ctcgaggggcctagacattgccctccagagagagcacccaacaccctccaggcttgaccggccagggtgtccccttcctaccttggagagagcagccccagggcatcctgcagggggtgctgggacaccagctggccttcaaggtctctgcctccctccagccaccc

cactacacgctgctgggatcctggatctcagctccctggccgacaacactggcaaactcctactcatccacgaaggccctcctgggcatggtggtccttcccagcctggcagtctgttcctcacacaccttgttagtgcccagcccctgaggttgcagctgggggtg
tctctgaagggctgtgagcccccaggaagccctggggaagtgcctgccttgcctccccccggccctgccagcgcctggctctgccctcctacctgggctccccccatccagcctccctccctacacactcctctcaaggaggcacccatgtcctctccagctgccgg
gcctcagagcactgtggcgtcctggggcagccaccgcatgtcctgctgtggcatggctcagggtggaaagggcggaagggaggggtcctgcagatagctggtgcccactaccaaacccgctcggggcaggagagccaaaggctgggtgtgtgcagagcggccccgag
aggttccgaggctgaggccagggtgggacatagggatgcgaggggccggggcacaggatactccaacctgcctgcccccatggtctcatcctcctgcttctgggacctcctgatcctgcccctggtgctaagaggcaggtaaggggctgcaggcagcagggctcgga
gcccatgccccctcaccatgggtcaggctggacctccaggtgcctgttctggggagctgggagggccggaggggtgtaccccaggggctcagcccagatgacactatgggggtgatggtgtcatgggacctggccaggagaggggagatgggctcccagaagaggag
tgggggctgagagggtgcctggggggccaggacggagctgggccagtgcacagcttcccacacctgcccacccccagagtcctgccgccacccccagatcacacggaagatgaggtccgagtggcctgctgaggacttgctgcttgtccccaggtccccaggtcatg
ccctccttctgccaccctggggagctgagggcctcagctggggctgctgtcctaaggcagggtgggaactaggcagccagcagggaggggacccctccctcactcccactctcccacccccaccaccttggcccatccatggcggcatcttgggccatccgggactg
gggacaggggtcctggggacaggggtccggggacagggtcctggggacaggggtgtggggacaggggtctggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtgtggggacaggggtccggggacaggggtgtggggacaggggtc
tggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtgtggggacaggggtcctggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtcctggggataggggtgtggggacaggg
gtgtggggacaggggtcccggggacaggggtgtggggacaggggtgtggggacaggggtcctggggacaggggtctgaggacaggggtgtgggcacaggggtcctggggacaggggtcctggggacaggggtcctggggacaggggtctggggacagcagcgcaaag
agccccgccctgcagcctccagctctcctggtctaatgtggaaagtggcccaggtgagggctttgctctcctggagacatttgcccccagctgtgagcagggacaggtctggccaccgggcccctggttaagactctaatgacccgctggtcctgaggaagaggtgc
tgacgaccaaggagatcttcccacagacccagcaccagggaaatggtccggaaattgcagcctcagcccccagccatctgccgacccccccaccccgccctaatgggccaggcggcaggggttgacaggtaggggagatgggctctgagactataaagccagcgggg
gcccagcagccctcagccctccaggacaggctgcatcagaagaggccatcaagcaggtctgttccaagggcctttgcgtcaggtgggctcagggttccagggtggctggaccccaggccccagctctgcagcagggaggacgtggctgggctcgtgaagcatgtggg
ggtgagcccaggggccccaaggcagggcacctggccttcagcctgcctcagccctgcctgtctcccagatcactgtccttctgccatggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggggacctgacccagccgcagcctttgtgaacc
aacacctgtgcggctcacacctggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacacccaagacccgccgggaggcagaggacctgcagggtgagccaaccgcccattgctgcccctggccgcccccagccaccccctgctcctggcgctcc
cacccagcatgggcagaagggggcaggaggctgccacccagcagggggtcaggtgcacttttttaaaaagaagttctcttggtcacgtcctaaaagtgaccagctccctgtggcccagtcagaatctcagcctgaggacggtgttggcttcggcagccccgagatac
atcagagggtgggcacgctcctccctccactcgcccctcaaacaaatgccccgcagcccatttctccaccctcatttgatgaccgcagattcaagtgttttgttaagtaaagtcctgggtgacctggggtcacagggtgccccacgctgcctgcctctgggcgaaca
ccccatcacgcccggaggagggcgtggctgcctgcctgagtgggccagacccctgtcgccagcctcacggcagctccatagtcaggagatggggaagatgctggggacaggccctggggagaagtactgggatcacctgttcaggctcccactgtgacgctgccccg
gggcgggggaaggaggtgggacatgtgggcgttggggcctgtaggtccacacccagtgtgggtgaccctccctctaacctgggtccagcccggctggagatgggtgggagtgcgacctagggctggcgggcaggcgggcactgtgtctccctgactgtgtcctcctg
tgtccctctgcctcgccgctgttccggaacctgctctgcgcggcacgtcctggcagtggggcaggtggagctgggcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccctgcagaagcgtggcattgtggaacaatgctgtaccagcatct
gctccctctaccagctggagaactactgcaactagacgcagcctgcaggcagccccacacccgccgcctcctgcaccgagagagatggaataaagcccttgaaccagccctgctgtgccgtctgtgtgtcttgggggccctgggccaagccccacttcccggcactg
ttgtgagcccctcccagctctctccacgctctctgggtgcccacaggtgccaacgccggccaggcccagcatgcagtggctctccccaaagcggccatgcctgttggctgcctgctgcccccaccctgtggctcagggtccagtatgggagcttcgggggtctctga
ggggccagggatggtggggccactgagaagtgacttcttgttcagtagctctggactcttggagtccccagagaccttgttcaggaaagggaatgagaacattccagcaattttccccccacctagccctcccaggttctatttttagagttatttctgatggagtc
cctgtggagggaggaggctgggctgagggagggggt[gap 100 bp] Expand Ns
ctcgagggaggagcccggggctggggtacggaggcctctgcacatcttagagtaaaacaagcaggagaggctgggtgcggtggctcatgcctataatcccagcactttaggaggctgaggcgggcagatcacctgaggtcgggagttcaagaccagcctgaccaaca
gggagaaaccccatctttactaaaactacaaaattagctgggtgtggtggcacatgcctgtaatcccagatattcgggaggctgaggcaggagaatcgcttgaacctgggaagcagaggttgcgctgagccgagatggcaccattgcactccagcctgggcaacgag
agcgaaactccgtctcaaaaaaacaaaaacaaaaaaatcaaaacaatcaaaaaaacaagcaggaggggctctgaggtgcctgcaacacccaggtacaatccgtggccctgaggcccatcacagggaaggggtctttgcagctctttcaacccccagcccagcatcca
aggaagcccagggcagggagaaacctcagctgcaccatcagagctcagaacagagaaggcagaaattagcagggagtggggctggggaggcttcctagaagacgtgtctcccgccttgctggcactgaggccttgaggatgggtccatactgggcccccactgccag
ggatgcagatccggcccactgctgaaatctgtgctcctggagcctccctcctgttcatgggccacaggctgtgaaaaccccagagtcctcccaggcagcaagttttgttttgttttttgtttgtttgcttgtttgttttttgagagtctgctcgtca

Related Interests