ou alteraes no perfil epidemiolgico das doenas causadas por agentes

transmitidos por vetores; da relevncia da famlia Culicidae para a sade pblica; da

iminncia de emergncia/re-emergncia de doenas e agravos ocasionados por


35

mosquitos e da inexistncia de estudos ecolgicos sobre esses insetos no Estado do

Rio Grande do Sul.


36

3 OBJETIVOS

3.1 OBJETIVO GERAL

Demonstrar a importncia da entomologia aplicada, atravs da prtica da

Vigilncia Entomolgica de culicdeos como estratgia da Vigilncia Ambiental em

Sade no Estado do Rio Grande do Sul.

3.2 OBJETIVOS ESPECFICOS

Manuscrito 1

Estimar a diversidade de uma comunidade de culicdeos

Inventariar a fauna

Caracterizar a distribuio temporal das espcies

Avaliar a influncia das variveis temperatura e pluviosidade sobre a

abundncia de mosquitos

Verificar a ocorrncia de espcies de importncia em sade pblica

Manuscrito 2

Identificar novos registros de espcies no Estado

Verificar a ocorrncia de espcies de importncia em sade pblica

Discutir sobre o potencial epidemiolgico das espcies

Manuscrito 3

Detectar a presena de espcies naturalmente infectadas com arbovrus

Identificar vetores potenciais do vrus da febre amarela

Manuscrito 4

Relatar o novo registro de uma espcie no Estado


37

4 RESULTADOS

4.1 MANUSCRITO 1

A ser submetido Revista Brasileira de Entomologia

Aspectos ecolgicos de mosquitos (Diptera, Culicidae)


em uma rea de Mata Atlntica no litoral norte do Rio Grande
do Sul, Brasil

Jder da Cruz Cardoso1, 2, Marcia Bicudo de Paula1, Aristides Fernandes1, Edmilson dos
Santos2, Marco Antnio Barreto de Almeida2, Daltro Fernandes da Fonseca2 & Maria Anice
Mureb Sallum1

1. Departamento de Epidemiologia, Faculdade de Sade Pblica, Universidade de So Paulo. 01246-


904 So Paulo-SP, Brasil. E-mail: jader@usp.br
2. Diviso de Vigilncia Ambiental em Sade, Centro Estadual de Vigilncia em Sade, Secretaria da
Sade do Estado do RS, 90650-090 Porto Alegre-RS, Brasil. E-mail: jader-cardoso@saude.rs.gov.br

ABSTRACT. Ecological aspects of mosquitoes (Diptera, Culicidae) in an

Atlantic Forest area on the north coast of Rio Grande do Sul state, Brazil. A

culicidean community in Maquin municipality, located close to the southern limit of

the Atlantic Forest, on the north coast of Rio Grande do Sul state was studied with

the main goal of knowing the composition, diversity, temporal distribution, and

influence of temperature and rainfall on the fauna. Samplings were performed

monthly between December 2006 and December 2008, in three biotopes: forest,

urban area, and transition area, using CDC traps and Nasci vacuum. A total of 2376
38

specimens were collected, from which 1766 (74.32%) were identified as 55 different

species belonging to 10 genera. The species Culex lygrus, Aedes serratus, and Aedes

nubilus were dominant (eudominant) and very constant throughout samplings. The

forest environment presented the highest species dominance (DS=0,20), while the

transition area showed highest values of diversity (H=2.55) and evenness (J=0.85).

These two environments were the most similar according to the Morisita-Horn index

(IM-H=0.35). Bootstrap estimates showed that 87.3% of the species occurring in the

region were detected. The temporal distribution of the species is more evident

between October and May indicating a seasonal pattern appropriate for survey

activities and fauna monitoring.

KEY-WORDS. Diversity, ecology, vectors, Entomological Surveillance.

RESUMO. Aspectos ecolgicos de mosquitos (Diptera, Culicidae) em uma rea de

mata atlntica no litoral norte do Rio Grande do Sul, Brasil. Uma comunidade de

culicdeos do municpio de Maquin, localizado prximo ao limite sul da Mata

Atlntica, litoral norte do Rio Grande do Sul foi estudada com o objetivo de conhecer

a composio, diversidade, distribuio temporal e influncia da temperatura e

pluviosidade sobre a fauna. As coletas foram realizadas mensalmente, de dezembro

de 2006 a dezembro de 2008, em trs bitopos: mata, rea urbana e ambiente de

transio, utilizando armadilhas CDC e aspirador de Nasci. Foram coletados 2376

exemplares dos quais 1766 (74,32%) foram identificados em 55 espcies

pertencentes a 10 gneros. As espcies Culex lygrus, Aedes serratus e Aedes nubilus


39

foram as dominantes (eudominantes) e as mais constantes ao longo das coletas. O

ambiente de mata foi o que apresentou maior dominncia de espcies (DS=0,20),

enquanto na rea de transio foram verificados os maiores valores de diversidade

(H=2,55) e equitabilidade (J=0,85). Esses dois ambientes foram os mais similares,

segundo o ndice de Morisita-Horn (IM-H=0,35). De acordo com o estimador

Bootstrap, 87,3% das espcies ocorrentes na regio foram detectadas. A distribuio

temporal das espcies mais evidente entre outubro e maio, indicando um padro

sazonal apropriado para atividades de levantamento e monitoramento da fauna.

PALAVRAS-CHAVE. Diversidade, ecologia, vetores, Vigilncia Entomolgica.

INTRODUO

A concentrao da populao brasileira ao longo do litoral aliada a processos

produtivos para suprir suas necessidades de consumo tem causado degradaes da

Mata Atlntica, aumentando a oferta de habitat para o desenvolvimento de

artrpodes hematfagos da famlia Culicidae. Alm disso, essa modificao da

paisagem natural torna a prpria populao humana exposta ao risco de doenas

como dengue, febre amarela, malria, filariose e encefalites, causadas por patgenos

transmitidos por esses insetos.

No Brasil, foram realizados estudos sobre ecologia de mosquitos em reas

com influncia da Mata Atlntica principalmente, nos Estados do Rio de Janeiro e

So Paulo (Forattini et al., 1978; 1981; 1986a; 1986b; 1990; 1993a; 1993b; 1995;

1996; Loureno-de-Oliveira, 1984; Loureno-de-Oliveira & Silva, 1985; Loureno-


40

de-Oliveira et al., 1985; Gomes et al., 1987; Guimares & Arl, 1984; Guimares &

Victrio, 1986; Guimares et al., 1985; 2000a; 2000b; 2000c; 2001) e Paran, no sul

(Lozovei, 2001; Silva et al., 2004; Santos-Neto & Lozovei, 2008; Bona & Navarro-

Silva, 2008).

No Rio Grande do Sul, at recentemente, os estudos disponveis sobre

Culicidae resultavam de investigaes epidemiolgicas realizadas at a primeira

metade do sculo passado. Desde o incio dos anos 2000, foram realizados dois

levantamentos de fauna abrangendo onze zonas fisiogrficas do Estado (Cardoso et

al., 2004; 2005).

Informaes sobre a diversidade de mosquitos possibilitam Vigilncia

Entomolgica conhecer qualitativa e quantitativamente as espcies ocorrentes em

determinada regio e seus padres de distribuio no tempo e espao para avaliar seu

potencial epidemiolgico, visando contribuir com as estratgias de preveno e

controle de doenas causadas por agentes transmitidos por vetores.

Considerando a ausncia de estudos abordando aspectos ecolgicos do grupo

e a importncia epidemiolgica dos mosquitos, o presente estudo teve como objetivo

caracterizar a estrutura de comunidade de culicdeos de rea situada prxima ao

limite sul do bioma Mata Atlntica, no Rio Grande do Sul.

MATERIAL E MTODOS

O trabalho foi realizado na estao experimental Litoral Norte da Fundao

Estadual de Pesquisa Agropecuria/FEPAGRO (293940S; 501249W), situada

no municpio de Maquin, e na rea central da cidade, localizada no nordeste do Rio

Grande do Sul, entre as encostas da Serra Geral e a Plancie Costeira, distante 140
41

km de Porto Alegre (Fig. 1). O municpio conta com pouco mais de 7.300 habitantes,

sendo residentes em rea urbana, aproximadamente, 2.000 pessoas. Engloba a bacia

hidrogrfica do rio Maquin que est situada numa rea reconhecida desde 1992 pela

UNESCO como Reserva da Biosfera da Mata Atlntica.

As variaes abruptas das altitudes determinam uma paisagem de montanhas

e plancies bem caractersticas ao longo do vale do rio. Segundo a classificao

fisionmico-ecolgica da regio, as florestas do litoral e encosta da Serra Geral

voltadas para o leste do Rio Grande do Sul encontram-se na regio da Floresta

Ombrfila Densa. J as florestas que margeiam a vertente sul da Serra Geral

pertencem regio da Floresta Estacional Semidecidual. Remanescentes da Mata

Atlntica so encontrados nos vrios extratos da mata nativa e das florestas

secundrias. Alm disso, o municpio localiza-se numa rea de ectono, o que

determina a ocorrncia de uma composio botnica muito rica e variada (Gerhardt

et al. 2000).

Junto ao porto de acesso da estao experimental, esto presentes

edificaes para moradia dos tcnicos, base de apoio para pesquisadores, escritrio,

galpes para armazenagem de produtos e maquinrios, alm de garagem para

tratores. Verifica-se uma paisagem aberta de campos alagveis e cobertura vegetal

restrita a uma mata ciliar que define os limites da propriedade, alm de algumas

rvores isoladas prximas das construes.

Atrs da rea de acesso, em direo ao planalto, apresenta-se uma mata

secundria na base da encosta da Serra Geral, localizada a uma altitude em torno de

20 metros acima do nvel do mar.


42

Figura 1. Localizao dos ambientes de coleta no municpio de Maquin. Litoral


norte do Rio Grande do Sul, Brasil.

A vegetao que cobria a rea de estudo, na dcada de 1950, no atingia dois

metros de altura e era composta por pteridfitas (samambaias), espcies de Baccharis

(vassouras) e algumas rvores de pequeno porte. Depois de quase 50 anos, estudos

sobre a composio florstica nesse local verificaram a ocorrncia de 102 espcies,

sendo 78 do componente arbreo. O estrato superior (dossel) se encontra entre 12 e

15 metros, com algumas rvores alcanando 20 metros, como Cabralea canjerana

(canjerana), Cedrela fissilis (cedro), Lonchocarpus guilleminianus (embira de porco)

e Matayba guianensis (camboat) (Sevegnani & Baptista, 1996). A disponibilidade

de habitats para formas imaturas de Culicidae estava representada por colees no

solo como alagados transitrios e um pequeno riacho perene, alm de criadouros em

recipientes como bromlias e ocos de rvores.

Uma srie histrica de dados coletados durante 30 anos na estao

meteorolgica da FEPAGRO mostra que no perodo mais quente do ano, entre

novembro e maro, as temperaturas mdias mximas variam de 38 a 38,8 C,


43

enquanto nos meses mais frios, junho e julho, a mdia das mnimas de 1,2 C e 3,4

C negativos, respectivamente. A mdia anual da umidade relativa do ar de 79% e

as precipitaes durante o ano somam 1.650 mm, sendo maro e abril os meses mais

midos (Gerhardt et al. 2000).

As capturas foram realizadas, mensalmente, no perodo de dezembro de 2006

a dezembro de 2008, em trs bitopos com diferentes graus de antropizao visando

cobrir um gradiente entre a mata e rea urbana, passando por um ambiente

intermedirio o qual denominamos transio.

As coletas diurnas foram realizadas exclusivamente no interior da mata entre

s 12:00 e 14:00h, empregando aspirador eltrico de solo, descrito por Nasci (1981).

Foram efetuadas quatro aspiraes com durao de dez minutos cada, nas seguintes

direes: norte, leste, sul e oeste, nesta ordem, de maneira a percorrer um transecto

na forma de cruz, a partir de um ponto central (293942.7S; 501310W, datum

SAD 69).

Para efetuar as coletas noturnas foram utilizadas trs armadilhas luminosas

automticas do tipo CDC (Sudia & Chamberlain, 1962) em cada ambiente. Os

equipamentos foram instalados, de maneira que o atrativo luminoso ficasse a uma

altura de 1,7 metros em relao ao solo. As armadilhas eram acionadas s 18h00min

e desligados s 06h00min, totalizando 12 horas de operao.

As tcnicas de transporte e montagem dos exemplares seguiram Forattini

(1962) e Consoli & Loureno-de-Oliveira (1994). As identificaes basearam-se na

morfologia das fmeas, preparadas em dupla montagem, e genitlias de machos,

montadas em lminas de vidro. As espcies foram determinadas no Laboratrio de

Entomologia em Sade Pblica (LESP) do Departamento de Epidemiologia da


44

Faculdade de Sade Pblica da Universidade de So Paulo (FSP/USP), com auxlio

de chaves dicotmicas disponveis em Consoli & Loureno-de-Oliveira (1994) e

Forattini (2002).

Os espcimes resultantes dessas coletas, em melhores condies, aps

devidamente catalogados, foram incorporados ao acervo da FSP/USP. As

abreviaes de gnero e subgnero so apresentadas conforme padronizao proposta

por Reinert (2001).

Conforme Moreno (2001) para que sejam obtidos parmetros completos de

diversidade recomendvel quantificar o nmero de espcies e sua

representatividade. Para tanto, o mais conveniente utilizar valores, tanto de riqueza

quanto de estrutura da comunidade, de tal forma que os parmetros sejam

complementares na descrio da diversidade.

Assim, foram utilizados os ndices de riqueza especfica (S) e diversidade de

Shannon (H). A similaridade entre os ambientes foi avaliada pelos ndices de

Morisita-Horn (IM-H), para dados quantitativos e Jaccard (IJ) qualitativo. A

dominncia foi estimada pelo ndice de Simpson (DS) e a equitabilidade, atravs do

ndice de Pielou (J) (Magurran, 2004; Moreno, 2001). Esses ndices foram obtidos

com auxlio do programa PAST, verso 1.88 (Hammer & Harper, 2009).

Para determinar as categorias de dominncia, foi utilizada a classificao

estabelecida por Friebe (1983) apud Ott & Carvalho (2001), onde D% = (i / t).100,

onde i = total de indivduos de uma espcie e t = total de indivduos coletados sendo:

D>10% Eudominante, D>5-10% Dominante, D>2-5% Subdominante, D=1-2%

Eventual e D<1% Rara.


45

A constncia das espcies ao longo das amostragens foi calculada pela

frmula C% = (p / N).100, onde p = nmero de ocasies amostrais em que a espcie

esteve presente; N = nmero total de coletas realizadas. Aps, foram agrupadas em

categorias de constncia nas quais C > = 50% eram consideradas Constantes; C = 25-

50% Acessrias e C < = 25% Acidentais (Silveira Neto, 1976 apud Ott & Carvalho,

2001).

Para analisar a suficincia amostral, foi utilizada a curva de acmulo de

espcies e os estimadores de riqueza de Chao 1, Jacknife 1, Bootstrap e Michaelis-

Menten, com 100 aleatorizaes, atravs do Software StimateS, verso 8.2.0

(Colwell, 2009).

Para verificar possveis influncias de temperatura e pluviosidade sobre a

abundncia de mosquitos foram feitos testes de correlao de Spearman utilizando

dados acumulados pela FEPAGRO, que mantm uma estao meteorolgica no local

de estudo. Os valores de abundncia foram correlacionados com as mdias mnimas

e mximas de temperatura referentes data da coleta, 10 e 15 dias antes e

pluviosidade acumulada nos 5, 10 e 15 dias anteriores a coleta. Os dados foram

calculados atravs do software PASW Statistics, verso 18.0.

RESULTADOS

Os resultados das amostragens mensais, de dezembro/2006 a dezembro/2008,

no municpio de Maquin esto apresentados na tabela I. Foram coletados 2376

culicdeos de 65 categorias taxonmicas (55 espcies e 10 grupos genricos). Da

subfamlia Anophelinae, foram coletados apenas 75 exemplares (3,16%), enquanto a

fauna de Culicinae totalizou 2301 indivduos (96,84%).


46

Tabela I. Distribuio de txons (espcies e grupos) por ambiente e tcnica de coleta.


Maquin, Rio Grande do Sul, dezembro de 2006 a dezembro de 2008.

Mata transio urbano


categoria taxonmica
Aspirao CDC CDC CDC Total
Aedes (Ochlerotatus) crinifer (Theobald, 1903) 71 22 9 0 102
Aedes (Och.) hastatus Dyar, 1922 12 1 0 0 13
Aedes (Och.) nubilus Theobald, 1903 155 90 0 0 245
Aedes (Och.) scapularis (Rondani, 1848) 124 17 17 1 159
Aedes (Och.) serratus (Theobald, 1901) 151 135 6 0 292
Aedes (Och.) sp. 0 2 0 0 2
Aedes (Protomacleaya) terrens (Walker, 1856) 1 0 0 0 1
Anopheles (Anopheles) fluminensis Root, 1927 1 21 14 0 36
Anopheles (Ano.) maculipes (Theobald, 1903) 0 0 7 0 7
Anopheles (Ano.) sp. 0 2 1 0 3
Anopheles (Kerteszia) cruzii Dyar & Knab, 1908 1 7 1 0 9
Anopheles (Nyssorhynchus) albitarsis
Lynch Arriblzaga, 1878 0 0 5 0 5
Anopheles (Nys.) evansae (Brthes, 1926) 0 0 3 0 3
Anopheles (Nys.) galvaoi Causey, Deane & Deane, 1943 0 3 0 0 3
Anopheles (Nys.) lutzii Cruz, 1901 0 4 0 0 4
Anopheles (Nys.) sp. 0 1 1 0 2
Anopheles (Nys.) strodei Root, 1926 0 3 0 0 3
Coquillettidia (Rhynchotaenia) chrysonotum/albifera 0 1 3 0 4
Coquillettidia (Rhy.) shannoni (Lane & Antunes, 1937) 0 1 0 0 1
Coquillettidia (Rhy.) venezuelensis (Theobald, 1912) 0 16 7 2 25
Culex (Culex) acharistus Root, 1927 1 0 0 0 1
Culex (Cux.) bidens Dyar, 1922 8 1 0 2 11
Culex (Cux.) chidesteri Dyar, 1921 19 2 2 7 30
Culex (Cux.) coronator Dyar & Knab, 1906 10 2 2 8 22
Culex (Cux.) declarator Dyar & Knab, 1906 18 0 0 0 18
Culex (Cux.) dolosus (Lynch Arriblzaga, 1891) 2 4 1 2 9
Culex (Cux.) lygrus Root, 1927 460 2 2 5 469
Culex (Cux.) mollis Dyar & Knab, 1906 1 0 0 0 1
Culex (Cux.) nigripalpus Theobald, 1901 112 0 0 2 114
Culex (Cux.) quinquefasciatus Say, 1823 0 0 0 16 16
Culex (Cux.) sp. 188 311 18 44 561
Culex (Melanoconion) bastagarius Dyar & Knab, 1906 0 1 0 1 2
Culex (Mel.) gr. Atratus 2 0 0 0 2
Culex (Mel.) pilosus (Dyar & Knab, 1906) 3 0 0 0 3
Culex (Mel.) ribeirensis Forattini & Sallum, 1987 1 31 0 3 35
Culex (Mel.) seao Mel. 7 14 2 2 25
Culex (Mel.) sp. 0 0 1 0 1
Culex (Microculex) aphylactus Root, 1927 7 0 0 0 7
Culex (Mcx.) dubitans Lane & Withman, 1951 4 0 0 0 4
Culex (Mcx.) gairus Root, 1927 0 1 0 0 1
Culex (Mcx.) imitator Theobald, 1903 26 0 1 0 27
Culex (Mcx.) inimitabilis Dyar & Knab, 1906 5 0 0 0 5
Culex (Mcx.) neglectus Lutz In: Bourroul, 1904 4 0 0 0 4
Culex (Mcx.) pleuristriatus Theobald, 1903 0 0 1 0 1
Culex (Mcx.) sp. 8 0 0 1 9
Culex (Phenacomyia) corniger Theobald, 1903 0 0 0 1 1
continua
47

Continuao Tabela I
Haemagogus (Conopostegus) leucocelaenus
(Dyar & Shannon, 1924) 2 0 0 0 2
Limatus durhami Theobald, 1901 3 0 0 0 3
Mansonia (Mansonia) flaveola (Coquillett, 1905) 0 1 0 0 1
Mansonia (Man.) humeralis Dyar & Knab, 1916 0 1 0 1 2
Mansonia (Man.) indubitans Dyar & Shannon, 1925 0 0 1 0 1
Mansonia (Man.) titillans (Walker, 1848) 0 2 5 1 8
Psorophora (Grabhamia) confinnis Lynch Arriblzaga, 1891 0 0 1 0 1
Psorophora (Janthinosoma) ferox (Humboldt, 1819) 31 3 0 0 34
Psorophora (Jan.) forceps Cerqueira, 1939 4 0 0 0 4
Uranotaenia (Uranotaenia) geometrica Theobald, 1901 0 1 0 1 2
Uranotaenia (Ura.) lowii Theobald, 1901 0 0 1 0 1
Uranotaenia (Ura.) mathesoni Lane, 1943 0 1 0 0 1
Uranotaenia (Ura.) nataliae Lynch Arriblzaga, 1891 0 1 0 1 2
Uranotaenia (Ura.) pulcherrima Lynch Arriblzaga, 1891 1 7 1 0 9
Wyeomyia (Pho.) quasilongirostris (Theobald, 1907) 1 0 0 0 1
Wyeomyia (Pho.) sp. 1 0 0 0 1
Wyeomyia (Pho.) theobaldi (Lane & Cerqueira, 1942) 2 0 0 0 2
Wyeomyia aporonoma Dyar & Knab, 1906 1 0 0 0 1
Wyeomyia confusa (Lutz, 1905) 2 0 0 0 2
Total de indivduos 1450 712 113 101 2376
Total de espcies 33 28 20 16 55

As tribos Aedini e Culicini, respectivamente com 855 e 1379 exemplares,

reuniram 97,08% da fauna referente subfamlia Culicinae. As demais tribos dessa

subfamlia totalizaram poucos espcimes. Foram coletados 42 indivduos

pertencentes tribo Mansoniini, 10 de Sabethini e 15 exemplares de Uranotaeniini

(Tabela II).

Tabela II. Abundncia de mosquitos por tribo e subfamlia em cada ambiente de coleta.
Maquin, Rio Grande do Sul, dezembro de 2006 a dezembro de 2008.

mata transio urbano total


Tribo/SUBFAMLIA
n % n % n % N %
Aedini 821 37,97 33 29,20 1 0,99 855 35,98
Culicini 1255 58,05 30 26,55 94 93,07 1379 58,04
Mansoniini 22 1,02 16 14,16 4 3,96 42 1,77
Sabethini 10 0,46 0 0,00 0 0,00 10 0,42
Uranotaeniini 11 0,51 2 1,77 2 1,98 15 0,63
CULICINAE 2119 98,01 81 71,68 101 100 2301 96,84

ANOPHELINAE 43 1,99 32 28,32 0 0,00 75 3,16

TOTAL 2162 100,00 113 100,00 101 100,00 2376 100,00


48

A maioria dos espcimes foi coletada na mata (931 machos/1231 fmeas),

seguidos da rea de transio (12/101) e ambiente urbano (37/64).

Mais de 90% dos espcimes coletados esto includos nos gneros Culex

(58,04%) e Aedes (33,5%), e somente os representantes de Culex (Culex)

corresponderam a mais de 50% do material. As identificaes especficas dos

representantes desse gnero foram principalmente baseadas na genitlia de machos.

Alm da maioria das fmeas de Culex (Culex) sp., no puderam ser

identificados representantes danificados de Culex (Melanoconion) (03 grupos), Culex

(Microculex) (01), Aedes (Ochlerotatus) (01), Anopheles (Anopheles) (01),

Anopheles (Nyssorhynchus) (01), Coquillettidia (Rhynchotaenia) (01) e Wyeomyia

(Phoniomyia) (01).

Foi possvel identificar 55 espcies de mosquitos que representam 74,32% do

material coletado (1766 exemplares), universo com o qual efetuamos as anlises

mais detalhadas. As espcies, pertencentes a 10 gneros, esto distribudas da

seguinte forma: Aedes (06), Anopheles (08), Coquilletidia (02), Culex (21),

Haemagogus (01), Limatus (01), Mansonia (04), Psorophora (03), Uranotaenia (05)

e Wyeomyia (04).

A tabela III apresenta a distribuio sexual das espcies, onde possvel

verificar que os machos foram coletados em maior nmero atravs da tcnica de

aspirao (68,97%), enquanto a CDC se mostrou mais efetiva para coleta de fmeas

(77,20%).
49

Tabela III. Distribuio sexual e classificaes de dominncia e constncia das espcies,


coletadas com aspirador de Nasci e armadilha CDC no municpio de Maquin, Rio Grande
do Sul, dezembro de 2006 a dezembro de 2008.

Aspirao CDC
Espcie Total % Dominncia1 Constncia2
M F M F
1 Cx. (Cux.) lygrus 456 4 9 469 26,56 Eudominante Constante
2 Ae. (Och.) serratus 2 149 141 292 16,53 Eudominante Constante
3 Ae. (Och.) nubilus 132 23 44 46 245 13,87 Eudominante Constante
4 Ae. (Och.) scapularis 56 68 4 31 159 9,00 Dominante Acessria
5 Cx. (Cux.) nigripalpus 67 45 2 114 6,46 Dominante Acidental
6 Ae. (Och.) crinifer 43 28 4 27 102 5,78 Dominante Acessria
7 An. (Ano.) fluminensis 1 2 33 36 2,04 Subdominante Acessria
8 Cx. (Mel.) ribeirensis 1 2 32 35 1,98 Eventual Acessria
9 Ps. (Jan.) ferox 6 25 3 34 1,93 Eventual Acessria
10 Cx. (Cux.) chidesteri 14 5 6 5 30 1,70 Eventual Acessria
11 Cx. (Mcx.) imitator 11 15 1 27 1,53 Eventual Acessria
12 Cq. (Rhy.) venezuelensis 1 24 25 1,42 Eventual Acessria
13 Cx. (Cux.) coronator 10 7 5 22 1,25 Eventual Acessria
14 Cx. (Cux.) declarator 18 18 1,02 Eventual Acidental
15 Cx. (Cux.) quinquefasciatus 13 3 16 0,91 Rara Acessria
16 Ae. (Och.) hastatus 5 7 1 13 0,74 Rara Acidental
17 Cx. (Cux.) bidens 8 3 11 0,62 Rara Acidental
18 An. (Ker.) cruzii 1 3 5 9 0,51 Rara Acidental
19 Cx. (Cux.) dolosus 2 7 9 0,51 Rara Acidental
20 Ur. (Ura.) pulcherrima 1 3 5 9 0,51 Rara Acidental
21 Ma. (Man.) titillans 8 8 0,45 Rara Acidental
22 An. (Ano.) maculipes 7 7 0,40 Rara Acidental
23 Cx. (Mcx.) aphylactus 7 7 0,40 Rara Acidental
24 An. (Nys.) albitarsis 5 5 0,28 Rara Acidental
25 Cx. (Mcx.) inimitabilis 5 5 0,28 Rara Acidental
26 An. (Nys.) lutzii 1 3 4 0,23 Rara Acidental
27 Cx. (Mcx.) dubitans 4 4 0,23 Rara Acidental
28 Cx. (Mcx.) neglectus 4 4 0,23 Rara Acidental
29 Ps. (Jan.) forceps 1 3 4 0,23 Rara Acidental
30 An. (Nys.) evansae 3 3 0,17 Rara Acidental
31 An. (Nys.) galvaoi 3 3 0,17 Rara Acidental
32 An. (Nys.) strodei 3 3 0,17 Rara Acidental
33 Cx. (Mel.) pilosus 2 1 3 0,17 Rara Acidental
34 Li. durhami 3 3 0,17 Rara Acidental
35 Cx. (Mel.) bastagarius 1 1 2 0,11 Rara Acidental
36 Ha. (Con.) leucocelaenus 2 2 0,11 Rara Acidental
37 Ma. (Man.) humeralis 2 2 0,11 Rara Acidental
38 Ur. (Ura.) geometrica 1 1 2 0,11 Rara Acidental
39 Ur. (Ura.) nataliae 2 2 0,11 Rara Acidental
40 Wy. confusa 2 2 0,11 Rara Acidental
41 Wy. (Pho.) theobaldi 2 2 0,11 Rara Acidental
42 Ae. (Pro.) terrens 1 1 0,06 Rara Acidental
43 Cq. (Rhy.) shannoni 1 1 0,06 Rara Acidental
44 Cx. (Cux.) acharistus 1 1 0,06 Rara Acidental
45 Cx. (Cux.) mollis 1 1 0,06 Rara Acidental
continua
50

Continuao Tabela III


46 Cx. (Mcx.) gairus 1 1 0,06 Rara Acidental
47 Cx. (Mcx.) pleuristriatus 1 1 0,06 Rara Acidental
48 Cx. (Phe.) corniger 1 1 0,06 Rara Acidental
49 Ma. (Man.) flaveola 1 1 0,06 Rara Acidental
50 Ma. (Man.) indubitans 1 1 0,06 Rara Acidental
51 Ps. (Gra.) confinnis 1 1 0,06 Rara Acidental
52 Ur. (Ura.) lowii 1 1 0,06 Rara Acidental
53 Ur. (Ura.) mathesoni 1 1 0,06 Rara Acidental
54 Wy. (Pho.) quasilongirostris 1 1 0,06 Rara Acidental
55 Wy. aporonoma 1 1 0,06 Rara Acidental
TOTAL 858 386 119 403 1766 100,00
1 Eudominante (D>10%), Dominante (D>5-10%), Subdominante (D>2-5%), Eventual (D=1-2%) e Rara (D<1%).
2 - Constantes (C > = 50%), Acessrias (C = 25-50%) e Acidentais (C < = 25%)

A utilizao do aspirador de Nasci na mata permitiu identificar 33 espcies.

Se forem includas as coletas com armadilha CDC, a riqueza nesse ambiente aumenta

para 46 espcies. Analisando somente as coletas com armadilha CDC, foram

identificadas 39 espcies. A maior riqueza foi verificada na mata (S=28), seguida da

rea de transio (S=20) e rea urbana (S=16).

O diagrama de Veen representa a composio de espcies amostradas com

armadilha CDC e ilustra a distribuio horizontal nos ambientes estudados (Fig. 2).

As espcies Ae. scapularis, Cq. venezuelensis, Cx. chidesteri, Cx. coronator, Cx.

dolosus, Cx. lygrus e Ma. titillans foram compartilhadas pelos trs ambientes; Ae.

crinifer, Ae. serratus, An. cruzii, An. fluminensis e Ur. pulcherrima foram comuns

mata e rea de transio; Cx. bastagarius, Cx. bidens, Cx. ribeirensis, Ma. humeralis,

Ur. geometrica e Ur. nataliae figuraram na mata e ambiente urbano. Nenhuma foi

compartilhada entre transio e urbano. Outras 10 estiveram presentes somente na

mata, oito na rea de transio e trs na rea urbana.


51

Figura 2. Diagrama de Veen detalhando as 39 espcies identificadas a partir de


coletas com armadilha CDC em Maquin, RS, entre dezembro de 2006 e dezembro
de 2008. A) espcies ocorrentes somente na mata, B) ambiente de transio, C) rea
urbana; d) espcies compartilhadas pelos ambientes de mata e transio, e) mata e
urbano, f) todos os ambientes.

Seis espcies apresentaram abundncia relativa acima de 5%, totalizando

mais de 100 indivduos coletados; oito tiveram entre 18 e 36 exemplares coletados,

com abundncia entre 1% e 2%. As outras 41 espcies apresentaram abundncia

relativa menor que 1%, das quais sete foram representadas por dois indivduos

(dobletons) e 13 por apenas um exemplar coletado (singletons). A Figura 3 apresenta

a curva de distribuio das abundncias.


52

500
450
400
350
n indivduos

300
250
200
150
100
50
0
1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55
espcie

Figura 3. Curva de distribuio de abundncia de culicdeos coletados entre


dezembro de 2006 e dezembro de 2008 no municpio de Maquin, Rio Grande do
Sul.

As espcies mais abundantes foram Cx. lygrus com 469 indivduos,

constituindo 26,56% do total, Ae. serratus (292/16,53%), Ae. nubilus (245/13,87%),

Ae. scapularis (159/9,0%), Cx. nigripalpus (114/6,46%) e Ae. crinifer (102/5,78%).

Juntas essas espcies representaram 78,20% da abundncia total. As 49 espcies

menos abundantes somaram 385 exemplares (21,80%). As trs primeiras, por

estarem presentes em 17 das 25 ocasies de coleta e pelas abundncias relativas

superiores a 10%, foram tambm as espcies mais constantes e dominantes

(eudominantes). Aedes scapularis e Ae. crinifer foram classificadas como

dominantes e acessrias, enquanto Cx. nigripalpus foi considerada dominante e

acidental, com presena em apenas seis ocasies amostrais (Tab. III).

O ndice de Simpson indicou maior dominncia para o ambiente de mata

(0,20), seguido da rea urbana (0,15) e rea de transio (0,10).


53

A rea de transio foi a que apresentou os maiores valores de diversidade de

Shannon (2,55) e equitabilidade (0,85).

A figura 4 apresenta a anlise de agrupamento por similaridade, onde se

verifica que o ambiente de mata e urbano foram mais similares segundo o ndice de

Jaccard (0,42), enquanto o ndice de Morisita (0,35) indicou maior similaridade entre

a mata e rea de transio.


CDC trans
CDC mata

trans

mata
CDC urb

CDCmata
CDCtrans
urb
CDCmata

CDCtrans

CDCurb
CDCurb

CDC

CDC
CDC
1 1

0.9 0.9
Similaridade (Morisita)

0.8 0.8
Similaridade (Jaccard)

0.7 0.7

0.6 0.6

0.5 0.5

0.4 0.4

0.3 0.3

0.2 A 0.2 B
0.1 0.1

Figura 4. Anlise de agrupamento da fauna, por similaridade entre ambientes com a


tcnica CDC. Maquin, Rio Grande do Sul. Dezembro de 2006 a dezembro de 2008:
A) Similaridade de Jaccard; B) Similaridade de Morisita

A curva de acmulo de espcies (Fig. 5) no atingiu a assintota (S corrigida),

indicando que mais espcies devem ser encontradas na regio estudada. At a stima

coleta foram identificadas 46 espcies, representando 83,63% da fauna amostrada.


54

70

60
Riqueza de espcies (S)

50

40

30

20

10

0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
coletas

S observada S corrigida

Figura 5. Curvas de riqueza de espcies (S) observada e corrigida (100


aleatorizaes). Maquin, RS, dezembro de 2006 a dezembro de 2008.

O estimador que apontou uma fauna mais prxima do observado (S=55) foi

Bootstrap (S=63), segundo o qual 87,3% das espcies foram amostradas. Michaelis-

Menten estimou uma riqueza de 65 espcies, indicando a possibilidade de serem

coletados representantes de mais 10 espcies, e, segundo Chao 1 (S=69), mais 14

espcies seriam amostradas. O estimador Jacknife de 1 ordem (S=73) indicou que

75,34% das espcies foram encontradas, podendo ser adicionadas outras 18 ao total

observado (Fig. 6).


55

80

70

60
Riqueza estimada

50

40

30

20

10

0
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25
coletas

Chao 1 Jacknife 1 Bootstrap MM

Singletons Doubletons Unicatas Duplicatas

Figura 6. Curvas de riqueza de espcies estimada, singletons, doubletons, unicatas e


duplicatas. Maquin, RS, dezembro de 2006 a dezembro de 2008. (MM: Michaelis-
Menten)

A figura 7 apresenta os dados de temperatura e pluviosidade obtidos a partir

da estao climatolgica da FEPAGRO. Os meses de maro (2007) e maio (2008)

foram os mais chuvosos. Maro foi tambm o ms que apresentou as mdias de

temperatura mais elevadas.

Entre dezembro de 2006 e junho de 2007 foi verificada a maior abundncia

(1380) e riqueza acumulada (46 espcies) de todo o perodo estudado, sendo

abril/2007 o ms que apresentou a maior abundncia. No restante do perodo se

observa um reduzido nmero de exemplares coletados (Fig. 8).


56

500 35,0
450
30,0
400
25,0
acumulada (mm)

temperatura (C)
350
pluviosidade
300 20,0
250
200 15,0
150 10,0
100
5,0
50
0 abr 0,0

abr
dez
fev

dez
fev

dez
jun

jun
out

out
ago

ago
2007 2008
coletas
pluviosidade acumulada tmx mdia tmn mdia

Figura 7. Distribuio mensal dos dados abiticos registrados no local de


estudo. Maquin, RS, dezembro de 2006 a dezembro de 2008. (tmx mdia:
temperatura mxima mdia; tmn mdia: temperatura mnima mdia).

400 30
indivduos
350
espcies 25
300
n de indivduos

n de espcies
20
250
200 15
150
10
100
5
50
0 0
dez

dez

dez
abr

abr
f ev

f ev
jun

jun
out

out
ago

ago

2007 2008
coletas

Figura 8. Distribuio de indivduos (abundncia) e espcies (riqueza) ao longo


das 25 coletas realizadas com armadilha CDC e aspirador de Nasci em
Maquin, Rio Grande do Sul, entre dezembro de 2006 e dezembro de 2008.

As variveis temperatura e pluviosidade apresentaram correlao positiva

com a abundncia de culicdeos. As correlaes entre temperatura e abundncia de

mosquitos foram significativas, sendo o maior valor, verificado para as temperaturas


57

mdias mnimas, obtidas nos dias de coleta (r=0,712; p<0,001). Por outro lado, no

foram observadas influncias estatisticamente significativas entre abundncia de

mosquitos e pluviosidade acumulada nos cinco (r=0,096), dez (r=0,025) e quinze

(r=0,105) dias que precederam as coletas.

DISCUSSO

As principais chaves dicotmicas para Culicidae disponveis na literatura

possibilitam identificaes baseadas na morfologia externa de fmeas, genitlia de

machos ou larvas de 4 nstar. No entanto, inconsistncias dos caracteres utilizados

para a separao das formas adultas, levando a agrupamentos no final das dicotomias

(Forattini, 2002), somados a exemplares danificados e ausncia de machos que

permitissem explorar outras possibilidades de diagnstico, dificultaram a

identificao baseada na morfologia externa das fmeas, especialmente de algumas

espcies de Culex.

A fauna amostrada com armadilhas CDC mostrou-se relativamente rica

(S=39), quando comparada a outros estudos empregando esta tcnica em rea de

Mata Atlntica, j que operaram somente com o atrativo luminoso do equipamento,

sem adio de iscas para potencializar sua capacidade de atrao. No litoral sul de

So Paulo, foram obtidas 64 espcies ou grupos de Culicidae utilizando armadilhas

iscadas ou no com atrativo animal, aps um ano de coletas explorando diferentes

ambientes, estratos e horrios (Gomes et al., 1987). Na Serra da Cantareira, regio

metropolitana de So Paulo, coletas com CDCs iscadas com CO2, realizadas

quinzenalmente, pelo perodo de um ano, permitiram identificar 21 espcies de 11

gneros (Montes, 2005). No Paran, utilizando armadilhas no iscadas, em dois


58

estratos da mata, mensalmente, durante um ano, os autores identificaram 31 espcies

pertencentes a 10 gneros (Santos-Neto e Lozovei, 2008).

Embora possa exercer a hematofagia em aves e outros mamferos, Cx.

quinquefasciatus considerada espcie oportunista, altamente antropoflica e

endoflica (Consoli e Loureno-de-Oliveira, 1994). Coloniza diversos tipos de

criadouros em ambientes urbanos, principalmente os poludos (Lopes et al, 1993), e

sua ocorrncia na rea central de Maquin no surpreendente. No entanto, a baixa

abundncia registrada para essa espcie foi inesperada. O pequeno porte e as

condies de saneamento ambiental da cidade, com pouca oferta de criadouros,

talvez sejam fatores que tenham contribudo para a densidade reduzida dessa espcie.

Alm disso, a cidade circundada por fragmentos que apresentam

continuidade com a vegetao de encosta, o que pode explicar o alto nmero de

espcies compartilhadas entre o ambiente urbano e os demais, conforme apontado

pela similaridade de Jaccard. Alteraes antrpicas na paisagem natural, alm de

aproximar a populao humana do ambiente silvestre, criam condies favorveis ao

aumento das populaes de mosquitos que podem repercutir na sade humana. A

preferncia pelo ambiente antrpico modificado j foi evidenciada para as espcies

An. albitarsis, Ma. indubitans, Cq. venezuelensis (Forattini et al., 1993a), Ae.

scapularis, Ae. serratus, Cx. nigripalpus, Cx. ribeirensis, e Cx. bidens (Forattini et

al., 1993b).

O ndice de Shannon pressupe que quanto maior o nmero de espcies em

relao ao nmero de indivduos, maior a complexidade da comunidade (Forattini,

2004). J o ndice de Pielou mede a proporo da diversidade observada em relao a

mxima diversidade esperada (Magurran, 2004). O ndice de Simpson se baseia na


59

probabilidade de dois organismos coletados ao acaso pertencerem a espcies

diferentes, descrevendo uma concentrao ou dominncia de espcies (Forattini,

2004). Embora o ambiente de mata tenha apresentado maior riqueza, foi tambm o

que apresentou maior dominncia. No ambiente de transio, os ndices de Shannon

(2,55), Pielou (0,85) e Simpson (0,10) indicaram maior diversidade e equitabilidade e

menor dominncia comparada s outras reas, possivelmente pela variedade e

estabilidade dos criadouros e proximidade com as bordas da mata.

No litoral do Rio Grande do Sul foram registrados casos de malria dos anos

1920 ao final dos anos 1960, sendo An. cruzii a principal espcie vetora. Esses

mosquitos tm como principais criadouros as bromlias, que acumulam gua em seus

imbricamentos. A abundncia reduzida de An. cruzii durante o estudo,

provavelmente se deve estiagem verificada na regio, e no a uma limitao da

tcnica, j que Santos-Neto & Lozovei (2008) coletaram com armadilhas CDC, no

Paran, um nmero mais expressivo de exemplares. Em reas de baixa endemicidade

de malria, no litoral de So Paulo, exames de infeco natural em anofelneos tm

mostrado a circulao de plasmdios (Branquinho et al. 1997). Apesar da pequena

quantidade de exemplares coletados, nosso estudo detectou oito das 15 espcies de

Anopheles registradas para o Estado (Cardoso et al., 2004; Gomes et al. 2009) e trs

espcies vetoras, sendo Anopheles cruzii classificada como primria e An. albitarsis

e An. fluminensis consideradas secundrias, as quais podem atuar em transmisses

locais ou regionais (Forattini, 2002).

Essas espcies no foram coletadas na rea urbana. No entanto, o registro das

mesmas em ambiente de transio, junto s residncias, refora a idia de que as

fmeas de An. cruzii e An. fluminensis, pela proximidade com a mata circundante, se
60

aproximam do domiclio para o repasto sanguneo e retornam mata (Forattini et al.,

2000; Guimares et al., 2000b), enquanto An. albitarsis encontra nos ambientes

antrpicos abertos, habitats ideais para o seu desenvolvimento, especialmente

caracterizados por alagados no solo destinados ao plantio de arroz (Forattini et al.,

1993a). A proximidade dessas espcies vetoras com o domiclio tambm sugere a

possibilidade do contato eficaz, definido por Forattini (2002) como a probabilidade

de organismos infectados e suscetveis propiciarem a transmisso do agente

infeccioso. Alm disso, de acordo com os critrios estabelecidos pelo Ministrio da

Sade (Brasil, 2004), as reas de risco para malria so definidas segundo a

receptividade (presena, densidade e longevidade do vetor) e vulnerabilidade da

regio (doentes oriundos de reas endmicas). Acredita-se que, mesmo com a

densidade reduzida de An. cruzii durante o estudo, a regio apresenta caractersticas

compatveis com a reemergncia da malria, especialmente no ambiente transio.

No que se refere subfamlia Culicinae, diversas espcies, principalmente

dos gneros Aedes e Culex tm sido incriminadas na transmisso de arbovrus ao

homem e outros animais. Dentre os subgneros de Aedes da Regio Neotropical,

Ochlerotatus, um dos que se apresenta mais associado transmisso de agentes

patognicos (Forattini, 2002). J os mosquitos dos subgneros Culex e Melanoconion

so os de maior importncia epidemiolgica dentro do gnero Culex (Consoli &

Loureno-de-Oliveira, 1994).

As seis espcies mais abundantes verificadas nesse estudo pertencem a Aedes

(Ochlerotatus) e Culex (Culex), sendo Ae. serratus, Ae. scapularis e Cx. nigripalpus

as que apresentam maior potencial para transmisso de arbovrus.


61

A ocorrncia na mata de espcies caractersticas de ambientes primrios e

bem preservados como Cx. neglectus e An. cruzii (Forattini et. al, 1993), bem como

de bioindicadores de ambientes alterados representados por Ae. scapularis e espcies

da tribo Mansoniini (Dorvill, 1996), indica que, embora ainda apresente

caractersticas de mata secundria, resultante de intervenes antrpicas, seu estado

de regenerao parece ser avanado.

O Rio Grande do Sul registrou a ocorrncia dos eventos climticos El Nio,

at janeiro de 2007, e La Nia, que se estendeu de maro de 2007 ao outono de

2008. O primeiro tem como caractersticas, perodo de inverno ameno e altos ndices

pluviomtricos na primavera. Entre os principais efeitos associados La Nia,

esto a estiagem, em virtude da diminuio das chuvas, principalmente nos perodos

de primavera e vero, e temperaturas mnimas mdias abaixo do normal, em

praticamente todos os meses do ano. Entre janeiro de 1998 e dezembro de 1999, sob

efeito, respectivamente de El Nio e La Nia, Teston & Corseuil (2004),

pesquisaram uma subfamlia de Lepidoptera em seis regies do Rio Grande do Sul e

verificaram grande variao em relao abundncia e riqueza de espcies, sendo

esses valores maiores no primeiro ano de coleta. De acordo com Begon et al. (1990),

quanto maior a heterogeneidade espacial, maior a riqueza de espcies. Por outro lado,

a riqueza diminui com o aumento da heterogeneidade temporal, pois aumentam as

variaes climticas.

Mesmo apresentando baixa abundncia e riqueza entre a primavera (2007) e

outono (2008), foi possvel verificar que a distribuio temporal das espcies mais

evidente nessas estaes, entre os meses de outubro e maio (Fig. 8). Nesse perodo, o

aumento das temperaturas e regimes de chuvas favorecem o desenvolvimento de


62

mosquitos (Forattini, 2002). A abundncia de culicdeos foi influenciada

principalmente pela temperatura, j que a pluviosidade no demonstrou correlao

significativa. Essa influncia trmica determina um padro sazonal

(primavera/outono) do qual se pode lanar mo para atividades de levantamentos e

monitoramento de culicdeos.

O padro de distribuio sazonal aqui verificado semelhante ao registrado

em outros Estados, porm, com pequenas variaes referentes a incidncias

especficas e ms de incio e trmino (Forattini et al., 1981; Guimares & Arl, 1984;

Guimares et al., 2000a; 2001).

O expressivo nmero de espcies classificadas como raras e acidentais (Tab.

III) pode ser explicado pelo dficit hdrico em consequncia do La Nia, que

inviabilizou criadouros temporrios refletindo na baixa abundncia e constncia das

espcies, e pela prpria declividade do terreno. Outro fator que pode ter contribudo

para isso, reside na baixa efetividade das tcnicas utilizadas sobre algumas espcies,

que eventualmente poderiam responder melhor a outras estratgias de coleta.

Embora a curva de acmulo de espcies (Fig. 5) e os estimadores (Fig. 6) no

tenham atingido a assintota, indicaram que o esforo amostral empregado foi

satisfatrio para inventariar em torno de 75% a 90% da fauna estimada. Essa

ferramenta alm de validar informaes de campo pode contribuir para avaliar e

planejar futuras aes de Vigilncia Entomolgica de vetores.

As informaes aqui sistematizadas refletem uma realidade pontual e

momentnea. Ainda assim, dados sobre a riqueza especfica, abundncia, distribuio

sazonal, ocorrncia de espcies vetoras e suas interfaces com o ambiente antrpico,

podem balizar futuros estudos entomo-epidemiolgicos na regio e esse


63

conhecimento s foi alcanado com atividades de monitoramento atravs da

Vigilncia Entomolgica.

AGRADECIMENTOS

Aos colegas Leandro Pinto, Hlio Jacques, Pedro Aquino, Valter Menezes,

Jorge Wilson do Centro Estadual de Vigilncia em Sade, pela indispensvel

contribuio nas coletas. Agradecemos direo da Fundao Estadual de Pesquisa

Agropecuria e aos tcnicos da Estao de Maquin, por proporcionar o

desenvolvimento desse trabalho autorizando as coletas em suas dependncias e

disponibilizando alojamento aos pesquisadores. MAMS tem financiamento da

Fundao de Amparo Pesquisa do Estado de So Paulo, FAPESP (Processo no.

05/53973-0), e Conselho Nacional de Desenvolvimento Tcnico e Cientfico (CNPq

BPP no. 300351/2008-9).

REFERNCIAS

Begon, M.; J. L. Harper; C.R. Townsend. 1990. Ecology: individuals, populations,


and communities. 2 ed. London, Blackwell Scientific Publications, 945p.

Bona, A. C. D. & M. A. Navarro-Silva. 2008. Diversidade de Culicidae durante os


perodos crepusculares em bioma de Floresta Atlntica e paridade de Anopheles
cruzii (Diptera: Culicidae). Revista Brasileira de Zoologia 25: 40-48.

Branquinho, M. S.; M. T. Marrelli; I. Curado; D. Natal; J. M. S. Barata; R. Tubaki; et


al. 1997. Infeco do Anopheles (Kerteszia) cruzii por Plasmodium vivax e
Plasmodium vivax variante VK247 nos municpios de So Vicente e Juquitiba,
So Paulo. Revista Panamericana de Salud Publica 2: 189-193.
64

Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade. 2004. Programa


Nacional de Controle da Malria/PNCM. Braslia, Ministrio da Sade, 128p.

Cardoso, J. da C.; E. Corseuil & J. M. S. Barata. 2004. Anophelinae (Diptera,


Culicidae) ocorrentes no Estado do Rio Grande do Sul, Brasil. Entomologa y
Vectores 11: 159-177.

Cardoso, J. da C.; E. Corseuil & J. M. S. Barata. 2005. Culicinae (Diptera, Culicidae)


ocorrentes no Estado do Rio Grande do Sul, Brasil. Revista Brasileira de
Entomologia 49: 275-287.

Colwell, R. K. 2009. EstimateS: Statistical estimation of species richness and shared


species from samples. Verso 8.2.0. Disponvel em: purl.oclc.org/estimates.
[Acessado em 02/08/2009]

Consoli, R. A. G. B. & R. Loureno-de-Oliveira. 1994. Principais mosquitos de


importncia sanitria no Brasil. Rio de Janeiro, Editora FIOCRUZ, 225 pp.

Correa, R. R. & G. R. RAMALHO. 1956. Reviso de Phoniomyia Theobald, 1903


(Diptera, Culicidae, Sabethini). Folia Clinica et Biologica 25: 1-176.

Darsie-Jr, R. F. 1985. Mosquitoes of Argentina. Part I. Keys for identification of


adult females and fourth stage larvae in English and Spanish (Diptera,
Culicidae). Mosquito Systematics 17: 153-253.

Dorvill, L. F. M. 1996. Mosquitoes as bioindicators of forest degradation in


Southeastern brazil, a statistical evaluation of published data in the literature.
Studies on Neotropical Fauna and Environment 31: 68-78.

Forattini, O. P. 1962. Entomologia mdica: parte geral, Diptera, Anophelini. v. 1.


So Paulo, Faculdade de Sade Pblica/USP, 662p.

Forattini, O. P. 2002. Culicidologia mdica: identificao, biologia,


epidemiologia. v. 2. So Paulo, Editora da Universidade de So Paulo, 860 pp.

Forattini, O. P. 2004. Ecologia, Epidemiologia e Sociedade. 2 ed. So Paulo, Artes


Mdicas, 720 pp.
65

Forattini, O. P.; A. de C. Gomes; E. A. B. Galati; E. X. Rabello & L. B. Iversson.


1978. Estudos ecolgicos sobre mosquitos Culicidae no sistema Serra do Mar,
Brasil. Revista de Sade Pblica 12: 297325.

Forattini, O. P.; A. de C. Gomes; J. L. F. Santos; E. A. B. Galati; E. X. Rabello & D.


Natal. 1981. Observaes sobre atividade de mosquitos Culicidae em mata
residual no Vale do Ribeira, So Paulo, Brasil. Revista de Sade Pblica 15:
557586.

Forattini, O. P.; A. de C. Gomes; D. Natal & J. L. F. Santos. 1986a. Observaes


sobre atividade de mosquitos Culicidae em mata primitiva da encosta no Vale do
Ribeira, So Paulo, Brasil. Revista de Sade Pblica 20: 120.

Forattini, O. P.; A. de C. Gomes; D. Natal & J. L. F. Santos. 1986b. Observaes


sobre atividade de mosquitos Culicidae em matas primitivas da plancie e perfis
epidemiolgicos de vrios ambientes no Vale do Ribeira, So Paulo, Brasil.
Revista de Sade Pblica 20: 178203.

Forattini, O. P.; A. de C. Gomes; J. L. F. Santos; I. Kakitani & D. Marucci. 1990.


Freqncia ao ambiente humano e disperso de mosquitos Culicidae em rea
adjacente a Mata Atlntica primitiva da plancie. Revista de Sade Pblica 24:
101107.

Forattini, O. P.; I. Kakitani; E. Massad & D. Marucci. 1993a. Studies on mosquitoes


(Diptera: Culicidae) and anthropic environment. 3. Survey of adult stages at the
rice irrigation system and the emergence of Anopheles albitarsis in South-
Eastern, Brazil. Revista de Sade Pblica 27: 313325.

Forattini, O. P.; I. Kakitani; E. Massad & D. Marucci. 1993b. Studies on mosquitoes


(Diptera: Culicidae) and anthropic environment. 4. Survey of resting adults and
synanthropic behaviour in South-Eastern Brazil. Revista de Sade Pblica 27:
398411.

Forattini, O. P.; M. A. M. Sallum; I. Kakitani; E. Massad & D. Marucci. 1995.


Studies on mosquitoes (Diptera: Culicidae) and anthropic environment. 8.
66

Survey of adult behaviour of Spissipes Section species of Culex (Melanoconion)


in South-Eastern Brazil. Revista de Sade Pblica 29: 100107.

Forattini, O. P.; I. Kakitani; E. Massad & D. Marucci. 1996. Studies on mosquitoes


(Diptera: Culicidae) and anthropic environment. 11. Biting activity and blood-
seeking parity of Anopheles (Kerteszia) in South-Eastern Brazil. Revista de
Sade Pblica 30: 107114.

Forattini, O. P.; I. Kakitani, R. la C. dos Santos, K. M. Kobayashi, H. M. Ueno; Z.


Fernndez. 2000. Potencial sinantrpico de mosquitos Kerteszia e Culex
(Diptera: Culicidae) no Sudeste do Brasil. Revista de Sade Pblica 34: 565-
569.

Gerhardt, C. H.; L. C. Troian; L. M. Guterrez; R.G. de Magalhes; L. A. Guimares;


L. O. Ferreira & L. de A. Miguel. 2000. Diagnstico Socioeconmico e
Ambiental do Municpio de Maquin/RS: Perspectivas para um
desenvolvimento rural sustentvel. Porto Alegre, Relatrio
PROPESQ/UFRGS, 108 pp.

Gomes, A. C. 2002. Vigilncia Entomolgica. Informe Epidemiolgico do SUS 11:


79-90.

Gomes, A. de C.; O. P. Forattini & D. Natal. 1987. Composio e atividade de


mosquitos Culicidae. Emprego de armadilha CDC no Vale do Ribeira, Estado de
So Paulo, Brasil. Revista de Sade Pblica 21: 363370.

Guimares, A. E. & M. Arl. 1984. Mosquitos no Parque Nacional da Serra dos


rgos, Estado do Rio de Janeiro, Brasil. 1. Distribuio estacional. Memrias
do Instituto Oswaldo Cruz 79: 309323.

Guimares, A. E.; M. Arl & R. N. M. Machado. 1985. Mosquitos no Parque Nacional


da Serra dos rgos, estado do Rio de Janeiro, Brasil. 2. Distribuio vertical.
Memrias do Instituto Oswaldo Cruz 80: 171185.
67

Guimares, A. E. & V. M. N. Victrio. 1986. Mosquitos no Parque Nacional da Serra


dos rgos, Estado do Rio de Janeiro, Brasil. 3. Preferncia horria para
hematofagia. Memrias do Instituto Oswaldo Cruz 81: 93103.

Guimares, A. E., R. P. de Mello, C. M. Lopes, C. Gentile. 2000a. Ecology of


mosquitoes (Diptera: Culicidae) in areas of Serra do Mar State Park, state of So
Paulo, Brazil. I Monthly Frequency and Climatic Factors. Memrias do
Instituto Oswaldo Cruz 95: 1-16.

Guimares, A. E., C. Gentile, C. M. Lopes, R. P. de Mello. 2000b. Ecology of


mosquitoes (Diptera: Culicidae) in areas of Serra do Mar State Park, state of So
Paulo, Brazil. II Habitat Distribution. Memrias do Instituto Oswaldo Cruz
95: 17-28.

Guimares, A. E., C. Gentile, C. M. Lopes, A. SantAnna, A. M. Jovita. 2000c.


Ecologia de mosquitos (Diptera: Culicidae) em reas do Parque Nacional da Serra
da Bocaina, Brasil. I Distribuio por habitat. Revista de Sade Pblica 34:
243-250.

Guimares, A. E., C. Gentile, C. M. Lopes, A. SantAnna. 2001. Ecologia de


mosquitos em reas do Parque Nacional da Serra da Bocaina. II Frequencia
mensal e fatores climticos. Revista de Sade Pblica 35: 392-399.

Hammer, O. & D. A. T. Harper. 2009. PAST: Paleontological Statistics software


package for education and data analysis. Verso 1.88. Disponvel em:
http://folk.uio.no/ohammer/past [Acessado em 15/06/2009].

Lopes, J., M. A. N. da Silva, A. M. Borsato, V. D. R. B. de Oliveira, F. J. de A.


Oliveira. 1993. Aedes (Stegomyia) aegypti L. e a culicideofauna associada em rea
urbana da regio sul, Brasil. Revista de Sade Pblica 27: 326-333.

Loureno-de-Oliveira, R. 1984. Alguns aspectos da ecologia dos mosquitos (Diptera:


Culicidae) de uma rea de plancie (Granjas Calbria), em Jacarepagu, Rio de
Janeiro. 1. Freqncia comparativa das espcies em diferentes ambientes e
mtodos de coleta. Memrias do Instituto Oswaldo Cruz 79: 479490.
68

Loureno-de-Oliveira, R.; T. F. da Silva & R. Heyden. 1985. Alguns aspectos da


ecologia dos mosquitos (Diptera: Culicidae) de uma rea de plancie (Granjas
Calbria) em Jacarepagu, Rio de Janeiro. 2. Freqncia mensal e no ciclo lunar.
Memrias do Instituto Oswaldo Cruz 80: 123133.

Loureno-de-Oliveira, R. & T. F. da Silva. 1985. Alguns aspectos da ecologia dos


mosquitos (Diptera: Culicidae) de uma rea de plancie (Granjas Calbria), em
Jacarepagu, Rio de Janeiro. 3. Preferncia horria das fmeas para o
hematofagismo. Memrias do Instituto Oswaldo Cruz 80: 195201.

Lozovei, A. L. 2001. Microhabitats de mosquitos (Diptera, Culicidae) em interndios


de taquara na Mata Atlntica, Paran, Brasil. Iheringia, Srie Zoologia 90: 313.

Magurran, A. E. Measuring Biological Diversity. Oxford: Blackwell Science, 2004.

Moreno, C. E. Mtodos para medir la biodiversidad. Saragoza: Unesco & SEA,


2001.

Rio Grande do Sul. Decreto lei n 44.050, de 05 de outubro de 2005. Aprova o


regimento interno da Secretaria da Sade. Dirio Oficial do Estado, Porto
Alegre, 06 de out 2005. p. 10.

Ott, A. P. & G. S. Carvalho. 2001. Comunidade de cigarrinhas (Hemiptera:


Auchenorrhyncha) de uma rea de campo do municpio de Viamo, Rio Grande
do Sul, Brasil. Neotropical Entomology 30: 233-243.

Reinert, J. F. 2001. Revised list of abbreviations for genera and subgenera of


Culicidae (Diptera) and notes on generic and subgeneric changes. Journal of
the American Mosquito Control Association 17: 51-55.

Rio Grande do Sul. 2009a. Plano de contingncia para dengue do estado do Rio
Grande do Sul. Disponvel em: http://www.saude.rs.gov.br/dados/12438759670
911229620783462Plano%20Estadual%20de%20Contigencia%20para%20
Dengue%202008%20final.pdf [Acessado em 05/11/2009].
69

Rio Grande do Sul. 2009b. Plano de ao para a Emergncia de Sade Pblica de


Importncia Nacional (ESPIN) de febre amarela no Rio Grande do Sul,
2008/2009. Disponvel em: http://www.saude.rs.gov.br/dados/124050732680012
34786948781Plano_Febre_Amarela_06_FEV_09.pdf [Acessado em
05/11/2009].

Santos-Neto & A. L. Lozovei. 2008. Aspectos ecolgicos de Anopheles cruzii e


Culex ribeirensis (Diptera, Culicidae) da Mata Atlntica de Morretes, Paran,
Brasil. Revista Brasileira de Entomologia 52: 105111.

Silva, A. M. da; V. Nunes & J. Lopes. 2004. Culicdeos associados a entrens de


bambu e bromlias, com nfase em Aedes (Stegomyia) albopictus (Diptera,
Culicidae) na Mata Atlntica, Paran, Brasil. Iheringia, Srie Zoologia 94: 63
66.

Sevegnani, L. & L. R. M. Baptista. 1996. Composio florstica de uma floresta


secundria, no mbito da Floresta Atlntica, Maquin, RS. Sellowia (45-48): 47-
71.

Teston, J. A. & E. Corseuil. 2004. Diversidade de Arctiinae (Lepidoptera, Arctiidae)


capturados com armadilha luminosa, em seis comunidades no Rio Grande do
Sul, Brasil. Revista Brasileira de Entomologia 48: 77-90.

Vasconcelos, P. F. C.; A. F. Sperb; H. A. O. Monteiro; M. A. N. Torres; M. R. S.


Sousa; H. B. Vasconcelos; L. B. L. F. Mardini & S. G. Rodrigues. 2003.
Isolations of yellow fever virus from Haemagogus leucocelaenus in Rio Grande
do Sul State, Brazil. Transactions of the Royal Society of Tropical Medicine
and Hygiene 97: 60-62.
70

4.2 MANUSCRITO 2
Submetido Revista da Sociedade Brasileira de Medicina Tropical

Novos registros e potencial epidemiolgico de algumas


espcies de mosquitos (Diptera, Culicidae) no Estado do Rio
Grande do Sul, Brasil.

Jder da Cruz Cardoso1, 2, Marcia Bicudo de Paula1, Aristides Fernandes1, Edmilson dos
Santos2, Marco Antnio Barreto de Almeida2, Daltro Fernandes da Fonseca2 & Maria Anice
Mureb Sallum1

1. Departamento de Epidemiologia, Faculdade de Sade Pblica, Universidade de So Paulo. 01246-


904 So Paulo-SP, Brasil. E-mail: jader@usp.br
2. Diviso de Vigilncia Ambiental em Sade, Centro Estadual de Vigilncia em Sade, Secretaria da
Sade do Estado do RS, 90650-090 Porto Alegre-RS, Brasil. E-mail: jader-cardoso@saude.rs.gov.br

RESUMO

A Vigilncia Entomolgica tem se mostrado uma importante estratgia de

monitoramento da fauna de culicdeos com vistas a predizer o risco de exposio a

espcies vetoras de patgenos. Esse trabalho apresenta 22 espcies encontradas pela

primeira vez no Rio Grande do Sul e discute o potencial epidemiolgico de algumas

espcies de mosquitos, ocorrentes no municpio de Maquin e outras regies do

Estado. Foi verificada a ocorrncia de 10 espcies potencialmente vetoras do vrus

Saint Louis, Oropouche, Aura, Trocara, Ilhus, Rocio, Una, West Nile e Encefalite

Equina do Leste.

Palavras-chave: Vigilncia Entomolgica. arbovrus. Culicidae. Rio Grande do Sul


71

ABSTRACT

The entomological surveillance has shown to be an important strategy for the

culicidean fauna monitoring, aiming to predict the risk of exposure to pathogen

vector species. This work presents 22 species found for the first time in Rio Grande

do Sul state and discusses the epidemiological potential displayed by mosquito

species occurring in Maquin municipality and in other regions of the state. The

occurrence of 10 potentially vector species for the viruses Saint Louis, Oropouche,

Aura, Trocara, Ilhus, Rocio, Una, West Nile, and Eastern Equine Encephalitis was

verified.

Key-words: Entomological Surveillance. arbovirus. Culicidae, Rio Grande do Sul

INTRODUO

Os culicdeos so os insetos vetores que mais atraem a ateno dos

especialistas em sade pblica, pois agrupam espcies envolvidas na transmisso de

diversos agentes infecciosos, entre os quais, vrus causadores de encefalites severas

em hospedeiros animais e que podem causar epidemias na populao humana1. A

circulao de vrus nos ambientes envolve ciclos complexos dos quais fazem parte,

artrpodes e hospedeiros vertebrados como aves e mamferos2. O termo arbovrus

tem origem na expresso inglesa ARthropod + BOrne + VIRUSes e significa vrus

transmitidos por artrpodes.

A Vigilncia Entomolgica um instrumento de coleta e avaliao peridica

de dados referentes aos vetores, tanto nas suas relaes com hospedeiros vertebrados,

incluindo humanos, quanto em aspectos ambientais que possam contribuir para o

aparecimento de doenas causadas por patgenos veiculados por esses insetos3. No


72

Estado do Rio Grande do Sul as atividades de Vigilncia Entomolgica de mosquitos

se iniciaram em 1995 com o programa da dengue, sendo Aedes (Stegomyia) aegypti

Linnaeus e Aedes (Stegomyia) albopictus (Skuse) as espcies para as quais o controle

direcionado.

Apesar das campanhas de controle estarem principalmente focadas nas duas

espcies do subgnero Stegomyia presentes no Brasil, outros mosquitos vem

assumindo importncia para a sade pblica local. o caso de Haemagogus

(Conopostegus) leucocelaenus (Dyar & Shannon). O vrus da febre amarela foi

isolado de exemplares dessa espcie coletados durante investigao de surto

epizotico que ocasionou mortes de primatas no humanos em dois municpios do

noroeste do Estado4. Dessa maneira, ficou evidente a necessidade de ampliar os

conhecimentos sobre a fauna silvestre de vetores e dos patgenos associados, atravs

de estudos sistematizados.

Cardoso e colaboradores5,6 elaboraram dois inventrios de Culicidae do Rio

Grande do Sul. Foram realizados levantamentos abrangendo 11 zonas fisiogrficas

do Estado, que permitiram atualizar as informaes referentes fauna de Culicidae

em termos de nomenclatura, distribuio geogrfica e riqueza de espcies e oferecer

informaes importantes para os servios de vigilncia. Nos inventrios citados,

foram registradas 71 espcies, sendo 57 da subfamlia Culicinae e 14 pertencentes

Anophelinae.

Considerando a importncia da Vigilncia Entomolgica de culicdeos como

estratgia de vigilncia em sade, este trabalho apresenta uma lista de espcies

encontradas pela primeira vez no Estado e discute a importncia de alguns txons

como potenciais vetores de arbovrus causadores de encefalites.


73

MATERIAL E MTODOS

O trabalho foi realizado no municpio de Maquin, situado no litoral norte do

Rio Grande do Sul, distante 140 km de Porto Alegre. O municpio est localizado

numa rea de ectono, o que determina composio vegetal rica, com remanescentes

da Mata Atlntica encontrados nos vrios extratos de mata nativa e de florestas

secundrias7. As coletas foram realizadas na rea urbana (antropizada), rea de

transio (com caractersticas rurais) e rea silvestre (mata secundria). Amostragens

na rea de transio e mata, foram realizadas nas dependncias da estao

experimental Litoral Norte da Fundao Estadual de Pesquisa

Agropecuria/FEPAGRO (293940S; 501249W), localizada a 1,5 km do centro

da cidade.

Em cada ambiente foram instaladas trs armadilhas luminosas tipo CDC8. Na

rea urbana e de transio, as armadilhas eram instaladas no peridomiclio e na mata,

distribudas em rvores, sempre posicionadas de maneira que o atrativo luminoso

ficasse a uma altura de 1,7 metros do solo. As coletas com CDC foram realizadas das

18h00min s 06h00min. Tambm na mata, foi utilizado um aspirador eltrico de

solo9 (aspirador de Nasci), empregado na busca ativa de exemplares, inclusive

noturnos, que esto em repouso em abrigos naturais, ou durante o vo dos insetos,

muitas vezes em decorrncia da perturbao causada pelo aparelho na vegetao.

Foram realizadas aspiraes de 10 minutos em quatro transectos, no horrio

compreendido entre 12h00min e 14h00min. As coletas tiveram periodicidade mensal

entre dezembro de 2006 a dezembro de 2008. As tcnicas de transporte e montagem

dos mosquitos seguiram Forattini10 e Consoli & Loureno-de-Oliveira11. Os


74

espcimes foram identificados no Laboratrio de Entomologia em Sade Pblica

(LESP) do Departamento de Epidemiologia da Faculdade de Sade Pblica da

Universidade de So Paulo (FSP/USP). Amostras do material foram incorporadas

Coleo Entomolgica da FSP/USP.

RESULTADOS

Como resultados das coletas realizadas no municpio de Maquin, foram

identificadas 55 espcies das quais 22 so registradas pela primeira vez no Rio

Grande do Sul e listadas na Tabela 1.

A maioria dos novos registros pertence ao gnero Culex, com 13 espcies,

seguidos de Aedes (2), Wyeomyia (3), Uranotaenia (2), Mansonia (1) e Psorophora

(1).

Representantes de Culex (Culex) acharistus Root, Culex (Culex) declarator

Dyar & Knab, Culex (Culex) mollis Dyar & Knab, Culex (Melanoconion) pilosus

Dyar & Knab, Culex (Microculex) aphylactus Root, Culex (Microculex) dubitans

Lane & Withman, Culex (Microculex) inimitabilis Dyar & Knab, Culex (Microculex)

neglectus Lutz In: Bourroul, Psorophora (Janthinosoma) forceps Cerqueira,

Wyeomyia (Phoniomyia) theobaldi Lane & Cerqueira, Wyeomyia aporonoma Dyar &

Knab e Wyeomyia confusa (Lutz) foram coletados exclusivamente pela tcnica de

aspirao. Por outro lado, Culex (Melanoconion) bastagarius Dyar & Knab, Culex

(Microculex) gairus Root, Culex (Microculex) pleuristriatus Theobald, Mansonia

(Mansonia) flaveola (Coquillett) e Uranotaenia (Uranotaenia) mathesoni Lane

foram amostrados somente nas armadilhas CDC.

Em relao aos ambientes de coleta, a maioria das espcies foi procedente da


75

mata. Na rea de transio foram identificadas Cx. lygrus, Cx. pleuristriatus e Ur.

pulcherrima, enquanto na urbana, Cx. bastagarius, Cx. lygrus e Cx. nigripalpus.

Tabela 1. Espcies de mosquitos registradas pela primeira vez no Rio Grande do Sul segundo
o ambiente de coleta: mata (ma), transio (tr) e urbano e tcnica empregada: Aspirador de
Nasci (ASP) e armadilha CDC. Municpo de Maquin, RS, dezembro de 2006 a dezembro
de 2008.

Tcnica
Espcie Ambiente
ASP CDC
1. Aedes (Ochlerotatus) hastatus Dyar, 1922 ma X X
2. Aedes (Ochlerotatus) nubilus Theobald, 1903 ma X X
3. Culex (Culex) acharistus Root, 1927 ma X
4. Culex (Culex) declarator Dyar & Knab, 1906 ma X
5. Culex (Culex) lygrus Root, 1927 ma, tr, ur X X
6. Culex (Culex) mollis Dyar & Knab, 1906 ma X
7. Culex (Culex) nigripalpus Theobald, 1901 ma, ur X X
8. Culex (Melanoconion) bastagarius Dyar & Knab, 1906 ma, ur X
9. Culex (Melanoconion) pilosus (Dyar & Knab, 1906) ma X
10. Culex (Microculex) aphylactus Root, 1927 ma X
11. Culex (Microculex) dubitans Lane & Withman, 1951 ma X
12. Culex (Microculex) gairus Root, 1927 ma X
13. Culex (Microculex) inimitabilis Dyar & Knab, 1906 ma X
14. Culex (Microculex) neglectus Lutz In: Bourroul, 1904 ma X
15. Culex (Microculex) pleuristriatus Theobald, 1903 tr X
16. Mansonia (Mansonia) flaveola (Coquillett, 1905) ma X
17. Psorophora (Janthinosoma) forceps Cerqueira, 1939 ma X
18. Uranotaenia (Uranotaenia) mathesoni Lane, 1943 ma X
19. Uranotaenia (Uranotaenia) pulcherrima Lynch Arriblzaga, 1891 ma, tr X X
20. Wyeomyia (Phoniomyia) theobaldi (Lane & Cerqueira, 1942) ma X
21. Wyeomyia aporonoma Dyar & Knab, 1906 ma X
22. Wyeomyia confusa (Lutz, 1905) ma X
76

DISCUSSO

Embora os representantes de Culex e Aedes (Ochlerotatus), respectivamente

tenham hbitos, predominantemente noturnos e diurnos com picos crepusculares1,

exemplares de Culex foram capturados com aspirador de solo e indivduos

pertencentes ao gnero Aedes amostrados em armadilhas CDC.

A presena de representantes de Aedes nas armadilhas CDC indica a

possibilidade de exemplares do grupo terem sido coletados ao entardecer ou

amanhecer, nos momentos de maior atividade, visto que os equipamentos

funcionavam, por 12 horas do crepsculo vespertino ao matutino. Em reas de

influncia de Mata Atlntica, Forattini e colaboradores12,13 verificaram

comportamento bimodal em espcies de Aedes.

Somando esses novos registros aos encontros de Cardoso e colaboradores5,6,

mais Anopheles galvaoi Causey, Deane & Deane, Anopheles intermedius (Peryass)

e Runchomyia reversa Lane & Cerqueira, citados recentemente14, a fauna de

culicdeos do Rio Grande do Sul totaliza, at o momento, 96 espcies. Das ocorrentes

em Maquin, algumas se destacam por terem sido encontradas naturalmente

infectadas com arbovrus em outras regies do Estado (Tabela 2) ou por

apresentarem caractersticas taxonmicas ou bioecolgicas que lhes conferem

potencial para transmisso desses patgenos.

Os principais arbovrus que circulam na Regio Neotropical pertencem aos

gneros Flavivirus, Alphavirus e Bunyavirus, includos respectivamente nas famlias

Flaviviridae, Togaviridae e Bunyaviridae. Dengue (DEN), encefalite de Saint Louis

(SLE), Febre Amarela (FA), Ilhus (ILH) e Rocio (ROC) so infeces ocasionadas

por vrus pertencentes ao gnero Flavivirus. Os patgenos causadores da Encefalite


77

Equina do Leste (EEL), Encefalite Equina do Oeste (EEO), Encefalite Equina

Venezuelana (EEV) e Mayaro (MAY) pertencem ao gnero Alphavirus e Oropouche

(ORO), ao gnero Bunyavirus1.

O papel epidemiolgico do Aedes (Ochlerotatus) serratus ainda pouco

conhecido. No entanto alguns encontros de infeco natural sugerem a competncia

vetora dessa espcie para transmitir arbovrus. Em condies naturais, Ae. serratus j

foi encontrado infectado com o vrus causador da encefalite Saint Louis (SLE) e

Oropouche (ORO) na Amaznia brasileira15,16, vrus AURA no Par e na provncia

de Misiones, Argentina17,18 e vrus TROCARA em Tucuru, Par e na Amaznia

peruana19,20. Alm disso, considerado vetor secundrio do vrus Ilhus (ILH),

atuando na manuteno do ciclo silvestre do vrus16. Os criadouros caractersticos de

Aedes (Ochlerotatus) serratus so alagados temporrios, no solo que sofrem

influncia direta das chuvas. A atividade hematofgica ocorre ao longo do dia, com

maior intensidade ao pr-do-sol. As fmeas so eclticas, mas parecem preferir

grandes mamferos para o repasto sanguneo1,11. So encontrados com certa

abundncia em ambientes silvestres primitivos e matas secundrias e apresentam

pouca tendncia a domiciliao21,22.

Exemplares de Culex (Culex) coronator e Culex (Culex) declarator tm sido

frequentemente encontrados com o vrus da Encefalite Saint Louis na regio

amaznica do Brasil, desempenhando importante papel na manuteno do ciclo desse

arbovirus. Na mesma regio, o vrus foi isolado de Mansonia pseudotitillans15 16


.

Culex (Culex) nigripalpus considerado vetor de arbovrus, mas ainda no foram

detectados isolamentos de exemplares coletados em territrio brasileiro. J foi

incriminado pela ocorrncia de casos de SLE nos Estados Unidos, alm de ter sido
78

encontrado naturalmente infectado com esse vrus na Amrica Central e norte da

Amrica do Sul. Na Repblica Dominicana considerado vetor potencial do vrus da

Encefalite Equina do Leste (EEL)1, e nos Estados Unidos, do vrus do Nilo

Ocidental23. No Brasil, estudos realizados no Parque Ecolgico do Tiet, uma rea de

preservao ambiental, na periferia da cidade de So Paulo, sugerem que a populao

de Cx. nigripalpus daquele local pode participar do ciclo de transmisso dos virus

Mucambo e Saint Louis, por realizar repasto sanguneo em roedores que atuam como

hospedeiros potenciais desses agentes infecciosos24.

Nos Estados Unidos, o sistema de vigilncia do vrus do Nilo Ocidental

(VNO), desde 1999, j isolou o vrus de 64 espcies de Culicidae, entre as quais,

Culex coronator, Cx. nigripalpus, Cx. quinquefasciatus, Ma. titillans, Ps. ciliata e

Ps. ferox23. Na Argentina, em 2006, o VNO foi isolado de trs equinos que morreram

com sintomas de encefalite25. Considerando as caracteristicas ecolgicas e biolgicas

de algumas espcies de Culicidae do Brasil, Natal e Ueno26 levantaram a hiptese de

que Cx. quinquefasciatus, Ae. scapularis e Ae. albopictus tem potencial para

participar da transmisso do virus do Nilo Ocidental. Em reas de Mata Atlntica, no

sudeste do Estado de So Paulo, Ae. scapularis e Ps. ferox foram incriminados como

vetores potencias do virus Rocio27. Ainda em So Paulo, o virus da SLE foi isolado

de paciente febril com suspeita de dengue e os autores28 alertaram para a necessidade

de se conduzir investigaes clnicas e epidemiolgicas de doenas febris que podem

ser confundidas com infeces causadas por Flavivirus.

No Rio Grande do Sul, entre 2002 e 2007 o programa de vigilncia ambiental

da febre amarela e outras arboviroses atravs do monitoramento de Primatas No

Humanos (PNH), capturou 181 macacos das espcies Alouatta caraya (bugio-preto)
79

e Alouatta guariba clamitans (bugio-ruivo). Testes de neutralizao permitiram a

deteco de anticorpos para os vrus Saint Louis (n=16) e Oropouche (n=1),

caracterizando esses registros em PNH como os mais meridionais no Brasil29.

A emergncia ou reemergncia de doenas transmitidas por vetores envolvem

questes complexas como dinmicas sociais e demogrficas e a nfase nas respostas

de emergncia em detrimento de programas de preveno30. No Brasil, o

comportamento humano de modificar o ambiente para satisfazer suas necessidades

est entre os principais fatores determinantes para emergncia de arbovrus31.

Os resultados do presente estudo demonstram a necessidade de levantamentos

de fauna como ponto de partida para a Vigilncia Entomolgica, pois os novos

registros de ocorrncia de culicdeos no Estado do Rio Grande do Sul representam

acrscimo de aproximadamente 23% na fauna conhecida para o Estado. O

conhecimento prvio das espcies de Culicidae que ocorrem em determinada regio

permite formular hipteses sobre os possveis vetores em casos de surtos ou

epidemias causados por mosquitos.

Alm disso, embora muitas dessas espcies ainda no estejam relacionadas

com a transmisso de patgenos ou a competncia e capacidade vetoras sejam pouco

conhecidas, estudos continuados abordando aspectos ecolgicos e de infeco natural

das populaes de mosquitos podem trazer informaes sobre o risco potencial de

determinada rea em relao circulao de agentes infecciosos transmitidos por

esses insetos.
80

Tabela 2. Espcies de mosquitos potencialmente vetores de arbovrus coletadas em Maquin


e outros municpios do Rio Grande do Sul.

Ocorrncia do vetor no
Espcie Vrus Local Referncia
RS*
Ae. serratus Saint Louis Amaznia brasileira Vasconcelos et al., 1991
Oropouche Amaznia brasileira Vasconcelos et al., 1998
Travassos da Rosa et al., Derrubadas, Santo Antnio
Aura Par
1998 das Misses, So Francisco
Misiones Sabattini et al., 1998 de Paula, Venncio Aires,
Travassos da Rosa et al., Maquin, Porto Alegre e
Trocara Tucuru
2001 Guaba
Amaznia peruana Turel et al., 2005
Ilhus Vasconcelos et al., 1998

Garruchos, Santo Antnio


das Misses, Gramado,
Ae. scapularis Rocio So Paulo Mitchell et al., 1986 Maquin, Sapiranga,
Osrio, Gravata, Canoas e
Porto Alegre

Cx. coronator Saint Louis regio amaznica Vasconcelos et al., 1991 Derrubadas, Santo Antnio
das Misses, Soledade, So
Francisco de Paula, Jlio
WNV Estados Unidos CDC, 2009 de Castilhos, Feliz,
Maquin, Porto Alegre e
Quara

Maquin (novo registro


Cx. declarator Saint Louis regio amaznica Vasconcelos et al., 1991
RS)

Cx. nigripalpus Saint Louis Estados Unidos Forattini, 2002

Amrica central Forattini, 2002


Maquin (novo registro
norte da Am. do sul Forattini, 2002 RS)
EEE Repblica Dominicana Forattini, 2002
WNV Estados Unidos CDC, 2009

Cx. Todas as reas com


WNV Estados Unidos CDC, 2009
quinquefasciatus adensamento humano
continua
81

Continuao Tabela 2.
Ma.
Saint Louis regio amaznica Vasconcelos et al., 1991 Maquin e Porto Alegre
pseudotitillans

Derrubadas, Ernestina,
Teutnia, Maquin, Santo
Ma. titillans WNV Estados Unidos CDC, 2009 Antnio da Patrulha,
Osrio, Porto Alegre,
Viamo e Cidreira

Ps. ciliata WNV Estados Unidos CDC, 2009 Maquin e Porto Alegre

Ps. ferox WNV Estados Unidos CDC, 2009


Derrubadas, Santo Antnio
Ilhus So Paulo Vasconcelos et al., 1998
das Misses, So Francisco
Amaznia Vasconcelos et al., 1998 de Paula, Gramado,
Peru Turell et al., 2005 Venncio Aires, Maquin,
Rocio So Paulo Mitchell et al., 1986 Porto Alegre, e Viamo
UNA Peru Turell et al., 2005
* baseada em Cardoso et al., 2005. Distribuio Norte/Sul.

AGRADECIMENTOS

Aos colegas Leandro Pinto, Hlio Jacques, Pedro Aquino, Valter Menezes e

Jorge Wilson do Centro Estadual de Vigilncia em Sade, pela indispensvel

contribuio nas coletas. Agradecemos direo da Fundao Estadual de Pesquisa

Agropecuria (FEPAGRO) e aos tcnicos da Estao de Maquin, por proporcionar

o desenvolvimento desse trabalho autorizando as coletas em suas dependncias e

disponibilizando alojamento aos pesquisadores. MAMS tem financiamento da

Fundao de Amparo Pesquisa do Estado de So Paulo, FAPESP (Processo no.

05/53973-0), e Conselho Nacional de Desenvolvimento Tcnico e Cientfico (CNPq

BPP no. 300351/2008-9).


82

REFERNCIAS

1. Forattini OP. Culicidologia mdica: identificao, biologia, epidemiologia. v.


2. So Paulo: Editora da Universidade de So Paulo; 2002.

2. Iversson LB. Situao atual do conhecimento eco-epidemiolgico sobre


arbovrus patognicos para o homem na regio da mata atlntica do Estado de
So Paulo. Rev Inst Med Trop So Paulo 1994; 36: 343-353.

3. Gomes AC. Vigilncia Entomolgica. Inf Epidemiol SUS 2002; 11: 79-90.

4. Vasconcelos PFC, Sperb AF, Monteiro HAO, Torres MAN, Sousa, MRS,
Vasconcelos HB, et al. Isolations of yellow fever virus from Haemagogus
leucocelaenus in Rio Grande do Sul State, Brazil. Trans R Soc Trop Med
Hyg 2003; 97: 60-62.

5. Cardoso JC, Corseuil E, Barata JMS. Anophelinae (Diptera, Culicidae)


ocorrentes no estado do Rio Grande do Sul, Brasil. Entomol Vect 2004; 11:
159-177.

6. Cardoso JC, Corseuil E, Barata JMS. Culicinae (Diptera, Culicidae)


ocorrentes no estado do Rio Grande do Sul, Brasil. Rev Bras Entomol 2005;
49: 275-287.

7. Gerhardt CH, Troian LC, Guterrez LM, Magalhes RG, Guimares LA,
Ferreira L. O, Miguel LA. Diagnstico Socioeconmico e Ambiental do
Municpio de Maquin/RS: Perspectivas para um desenvolvimento rural
sustentvel. Porto Alegre, Relatrio PROPESQ/UFRGS, 2000.

8. Sudia WD, Chamberlain RW. Battery operated light trap, an improved


model. Mosq News 1962; 22:126-129.

9. Nasci RS. A lightweight battery-powered aspirator for collecting resting


mosquitoes in the field. Mosq News 1981; 41: 808-811.

10. Forattini OP. Entomologia mdica: parte geral, Diptera, Anophelini. v. 1. So


83

Paulo: Faculdade de Sade Pblica/USP; 1962.

11. Consoli RAGB, Loureno-de-Oliveira R. Principais mosquitos de


importncia sanitria no Brasil. Rio de Janeiro: Editora FIOCRUZ; 1994.

12. Forattini OP, Gomes AC, Santos JLF, Galati EAB, Rabello EX, Natal D.
Observaes sobre atividade de mosquitos Culicidae, em mata residual no
Vale do Ribeira, S. Paulo, Brasil. Rev Sade Pblica 1981; 15: 557-86.

13. Forattini OP, Gomes AC, Natal D, Santos JLF. Observaes sobre atividade
de mosquitos Culicidae em matas primitivas da plancie e perfis
epidemiolgicos de vrios ambientes no Vale do Ribeira, So Paulo, Brasil.
Rev Sade Pblica 1986; 20: 178-203.

14. Gomes AC, Paula MB, Vitor Neto JB, Borsari R, Ferraudo AS. Culicidae
(Diptera) em rea de Barragem em Santa Catarina e Rio Grande do Sul.
Neotrop Entomol 2009; 38: 553-555.

15. Vasconcelos, P. F. C.; Travassos da Rosa, J. F. S.; Travassos da Rosa, A. P.


A.; Degallier, N.; Pinheiro, F. P. & S Filho, G. C. Epidemiologia das
encefalites por arbovrus na Amaznia brasileira. Rev Inst Med Trop So
Paulo 1991; 33 (6): 465-476.

16. Vasconcelos PFC, Travassos da Rosa APA, Pinheiro FP, Shope RE,
Travassos da Rosa JFS, Rodrigues SG, et al. Arboviruses pathogenic for man
in Brazil. In: Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa
JFS (eds.). An Overview of Arbovirology in Brazil and Neighbouring
Countries. Belm: Instituto Evandro Chagas; 1998. p. 72-99.

17. Travassos da Rosa JFS, Travassos da Rosa APA, Vasconcelos PFC, Pinheiro
FP, Rodrigues SG, Travassos da Rosa ES et al. Arboviruses isolated in the
Evandro Chagas Institute, including some described for the first time in the
Brazilian Amazon region, their known hosts, and their pathology for man. In:
Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS. (eds.) An
Overview of Arbovirology in Brazil and Neighbouring Countries. Belm,
Instituto Evandro Chagas, 1998. p. 19-31.
84

18. Sabattini MS, Avils G, Monath T P. Historical, epidemiological and


ecological aspects of arboviruses in Argentina: Togaviridae, Alphavirus. In:
Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS (eds.). An
Overview of Arbovirology in Brazil and Neighbouring Countries. Belm,
Instituto Evandro Chagas, 1998. p. 135-153.

19. Travassos da Rosa AP, Turell MJ, Watts DM, Powers AM, Vasconcelos
PFC, Jones JW et al. Trocara Virus: A newly recognized Alphavirus
(Togaviridae) isolated from mosquitoes in the Amazon basin. Am J Trop
Med Hyg 2001; 64: 9397.

20. Turell MJ, OGuinn ML, Jones JW, Sardelis MR, Dohm DJ, Watts DM et al.
Isolation of Viruses from Mosquitoes (Diptera: Culicidae) Collected in the
Amazon Basin Region of Peru. J Med Entomol 2005; 42: 891-898.

21. Forattini OP, Kakitani I, Massad E, Marucci D. Studies on mosquitoes


(Diptera: Culicidae) and anthropic environment. 4. Survey of resting adults
and synanthropic behaviour in South-Eastern Brazil. Rev Sade Pblica
1993; 27: 398411.

22. Forattini OP, Kakitani I, Massad E, Marucci D. Studies on mosquitoes


(Diptera: Culicidae) and anthropic environment. 9- Synanthropy and
epidemiological vector role of Aedes scapularis in South-Eastern Brazil. Rev
Sade Pblica 1995; 29: 199207.

23. (CDC). Centers for Disease Control and Prevention. West Nile Virus:
entomology. Disponvel em: <http://www.cdc.gov/ncidod/dvbid/westnile/
mosquitospecies.htm>. Acesso em: 10 out 2009.

24. Laporta GZ, Crivelaro TB, Vicentin EC, Amaro P, Branquinho MS & Sallum
MAM. Culex nigripalpus Theobald (Diptera, Culicidae) feeding habit at the
Parque Ecolgico do Tiet, So Paulo, Brazil. Rev Bras Entomol 2008; 52:
663-668.

25. Morales MA, Barrandeguy M, Fabbri C, Garcia JB, Vissani A, Trono K, et


al. West Nile virus isolation from equines in Argentina, 2006. Emerg Infect
85

Dis 2006; 12: 1559-1561.

26. Natal D, Ueno HM. Vrus do Nilo Ocidental: caractersticas da transmisso e


implicaes vetoras. Entomol Vect 2004; 11: 417-433.

27. Mitchell CJ, Forattini OP, Miller BR. Vector competence experiments with
Rocio virus and three mosquito species from the epidemic zone in Brazil. Rev
Sade Pblica 1986; 20: 171-177.

28. Rocco IM, Santos CLS, Bisordi I, Petrella SMCN, Pereira LE, Souza RP, et
al. St. Louis encephalitis virus: first isolation from a human in So Paulo
State, Brazil. Rev Inst Med Trop So Paulo 2005; 47: 281-285.

29. Almeida MAB, Santos E, Cardoso JC, Fonseca DF, Torres MAN, Flores NR,
et al. Vigilncia de febre amarela e outras arboviroses atravs do
monitoramento de primatas no humanos de vida livre no Rio Grande do Sul.
In: 44 Congresso da Sociedade Brasileira de Medicina Tropical, 2008, Porto
Alegre/RS. Rev Soc Bras Med Trop 2008; 41, p.173.

30. Gubler DJ. Resurgent Vector-Borne Diseases as a Global Health Problem.


Emerg Infect Dis 1998; 4: 442-450.

31. Figueiredo LTM. Emergent arboviruses in Brazil. Rev Soc Bras Med Trop
2007; 40: 224-229.
86

4.3 MANUSCRITO 3

A ser submetido, em ingls, Emerging Infectious Diseases

Isolamento do vrus da Febre amarela em mosquitos (Diptera,


Culicidae) de reas epizoticas do noroeste do
Rio Grande do Sul, Brasil.

Jder da C. Cardoso, Marco A. B. de Almeida, Edmilson dos Santos, Daltro F. da Fonseca,


Maria A. M. Sallum, Carlos A. Noll, Hamilton A. de O. Monteiro, Ana C. R. Cruz, Valria
L. Carvalho, Eliana V. Pinto & Pedro F. da C. Vasconcelos

Author affiliations: Secretaria da Sade do Estado do Rio Grande do Sul, Porto Alegre, Brazil (J. C.
Cardoso, M. A. B. Almeida, E. Santos, D. F. Fonseca, C. A. Noll); Universidade de So Paulo, So
Paulo, Brazil (J. C. Cardoso, M. A. M. Sallum); Instituto Evandro Chagas, Ananindeua, Brazil (H.
A. O. Monteiro, A. C. R. Cruz, V. L. Carvalho, E. V. Pinto, P.F.C. Vasconcelos) and Universidade
do Estado do Par, Belm, Brazil (P.F.C. Vasconcelos)

ABSTRACT. Isolation of the yellow fever virus in mosquitoes (Diptera,

Culicidae) in epizootic areas of the Northwestern region of Rio Grande do Sul

state, Brazil. In the years 2001 and 2002, in the southern region of Brazil, the yellow

fever virus was detected in mosquitoes of the species Haemagogus leucocelaenus

and in non-human primates in the genus Alouatta. In October 2008 new epizooties

were reported in the Rio Grande do Sul and led to the intensification of

environmental surveillance measures to the early detection of the viral circulation

and to direct vaccination of the human population. The present work presents the

results obtained by an entomological surveillance in two areas that recorded primate

deaths. Mosquitoes were collected with a hand net and a bottle-type vacuum, and

were sent to the laboratory for taxonomic identification and viral detection. The virus
87

was isolated again from mosquitoes Hg. leucocelaenus and first time from Aedes

serratus. The results confirmed the role of Hg. leucocelaenus as the main vector of

yellow fever virus in Rio Grande do Sul State and suggested the potential of Ae.

serratus as secondary vector. Molecular analyses showed the circulating virus

belongs to the South American genotype I.

Key-words: Yellow Fever, Haemagogus leucocelaenus, Aedes serratus,

Entomological Surveillance.

RESUMO

Nos anos de 2001 e 2002, no extremo sul do Brasil, o vrus da febre amarela foi

detectado em mosquitos da espcie Haemagogus leucocelaenus e primatas no

humanos do gnero Alouatta. Em outubro de 2008 novas epizootias ocorreram no

Rio Grande do Sul e desencadearam a intensificao das aes de vigilncia

ambiental para detectar precocemente a circulao viral e direcionar a vacinao da

populao humana. Este trabalho apresenta os resultados obtidos pela vigilncia

entomolgica em duas reas com registro de mortes de primatas. Os mosquitos foram

coletados com pu e aspirador tipo frasco e enviados ao laboratrio para

identificao taxonmica e deteco viral. O vrus foi isolado novamente de

mosquitos Hg. leucocelaenus e pela primeira vez de Aedes serratus. Os resultados

confirmaram o papel de Hg. leucocelaenus como vetor principal do vrus no Rio

Grande do Sul e sugerem o potencial de Ae. serratus como vetor secundrio.

Anlises moleculares mostraram que o vrus circulante pertence ao gentipo I sul

americano.
88

Palavras-chave: Febre amarela, Haemagogus leucocelaenus, Aedes serratus,

Vigilncia Entomolgica.

INTRODUO

A febre Amarela uma doena febril aguda causada pelo vrus Febre amarela

(VFA), membro do gnero Flavivirus, famlia Flaviviridae. O VFA endmico nas

regies tropicais das Amricas e frica (1,2). O vrus transmitido, atravs da

picada de insetos hematfagos da famlia Culicidae, a hospedeiros vertebrados,

principalmente primatas no humanos (PNH), podendo infectar tambm o homem.

Nas Amricas, o ciclo urbano envolve mosquitos Aedes aegypti e o homem,

enquanto no silvestre o vrus transmitido aos PNH por mosquitos dos gneros

Haemagogus e Sabethes, especialmente Haemagogus janthinomys, Haemagogus

albomaculatus, Haemagogus leucocelaenus, Sabethes chloropterus, Sabethes

glaucodaemon, Sabethes soperi e Sabethes cyaneus (2,3).

No Brasil, so descritas duas reas epidemiolgicas. A rea com

recomendao de vacinao ou rea de risco para a febre amarela silvestre, que inclui

as regies Norte, Centro Oeste, os Estados do Maranho e Minas Gerais, mais a parte

ocidental dos Estados do Piau, Bahia, So Paulo, Paran, Santa Catarina e Rio

Grande do Sul. A rea sem recomendao de vacinao abrange a regio litornea

que vai do Piau ao Rio Grande do Sul (4). No perodo de 1989 e 2008, ocorreram

546 casos humanos com 241 bitos devido febre amarela (5).
89

No Rio Grande do Sul, extremo sul do pas, os ltimos casos humanos de

febre amarela silvestre datam da dcada de 1960 (6). Aps 40 anos de silncio, o

vrus foi isolado de mosquitos Haemagogus leucocelaenus coletados em 2001,

durante uma epizootia envolvendo PNH de vida livre da espcie Alouatta caraya

(bugio preto), no Noroeste do Estado (7). Esses achados em mosquitos e PNH

desencadearam aes de vacinao em 44 municpios, prevenindo a ocorrncia de

casos humanos e levando a Secretaria da Sade do Estado a iniciar um programa de

vigilncia ambiental para febre amarela e outros 18 arbovirus, buscando detectar

precocemente a presena desses patgenos em mosquitos e PNH (mediante deteco

de anticorpos especficos), atravs da Vigilncia Entomolgica e Vigilncia de

Epizootias, respectivamente. Esse monitoramento foi sendo aprimorado e, em 2002,

uma nova epizootia possibilitou o registro de circulao viral na regio Central do

Estado, incluindo mais nove municpios na rea de vacinao que permaneceu

inalterada por seis anos.

Em outubro de 2008, a Secretaria da Sade do Estado, verificou um aumento

no nmero de notificaes de mortes de macacos Alouatta caraya na regio noroeste

e intensificou as aes de vigilncia antes mesmo da confirmao desses bitos por

febre amarela. A circulao viral avanou o ano de 2009 e, at abril, foram

registrados mais de 1600 bitos de primatas e sete mortes de humanos (8).

Este trabalho descreve os resultados obtidos pela Vigilncia Entomolgica

durante investigaes realizadas em reas com registros de epizootias por febre

amarela em dois municpios do noroeste do Rio Grande do Sul, no ano de 2008.


90

MATERIAL E MTODOS

rea de estudo

As investigaes entomolgicas foram realizadas em reas rurais dos

municpios de Caibat (W 54 38; S 2817) e Coronel Barros (W 5403; S 2822),

pertencentes bacia do Rio Iju. Esses municpios esto distantes, respectivamente,

487 km e 417 km de Porto Alegre, capital do Estado do Rio Grande do Sul, e distam

entre si, aproximadamente 80 km (Figura 1). Caibat possui 5.080 habitantes

enquanto Coronel Barros tem uma populao de 2.241 residentes, de acordo com a

contagem populacional de 2007 (9). A paisagem dominada por plantaes e

pecuria extensiva, evidenciando a ao antrpica sobre o ambiente (10).

Figura 1. Localizao (em vermelho) dos municpios do onde foram realizadas as coletas no Rio
Grande do Sul. Brasil, novembro de 2008.

As formaes vegetais arbreas remanescentes esto distribudas em matas de

galeria ou fragmentos isolados presentes nas reas cultivadas e campos de pastagem,

geralmente associados a pequenos rios e crregos para ofertar sombra e gua ao

gado. As florestas da regio so classificadas como Florestas Estacionais Deciduais.


91

O carter estacional definido pelas baixas temperaturas verificadas no inverno que

fazem com que as rvores emergentes do estrato superior percam suas folhas em

razo da seca fisiolgica causada pelo frio (11).

O clima subtropical mido, apresentando dois perodos trmicos distintos

durante o ano. No vero a temperatura mdia das mdias supera os 20C, enquanto

no inverno, a mdia das mdias inferior a 15C. Quanto ao regime de chuvas, no

so observados perodos de dficit hdrico (12).

Procedimentos de campo

As coletas foram realizadas entre os dias 19 e 27 de novembro de 2008, em

matas residuais com registros de mortes de PNH, nos municpios de Caibat e

Coronel Barros. Os mosquitos foram capturados, no nvel do solo, com rede

entomolgica e aspiradores manuais tipo frasco, em diferentes horrios, no intervalo

compreendido entre 8h30min e 16h. Aps a coleta os insetos foram congelados,

transferidos para tubos criognicos e acondicionados em botijo contendo nitrognio

lquido para transporte at o laboratrio, onde foram armazenados em freezer -70C

at o processamento das mesmas.

Identificao taxonmica e tentativas de isolamento viral

Cultivo celular: os lotes de mosquitos foram identificados at a categoria

taxonmica especfica ou genrica, separados em lotes mximos de 30 indivduos e

macerados em soluo salina tamponada de albumina bovina contendo penicilina

(100 UI/mL) e estreptomicina (100 g/mL), centrifugados a 3.000 rpm sob 4C,

filtrados e inoculados em cultura de clulas VERO (clulas epiteliais de rim de


92

macaco verde africano, Cercopithecus aethiops). Posteriormente foram

acompanhadas por um perodo de at 14 dias; aps este tempo as clulas foram

triadas pela Tcnica de Imunofluorescncia Indireta (IFI), utilizando-se anticorpos

policlonais contra os Flavivirus (vrus Bussuquara, Cacipacore, Dengue, Febre

Amarela, Ilhus, Naranjal-like, encefalite Saint Louis) e Alphavrus (vrus Aura,

Eastern equine encephalitis, Mayaro, Mucambo, Pixuna, Una, Western equine

encephalitis e Trocara). Os lotes de mosquitos positivos para Flavivirus foram

novamente testados por IFI utilizando-se anticorpos monoclonais para a

identificao do vrus da Febre Amarela.

Camundongos albinos suos recm-nascidos: esses animais foram

inoculados por via intracerebral (ic.) na quantidade de 0,02 mL com a mesma

suspenso usada para infectar os cultivos celulares. Os camundongos demonstrando

sinais de doena foram colhidos e testados por Fixao do complemento para a

confirmao do isolamento viral de febre amarela, segundo o protocolo previamente

descrito (13,14).

Taxa mnima de infeco

A taxa mnima de infeco nas espcies das quais se isolou o vrus da febre

amarela foi calculada dividindo o nmero total de lotes positivos por espcie de

mosquito pelo nmero total de mosquitos processados da espcie x 100 (7,15,16).


93

Extrao de cido ribonuclico (RNA)

Para extrao do RNA viral foi utilizado o reagente Trizol LS (Invitrogen/San

Diego/EUA) seguindo as orientaes do fabricante.

Transcrio reversa seguida da reao em cadeia mediada pela

polimerase (RT-PCR)

O cDNA foi obtido diretamente do RNA viral pela transcrio reversa in

vitro. Foram utilizados 5 L do RNA e adicionado 1 L (0,2uM) de oligonucleotdeo

reverso FA2554 (GTATGAGTACTTGTTCAGCCAGTC), estes foram incubados

para desnaturao da molcula de RNA a 94C por 2 minutos e deixados

temperatura ambiente por 5 minutos. Em seguida foram acrescentados 14 L da

mistura da reao de transcrio reversa (RT) contendo tampo 1X, dNTPs 1 mM, 10

mM de DTT, inibidor de RNAse 40 U (RNaseOUT Invitrogen) e transcriptase

reversa 1,5 U (Superscript-II, Reverse Transcriptase, Invitrogen ). A sntese de

cDNA foi feita a 45C por 1 hora, em seguida aquecida a 94C por 10 minutos e

deixada a 4C at a adio da mistura do PCR para amplificao do cDNA.

Ao volume final de 20 L da RT foram acrescentados 30 L da mistura de

PCR, a qual continha tampo 1X, MgCl2 2 mM, DNA polymerase 2,5 U (Platinum

Taq DNA Polymerase), 0,2 M dos oligonucleotdeos senso (FA1223)

(GAAGAGAACGAAGGGACAATGC) e reverso (FA2554). O programa para

amplificao consistiu de uma desnaturao prvia de 94C por 2 min, seguida de 35

ciclos, cada um composto por etapas de desnaturao a 94C por 30 segundos,

hibridizao a 55 C por 30 segundos e extenso a 72 C por 2,5 minutos, seguido de

um ciclo de extenso final de 72 C por 5 minutos.


94

Seqenciamento nucleotdico

Para o seqenciamento de nucleotdeos os amplicons foram purificados

utilizando o kit comercial QIAquick Gel Extraction (Qiagen), o qual utiliza colunas

de reteno a base de slica, seguindo o protocolo descrito pelo fabricante. O cDNA

purificado foi seqenciado usando o Kit ABI PRISM Dye Terminator verso 3.1

(Applied Biosystems), que emprega o mtodo de terminao de cadeia por

didesoxiribonucleotdeo marcados com diferentes fluorforos para cada nucleotdeo

na extremidade 3 (17).

Na mistura para cada reao de seqenciamento foram usados 8 L de

Terminator ready reaction mix, 2 L (100 ng) do produto de PCR, 3,5 pmoles dos

oligonucleotdeos FA1223 e FA2554 e quantidade suficiente de gua para um

volume final de 10 L. O produto da reao de seqenciamento foi precipitado

utilizando o protocolo do etanol e lcool isoproplico e em seguida submetido

eletroforese no seqenciador automtico ABI PRISM 3130 (Applied Biosystems).

Anlise filogentica das seqncias obtidas

Para montagem, alinhamento e anlise de homologia foram utilizados os

programas SEQMAN II, EDITSEQ e MEGALIGN includos no pacote Lasergene

verso 4.05 (DNASTAR). Para montagem dos dendogramas e rvores filogenticas

foi utilizado o programa Molecular Evolutionary Genetics Analysis - MEGA, verso

4.1 2001 (18) usando o mtodo de agrupamentos de vizinhos (neighbor-joining -

NJ). A distncia nucleotdica foi calculada pelo mtodo Kimura 2 parmetros e

anlise de bootstrap com 1.000 pseudorplicas (19). Para permitir um melhor


95

enraizamento da rvore filogentica, foi adicionado um grupo de seqncia externo

que est representado pela cepa ASIBI (prottipo VFA) e uma cepa de VFA de

Uganda.

RESULTADOS

O vrus da febre amarela foi isolado em sete lotes de mosquitos Hg.

leucocelaenus procedentes de Coronel Barros e Caibat. Tambm houve isolamento

do vrus da febre amarela em um lote com trs espcimes de Ae. serratus coletados

em Coronel Barros (Tabela 1). Todos os lotes com isolamento de febre amarela

apresentaram resultados positivos nas trs tcnicas utilizadas, exceto o lote Be Ar

754962, positivo apenas na cultura de clulas e no RT-PCR.

Tabela 1. Lotes de mosquitos positivos para o vrus da febre amarela coletados nos
municpios de Coronel Barros e Caibat, Rio Grande do Sul, Novembro de 2008.
Data Horrio Municpio Localidade Lote Espcie N
25/11/08 10:00 - 14:00 Coronel Barros Rinco Canta Galo 754954 Hg. leucocelaenus 30
25/11/08 10:00 - 14:00 Coronel Barros Rinco Canta Galo 754955 Hg. leucocelaenus 30
26/11/08 10:05 - 14:15 Coronel Barros Rinco Canta Galo 754956 Hg. leucocelaenus 23
25/11/08 10:00 - 14:00 Coronel Barros Rinco Canta Galo 754957 Ae. serratus 03
19/11/08 8:30 - 11:30 Coronel Barros Rinco dos Pampas 754962 Hg. leucocelaenus 29
27/11/08 9:40 - 13:40 Coronel Barros Rinco dos Pampas 754963 Hg. leucocelaenus 27
26/11/08 9:30 - 12:00 Caibat Capo Herval 754984 Hg. leucocelaenus 14
25/11/08 9:00 - 16:00 Caibat Linha Caar 754993 Hg. leucocelaenus 20

Foram coletados 358 mosquitos pertencentes a 14 categorias taxonmicas. As

espcies mais abundantes em relao ao total de mosquitos foram Haemagogus

leucocelaenus (52,8%) e Aedes serratus (14,8%). Tanto nos municpios de Coronel

Barros quanto de Caibat 179 exemplares foram capturados e preparados,

respectivamente, em 16 e 20 lotes para isolamento viral (Tabela 2).


96

Tabela 2. Abundncia de mosquitos e nmero de lotes preparados para isolamento viral


procedentes dos municpios de Coronel Barros e Caibat, Rio Grande do Sul, Novembro de 2008.

MUNICPIO/localidade
CORONEL BARROS CAIBAT
Rinco dos Rinco Linha da Linha Capo do
Categoria taxonmica Total
Pampas Canta Galo Pedreira Caar Herval

Aedes scapularis 1 1
Aedes serratus 8 3 4 32 6 53 (5)
Anopheles mediopunctatus 1 1
Chagasia species 2 1 3 (2)
Coquillettidia venezuelensis 1 1
Haemagogus leucocelaenus 56 (2) 83 (3) 36 (2) 14 189 (8)
Johnbelkinia species 1 1
Psorophora albigenu 1 1
Psorophora albipes 3 38 (2) 41 (3)
Psorophora ferox 1 1 3 11 12 28 (5)
Psorophora species 6 7 13 (2)
Sabethes albiprivus 5 5
Sabethes intermedius 2 1 3 (2)
Wyeomyia species 3 13 2 18 (3)
Total 75 (7) 97 (7) 7 (2) 105 (12) 74 (8) 358 (36)

Dos 189 exemplares de Hg. leucocelaenus capturados, 173 (91,5%)

pertenceram a lotes positivos. O vrus no foi detectado apenas em um lote com 16

mosquitos da localidade de Linha Caar. A taxa mnima de infeco foi de 1,88%

para a espcie Ae. serratus e de 3,70% para Hg. leucocelaenus.

Anlise filogentica realizada com seis cepas do VFA isoladas dos artrpodes

procedentes do Rio Grande do Sul foi comparada com seqncias de cepas de VFA

da Amrica do Sul, incluindo a seqncia de nucleotdeos de um isolado de Hg.

leucocelaenus em 2001 do RS. As cepas de VFA que circularam durante o recente

surto de FA no RS pertencem ao gentipo I da Amrica do Sul e mesmo pertencendo

ao gentipo da cepa de VFA de Hg. leucocelaenus/2001, se mantiveram distantes

geneticamente (Figura 2).


97

Figura 2. Anlise filogentica da regio estrutural parcial do envelope (E) de seis amostras de VFA
seqenciadas nesse estudo. Comparao com 17 seqncias brasileiras do gentipo I da Amrica
do Sul; e seis seqncias de cepas referenciadas do gentipo II da Amrica do Sul (Peru, Bolvia e
Brasil) obtidas do genbank/ncbi/nlm/nih/gov. A anlise foi realizada utilizando o mtodo de
agrupamento de vizinhos e a distncia nucleotdica calculada pelo mtodo de Kimura 2
parmetros. Os valores bootstrap foram calculados aps 1000 rplicas e esto listados apenas
nos ramos principais. As seqncias de VFA cepa Asibi e Uganda foram usadas como grupo
externo durante a anlise. A barra vertical apenas ilustrativa. As amostras em vermelho so
seqncias obtidas dos isolados do Rio Grande do Sul.
98

DISCUSSO

A febre amarela representa, ainda hoje, um importante agravo infeccioso que

apresenta elevada morbidade e letalidade. Depois de 40 anos dos ltimos casos

humanos, o vrus ressurgiu no sul do Brasil em 2001, durante uma epizootia de PNH,

sem registro de ocorrncia em humanos (7). interessante observar que nesta regio,

exemplares de Hg. janthinomys, considerado o principal transmissor do vrus da

febre amarela nas Amricas, no tm sido coletados, enquanto Hg. leucocelaenus se

apresenta como a espcie mais abundante nas capturas.

Haemagogus leucocelaenus uma espcie amplamente distribuda na

Amrica do Sul, necessitando confirmar sua presena no oeste da cordilheira dos

Andes, sul do Chile e da Argentina. Possui hbitos silvestres, diurnos e

acrodendrfilos embora possa realizar repasto sanguneo em hospedeiros no nvel do

solo (20). No Brasil, essa espcie mais comum e abundante nas florestas do sul

(21).

No Rio Grande do Sul, o primeiro registro de ocorrncia de Hg.

leucocelaenus foi no municpio de Taquara em 1932 (22). Mais tarde, em 1939, sua

presena foi detectada nos municpios de Santa Rosa, Santo Augusto e So Luiz

Gonzaga, regio noroeste do Estado (21).

Sob condies naturais, o vrus da febre amarela foi isolado de Hg.

leucocelaenus em 1938, a partir de 16 exemplares coletados no Estado do Rio de

Janeiro (23) em 1944, de um lote com seis espcimes procedentes de uma floresta

prxima de Villavicencio (21). Depois de quase sessenta anos, pesquisas

entomolgicas durante evento epizotico, em reas rurais de duas localidades da

regio noroeste do Rio Grande do Sul, possibilitaram isolar duas cepas do vrus em
99

21 exemplares procedentes de Santo Antonio das Misses (7). Na oportunidade,

esses autores sugeriram que Hg. leucocelaenus poderia ser vetor secundrio da febre

amarela alm de desempenhar importante papel na epidemiologia dessa arbovirose

no Cone Sul.

Os vetores biolgicos podem ser classificados em principais ou primrios e

auxiliares ou secundrios conforme a rea de transmisso a que est associado.

Segundo Forattini (20) os vetores auxiliares contribuem com a ao dos vetores

principais quando coexistem ou podem assumir o papel de vetor principal, mas em

carter local ou regional. J os vetores principais desempenham esse papel em

amplas regies biogeogrficas.

Considerando que at o momento, Hg. leucocelaenus a nica espcie do

gnero com ocorrncia confirmada no Rio Grande do Sul (24), nossos dados

reforam o papel de Hg. leucocelaenus como vetor primrio da febre amarela

silvestre no Estado, podendo esta condio ser ampliada para outros Estados

brasileiros da regio Sul.

Em So Paulo, investigaes entomolgicas em vrios municpios

verificaram que Hg. leucocelaenus foi uma das espcies mais abundantes e

capturadas em todas as regies estudadas, durante um surto de febre amarela

silvestre, mas o vrus amarlico somente foi isolado de Hg. janthinomys. Os autores

evidenciaram a capacidade da espcie para adaptar-se a ambientes secundrios e

degradados, e embora tenham coletado exemplares de outras espcies (Hg.

janthynomis/capricornii e Hg. spegazzinii), destacam a possibilidade de Hg.

leucocelaenus estar envolvida na manuteno desses focos da doena (25).


100

Todas as coletas nos municpios de Caibat e Coronel Barros ocorreram junto

ao solo em remanescentes de floresta decidual cercados por plantaes de soja.

Como o estrato superior contnuo dessas matas no excede 20 metros de altura (12),

e em virtude do alcance de vo de Hg. leucocelaenus associado a busca ativa de

sangue por parte das fmeas (20) razovel supor que as coletas ao nvel do solo

permitem amostrar nmero suficiente de exemplares para identificao taxonmica e

testes de isolamento viral, no necessitando de plataformas, indispensveis em outras

regies do Brasil para a coleta de Hg. janthinomys e outras espcies. Em 2001,

quando o vrus da febre amarela foi isolado em dois lotes com 23 mosquitos, cabe

lembrar que 22 exemplares foram coletados no nvel do solo (7).

No Instituto Evandro Chagas, aproximadamente 98% dos isolamentos do

vrus da febre amarela so adquiridos de mosquitos dos gneros Haemagogus e

Sabethes. Excepcionalmente espcies de outros gneros como Aedes fulvus, Aedes

scapularis e Psorophora albipes foram encontradas infectadas, mas com apenas um

isolamento obtido (2) necessitando, portanto, de novas evidncias que caracterizem a

importncia na dessas espcies na manuteno do VFA na natureza.

Na localidade de Rinco Canta Galo, em Coronel Barros, foram coletados trs

exemplares de Aedes serratus dos quais o vrus amarlico foi isolado (lote BE AR

754957). Essa informao extremamente importante, pois a primeira vez que essa

espcie encontrada naturalmente infectada com o VFA.

Esses mosquitos tm como criadouros, alagados temporrios no solo. So

abundantes em ambientes silvestres e a atividade hematofgica diurna, com picos

no crepsculo vespertino. Embora as fmeas sejam eclticas, parecem preferir

grandes mamferos para o repasto sanguneo (26,20).


101

Alguns encontros de infeco natural sugerem a competncia vetorial dessa

espcie para transmitir arbovrus. Ae. serratus j foi encontrado infectado na

Amaznia brasileira com o vrus Oropouche (ORO) (27), vrus AURA no Par e na

provncia de Misiones, Argentina (28,29) e vrus TROCARA no Par e na Amaznia

peruana (30,31). Alm disso, considerado vetor secundrio do vrus Ilhus (ILH)

(27).

No tocante ao estudo molecular, a distribuio das cepas de VFA do presente

estudo mostrou-se monofiltica formando um subgrupo dentro do clado I do

gentipo I sul americano. Contudo interessante notar que houve a formao de dois

clados (I e II) que agruparam aleatoriamente cepas de vrios Estados brasileiros e

com isso podemos afirmar que a formao dos clados se deu pela data da circulao

do vrus e no pela distribuio geogrfica, sendo que as cepas do sul do Brasil tm

mostrado elevado ndice de divergncia gentica com as cepas do clado II,

denominado de Par antigo por Vasconcelos e colaboradores (32). Esses achados

foram anteriormente verificados na anlise da regio da juno N-terminal da

protena NS5/ regio no traduzida 3 de 79 amostras brasileiras do VFA (32).

Dessa forma, os isolados de VFA de nosso estudo esto geneticamente mais

distantes dos demais VFA isolados tanto em humanos quanto de mosquitos e PNH

em outros Estados brasileiros das dcadas de 60, 70, 80 e 90. Por outro lado, essas

cepas mostraram relao gentica com um isolado de VFA de Haemagogus do

Tocantins do ano de 2000 (32) e com a cepa de VFA procedente do Rio Grande do

Sul em 2001 (7).

Em concluso, este estudo confirmou o importante papel de Haemagogus

leucocelaenus como vetor da febre amarela no Rio Grande do Sul; demonstrou a


102

infeco natural de Aedes serratus, atuando como potencial vetor secundrio da febre

amarela no sul brasileiro; e identificou que o gentipo I da Amrica do Sul, clado I

foi o responsvel pela epidemia e epizootia de febre amarela.

Estudos comparativos com cepas de VFA de primatas e humanos da mesma

regio geogrfica devem ser realizados utilizando relgio molecular, para entender a

dinmica de transmisso do vrus.

AGRADECIMENTOS

Aos colegas da Secretaria Estadual da Sade do Rio Grande do Sul Acelino

C. dos Santos e Valdir J. D. Lopes (17 Coordenadoria Regional de Sade) e

Fernando Berger Ferreira (12 Coordenadoria Regional de Sade) pelas atividades de

coleta, com apoio dos municpios. Seo de virologia do Instituto de Pesquisas

Biolgicas - Laboratrio Central do Estado do Rio Grande do Sul (IPB-LACEN/RS)

pelo armazenamento e envio das amostras ao IEC. Agradecemos tambm ao GT de

arboviroses e Coordenao Geral de Laboratrios de Sade Pblica da Secretaria de

Vigilncia em Sade do Ministrio da Sade pelo apoio, especialmente Dra.

Zouraide Guerra por disponibilizar algumas referncias utilizadas nesta publicao.

MAMS tem financiamento da Fundao de Amparo Pesquisa do Estado de So

Paulo, FAPESP (Processo no. 05/53973-0), e Conselho Nacional de

Desenvolvimento Tcnico e Cientfico (CNPq BPP no. 300351/2008-9). Este

trabalho foi parcialmente financiado pelos projetos INCT-

FHV/CNPq/FAPESPA/CAPES (Grant 573739/2008-0), CNPq (Grant 300460/2005-

8) e IEC/SVS.
103

REFERNCIAS

1. Monath TP. 2001. Yellow fever update. Lancet Infect Dis 1: 11-20.

2. Vasconcelos PFC. 2003. Febre amarela. Rev Soc Bras Med Trop 36: 275-293.

3. Carvalho VL, Silva EVP, Carvalho CL, et al. 2008. Isolamento do vrus da
febre amarela em clulas c6/36 a partir de lotes de mosquitos capturados em
jata - GO. In: 44 Congresso da Sociedade Brasileira de Medicina Tropical,
2008, Porto Alegre/RS. Rev Soc Bras Med Trop 41, 2008.

4. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade. 2010. Febre


Amarela Silvestre, Brasil: Boletim de atualizao dezembro de 2009. [cited
2010 jan 24] Available from http://portal.saude.gov.br/portal/arquivos/pdf/bole
tim_febre_amarela_09_12_09.pdf

5. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade. 2009. Febre


Amarela: aspectos epidemiolgicos. [cited 2009 sep 19] Available from
http://portal.saude.gov.br/portal/saude/profissional/visualizar_texto.cfm?idtxt=
31620

6. Nobre A, Antezana D, Tauil PL. 1994. Febre amarela e dengue no Brasil:


epidemiologia e controle. Rev Soc Bras Med Trop 27 (supl III): 59-66.

7. Vasconcelos PFC, Sperb AF, Monteiro HAO, Torres MAN, Sousa, MRS,
Vasconcelos HB, et al. 2003. Isolations of yellow fever virus from
Haemagogus leucocelaenus in Rio Grande do Sul State, Brazil. Trans R Soc
Trop Med Hyg 97: 60-62.

8. Rio Grande do Sul. 2009. Plano de ao para a Emergncia de Sade Pblica


de Importncia Nacional (ESPIN) de febre amarela no Rio Grande do Sul,
2008/2009. [cited 2009 nov 05]. Available from
http://www.saude.rs.gov.br/dados/12405073268
001234786948781 Plano_Febre_Amarela_06_FEV_09.pdf
104

9. Brasil. Instituto Brasileiro de Geografia e Estatstica (IBGE). 2009. Cidades.


[cited 2009 sep 28] Available from
http://www.ibge.gov.br/cidadesat/topwindow.htm?1

10. Rambo B. 1994. A fisionomia do Rio Grande do Sul: Ensaio de monografia


natural. 3 ed. So Leopoldo: UNISINOS, 473 pp.

11. Klein RM, Reis A, Reitz R. Projeto Madeira do Rio Grande do Sul. SUDESUL.
Porto Alegre, 1988. 525p.

12. Teixeira MB, Coura-Neto AB, Pastore U, Rangel Filho ALR. 1986. Vegetao:
as regies fitoecolgicas, sua natureza e seus recursos econmicos. Estudo
fitogeogrfico. In: Levantamento de recursos naturais. Instituto Brasileiro de
Geografia e Estatstica, Rio de Janeiro, v.33, p.541-632.

13. Beaty B, Calisher CH, Shope RE. Arboviruses. In Diagnostic Procedures for
Viral, Rickettsial and Chlamydial Infections, Lennette ED, Lennette DA,
Lennette ET (ed.), 7th edition. American Publich Health association,
Washington; 1995. p. 189-112.

14. Vasconcelos PFC, Costa ZG, Travassos da Rosa ES, et al. 2001. An epidemic
of jungle Yellow fever in Brazil, 2000. Implications of climatic alterations in
disease spread. J Med Virol. 65(3):598-604.

15. Walter SD, Hildreth SW, Beaty BJ. 1980. Estimation of infection rates in
populations of organisms using pools of variable size. Am J Epidemiol 112:
124-128.

16. Vasconcelos PFC, Rodrigues SG, Degallier N., et al. 1997. An epidemic of
sylvatic yellow fever in Southeast region of Maranho State, Brazil, 1993-
1994. Epidemiological and entomological findings. Am J Trop Med Hyg
57:132-137.

17. Sanger F, Nicken S, Coulson AR. 1977. DNA sequencing with chain-
terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467

18. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary


105

Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596-
1599.

19. Kimura M. 1980. A simple method for estimating evolutionary rate of base
substitution through comparative studies of nucleotide sequences. J Mol Evol 16:
111-120.

20. Forattini OP. 2002. Culicidologia mdica: identificao, biologia,


epidemiologia. v. 2. So Paulo, Editora da Universidade de So Paulo, 860 pp.

21. Kumm HW, Cerqueira NL. 1951. The Rle of Ades leucocelaenus in the
epidemiology of jungle yellow fever. Bull Entomol Res 42: 195-200.

22. Pinto C. 1932. Alguns mosquitos do Brasil e do oriente da Bolvia (Diptera.


Culicidae). Rev Med-Cirurg Brasil (10): 285-309

23. Shannon RC, Whitman L, Frana M. 1938. Yellow fever virus in jungle
mosquitoes. Science 88: 110-111.

24. Cardoso JC, Corseuil E, Barata JMS. 2005. Culicinae (Diptera, Culicidae)
ocorrentes no estado do Rio Grande do Sul, Brasil. Rev Bras Entomol 49: 275-
287.

25. Camargo-Neves VLF, Poletto DW, Rodas LAC, Pachioli ML, Cardoso RP,
Scandar SAS, et. al. 2005. Entomological investigation of a sylvatic yellow
fever area in So Paulo State, Brazil. Cad Sade Pblica 21:1278-1286.

26. Consoli RAGB, Loureno-de-Oliveira R. 1994. Principais mosquitos de


importncia sanitria no Brasil. Rio de Janeiro, Editora FIOCRUZ, 225 p.

27. Vasconcelos PFC, Travassos da Rosa APA, Pinheiro FP, Shope RE, Travassos
da Rosa JFS, Rodrigues SG, et al. Arboviruses pathogenic for man in Brazil.
In: Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS (eds.).
An Overview of Arbovirology in Brazil and Neighbouring Countries. Belm:
Instituto Evandro Chagas; 1998. p.72-99.

28. Travassos da Rosa JFS, Travassos da Rosa APA, Vasconcelos PFC, Pinheiro
106

FP, Rodrigues SG, Travassos da Rosa ES et al. Arboviruses isolated in the


Evandro Chagas Institute, including some described for the first time in the
Brazilian Amazon region, their known hosts, and their pathology for man. In:
Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS. (eds.) An
Overview of Arbovirology in Brazil and Neighbouring Countries. Belm,
Instituto Evandro Chagas, 1998. p. 19-31.

29. Sabattini MS, Avils G, Monath T P. Historical, epidemiological and


ecological aspects of arboviruses in Argentina: Togaviridae, Alphavirus. In:
Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS (eds.). An
Overview of Arbovirology in Brazil and Neighbouring Countries. Belm,
Instituto Evandro Chagas, 1998. p.135-153

30. Travassos da Rosa AP, Turell MJ, Watts DM, Powers AM, Vasconcelos PFC,
Jones JW et al. 2001. Trocara Virus: A newly recognized Alphavirus
(Togaviridae) isolated from mosquitoes in the Amazon basin. Am J Trop Med
Hyg 64: 9397

31. Turell MJ, OGuinn ML, Jones JW, Sardelis MR, Dohm DJ, Watts DM et al.
2005. Isolation of Viruses from Mosquitoes (Diptera: Culicidae) Collected in
the Amazon Basin Region of Peru. J Med Entomol 42: 891-898.

32. Vasconcelos PFC, Bryant JE, Travassos da Rosa APA, Tesh RB, Rodrigues
SG, Barret ADT. 2004. Genetic Divergence and Dispersal of Yellow Fever
Virus, Brazil. Emerg Infect Dis 10: 1578-1584.
107

4.4 MANUSCRITO 4

Aceito para publicao na Neotropical Entomology

First record of Culex (Culex) brethesi (Dyar) (Diptera,


Culicidae) in Rio Grande do Sul State, Brazil

JDER DA C CARDOSO1,2, MARCIA B DE PAULA1, ARISTIDES FERNANDES1, EDMILSON DOS

SANTOS2, MARCO A B DE ALMEIDA2, DALTRO F DA FONSECA2 & MARIA A M SALLUM1

1
Departamento de Epidemiologia, Faculdade de Sade Pblica, Universidade de So Paulo (So
Paulo University School of Public Health Department of Epidemiology). Avenida Dr. Arnaldo, 715,
01246-904 So Paulo, So Paulo, BRAZIL. E-mail: jader@usp.br
2
Diviso de Vigilncia Ambiental em Sade, Centro Estadual de Vigilncia em Sade, Secretaria da
Sade do Estado do RS (State of Rio Grande do Sul Department of Health, State Health Surveillance
Center, Environmental Health Surveillance Division), Rua Domingos Crescncio, 132, 90650-090
Porto Alegre, Rio Grande do Sul, BRAZIL. E-mail: jader-cardoso@saude.rs.gov.br

Primeiro registro de Culex (Culex) brethesi (Dyar) (Diptera, Culicidae) no

Estado do Rio Grande do Sul, Brasil. RESUMO - Este trabalho relata o primeiro

registro de Culex (Culex) brethesi no Estado do Rio Grande do Sul, Brasil. A espcie

foi identificada a partir da anlise de exemplares coletados em mata de restinga com

auxlio de aspirador de Nasci, durante expedio para vigilncia do Vrus do Nilo

Ocidental, em julho de 2006, no municpio de Mostardas, Rio Grande do Sul, Brasil.

PALAVRAS-CHAVE: Vigilncia Entomolgica, Rio Grande do Sul, Vetores,

Arbovrus
108

ABSTRACT - This is the first record of Culex (Culex) brethesi in Rio Grande do Sul

State, Brazil. The species was identified from specimens collected in a sand bar

vegetation with aid of a Nascis trap, during an expedition for surveillance of the

West Nile Virus, in July of 2006, in the city of Mostardas, Rio Grande do Sul, Brazil.

KEY WORDS: Entomological Surveillance, Rio Grande do Sul, Vectors,

Arbovirus

Mosquitoes (Diptera: Culicidae) are among the most important vectors of the

West Nile Virus (WNV), an arbovirus of the genus Flavivirus (Flaviviridae), which

infects equines and urban and wild birds and may lead to death. In humans, this virus

causes fever, at times progressing to acute meningitis, encephalitis, and death. The

WNV was detected in Africa, Asia, Europe (Natal & Ueno 2004) and in the United

States (Petersen & Roehrig 2001). In 1999 the WNV has spread throughout North

America and Central America, and was first isolated in South America in 2006, in

Buenos Aires, Argentina (Morales et al 2006). In the United States, between 1999

and 2008, tests performed in mosquitoes detected the WNV in 64 Culicidae species,

of which the majority belonged to the genera Culex and Aedes (CDC 2009).

In Brazil, it has been registered 156 species of the genus Culex, which are

subdivided into nine subgenera (WRBU 2009). The subgenus Culex is one of the

most important in the Neotropical Region from an epidemiological point of view

(Forattini 2002).

Because of the potentiality to be introduced in Brazil, the WNV surveillance

includes entomological studies aimsing to identify potential vector species, know


109

their population dynamics, and detect and monitor viral activity in potential hosts. To

achieve this, actions focused on adult forms of Culex spp. and Aedes spp. are

recommended, both in areas of high risk of transmission (zoos, hunting reserves,

feeding territories or migratory bird refuges) and places of notification of possible or

confirmed WNV cases in birds, humans and other mammals (OPAS 2002). Between

July 24th and 28th, 2006, as part of the WNV Surveillance Program routine, the State

Health Surveillance Center, an organ of the State of Rio Grande do Sul Department

of Health, organized an expedition to the Lagoa do Peixe National Park (PNLP), the

largest migratory bird refuge in this state. The Park covers the cities of Tavares

(80%), Mostardas (17%) and So Jos do Norte (3%), and is located between the

Lagoa dos Patos and the Atlantic Ocean, on the central section of the Coastal Plains

of the state of Rio Grande do Sul (Fig 1).

Fig 1 The box above shows the location of the Lagoa do Peixe National Park, where specimens were
collected. State of Rio Grande do Sul, Brazil.

According to its management plan, the PNLP covers an area of 344 km and

is 62 km long and 6 km wide on average. Mean annual temperature varies from 18C

and 20C and mean annual rainfall reaches 1,186 mm. Except for a long belt of
110

coastal dunes, the topography is flat, and the soil is basically formed by marine

quartz sands (Loebmann & Vieira 2005).

Mosquitoes were collected in sand bar vegetation on the road (310642 S;

505159 W) that connects the city of Mostardas with the coast. A total of two 15-

minute manual aspirations were performed (from 09h30min. to 09h45min. and from

10h15min. to 10h30min.), using Nasci traps (Nasci 1981). The mosquitoes collected

were stored in entomological boxes and sent to the Laboratory of Entomology in

Public Health - So Paulo University School of Public Health to identify the species.

A total of four Culex (Culex) brethesi (Dyar, 1919) specimens were identified, based

on characters of the male genitalia.

Culex brethesi was described from the genitals of a male collected in San

Isidro, in the province of Buenos Aires, Argentina. The geographic distribution of

this species is not well known. While Guimares (1997) indicates to the occurrence

of Cx. brethesi in Argentina and questions its presence in Brazil, the Smithsonian

Institution online catalogue of mosquitoes records the presence of this species only in

Argentina and Uruguay (WRBU 2009). In Brazil, Taipe-Lagos & Natal (2003), in a

study of mosquito ecology in the Tiet Ecological Park located in the outskirt of the

city of So Paulo, identified four Cx. brethesi specimens. However, the authors did

not specify whether they were male or female. Rossi (2006) used material originated

from collections made in Buenos Aires and from the Museu de la Plata archives to

re-describe the male, female, pupa and 4th instar larva. In addition, information about

taxonomy and geographic distribution of the species was updated. According to

Rossi (2006), Cx. brethesi occurs in the Argentinean provinces of Buenos Aires,

Cordoba, Mendoza, Misiones, Santa Fe, Santiago del Estero, Entre Rios, Corrientes
111

and Misiones. The author suggests that other records of this species could have

resulted from mistaken identifications, not based on male genital structures.

In this study Cx. brethesi is recorded for the first time in Rio Grande do Sul

state, making clear its occurrence in Brazil. The specimens were identified based on

characteristics of the male genitalia (Fig 2), and incorporated into the Entomological

Collection of the So Paulo University School of Public Health (FSP-USP).

Even though this species has not been associated, until now, with the

transmission of pathogens that cause diseases in humans this finding shows the

importance of detailed collection activities of the Culicidae fauna as an

entomological surveillance strategy.

Fig 2 Culex (Culex) brethesi. Male genitalia. A, Gonocoxite and gonostylus. B, Detail of the subapical
lobe of the gonocoxite. C, Detail of the subapical lobe of gonocoxite, showing setae g and h. D,
Phalosome, showing the ventral arms of lateral plate. E, Phalosome, showing the dorsal arms and
lateral arms of lateral plate. F, Proctiger.
112

ACKNOWLEDGEMENTS

We acknowledge the Lagoa do Peixe National Park management for permit

the collections. MAMS tem financiamento da Fundao de Amparo Pesquisa do

Estado de So Paulo, FAPESP (Processo no. 05/53973-0), e Conselho Nacional de

Desenvolvimento Tcnico e Cientfico (CNPq BPP no. 300351/2008-9).

REFERENCES

Centers for Disease Control and Prevention (CDC). West Nile Virus: entomology.
Available from http://www.cdc.gov/ncidod/dvbid/westnile/mosquitoSpecies.htm
(Accessed 16 March 2009).

Forattini O P (2002) Culicidologia Mdica. Identificao, Biologia, Epidemiologia.


So Paulo, EDUSP, 864 pp.

Guimares J H (1997) Systematic Database of Diptera of the Americas South of the


United States (Family CULICIDAE), So Paulo, Pliade/FAPESP, 286 pp.

Loebmann D, Vieira J P (2005) Amphibians list from Lagoa do Peixe National Park,
Rio Grande do Sul, Brazil. Rev Bras Zool 22: 339-341.

Morales M A, Barrandeguy M, Fabbri C, Garcia J B, Vissani A, Trono K, Gutierrez


G, Pigretti S, Menchaca H, Garrido N, Taylor N, Fernandez F, Levis S & Enra D
(2006) West Nile virus isolation from equines in Argentina, 2006. Emerg Infect Dis
12: 1559-1561.

Nasci R S (1981). A lightweight battery-powered aspirator for collecting resting


mosquitoes in the field. Mosq News 41: 808-811.

Natal D & Ueno H M (2004) Vrus do Nilo Ocidental: caractersticas da transmisso


e implicaes vetoras. Entomol y Vectores 11: 417-433.
113

Organizao Pan-Americana da Sade (OPAS). (2002) Diretrizes para Vigilncia,


Preveno e Controle do Vrus do Nilo Ocidental (West Nile Vrus WNV).
Available from www.paho.org/Portuguese/AD/DPC/CD/wnv-guidelines.pdf
(Accessed 15 March 2009).

Petersen L R & Roehrig J T (2001) West Nile Virus: A reemerging global pathogen.
Emerg Infect Dis 7: 611-614.

Rossi G C (2006) Redescription of Culex (Culex) brethesi Dyar, 1919 (Diptera:


Culicidae). Zootaxa 1312: 25-35.

Walter Reed Biosystematics Unit (WRBU). Systematic Catalog of Culicidae.


Available from http://www.mosquitocatalog.org/species/species_profile.asp?
ID=3425 (Accessed 08 June 2009).
114

5 CONSIDERAES FINAIS

Em virtude da origem essencialmente biolgica dos estudos epidemiolgicos,

a expresso histria natural da doena tem sido amplamente utilizada. Esse termo

considera a conexo de trs fatores fundamentais, o agente, o susceptvel e o

ambiente. No entanto, com os avanos dos conhecimentos ecolgicos, foi

incorporada a anlise dos determinantes de natureza biolgica, fsica e social como

desencadeadores de agravos e doenas, sendo o termo ecologia da doena, utilizado

para designar esses processos. Os fatores determinantes do quadro ecolgico da

doena podem ser endgenos, referentes ao organismo ou exgenos, relacionados

com o ambiente (FORATTINI, 2004).

O foco da Vigilncia Ambiental em Sade est, justamente, na exposio

como determinante de agravos populao (BARCELLOS e QUITRIO, 2006).

Com a estruturao da vigilncia em sade, a vigilncia ambiental se debrua sobre

os condicionantes e determinantes ambientais e atua conjuntamente com a vigilncia

epidemiolgica, compartilhando informaes sobre os vetores e hospedeiros que

podero ser utilizadas para predizer risco e evitar o aparecimento de casos.

De acordo com os nveis de preveno segundo a histria natural da doena

(FORATTINI, 2004), as aes da vigilncia ambiental esto concentradas na

preveno primria e secundria. No primeiro caso, as medidas de preveno

ocorrem no perodo pr-patognico, com objetivos de evitar a exposio da

populao aos fatores determinantes. Na preveno secundria, as medidas so

aplicadas nos perodos pr-clnico, clnico inicial ou clnico manifesto com a

finalidade de diagnosticar e tratar precocemente o agravo ou evitar novos casos e

recuperar a sade dos doentes.


115

Em se tratando de doenas infecciosas cujo agente transmitido por vetor

biolgico, conhecidas tambm como doenas metaxnicas (FORATTINI, 2004), a

entomologia deve atuar nos dois nveis de preveno (primria e secundria) e no

somente na presena de casos humanos. Informaes sistematizadas sobre os vetores

alm de propiciar o monitoramento da distribuio, densidade e outros aspectos

fundamentais para o entendimento sobre o processo de transmisso de patgenos,

proporciona aes mais controladas, seguras e efetivas em casos de intervenes de

emergncia.

Segundo DONALSIO e GLASSER (2002) entre as principais linhas de

investigao da Vigilncia Entomolgica esto os estudos sobre ecologia de vetores.

No litoral do Rio Grande do Sul, informaes sobre riqueza, abundncia,

constncia, dominncia e distribuio temporal, permitiram inventariar e caracterizar

a entomofauna de maneira a identificar possveis espcies vetoras e verificar padres

sazonais que nortearo as aes da Vigilncia Entomolgica. Com as 23 espcies

detectadas pela primeira vez, atravs desse estudo, ampliam-se os registros de

culicdeos no Estado para 97 espcies inventariadas.

Embora seja difcil mensurar caractersticas de populaes vetoras em

ambientes silvestres (GOMES, 2002), alguns autores vm utilizando ndices de

diversidade para, juntamente com parmetros de riqueza e abundncia, caracterizar

comunidades de vetores em programas de vigilncia (ZHONG et al., 2003;

MENDOZA et al., 2008). Os ndices de diversidade, equitabilidade e dominncia se

complementaram na descrio da comunidade. Os estimadores de riqueza se

mostraram como importante ferramenta para verificar o esforo amostral empregado.


116

Assim, podem ser utilizados para avaliar, validar e planejar aes de monitoramento

da entomofauna.

As espcies apresentaram um padro sazonal mais evidente nos meses

quentes e chuvosos, compreendidos entre a primavera e o outono, especialmente

entre os meses de outubro a maio, sendo esse o perodo mais indicado para atividades

de levantamento e monitoramento de fauna.

No que diz respeito malria no Brasil, apenas 1% do total de casos ocorre

na regio extra-amaznica. No entanto, a letalidade nesta regio muito alta, em

decorrncia da falta de diagnstico e tratamento precoce adequado (BRASIL, 2004).

Entre as dcadas de 1920 e 1960 o litoral norte foi a principal rea endmica de

malria no Rio Grande do Sul e An. cruzii, o vetor incriminado na transmisso

(MACHADO, 1943; BARATA, 1973). Atualmente, as reas de risco so

determinadas de acordo com o potencial malargeno relacionado com a receptividade

e vulnerabilidade da regio. A receptividade se mantm pela presena, densidade e

longevidade do vetor e a vulnerabilidade se d pela chegada de portadores de malria

oriundos da regio amaznica e de outros pases (BRASIL, 2004).

No municpio de Maquin houve identificao de oito espcies de Anopheles

junto s residncias na rea de transio, das quais Anopheles albitarsis, An. cruzii e

An. fluminensis so classificadas, segundo FORATTINI (2002), como vetoras dos

plasmdios da malria humana. Embora a densidade de anofelneos no tenha sido

substancial, os resultados sugerem que a regio receptiva malria. Assim, para

evitar a reintroduo da doena, resultante da falta de efetividade no controle da

receptividade e vulnerabilidade (BRASIL, 2004), estratgias de vigilncia entomo-

epidemiolgica devem ser direcionadas para a regio.


117

As arboviroses so essencialmente zoonoses que ocorrem na natureza

envolvendo artrpodes e vertebrados. No entanto, o comportamento do homem pode

determinar mudanas nos padres do agente viral ou dos vetores, aproximando-os do

convvio humano. O quadro clnico das arboviroses constitudo de febre, artralgia,

febre hemorrgica e comprometimento neurolgico que pode resultar em encefalites

(FORATTINI, 2002). No litoral norte foram identificadas espcies potencialmente

vetoras dos arbovrus Aura, Encefalite Equina do Leste, Encefalite Equina do Oeste,

Ilhus, Mayaro, Oropouche, Rocio, Saint Louis, Trocara, Una, Vrus do Nilo

Ocidental. Essas constataes alertam a Vigilncia Entomolgica a monitorar os

possveis vetores, ampliam as possibilidades de exposio da populao humana a

esses agentes patognicos e sugerem que a vigilncia epidemiolgica atente para

sintomas compatveis com as viroses causadas por esses agentes patognicos.

Na regio noroeste do Estado, o vrus da febre amarela silvestre foi isolado de

Haemagogus leucocelaenus e, pela primeira vez, foi obtido isolamento a partir de

mosquitos Aedes serratus. Esses encontros alteram o status dessas espcies no que

tange ao papel vetorial. Em 2001, VASCONCELOS et al. (2003) j haviam isolado o

vrus amarlico de Hg. leucocelaenus e, na oportunidade, consideraram a espcie

como vetora secundria no Cone Sul. Agora, em virtude de novo isolamento, sugere-

se que possa atuar como vetor primrio na regio sul do Brasil. A espcie Aedes

serratus pode desempenhar papel secundrio na transmisso do vrus da febre

amarela, sendo necessrias aes de monitoramento que incluam essa espcie, pois

apresenta potencial para transmisso de diversos arbovrus.

A identificao de espcies potencialmente vetoras de plasmdios e

arbovrus, bem como os isolamentos obtidos de organismos considerados pouco


118

importantes na transmisso do vrus da febre amarela, ampliam as perspectivas sobre

capacidade e competncia vetorial de vrios culicdeos no Rio Grande do Sul.

A Vigilncia Entomolgica como instrumento da Vigilncia Ambiental em

Sade ainda apresenta uma srie de limitaes, como ausncia de ncleos de

entomologia na maioria dos Estados; existncia de poucos centros de referncia em

entomologia mdica; falta de conhecimento, por parte dos profissionais da rea da

sade, para entender o rigor necessrio aos procedimentos entomolgicos; carncia

de profissionais qualificados em taxonomia e ecologia de vetores a fim de garantir

eficincia metodolgica na captura, identificao e anlise das informaes sobre as

espcies (GOMES, 2002).

No Rio Grande do Sul, nos ltimos 50 anos, no foram registrados novos

casos de malria e filariose (MARQUES e GUTIERREZ, 1994; ROCHA e

FONTES, 1998). Em 2007, os primeiros casos de dengue autctone foram

verificados e, no final de 2008, casos humanos de febre amarela foram notificados

depois de mais de 40 anos (RIO GRANDE DO SUL, 2009a; 2009b).

Paradoxalmente, esse privilgio representado pela ausncia de doenas causadas por

patgenos transmitidos por vetores, contrasta com as conseqncias geradas pelo

pouco desenvolvimento desse campo do conhecimento no Estado. As universidades

priorizaram outras linhas de atuao e os servios estruturaram programas voltados

s necessidades de sade da populao.

Atualmente, a ausncia de cursos especficos para formao de recursos

humanos em entomologia para a sade pblica e grupos de pesquisa incipientes,

especialmente em taxonomia e ecologia de vetores, dificultam a interface com as

universidades locais. A Vigilncia Entomolgica ainda uma rea do SUS em


119

construo. A carncia e limitao tcnica de pessoal diante das demandas crescentes

so fatores que dificultam sua execuo.

Para EIRAS (2000) o desinteresse do governo brasileiro pela sade pblica,

particularmente, pelas doenas transmitidas por artrpodes, tem desestimulado

continuamente a formao de entomologistas nos ltimos anos. Alm disso, essa

deficincia de profissionais especializados e competentes, juntamente com a falta de

monitoramento dos mosquitos vetores, tem resultando em campanhas de controle

deficientes.

Para atuar na Vigilncia Entomolgica de mosquitos so necessrias equipes

compostas por entomlogos, profissionais com formao acadmica, responsveis

pelo planejamento, execuo e avaliao das estratgias de vigilncia e controle de

vetores, e tcnicos em entomologia, capacitados a apoiar aes especficas de campo

e laboratrio.

No mbito laboratorial, os entomlogos (taxonomistas) de laboratrios

estaduais e municipais devem ser capazes de identificar sua fauna, auxiliados por

tcnicos em entomologia (pra-taxonomistas), habilitados a reconhecer algumas

espcies de interesse local.

A rede de laboratrios (central e regionais) deve atender prontamente s

demandas da vigilncia, para que o carter preditivo da entomologia possa resultar

em estratgias de preveno e controle oportunas e efetivas. O trabalho de campo,

descentralizado para os municpios, deve priorizar aes integradas, nas quais grupos

taxonmicos diferentes podem ser coletados na mesma ocasio amostral (exemplo:

culicdeos e flebotomneos), para otimizar recursos humanos e financeiros. Alm

disso, coletas devem ser contnuas e abrangentes, de maneira a permitir avaliao de


120

padres de distribuio, riqueza e potencial epidemiolgico da fauna. No Peru, essas

estratgias so utilizadas e as informaes so armazenadas em um Sistema de

Vigilncia Entomolgica (SVE) (PERU, 2002). Diferentemente de outras reas da

sade que utilizam dados secundrios, a entomologia raramente dispe de

informaes se no as produzir. Dessa forma, os servios de sade assumem o papel

fundamental de realizar pesquisas aplicadas com intuito de abastecer seus sistemas

de informaes, sejam eles de programas abrangentes ou especficos.

A estruturao e ampliao das aes da Vigilncia Entomolgica dependem

de uma poltica estadual que contemple, principalmente, as seguintes estratgias: a)

formao, contratao e capacitao permanente de profissionais de campo e

laboratrio; b) coletas continuadas, abrangentes e integradas; c) uso da Vigilncia

Entomolgica como ferramenta de informao; d) financiamento que garanta a

sustentabilidade das aes.

Espera-se que o estudo tenha contribudo para evidenciar o papel da

entomologia no campo da sade pblica e que as informaes aqui reunidas

estimulem a estruturao da Vigilncia Entomolgica como estratgia de Vigilncia

Ambiental em Sade no Estado do Rio Grande do Sul.


121

6 REFERNCIAS

1. Barata JMS. Estado atual da bromlia-malria no Brasil. So Paulo; 1973. [Tese


apresentada para obteno do grau de Mestre em Sade Pblica Faculdade de
Sade Pblica da Universidade de So Paulo].

2. Barcellos C, Quiterio LAD. Vigilncia Ambiental em Sade e sua implantao


no Sistema nico de Sade. Rev Sade Pblica. 2006; 40 (1): 170-177.

3. Bertolli Filho C. Histria da sade pblica no Brasil. So Paulo: tica, 2004.

4. Brasil. Ministrio da Sade. Gabinete do Ministro (GM). Portaria n 1.399, de 15


de dezembro de 1999. Regulamenta a NOB SUS 01/96 no que se refere s
competncias da Unio, estados, municpios e Distrito Federal, na rea de
epidemiologia e controle de doenas, define a sistemtica de financiamento e d
outras providncias. Dirio Oficial da Repblica Federativa do Brasil, Braslia,
16 de dez 1999.

5. Brasil. Constituio (1988). Constituio da Repblica Federativa do Brasil. 14.


ed. Braslia: Cmara dos Deputados; 2000a.

6. Brasil. Ministrio da Sade. Fundao Nacional de Sade (FUNASA). Doenas


Infecciosas e Parasitrias: aspectos clnicos, vigilncia epidemiolgica e medidas
de controle - Guia de bolso. 2. ed. Braslia: Ministrio da Sade: FUNASA;
2000b.

7. Brasil. Ministrio da Sade. Fundao Nacional de Sade (FUNASA). Instruo


Normativa n 1, de 25 de setembro de 2001. Regulamenta a Portaria MS n 1.399,
de 15 de dezembro de 1999, no que se refere s competncias da Unio, estados,
municpios e Distrito Federal, na rea de Vigilncia Ambiental em Sade. Dirio
Oficial da Repblica Federativa do Brasil, Braslia, 26 de set 2001a.
122

8. Brasil. Ministrio da Sade. Fundao Nacional de Sade (FUNASA). Dengue-


instruo para pessoal de combate ao vetor: manual de normas tcnicas. Braslia;
2001b. 84p.

9. Brasil. Ministrio da Sade. Fundao Nacional de Sade (FUNASA). Programa


Nacional de Controle da Dengue. Braslia; 2002. 32p.

10. Brasil. Conselho Nacional de Secretrios de Sade. Para entender a gesto do


SUS. Braslia: CONASS, 2003.

11. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade. Programa


Nacional de Controle da Malria/PNCM. Braslia; 2004. 128p.

12. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade (SVS). Instruo


Normativa n 1, de 07 de maro de 2005. Regulamenta a Portaria GM/MS n
1.172/04, no que se refere s competncias da Unio, estados, municpios e
Distrito Federal na rea de vigilncia em sade ambiental. Dirio Oficial da
Repblica Federativa do Brasil, Braslia, 22 de mar 2005a. Seo I, p. 35.
(republicada por ter sado com incorreo no original)

13. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade (SVS). Consenso


Brasileiro em Doena de Chagas. Rev Soc Bras Med Trop. 2005b; 38 (Supll. III):
1-29.

14. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade (SVS). Guia de


vigilncia epidemiolgica. 6. ed. Braslia: Ministrio da Sade; 2005c.

15. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade (SVS). Guia de


vigilncia epidemiolgica e eliminao da filariose linftica. Braslia: Ministrio
da Sade; 2009.
123

16. Calado DC, Silva MAN da. Comunidade de mosquitos (Diptera, Culicidae) em
recipientes antrpicos introduzidos em rea rural e urbana da regio
metropolitana de Curitiba, Paran, Brasil. Rev Bras Zool. 2001; 18 (Supl. 1): 51-
60.

17. Cardoso J da C. Culicdeos (Diptera, Culicidae) ocorrentes no Estado do Rio


Grande do Sul, Brasil. Porto Alegre; 2003. [Dissertao de Mestrado Pontifcia
Universidade Catlica do Rio Grande do Sul].

18. Cardoso J da C, Corseuil E, Barata JMS. Anophelinae (Diptera, Culicidae)


ocorrentes no estado do Rio Grande do Sul, Brasil. Entomol Vect. 2004; 11 (1):
159-177.

19. Cardoso J da C, Corseuil E, Barata JMS. Culicinae (Diptera, Culicidae)


ocorrentes no estado do Rio Grande do Sul, Brasil. Rev Bras Entomol. 2005; 49
(2): 275-287.

20. Carmo EH, Penna G, Oliveira WK. Emergncias de sade pblica: conceito,
caracterizao, preparao e resposta. Estud av 2008; 22 (64): 19-32.

21. Carrera M. Insetos de interesse mdico e veterinrio. Curitiba: UFPR; 1991.


Introduo; 13-21.

22. Consoli RAGB, Loureno-de-Oliveira R. Principais mosquitos de importncia


sanitria no Brasil. Rio de Janeiro: Editora FIOCRUZ; 1994.

23. Consolim J, Luz E, Pellegrini NJ de, Torres PB. O Anopheles (Nyssorhynchus)


darlingi ROOT, 1926 e a malria no Lago de Itaipu, estado do Paran, Brasil:
uma reviso de dados. Arq Biol Tecnol. 1991; 34 (2): 263-286.

24. Corseuil E. Apostila de entomologia. Porto Alegre: Start; 2001. Divises; 1-6.
124

25. Coutinho JO. Contribuio para o estudo da distribuio geogrfica dos


anofelinos do Brasil: sua importncia na transmisso da malria. So Paulo;
1947. [Tese apresentada para o concurso docncia-livre da cadeira de
parasitologia da Faculdade de medicina da USP].

26. Donalsio MR, Glasser CM. Vigilncia entomolgica e controle de vetores do


dengue. Rev Bras Epidemiol. 2002; 5 (3): 259-272.

27. Eiras AE. Culicideos. In: Neves DP, Melo AL de, Genaro O, Linardi PM,
organizadores. Parasitologia Humana. 10. ed. So Paulo: Atheneu; 2000, p. 355-
367.

28. Ferreira E. Distribuio geogrfica dos anofelinos no Brasil e sua relao com o
estado atual da erradicao da malria. Rev Bras Malariol Doenas Trop. 1964;
16:329-348.

29. Figueiredo LTM. Emergent arboviruses in Brazil. Rev Soc Bras Med Trop. 2007;
40 (2): 224-229

30. Forattini OP. Culicidologia mdica: princpios gerais, morfologia, glossrio


taxonmico. So Paulo: Editora da Universidade de So Paulo; 1996. v. 1.

31. Forattini OP. Mosquitos Culicidae como vetores emergentes de infeces. Rev
Sade Pblica. 1998; 32 (6): 497-502.

32. Forattini OP. Febre amarela [Editorial]. Rev Sade Pblica. 1999; 33 (6).

33. Forattini OP. Reemergncia de infeces [Editorial]. Rev Sade Pblica. 2000;
34(2).

34. Forattini OP. Culicidologia mdica: identificao, biologia, epidemiologia. So


Paulo: Editora da Universidade de So Paulo; 2002. v. 2.
125

35. Forattini OP. Ecologia, epidemiologia e sociedade. 2. ed. So Paulo: Artes


Mdicas; 2004.

36. Freitas CM de. Avaliao de Riscos como Ferramenta para a Vigilncia


Ambiental em Sade. Inf Epidemiol SUS. 2002; 11 (4): 227-239.

37. Gomes A de C. Vigilncia Entomolgica. Inf Epidemiol SUS. 2002; 11 (2):79-


90.

38. Gomes A de C, Paula MB, Neto JBV, Borsari R, Ferraudo AS. Culicidae
(Diptera) em rea de Barragem em Santa Catarina e Rio Grande do Sul. Neotrop
Entomol. 2009; 38 (4): 553-555.

39. Guimares JH. Systematic database of Diptera of the Americas South of the
United States (family culicidae). So Paulo: Pliade/FAPESP; 1997.

40. Harbach RE, Kitching IJ. Phylogeny and classification of the Culicidae (Diptera).
Syst Entomol. 1998; 23 (4): 327-370.

41. Harbach RE, Peyton EL. Sistematics of Onirion, a new genus of Sabethini
(Diptera: Culicidae) from the Neotropical Region. Bulletin of the Natural History
Museum (Entomology Series). 2000; 69 (2):115-169.

42. Hutchings RSG, Sallum MAM, Ferreira RLM. Culicidae (Diptera:


Culicomorpha) da Amaznia Ocidental Brasileira: Querari. Acta Amazon 2002;
32 (1): 109-122.

43. Judd DD. Review of a bromeliad-ovipositing lineage in Wyeomyia and the


resurrection of Hystatomyia (Diptera: Culicidae). Ann Entomol Soc Am. 1998;
91 (5): 572-589.
126

44. Kent RJ, Lacer LD, Meisch MV. Initiating Arbovirus Surveillance in Arkansas,
2001. J Med Entomol. 2003; 40 (2): 223-229.

45. Lane J. Neotropical Culicidae. So Paulo: Universidade de So Paulo; 1953. 2 v.

46. Lopes J, Lozovei AL. Ecologia de mosquitos (Diptera: Culicidae) em criadouros


naturais e artificiais de rea rural do Norte do Estado do Paran, Brasil. I
Coletas ao longo do leito de ribeiro. Rev Sade Pblica. 1995; 29 (3): 183-195.

47. Luna EJA, Pereira LE, Sousa RP. Encefalite do Nilo Ocidental, nossa prxima
epidemia? Epidemiol Serv Sade. 2003; 12 (1): 7-19.

48. Lutz A, Araujo HC de S, Fonseca-Filho O da. Viagem scientifica no Rio Paran e


a Assuncion com volta por Buenos Aires, Montevideo e Rio Grande. Mem Inst
Oswaldo Cruz. 1918; 10 (1): 104-171.

49. Luz E, Consolim J, Barbosa OC, Torres PB. Larvas de Anopheles (subgnero
Kerteszia) Theobald 1905 encontradas em criadouros artificiais, no estado do
Paran, Brasil. Rev Sade Pblica. 1987; 21 (5): 466-468.

50. Machado LS. A malria no Rio Grande do Sul. Arq Dep Estadual Sade. 1943;
4: 82-85.

51. Machado PA. O Homem e os insetos, passado, presente e futuro. Rev Sade
Pblica. 1987; 21 (6): 474-479.

52. Maciel-Filho AA, Ges-Jr CD, Cancio JA, Oliveira ML, Costa SS da.
Indicadores de Vigilncia Ambiental em Sade. Inf Epidemiol SUS. 1999; 8 (3):
59-66.

53. Marques AC, Gutierrez HC. Combate malria no Brasil: evoluo, situao
atual e perspectivas. Rev Soc Bras Med Trop. 1994; 27 (Supll. 3): 91-108.
127

54. Medeiros Z, Menezes JA, Cesse EP, Lessa F. Controle da filariose linftica no
Brasil, 1951 2000. Epidemiol Serv Sade. 2003; 12 (2): 77-86.

55. Mendoza F, Ibaes-Bernal S, Cabrero-Saudo FJ. A standardized sampling


method to stimate mosquito richness and abundance for research and public
health surveillance programmes. Bull Entomol Research. 2008; 98: 323-332.

56. Moore CG, McLean RG, Mitchell CJ, Nasci RS, Tsai TF, Calisher CH, et al.
Guidelines for arbovirus surveillance programs in the united states. Colorado:
CDC; 1993.

57. Nascimento TFS do, Loureno-de-Oliveira R. Anopheles halophylus, a New


Species of the Subgenus Nyssorhynchus (Diptera: Culicidae) from Brazil. Mem
Inst Oswaldo Cruz. 2002; 97 (6): 801-811.

58. Natal D, Ueno HM. Vrus do Nilo Ocidental: caractersticas da transmisso e


implicaes vetoras. Entomol Vect. 2004; 11 (3): 417-433.

59. Netto AS. Mosquitos do Rio Grande do Sul. Porto Alegre; 1940. [Tese para
docente da cadeira de parasitologia da faculdade de medicina de Porto Alegre].

60. Nobre A, Artezana D, Tauil PL. Febre amarela e dengue no Brasil: epidemiologia
e controle. Rev Soc Bras Med Trop. 1994; 27 (Supll. 3): 59-66.

61. OPS (Organizao Panamericana de La Salud). Informe de la situacin de los


programas de malaria en las amricas. In: 26 Conferncia Sanitria
Panamericana, Washington, DC; 2002. p. 1-39.

62. Papavero N, Guimares JH. The taxonomy of brasilian insects vectors of


transmissible diseases (1900 - 2000) - then and now. Mem Inst Oswaldo Cruz.
2000; 95 suppl 1: 109-118.
128

63. Peru. Ministerio de Salud. Direccion General de la Salud Ambiental (DIGESA).


Manual de campo para la vigilancia entomolgica. Lima: DIGESA; 2002.

64. Peryass AG. Os culicideos do Brazil. Rio de Janeiro: Typographia Leuzinger;


1908.

65. Peryass AG. Os anophelinos do Brazil. Arch Mus Nac. 1921; 23: 5-101.

66. Pessoa SB, Martins AV. Parasitologia Mdica. Rio de Janeiro: Guanabara
Koogan; 1988.

67. Petersen LR, Roehrig JT. West Nile Virus: a reemerging global pathogen. Rev
Biomdica (Yucatan). 2001; 12 (3): 208-216.

68. Pinto C. Alguns mosquitos do Brasil e do oriente da Bolvia (Diptera. Culicidae).


Rev Med Cir do Brasil. 1932; (10): 285-309.

69. Pinto C, Netto AS, Marques H. Mosquitos do Rio Grande do Sul. Arq Dep
Estadual de Sade. 1940; 1: 14-51.

70. Primio R di. O impaludismo autctone do Rio Grande do Sul. Arq Riograndenses
de Medicina. 1931; 4: 1-6.

71. Primio R di. Alguns culicdeos do Rio Grande do Sul. consideraes nosolgicas
a respeito. Arq Riograndenses de Medicina. 1935; 4 (14): 127-64.

72. Primio R di. Em torno de alguns transmissores de doenas no Rio Grande do Sul.
Arq Riograndenses de Medicina. 1937; 7: 305-14.
129

73. Reinert JF. Restoration of Verrallina to generic rank in tribe Aedini (Diptera:
Culicidae) and descriptions of the genus and three included subgenera. Contrib
Am Entomol Inst. 1999; 31 (3):1-83.

74. Reinert JF. New classification for the composite genus Aedes (Diptera: Culicidae:
Aedini), elevation of subgenus Ochlerotatus to generic rank, reclassification of
the other subgenera, and notes on certain subgenera and species. J Am Mosq
Control Assoc. 2000a; 16 (3):175-188.

75. Reinert JF. Restoration of Ayurakitia to generic rank in tribe Aedini and a revised
definition of the genus. Contrib Am Entomol Inst. 2000b; 16:57-65.

76. Rio Grande do Sul. Secretaria da Sade. Centro Estadual de Vigilncia em


Sade. Programa Estadual de Controle do Simuldeo Norma Tcnica e
Operacional. Porto Alegre; 2002.

77. Rio Grande do Sul. Secretaria da Sade. Centro Estadual de Vigilncia em


Sade. Projeto de Vigilncia em Febre Amarela. Porto Alegre; 2003.

78. Rio Grande do Sul. Decreto lei n 44.050, de 05 de outubro de 2005. Aprova o
regimento interno da Secretaria da Sade. Dirio Oficial do Estado, Porto Alegre,
06 de out 2005a. p. 10.

79. Rio Grande do Sul. Secretaria da Sade. Centro Estadual de Vigilncia em


Sade. Projeto de Vigilncia Ambiental em Leishmaniose Tegumentar
Americana. Porto Alegre; 2005b.

80. Rio Grande do Sul. Plano de contingncia para dengue do estado do Rio Grande
do Sul. Porto Alegre: Secretaria Estadual da Sade; 2009a [acesso em 05 nov
2009]. Disponvel em: http://www.saude.rs.gov.br/dados/124387596709112296
20783462Plano%20Estadual%20de%20Contigencia%20para%20Dengue%2020
08%20final. pdf
130

81. Rio Grande do Sul. Plano de ao para a Emergncia de Sade Pblica de


Importncia Nacional (ESPIN) de febre amarela no Rio Grande do Sul,
2008/2009. Porto Alegre: Secretaria Estadual da Sade; 2009b [acesso em 12 nov
2009]. Disponvel em http://www.saude.rs.gov.br/dados/124050732680012347
86948781Plano_Febre_Amarela_06_FEV_09.pdf

82. Rocha EMM, Fontes G. Filariose bancroftiana no Brasil. Rev Sade Pblica.
1998; 32 (1): 98-105.

83. Rosen G. Uma histria da sade pblica. So Paulo: Hucitec, UNESP; Rio de
Janeiro: ABRASCO; 1994. A era bacteriolgica e suas conseqncias (1875-
1950); 219-252.

84. Ruas-Neto AL, Silveira SM. Uso de inseticidas bacterianas para o controle de
culicdeos e simuldeos no Rio Grande do Sul. Mem Inst Oswaldo Cruz. 1989; 84
(Supl. 3): 39-45.

85. Ruas-Neto AL, Silveira SM, Colares ER da C. Mosquito control based on


larvicides in the state of Rio Grande do Sul, Brazil: choice of the control agent.
Cad Sade Pblica. 1994; 10 (2):222-30.

86. Sallum MAM, Schultz TR, Wilkerson RC. Phylogeny of Anophelinae (Diptera
Culicidae) based on morphological characters. Ann Entomol Soc Am. 2000;
93(4):745-775.

87. Santos E dos, Almeida MAB, Souza GD, Rangel S, Lammerhirt CB, Cruz LL et
al. Situao da Leishmaniose Tegumentar Americana no Rio Grande do Sul. Bol
Epidemiol (Porto Alegre). 2005; 7 (2):1-3.

88. Santos R La C. Atualizao da distribuio de Aedes albopictus no Brasil (1997-


2002). Rev Sade Pblica. 2003; 37(5): 671-673.
131

89. Silva MAN da, Lozovei AL. Criadouros de imaturos de mosquitos (Diptera,
Culicidae) introduzidos em mata preservada na rea urbana de Curitiba, Paran,
Brasil. Rev Bras Zool. 1996; 13(4):1023-1042.

90. Teodoro U, Guilherme ALF, Lozovei AL, La Salvia Filho V, Sampaio AA,
Spinosa RP et al. Mosquitos de ambientes peri e extradomiciliares na regio sul
do Brasil. Rev Sade Pblica. 1994; 28(2):107-115.

91. Torres MAN, Mardini LBF, Gomes CS, Fonseca D, Bedin C, Sperb AF.
Descentralizao dos programas de controle de FA Dengue e doena de Chagas
no Rio Grande do Sul. In: Anais do XXXVII Congresso da Sociedade Brasileira
de Medicina Tropical. 2001 mar 11-15; Bahia, Brasil. Minas Gerais: Rev Soc
Bras Med Trop; 2001 34 suppl 1: 124.

92. Torres MAN, Santos E dos, Almeida MAB de, Cruz LL, Sperb AF. Vigilncia da
Febre Amarela Silvestre no Rio Grande do Sul. Bol Epidemiol (Porto Alegre).
2003; 5 (4):1-7.

93. Torres MAN, Almeida MAB de, Santos E dos, Monteiro HAO, Cardoso J da C,
Costa IA da, Ferreira FB. Vigilncia Entomolgica da Febre Amarela Silvestre
no Rio Grande do Sul. Bol Epidemiol (Porto Alegre). 2004; 6 (1):6.

94. Vasconcelos PFC, Travassos da Rosa APA, Pinheiro FP, Shope RE, Travassos da
Rosa JFS, Rodrigues SG, et al. Arboviruses pathogenic for man in Brazil. In:
Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS. An
Overview of Arbovirology in Brazil and Neighbouring Countries. Belm:
Instituto Evandro Chagas; 1998. p.72-99.

95. Vasconcelos PFC, Sperb AF, Monteiro HAO, Torres MAN, Sousa MRS,
Vasconcelos HB et al. Isolations of yellow fever virus from Haemagogus
132

leucocelaenus in Rio Grande do Sul State, Brazil. Trans R Soc Trop Med Hyg.
2003; 97:60-62.

96. Vasconcelos PFC. Febre amarela. Rev Soc Bras Med Trop. 2003; 36: 275-293.

97. Vianna EES, Costa PRP, Ribeiro PB. Oviposio e longevidade de adultos do
Culex quinquefasciatus Say, 1823 (Diptera: Culicidae) em condies ambientais,
em Pelotas, RS. Rev Bras Parasitol Vet. 1996a; 5 (1):47-52.

98. Vianna EES, Costa PRP, Ribeiro PB. Longevidade e viabilidade do ciclo
aqutico do Culex quinquefasciatus Say, 1823 (Diptera: Culicidae) em condies
ambientais, em Pelotas, RS. Rev Bras Parasitol Vet. 1996b; 5 (1):53-56.

99. (WRBU) Walter Reed Biosystematics Unit. Systematic Catalog of Culicidae.


[Acesso em 04 fev 2010]. Disponvel em http://www.mosquitocatalog.org/
default.aspx

100. Zhong H, Yan Z, Jones F, Brock C. Ecological analysis of mosquito light trap
collections from West Central Florida. Environ Entomol. 2003; 32 (4):807-815.
133

ANEXO A - TCNICAS DE COLETA

Armadilha CDC

Aspirador de Nasci

Rede entomolgica ou pu

Aspirador manual tipo frasco


134

ANEXO B LOCALIZAO DAS REAS DE COLETA


135

ANEXO C AMBIENTES DE COLETA

Maquin - mata Maquin - transio

Maquin - urbano Caibat

Coronel Barros Mostardas


136

ANEXO D - REVISTA BRASILEIRA DE ENTOMOLOGIA

Forma e preparao de manuscritos

Os manuscritos devem ser enviados online pelo endereo


http://submission.scielo.br/index.php/rbent/login. O texto deve ser editado, de preferncia,
em Microsoft Word, em pgina formato A4, usando fonte Times New Roman tamanho 12,
espao duplo entre as linhas, com margem direita no justificada e com pginas numeradas.
Usar a fonte Times New Roman tambm para rotulagem das figuras e dos grficos. Apenas
tabelas e grficos podem ser incorporados no arquivo contendo o texto do manuscrito.

O manuscrito deve comear com uma pgina de rosto, contendo: ttulo do trabalho e nome(s)
do(s) autor(es) seguido(s) de nmero(s) (sobrescrito) com endereo(s) completo(s), inclusive
endereo eletrnico, e com respectivos algarismos arbicos para remisso. No utilizar
palavras escritas totalmente em maisculas, exceto nas indicaes a seguir. Em seguida,
apresentar ABSTRACT, com no mximo 250 palavras, com o ttulo do trabalho em ingls e
em pargrafo nico; KEYWORDS, em ingls, em ordem alfabtica e no mximo cinco. Na
seqncia vir o RESUMO em portugus, incluindo o ttulo e PALAVRAS-CHAVE, em
ordem alfabtica e equivalentes s KEYWORDS. Devem ser evitadas palavras-chave que
constem do ttulo e do resumo do artigo.

No corpo do texto, os nomes do grupo-gnero e do grupo-espcie devem ser escritos em


itlico. Os nomes cientficos devem ser seguidos de autor e data, pelo menos na primeira
vez. No usar sinais de marcao, de nfase, ou quaisquer outros. Conforme o caso
(manuscritos de outra rea, que no sejam de Sistemtica, Morfologia e Biogeografia), a
Comisso Editorial decidir como proceder.

As referncias devem ser citadas da seguinte forma: Canhedo (2004); (Canhedo 2003, 2004);
(Canhedo 2004; Martins & Galileo 2004); Parra et al. (2004).

As figuras (fotografias, desenhos, grficos e mapas) devem ser sempre numeradas com
algarismos arbicos e, na medida do possvel, na ordem de chamada no texto. As escalas
devem ser colocadas na posio vertical ou horizontal. As tabelas devem ser numeradas com
algarismos romanos e includas, no final do texto em pginas separadas. Se necessrio,
grficos podem ser includos no arquivo do texto e, como as tabelas, devero vir no final do
texto. As figuras devem ser enviadas em arquivos suplementares, com, no mnimo, 300 dpi
de resoluo para fotos coloridas e 600 dpi para desenhos a trao e fotos branco e preto, em
formato tiff ou jpeg de baixa compactao, sendo que os manuscritos que no atendam s
configuraes indicadas acima sero devolvidos. O tamanho da prancha deve ser
proporcional ao espelho da pgina (23 x 17,5 cm), de preferncia no superior a duas vezes.
Para a numerao das figuras utilizar Times New Roman 11, com o nmero colocado
direita e abaixo. Isto s deve ser aplicado para as pranchas quando em seu tamanho final de
publicao. A fonte Times New Roman deve ser usada tambm para rotulagem inserida em
fotos, desenhos e mapas (letras ou nmeros utilizados para indicar nomes das estruturas,
abreviaturas etc.) e em tamanho apropriado de modo que em seu tamanho final no fique
mais destacada que as figuras propriamente ditas. Fotografias (preto e branco ou coloridas) e
desenhos a trao devem ser montados em pranchas distintas. A Comisso Editorial poder
fazer alteraes ou solicitar aos autores uma nova montagem, bem como o envio de novos
arquivos de figuras. As legendas das figuras devem ser apresentadas no arquivo de texto. O
custo da publicao de pranchas coloridas dever ser arcado pelos autores.
137

Os AGRADECIMENTOS devem ser relacionados no final do trabalho, imediatamente antes


das Referncias. Sugere-se aos autores que sejam sucintos e objetivos. Para as
REFERNCIAS, adota-se o seguinte:

1. Peridicos (os ttulos dos peridicos devem ser escritos por extenso e em negrito, assim
como o volume do peridico):

Zanol, K. M. R. 1999. Reviso do gnero Bahita Oman, 1936 (Homoptera, Cicadellidae,


Deltocephalinae). Biocincias 7: 73145.

Martins, U. R. & M. H. M. Galileo. 2004. Contribuio ao conhecimento dos Hemilophini


(Coleoptera, Cerambycidae, Lamiinae), principalmente da Costa Rica. Revista Brasileira de
Entomologia 48: 467472.

Alves-dos-Santos, I. 2004. Biologia da nidificao de Anthodioctes megachiloides Holmberg


(Anthidiini, Megachilidae, Apoidea). Revista Brasileira de Zoologia 21: 739744.

2. Livros:

Michener, C. D. 2000. The Bees of the World. Baltimore, Johns Hopkins University Press,
xiv+913 p.

3. Captulo de livro:

Ball, G. E. 1985. Reconstructed phylogeny and geographical history of genera of the tribe
Galeritini (Coleoptera: Carabidae), p. 276321. In: G. E. Ball (ed.). Taxonomy, Phylogeny
and Zoogeography of Beetles and Ants. Dordrecht, W. Junk Publishers, xiii+514 p.

Referncias a resumos de eventos no so permitidas e deve-se evitar a citao de


dissertaes e teses.

Nas Comunicaes Cientficas o texto deve ser corrido sem diviso em itens (Material e
Mtodos, Resultados e Discusso). Inclua o Abstract e o Resumo seguidos das Keywords e
Palavras-Chave.

Provas sero enviadas eletronicamente ao autor responsvel e devero ser devolvidas, com as
devidas correes, no tempo solicitado.

O teor cientfico do trabalho assim como a observncia s normas gramaticais so de inteira


responsabilidade do(s) autor(es). Para cada trabalho publicado sero fornecidas 10 (dez)
separatas, independente do nmero de autores.

Sugere-se aos autores que consultem a ltima edio da revista para verificar o estilo e lay-
out. Ao submeter o manuscrito o autor poder sugerir at trs nomes de revisores para
analisar o trabalho, enviando: nome completo, endereo e e-mail. Entretanto, a escolha final
dos consultores permanecer com os Editores.
138

ANEXO E - REVISTA DA SOCIEDADE BRASILEIRA DE MEDICINA TROPICAL

Preparao do manuscrito

Todo manuscrito deve ser submetido atravs do sistema online nos endereos
http://submission.scielo.br/index.php/rsbmt/login ou http://www.scielo.br/rsbmt. A carta de
apresentao deve conter uma declarao assegurando que o material no foi publicado ou
est sob considerao por outro peridico cientfico. O autor deve escolher dentro do item
Diretriz para Submisso (item 3.7) uma categoria para o manuscrito (Artigos Originais,
Editoriais, Artigos de Reviso, Comunicaes Breves, Relatos de Casos, Relatrios
Tcnicos, Imagens em Doenas Infecciosas, Obiturios e Cartas ao Editor, ou outros quando
no se encaixar em nenhuma das categorias listadas). A responsabilidade pelo contedo do
manuscrito inteiramente do autor e seus co-autores.

Layout de Artigo Original

O manuscrito deve ser preparado usando software padro de processamento de textos e deve
ser impresso (fonte times new Roman tamanho 12) com espao duplo em todo o texto,
legendas para as figuras e referncias, margens com pelos menos 3cm. O limite de palavras
de 6.000 com at 5 inseres (figuras e tabelas). O manuscrito deve ser dividido nas
seguintes sees: Carta de envio, endereada ao editor chefe, resumo estruturado, palavras-
chaves, introduo, mtodos, resultados, discusso, concluses, agradecimentos e
referncias. Abreviaes devem ser usadas com moderao.

Pgina de Ttulo: deve incluir o nome dos autores na ordem direta e sem abreviaes,
graduaes mais elevadas possudas, afiliaes em instituies com endereo acadmico do
autor correspondente e todos os co-autores e apoio financeiro.

Ttulo: deve ser conciso, claro e o mais informativo possvel, no deve conter abreviaes e
no deve exceder a 200 caracteres, incluindo espaos.

Ttulo Corrente: com no mximo 70 caracteres.

Resumo Estruturado: deve condensar os resultados obtidos e as principais concluses de


tal forma que um leitor, no familiarizado com o assunto tratado no texto, consiga entender
as implicaes do artigo. O resumo no deve exceder 250 palavras (100 palavras no caso de
comunicaes breves) e abreviaes devem ser evitadas. Deve ser subdivido em: Introduo,
Mtodos, Resultados e Concluses.

Palavras-chaves: 3 a 6 itens devem ser listados imediatamente abaixo do resumo


estruturado.

Introduo: deve ser curta e destacar os propsitos para o qual o estudo foi realizado.
Apenas quando necessrio citar estudos anteriores de relevncia.

Mtodos: devem ser suficientemente detalhados para que os leitores e revisores possam
compreender precisamente o que foi feito e permitir que seja repetido por outros. Tcnicas-
padres precisam apenas ser citadas.

tica: em caso de experimentos em seres humanos, indicar se os procedimentos realizados


esto em acordo com os padres ticos do comit de experimentao humana responsvel
(institucional, regional ou nacional) e com a Declarao de Helsinki de 1964, revisada em
1975, 1983, 1989, 1996 e 2000. Quando do relato de experimentos em animais, indicar se
139

seguiu um guia do conselho nacional de pesquisa, ou qualquer lei sobre o cuidado e uso de
animais em laboratrio foram seguidas.

Resultados: devem ser um relato conciso e impessoal da nova informao. Evitar repetir no
texto os dados apresentados em tabelas e ilustraes.

Discusso: deve relacionar-se diretamente com o estudo que est sendo relatado. No incluir
uma reviso geral sobre o assunto, evitando que se torne excessivamente longa.

Agradecimentos: devem ser curtos, concisos e restritos aqueles realmente necessrios, e, no


caso de rgos de fomento no usar siglas.

Conflito de Interesse: todos os autores devem revelar qualquer tipo de conflito de interesse
existente durante o desenvolvimento do estudo.

Referncias: devem ser numeradas consecutivamente, na medida em que aparecem no texto.


Listar todos os autores quando houver at seis. Para sete ou mais, listar os seis primeiros,
seguido por et al. Digitar a lista de referncias com espaamento duplo em folha separada.
Referncias de comunicaes pessoais, dados no publicados ou manuscritos em
preparao ou submetidos para publicao no devem constar da lista de referncia. Se
essenciais, podem ser incorporados em local apropriado no texto, entre parnteses da
seguinte forma: (AB Figueiredo: Comunicao Pessoal, 1980); (CD Dias, EF Oliveira: dados
no publicados). Citaes no texto devem ser feitas pelo respectivo nmero das referncias,
acima da palavra correspondente, separado por vrgula (Ex.: Mundo.1,2,3; Vida.30,42,44-50). As
referncias no fim do manuscrito devem estar de acordo com o sistema de requisitos
uniformes utilizado para manuscritos enviados para peridicos biomdicos (Consulte:
http://www.nlm.nih.gov/citingmedicine). Os ttulos dos peridicos devem ser abreviados de
acordo com o estilo usado no Index Medicus (Consulte:
http://ncbi.nlm.nih.gov/sites/entrez?db=journals&TabCmd=limits).

Alguns exemplos de referncias:

1. Russell FD, Coppell AL, Davenport AP. In vitro enzymatic processing of radiolabelled
big ET-1 in human kidney as a food ingredient. Biochem Pharmacol 1998;55:697-701.

2. Porter RJ, Meldrum BS. Antiepileptic drugs. In: Katzung BG, editor. Basic and clinical
pharmacology. 6th ed. Norwalk (CN): Appeleton and Lange; 1995. p. 361-80.

3. Blenkinsopp A, Paxton P. Symptoms in the pharmacy: a guide to the management of


common illness. 3rd ed. Oxford: Blackwell Science; 1998.

Figuras: devem preferencialmente ser submetidas em alta resoluo no formato TIFF. As


figuras devem ser colocadas em arquivos separados, nomeados apenas com o nmero das
figuras (ex.: Figura 1; Figura 2). Certifique-se que as mesmas tm uma resoluo mnima de
300dpi.

Fotografias: devem ser enviadas com boa resoluo (mnimo de 300dpi) no formato
TIFF, preferencialmente, preparadas utilizando o Adobe Photoshop.

Grficos: criados usando Microsoft Word ou Excel, devem ser salvos com a extenso
original (.doc ou .xls). Eles no devem ser copiados ou colados de um programa para o
outro.
140

Mapas e Ilustraes: devem ser vetorizadas (desenhados) profissionalmente utilizando os


softwares CorelDraw ou Illustrator em alta resoluo, e suas dimenses no devem ter mais
que 21,5 x 28,0cm.

Imagens: produzidas em software estatstico devem ser convertidas para o formato Excel
ou PowerPoint. Caso no seja possvel, converter o arquivo para o formato TIFF com
resoluo de 300dpi, e enviar juntamente com o arquivo no formato original.

Legendas: nas figuras, as legendas devem ser digitadas juntas com espaamento duplo em
uma folha separada.

Ilustraes Coloridas: devem ser aprovadas pelos editores e as despesas extras para
confeco de fotolitos coloridos sero de responsabilidade dos autores.

Tabelas: devem ser digitadas com espaamento duplo, com um ttulo curto e descritivo e
submetido online em um arquivo separado. Legendas para cada tabela devem aparecer no
rodap da mesma pgina que a tabela. Todas as tabelas devem ter numerao arbica, citadas
no texto, consecutivamente. Tabelas no devem ter linhas verticais, e linhas horizontais
devem ser limitadas ao mnimo, com notas de rodap logo abaixo. Tabelas devem ter no
mximo 17cm de largura.

Processo de Envio: a partir de 21 de Outubro de 2009, os artigos submetidos Revista da


Sociedade Brasileira de Medicina Tropical devero utilizar apenas a via eletrnica. Todos os
manuscritos devero ser enviados via internet para
http://submission.scielo.br/index.php/rsbmt/login, seguindo as instrues no topo de cada
tela. A partir desta data o processo de reviso pelos pares tambm ser totalmente pela via
eletrnica.

Sobre Re-envio e revises: a revista diferencia entre: a) manuscritos que foram rejeitados e
b) manuscritos que sero re-avaliados aps a realizao das correes que foram solicitadas
aos autores.

Re-envio: caso o autor receba uma carta informando que seu trabalho foi rejeitado e queira
que os editores reconsiderem tal deciso, o autor poder re-envi-lo. Neste caso ser gerado
um novo nmero para o manuscrito.

Reviso: caso seja necessrio refazer seu manuscrito com base nas recomendaes e
sugestes dos revisores, ao devolv-lo, para uma segunda anlise, por favor, encaminhe o
manuscrito revisado e informe o mesmo nmero do manuscrito.
141

ANEXO F EMERGING INFECTIOUS DISEASES


142

ANEXO G - NEOTROPICAL ENTOMOLOGY

Forma e preparao do manuscrito

O artigo (texto e tabelas) deve ser submetido em formato doc. Configure o papel
para tamanho A4, com margens de 2,5 cm e linhas e pginas numeradas sequencialmente ao
longo de todo o documento. Utilize fonte Times New Roman tamanho 12 e espaamento
duplo.

Pgina de rosto. No canto superior direito, escreva o nome completo e o endereo (postal e
eletrnico) do autor responsvel pelo artigo. O ttulo do artigo deve aparecer no centro da
pgina, com iniciais maisculas (exceto preposies, conjunes e artigos). Nomes
cientficos no ttulo devem ser seguidos pelo nome do classificador (sem o ano) e pela ordem
e famlia entre parnteses. Abaixo do ttulo e tambm centralizado, liste os nomes dos
autores usando apenas o primeiro nome e o sobrenome de cada autor por extenso, em
maisculas pequenas (versalete). A seguir, liste as instituies dos autores, com endereo
postal e endereo eletrnico, com chamada numrica se houver mais de um endereo.

Pgina 2. Abstract. Escreva ABSTRACT, seguido de hfen, continuando com o texto em


pargrafo nico e, no mximo, 250 palavras. Pule uma linha e mencione o termo KEY
WORDS em maisculas. Use de trs a cinco termos separados por vrgulas e diferentes das
palavras que aparecem no ttulo do trabalho.

Elementos Textuais

Introduo. No deve apresentar o subttulo "Introduction". Deve contextualizar claramente


o problema investigado e trazer a hiptese cientfica que est sendo testada, bem como os
objetivos do trabalho.

Material and Methods devem conter informaes suficientes para que o trabalho possa ser
repetido. Inclua o delineamento estatstico e, se aplicvel, o nome do programa utilizado para
as anlises.

Results and Discussion podem aparecer agrupados ou em sees separadas. Em Resultados,


os valores das mdias devem ser acompanhados de erro padro da mdia e do nmero de
observaes, usando para as mdias uma casa decimal e, para o erro padro, duas casas. As
concluses devem estar contidas no texto final da discusso.

Acknowledgments. O texto deve ser breve, iniciando pelos agradecimentos a pessoas e


depois a instituies apoiadoras e agncias de fomento.

References. Sob esse ttulo, disponha as referncias bibliogrficas em ordem alfabtica, uma
por pargrafo, sem espaos entre estes. Cite os autores pelo sobrenome (apenas a inicial
maiscula) seguido das iniciais do nome e sobrenome sem pontos. Separe os nomes dos
autores com vrgulas. Em seguida inclua o ano da referncia entre parnteses. Abrevie os
ttulos das fontes bibliogrficas, sempre iniciando com letras maisculas, sem pontos. Utilize
as abreviaturas de peridicos de acordo com BIOSIS Serial Sources
(www.library.uiuc.edu/biotech/jabbrev.html#abbrev ou
http://www.library.uq.edu.au/faqs/endnote/biosciences.txt). Os ttulos nacionais devero ser
abreviados conforme indicado no respectivo peridico. Evite citar dissertaes, teses,
revistas de divulgao. No cite documentos de circulao restrita (boletins internos,
relatrios de pesquisa, etc), monografias, pesquisa em andamento e resumos de encontros
cientficos. Exemplos:
143

Suzuki K M, Almeida S A, Sodr L M K, Pascual A N T, Sofia S H (2006) Genetic


similarity among male bees of Euglossa truncata Rebelo & Moure (Hymenoptera: Apidae).
Neotrop Entomol 35: 477-482.

Malavasi A, Zucchi R A (2000) Moscas-das-frutas de importncia econmica no Brasil:


conhecimento bsico e aplicado. Ribeiro Preto, Holos Editora, 327p.

Oliveira-Filho A T, Ratter J T (2002) Vegetation physiognomies and woody flora of the


cerrado biome, p.91-120. In Oliveira P S, Marquis R J (eds) The cerrados of Brazil: ecology
and natural history of a Neotropical savanna. New York, Columbia University Press, 398p.

Tabelas. Devem ser inseridas no texto aps as Referncias. Coloque uma tabela por pgina,
numerada com algarismo arbico seguido de ponto final. As notas de rodap devem ter
chamada numrica. Na chamada de texto, use a palavra por extenso (ex.: Tabela 1). Exemplo
de ttulo:

Tabela 1 Mean ( SE) duration and survivorship of larvae and pupae of Cirrospilus
neotropicus reared on Phyllocnistis citrella larvae. Temp.: 25 1C, RH: 70% and
photophase: 14h.

Figuras. Aps as tabelas, coloque a lista de legendas das figuras. Use a abreviao "Fig no
ttulo e na chamada de texto (ex.: Fig 1)". As figuras devem estar no formato jpg, gif ou eps
e devem ser originais ou com alta resoluo e devem ser enviadas em arquivos individuais.
Grficos devem estar, preferencialmente, em Excell. Exemplo de ttulo:

Fig 1 Populacional distribution of Mahanarva fimbriolata in So Carlos, SP, 2002 to 2005.

Citaes no texto

Nomes cientficos. Escreva os nomes cientficos por extenso, seguidos do autor descritor,
para insetos e caros, quando mencionados pela primeira vez no Abstract e no corpo do
trabalho. Ex.: Spodoptera frugiperda (J. E. Smith). No restante do trabalho use o nome
genrico abreviado (Ex.: S. frugiperda), exceto nas legendas das figuras e cabealhos das
tabelas onde deve ser grafado por extenso.
Fontes de consulta. As referncias no texto devem ser mencionadas com o sobrenome do
autor, com inicial maiscula, seguido pelo ano da publicao (ex.: Martins 1998). No caso de
mais de uma publicao, ordene-as pelo ano de publicao, separando-as com vrgulas (ex.:
Martins 1998, Garcia 2003, 2005, Wilson 2008). Para dois autores, use o smbolo "&" (ex.:
Martins & Gomes 2004). Para mais de dois autores, utilize "et al" (em itlico) (ex.: Avila et
al 2009).
Notas Cientficas
Registros de ocorrncia e de interaes trficas ou novos mtodos para estudo de insetos ou
caros podem ser submetidos como nota cientfica. As instrues so as mesmas dos artigos
completos. Entretanto, a Introduo, Material e Mtodos e Resultados e Discusso devem ser
escritos em texto corrido, sem subttulos. Os resumos (em ingls e portugus/espanhol)
devem ter at 100 palavras cada e o texto, no mximo 1.000 palavras. Quando estritamente
necessrio, podem ser includas figuras ou tabelas, observando-se o limite de duas figuras ou
tabelas por trabalho.
A publicao de registro de nova praga introduzida no Brasil precisa estar de acordo com a
Portaria Interministerial 290, de 15/abril/1996, disponvel em
http://extranet.agricultura.gov.br/sislegis-
consulta/consultarLegislacao.do?operacao=visualizar&id=883.
144

ANEXO H GUIA DE BOLSO


145

ANEXO I CURRCULO LATTES DO AUTOR E ORIENTADORA

Currculo completo
http://lattes.cnpq.br/8824558155118470

Currculo completo
http://lattes.cnpq.br/1200247772482237