DR.JOHNF.

ASHTON

EVOLUCION
IMPASIBLE

DOCE RAZONES POR LAS QUE LA EVOLUCIÓN NO PUEDE
EXPLICAR EL ORIGEN DE LA VIDA SOBRE L A TIERRA

EVOLUCION
IMPOSIBLE

VOLUCION
DOCE RAZONES POR LAS QUE LA EVOLUCIÓN NU I V i l >1
EXPLICAR EL ORIGEN DE LA VIDA SOBRE LA 7 ILRIA

DR. JOHN F. ASHTON

Adven tus
Editorial Universitaria Iberoamericana

Asociación
Casa Editora Av, San Martín 4555, B1604CDG Florida Oeste
Sudamericana Buenos Aires, República Argentina

Evolución imposible
12 razones por las que la Evolución no puede explicar el origen de la vida sobre
la Tierra
John F. Ashton

Título del original: Evolution Impossible: 12 Reasons Why Evolution Cannot
Explain The Origin o f Life on Earth. Publicado por New Leaf Publishing Group,
Inc., P. O. Box 726, Green Forest, Arkansas 76238, U.S.A., 2012.

Director: Gabriela S. Pepe
Traducción: Néstor Rivera
Diseño del interior y de la tapa: Romina Genski
Ilustración de la tapa: Shutterstock

Libro de edición argentina
IMPRESO EN LA ARGENTINA - Printed in Argentina

Primera edición
MMXV- 5M

Es propiedad. © 2012 John F. Ashton y New Leaf Publishing Group.
©2015 ACES. ©2015ADVENTUS. Primera edición en español con autorización
de los propietarios del copyright.
Queda hecho el depósito que marca la ley 11.723.

ISBN 978-987-701-443-3

Ashton, John F.
Evolución imposible : 12 razones por las que la Evolución no puede explicar el origen de la vida
sobre la Tierra / John F. Ashton / Dirigido por Gabriela S. Pepe. - 1a ed. - Florida : Asociación
Casa Editora Sudamericana, 2015.
228 p. ; 21 x 14 cm.

Traducción de: Néstor Rivera.

ISBN 978-987-701 -443-3

1. Ciencia. 2. Religión. I. Pepe, Gabriela S., dir. II. Rivera, Néstor, trad. III. Título.
CDD 261.55

Se terminó de imprimir el 10 de diciembre de 2015 en talleres propios (Av. San
Martín 4555, B1604CDG Florida Oeste, Buenos Aires).

Prohibida la reproducción total o parcial de esta publicación (texto, imágenes
y diseño), su manipulación informática y transmisión ya sea electrónica,
mecánica, por fotocopia u otros medios, sin permiso previo dei editor.

-10753 7-

13 CAPÍTULO 2 TEORÍA DE LA EVOLUCIÓN DE DARWIN ............. 9 CAPÍTUL01 LA EVOLUCIÓN ¿ES UN HECHO?................................................................................................................................................................... NO DE EVOLUCION.............. .................................93 CAPÍTULO 7 DILUVIO UNIVERSAL: EVIDENCIAS GEOLÓGICAS......70 CAPÍTULO 6 INTERMEDIARIOS EVOLUTIVOS AUSENTES EVIDENCIAS DE QUE LA EVOLUCION NUNCA TUVO LUGAR...........................................................................PRÓLOGO..........................................................................23 CAPÍTULO 3 CÉLULAS: CASUALIDAD IMPOSIBLE POR QUÉ UNA CELULA VIVA NO PUEDE APARECER POR CASUALIDAD......................109 ........................ SO CAPÍTULO 5 EL REGISTRO FÓSIL EVIDENCIA DE EXTINCION.................................................................35 CAPÍTULO 4 ¿MUTACIONES ALEATORIAS? POR QUÉ NO PUEDEN EVOLUCIONAR NUEVOS TIPOS DE ORGANISMOS POR MEDIO DE MUTACIONES ALEATORIAS.......................... 7 INTRODUCCIÓN.................

...... ’ A .. r m ...... \ o: Ai ............. ............CAPÍTULO 8 DILUVIO UNIVERSAL: EVIDENCIAS HISTÓRICAS CAPÍTULO 9 FALENCIAS DE LA DATACIÓN RADIOMÉTRICA ....... e............................ re .....-...................... o ■ va .v.........220 APÉNDICE 227 .................... o:o .......■■■......... T ■■■[-..■ : V.a .....t -' : .................173 CAPÍTUL012 CIENTÍFICOS NO EVOLUCIONISTAS CIENTÍFICOS ALTAMENTE CALIFICADOS RECHAZAN i....s o o ce •: CAPÍTULO 11 LA TEORÍA DEL BIG BANG NG E SA RESPALDADA DÜR luS L A OS OBSERVADOS......■................I . .............. j r ....■ c e a este v é ......... :■ ■ ' :■■■.....................................II ' a ■ a .7> v ■■ ...-s ■ c a r a s o.3 0 9 CAPÍTULO 14 RESUMEN DOCE OREO LES BASADAS E E ATENDIAS LroN i ípíL’-tct HARA RbCHAZAR LA EVO LO O ON .......... A TEORIA DE LA EVOLU­ CIÓN............... ........... :........... 18? CAPÍTULO 13 EVIDENCIAS DE LA EXISTENCIA DE DIOS UN DIOS QUE INTERVIENE EN LA HISTORIA E INTERACTÚA CON LA ESPECIE HUM ANA... : d a tac :: •........ CAPÍTULO 10 FALENCIAS DE LA DATACIÓN RADIOMÉ TRICA ............... r o í a ....... en: ..............

elevar la Teoría de la Evolución a la categoría de ley. y cuestionarla es “ignorancia y descaro” (Prof. o criti­ car a quienes se atrevan a cuestionar el proceso evolutivo. The Probability ofGod (London: SCM Press Ltd. con plena concien­ cia. D arlington). y de que las formas de vida simples den lugar a otras más com ­ plejas por medio de procesos naturales de m utación y selección. aunque adhieren a la Teoría de la Evolución. Debido a la infinitamente pequeña probabilidad de que la vida se forme espontáneamente.. Esto es lo que ocu­ rre actualmente con la Teoría de la Evolución. John Ashton ha re­ saltado estas dificultades en su libro. 1985). muchas personas mirarán el título del libro y lo desestimarán * Hugh Montefiore. ninguna persona libre de prejuicios puede. deberían tener la m ente abierta y estar dispuestos a considerar todas las evidencias. incluso los científicos encuen­ tran difícil aceptar algo que se aparte de ella. Sin embargo. El Dr. algunos científicos tienen una actitud abierta y. la historia nos ha demostrado que una vez que una idea se ha arraigado. D. de todas las personas. . p. Esta teoría se ha convertido en un dogma o. para citar al profesor Bernard David. Lamentablemen­ te.1 A pesar de esto. Ashton propone explicaciones alternativas para los datos del m undo natural que com únm ente se interpretan dentro del marco de la Teoría de la Evolución. debería estar dispuesto a considerar otras interpretaciones. en “la Ley de Darwin”. 75. están dispuestos a adm itir que presenta dificultades. l objetivo de la investigación científica es descubrir la ver­ E dad. En este libro. C. Si uno acepta que el proceso evolutivo presenta dificultades. el Dr. y los científicos.

Profesor Em érito Warren Grubb. PhD Facultad de Ciencias Biomédicas. . Perth.sin siquiera abrirlo. Es a este tipo de personas a quienes recomiendo el libro del Dr. sino para aquellos que exhiben una m ente abierta y están dispuestos a examinar sin prejuicios dis­ tintas posibilidades en su búsqueda de la verdad. Australia Occidental. Y es que esta obra no es para quienes tengan una m entalidad estrecha. Universidad de Curtin. Ashton.

estuve pensando en el papel de las m u­ taciones en relación con la Teoría de la Evolución. y existía la posibilidad de colaborar con ellos en un proyecto para integrar ras­ gos de resistencia a enfermedades en un nuevo tipo de cereal recién desarrollado. del que estábamos hablando. pero pregúntele a nuestro genetista. Pensó por un momento y respondió alargando las palabras: “Hm m m. pregunté al investigador en jefe del proyecto: “¿Alguna vez las mutaciones han originado nueva información genética significativa?” Su respuesta fue inmediata: “¡Por supuesto que sí!” “¿Podría darme un ejemplo?”. mientras estábamos sentados alrededor de la mesa.. Así que. Estaban invesii- gando sobre cruzamiento y selección de cultivos... Para que una nueva especie evolucione a partir de un antepasado común. potencialmente. Las técnicas de mejora incluían tratar las semillas con productos químicos que dañaban su ADN. debe surgir información genética nueva. Esta pérdida de material genético hacía que la “nueva” planta pro­ dujera un grano con almidón menos digerible. él será capaz de darle un ejemplo”. El nuevo tipo de cereal. No puedo recordar ahora mismo ningún ejemplo espe­ cífico. que al ser incor­ porado en la elaboración de alimentos podía. Las semillas imitantes se germinaban. tuve una reunión con varios pro leso res tic H una universidad australiana muy respetada. presumiblemente a partir de algún tipo de mutación favorable. . Durante el almuerzo. le pedí a continuación. poseía una disparidad favorable causada por la destrucción de parte de un gen. ser beneficioso para la prevención y el control de la diabetes tipo II. y se estudiaban en busca de cualquier rasgo benefi­ cioso que pudiera haber resultado de los cambios. ace algún tiempo..

Los resultados del análisis de laboratorio estimaron una edad de 6. he estado estudiando las evidencias a favor y en contra de la evolución. decidí comenzar a investigar y escribir este libro. Pensé en las dos respuestas. Desde principios de los años '70. En aque­ lla época. pero completa­ m ente opuesta: “¡Nunca!” Sorprendido. encontrada en una vieja mina de oro. Cuando pensé en esto. Sin embargo. ciclan exactamente lo mismo.600 años. biologos especialistas en diferentes campos. Dijo que no conocía ningún caso de una m utación. relacionada con la investigación de un fragmento de madera de una pala europea. parcialmente fosili­ zada. Ya que ninguno corrigió su respuesta. Pero si el genetista estuviera en lo cierto y las m utaciones no pudieran producir nueva inform ación genética significativa. de entre los cuales la selección natural escogerá los más favorables para crear nuevas especies. la actividad minera de la zona databa de fines del siglo XIX y era im­ . continué presionando. me atrevería a afirmar que los demás investigadores presentes en el almuerzo. que dará lugar a nuevos rasgos. lo que generalmente resulta en una pérdida de información genética. me encontré con el investigador su­ perior de Genética del D epartam ento de Producción Vegetal de la Universidad. esa tarde. Horas después. y le planteé la misma pregunta. natural o provocada. Me explicó que las m u­ taciones siempre causan daños en el A D N . un amigo mío estaba terminando su doctorado en Geoquí­ mica. es m uy pro­ bable que la mayoría de los científicos actuales que defienden la validez de la Peoría de la Evolución piensen tam bién que las m utaciones pueden producir nueva inform ación genética. la evolución sería imposible y no podría haber ocurrido. Su respuesta fue tan rápida como la anterior. que hubiera dado lugar a nueva información genética significativa. El científico de más edad y ex­ periencia creía efectivamente que las m utaciones pueden pro­ ducir inform ación genética nueva. cuando era investigador en el Departamento de Química de la Universidad de Tasmania. Más aún. Un día me mostró los resultados de una datación radiométrica hecha con la prueba del carbono 14.

Branch.3 publicado originalmente en 1999. God. Desde entonces. Scott y G. 3 John F. . A medida que continuaba mi investigación. en oposición a la evolución. Andrews. 2E. aparentemente incorrecto. Australia. italiano. y estas se convirtieron en el libro In Six Days: 50 Scientists Explain Why They Believe in Creation [En seis días: Cincuenta científicos explican por qué creen en la Creación]. la obra ha sido reimpresa numerosas veces. 23-33. vol. 53. en el contexto del debate creación/evolución. decidí ponerme en contacto con científicos que defendían una visión creacionista de los orígenes y preguntarles por qué elegían aceptar la Creación. me convencí de que la Teoría de la Evolución presentaba problemas obvios. Dent & Sons. incluyendo ediciones en alemán. Evolution from Space (London: J.4 La creación es un acto de Dios -él es la Inteligencia suprema— y.: C. decidí escribir también a profesores s de universida­ 1 Fred Hoyle y Chandra Wickramasinghe. Andrews. H. estimuló mi interés por los métodos de datación radiométrica. Este resultado. Encontré sus argumentos tan reveladores y convincen­ tes que edité algunas de las respuestas. 2001). pp. después de un seminario sobre evi­ dencias a favor de la Creación.C. en Sídney.M. H. en. “Antievolutionism: Changes and Continui- ties”..probable que el mango de la pala estuviese hecho de una madera que tuviera más de unos pocos cientos de años. Culture and Fear”. ed. Science and Evolution (Homebush West. N° 63 (2003). es citado frecuente­ mente en Internet. New South Wales: AN- ZEABooks. Being Human: Science.12 A finales de los años '90. E. además. In Six Days: 50 Scientists Explain Why They Believe in Creation (Oreen Forest. “The Science of Culture.. BioScience. 1981). pp.1y el profesor E. que estaban siendo percibidos por prominentes científicos como Sir Fred Hoyle. Miscellaneous Series. Jefe del Departamento de Materiales en la Universidad de Londres. 4 Ver referencias a In Six Days. por ej. AR: Master Books. The Royal Society of New Zealand. 282-285. un reconocido astrónomo británico. español y coreano. Graves. por eso.. Ashton. 1981). dictado en la Universidad de Ma- cquarie. N° 3 (2003). y por las implicaciones asociadas para la datación de la columna geológica y la evolución.

5 También esta obra ha sido reimpresa varias veces. 2001). espero que sirva. no obstante. y el conjunto se publicó en 2001 bajo el título The God Factor: 5 0 Scientists and Academics Explain Why They Believe in God [El factor divino: 50 científicos y académicos explican por qué creen en Dios]. pidiéndoles que me explicaran por qué creían en Dios. En él se detallan las evidencias que apoyan la afirmación de aquel genetista sobre la incapacidad de las mutacio­ nes para producir nueva información genética significativa. des seculares que se autodefinían como creyentes. en los milagros y en las respuestas a las oraciones. “In Six Days” y “ The God Factor”. The God Factor: 50 Scientists and Academics Explain Why They Believe in God (Australia: HarperCollins Publishers. . Una vez más. Muchos lee- totes encontrarán esta perspectiva nueva y desafiante.. y resume las evidencias científicas en con­ tra de la evolución como mecanismo responsable de la diversidad de la vida en la 1ierra. Estos académicos me proporcionaron abundantes evidencias de un Dios personal que interactúa con su creación. junto con datos de muchas otras investigaciones que también se oponen a las explicaciones clásicas de la Teoría de la Evolución. para estimular un debate mejor informa­ do sobre el tema de los orígenes. ed. El presente libro es una continuación de los anteriores. 5 John F. al menos. edité algunas de las respuestas que recibí. Ashton.

simplemente porque eso es lo que les fue enseñado en todos los niveles del sistema educati­ vo. La mayoría de los libros de texto. los museos y los autores de divulgación científica afirman. La mayoría de los científicos y educadores creen que la evolución es un hecho. puede escribir ahora un libro que afirme que existen evidencias de que la Teoría de la Evolución es imposible?” Esta es una pregunta válida. sin . Eso es lo que me enseñaron en las clases de Biología. LA EVOLUCION :-■■■: : : ¡ r e ir" uando empiece a leer este libro. las academias de ciencias. ¿Cómo un científico en ejercicio. incluyendo a los seres humanos. a lo largo de cientos de millones de años. profesor universita­ rio. usted probablemente reac­ C cionará de la misma manera que muchos otros lo han hecho antes: “Yo pensaba que estaba bien establecido científicamen­ te que toda vida sobre la Tierra. evolucionó a partir de células primitivas muy simples. y trae a colación los temas abor­ dados en este libro.

uk/creationism. vacilar.org. G. DC: National Academy Press. afirmando que existe un vasto cuerpo de conocimientos factuales (basados sobre hechos) que respalda la teoría de que los procesos naturales de la evolución han inducido la compleji­ 1N.edu/ catalog. Evolution and Creationism. Patel. los meca­ nismos por los cuales estos procesos han generado adaptación y divergencia en las especies.560 millones de años. La Academia sostiene que la Teoría de la Evolución está respaldada por tantos experimentos y observaciones que los científicos es­ tán convencidos de que los componentes fundamentales de la teoría no serán refutados por nuevas evidencias científicas. 81. aproxi­ madamente. En línea: www. Por ejemplo. H. NY: Coid Spring Harbour Laboratory Press.php?record_id=l 1876.geolsoc. que la evolución es un hecho demostrado por la ciencia. a causa de la variación genética combinada con la selección natural. 2 Science. y sostiene que la vida ha evolucionado hasta su forma actual durante un período de miles de millones de años. A. 2007). . J. National Academy of Sciences and Institute of Me­ dicine (Washington. 11. 2008). la Academia Nacional de Ciencias de Esta­ dos Unidos afirmó que la evolución se considera un hecho. ‘Creation Science’ and ‘Intelligent Design’ ”. puede leerse el siguiente enca­ bezamiento destacado en negrita: “La teoría evolutiva explica el hecho de la evolución”.1Los autores van aún más allá.3 La Academia de Ciencias Australiana publicó un punto de vista similar. Ln una declaración de postura” sobre la evolución publica­ da en el año 2008. 4. en muchos casos. Evolution (Coid Spring Harbour. D. p. Barton. Declaración de la Sociedad Geológica de Londres (11 de abril de 2008). Eisen y N. en un libro de texto universitario sobre evolución ampliamente utilizado en 2007. p. 3“ ‘Young Earth Creationism’.nap.12 La Sociedad Geológica de Londres afirma que ha quedado estable­ cido más allá de toda duda que nuestro planeta tiene. H. y afirman que actualmente los científicos comprenden el funcionamiento de todos los procesos evolutivos y. En línea: www. E. Briggs.

si. En línea: www.net/File. 5The Interacademy Panel on International Issues. la mayoría de los museos de historia natural del mundo. En línea: www.4 De hecho. Ex­ 4Australian Academy of Science.noanswer- singenesis.5 En esta misma línea. declaraba lo siguiente: “La evolución de los seres vivos ha estado ocurriendo durante miles de millones de años. Carta publicada en los principales periódicos australianos (21 de octubre de 2005). presentan la evolución como un “hecho” de la ciencia.dad biológica que encontramos hoy sobre la Tierra.mnh. El Interacademy Panel. la mayoría de las academias de ciencias del m undo adhieren fir­ memente a la Teoría de la Evolución. Eso es un hecho” (énfasis añadido). lo cual está confirmado por la Paleontología. y es responsable de la deslumbrante diversidad de la vida sobre la Tierra.au/id_archer_et_al_aust. publicó en 2006 una de­ claración sobre la enseñanza de la evolución firmada por 67 de las academias miembros.htm. la Biología y la Bioquímica modernas. 6Ver: www.500 millones de años. “Intelligent Design Is Not Science”. al menos. Por ejemplo.interacademies. es razonable que los visitantes y los medios de comunicación lo crean. afirmando que múltiples observaciones y experimentos independientes han establecido como ciertos los siguientes “hechos” sobre la evolución de la vida en la Tierra: • Que la vida apareció en la Tierra hace. en su exposición de 2009 “Desde Darwin: La evolución de la evolución”. red global de academias de ciencia. • Que la vida ha continuado evolucionando desde que apareció por primera vez.6 Cuando la institución científica más preeminente del m undo afirma rotundam ente que la evolución es un hecho.html. o IAP. . 2. el Instituto Smithsonian.org.edu/exhibits/darwin/evolution. “IAP Statement on the Teaching of Evo- lution” (2006). en sus exhibiciones.aspx?id=6150. • Que la estructura del código genético de todos los seres vivos indica su origen primigenio común.

Cuando Charles Darwin propuso esta teoría hace más de 150 años. Por ejemplo. 2009). según explico detalladamente en el capítulo 3. Sin embargo. p. la bioquímica celular no ha­ bía sido descubierta todavía. de la Universidad de Oxford. 18. The Greatest Show on Earth: The Evidence fo r Evolution (London: Bantam Press. la molécula química que codifica la estructura y el funcionamiento de los innumerables tipos de células distintas que constituyen los millones de organismos diferentes que habitan nuestro planeta. El eminente paleontólogo Stephen J. . cuando revisamos más atentamente estas decla­ raciones acerca de la evolución. National Aca- demy of Sciences (Washington.8 No obstante. se afirma que la vida apareció espon­ táneamente sobre la Tierra hace muchos millones de años. los científicos de la época conocían muy poco acerca de la extraor­ dinariamente compleja maquinaria bioquímica que existe dentro de los organismos vivos. DC: National Academy Press. El 7Science and Creationism: A View jrom the National Academy o f Sciences. 8 Richard Dawkins. afirma que el propósito de su libro sobre evolución. Casi un siglo de estudios científicos adicionales fue necesario antes de que se descubriera el AD N . escribió que no negaba el “hecho” de la evolución. pertos evolucionistas bien conocidos reafirman esta posición. pero no he encontrado ningún artículo científico acreditado que expli­ que un mecanismo plausible por el cual una célula podría surgir de manera natural a partir de sus moléculas constituyentes (un proceso llamado “abiogénesis”). p. de la Universidad de Harvard. Gould. O tra afirmación común es que toda la vida evolucionó a partir de organismos primitivos por medio de pequeños cambios acu­ mulativos sometidos a la acción de la selección natural. es mostrar que esta es un “hecho ineludible”. 1999). estas no confirman realmente la aseveración. descubrimos que muchas de ellas son meras afirmaciones hechas sin citar evidencias demostradas. Incluso cuando se citan evidencias.7 y el profesor Richard Dawkins. sí he encontrado muchos hallazgos científicos que demuestran que la abiogénesis no puede ocurrir. de hecho. 28. publicado en 2009.

Sin embargo. Un ejemplo reciente es el caso del direc­ tor científico del Ministerio de Educación Israelí. Sin embargo. pueda surgir alea­ toriamente. no he podido encontrar ni una sola publicación científica en que se reporten las evidencias necesarias para respaldar el requisito fundamental de la evolución: que puede surgir nueva información genética significativa por medio de proce­ sos aleatorios. a me­ dida que han ido descubriendo las evidencias más recientes con respecto a la bioquímica de los organismos vivos. puede ser una sorpresa para muchos lectores. En la actualidad. dudarán de que mis observaciones sean correc­ tas. de puestos de influencia. existen numerosos datos publicados que muestran que es imposible que nueva información genética signifi­ cativa. El descubrimiento de que no solamente no está demostrado el extensamente aclamado “hecho” de la evolución. no es fácil para los científicos rechazar públicamente la evolución. conocemos con un alto nivel de detalle la enorme complejidad de las estructuras celulares y su bioquímica. Gavriel Avi­ . Después de todo. igual que de la información genética que las codifica. Tampoco ningún artículo que informe de la observación de nueva información genética significativa que haya aparecido por azar. Al contrario. ha per­ mitido la exploración exhaustiva de los organismos vivientes y sus células. debido a la presión que ejercen sus colegas para desacreditarlos. ¿no acabo de señalar que la mayoría de los científicos de todo el m undo consideran que la evolución ocurrió realmente? ¿Cómo puedo decir ahora que ha sido refutada por es­ tudios científicos? Si es así. ¿por qué otros científicos no rechazan la teoría de Darwin? La respuesta es que algunos científicos. de sofisticados equipos científicos y nuevas metodologías. en particular durante las últimas tres décadas. sino además existen numerosos artículos publicados en la literatura científica que lo refutan. de alguna trascendencia para la evolución.reciente desarrollo. Dr. sí están empe­ zando a cuestionar la evolución. e incluso destituirlos. incluso. Estas evidencias se presentan en detalle en el capítulo 4. En otras palabras. Al­ gunos. no he encontrado hasta la fecha ningún artículo publicado en una revista acreditada que proponga un mecanismo plausible para la aparición por azar de esa inmensa cantidad de infor­ mación genética compleja.

Ver: www. 1967).13 9 O. que fue celebrado en el Instituto Wistar. 13Michael Dentón. 10Ben Stein. A mediados de los años '60. y la ineptitud de la Teoría tic la Evolución para explicar el origen de estos sistemas. 1986). expone varios ejemplos de persecución y marginación de científicos que se han atrevido a cuestionar las evidencias en favor de la evolución. S. Kaplan. M. Stahl. ed.com. Vertebróte History: Problems in Evolution (New York: McGraw-Hill. tal. .9 El documental Expelled.12 A mediados de los años '80. quien fue expulsado por cuestionar la validez de la evolución. producido hace unos años.haaretz. “Sa’ar Dismisses Chief Scientist for Questioning Evolution”.com. la paleóntologa Dra. llamó la atención sobre algunos defectos graves en las evidencias fósiles a favor de la evolu­ ción. 11P. “Mathematical Challenges to the Neo-Darwinian Interpretation of Evolution”. Ver: www. Documental para DVD (Premise Media Corporation. PA: Wistar Institute Press. Estados Unidos. Kashti. Expelled: No Intelligence Allowed. Haaretz (5 de octubre de 2010).. graduado del King’s College de Londres. no se admite inteligencia]. Evolution: A Theory in Crisis (Bethesda. 1973). The Wistar Institute Symposium Monograph. También en los años '70. Los estudios matemáticos resultantes culminaron en un simposio sobre el análisis de las probabilidades de que la evolución hubiese podido ocurrir. N° 5 (Philadel- phia. graduada en la Universidad de Harvard. Moorhead y M. 2008). un grupo de matemáti­ cos desafió la credibilidad de la evolución desde la probabilística. Barbara J. pero no aportaron ninguna respuesta cuantitativa a los desafíos presentados por los estudios de probabilísticas. Mi- chael Dentón.101 Las dudas con base científica sobre la Teoría de la Evolución no son nuevas. respetado centro de investigación biomcdica de Filadelfia. destacó la enorme complejidad de los sistemas biológicos a nivel molecular. Stahl. el biólogo molecular Dr.expelledthemovie.11 Estos insistieron en que los matemáticos no comprendían el funcionamiento de la evolución. 12 Barbara J. Las presentaciones del simposio se publicaron en un documento que fue ampliamente criticado por los biólogos. No Intelligence Allowed [Expulsado. MD: Adler & Adler.

por medio de un código altamente sofisticado. y el profesor de Biología Celular y del Desarrollo. por su parte. inrrincadamente complejas.15 En un intento por llenar esta notoria brecha en la explicación evolutiva de cómo los animales y las plantas desarrollaron su asombrosa variedad y complejidad. Spetner. John C. El genoma es el plano de A D N de los seres vivos. y específicas en estructura y en función. de la Universidad de California. como el Prof. ya que no explica el origen último de la información. 1)e la misma manera en que los dígitos en un código de barras. .14 del Instituto Federal Alemán de Física. Kirschner. Gerhart. el profesor de Biología de la Escuela de Medicina de Harvard. Cualquier pequeña alteración en la disposición de los aminoácidos que las componen afecta su forma. Las cade­ nas de A D N están conformadas por pequeñas piezas. Dr. y eso planteó el desafío de encontrar un origen natural para la inmensa cantidad de información específica contenida en ellas. La información presente en el A D N se relaciona con la contenida en las proteínas. 1997). Lee Spetner. que deben estar colocadas en un orden específico para codificar correctamente las características de cada organis­ mo. Marc W. El orden de sus componentes dota al A D N y a las proteínas de información biológica específica. la manera en que están plegadas y su función. Werner G itt. elaboraron una nueva 14Wemer Gitt. Not By Chance: Shattering the Modern Theory ofEvolution (New York: Judaica Press. y el físico graduado en el Instituto Tecnológico de Massachusetts. en Berkeley. AR: Master Books. 15Lee M. son moléculas altamente varia­ bles. In the Beginning Was Information (Green Forest. El fra­ caso de la Teoría de la Evolución al no poder explicar la fuente de la información biológica ha sido señalado por algunos teóricos de la información. 2006). Dr. Las proteínas. En los años '90. se aplicó la recién popularizada Teoría de la Información al análisis de moléculas orgánicas altamente infor­ mativas. Pero ¿de dónde provino toda esta información? “De un antepasado” no es una respuesta útil. llamadas nucleótidos. el orden debe ser el indicado o el sistema fallará.

en un extraordinario artículo titulado “W hy Pigs D on’t Have Wings” [Por qué los cerdos no tienen alas]. quien presen­ ta. 2010). poderosos argumentos que afirman la incapacidad de la selección natural darwiniana de ser un m otor eficaz para la evolución de las especies.16 Estos autores sugieren que los “procesos centrales”. Jerry Fodor. vol.uk/v29/n20/jerry-fodor/why-pigs-dont-have-wings. 29.lrb. relacionada con el moderno campo de la Epigenética. 2005). “Why Pigs Don't Have Wings”.17 El artículo del Dr. Masimo Piattelli-Palmarini. 17Jerry Fodor.18 16 Marc W. y a una nueva configuración de parte del organismo. N° 20 (2007). Los detalles de esta teoría se describen en el libro The Plausibility o f Life: Resolving Darwins Dilemma [La credibilidad de la vida: Resolviendo el dilema de Darwin]. pp. Los mismos autores admiten. The Plausibility ofLife: Resolving Darwin’s Di­ lemma (New Haven. en la conclusión del libro. son tan estables que son inmunes a los cambios causados por las m uta­ ciones a pequeña escala. 18 Jerry Fodor y Masimo Piattelli-Palmarini. CT: Yale University Press. En caso de que se demostrara que esta teoría explica adecuadamente algunos cambios en los sistemas biológicos. codificados en el A D N de un organismo y responsables de su estructura básica. titu­ lado W hatD arw in Got Wrong [En lo que Darwin se equivocó]. a la que llamaron “variación facilitada”. Fodor atrajo muchos comentarios de otros científicos. profesor de Ciencia Cognitiva de la Universidad de Arizona. que su teoría plantea numerosas preguntas sobre el origen de los “procesos centrales” altamente conservados. publicado por Yale University Press. coescrito con el Dr. Dr. 19-22. . Otros problemas de la teoría evolutiva fueron señalados por el filósofo de la Universidad Rutgers. What Darwin Got Wrong (New York: Farrar. En línea: www. las mutaciones acumuladas en el tiempo pueden ser activadas por cambios ambientales poste­ riores y dar lugar a unos “procesos centrales” totalmente nuevos. Sin embargo. por lo que decidió continuar desarrollando sus argumentos en un li­ bro más reciente. teoría. Kirschner y John C. London Review o f Books. Straus and Giroux.co. en 2005. aun quedaría por determinar de dónde procede la información genética de los “procesos centra­ les” originales. Gerhart.

. diciendo: “Básicamente.20 Esta declaración se aleja bastante de las rotundas afirmaciones de libros de texto de Biología y de las exposiciones de los museos. Debido a que la selección natural es el núcleo esencial de la teoría de Darwin. Los científicos expertos en evolución se enfrentan actualmente con un grave dilema. Mazur cita al Dr. la teoría de Darwin estaría muerta. destaca la creciente comprensión por parte de los científicos de que si la selección natural fuera rechazada y perdiera su posición como puntal de la evolución. en julio de 2008. Nadie ha sido capaz de diseñar un experimento y conseguir que cierto tipo de organismo evolucione en otro nuevo tipo de organismo (a menos que deliberadamente se elimine información genética o se inser­ te información genética procedente de otro organismo. 2010). la publicación de Fodor representó un serio desafío a la integridad científica de la evolución. 19 Suzan Mazur. Los evolucionistas están buscando. En realidad. En línea: www. Por consiguiente. .books. ni en condiciones naturales ni en el laboratorio. 16 de los principales científicos evolucionistas del mundo se reunieron en el Instituto Konrad Lorenz. nadie sabe cómo trabaja la evolución porque nun­ ca nadie la ha observado. no creo que nadie sepa cómo funciona la evolución”. 20Ibíd. la evolución nunca ha sido observada.p. opciones de las cuales ninguna sería verdadera evolución).com/books. para investigar sobre la evolución y la cognición. ¿Qué teoría podría reemplazar al neo-Darwi- nismo? Nadie lo sabe.19 quien en­ trevistó tanto a los asistentes como a otros expertos mundiales en el campo de la Biología Evolutiva. con la finalidad de discutir acerca de esta seria amenaza a la ciencia evolutiva. la deja bien lejos de poder ser considerada un hecho científico. Jerry Fodor. CA: North Atlantic Books. De entre los comentarios reco­ gidos. a tientas. N o disponer de mecanismos plausibles ni de ninguna evidencia experimental para explicar cómo ocurre la evolución.google. La cobertura de la conferencia estuvo a cargo de la periodista científica Suzan Mazur. 34. The Altenberg 16: An Exposé o f the Evolution Industry (Berkeley.

Las entrevistas re­ portadas por Susan Mazur presentan una vivida imagen de las in­ certidumbres y los vehementes desacuerdos de estos científicos. 1938). Greene.21 El actual debate científico sobre los mecanismos de la evolución demuestra que la evolución no es un “hecho” demostrado de la ciencia. Signature in the Cell: DNA and the Evidence fo r Intelligent Design (New York: HarperOne. Ver también: A. Science. en su recien­ te libro Signature in the Cell: DNA and the Evidence fo r Intelligent Design [La firma en la célula: el A D N y las evidencias del diseño inteligente]. 2009). Ideo- logy and World View (Berkeley. repasaremos la Teoría de la Evolución de Darwin en el próximo capítulo. Según algunos comentaristas sociales. John C.22 Esta obsesión con la “cosmovisión mecánica” ha seguido dominando la ciencia hasta el día de hoy. vol. Antes de considerar más evidencias en contra de la evolución. CT: Yate University Press. “Social Factors in the Origin of Darwinism”. Stephen C. 334. de que se descubrirá. 315-326. Meyer. filósofo graduado en la Universidad de Cambridge. que continúan aferrándose incondicionalmente a su fe en que la evolu­ ción es un hecho incuestionable de la historia. 1981). 21Stephen C. 22 Geoffrey West. los mecanismos internos propuestos para la evolución se han manifestado extraor­ dinariamente ineficaces. CA: University of California Press. un proceso mecánico natural capaz de explicar cómo apareció la vida. Pero. Charles Darwin: A Portrait (New Haven. pp. cuando la máquina devino en la principal preocupación de la época. Meyer. sino su “deseo”. Darwin estableció una concepción mecánica de la vicia orgánica en la “era de las má­ quinas” —justo tras la primera exposición mundial de Londres en 1851—. extravagante a la luz de las evidencias abrumadoras en contra. 13 (1938). mecanismos creíbles que puedan explicar la multitud y la diversidad de formas de vida presentes en nuestra biosfera. en algún momen­ to. p. frente a los recientes descubrimientos de la biología molecular como los que presenta el Dr. The Quarterly Review ofBioIogy. desarrollándose especialmente en la controversia acerca de la evolución. Sandow. .

constitución y hábitos. TEORIA DE LA EVOLUCIÓN DE DARWIN 1año 2009 vio el 150° aniversario de la publicación del libro “ de Charles Darwin The Origin o f Species by Means o f Natural Selection or The Preservation ofFavoured Races in the Struggle fo r Life [El origen de las especies por medio de la selección natural. p. The Origin o f Species by Means o f Natural Selection or the Preservation o f Favoured Races in the Struggle fo r Life (London: John Murray. . o la preservación de las razas favorecidas en la lucha por la vida]. m a­ yor ventaja tendrán en la lucha por la existencia”.1 1Charles Darwin. 1859). Propuso que había un principio en la naturaleza: “Cuanto más diversificados estén los descendientes de cual­ quier especie en cuanto a estructura. En su obra. Darwin registró sus observaciones respecto de la lucha por la supervivencia de muchas especies. 156.

evo­ 2Ibíd. 160. que pertenecían a 8 órdenes. al haber más probabilidades de que algunas de ellas sobrevivan.. Después de mil generaciones (según el mismo Darwin. p. como las precipitaciones. A medida que la especie se reproduce durante generaciones. En otras palabras. cuanta más variedades de gramíneas haya. estas dos especies vuelven a bifurcarse. Allí. 3 lbíd. N° 2. New Scientist. 3 La parte inferior del árbol correspondería a una especie pertene­ ciente a un género extenso. e ilustró su idea con el diagrama de un árbol cuyas ramas de dividen sucesi­ vamente en ramas más pequeñas. pdf. la temperatura y el tipo de suelo. re­ presentadas en líneas divergentes desde un punto común. ma­ yor será la cantidad de ellas que podrá sobrevivir a variaciones en las condiciones ambientales. tres nuevas especies habrán surgido. Después de diez niveles de bifurcación en este árbol hipotético de la vida (es decir.org/ Z5221S. de 18 géneros diferentes. Algunas ramas se detienen sin bifurcarse. 157. pudo identificar 20 especies de plantas.. 161. mayor será la probabilidad de que aumenten en número y perpetúen la especie. describió sus observaciones de una pequeña área de 90 por 120 centímetros de terreno. “Uprooting Darwin’s Tree”. como parte del mecanismo de diversificación para la supervivencia. Todas ellas estaban luchando por sobrevivir en el mismo ambiente. el resultado es una gran cantidad de especies divergentes. Durante las siguientes mil generaciones. después de diez mil generaciones). En Enea: www. Darwin quedó impresionado por la enorme variedad de especies que existen en la naturaleza. Después de miles de generaciones.692 (21 de enero de 2009). pp.thedivineconspiracy. se producen diferencias sumamente leves. . diez mil generaciones podría ser una mejor estimación). Ver también: Graham Lawton. 34. las diferencias acumuladas entre las dos líneas principales de la bifurcación son suficientes como para ser consideradas dos especies distintas. lo que repre­ senta la extinción de esa variedad particular.2 Darwin propuso la hipótesis de que las diferentes especies y géneros surgieron de un antepasado en común. p. Por ejem­ plo.

aunque el tamaño y la forma de los huesos varíen de acuerdo con las distintas formas de locomoción. las diferencias entre las especies serían tan importantes como para constituir nuevos géneros. Este concepto darwiniano de un árbol de la vida que representa gráficamente el modo en que surgieron las diferentes especies. lo que sugiere la existencia de un patrón original. Asimis­ mo. Darwin propuso que esto era un ejemplo claro de la selección natural en ple­ no funcionamiento. que posteriormente se modificó y diversificó para adaptarse a las necesidades de cada especie. con éxito. por ejemplo. las extremidades anteriores de los seres humanos. cerca de la costa oeste de África del Norte.451. 418. ventajas para sobrevivir en su entorno específico. después de catorce mil generaciones. Darwin propuso el mecanismo de la selección natural a través de la su­ pervivencia del más apto. Cada nueva especie en el árbol de la vida sería el resultado de pequeñas mutaciones sucesivas que ha­ brían proporcionado. Darwin sugirió que. Darwin argu­ mentó. 200 carecían de alas. los caballos. Durante miles de generaciones. que todas las flores tienen sépalos. De forma semejan­ te. El descubrimiento de un gran número de especies de escarabajos sin alas en las islas de Madeira. los topos. mientras que en las áreas no expuestas abundaban los escarabajos alados.lucionado y llegado a ser significativamente diferentes del ancestro original. La proporción de estos escarabajos era superior en las regiones de las islas expuestas al viento. el número de vértebras del cuello de los elefantes y de las jirafas es idéntico. intrigó a Darwin.pp. . los escarabajos de alas más pequeñas eran menos propensos a ser arrastrados mar 4/Wtf. hizo que la idea fuese relativamente fácil de comprender. Señaló. a pesar de la diferencia de longitud. a los seres que las poseen..415. De las 550 clases de escarabajos de las islas.4 Com o explicación para este “hecho de la naturaleza”. pétalos. que las evidencias en favor de tal árbol eran obvias en la naturaleza. estambres y pistilos. los defines y los murciélagos están construidas siguiendo el mismo patrón óseo.

en el que Lyell proponía que los continentes se habían estado for­ mando durante millones de años mediante lentos cambios. a una nueva rama en el “árbol de la vida”. p. 7 5 Ibíd. representados en la parte más alta. sobrevivían para reproducirse. Esta hipótesis geológica proveía del marco de tiempo necesario para la evolución. 176. hasta dar lugar a una nueva especie. Darwin. argumentando que la sucesión de fósiles mostraba la divergencia de las diferentes especies a partir de sus antepasados comunes. Planteó que el diagrama del árbol podía explicar de que manera los géneros representados en la par­ te inferior del árbol. en la que la vida vio la luz por primera vez”. Darwin leyó el libro de Charles Lyell: Principies o f Geology [Principios de Geología]. 7 Ibíd. Los escarabajos sin alas corresponderían. siguiendo la ilustración de Darwin. el rasgo responsable por las alas pequeñas o débiles fue aumentando su presencia en las zonas más expuestas al viento. Mientras viajaba a bordo del H M S Beagle. 6 Ibíd..5 Con el tiempo. 404.. evolucionaron hasta dar lugar a nuevos géneros. 177.adentro por el viento y. por medio del mecanismo de la selección natural. pp. . debo deducir de la analogía que.6 Darwin llegó a la conclusión de que toda forma de vida había evolucionado.405. algunos de los cuales han permanecido hasta la actualidad. heredadas generación tras generación. sucesivas mutaciones exitosas. todos los seres orgánicos que alguna vez han vivido en esta Tierra descienden de una única forma primigenia. entonces. fueron reduciendo progresivamente el tamaño de las alas de los escarabajos. 455. probablemen­ te. pasó a aplicar su concepto del árbol de la vida al registro fósil. a partir de un único organismo original y a lo largo de eones de tiempo. Poco a poco. En sus propias palabras: “Por lo tanto. por lo tanto. correspondientes a fósiles de la era Silúrica.. pp.

más antiguos. siguiendo las líneas originalmente propuestas por Darwin. se pueden encontrar fácilmente en los libros de texto de Biología. conocidas como homologías. desde la supuesta forma de vida primigenia hasta las actuales. Hasta los años '90. están codificados en el A D N de cada organismo. Esta hipótesis. pp. es conocida como la ‘Teoría de la Evolución. Solomon. Berg. Martin y Eldra P. En los casos en que una especie se ha extinguido. apoyándose en datos procedentes del aná­ lisis genético de organismos modernos. Ejemplos particulares de ramas del árbol. 7“ ed. Las relacio­ nes entre ambos se establecían sobre la base de semejanzas es­ queléticas y fisiológicas. Biology. Darwin propuso una teoría científica para explicar el origen de la diversidad biológica. CA: Thomson. Brooks/Cole. Los fósiles provenientes de los es­ tratos superiores se postulaban como descendientes de aquellos encontrados en los estratos inferiores. los avances en la investigación sobre el ár­ bol de la vida se basaron.8 Desde la década de los 90 en adelante. modificada posteriormente con la incorporación de conocimientos de genética m oderna y otras disciplinas. basada sobre pequeños cambios he­ redables. Identificando fragmentos comunes de A D N en especies diferentes. los biólogos han dedicado una parte importante de sus actividades de investigación a identificar vías evolutivas y a completar los detalles de este árbol de la vida. El hecho de que los nuevos organismos fueran similares a sus antepasados. (Belmont. 341. . Los rasgos hereditarios que constituyen las bases para establecer las relaciones evolutivas. Diana W. en forma y en función. 2005). los biólo­ gos intentan vincular esos organismos con un antepasado co­ 8 Linda R. que se habrían ido acumulando hasta dar lugar a una inmensa variedad de organismos nuevos. permitiría que la vía evolutiva pudiera ser rastrea­ da en el registro fósil. 343. tal como la vía evolutiva propuesta para la evolución de los vertebrados. la estructura del árbol ha ido cambiando considerablemente a medida que los biólogos reasignan sus ramas. la rama simplemente termina sin bifurcarse. principalmente. 344. sobre descubrimientos vinculados con el registro fósil. A lo largo de los últimos cien años.

ibíd.910En la página web del Museo Nacional de Historia Natural del Instituto Smithsonian. entonces.si. incluyendo los seres humanos. teniendo su origen en el “último antepasado común universal” (LUCA. Durante los siguientes 600 a 1. las sangui­ juelas. Ocho años después.. . sobre la base de semejanzas anatóm i­ 9 Lawton. surgieron los protozoos y las plantas. aproximadamente 3. de naturaleza desconocida. como tiburones. seguidos por los animales vertebrados. los hongos y la bacteria Escherichia coli.edu/exhibits/darwin/treeoflife.html. cuya naturaleza también se desconoce. peces y anfibios. y la selección en relación con el sexo].mnh. Huxley en su libro Evidence as to M ans Place in Nature [Evi­ dencias de la posición del hom bre en la naturaleza]. y a mamíferos. se puede encontrar un diagrama moderno del árbol de la vida que muestra la supuesta relación evolutiva de los seres humanos con los perros. and Selection in Relation to Sex [La descendencia del hom bre.w El concepto de que los seres hum anos descienden de otras es­ pecies de primates fue explícitamente argumentado por Tilomas H . aparecieron los animales invertebrados.100 millones de años.000 millones de años después de que los primeros seres vivos se formaran. Se afirma que. Del LUCA surgen. publicado en 1863. posterior­ mente. en otra. Estos diagramas son llamados “árboles filogenéticos”. la última bifurcación dio lugar a reptiles y a aves en una rama. 10En línea: www. Representaciones recientes del árbol filogenético muestran las primeras formas de vida. siglas en ingles de Last Universal Common Ancestor). moluscos e insectos. 34-39. arqueas (sim ilares a las bacterias) y eucariotas (células más complejas. y representan la conexión teórica empleando un diagrama tipo árbol. tales como gusanos. tres tipos de organismos unicelulares: bacterias (procariotas). las células eucariotas comenzaron a evolucionar y generaron organismos multicelulares. seguidos por amebas y hongos. Darwin amplió estos argumentos en su obra The Descent ofM an. cuyo material genético está empaquetado en un compartimento llamado núcleo). en la que propuso. pp. m ún. A partir de estos.

Natnre.cas. como la famosa “Lucy”. “Pygmy Chimps. pp. Scientific American (enero de 2009). 389-395.11 En el ámbito no científico.1112 De hecho. 437 (2005). E. 104. estudios posteriores han demostrado que Lucy era. descubierto en Etiopia en 1974. el Australopithecus se diferencia más de los simios y los humanos que los simios de los hum anos. 46-48. que el hom bre descendía de chimpancés y gorilas. La idea de que los seres hum anos evolucionaron a partir de los primates continúa siendo un tema dom inante en el panoram a científico actual. 12A. “Lucy” es el nombre popular con que se conoce a los restos fosilizados de un espécimen de Australopithecus afarensis. 40.13 Para muchos biólogos. donde todavía viven estos primates. Darwin predijo que los fósiles de los antepasados más antiguos de los seres hum anos se encontrarían en Africa. vol. En 2005 se publicó la secuencia com­ pleta del genoma del chimpancé. muy similar al chimpancé pigmeo o bonobo. y se comparó con el genoma hum ano. people and the pundits”. pp. N° 1. esta idea se ha popularizado gra­ cias a documentales y a artículos de divulgación que muestran representaciones artísticas de la evolución desde los simios hasta los seres humanos. 258 (1975). En este caso concreto. 14The Chimpanzee Sequencing and Analysis Consortium. vol. Zihlman. “The place of the australopithecines in human evolution: grounds for doubt?". además. 39. vol.430 (15 de noviembre de 1984). necesario clarificar el significado de “sim ilitud” para no llegar a conclusiones engañosas. Nature. este porcentaje ha resultado ser exagerado. “The Human Pedigree”. examinar di­ 11 K. pp. . “Initial Sequence of the Chimpan- zee Genome and Comparison with the Human Genome”. Oxnard. Es. Wong. Varias investigaciones en curso continúan intentando establecer los detalles de la línea evolutiva que une a los grandes simios con los hum anos. 13 C.14 Se afirmó que la similitud entre ambos era de aproxi­ m adamente un 96%. en realidad. Por ejemplo. la relación evolutiva entre los grandes simios y los humanos ha sido confirmada por las semejanzas entre el A D N de ambos. 69-87. pp. New Scientist. y a la exhibición en los museos de ciencias na­ turales de reconstrucciones con apariencia claramente humana de supuestos eslabones perdidos.

. simplemente.. el hecho de compararlos para evaluar la similitud. Las primeros cien pares de bases del A D N m itocondrial del chimpacé son: gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcacccc ataaacaaacaggtttggtcctagcctttctattag. pp. vol. S. 16 Ver: www. el biólogo Dr.. también revisaron las estimaciones de la s i m i l i tu d entre los genomas y concluyeron que es inferior al 86% .276. 2. JeffreyTomkins.Ebersberger. Je- rry Bergman.15 El Dr. junto con sus colaboradores del Centro de Bioinformática Intcgradora de Viena. Ebersberger. necesaria 151. En sus propias palabras: “En aproximadamente un 23% de nuestro genoma no existe evidencia alguna de que com­ partamos ascendencia genética inmediata con nuestro pariente vivo más cercano. Galgoczy. 24 (2007). y llegó a la conclusión de que la similitud entre humanos y chimpancés era sustancialmente infe­ rior al 96%. y su colega. llevó a cabo un análisis detallado de ambos genomas. Para una revisión más reciente de la literatura que sugiere que la similitud real se sitúa alrededor de un 70%.16 La similitud entre el A D N de humanos y chimpancés puede igualmente interpretarse como una prueba de que ambas especies fueron creadas por el mismo Diseñador inteligente.creation. Teniendo en cuenta que el genoma hum ano y el del chim ­ pancé están ambos constituidos por más de tres mil m il lo n e s de pares de bases.creation. ver: www.com/human-chimp-dna-similarity-re-evaluated.. Este proveyó a ambas con una gran cantidad de información similar. Taudien. rectamente el A D N no ayuda mucho. El Dr. resulta evidente la dificultad que entraña. M o­ lecular Biology and Evolution.com/human-chimp-dna-similarity-literature . P. Y los cien primeros pares de bases del A D N mitocondrial h u ­ m ano son: gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtattttcgtc tggggggtgtgcacgcgatagcattgcgagacgctg.. et al. “Mapping human genetic ancestry”. gene­ tista de la Universidad Clemson.266-2. el chimpancé”.

cuando m i­ ramos así al embrión. A modo de ejemplo. p. pero también con suficiente información específica (un 14% es una diferencia importante) para otorgarles sus características únicas.para las numerosas estructuras y funciones comunes. es decir.. a las especies actuales”. Ambos vehículos tenían motores traseros de cuatro cilin­ dros opuestos horizontalmente y refrigerados por aire. Otras supuestas evidencias de que los humanos han evoluciona­ do proceden de un concepto que predominó durante largo tiempo en el campo de la Embriología: la noción de que. se recapitula la historia evolutiva de la especie. Darwin lo expresó así en E l origen de las especies: “Así como el desarrollo embrionario de cada especie y grupo de especies nos muestra parcialmente la estructura de sus progenitores ancestrales menos modificados. etc. podemos citar las numerosas similitudes que existían entre los primeros modelos escarabajo de Volkswagen y los automóviles Porsche. La presencia de un patrón común en las extremidades de los vertebra­ dos podría tener su origen en la acción de un Diseñador inteligente... no porque evolucionaron de un ancestro común. podemos ver claramente por qué las antiguas formas de vidas ya extintas deberían ser similares a los embriones de sus descendientes.18 17Darwin. La misma explicación puede aplicarse a otros ejemplos de homologías usados con frecuencia como apoyo a la Teoría de la Evolución. maletero en la parte delantera.17 Darwin continuó diciendo: “La embriología resulta m ucho más interesante. 427. que ha adaptado una estructura básica multifuncional a las necesi­ dades específicas de cada grupo de animales. dos puertas. 18Ibíd. ibíd. sino porque ambos fueron diseñados por el mismo equipo: Ferdinand y su hijo Ferdinand “Ferry” Porsche. . durante el desa­ rrollo embrionario de un animal. como una imagen más o menos oscure­ cida de la forma ancestral com ún de cada grupo de animales”. 428. p.

3° ed. Biology. un pollo y un ser humano. Richardson. 1993). 1. K. et al. Haeckel publicó. La idea de que la ontogenia (desarrollo de un organismo) re­ capitula la filogenia (historia evolutiva de la especie) fue popula­ rizada por el zoólogo alemán Ernst Haeckel. En un determinado estadio del desarrollo. 402.19 A mediados de los años '90. 277 (5 de septiembre de 1997). incluidos los seres humanos. Berg. Martín. 196 (1997). 91-106. Esto parecía indicar que todos los animales vertebrados. Los embriones humanos no tenían es­ tructuras similares a branquias en ninguna etapa de su desarrollo. K. por lo tanto. pasaban por un estado similar a un pez antes de diferenciarse y adquirir las características propias de su especie. P. Poco después de la publicación del libro de Darwin. vol. R. y hasta la década de los años '90 los libros de Biología contenían ilustracio­ nes de embriones humanos con hendiduras branquiales y cola. 1. “There Is No Highly Conserved Embryonic Stage in the Ver­ tebrales: Implications for Cuirent Theories of Evolution and Development”.435. p. por ej. vol. una salamandra. Pennisi. 281 (28 de agosto de 1998). la idea de que el desarrollo embrionario de los vertebrados prueba de algún modo la evolución sigue apareciendo en algunos textos científicos actuales.20 Aunque la teoría de la recapitulación ha quedado desacreditada en su versión literal. Durante más de un siglo los dibujos de Haeckel se utilizaron como evidencia de la evolución.. Los resultados -q u e fueron publicados en 1997 en las revistas científicas Anatomy and Embriology y Science— de­ mostraban que los embriones reales eran m uy diferentes de las ilustraciones de Haeckel. Science. Solomon y CJaude Villee. y la comunidad científica reconoce que las ilus­ traciones de Haeckel eran fraudulentas. pp. carta a Science. E. .: L. “Haec- kel’s Embryos. todos los embriones aparecían representados con hendiduras branquiales similares a las de los peces. (New York: Saunders College Publisbing. Richardson. Un libro de 19 Ver. 20M. E. una tortuga. a su vez. M. Continued”. el embriólogo Michael Richardson recolectó y fotografió los mismos tipos de embriones que Haeckel había dibujado. “Haeckel’s Embryos: Fraud Redisco- vered”. pp. vol. pp. unas ilustraciones que comparaban los supuestos embriones de un pez. W. Anatomy and Embryology. Sugería.285. D. que los peces eran los antepasa­ dos del resto de los grupos.

de la guerra de la naturaleza. 22 Pero ¿ocurre esto realmente? ¿Produce. guiada por la selección natural durante un largo período de tiempo. publicado en 2005 y ampliamente usado en el ni­ vel universitario. Hemos argumentado que las homologías pueden igual­ mente explicarse como resultado de un Diseño inteligente. se obtiene directamente el mejor resultado que po­ dríamos imaginar. las ilustraciones de I laeckel son un claro ejemplo de una importante evidencia en favor de la evolución que ha resultado falsa y que. la acumulación de pequeños cambios hereditarios. que exageraban las características intermedias. Sin embargo. texto de Biología. se ha perpetuado en los textos científicos. en la lucha de los seres vivos por la supervivencia.. 22Darwin. la mayoría de ellos han resultado ser claramente humanos o cla­ ramente simios. 21 En este capítulo hemos analizado varias de las evidencias que se han utilizado con el propósito de apoyar la Teoría de la Evolución de Darwin. sin embargo. Biology. y afirma que “todos los embriones de los vertebrados” tienen estructuras branquiales y otras características propias de los peces. 347. 7" ed. Darwin escribió. . Pero 21 Berg. de la ham bruna y la muerte. en la conclusión de su obra: “Por lo tanto. algu­ na vez la “guerra de la naturaleza” nuevos organismos superiores? Revisaremos atentamente esta declaración en el capítulo 4. ibíd. puede producir tipos de vida totalm ente nuevos. eran interpretaciones sesgadas con la finalidad de favorecer una ex­ plicación evolutiva. En el caso de los restos fósiles utilizados para respaldar la evolución humana. la afirmación principal de la teoría de Darwin es que.. la producción de animales superiores”. Finalmente. Martin y Solomon. 457. sostiene que los patrones del desarrollo embrioló­ gico demuestran que los vertebrados comparten un antepasado co­ mún. o ha producido. p. Esto demuestra que las representaciones iniciales de hombres-mono. p.

este organismo tuvo que formarse y cobrar vida a partir de materia inanimada y de procesos químicos natura­ les. Si la Teoría de la Evolución no incluye ningún elemento de creación sobrenatural.antes tenemos que examinar otra afirmación de Darwin: que to­ dos los seres vivos surgieron a partir de un único organismo prim i­ genio. es decir. que estas combinaciones hayan dado lugar al primer organismo viviente? Revisaremos la ciencia detrás de esta quimera en el próximo capítulo. . ¿Es posible que la vida surgiera de combinaciones aleatorias de compuestos químicos naturales.

Algunos científicos llegan. Tanto la abiogénesis (aparición espontánea de la vida) como la diversificación de la vida por la evolución darwiniana. Sin embargo. a pesar de que ninguno de los dos procesos ha sido demostrado científicamente. CELULAS: CASUALIDAD IMPOSIBLE e qué modo comenzó la vida continúa siendo uno de los D interrogantes fundamentales de la ciencia moderna. comprender cómo la primera célula viviente se desarrolló a través de procesos físicos y químicos naturales hace mucho. se consideran actualmente he­ chos comprobados. . se asume comúnmente que simplemente “ocurrió”. mucho tiempo es fundamental para la Teoría de la Evolu­ ción. Aunque nadie ha presentado todavía una explicación satis­ factoria de cómo pudo formarse la primera célula viva.

En este capítulo estudiaremos más atentamente los hallazgos científicos que demuestran que una célula viva no puede surgir por casualidad. Szostak. pp. a incluir la evolución en la definición de vida. incluso.*23Afirmaciones similares se repiten en la mayoría de los libros de ciencia. y su coinvestigador. Por ejem­ plo. y la Teoría de la Evolución por sí sola resultaría incapaz de ofrecer una explicación mecánico-naturalista completa de cómo llegamos aquí. “Origin of Life on Earth”. 2Ibíd. la vida apareció”. Jack Szostak.. la NASA (Administración Nacional Aeronáutica y Espacial de los Estados Unidos) define la vida como “un sistema quími­ co autosostenible capaz de experimentar evolución Darwiniana”. el profesor emérito de Química Inorgánica de la Universidad de Nueva Gales del Sur.] las primeras formas de vida aparecieron en los océanos”. escribe: “Parece que hace aproximadamente 3.850 millones de años [.500 millones de años. “Thoughts on the Chemical Origin of life”. 58. vol. 301 (septiembre de 2009). pp. . vol. (New York: McGraw Hill Publishers. el profesor de genética de la Universidad Harvard.. Poco después. Biochemistry: The Molecular Basis ofLife. 3Stanley Livingstone.4 ‘Alonso Ricardo y Jack W. 3o ed. Por ejemplo. 78 (diciembre 2008/enero 2009).22 De forma semejante. 2003). Esta definición implica directamente que la evolución es un he­ cho de la ciencia tanto como lo es la vida. 10-12. Scientific American. 38-45. El popular texto universitario de bioquímica de McKee y McKee sostiene: “La Tierra se formó de una nube de gas y polvo cósmico condensando hace unos 4. si se pudiera demostrar que es completamente imposible que un ser vivo se forme a partir de materia inanimada únicamente a través de procesos naturales. McKee.1 Sin embargo. Chemistry in Australia. Stanley Livingstone. afirman que “la primera vida surgió de la materia no viva hace alrededor de 3.700 millones de años”. la selección natural se quedaría sin materia prima sobre la cual actuar. 4Trudy McKee y James R. La mayoría de los artículos científicos acerca de los orígenes em­ piezan con la confiada aseveración de que las células vivas se for­ maron a sí mismas hace miles de millones de años. Alonso Ricardo. p.

¿de qué modo pueden los científicos utilizar estos métodos de modo de establecer la fecha del origen de la vida? Lo hacen sobre la base de más suposiciones. se requie­ . a su vez. y en el caso de rocas que contienen fósiles. Analicemos sus declaraciones más atentamente: ¿De dónde proviene el cálculo de estos períodos de tiempo como “unos 3. Nótese el uso de la palabra “presunta”. no es posible validar estos métodos de datación para fechas prehistóricas y. Cabe preguntarse sobre qué evidencias basan estos eminentes profesores tales afirmaciones. son en realidad estimaciones que.850 millones de años”. no a restos de seres vivos. madrigueras. podemos señalar que los métodos radiométricos referidos anteriormente corresponden a rocas volcáni­ cas. de las afirmaciones anteriores. El cálculo requiere hacer un análisis químico de la roca en el presente y compararlo con la presunta composición de la roca en el pasado. Los fósiles son restos conservados de organismos que vivieron en el pasado. huellas. Profundizando un poco más.700 millones de años atrás” o “hace unos 3. los cálculos derivados de la datación radiométrica deben ser considerados con suma cautela. es decir. En realidad. esta vez referidas a los fósiles. están basa­ das sobre suposiciones indemostrables. La incertidumbre aso­ ciada con este método se discute con mayor detalle en un capítulo posterior. pero la idea que se destaca en este punto es que los pe­ ríodos de tiempo de miles de millones de años. deposiciones y otras señales de actividad. en los que supuestamente tuvo lugar el origen de la vida? Los períodos de tiempo que se remontan tan atrás se calculan por medio de datación radiométrica. por consiguiente. moldes de estos. En la deposición de los materiales que constituirán rocas sedimentarias suele estar involu­ crada el agua. Entonces. para calcular la edad de la roca en cuestión. Se encuentran casi siempre en lo que se conoce como rocas sedimentarias. rocas formadas a partir de sedimentos procedentes de otras rocas. no hay ninguna manera de saber con certeza cuál era la composición real de la roca en un pasado tan lejano. Esta consiste en utilizar las tasas a las que los elementos radioactivos de ciertas rocas se trans­ forman de un elemento químico a otro.

junto con sus fósiles característicos. Barberton Mountain Land. vol.500-Million-Year-Old Onverwacht Group. Sin embargo. Packer. Según la datación convencional. así que. M. su antigüedad suele calcularse a partir de la edad estimada para las rocas volcánicas subyacentes y suprayacentes. W. Walsh y D. R. a menos que haya evidencias de in­ versión. ya que ciertos tipos de fósiles solo aparecen en determinadas capas. Science. 314 (1985). importantes re­ vistas científicas Science y N aturé publicaron el descubrimiento 5 J. South Africa”. W. Al conjunto ordenado de los estratos presente en todo el m undo. “Microfossils of the Early Archean Apex Chert: New Evidence of the Antiquity of Life . correspondientes al “eón Ar- queano o Arcaico”. Según se explicará en detalle más adelante. Dichos estratos se diferencian en su contenido fósil por abundancia y en composición. rocas similares de otros lugares. Schopf. o son más abundantes en unas ca­ pas que en otras. es un famoso lugar donde se pueden observar expuestos numerosos estratos sucesivos de rocas sedimentarias. los fósiles que es­ tas contienen y su antigüedad estimada. el Precámbrico tuvo lugar entre 600 y 4. Lowe. normalmente. 237 (1987). que las rocas inferiores o más profundas son las más antiguas. vol.3-Billion to 3. lo más común es que una vez establecida la corre­ lación entre determinadas rocas sedimentarias. El Gran Cañón del Colorado. en forma de capas llamadas “estratos”. Nature. Las rocas sedimentarias se encuentran por todo el mundo. M. 640-646. Los geólogos asumen. 70-73. vol. “Early Archean (3. Australia”. se daten simplemente a partir de su contenido fósil. generalmente las rocas sedimentarias no se pueden datar por métodos radiomé- tricos. Schopf y B. . M. en Atizona. Las rocas de la parte inferior de la columna corresponden a un período que los científicos han llamado el Precámbrico. J. pp. pp. re que el entierro sea rápido para que el organismo se mantenga a salvo de la descomposición. Science. A mediados de los años '80. “Filamentous Microfossils from the 3.5-Billion-Year-Old) Mi- crofossils from Warrawoona Group. 260 (1993). Estados Unidos. pp. La búsqueda de las primeras formas de vida por parte de los científicos evolucionistas se ha concentrado en las capas inter­ medias de las rocas Precámbricas.500 millones de años atrás. 530-532. se lo llama “co­ lum na geológica”.

con una edad estimada de 3. Expelled: No Intelligence Allowed.M.500 millones de años.850 millones de años. que la vida debió haber llegado a la Tierra desde el espacio. incluso. llamada Panspermia. al ser presionado por su entrevistador.6 reconoció la imposibilidad de que la vida apareciera espontáneamente. 2008).com. Ben Stein. no pudo ofrecer ninguna explicación mecanicista y reconoció la posi­ bilidad de que la primera forma de vida llegara a nuestro planeta procedente de algún otro lugar en el espacio. Esta teoría. Evolution from Space (London: J.700 o 3. en su libro Evolution From Space [Evolución desde el espacio]. los científicos todavía no tienen una explicación factible ni experimentalmente viable de cómo pudo empezar la vida. Pero colocar el origen de la vida en una era fechada hace miles de millones de años no explica cómo pudo empezar la vida a partir de la materia inanimada. 1981). . Sir Fred Hoyle. A pesar de que se catalogaron como las primeras formas de vida conocidas. si 6Fred Hoye y Chandra Wickramasinghe. Ver: www. elocuente defensor de la evolución y profesor de la Universidad de Oxford. Documental para DVD (Premise Media Corporation. 7 Ben Stein. para que explicara cómo pudo haber comenzado la vida. En fechas más recientes. Dent and Sons.de fósiles filamentosos microscópicos en rocas sedimentarias de esa época. ¿Existe alguna prueba científica que sugie­ ra que la vida comenzó con la formación aleatoria de un organismo vivo a partir de compuestos químicos no vivos? Lo cierto es que después de más de cincuenta años de investigación y experimen­ tación.7 ¿Podemos afirmar con seguridad que es imposible que una cé­ lula viva aparezca espontáneamente? La respuesta es evidente. Algunos científicos famosos han sugerido. los científicos afirman que los primeros organismos vivos debieron aparecer m ucho antes: hace unos 3. En realidad. que responden a la necesidad de períodos de tiem po suficiente­ mente largos para que la Teoría de la Evolución parezca plausi­ ble. Ri­ chard Dawkins. fue divulgada hace unos años por el astrónomo de la Universidad de Cambridge.expelledthemovie. estas fechas son meras conjeturas.

660 tipos de ácidos nucleicos. Las proteínas son largas cadenas de aminoácidos. calculó las siguientes estadísticas: Una sola E. Usando estos datos. Escherichia coli and Sdlmonella (Washington. ed. profesor de Bioquímica de la Universidad de Loma Linda. EE. Ven www..htm. desde una 8 Cálculo realizado por George T. 14. Neidhardt. Los lípidos son las moléculas que forman las grasas. . también posee unos 24. Consideremos los componentes de la bacteria Escherichia coli. Javor. de lo contrario. la célula moriría. DC: ASM Press. 1996). incluyendo 4. En 1996 se publicó un juego de artículos en dos tomos.org/ origins/25002. que deben encontrarse en la con­ centración apropiada porque. con un total de 2.grisda. Si descontamos el agua. aunque no son biopolímeros verdaderos. en condiciones normales. consideramos que incluso la célula más simple es una maravilla de ingeniería mucho más compleja que cualquier maquina inventada jamas por la mente humana. Datos tomados de F.8 Todos estos componentes representan el 30% de la célula que.UU. que resumía los cono­ cimientos biológicos y bioquímicos sobre este organismo hasta la fecha. Estas moléculas funcionan de manera coordinada con aproximadamente 800 tipos distintos de intermediarios metabó- licos y 30 tipos de minerales.000 millones de moléculas de agua. los ácidos nucleicos son largas cadenas de nucleótidos y los polisacáridos son largas cadenas de moléculas de azúcar. más del 90% de los componentes celu­ lares están formados por biopolímeros.800 páginas. p.). C. La proporción adecuada de compuestos orgánicos. coli contiene millones de moléculas orgánicas (mo­ léculas características de los seres vivos que no se encuentran en la materia inerte). George Javor. un organismo unicelular que se encuentra en el tracto gastrointestinal humano y ha sido estudiado en detalle por los científicos. largas moléculas orgánicas formadas a base de bloques básicos más pequeños. y entre 50 y 100 tipos de lípidos. componentes inorgánicos y agua garantiza un entorno adecuado para las reacciones químicas que tienen lugar dentro de las estructuras de la célula. tres tipos de polisacáridos.000 tipos de proteínas. profesor de Bioquímica de la Universidad de Loma Linda (California.

9 El problema de crear una célula viva va mucho más allá de la formación de enlaces. cuya función principal es servir como catalizador de las reacciones químicas celulares. El A D N está formado por centenares de fragmentos llamados “genes”. previenen otras reacciones químicas colaterales indeseables. Es extraordinariamente difícil formar nuevos enlaces quími­ cos eliminando agua en un ambiente acuoso. es decir. constituye la información gené­ tica. si cada nuevo enlace requería perder agua.. es necesario expli­ car cómo pudieron formarse los enlaces químicos necesarios para dar lugar a cadenas mayores. . Un rasgo común de los biopolímeros es que los enlaces que mantienen unidos los bloques básicos se forman por deshidratación. además. ya que la secuencia específica de los bloques contiene información que rige las reacciones químicas responsables de la existencia de la célula. La funcionalidad de los biopolímeros de­ pende de que los bloques se ensamblen en un orden determinado. Esta característica supone un desafío para la Teoría de la Evolución química.42. 41.perspectiva bioquímica pueden agregarse para formar estructuras complejas tales como las membranas celulares. 9Ricardo y Szostak. Aun si los bloques individuales de los biopolímeros hubieran estado presentes. retiran­ do una molécula de agua. respon­ sables de los rasgos particulares de cada organismo. ibíd. tal como el ácido desoxirribonucleico (ADN). situados en un orden preciso. así como de los enzimas responsables por su funcionamiento y reproducción. Por ejemplo. y controlan que estas reacciones ocurran en el momento y el lugar apropiados. pp. Un gen es una cadena de miles de nucleótidos. la secuencia de aminoácidos determina el tipo de actividad química de cada proteína. al mismo tiempo. y a la velocidad necesaria. que asume el origen dé­ la vida en un ambiente acuoso. La secuencia de nucleótidos en un ácido nucleico. Esta información está codificada de manera tal que el A D N contiene instrucciones precisas para la fabricación de las proteínas que conforman las estructuras celulares. Hay un tipo especial de proteína llamada “enzima”.

. En el ácido ribonucleico (ARN). donde se encuentra la información necesaria para fabricar las proteínas y las enzimas celulares. 103 Envoltura celular 195 1 Procesos celulares 188 Metabolismo intermediario central 188 Metabolismo energético 243 i Metabolismo de ácidos grasos y lípidos 48 i Nucleótidos y moléculas relacionadas 58 | Funciones reguladoras 45 Reproducción 115 Transcripción 55 Traducción 182 C uadro 1: funciones de algunos genes de A D N de escherichia coli. Mediante el llamado “código genético”.10 Las funciones de algunos de estos genes han sido identificadas del modo que se presenta en el C uadro 1. 1. Blattner. coli contiene 4. : . G. encontramos una base similar. un grupo fosfato y una base nitrogenada. a la que se le asigna la letra U.474. I I . vol. citosina y timina. Guy Plunkett III. pp. Craig A. llamada uracilo. e informa al aparato celular de construcción de proteínas sobre la secuencia precisa de aminoácidos que debe ensamblarse.453-1. la secuencia de bases nitrogenadas de cada gencodifica una o más proteínas espe­ cíficas. guanina. Cada nucleótido está formado por una molécula de azúcar. Los genes son una especie de bibliotecas celulares. et al. 277 (1997). etc.. Frederick R. El A D N de E. “The Complete Genome Sequence of Escherichia coli K-12”. C yT. Bloch. comúnmente conocidas por sus iniciales: A. en vez de la base timina. Science.288 genes. Las bases nitrogenadas pre­ sentes en el A D N son cuatro: adenina. IMetabolismo de aminoácidos 131 Biosíntesis de cofactores.

Fraser. 270 (1995).750 tipos de biopolímeros asom­ brosamente complejos. que vive en el tracto genital humano. J. tiene solamente 471 genes. 397-403. ten­ drían que iniciarse en su interior cientos de reacciones metabólicas. viva. Science. O.. además. la /:'. con los intermediarios metabólicos precisos en concentraciones y lugares exactos. Esta última situación sería el equiva-1 11C.11 No obstante. hasta que. . “The Minimal Gene Complemenl ol My- coplasma Genitalium”. coli no es la célula más simple conocida. para que las reacciones se dieran en forma correcta. que realizan aproximadamente 800 reac­ ciones químicas diferentes en forma simultánea.288. Es decir: Para que la vida hubiese podido surgir a partir de materia inani­ mada. coli requiere cerca de 4. M. deberían haberse sintetizado en grandes cantidades miles de moléculas complejas especializadas. de hecho.El C uadro 1 contiene únicamente las funciones de 1. y en el caso de que haya ocurrido “milagrosamente”. la función de los restantes 2. D. La bacteria Mycoplasrna genitalium. ¿Puede imaginar un sistema de tal complejidad que aparezca por casualidad y funcionando de manera correcta? Por supuesto. Estas moléculas inorgánicas tendrían que haber interac­ tuado una y otra vez al azar. El sentido común nos dice que este tipo de reacciones no ocu­ rren por casualidad. Cada detalle del metabolismo y la infraestructura del organismo está codificado en su genoma. pp. porque en el m om ento de la publicación de la secuencia genética de E. vol. Para cobrar vida.551 genes de un total de 4. continúa siendo imposible que su ge­ noma se haya formado por casualidad. La supervivencia de un organismo unicelular tan simple como la E. et al.737 no había sido identificada. de algún modo. Sin embargo.6 millones de pares de núcleotidos. se formara una estructura similar a una célula. Gocayne. esta extraordinaria y compleja estructura todavía no estaría viva. eso no garantizaría que la célula resul­ tante estuviera. ni siquiera intencionadamente es posible hacer que ocurran. a partir de pequeñas moléculas inorgánicas. White. que consta de 4. controlados indirectamente a través de la acción de las proteínas.coli.

está muerto. Una vez que un organismo.. pero la célula está ahora muerta a causa de la rotura de su membrana citoplasmática por el disolvente químico tolue­ no. lente a una célula de E. tendría que haber cobrado vida rápidamente. polisacáridos) a partir de los biomonómeros. los defensores de la evolución química tendrían que demostrar que. b) crear gradientes eléctricos que la célula utiliza para generar energía. Una membrana celular intacta permite a) mantener distintas concentraciones de determinadas sustancias a uno y a otro lado de ella... Teóricamente. sin embargo. tendría que haber sido posible que: • . simplemente. Resumiendo: Para dar validez científica a su propuesta. bajo las condi­ ciones que supuestamente existían en una Tierra primigenia. imposible. • .. el organismo y sus complejos componentes y sistemas de información deben haberse fo rm a d o por procesos aleatorios. La evolución. las reacciones celulares regresan al equilibrio químico. La rotura de la membrana interrumpe la producción de energía celular y. • . Después de esto.750 tipos de biopolímeros se encontrarían en su lugar y todas las rutas metabólicas estarían establecidas.apareciesen las rutas metabólicas interdependientes que re- . ácidos. como resultado.. Los 4.se formaran los biopolímeros (proteínas. coli a la que se haya eliminado reciente­ mente con una gota de tolueno. no se le puede devolver la vida.se formaran los biomonómeros (bloques básicos. incluso el más simple. nucleicos. es.. no equivale solamente a traer a la vida a un organismo muerto. Sabemos qué habría que hacer. lista es una observación científica evidente. para evitar que se empiece a descomponer o dañarse por causa de las sustancias químicas y las radiaciones ambientales. hn primer lugar. para hacer que la compleja maquinaria ce­ lular se pusiera en marcha otra vez solo tendríamos que cambiar simultáneamente la concentración de los intermediarios metabó- licos para devolverlos a las concentraciones de la fase de desequili­ brio. pero no es posible lograrlo ni con la mejor tecnología. cosa que en la práctica significa la muerte celular. como ami­ noácidos o nucleótidos).

Los moléculas así formadas tenían un tamaño muy inferior al de los equivalentes celulares. pero solamente trabajando bajo con­ diciones ideales y utilizando versiones de nucleótidos modificadas para aumentar su reactividad química. matemático de la Uni­ versidad de Chicago y autor de The Design Inference: Eliminating Chance Through SmallProbabilities [La inferencia del diseño: Elimi­ nando el azar a través de pequeñas probabilidades]. No obstante.. se han encontrado con graves dificultades para lograr reproducir el paso 2.. • . en la que las re­ acciones químicas tuvieran lugar en la dirección apropiada. lo que las sitúa muy lejos de las complejas moléculas gigantes con información codificada que se requieren para la vida. Hasta el momento. ibíd. sino también que dichos biopolíme­ ros contengan información codificada específica. a causa de procesos aleatorios no dirigidos. . El paso 2 requiere no solo la formación de biopolímeros. man­ teniendo la célula en un estado estable de no equilibrio (viva).12 En estos experimentos. a fin de que estos cálculos sean significativos. guian la producción de los biopolímeros y la función celular.. y su secuencia era totalmente aleatoria y afuncional. tampoco se abordó el problema del origen de la información genética. 38-45. pp. El modelo evolu­ tivo requiere que la información haya sido codificada. Es cierto que se ha conseguido sintetizar algu­ nos biopolímeros pequeños. Esta pregunta ha sido respondida por William A. tenemos que establecer cuán improbable es un evento para considerarlo imposible en la práctica. que les permita interconectar las diferentes rutas metabólicas y permitir a la célula funcionar como un todo coordinado (paso 3).apareciese una célula completamente formada. los científicos han sido capaces de repetir en el laboratorio la mayoría de las reacciones requeridas para el paso 1. Dembski ha de­ l2Ricardo y Szostak. Dembski. La probabilidad de la aparición aleatoria de secuencias de pro­ teínas o genes con información codificada específica puede ser cal­ culada matemáticamente. Sin embargo.

. una molécula corta —una proteína de 100 aminoácidos de longitud-.13 Para el universo conocido. Este número corresponde a un 1 se­ guido por 150 ceros. y de he­ cho ocurre. o Vi. concluiremos que esa proteína o ese gen específico no pudieron aparecer por azar.150 veces. La probabilidad de construir una cadena de 100 ami­ noácidos que presente únicamente enlaces peptídicos es de 0/2)99. pp.000. en la que una es la imagen especular de la otra.000. por ejemplo. lo que representa aproximadamente 1 oportunidad de cada 1. un 1 seguido por 12 ceros. es decir. la probabilidad de tener cuatro enlaces peptídicos en una cadena de cuatro enlaces es Vi x Vi x Vi x Vi = 0/2)4 = 1/16. Para dar lugar a una cadena proteica funcional.) Utilizando este punto de referencia.000.000. o 1. 1998). podemos calcular la probabi­ lidad de autoformación de una secuencia específica de aminoácidos en una protema o una secuencia específica de bases en un gen. Dembski. o 1.000. con una probabilidad aproximadamente igual. es posible. y un billón es 1012. MA: Cambridge University Press. Si la probabilidad resultante es menor que 1 en 10. La síntesis aleatoria de aminoácidos produce ambas formas con una frecuencia similar. Según esto. 175-223. un 1 seguido por 6 ceros. The Design Inference: Eliminating Chance Through Small Proba- bilities (Cambridge. o 1 oportunidad de cada 16. del mismo modo en que la mano izquierda es el reflejo de la mano derecha. No obstante. (Nótese que un millón es 106. y la probabilidad de que haya surgido por casualidad a partir de sus componentes básicos.150. la probabilidad de que se forme un enlace peptídico en cualquier punto particular de la cadena en crecimiento es una de cada dos. Los aminoácidos en la naturaleza pueden aparecer en dos formas distintas. los aminoácidos deben unirse entre sí por medio de un tipo específico de enlace químico conocido como “enlace peptídico”. pero las proteínas funcionales de las células solo 13William A. cuando excede los recursos probabilísticos disponibles. que los aminoácidos se enlacen de otra manera.000. Por tanto. Consideremos. se ha calculado que esto ocurre cuando nos encontramos con una oportunidad en 10.030.mostrado matemáticamente que el azar puede ser eliminado como explicación plausible para un sistema especificado. es decir.

000 o 1/1023. con un programa de ordenador que asignara un carácter al azar (de entre los diez posibles) a cada una de las 23 posiciones del mensaje. En este mensaje hay un total de 23 caracteres.030. La probabilidad de colocar el aminoácido correcto en el sitio correcto es de 1 vez cada 20 oportunidades. la probabilidad de tener 100 aminoácidos L for­ mando una cadena con solamente enlaces peptídicos es 1/1060.utilizan una de ellas. llamada forma D. Imaginemos que queremos generar este mensaje aleatoriamente. a 1 vez cada 10. lo que corresponde. Para obtener una proteína funcional que contenga información significativa. sería de (Vi2) 100.000.000. que pueden ser considerados como las letras empleadas para escribir un mensaje. la probabilidad de incorporar una forma L a una cadena proteica sería de 1/2. esto es 1/ 100. Por lo tanto. y la probabilidad de incorporar 100 aminoácidos. con diez tipos diferentes: 9 letras más el espacio.000. lo mismo para que la segunda sea una “e”. los aminoácidos tienen que incorporarse siguiendo una secuencia específica. A menos que los aminoácidos estén en la secuencia correcta. igual que las letras del alfabeto deben estar organizadas de cierta secuencia para producir una frase con sentido. la llamada forma L.000. Hasta aquí solo hemos considerado aspectos estructurales. esto representa una oportunidad de 1. La probabilidad de obtener la frase completa es de una en 10 x 10 x 10 x 10 x 10 x l O x l O x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 x 10 intentos. el mensaje no transmitirá la información ne­ cesaria y la célula no funcionará correctamente. Si ambas formas se encontraran en la misma proporción en el ambiente.000.130.000. Pero todos estos aminoácidos necesitan . Por ejemplo. y así sucesiva­ mente. Igual que an­ tes. Teniendo en cuenta ambos requisitos. pero aún no hemos tenido en cuenta el requisito de la información. que son 19 letras y cuatro espacios. aproximadamen­ te. considere el dicho: “De tal palo tal astilla . todos ellos de forma L. La probabilidad de que la primera letra sea una “ti” será de 1/10. Los sistemas biológicos contienen 20 aminoácidos diferen­ tes. y nunca la otra. la probabilidad de formar por casualidad una proteína específica de 100 aminoácidos de longitud sería (1/20)100.

que puede comprender miles.130 x 10. Function. Sauer. 306-310. Reidhaar-Olson y R. los científicos han calculado que el ser vivo más simple posible requeriría un genoma mínimo de 250 a 14J. Journal o f Molecular Biology. Y. el cálculo está basado sobre una proteína relati­ vamente pequeña. la probabilidad de que se cumplan las tres condiciones a la vez es de 1 vez cada 10. de bases nitro­ genadas. Además. o 1/10190. D. 7 (1990). ser aminoácidos L y tienen que estar conectados entre sí por enlaces peptídicos. 301. y algunas son mucho más largas. A partir de estudios con organismos unicelulares. Por otro lado. pues. “Biological Function Places Unexpectedly Tight Constraints on Protein Sequences”. vol.150 (cuarenta ceros más a la derecha) y. Ver también: D. váli­ das. e incluso millones. pp. define el máximo límite de probabilidad de que un evento de­ term inado haya ocurrido en alguna parte del universo durante el tiempo de existencia del universo. and Genetics. por lo tanto. y la pro­ babilidad de que una secuencia funcional de aminoácidos haya surgido por casualidad resulta equivalente a encontrar ¡un átomo particular en todo el universo!14 Si en lugar de una proteína consideramos el caso de un gen. lo que reduciría aún más las probabilidades de formar una proteína co­ rrecta. Este número es m ucho más grande que 10. “Functionally Acceptable Solutions in Two Alpha-Helical Re- gions of Lambda Repressor”. vol.30 x 10. N° 3 (2000). tampoco tiene en cuenta el hecho de que hay aminoácidos en la naturaleza que no forman proteínas. pp. se requeriría mucho más que un solo gen. 585-596. las probabilidades de obtener una secuencia aleatoria que contenga información significativa son ínfimas. PROTEINS: Structure. El cálculo mostrado anteriormente no tiene en cuenta que hay otras secuencias con el mismo número de aminoácidos que po­ drían contener información alternativa y ser. Una proteína biológica típica consta de unos 300 aminoácidos. según Dembsky. por supuesto. . Axe. Así. Bioquímicos de la Universidad de Cambridge y del Instituto de Tecnología de Massachusetts han publicado cálculos más detallados.30 veces.

and Explanation”. 16 Puede encontrarse una discusión detallada del cálculo de las probabilidades con refe­ rencias a literatura de apoyo en: S. 1.150. Mushegian y E. Los defensores de la evolución química están apoyando y enseñando un modelo no corroborado desde hace más de 80 años. descubrimos que todavía no se ha propuesto ninguna explicación mecánica o naturalista plausible sobre el modo en que comenzó la vida.400 genes. vol.discovery. ignorando múltiples evidencias de que la abiogénesis no es posible. . and Public Education (Michigan: Michigan State University Press. Design. Cuando se examina atentam ente la literatura evolucionista desde sus inicios hasta la actualidad.15 Es evidente que la probabilidad de que la vida haya aparecido por casualidad. 2003). C.or- g/a/2184. “A Minimal Gene Set for Cellular Life Derived by Comparison of Complete Bacterial Genomes”. Ver también: A. pp. lo que nos permite concluir que la abiogénesis es imposible:16 un organismo vivo no puede surgir de la materia inanimada por medio de procesos aleatorios. Koonin. 15 E. 10.273. aun en su forma más simple. Science. es m uy in­ ferior a 1 oportunidad en 10. 93 (1996). Extracto disponible en línea: www.099. Speciation. Darwinism. vol. 272 (1996). “DNA and the Origin of Life: Informa­ tion. Proceedings ofthe Natio­ nal Academy o f Sciences ofthe USA. “Seeking Life’s Bare Genetic Necessities”.268-10. Pennisi. Meyer. pp.098-1.

¿MUTACIONES
ALEATORIAS?
POR Q l Jl M í J ! -I II. I )| .N I VOLUCIONAR NUEVOS TIPOS DE
OÍAiANIDMí )í - 1' ( HI MI: DIO DE MUTACIONES ALEATORIAS

1 concepto de evolución forma parte de la enseñanza de la Bio-
“ “ logia en muchos países. Películas documentales, como la serie
de la BBC The Genius o f Charles Darwin [El genio de Charles
Darwin], presentan la evolución a las grandes audiencias, y su mensa­
je expresa que la evolución es un hecho científico. En 2009, el presen­
tador de ese programa, profesor Richard Dawkins, de la Universidad
de Oxford, publicó un libro incluyendo lo que para él es una gran
acumulación de evidencias a favor de la evolución. En las primeras
páginas, Dawkins afirma: “En el resto de este libro, demostraré que
la evolución es un hecho ineludible”.1 Pero ¿lo es verdaderamente?

1 Richard Dawkins, The Greatest Show on Earth: The Evidence fo r Evolution (London:
Bantam Press, 2009), p. IB.

En este capítulo revisaremos con cuidado las evidencias propuestas
con el fin de apoyar la piedra angular de la Teoría de la Evolución:
la afirmación de que las mutaciones aleatorias, filtradas por la selec­
ción natural, pueden dar lugar a formas de vida totalmente nuevas, en
forma gradual. Empecemos por comprobar si las mutaciones, junto
con la selección natural, son capaces de producir toda la información
genética necesaria de modo de generar la diversidad de la vida pasada
y la actual en la Tierra.
La información genética es responsable por la forma y la fun­
ción de un organismo, y está codificada en su AD N . Incluye la
información para producir todos los componentes físicos de un
espécimen: piel o corteza, y pelaje; órganos internos y externos;
huesos; concha o caparazón; raíces y hojas; color; sistemas diges­
tivo, nervioso, reproductor, óptico, inmunitario; forma física; ce­
rebro, etc. También codifica miles de enzimas y otras proteínas;
y hormonas y moléculas específicas, como las toxinas de defensa.
La evolución requiere que la información genética específica de
cada tipo de animal, planta, hongo o bacteria haya surgido por
medio de mutaciones aleatorias. Y posteriormente, a causa de los
depredadores y otras presiones ambientales, la información ge­
nética menos ventajosa habría sido eliminada, quedando única­
mente aquella que beneficia a los organismos que la contienen.
Dawkins afirma:

“En el caso del A D N , comprendemos bastante bien cómo la
información contenida aum enta durante el tiempo geológico.
Darwin lo llamó selección natural”.2

A partir de los conocimientos bioquímicos actuales sobre el
A D N , pretendo demostrar que las mutaciones aleatorias y la se­
lección natural son incapaces de producir la información gené­
tica requerida para la evolución de los millones de especies dife­
rentes de seres vivos. Para ello, revisaremos las evidencias reales,

2Ibícl., p. 405.

tal como las observamos hoy, y las contrastaremos con algunos
conceptos teóricos del pasado.
Dentro de las ciencias naturales, el término “evolución” se uti­
liza para describir los cambios graduales que pueden ocurrir en
una población en un tiempo más o menos largo. Muchos cambios
morfológicos y fisiológicos son el resultado de cambios en la infor­
mación genética codificada en el A D N . Los cambios en el A D N
se llaman “mutaciones”. Las mutaciones pueden ser espontáneas
o provocadas, y tienen el potencial de provocar significativos cam­
bios visibles en los organismos. La inducción de mutaciones en
animales de laboratorio es una técnica común en investigación
médica, y también se utiliza para la modificación de variedades
vegetales y animales de granja.
En teoría, hay tres maneras distintas de cambiar la informa­
ción genética del A D N por medio de mutaciones, de manera
que estas puedan contribuir a la evolución de los organismos.
Para facilitar la comparación entre ellas, vamos a describirlas
como Evolución tipo 1, tipo 2 y tipo 3.
• Evolución tipo 1: Consiste en la pérdida de información ge­
nética preexistente. Supongamos que una población de ratones con­
formada por ratones de pelaje claro y de pelaje oscuro se traslada a
un área arenosa de color claro. En esa zona, los depredadores verán y
atraparán con mayor facilidad a los ratones oscuros y, después de un
tiempo, pueden llegar a eliminarlos completamente. Si el color del
pelaje es un rasgo genético y el gen para pelaje oscuro desapareciera
de la población, se habrá producido un cambio permanente causado
por selección natural. Esta situación, sin embargo, es infrecuente en
la naturaleza. Muchas veces, los genes que suponen una desventaja
permanecen en la población en proporciones bajas, porque algunos
individuos siguen portando la información en sus genes aunque esta
no siempre se manifieste. En el ejemplo de los ratones, algunos indivi­
duos podrían todavía mantener la información para pelaje oscuro en
su A D N y producir, de vez en cuando, crías de pelaje oscuro. Si en el
futuro algunos ratones migraran a otra zona donde los ratones claros
se vieran desfavorecidos, los ratones oscuros aumentarían en número
en la nueva población. En este ejemplo, no se crea información gené-

NUTACIONES ALEAl'ORIAG?

cica nueva; se observan cambios evolutivos causados por selección na­
tural, que favorece la supervivencia en un nuevo ambiente por medio
de la eliminación de información genética no favorable.
Este mismo mecanismo explica algunos de los ejemplos típicos
utilizados para apoyar la evolución, como el hecho de que los guppys
machos desarrollen colores más brillantes cuando son liberados en
arroyos donde hay pocos depredadores.3 En corrientes con una alta
densidad de depredadores, los guppys macho más fáciles de ver son
comidos antes de que puedan reproducirse, así que, se reproducen
principalmente los peces de coloración menos vistosa. No obstante,
algunos de los guppys supervivientes de color apagado portan todavía
los genes de los colores brillantes, por lo que de vez en cuando aparece
algún macho llamativo; que suele ser devorado enseguida. Si algunos
de los guppys de colores apagados se liberaran en una laguna con po­
cos depredadores, los machos de colores intensos que nazcan podrían
sobrevivir hasta la edad adulta. Como estos atraen más a las hembras,
se reproducen de manera más efectiva y producen más descendencia
de colores brillantes. Por lo tanto, la reaparición de peces de colores
vivos y la evolución de la población hacia una mayor abundancia de
estos no implica nueva información genética.
O tro punto para destacar es que, en estos ejemplos y otros
similares que aparecen en los libros de texto de Biología, los su­
puestos cambios evolutivos involucran a un único tipo de orga­
nismo.4 Los ratones son ratones antes y después de los cambios,
los guppys siguen siendo guppys; las polillas, polillas; y las ra­
nas, ranas. N o hay ningún ejemplo de polilla que evolucione en
mosca, o viceversa. En otras palabras, la pérdida de información
genética no resulta en un nuevo tipo de organismo, sino solo en
una variante de este.
La selección natural puede actuar de diferentes maneras sobre la
información, sin necesidad de eliminarla por completo. Los efectos

3Ibíd., pp. 133-139. Ver también: Linda R. Berg, Diana W. Martin y Eldra P. Solomon,
Biology, 7“ ed. (Belmont, CA: Thomson, Brooks/Cole, 2005), pp. 349, 350.

4Berg, Martin y Solomon, Biology, 7a ed., caps. 17-19.

ambientales pueden provocar cambios en los organismos activando (o desactivando) la actividad de genes presentes en el ADN. La editorial lee el informe m utado y empieza a publicar libros sobre evolución. Nuestra “m utación” ha resultado en una pérdida de infor­ mación. un gen X en particular puede ralentar o incluso apagar un gen Y. Cuando los depredadores son eliminados de la ecuación. Por consiguien­ te. pero aletargada. La técnica de destruir información genética para producir rasgos nuevos ha sido usada para la mejora de variedades de cultivo durante . Por ejemplo. en forma de estrés por depredación. la información destruida por nuestro blanqueador cambiará la in­ formación (el mensaje) codificada en la oración. no será leída ni estará disponible para ser utilizada. la presión ambiental. Si con un blanqueador químico borramos la palabra N O . como un color distinto. como una sustancia química o algún tipo de radiación. afectara al gen X y le impidiera realizar su función de apagar al gen Y. de ma­ nera que machos vistosos aparecerían como apagados. Por consiguiente. Los genes pueden ser activados o desactivados por otros genes o por compuestos químicos en el entorno de la célula. El mensaje m utado ha activado una acción preexistente. podría desactivar los genes responsables por la producción de color. Si un factor ambiental. la editorial no publica ningún libro sobre evolución. el gen Y se activaría y su información genética po­ dría expresarse en forma de un nuevo rasgo. La desactivación de un gen supone que aunque la información está presente. Por ejemplo. considere un editor leyendo este informe: “LA MAYORÍA D E LOS C IEN TÍFIC O S N O CREE EN LA E V O L U C IÓ N ”. En el caso de los guppys. pero todavía tiene sentido. La ac­ tivación de un gen implica que la información contenida está dis­ ponible para ser expresada en el organismo. la disminución de la presión ambiental causaría la reactivación de la información genéti­ ca existente para la producción de colores vivos. se envía este nuevo informe al editor: “LA MAYORÍA D E LOS C IE N T ÍFIC O S CREE EN LA E V O L U C IÓ N ”.

280. Ver también: G. 1. con almidón menos ramificado y. los cambios ambientales provocan variaciones en la forma en que se pliega y empaqueta la extensa molécu­ la circular de ADN. Pode­ mos mencionar el caso de los compuestos químicos que desactivan o destruyen los genes que codifican la proteína-1 del gránulo de almi­ dón (SGP-1). vol. luego. “DNA Topology and the Global Control of Bacterial Gene Expression: Im- plications for the Regulation of Virulence Gene Expression". No se crea ninguna información nueva. esas semillas son germinadas. porque es probable que estas semillas contengan una mayor diversidad genética. responsable por la síntesis de las cadenas ramificadas de almidón en las semillas. con un menor índice glucémico que el maíz común. En las bacterias. 175-203. W. . pp. miles de semillas son expuestas a ra­ diación ionizante o a productos químicos que dañan las moléculas de ADN. de maíz. / A j I a u ü NES AL. y estos cambios afectan la activación o la desactiva­ ción de determinados genes. de­ bemos recordar que. comparada con las variedades domés­ ticas. 36 (2002). Hatfield y C. un menor índice glucémico.5 5C. Por esta técnica. Dormán. “DNA Topology-mediated Control of Global Gene Expression in Escherichia coli”. Los cambios en el entorno físico de la célula que ejercen presión física sobre el propio ADN también pueden afectar la actividad de la infor­ mación genética. etc. pp. Para la mejora de variedades de cultivo. lo cual supone una ventaja para el consumo por personas diabéticas. los nuevos rasgos se deben a la pérdida de información. pero esta capacidad también utiliza información genética preexistente. para buscar posibles rasgos beneficiosos como resistencia a la sequía.271-1. Destruir genes en especies silvestres incrementa la posibilidad de producir un rasgo beneficioso en su descendencia.EATORiAS? muchas décadas. los especialistas suelen escoger semillas de ubicaciones silvestres que no hayan estado sometidas a demasiada selección. no se ha creado ninguna información genética nueva. vol. Después. por ejemplo. La descendencia de estas plantas producirá un grano. Esta es una estrategia de las bacterias para sobrevivir a cambios repentinos en su ambiente. . toda semilla que logre crecer es examinada. Benham. 141 (1995). en todos estos casos. J. J. Micmbiology. Animal Review ofGenetics. por lo tanto. No obstante.

Como los errores de copia se producen al azar. Van Ryk. 277. Todos ellos son sim­ plemente casos de evolución tipo 1. en el Canal 4. con lo que las nuevas células poseerán un A D N ligeramente modificado. donde las especies implicadas han perdido información genética. causada por la eliminación de 32 pares de bases de in­ formación. vol. Rather Than by Receptor Sequestration”. o incluso queden inutilizados por completo. al menos. Venkatesan. et a l. parte 1. lo que provoca que la enfermedad se detenga o. N° 3 (2002). el profesor Richard Dawkins afirma que las mujeres de Nairobi resistentes al V IH son evidencia de la “imparable fuerza de la se­ lección natural”. lo más probable es que el gen o los genes afectados por el cambio sufran de alguna alteración en su funcionalidad. Journal o f Biológica! Chemistiy. The Genius o f Charles Darwin. Documental para televisión (exhibido el 4 de agosto de 2008. “Reduced Cell Surface Expression of CCR5 in CCR5Delta 32 Heterozygotes Is Mediated by Gene Dosage. por no decir de un nuevo tipo de organismo. un claro ejemplo de una mutación que comprende pérdida de información genética. sin embargo. 7S. .287-2. se ralentice. el receptor celular que el V IH utiliza para entrar en las células es defectuoso y no es funcional.7 Aunque esta mutación tiene un efecto beneficioso indiscutible para las mujeres que la poseen. Este problema se repite en cada uno de los ejemplos citados en los libros de texto y en los documentales a favor de la evolución. 2. Petrovic. es atribuible a la pérdida de la in­ formación genética preexistente. En la primera parte del documental E l genio de Charles Darwin. Como resultado. La resistencia observada resulta de una mutación del gen CCR5 en las mujeres. pp. A. como un ojo o una pierna. L. Los cambios en el A D N que producen desactivación o destruc­ ción de genes también pueden darse a causa de errores durante la replicación del A D N previo a la reproducción celular.6 Este es. Reino Unido).301. 6Dawkins. lo que resultará en una pérdida de información y una posible evolución de tipo 1. D. y no sirve como ejemplo de que la evolución podría producir la información genética necesaria para la evolución de nuevos órganos.

3 (2000).S178.000 pares de bases. pudiendo ambos pertenecer a especies distintas. pp. N° 10 (2008). vol. Jonsson. S173. R. Beckman. 444-450. R. “Cancers Exhibit a Mutator Phenotype: Clini- cal Implications”. M. La información genética adicional puede incor­ porarse al A D N de un organismo a través de virus. vol. “CCR5-. Antonarakis. H. et ah. Este plásmido puede transferirse desde una inofensiva bacteria Escherichia a bacterias patógenas. 159. Orr. N. que está formado por 90. Krawezak y D. la evolución tipo 1 es la más común. 30-36. pp.8 y muchas son responsables por enfermedades ge­ néticas o heredadas. ibíd. las mutaciones son en realidad perjudiciales. y se co­ rresponde con el tipo de evolución implicado en los ejemplos que se usan normalmente como evidencias de que la evolución es un hecho. Cáncer Research. . D. de proteínas que se comportan de manera similar a los virus. J. ci­ tada por el profesor Dawkins como ejemplo de m utación bene­ ficiosa en relación con la transmisión del V IH . Sríentific American (enero de 2009). ¿MU iA l' iUN ES ALEA \ £j RiASE En la mayoría de los casos. E.32 Mutation Is Strongly Associated with Primary Sclerosing Cholangitis”. pp. 10*Incluso la m utación CC5 Delta 32. Pandeya.551-3. pp. “Disease Causing Mutations in the Human Genome”. A. o de plásmidos que pueden portar genes específicos. J. European Journal ofPediatrics.12 Sin embargo. supl. la estreptomicina y al­ gunos otros antibióticos. A. como la 8A. 9 S. vol. porta genes para la resistencia frente a la sulfonamida. Por ejemplo. Loeb. este tipo de evolución no puede crear nuevos órganos ni nuevas clases de organismos y. 68. • Evolución tipo 2: Comprende la transferencia de informa- cion genética de un ser vivo a otro.. el plásmido R100. 10L. Cooper. 30-36. 12 Orr.557. 5 (2004). “Testing Natural Selection”. ha sido reciente­ m ente relacionada con un incremento del riesgo de contraer una grave enfermedad hepática. Eri. M. por lo tanto. 3. no puede ser un mecanismo para explicar la existencia de los millones de clases de animales y de plantas que han sido descubiertos. Genes and Immunity. Bielas y R.9 Muchos cánceres y tumores malignos que afectan a animales y a seres hum anos pueden relacionarse con mutaciones de tipo l .11 Resumiendo.

la superficie del óvulo contiene proteínas específicas que se unen solamente a moléculas complementa­ rias específicas de los espermatozoides de la misma especie. que tanto preocupan a los procesadores de alimentos. La inserción de estos genes resulta en la evolución de una nueva especie de la Salmonella resistente a los antibióticos. En caso de que estos se formen. ibíd. Las plantas poseen un sistema de reconocimiento molecular similar. la cepa potencialmente letal de la Escherichia coli que se conoce con el código 0 1 5 7 :H 7 pudo haber evolucionado a partir de una bacteria E. son generalmente abortados o se transforman en adultos estériles. Martin y Solomon. Puede producir una nueva cepa de un organismo. normalmente. vol. solo la transferencia de un organismo a otro de información genética preexistente. Algunos de estos mecanismos impiden que dos especies diferentes se apareen en­ tre sí y produzcan un nuevo tipo de ser vivo. i iMPOSK Salmonella. A. Esto impide. pp. De he­ cho. Australian Veterinary Journal. pero no un nuevo tipo de organismo.14 Podríamos 13K. 73. 14Berg. de manera que los granos de polen no suelen germinar sobre el estigma (la parte femeni­ na de una flor) de una especie diferente de planta. Bettelheim. en la reproducción sexual que incluye un óvulo y un espermatozoide. por transferencia de genes codificadores de toxinas de alguna otra bacteria. “Enterohaemorrhagic Escherichia coli: A New Problem. De forma semejante. p. Por ejemplo. . an Oíd Group of Organisms”. coli no patogénica. Es interesante notar que todas las especies poseen mecanis­ mos responsables por m antener su integridad. N°1 (1996). 20-26. pudieron haberse desarrollado en los últimos 50 años como consecuencia de la transferencia entre bacterias de genes codificadores de toxinas y genes de resistencia a los ácidos.. 130. Este es un ejemplo de mecanismo antievolutivo que se puede observar en la naturale­ za. se cree que muchas de las bacterias responsables por intoxi­ caciones alimenticias. la formación de embriones híbridos.13 La evolución tipo 2 tampoco implica la creación de infor­ mación genética totalmente nueva.

los me­ canismos de enfoque. • Evolución tipo 3: Com prende la generación de informa­ ción genética útil totalm ente nueva dentro del A D N de un organismo. El biofísico Dr. 107. estructuras sensoriales. incluso los más sencillos. no hay ningún mecanismo conocido que pueda explicar la formación de las grandes cantidades de información genética que requiere la aparición de miembros articulados durante la evolución de los artrópodos (crustáceos.apologetics. insectos y arañas). de la información necesaria para el desarrollo y el funcionamiento de todos sus componentes: las lentes. y la programación del cerebro para usarlas.” 2007.aspx. Not by Chance! Shattering the Módem Tlieoiy ofEvolution (New York: Judaica Press. m úscu­ los. ya que combinan información genética procedente de dos organismos de distinta especie.decir que los híbridos naturales. etc. a partir de ancestros que no los poseen.. Explicar la aparición de novedades evolutivas. De forma semejante.. 1997). el nervio óptico. En línea: www. “Just Add Energy. son ejemplos de evolución tipo 2. estructu­ ras u órganos totalm ente nuevos es un desafío im portante para la Biología evolutiva. .] La macroevolución tam bién trata de descubrir y de explicar 15Lee M. profesor de las uni­ versidades de Harvard y Johns Hopkins. órgano o función que no existía anteriormente. que resulta en una estructura. articulaciones. la formación del primer ojo implicaría la aparición simultánea.org/JUSTADDENERGY/tabid/82/Default. Inc. Spetner. etc.15 En realidad. Lee Spetner. o la formación de ojos. señala que la evolu­ ción de tipo 3 nunca ha sido observada. Según un libro de Biología ampliamente utilizado: “Una preocupación de la macroevolución es explicar las novedades evolutivas. Ver también: A. o que desarrollara ojos y la percepción sen­ sorial asociada a ellos. p. sus mecanismos de control. las vías de suministro de sangre. La aparición de un nuevo tipo de patas requeriría cantidades masivas de información genética para co­ dificar las distintas partes: exoesqueleto. cuando raramente se producen. que son grandes cambios fenotípicos [. Mclntosh... Un ejemplo hipotético sería un gusano que desarrollara patas articuladas junto con un nuevo tipo de locomoción. en el A D N .

Martin y Solomon. p. tal como propone la Teoría de la Evolución darwiniana.evolution. se cita un único ejemplo de evolución de tipo 3: los experimentos realizados por el bacterió­ logo Richard Lcnski y sus colegas de la Universidad del Estado de M ichigan.shtml.6 millones de pares de bases tuvo la oportunidad de mu- tar al menos una vez a lo largo del experimento. 18 Dawkins.16 Un sitio web educativo de prestigio lo expone de forma mucho más franca: “Los biólogos no discuten sobre esta conclusión [que la vida sobre la Tierra ha evolucionado]. Pero están tratando de ima­ ginarse cómo ocurrió la evolución. “The Big Issues”. 131. 377. ibíd. de 470 páginas. los evolucionistas no han encontrado ningún mecanismo capaz de generar estas novedades evolutivas. coli.17 Hasta la fecha. así que. después de más de 3E500 16Berg. El Dr. Durante este tiempo. Uno de los libros recientes que argumentan a favor de la Teoría de la Evolución con supuestas evidencias es The Greatest Show on Earth: The Evidence jb r Evolution [El espectáculo más grande de la Tierra: Evidencias de la evolución]. el único cambio evolutivo importante. . 17Evolution 101!. cambios importantes en la diversidad de las especies a lo largo del tiem po. Sin embargo. podemos decir que cada uno de los 4. y ese no es un trabajo fácil”.. El número total de mutaciones era superior al número total de bases del A D N de E. Richard Lenski y un equipo de investigadores del Depar­ tamento de Microbiología y Genética Molecular investigaron las mutaciones producidas en 12 poblaciones inicialmente idénticas de la bacteria Escherichia coli a lo largo de más de tres décadas. las bacterias produjeron decenas de miles de generaciones y experimentaron miles de millones de mutaciones. la evolución de tipo 3 se acepta como un hecho porque es necesaria para generar nuevas clases de organismos cada vez más complejos. Sin em­ bargo. En línea: www.edu/evosite/evol01/ VIIBigissues.. p. ibíd.berkeley.18 Examinaremos en detalle esta importante afirmación. En esta obra. del profesor Richard Daw- kins.

J (En bio­ logía. afecta la expresión genética. y fue reactivado en la cepa m utante. pero las cepas no m utantes carecen de una molécula transportadora específica para este compuesto químico. cualquier E. La cepa m utante. desarrollaron defectos en sus mecanismos de reparación del A D N . lo que conduce a tasas de m utación más altas. lo que. Proceedings o f the National Academy o f Sciences. D. la información genética para el transporte ya estaba presente en el organismo. Aparecieron. . pp. vol. El Dr. posee una molécula transportadora funcional. un tercio del total. C.|. por lo que no nos encontramos ante un ejem­ plo real de evolución tipo 3. capaz de utilizar citrato. fue el hecho de que una de las poblaciones adquirió la capacidad de utilizar el ión químico citrato como fuente de ali­ mento. El Dr. N° 23 (2008).¡>c-aeraciones. 105. 7. coopción es la adquisición de una nueva función por parte de una estructura preexistente. Borland y R. Lenski y sus colegas no están seguros del mecanismo exacto implicado en la m uta­ ción. esto es. también. Blount. El único ejemplo presentado por Dawkins de que el binomio mutaciones aleatorias-selección natural puede producir información genéti­ ca novedosa ha resultado no ser válido. Cuatro de las poblaciones. diferencias en los niveles de salud entre las poblaciones. sino de evolución tipo 1. es que “un transportador especifico de otra sus­ tancia ha sido cooptado para el transporte de citrato”. cosa que la mayoría de las bacterias E. Z.899-7. que consideran más probable. en todas las poblaciones. O tra posibilidad. como es sabido. U na explicación sugerida es que el gen transportador es­ taba presente pero inactivado por mutaciones anteriores.19 19 Z.906. Lenski. Diez poblaciones desarrollaron cambios en el empaquetamiento de su A D N . las generaciones sucesivas crecieron más rápido y crearon células de tamaño mayor que sus antepasados. Lenski y sus colegas informaron tam bién de otros cam­ bios evolutivos durante sus estudios. coli tiene el metabolismo interno ne­ cesario para utilizar citrato. En realidad.) En cualquiera de los dos casos. coli no puede hacer. Por ejemplo. E. “Historical Contingency and the Evolution of a Key Innovation in an Experimental Population of Escherichia coli”.

miles de nuevos genes tuvieron que formarse por mutaciones aleatorias.com/pubs/2008bCluneEtAl. es decir. Lenski y sus coin­ vestigadores han servido también para demostrar que la selección natural es. después de millones y millones de mutaciones indivi­ duales ocurridas durante más de 44. PLoS Comput Biology. que probablemente ya estaba codificada de forma latente dentro del A D N del organismo. contienen mucha más información genética. “Natural Selection Fails to Optimise Mutation Rates for Long-Term Adaptation on Rugged Fitness Landscapes”. Lenski eran todavía bac­ terias E. casi 50% más que las bacterias. et al. En pri­ mer lugar. No se convirtieron en bacterias anaerobias gram-nega- tivas. Los estudios divulgados en 2008 por el Dr. de 4. 4. D. no evolucionaron para transformarse en otro tipo de bacterias. Misevic. en realidad. Las levaduras tienen aproximadamente 6.pdf. donde la adecuación a la supervivencia en el medio ambiente es compleja. . Ofria. N° 9 (2008): el000187. Pongamos por caso la evolución de un organismo similar a la levadura común. Si las bacterias evolucionaron para conver­ tirse en levaduras. un mecanismo m uy pobre para optimizar las tasas de mutación en escenarios de tipo m undo real. El resultado evolutivo más importante fue la producción de una nueva molécula transportadora. Clune.. ‘. ninguna de las miles de millones de mutaciones fue capaz de producir información genética nueva. vol. En línea: http://www. La información codificada en un parásito as­ cáride (Ascaris lumbricoides) está contenida en un A D N de 97 mi- 20J. a partir de una bacteria unicelular tipo la E.5 k v í p o s ?í . ¡Y una levadura continúa siendo un organismo unicelular! La evolución de un organismo multicelular requeriría la creación de una cantidad mucho mayor de informa­ ción genética nueva.' Aún así. necesitaríamos aumentar el número de pares de bases del A D N .20 La evolución de tipo 3 requiere que se produzca abundante cantidad de información genética nueva para poder seleccionar la más apta para la supervivencia.6 millones a 12.000 genes. y estos son mucho más grandes. coli. la Saccharomyces cerevisiae. como la Shigella o la Salmonella. No desarrollaron núcleo.oMa. C. En otras palabras.1 millones. coli del experimento del Dr. coli-. e «-q «J{:. todas las bacterias E.000 generaciones.

y estos genes son mucho más largos y complejos que los genes de las levaduras. La evolución de una levadura a uno de estos gusanos reque­ riría la creación de 13.000 genes adicionales de información gené­ tica nueva. MU :¡0 NES ALEATORIAS? llones de pares de bases. La levadura. tiene una estructura genética muy distinta de la de una bacteria. Es importante enfatizar que se requiere información genética to­ talmente nueva para que la Teoría de la Evolución funcione. junto con los cálculos de probabilidad desarrolla­ dos en el capítulo anterior. veríamos que la cantidad es enorme en cada paso. sugieren que la probabilidad de que la información genética necesaria para crear una levadura a partir de una bacteria es tan baja que es imposible en la práctica.oml. la levadura Saccharomyces cerevisiae presenta un tipo de reproducción particular. Functional and Comparative Genomics Fact Sheet. . por medio de mutaciones aleatorias no dirigidas.gov/sci/ techresources/HumanJjenome/faq/compgen. . A y B. la posibilidad de una evolución tipo 3 se complica con­ siderablemente. aunque unicelular. Los experimentos del Dr.shtml. La in­ formación genética necesaria para crear una levadura en un m un­ do de bacterias no se asemejaría a nada que hubiese existido antes. que solo se aparean entre sí. complejos sistemas de reconocimiento celular. pues su A D N se encuentra concen­ trado en el núcleo. Lenski.21 Si siguiéramos subiendo en el árbol evolutivo. toda esta información genética surgió por casualidad como consecuencia de sucesivas mutaciones aleatorias. Además de la información necesaria para los nuevos procesos de repro­ ducción no presentes en las bacterias. De acuerdo con la Teoría de la Evolución. y calculáramos la información genética nueva requerida para la aparición de nuevos organismos de nivel superior. repartidos en aproximadamente 19. también se habrían tenido que desarrollar.000 genes. formados por mutaciones aleatorias. Además. modificado por última vez el 19 de septiembre de 2008. Existen dos tipos celulares distintos. Véase http://www. Si esto es así cuando nos referimos a organismos muy sencillos que se repro­ ducen a gran velocidad y tienen un gran potencial para sufrir m u­ taciones. cuando consideramos cambios entre organismos 21 Human Genome Project Information.

y en el laboratorio. Y aun quedaría por mencionar los miles de millones de genes diferentes que exis­ tían en el pasado y que se han perdido debido a la extinción. son miles de millones de genes distintos. no ha habido tiempo suficiente. La mayoría de las bac­ terias se duplican en un lapso de entre una y tres horas. se requeriría un tiempo miles de veces más largo a fin de que las mutaciones aleatorias puedan acumularse en las células reproductoras hasta dar lugar a nueva información genética significativa. o de cada una de las 31.153 especies de peces. una vaca tiene los suyos. Es decir. un ri­ noceronte tiene genes específicos de rinoceronte en su AD N . Por lo tanto. la E. los que determinan las características particulares cada una de las 1.734 especies de reptiles.22 Pero el ratón es solo uno de 5. en los supuestos cuatro mil millones de años de historia de la vida en la Tierra. con genes singulares. Para muchos mamíferos y reptiles. cada uno de los cuales tiene información genética diferente. Si pasamos a los invertebrados. .487 mamíferos.000 genes. hay genes específicos que caracte­ rizan a cada una de las 100.700. En total. Literalmente. por medio de mutaciones aleatorias. de cada una de las 8. para ~Ibíd. según la Teoría de la Evolución. sino también requieren mucho más tiempo para alcanzar la edad reproductiva. cada uno formado por miles de pares de bases ordenadas en una secuencia especifi­ ca con sentido.000 especies del planeta.600 millones de pares de bases y 25. Cada uno de estos genes tuvo que aparecer. coli puede producir una nueva generación cada media hora.990 especies de aves. con un tamaño medio de 100. y cada tipo de oso tiene un A D N distinto. El A D N de un ratón tiene cerca de 2. ■ ¡ V pluricelulares situados más arriba en el árbol evolutivo de Darwin. Los animales tienen un A D N complejo. al igual que un oso. una nueva genera­ ción puede demorar meses o años hasta alcanzar la edad en la que pueden reproducirse.000 especies diferentes de insectos. Los animales y las plantas no solo presentan una complejidad ge­ nética infinitamente superior.000 bases. Y no hemos considerado aun los genes específicos de las 9.

ya que inutilizan parte de la secuencia del A D N . Según puntualizó H .000 ejemplos de mutaciones o supresiones de genes sospechosas de causar enfermedades genéticas humanas están compiladas en la página web Mendelian Inheritance in M an [Herencia mendeliana en el hombre]. de la Universidad Johns Hopkins. reducen la apti­ tud. ha publicado numerosos ejemplos de cálculos probabilísticos que demuestran cuán invero­ símil es la evolución de organismos superiores por medio de m u­ taciones aleatorias. pp. solamente una pequeña minoría es beneficiosa e incrementa la aptitud”.23 Esto es exactamente lo que se observa en el laboratorio. quien enseñó durante años Teoría de la Informa­ ción en la Universidad Johns Hopkins.que toda la información genética presente en los genomas de los millones de especies de bacterias. “una abrumadora mayoría de las mutaciones aleatorias son perjudiciales. Ver también: www. hongos.25 La investigación del cáncer ha demostrado que los tumores malig­ nos están relacionados con las mutaciones. y que la tasa de mutación 23Spetner. es en sí mismo estadísticamente imposible.nih. 85-160.hugo-inter- national. Y basándose sobre la teoría de las probabilidades y la teoría de la información. 30-36. ibíd. pp. .nlm. es decir. necesaria para producir una nueva especie. lo que.gov/Omim/mimstats. Lee Spetner. plantas y animales evo­ lucionara por medio de mutaciones aleatorias a partir del genoma de un supuesto organismo primitivo. 24Orr. afirma que la mayoría de los cambios provocados por mutaciones aleatorias son perjudiciales para el organismo. es estadísticamente imposible.org. Spetner muestra que la generación aleatoria de información genética inédita.. Alien Orr.ncbi. Listas de más de 10. como vimos en un capítulo anterior. desde la fibrosis quística hasta la enfermedad de H untington y la tendencia familiar a tener colesterol alto.24 Múltiples enfermedades. profesor de Biología de la Universidad de Rochester.. El I )r. ibíd. están relacionadas con secciones faltantes en los ge­ nes y errores en la duplicación del AD N . 25 En línea: www.html.

reducir la acumulación de mutaciones es un factor clave para salvar de la extinción a espe­ cies amenazadas. La acumulación de mutaciones no propicia la evolución de una nueva especie. Sanford. o incluso la muerte. La desaparición de plantas y de animales por causas antropogéni- 26 Loeb. lo que disminuye la capacidad reproductora o la supervivencia.. et al. “en teoría. 3. pp. Los organismos intentan disminuir al máxi­ mo el número de mutaciones.. el riesgo de cáncer y de otras enfermedades se incrementa considerablemente. 8. suelen resultar en enfermedades. individuos reproductores procedentes de otra población. En poblaciones relativamente pequeñas. Baumgardner. sino que favorece la extinción de la población. Mantener la integridad de su ADN es una prioridad para los organismos. J.está muy lejos de la realidad. y cuando estas ocurren. pp. vol. Por esta razón. p.28 La solución para liberar el cuello de botella es introducir información genética nueva incorporando. 120. W..557. al conjunto. 147-165. De he­ cho. las mutaciones aleatorias no pueden constituir la base de la evolución”.26 La suposición de que las mutaciones son el método de la naturaleza para maximizar la diversidad y así asegurar la supervivencia -lo que constituye la plataforma teórica de la Teoría de la Evolución. Brewer. N° 2 (2007). Cuando estos mecanismos no funcionan porque la actividad de los genes de reparación del AD N queda suprimida por alguna razón.551-3. Bielas y Beckman. con el propósito de minimizar las mutaciones. ibíd. de unos 100 individuos. . así como de reparación del AD N erróneo o dañado.es mucho mayor en células cancerígenas que en el resto. ibíd. del individuo. Scalable Computing: Practice and Experience. La salud de los individuos se ve afectada por la presencia de A D N dañado en sus genomas. Tal como apun­ ta Spetner. 27 Spetner. la mayoría de las especies poseen diversos mecanismos de protec­ ción contra las mutaciones. 28 J. las mutaciones se acumulan como consecuencia de la endogamia. por ejemplo.27 Un ejemplo más de la incapacidad de las mutaciones para gene­ rar diversidad biológica útil es el llamado “efecto cuello de botella”. “Mendel’s Accoimtant: A Biologically Realistic Forward-time Population Genetics Program”.

Teniendo en cuenta los millones de especies que existen actualmente. si las novedades evolutivas siguieran apareciendo hoy al mismo ritmo. esto equivale. 31A. 105. evolucionaron en su mayoría durante los últimos 600 millones de años.25% de las especies que que­ dan. 30Graham Lawton. completamente formadas.org/content/105/Supplement_l/! 1453. 32Citado en: J. no debería ser difícil observar alguna de ellas. vol. Hubbell y F.32 Los datos recopilados por la IUCN.D. Wilson ha estimado que la Tierra está perdiendo anualmente cerca del 0. S.29 En total. en promedio. lo que los científicos constatan es la pérdida ininterrum­ pida de información genética. C. 3. P. Proceedings o f the National Academy o f Sciences. sobre todo consideran­ do los exhaustivos esfuerzos que los científicos han realizado durante los últimos 50 años para demostrar la evolución. Por el contrario.000 nuevas especies en la literatura científica. ni algún ejemplo de evolución que inclu­ ya información genética totalmente nueva. a la aparición de una nueva especie cada tres o cinco años. “Patterns in Macroevolution”. J.evolution.pdf .31 En ningún caso son evidencia de nueva información genética en desarrollo. Austra­ lia: Department of the Environment. Numbers ofLiving Species in Australia and the World (Canberra. no se ha reportado en la literatura ni un solo ejemplo de un órgano nuevo o mejorado. International Unionforthe 29Evolution 101!. que se des­ cubren principalmente en regiones remotas del planeta. 1 (12 de agosto de 2008). Water. pp.edu/ evosite/evolOl/VIBPatterns. El eminente biólogo E. 2009).30 De ser cierto.pnas. se describen aproximadamente 18.full. En línea: www. “In the Light of Evolution II: Biodiversity and Extinction”. En línea: www. p. pero son especies preexistentes. Cada año.berkeley. Ayala.shtml. Chapman. supl. pero la extinción de especies no es un problema nuevo en la historia de la tierra. Avise. Heritage and the Arts. “Uprooting Darwin's Tree”. New Scientist (24 de enero de 2009). 34-39. a medida que se extinguen más y más especies. se ha esti­ mado que alrededor del 98% de todas las especies que alguna vez han existido están ahora extintas. ni de un sistema nuevo de locomoción. O. Utilizando datos del registro fósil. ni de un ojo “superior” más eficiente. estaríamos hablando de 100 a 200 millones de formas de vida diferentes que.cas ha alcanzado proporciones realmente preocupantes en los úl timos tiempos. de acuerdo con los defensores de la evolución. Sin embargo.

Actualmente. Comunicado de prensa (10 de diciembre de 2009). Los científicos no han encontrado todavía una explicación plausible de cómo se produjo la cantidad masiva de información genética que observamos a nuestro alrededor. Alan Cooper. Los organismos poseen diversos mecanismos para reducir las 33En línea: www. dijo: “Los estudios de A D N an­ tiguo han revelado que la pérdida de la diversidad genética en muchas especies supervivientes parece haber sido extremadamente grave”. requerido por la Teoría de la Evolución. y lo supone masivas pérdidas de información genética a lo largo del tiempo. se resumen las principales conclusiones: No se ha observado ni reportado en la literatura científica ningún ejemplo confirmado de evolución tipo 3 (creación de información genética totalm ente nueva).33 corro­ bora esta tendencia a la extinción. evidencias científicas en muchos ámbitos diferen­ tes no apoyan el incremento de información genética. Cálculos matemáticos y estadísticos demuestran que las m u­ taciones no pueden producir la información genética nueva re­ querida para la evolución tipo 3. junto con las evidencias fósiles de las numerosas extinciones del pasado. Ver: www. apuntan a la pérdida continua y progresiva de información genética preexistente. refiriéndose a la pérdida de la diversidad genéti­ ca al final de la última Edad de Hielo. A continuación.Comervation o f Nature and Natural Resources [Unión internacional para la conservación de la naturaleza y los recursos naturales]. con el consi­ guiente aumento de la diversidad y la complejidad. Australian CenterforAncientD N A [Centro Australiano de A D N An­ tiguo].34 En otras palabras.au/news/news37301.org.adelaide. estas evidencias.edu. 34Universidad de Adelaida.html. no existe ningún mecanismo conocido capaz de producir este tipo de evolución. En este capítulo he intentado ofrecer una visión general de la evi­ dencia disponible actualmente respecto de los supuestos motores de la evolución darwiniana: mutaciones aleatorias y selección natural. El director del ACAD.iucnredlist. . por el contrario. Australia.

Los científicos continúan observando. Aun los más simples organismos unicelulares contienen infor­ mación genética extremadamente compleja. . Este proceso nunca ha sido observado y. También. Las evidencias sobre este punto se analizarán con mayor detalle en el próximo capítulo. Lo que se observa en el registro fósil es extinción. La Teoría de la Evolución propone que. estructuras o mecanis­ mos fisiológicos) no pueden evolucionar por medio de m utacio­ nes aleatorias.tasas de mutaciones y reparar el A D N . en la actualidad. hubo poblaciones de organismos unicelulares simples. no evolución. la mayor parte de la cual se ha perdido permanentemente. en el pasado. una tendencia a la pérdida de información genética en la naturaleza. El registro fósil corrobora esta conclusión. Los millones de especies distintas que han habitado la Tierra en el pasado contenían una inmensa cantidad de información genética diversa. podemos concluir que esto es completamente imposible. En otras palabras. los seres vivos tienden a minimizar los cambios evolutivos. dado que en el pasado existía una mayor diversidad biológica que en el presente. que evolucio­ naron hacia seres más complejos como resultado de adquirir in­ formación genética compleja a través de mutaciones aleatorias. Nuevas especies de organismos caracterizados por novedades evolutivas (nuevos órganos. existen meca­ nismos establecidos para prevenir la reproducción entre especies diferentes. sobre la base de nuestros conocimientos actuales de bioquímica y los cálculos probabilís- ticos apropiados.

/ EL REGISTRO FOSIL na de las razones principales por la que muchos científi­ U cos confían en la evolución es la existencia de fósiles de animales y plantas cuyas dataciones indicarían millones de años de antigüedad. tan detallado que incluso pueden reconocerse los pliegues de la piel y los ojos. A veces. La mayoría de los fósiles. generalmente en rocas. Los fósiles son los restos. En este capítulo. se encuentra en rocas sedimentarias como lodolita. caliza. con el fin de comprobar si real­ m ente suministra evidencias en favor de la evolución. ámbar. estos fósiles se encuentran con­ servados de alguna manera. sin embargo. Este tipo de rocas se . En una corriente de lava sobre Blue Lake. los animales han sido sepultados en lava. arenisca. o en condiciones por debajo de la temperatura de congelación. marcas o moldes de plantas o de anima­ les fallecidos hace mucho tiempo. en el Estado de Washington. alqui­ trán. revisaremos aspectos relacionados con el registro fósil. esquisto y carbón. hay un molde detallado del cuerpo de un rinoceronte.

Dunbar. o reemplazan las estructuras celulares molécula a molécula. o sean devorados por carroñe- ros. vol. Haciendo un molde de yeso de la impresión en la roca. es necesario que el material se endurezca rápidamente. que están compuestos en gran parte de carbono. la madera o los huesos enterrados se transforman literalmente en piedra cuando minerales como el sí­ lice se filtran en el organismo y llenan vacíos microscópicos en el hueso o la madera. las conchas. . para evitar que el viento u otros procesos climáticos alteren las marcas. “The Carcasses of the Mammoth and Rhinoceros Found in the Frozen Ground of Siberia”. Para la preservación de pisadas. Transactions o f the American Philosophical Society. se disuelve y desaparece. como parte del avance de la ciencia estratigráfica. este generalmente se descompone. El m am ut de Beresovka.1 El uso de fósiles con el propósito de calcular la edad de las rocas fue desarrollado durante los siglos XVII al XIX. se descomponen y dejan solo un residuo de carbono en la superficie de la roca. Algunas veces. Existen distintos procesos de formación de fósiles. como arena o barro. t. McGraw-Hill Encyclopedia o f Science and Technology (New York: McGraw-Hill Book Company. que dibuja la silueta original del animal o la planta. los paleontólogos pueden conocer cómo era el animal original. un doctor danés de1 1 C.P. como el m amut lanudo. En contadas ocasiones los fósiles contienen res­ tos prácticamente inalterados. pp. con una preservación extraordinaria. “Fossil”. Bajo ciertas condiciones. 23 (1929). 5. encontrados en el hielo del Artico. 473. pero en todos los casos se requiere un entierro rápido. tenía en la boca ali­ mento todavía sin tragar y sangre coagulada en el pecho. O. Ver también: I. 1960). 11-74. También se han encontrado cadáveres enteros del extinto rinoceronte lanudo en yacimientos de petróleo en Polonia. pero deja su forma impresa en la roca. su concha o sus huesos. hidrógeno y oxígeno. Cuando los materiales que rodean al organismo se endurecen. hallado en Siberia oriental en 1901. para impedir que las plantas o los animales se descompongan. los tejidos orgánicos como la carne o la celulosa. En 1669.forman por medio de procesos que involucran la acción del agua. Se puede citar ejemplares completos de mamíferos extintos. p. Tolmachoff. rastros y madrigueras en superficies blandas.

En 1785. nombre Niels Stensen (o Nicolaus Steno) propuso que los estratos. Después de recolectar muchas mues­ tras de roca. se llega a la conclusión de que los fósiles de los estratos inferiores son más antiguos que los fósiles de los estratos superiores. percibió que cada uno de los estratos tenía un conjunto único de fósiles que podía ser usado para reconocer dicho estrato particular en otros afloramientos rocosos. Lo que Smith descubrió se conoce como el “Principio de sucesión faunística”. igual que los eventos geológicos que han tenido lugar durante su historia. de manera que en una sucesión sedimentaria no alterada. al comparar los fósiles de cada a capa. o capas de roca. como una falla. por movimientos del terreno pos­ teriores a su deposición. Smith había estado trabajando con una larga secuencia de formaciones ricas en fósiles que alternaban calizas y es­ quistos en el sur de Inglaterra. Utilizando estas leyes estratigráficas. un geólogo británico llamado William Smith propuso que las secuencias de estratos podrían estar correlacionadas entre un área y otra. en el que presento su “Principio del uniformitarianismo”. y cuyos resultados perduran hasta la actualidad. se depositan horizontalmente de manera secuen- cial. como una intrusión de material magmático o una disconti­ nuidad. entonces. Este principio sentó los cimientos para el establecimiento de un nuevo paradigma que cambiaría por completo la geología de la época. los geólogos pueden deter­ minar las edades relativas de las capas de roca de una formación ro­ cosa. corta o atraviesa un grupo de estratos. Esta secuencia puede ser alterada. Si una formación rocosa. Por ejemplo. Combinando este principio con la ley de superposición de estratos de Steno. las secuencias de estratos en Inglaterra podían correlacionarse con las de branda. el geólogo escocés James Hut- ton publicó su trabajo Theory o fth e Earth [Teoría de la Tierra]. H utton propu­ so que las leyes naturales y los procesos geológicos que han ido moldeando la Tierra a lo largo de períodos muy largos de tiempo . e incluso invertida. los estratos aparecen inclinados o incluso perpendiculares respecto del horizonte. esta tiene que haberse formado después de la deposición en dichos estra­ tos. En 1799. unos pocos años antes de que Smith propusiera el principio de sucesión faunística. r^da estrato de roca es anterior al estrato superior.

“Menos reciente”. los procesos geológicos observados actual­ mente pueden ser usados no solo para explicar los que ocurrieron en el pasado. Dado que Lyell había asumido el punto de vista del uniformitarianismo de H utton. más antiguos. y Plioceno. y que seguirán haciéndolo en el futuro de la misma manera y a la misma velocidad. que fue utilizado poste­ riormente para demoler la creencia científica en el diluvio bíblico. “Más reciente”. entre los años 1830 y 1833. en el pasado son exactamente los mismos que actúan hoy. Promovió el concepto de “columna geológica”. y las utilizó para es­ timar largas edades para las formaciones geológicas. Lyell había notado que los fósiles de las capas más al­ tas. Una de las estimaciones más influyentes de Lyell fue su cálculo de la edad del desfiladero de las Cataratas del Niágara. sino también para calcular cuándo ocurrieron. La idea de Lye­ ll de correlacionar el contenido fósil de los estratos rocosos y el tiempo geológico apareció por primera vez su el trabajo The Prin­ cipies ofGeology [Principios de la Geología]. según la proporción entre conchas marinas de especies recientes y de especies extintas presentes. y por lo tanto las más recientes. Por lo tanto. en lagos y mares. Mioceno. que posteriormente fueron asumidos universalmente por los geó­ logos: Eoceno. otro geólogo británico. es­ tudió los fósiles de los Alpes europeos y concibió la idea de divi­ dir el sistema de estratos rocosos en grupos. propuso que la formación de las capas fue consecuencia de los procesos de compresión y el aumento de temperatura que sufren los sedimentos arrastrados por los agentes geológicos tras acumularse lentamente en deltas de ríos. junto con otros geólogos. que significa “Nuevo amanecer”. Lyell propuso nombres para estos grupos. Charles Lyell. También publicó una tabla de las conchas correspondientes a la clasificación. que fue de­ sarrollado durante las décadas siguientes por él mismo. Lyell realizó sus propias observaciones para calcular las tasas extremadamente lentas a las que se produ­ cen los procesos geológicos en la actualidad. Esto le sugirió que el tipo de fósiles podía ser usado para establecer el orden de deposición de los grupos de estratos y para relacionar formaciones de distintas localidades. parecían más complejos que los fósiles de los estratos inferiores. . Tres décadas después.

p. 1.6 Si Lyell hubiera realizado su cálculo uti­ lizando la erosión real. pp. 3James Ussher. AR: Master Books. 16. Mediciones posteriores mostraron que la velocidad de erosión era. como un evento histórico que ocurrió hace aproximadamente 4. Pierce y M. 10° ed. tuvo un efecto profundo sobre la cosmovisión de la comunidad científica en relación con la aceptabilidad de largas edades de las rocas y el registro fósil. t. Lyell. 83. Pierce (Green Forest. Lyell calculó una antigüedad aproximada de 35. 22. y no en una medición científica. In the Minds ofM en (Toronto. 66.500 años. 30 centímetros al año. a partir del registro bíblico y las fechas estimadas para el reinado del rey Salomón. 1867). 361.M. Tovell. mucho más rápida: alrededor de 120 a 150 centímetros al año. p. aun así. habría determinado la edad del cañón en unos 7. .4 A partir de la longitud del desfiladero. 5Taylor. aproximadamente. de que el m undo debía ser mucho más viejo que las fechas calculadas según el registro bíblico. ibíd.000 años. Principies ofGeology. 4C.. un habitante local le contó que las cataratas retrocedían alrededor de 90 centímetros cada año. 82. sv u u lk k ?.C. la Universidad de Oxford todavía incluía en la enseñanza de la geología el diluvio bíblico universal.?5íí S úEi En tiempos de Lyell. Taylor.’ Es revelador notar que la velocidad de 30 centímetros al año estaba basada sobre una conjetura personal de Lyell.000 años. en las mentes de muchos científicos.3 Cuando Lyell visitó las cataratas en 1841. de un poco más de 10. y estimó que una velocidad de recesión más probable era. fecha bastante más próxima a las estimaciones propuestas para el diluvio. de hecho. Revisado y actualizado por L.2 El arzobispo James Ussher había calculado. que el diluvio global ocurrió alrededor del año 2349 a. Lyell supuso que esta era una afirmación exagerada. 1984). Cañada: Royal Ontario Museum Publication 1979). (London: John Muiray. 6W. Si prescindimos del uniformitarianis- mo y suponemos que la velocidad de erosión pudo ser más rápida 21. The Niagara River (Toronto. p. Cañada: TFE Publishing.500 metros. pero. p. T. Esta cifra fue ampliamente aceptada y sirvió de “prueba”. The Aunáis ofthe World (1658). 2003).

no es posible determinar la edad del cañón por este método. como el Gran 7Ver: www. Una vez establecida la antigüedad de cada estrato y grupos de estratos. que también sugieren que la circulación de agua en las cataratas ha variado considerablemente con el tiempo. se calculó la edad total de las rocas de las diferentes secciones. esta cifra no está calculada a partir de las tasas de erosión.7 Aunque Lyell no tenía evidencias científicas demostradas para sus largas edades. basadas sobre teorías de actividad glacial en el área durante la pasada edad de hielo. podía calcularse el período de tiempo que correspondía a cada estrato. durante la retirada masiva de las aguas del diluvio. así como los fósiles que contienen. Dado que Lyell ha­ bía observado que había estratos sedimentarios de miles de me­ tros de espesor que contenían millones de capas finas. sus teorías sobre la edad de las rocas tuvieron una amplia aceptación. llegó a la conclusión de que los estratos inferiores. Dado que en realidad no sabemos con certeza cuál era la velocidad de recesión antes del siglo XVIII. . la antigüedad se acortaría y sería perfectamente com­ patible con el relato bíblico.magaraparks.500 años. M idiendo el grosor de los estratos. Esta metodología permitió calcular los períodos de tiempo in­ dividuales correspondientes a diferentes estratos de la columna geológica.htmI. sus conteni­ dos fósiles fueron asignados a períodos de tiempo específicos y empezaron a usarse para datar rocas con esa combinación con­ creta de fósiles. Sumando estos períodos de tiempo. aunque algunos afloramientos. La posición oficial del gobierno de Ontario sobre la edad de las ca­ taratas es que tienen 12.com/media/geology-facts-figures. sino que proviene de esti­ maciones generales. Sin embargo. por ejemplo.en el pasado. debían tener millones de años de antigüedad. Lyell estimó la velocidad de formación de los diferentes estratos. Ninguna región del m undo contiene un registro completo del tiempo geológico. A partir de las tasas de erosión de las rocas y de acumulación de sedimentos aluviales en la actualidad.

“Geological Time Scale”.500 millones de años (MA) hasta hace 542 MA. 135. . y en la otra se encuentran en la parte superior. Kulp. las es­ timaciones de tiempo geológico variaban hasta en un factor diez. sino que es un constructo teórico creado a partir de secuencias observadas en diferentes lugares. en términos de tiempo geológico convencional. Cañón del Colorado. Hasta el desarrollo de la datación radiométrica (que se discutirá en mayor profundidad en un capítulo posterior). La escala de tiempo geológico correspondiente a la columna geológica se calculó a partir del grosor de los estratos. p. 6. No obstante. Si en una de las regiones las capas de caliza y de esquisto se encuentran en la parte inferior del afloramiento. y se divide en tres eras: 8 J. diferentes partes del registro apare­ cen en distintas regiones. Siguiendo la idea del uniformitarianismo. y divide este período de tiempo en eones. consideran­ do tasas constantes de erosión y de sedimentación. • El eón Fanerozoico abarca desde hace 542 M A hasta el presente. se asume que estas tienen la misma antigüedad. t. asigna a la Tierra 4.8 La escala de tiempo geológico convencional. la co­ lumna geológica que aparece en los libros de texto no se encuentra tal cual en ningún afloramiento.500 m i­ llones de años de antigüedad. cuando se observa el mismo patrón de capas alternas de caliza y de esquisto con fósiles similares en dos regiones diferentes. muestran estratos de roca que. corresponderían a cientos de millones de años. L. se asumió que estas tasas habían per­ manecido esencialmente constantes durante cientos de millones de años. Así pues. aceptada actual­ m ente por la com unidad científica. y la existencia de secuencias parcialmente solapadas ha permitido establecer correspondencias entre distintas regiones. • El eón Precámbrico abarca desde hace 4. Por ejemplo. períodos y épocas. con la colaboración de geólogos de todo el mundo. los datos procedentes de ambas regiones se pueden unir para reconstruir una secuencia más extensa. McGraw-Hill Encyclopedia o f Science and Tech­ nology. eras.

10.5 MA. Lutgens.5 MA. 328. Se divide en cinco épocas: Paleoceno. que fue­ ron ampliamente aceptados sin discusión porque establecían el marco temporal necesario para la evolución biológica. 2009). que abarca desde hace 251 M A hasta hace 65. pp. Jurásico: 199. Mioce­ no y Plioceno. hemos descrito las bases históricas por las cua­ les el registro fósil ha llegado a ser considerado una prueba de la evolución. Misisipiense: 359-318 ALA. NJ: Pearson Education.5 M A hasta hace 1. Cuaternario: abarca desde hace 1.6-145.5-65.íL rf ¡ KO rU'oíL La era Paleozoica. Y la era Cenozoica. EL K t. que abarca desde hace 65. Cálculos de tasas de erosión y deposición basadas sobre el uniformitarianismo dieron lugar a estimaciones de lar­ gas edades para los estratos de la columna geológica. Silúrico: 444-416 MA. La ob­ servación. y se divide en siete períodos: Cámbrico: 542-488 MA. K.8 MA.5 MA. generalmente cierta. La era Mesozoica.5 millones de años hasta el presente. International.8 ALA. que abarca desde hace 542 M A hasta hace 251 MA. Pérmico: 299-251 MA. Se divide en dos épocas: Pleistoceno y Holoceno. J. y se divide en dos períodos: Terciario: abarca desde hace 65. Pensilvano: 318-299 MA. Oligoceno. Eoceno. de que los fósiles aum entan en complejidad a medida que se asciende en la columna. . hasta el presente.9 Hasta aquí. junto con 9E. Cretácico: 145. Devónico: 416-359 MA. con tres períodos: Triásico: 251-199. Tarbuck y F. 12° ed.6 MA. (Upper Saddle River. Earth Science. Ordovícico: 488-444 MA.

sean ingeridos por otros animales o se degraden a causa de los agentes ambientales.10 Cabe preguntarse. millones de años. supuestamente. Brooks/Cole.: Linda R. donde en muchos ambientes solo se depositan unos pocos milímetros de sedimen­ to al año. T ed. Dedicaremos el resto del capítulo a resolver esta cuestión. pero en la actualidad no se observan plantas ni animales en proceso de f o s iliz a c ió n • En cuarto lugar. Así pues. . 2005). sin embargo. es m uy difícil que inclu­ so los fósiles más pequeños se hayan formado en condiciones lentas de sedimentación como las actuales. • En tercer lugar. de manera que no se descompongan. fueron necesarios grandes vo­ lúmenes de sedimentos para su enterramiento. las rocas sedimentarias que contienen fósiles se encuentran en todo el m undo. es decir. como las ballenas y los dinosaurios. Martin y Eldra P. por lo tanto. • En prim er lugar. CA: Thomson. pp. es im portante notar que prácticamente todos los fósiles se encuentran en rocas sedimentarias. datos posteriores procedentes de dataciones radiométricas. • En segundo lugar. el registro fósil muestra un gran núm ero de 10Ver. Esto significa que la de­ posición de los sedimentos que dieron lugar a estas rocas abarcó grandes extensiones y enterró a millones de organismos durante. el proceso de fosilización requiere que plan­ tas y animales sean enterrados rápidamente. son de gran tamaño. El uniformitarianismo asume que las condiciones del pasado fueron iguales a las del presente. si un cambio de pa­ radigma con distintas asunciones de base perm itiría interpretar la evidencia del registro fósil de otra manera. por ej. Biology. su­ pusieron apoyo adicional para este paradigma geológico. que ha perdurado hasta la actualidad. Diana W. De hecho. la mayoría de los textos universitarios en uso citan el registro fósil como evidencia de la evolución. Berg. 389-401. en rocas que se han formado bajo el agua. y alcanzar conclu­ siones científicamente validas aunque completamente diferen­ tes. (Bel- mont. Esto sugiere que algunos fósiles solo podrían formarse bajo lo que llamaríamos “condiciones catastróficas”. Solomon. Muchos de los animales que encontramos fosilizados.

bajo las condiciones que producen los depósitos aluviales en la actualidad. no se observa la for­ mación de fósiles. una prueba clara de la extinción de múltiples formas de vida. pero no se ha observado que los restos de estos orga­ nismos se encuentren ni siquiera en las primeras fases del proceso de fosilización. Ni siquiera la caza indiscrimi­ nada de bisontes en las praderas de los Estados Unidos durante el siglo XIX. y que fueron utilizadas por Lyell en sus cálculos de la antigüedad de las formaciones rocosas. langostas. Si el uniformitarianismo no es aplicable a la formación de los fósiles. lagartos y otros animales. tam­ poco se ha descubierto en nuestras costas o en los deltas de los ríos evidencias de fosilizaciones recientes de estrellas de mar. cangrejos. Ya hemos mencionado que se calcula que entre un 98% y un 99% de las diferentes especies que habitaron el planeta están ex­ tintas. no se ha ob­ servado que se fosilicen las huellas dejadas en playas arenosas. En otras palabras. y por lo tanto. ballenas. osos polares. que las suposiciones del uniformitarianismo no se cumplen. se ha registrado todo tipo de observaciones científicas. La existencia de lechos de fósiles que contienen grandes cantidades de restos o de especímenes de gran tamaño indica que estos fósiles se forma­ ron debido a procesos catastróficos ocurridos en el pasado. A lo largo de los últimos 2. Sin embargo. El registro fósil puede considerarse. cuya cantidad se ha ido incrementando. entonces. especialmente en los últimos tres siglos.000 años. que llevó a la especie al borde de la extinción. y no parece que esta sea posible. Los periódicos no informan de ningún evento natural que haya causado la fosilización de miles de pingüinos. Las recientes inundaciones en Queensland. Australia. de los fósiles que contienen y de la vida sobre la Tierra que se . algas o aves marinas. este hecho invalida las estimaciones de la edad de las rocas sedimenta­ rias. peces o conejos.especies de plantas y animales del pasado que hoy ya no existen. La presencia de millones de organismos fosilizados en lechos fósiles de miles de metros de espesor sugiere la acción de procesos geoló­ gicos masivos a una escala mucho mayor que cualquier cosa que haya ocurrido en la Tierra durante los últimos miles de años. acabaron con la vida de miles de canguros. resultó en la acumulación de grandes cantidades de fósiles de bisontes.

han calculado siguiendo este principio. dinosaurios gigantes que alcanzaban 30 metros de longitud.12 O tro cementerio espectacular de dinosaurios se ha encontrado en la Cuenca de Nemgt.5 millones de kilómetros cuadrados. con las mandíbulas inferiores en su lugar. llIbíd„ p. Imagine las proporciones catastróficas de un evento capaz de arrastrar y enterrar a estos grandes animales. lodolita. Esta formación consta de capas de piedra caliza. pp. entre los que se encuentran los famosos estegosaurios y los saurópodos. salamandras. que se depositó a partir de agua moviéndose a gran velocidad. se encuentran fósiles de peces. los lagartos voladores conocidos como pterodáctilos. con capas superiores de conglomerado que contienen abundantes restos de dinosaurios. 487-577. 11A. conviviendo con animales como los dinosaurios. ranas. en Mongolia. Junto con los restos de dinosaurios. describe ejemplos de grandes cementerios de fósiles que ilustran la escala y la magnitud de los procesos de fosilización del pasado. t. . Se ha descubierto restos de muchos tipos diferentes de dinosaurios. cangrejos de río y almejas. que están ahora extintos. A. lagartijas. lagartijas y aves.*11 La Formación Morrison y otras equivalentes incluyen extensos cementerios de fósiles que se extienden desde Nuevo México hasta Canadá. incluyendo segmentos esqueléticos semiarticulados relativamente intactos. Earth’s Catastrophic Past (Dallas TX: Institute for Creation Research. cocodrilos. Snelling. así como pterosaurios. de la Universidad de Sidney. Un punto para destacar con respecto a este cementerio es que tanto los dino­ saurios terrestres como los animales acuáticos fueron enterrados en una enorme formación de arenisca conglomerada. cubriendo una superficie de 1. tortugas. 2. 571. Andrew Snelling. El geólogo investigador Dr. limolita y arenisca. Muchos de los cráneos están prácticamente completos. donde cientos de esquele­ tos articulados bien conservados de estos animales se hallan ente­ rrados junto a esqueletos de mamíferos. incluso con partes de las orejas conservadas. Esto sugiere que las mismas especies de anima­ les que existen hoy existían también en el pasado. 2009).

for­ mados por caparazones de carbonato cálcico de criaturas marinas microscópicas. Snelling. las masas musculares fibro­ sas y aun las branquias de los artrópodos. . La preservación de estos fósiles es tan extraordinaria que se aprecia en todo su detalle los órganos sen­ soriales. Según señala el Dr. en un estado de excelente conserva­ ción. en Estados Unidos. 544. como gasterópodos. cuya fosilización es tan perfecta que se aprecia hasta la silueta de los músculos de la cola y los ligamentos de las patas palmeadas traseras. Esta formación contiene una gran cantidad de organismos terrestres. marinos y de agua dulce en­ terrados y fosilizados juntos. situada en la fron­ tera entre Virginia y Carolina del Norte. se han conservado abundantes fósiles de insectos completos. y también se encuentran en partes de Estados Unidos y en la costa de Australia Occidental. 13Ibíd. estos depósitos sugieren una deposición y un enterramiento catastróficos. También contienen fósiles de animales marinos de mayor tamaño. como los famosos acantilados blancos de Dover. y su subsiguiente enterramiento y fosiliza­ ción. nautiloideos. Asi­ mismo. Estos lechos se extienden a través de Europa.. pp. en diferentes localizaciones distribuidas a lo largo de cientos de kilómetros. En la formación de esquistos Cow Branch. son los lechos cretácicos de creta. en Sudáfrica. y también muchos especímenes articulados de reptiles acuáticos. En las montañas de Cedarberg. desde Irlanda hasta Turquía. 543. Se trata de una distribución global de lechos uniformes de creta de hasta 100 metros de espesor. en la costa sureste de Gran Bretaña.13 Uno de los ejemplos más espectaculares de las condiciones catas­ tróficas que prevalecieron en la Tierra y cuyo resultado fue la vasta destrucción de la vida. la formación Soom Shale contiene miles de fósiles excepcionalmente bien conservados de braquiópodos. hay fósiles de vertebrados de los que se preservaron las partes blandas. ammonites y belemnites. artrópodos y co- nodontos. Egipto e Israel. igual que los tractos digestivos de los conodontos. los apéndices locomotores.

más de 100 familias de invertebrados marinos. así como de los ammonites y algunos otros grupos de moluscos marinos”.pnas. vol. los reptiles vola­ dores y los grandes reptiles marinos. Ayala. A.p. Otros grupos de organismos que . En total. “In the Light of Evolution II: Biodiversity andEx- tinction”. 105. bra­ quiópodos. supl. 3. con un total de 90% al 95% de especies marinas eliminadas. y que el cierre de este período fue marcado “por la extinción de los dinosaurios. “Cretaceous”. señalan extinciones masivas registradas al final del período Ordovícico. conodontos. La extinción del final del Ordovícico resultó en la desaparición de un tercio de todas las familias de braquiópodos y briozoos. y durante los períodos Devónico. trilobites.4W. trilobites y graptolites. y gran parte de la fauna cons­ tructora de arrecifes. incluyendo organismos constructores de arrecifes. t.14 Según podemos ver. igual que de numerosos gru­ pos de conodontos. varios tipos de corales. En línea: www. pp. Triásico y Cretácico.15 Los estratos que corresponden a estos períodos geológicos mues­ tran un enterramiento de animales tan catastrófico que eliminó permanentemente a muchas especies. C. El Dr. El eminente geólogo y paleontólogo Dr. La ex­ tinción en masa del Pérmico es la más evidente del registro fósil.org/content/105/Supplement_l/11453. La extinción de la última parte del período Devónico afectó al 70% de los invertebrados marinos. John Avise y sus colegas del Departamento de Ecolo­ gía y Biología Evolutiva de la Universidad de California.457. P.pdf . 11. W illiam A. 1 (12 de agosto de 2008). 542. el registro fósil es un registro continuo de extinciones masi­ vas en un ambiente marino. placodermos y pelicosaurios. Avise.453-11. La fauna desaparecida está comprendida por foraminíferos fusuli- nidos. Cobban afirma que la deposición de enormes yacimientos de creta a lo largo del m undo se corresponde con “la época de mayor inunda­ ción de la superficie terrestre”. blastoideos. fueron destruidas. Cobban. S. full. acantodios. Proceedings o f the National Academy o f Sciences. Hubbell y F. 15J. agnatos y placodermos. J. Pérmico. trilobites. McGraw-Hill Encyclopedici o f Science and Technology.

moviéndose a una velocidad estimada de 150 kilómetros por hora.html. en todos los casos se trata de eventos de extensión mundial que implican condiciones marinas catastróficas: entierros en masa y grandes cantidades de agua en movimiento. en el tiempo geológico. Otros tipos de organismos barridos en este m omento fueron los pterosaurios. crinoideos. ammonoideos. euriptéridos. A pesar de ser la segun­ da en importancia. una pequeña erupción derritió la nieve del interior del cráter y desplazó el agua. Dos años después. tiburones. el 12 de junio de 1980. un grueso lecho de 20 metros de espesor conformado por múltiples estratos fue depositado durante una sola tarde. por lo que cada una de ellas requirió un período corto de tiempo (días o semanas). la extinción que tuvo lugar al final de Cretáci­ co genera un mayor interés entre el público porque incluye la des­ aparición de los dinosaurios. Una interpretación alternativa sería considerar que las formaciones rocosas correspondientes a las grandes extinciones se crearon sucesivamente durante un evento catastrófico global. el 19 de marzo de 1982. ostrácodos y equinodermos. creando una poderosa corriente de lodo de 32 kilómetros. produjeron estratos laminados en unas pocas horas. Un ejemplo de la velocidad a la que pueden formarse los estratos durante eventos geológicos extraordinarios es lo que ocurrió durante y después de la erupción del monte St. .org/Canada/Museum/extinction/extincmenu. Helens. el 18 de mayo de 1980.park. A las pocas semanas. reptiles marinos y muchas especies de plantas.perdieron cantidades sustanciales de especies contienen briozoos. Curiosamente. braquiópodos. estratos que. Más información sobre los efectos de estas extinciones se puede encontrar en el sitio web del Centro de Geociencias de Ottawa-Carleton. la gran mayoría de las aves. peces óseos. habrían correspondido a miles de años. Flujos de gas caliente y fragmentos de piedra pó­ mez. de haber sido datados a partir de las tasas normales de deposi­ ción.16 Las dataciones convencionales asignan largos períodos de tiempo a cada una de estas extinciones y las sitúan. los rudistas bivalvos. que cor­ 16Ver: www. los ammonoideos. los belemnoideos. separadas por millones de años.

Mary Schweitzer.uk72/hi/science/nature/8502076.000 huellas fósiles de seis especies diferentes de dinosaurio. AR: Master Books. o miles de inundaciones locales a lo largo de miles de millones de años. 52. la Dra. Todas las huellas tienen la misma orientación. Los geólogos pudieron constatar la formación de un Gran Cañón en miniatura en un día.74-76. Helens (Green Forest. Examinemos más evidencias científicas que apuntan en esta dirección. En la ciudad de Zhucheng. Footprints in the Ash: The Explosive Story o f Mount St. lo que sugiere enérgicamente que estos animales estaban huyendo de alguna catástrofe. el registro fósil puede interpre­ tarse claramente como una evidencia de un diluvio global catas­ trófico que exterminó la flora y la fauna que existía sobre la Tierra hace apenas unos pocos miles de años. Y. inclu­ yendo tiranosaurios. Austin.tó un cañón de 43 metros de profundidad a través de roca sólida. podríamos también interpretar que todas las extincio­ nes registradas ocurrieron en realidad durante un único evento de inundación universal.18 Otros fósiles ex­ puestos en museos. podríamos interpretar el registro fósil como evidencia de grandes catástrofes marítimas y volcánicas en todo el mundo. 191. . 2005). Si conseguimos escapar del paradigma del uniformitarianismo. Taylor. pp. son claros indi­ cadores de un entierro y una fosilización muy rápidos. y no en media docena de grandes inundacio­ nes separadas por millones de años. 53. 89. celurosaurios y hadrosaurios. Marinas y Terrestres de la Universidad Estatal de Carolina del Norte. bajo condiciones catastróficas. pp. profesora asociada de Cien­ cias Atmosféricas. Cañada: TFE Publishing.co. 62. como el de un ictiosauro dando a luz (Museo de Historia Natural de Stuttgart) o un pez percha comiéndose un arenque (Museo de Historia Natural de Princeton). 1984). Helens demuestran que el principio del uniformitarianismo no puede aplicarse para calcular las edades de las rocas.stm.19 En 2005.bbc. comunicaron el 17John Morris y Steven A. en China. teniendo en cuenta que las formaciones creadas tras la erupción del monte St. 18Ver: news.17 A partir de estas situaciones recientes. y sus compañeros de trabajo. 88. In the Minds ofM en (Toronto. T. se ha descubierto más de 3.

L. 21 C.500 años. la existen­ cia de fragmentos de A D N que pueden ser recuperados sugiere que la antigüedad de las hojas fósiles de Clarkia es solamente de unos miles de años. pp. S. Soltis y Y. “Molecular Preservation in Late Cretaceous Sauropod Dinosaur Eggshells”. 344 (22 de abril de 1990). et al. E. pp. “DNA Sequences from Miocene Fossils: An NDHF Sequence and an RBCL Sequence of Persea Pseudocarolinesis (Lauraceae)”. E.000 años. Suh. A. Kim. Estas biomoléculas se degradan con rapidez y no pueden sobrevivir durante millones de años. Giannasi. T. vol. Garrido. Nielsen-Marsch. los investigadores afirman que la velocidad de minera- lización debió haber sido “prácticamente instantánea”. el A D N desaparecería completamente de los restos fósiles después de 20. Golenberg. Clegg. M. et al. con lo que se les asignan edades de entre 17 y 20 millones de años. Ame­ rican Journal ofBotany. “Biomolecules in Fossil Remains..20 La interpretación de una edad relativamente reciente para los fósiles ha quedado respaldada por el hallazgo de proteínas. 23E. científicos de la Universidad de California informaron en 1990 que habían extraído A D N de muestras de hojas fósiles procedentes de los yacimientos de fósiles de Clarkia. The Biochemist (junio de 2002). 22S. Multidisciplinary Approach to Endurance”. 656-658. . 272 (2005). 12-14. M. A una tem peratura media de 20 °C. Debido a que el tejido blando de los embriones se degrada rápidamente después de su muerte. 615-620. en Idaho.22 De acuerdo con la datación convencional. Soltis. 9 (2004). 775-784. vol. H. lo cual fue confirmado posteriormente por otros equipos cien­ tíficos. Chiappe.descubrimiento en la Argentina de cáscaras de huevo de dinosaurios saurópodos excepcionalmente bien conservadas. Schweitzer. Proceedings ofthe Royal Society B: Biological Sciences. P. estos yaci­ mientos pertenecen al M ioceno. pp.Letters to Nature. C. En 1991. los científicos de la División 20 M.23 N o obstante. vol.. para que se hayan podido conservar y fosilizar los tejidos blandos. D. A D N y tejido blando en fósiles de dinosaurio. Se calcula que si la tem peratura media de las rocas fuera de 10 °C. pp. el A D N se habría descompuesto totalm ente y no sería detectable después de aproximadamente 2. D.21 Sin em­ bargo.

L. Valdez. 183-197. Spall. Proceedings ofthe National Academy o f Sciences ofthe USA. Seismosaurus”. M ary Schweitzer y sus compañeros de la Universidad Estatal de M ontana comunicaron el descubrimiento de un fragmento de hueso de Tyrannosaurus rex que contenía glóbulos rojos con he­ moglobina. J. W.296. 10 (febrero de 1991). 44. Gurley. C. Wittmeyer. sin duda. vol. 1 (2003). et al. 27G. pp. y descubrieron tejidos elásticos flexibles (matriz ósea.. vol.de Ciencias Naturales del Laboratorio Nacional de Los Álamos. Proceedings of the Royal Society B: Biological Sciences. R. con una antigüedad es­ tim ada de 150 millones de años. vol. pp. Los investi­ gadores llegaron a la conclusión de que se había demostrado.. vol. vasos sanguíneos y células) en el interior del miem ­ bro trasero de otro esqueleto de Tyrannosaurus rex. J.955. Homer y J. Waddington. 26 M. Homer. el al. J. extrajeron proteínas de las vértebras de un fósil de dinosaurio saurópodo (seismosaurio) procedente de la formación M orrison de Nuevo México. pp. la existencia de restos de tejido blando no fosilizados en extremidades de dinosaurio. G. H. Embery. Schweitzer. supl. El material orgánico recuperado todavía era capaz de inducir una respuesta inmunológica.291-6. Carrón. Journal ofProtein Chemistry. pp. Toporski. K. 25M. vol. M. D. alrededor del doble de la edad estimada para los restos de Tyrannosaurus rex. Marshall. Connect Tissue Res. 307 (2005). R.25 hallazgo que provocó controversia y escepticismo en la com unidad científica. J.27 24L. Schweitzer. “Soft Tissue and Cellular Preser­ vation in Vertébrate Skeletal Elements from the Cretaceous to the Present”. “Identification of Proteinaceous Ma­ terial in the Bone of the Dinosaur Iguanodon”.. Milner. “Proteins in the Fossil Bone of the Dino- saur.26 Otros investigadores empe­ zaron también a buscar evidencias de tejido blando en restos de dinosaurios. M. H. Wittmeyer y J. A pesar de la polémica. H. Science. cuya edad estimada es de 120 millones de años. la Dra. Schweitzer. Schweitzer y sus colegas continuaron buscando ejemplos de tejido blando en muestras de dinosaurio. de Nuevo México.952- 1. R. R. J. “Heme Compounds in Dinosaur Trabe- cular Bone”. et al. 94 (1997). y encontraron un material de tipo proteico en huesos del dinosaurio Iguanodon. 274 (2007). L. . “Soft-Tissue Vesse- ls and Cellular Preservation in Tyrannosaurus rex”.24 Seis años más tarde. 1. K. 75-90. A. 6.

científicos de la Universidad Estatal de Carolina del Norte informaban de la recupe­ ración de un fémur del dinosaurio pico de pato. corales y anémonas. y en contra de la evolución. 626-631. . aparecen repentinamente fósiles de medusas. En este artículo. vol. nombre asignado a la primera y más larga etapa de la historia de la Tierra. Otras evidencias en contra de la evolución gradual a lo largo de millones de años es la aparición repentina de nuevas especies de animales en el registro fósil. al llegar a las rocas del Precámbrico tardío. cuya antigüedad se estima entre 600 y 540 millones de años. pero su veracidad ha quedado confirmada recientemente por un artículo publicado en la revista Science. hay solo un puñado de fósiles de lo que se cree que eran bacterias y algas primitivas. 324 ( I o de mayo de 2009). W. H. todos los resultados de este estudio fueron verificados independientemente por investigadores del Beth Israel Deaconess Medical Center. El análisis del hueso reveló tejidos blandos y materia ósea. encontrado bajo 7 metros de arenisca en la Formación del Río Judith. El conocimiento experimental que tenemos sobre la estabilidad de los materiales biológicos indica que no es posible que dichos teji­ dos sobrevivan durante millones de años sin descomponerse. Schweitzer. de donde se aislaron proteínas de colágeno y células óseas. Sin embargo. Algunos científicos han intentado refutar estos hallazgos. Canadensis”. y se identificaron partes de la secuencia de ADN.28 El indiscutible descubrimiento de tejido blando en fósiles de dinosaurio es una evidencia a favor de edades cortas para las especies fósiles. 28M. Dado que los trabajos publicados anteriormente informando sobre la presencia de tejidos blandos en fósiles de Tyrannosaurus rex habían sido polémicos. C. Science. sin que se hubiesen encontrado los supuestos intermedios evolutivos. et a l. pp. En la mayoría de las rocas del Precámbrico. Zheng. en mayo de 2009. El descubrimiento de tejidos blandos conservados en fósiles arroja serias dudas sobre sus supuestas edades de decenas de millones de años. L. en Montana oriental. Brachyhphosaurus canadensis. “Bioraolecular Characterisation and Protein Sequences of the Campanian Hadrosaur B. Organ. encontramos muy pocos tipos de organismos. de la Universidad de Harvard y de la Universidad del Estado en Montana.

Los trilobites. pero tampoco se han encontrado evidencias fósiles de animales con patas u ojos parcialmente desarrollados. así como patas con todas sus partes mecánicas y nerviosas. mIbíd. de nuevo. 56-65. de Africa y de Rusia. Ward. Smithsonian Handbooks: Fossils (New York: Dorling Kindersley. Tampoco hay una explicación plausible de cómo pudieron aparecer cantidades tan grandes de nueva información genética en un período relativamen­ te breve de tiempo geológico. sin fósiles intermedios. no se ha encontrado ninguna evidencia de ese proceso de evolución. No existen evidencias fósiles de organismos intermedios con cuerpos en proceso de desarrollo o en las primeras fases de formación de una cabeza. 44. la cola y múltiples segmentos corporales es enorme. se en­ cuentran las rocas del Cámbrico.29 La cantidad de informa­ ción genética necesaria para codificar la cabeza. Aun así. caracoles. con cabeza y patas.T similares a las especies actuales. La información genética de estos animales es muy diferente de la de las bacterias y las algas. evolucio­ naron durante períodos de tiempo m uy largos. conodontos. nautilos y trilobites. erizos de mar. que se encuentra en rocas del Precámbrico tardío de Australia. Justo encima de la frontera con el Precámbrico tardío.. En las rocas del Cámbrico encon­ tramos fósiles de gusanos segmentados. La cantidad de nueva información genética necesaria para producir ojos con todos sus detalles. los animales alta­ m ente complejos. tales como trilobites y nautiloideos. fósiles m uy comunes en las rocas cámbricas. 29C. 2002). . Incluso más sorprendente es la aparición repentina de un pequeño animal segmentado de siete centímetros de longitud.30 tienen ojos y patas seg­ mentadas. pp. Walker y D. componentes y mecanis­ mos de enfoque. y si evo­ lucionaron a partir de ellas deberíamos encontrar organismos con características intermedias en las rocas que los separan. De acuerdo con la Teoría de la Evolución. llamado sprig- gina. mariscos. es enorme. pp. que contienen fósiles comple­ tamente formados de animales genéticamente muy diversos. ' i. Si esto es cierto.

Consideremos. que el registro fósil del Cámbrico contiene representantes de los principales fi­ los de animales invertebrados. 2. los nautiloideos del Cámbrico.100 metros de estratos no fosilíferos. . En Marruecos.200 metros de gro­ sor que contiene fósiles de trilobites y arqueociatos. En las montañas Inyo de California. Bell. t.32 La aparición súbita de formas de vida en las capas del Cám ­ brico muestra un aumento repentino de diversidad biológica tal. además. Los paleontólogos del Museo Sueco de Historia Natural han en­ contrado nautiloideos en rocas del Cámbrico. fósiles de algas. C.000 metros de piedra caliza que contienen solamente estro- matolitos. El Profesor W.200 me­ tros de estratos que no contienen ningún fósil. por ejemplo. . encontramos 1. y bajo estos.2lbíd„ p. sobre 2. que los científicos lo han llamado la “explosión del Cámbrico”. los pulpos y las sepias. ex profesor de Geología en la Universidad de Texas. “Cambrian”.su evolución debería haber quedado reflejada en el registro fósil. moluscos depre­ dadores inteligentes como los calamares. 426. señala que esta misma estructura de estratos no fosilíferos de miles de metros de grosor que subyacen inmediatamente a las formaciones de trilobites del Cámbrico.y responsable por sus características. McGraw-Hill Encyclopedia o f Science and Technology.31 El Profesor Bell señala. encontramos 900 metros que contienen fósiles de organismos constructores de arrecifes. Estos animales pertenecen al grupo de los cefalópodos. 425. tam bién se observa en Australia y en Asia Oriental. . con un sistema de 31W. Charles Bell. hay una formación de más de 4. p. Si examinamos los estratos por debajo de los trilobi- tes del Cámbrico inferior de Noruega. que aparecieron repentinam ente sin evidencia fósil de evolución. con todo. es decir. 3. llamados arqueociatos. Este aumento en la diversidad implica un importante incremento en la cantidad y la complejidad de la información genética con­ tenida en estos animales. no encontramos evidencia alguna de que esto haya ocurrido.

2. Las plumas de mar. 13H. estudios de A D N antiguo han demostrado que la diversidad genética era mayor en el pasado. Dunca. incluso en las rocas más profundas. rayas. Com o comentamos en un capítulo anterior.333. ranas. y no muestra evidencia alguna de evolución. como sucede con muchos otros grupos de animales encontrados en el registro fósil. Este tipo de descubrimientos sugiere que la información genética contenida en las especies antiguas era mayor y más rica. “Late Cambrian Plectronocerid Nautiloids and Their Role in Cephalopod Evolution”. 50. tortugas. aves.propulsión a chorro más sofisticado y eficiente que otras especies encontradas en rocas de períodos posteriores.33 El registro fósil.34 En la actualidad. Y-B. caimanes. N° 6 (2007). continúan produ­ ciendo el mismo tipo de descendencia. Mutvei. salamandras. distintos tipos diferentes de tiburones. revela formas de vida completamente desarrolladas y muy sofisticadas. lagartijas. del Centro Australiano de A D N Antiguo. 34Cari Wemer. langostinos y langostas. Living Fossils ~ Evolution: The Grand Experiment (Oreen Forest. y descubrió que la extinta cebra gigante llamada Cape era solo una variante grande de la m oderna cebra de las lla­ nuras. y mamíferos que aparecen en los mismos estratos de roca en los que se encontraron fósiles de dinosaurios. Esta obra contiene una extensa colección de fotografías de fósiles de la era de los dinosaurios. 1. pues. mientras duran. Zhang y E. El registro fósil cuenta la misma historia. El profesor Alan Cooper.327-1. estudió huesos de especies antiguas de la fami­ lia del caballo. Es también significativo que las especies de nautilos todavía existen hoy. cuyos fósiles fueron encontrados en rocas del Precámbri­ co. . los fósiles Cretácicos de celacanto son iguales que los celacantos que hoy se encuentran en el Océano Indico. peces. observamos especies que se extinguen mien­ tras otras sobreviven. son extremadamente similares a sus homólogos modernos muchos de los fósiles de estrellas de mar. son prácticamente idénticas a las que viven hoy en los fondos marinos. pp. 2008). vol. AR: New Leaf Press. cangrejos. t. y aquellas que sobreviven no se transforman en especies nuevas sino que. libélulas y otros insectos. Asimis­ mo. consideradas millo­ nes de años más recientes. Palaeontology. junto con sus formas vivientes. cocodrilos.

Australia. doi:10. y las capas sedimentarias que los contienen. A. Lindgren. color. C on el paso del tiempo. P. Alwmark.edu. la variabili­ dad dentro de la especie y parte de su capacidad de adaptación. Por el contrario. grosor del pelaje y otros detalles simila­ res. ver: J. . estas especies originales habrían ido per­ diendo parte de su información genética. 36 Para ampliar. En línea: http://lup. siempre dentro de los límites de la especie: una cebra grande continúa siendo una cebra y no va a dar lugar a descendientes con alas o con cuernos. vol. que cuestionan las largas edades convencionales. La especie original contaría con un patrim onio genético rico.com/dino-dna-bone-cells. Uvdal.H.36 Es cierto que no hemos comentado los métodos de datación ra- diométrica. y hemos asumido equivocada­ mente una mayor diversidad entre las especies extintas de mega- fauna”. Ver: www. et al. y presentamos descubrimientos científicos. Estos métodos y sus deficiencias serán 35 Universidad de Adelaida. que le perm itiría dar lugar a diferentes variedades adap­ tadas a diferentes condiciones ambientales. podrían corresponder en realidad a variedades de la misma especie. C. A. Comunicado de prensa (10 de diciembre. y conclui­ mos que no representa una evidencia directa para la evolución. Hemos argumentado que el principio del uniformitarianismo no es adecuado para calcular las edades de los fósiles. 6.1371/joumal. Lee . 2009). cuyos resultados de millones de años parecen respal­ dar el modelo evolutivo. “hemos subestimado cuánto puede variar una especie en el tiempo y el espacio. los fósiles.0019445. algunas de las especies extintas que son similares a especies actuales. lo que perm itió una mayor variación dentro de cada especie. Según Cooper.lu.au/news/news37301. y con ella..35 En otras palabras.lub. Ver también: www.se/luur/ download?func=downloadFile&recordOId=1972940&fileOId=1975834.pone. En este capítulo hemos analizado el registro fósil. pueden interpretarse como evidencias a favor de una inundación catastrófica m undial que produjo la desaparición de la vida preexistente. Engdahl. como la presencia de biomoléculas y tejidos blandos en fósiles de di­ nosaurio. N° 4 (2011): el9445.adelaide. PLoS ONE.creation. “Microspectroscopic Evidence of Cretaceous Bone Proteins”.html. pero presentan diferencias en cuanto a tam año.

tampoco apoya el modelo evolutivo convencional. como al inicio del Cámbrico. y la información genética asociada a esta. las especies aparecen completamen­ te formadas. sin intermediarios evolutivos que muestren la ad­ quisición gradual de nuevos órganos o estructuras. También mostra­ mos que. analizaremos las pruebas geológicas. lo que sugiere movi­ mientos de agua a gran escala.analizados en detalle en un capítulo posterior. . La aparición súbita de una elevada diversidad biológica en ciertos lugares del registro fósil. de igual modo. han sido m ucho mayores en el pasado. en el registro fósil. históricas y culturales que respaldan el relato bíblico de un diluvio catas­ trófico universal. El registro fósil muestra que la diversidad biológica. Posteriormente. muestra evidencias claras de destrucción y enterramiento catastróficos de miles de organismos en todo el m undo. En el próximo capítulo trataremos en mayor profundidad el problema de los intermediarios evolutivos en el registro fósil.

Martin y E. 7a ed. R. 2005). 22-25. pp. Evolution and Creationism (Washington. p.LUGAR egún los defensores de la evolución. Berg. W. INTERMEDIARIOS EVOLUTIVOS AUSENTES EVIDÉÑCVSDEQÜE LÁ^'e VOLUCIÓ n 'NUNCA TUVO. CA: Thomson Brooks/Cole. 339. D. 2008). Science. para dar lugar a una gran diversidad de seres vivos1 1L. (Belmont. DC: National Academy Press. Biology. . Ver también: National Academy of Sciences and Institute of Medicine. Solomony. P. el registro fósil pro­ S porciona evidencias directas y extensivas que docum entan la veracidad de la evolución.1 Se afirma que existen restos de organismos con características intermedias que demuestran cómo las sencillas formas de vida primitivas evolucionaron gra­ dualmente.

complejos. El Dr. Richard Dawkins, en su libro más reciente
sobre las evidencias de la evolución, describe un escenario evo­
lutivo en el cual toda la vida se originó en el mar. Posteriormen­
te, algunas criaturas marinas evolucionaron, en etapas sucesivas
,hasta convertirse en criaturas terrestres, y acabaron dando lugar
a los reptiles, los insectos, las aves y los mamíferos que cono­
cemos hoy. Dawkins escribe: “Afortunadamente, las etapas de
transición de nuestro éxodo, como peces que emergieron a tie­
rra, están documentadas con gran elegancia en el registro fósil”.2
Pero ¿lo están verdaderamente? Consideremos con m ucha aten­
ción las evidencias reales tras esta rotunda afirmación.
Para que un pez con branquias y aletas evolucione hasta con­
vertirse en un vertebrado terrestre capaz de caminar y de respirar
en tierra, no solo se requiere la formación de pulmones. Además,
debe haber una transformación radical del sistema esquelético, que
incluya la formación de dedos; la rotación de las extremidades y su
fortalecimiento, de manera que puedan soportar el peso corporal; la
separación de los hombros del cráneo, que en los peces se encuen­
tran fusionados; y la unión de la pelvis con la columna vertebral.
Todos estos cambios suponen una gran cantidad de nueva informa­
ción genética, que debió surgir de mutaciones aleatorias. En otras
palabras, en un momento determinado de la historia evolutiva de
los anfibios, cuando los gametos masculino y femenino de dos pe­
ces se combinaron para formar un nuevo embrión, este contenía
una pequeña modificación fortuita en su ADN, con información
genética para comenzar a generar pulmones, lo que confirió a este
nuevo individuo una ventaja para sobrevivir y reproducirse. Este
proceso se repitió múltiples veces, formando y desarrollando to­
das las nuevas estructuras que hemos citado, hasta dar lugar a los
anfibios modernos. El problema principal con esta explicación es
que, como hemos argumentado en capítulos anteriores, no existe
ningún mecanismo conocido capaz de producir nueva información
genética significativa.

2 Richard Dawkins, The Greatest Show on Earth: The Evidence fo r Evolution (London:
Bantam Press, 2009), p. 161.

INTERMEDIARIOS EVOLUTIVOS AUSENTAS

La sola evolución de branquias a pulmones implica una enor­
me cantidad de información genética nueva, en forma de miles de
bases que tienen que aparecer y acumularse en la secuencia correc­
ta para dar lugar al primer pulmón activo. Estas bases tienen que
codificar no solo las nuevas estructuras del sistema respiratorio
propiamente dicho, sino también la musculatura, los controles
del sistema nervioso, y una nueva química sanguínea con sus mo­
léculas asociadas y las rutas enzimáticas necesarias. Se supone que
esto ocurrió lentamente, basándose sobre pequeños cambios acu­
mulativos. Sin embargo, se trata de un proceso genético tan com­
plejo que los científicos no pueden reproducirlo, ni siquiera sobre
el papel. No hay nadie que pueda, partiendo del genoma de un
pez sin pulmones, enumerar las mutaciones genéticas necesarias
para convertirlo en un pez pulmonado. Pese a esto, mucha gente
acepta sin discusión que el proceso ocurrió, y que se dio por azar.
Simultánea o posteriormente a la formación de los pulmones, la
existencia de criaturas capaces de sobrevivir lucra del agua implica
también la evolución de una estructura pélvica y de extremidades
capaces de soportar el peso del cuerpo. Esto requiere mucha más in­
formación genética nueva procedente de mutaciones aleatorias, que
progresivamente tuvo que dar lugar a estructuras óseas, articulacio­
nes, músculos, tendones, ligamentos, vasos sanguíneos y rutas ner­
viosas capaces de controlar el movimiento de los nuevos apéndices.
La explicación evolutiva tradicional indica que los peces que po­
dían usar sus aletas para arrastrarse de un pantano a otro sobrevi­
vían mejor a las sequías.3 Una serie de mutaciones sucesivas en las
aletas permitió el desplazamiento en tierra firme, y con el tiempo,
mutaciones adicionales produjeron modificaciones en el tamaño,
la forma y la posición de los huesos, de manera que las extremida­
des pudieron sostener el cuerpo y mejorar la locomoción terrestre.
Otros científicos han propuesto que el desarrollo de extremidades
capaces de caminar se produjo antes de que los peces abandonaran
el medio acuático, y que las utilizaban para desplazarse sobre el fon­

3 Dawkins, ibíd., p. 165.

do.4 En cualquier caso, dados los profundos cambios anatómicos y
fisiológicos implicados en la evolución de pez a anfibio, y suponien­
do que los cambios tuvieron lugar en pequeños pasos a lo largo de
millones de años, cabría esperar encontrar cantidad de evidencias de
este proceso en forma de fósiles de transición.
Las formas de transición son extremadamente escasas en el
registro fósil, pero los evolucionistas afirman que, en el caso de
la evolución de peces a anfibios, la secuencia detallada está bien
documentada. Proponen que los anfibios evolucionaron durante
el Devónico, a partir de un tipo de peces con aletas lobuladas
(sarcopterigios), y presentan como evidencia una serie de fósiles
de edades sucesivas, cuyos elementos esqueléticos parecen cam­
biar progresivamente para adaptarse a la locomoción en tierra.
Los fósiles que forman dicha secuencia son los siguientes:
• Eusthenopterom Fósil que se considera que es el más antiguo
y, por tanto, ancestral en esta línea evolutiva. Este pez de aletas
lobuladas, que podía medir hasta 1,8 metro, presentaba algunas
características comunes con anfibios fósiles del Devónico, como
el patrón de huesos del cráneo, el tipo de dientes y los orificios
nasales. Además, los huesos de sus aletas eran similares a los de
los tetrápodos (animales terrestres de cuatro patas), y se puede
distinguir el húmero, el radio y el cubito en la aleta delantera, y
el fémur, la tibia y la fíbula en la aleta trasera. El Eusthenopteron
era un animal completamente acuático, con forma y locomoción
típica de los peces. Tenía aletas dorsales y se propulsaba con mo­
vimientos de la cola. Las aletas no le servían para caminar porque
los hombros estaban fusionados con el cráneo, y los huesos de las
aletas traseras estaban separados de la columna vertebral.
• Panderichthys: Es otro pez de aletas lobuladas, similar al Eus­
thenopteron pero sin aletas dorsales. Ambos fósiles han sido da­
tados con una antigüedad de entre 380 y 385 millones de años
(MA).
• Tiktaalik. Siguiente fósil de la secuencia, descubierto en 2006,

4James L. Edwards “Two perspectives on the evolution of the tetrapod limb”, American
Zoologist, vol. 29, N° 1 (1989), pp. 235-254.

y con una antigüedad estimada de 375 MA. Igual que los anterio­
res, el Tiktaalik era un pez de aletas lobuladas, pero tenía caracte­
rísticas especiales que lo acercan a los animales terrestres. La cabeza
del Tiktaalik era similar a la de un cocodrilo, y algunos detalles del
esqueleto del cuello y de las extremidades sugieren que podía sujetar
el peso de su cuerpo sobre las aletas, en aguas poco profundas.
• Acanthostega e Ichthyostega-. Dos de los más conocidos que co­
rresponden ya a anfibios verdaderos. Son los últimos fósiles que
vamos a comentar aquí. Medían, aproximadamente, un metro de
largo y tenían patas con dedos diferenciados; cuello móvil; cintura
escapular (hombros) separada del cráneo; y cintura pélvica unida a
la columna vertebral. Estas dos últimas características permitían la
locomoción en cuatro patas, típica de los tetrápodos. Estos fósiles
han sido datados con antigüedades de alrededor de 365 MA.
Esta secuencia de fósiles de transición se puede encontrar, con
pequeñas variaciones, en libros de texto, libros de divulgación
sobre evolución y artículos científicos. A prim era vista, puede
dar la impresión de que realmente muestra la evolución progre­
siva de peces a anfibios por medio de la adquisición de las adap­
taciones necesarias para la vida fuera del agua. Sin embargo, un
análisis más profundo puede llevarnos a una conclusión distinta.
En prim er lugar, esta secuencia evolutiva no explica una de
las adquisiciones evolutivas más importantes y difíciles para el
paso del medio acuático al medio terrestre: la aparición de los
pulmones. Se considera que el Eusthenopteron, prim er eslabón
de la secuencia, ya poseía, además de branquias, pulmones fun­
cionales similares a los de los peces pulmonados actuales.
En segundo lugar, los fósiles que forman la secuencia, espe­
cialmente el Tiktaalik, muestran una mezcla de características de
distintos grupos animales, pero eso no los convierte autom ática­
m ente en formas de transición.5 En la actualidad, tenemos ejem­
plos de animales, como el ornitorrinco, que a pesar de presentar
una extraña combinación de características (es un mamífero con

5P. Garner, “Tiktaalik, the ‘Fishopod’ from the Canadian Artic”, Origins, vol. 48 (2008),
pp. 12-14.

como cabría esperar en un verdadero fósil de transición. vol. no se considera una forma interm edia entre aves y mamífe­ ros. mientras que los dos últimos (anfibios verdaderos) tienen dedos perfectamente desarrollados. pero los tres primeros (peces verdaderos) no tienen dedos. cráneo aplanado. que se supone que son sus ancestros. 7Janvier. que 6Gamer.pelo que amam anta a sus crías. en una forma­ ción rocosa datada con 397 MA de antigüedad. pp.7 Según este descubrimiento. En ningún momento se aprecia el desarrollo gradual de los dedos. 17. Un equipo de investigación dirigido por Grzegorz Niedzwiedzki descubrió.41. En tercer lugar. con algunas características comunes (gran tamaño. huellas fósiles de un tetrápodo. similar al Ichthyostega. ninguno de los fósiles de la secuencia muestra estructuras parcialmente desarrolladas. 40. 463 (2010).com/tetrapod. Journal ofCreation. como el Eusthenopteron o el Panderichthys. los anfibios verdaderos serían ante­ riores a los peces de aletas lobuladas. . con dedos diferenciados. Nature. publicado en la revista Na- ture en 2010. las supuestas “etapas de transición de nuestro éxodo como peces que emergieron a tierra” no están tan documentadas como algunos afirman. vol. El hecho de que los peces sarcop- terigios del Devónico y los anfibios del mismo período tengan algunas características similares podría explicarse debido a que habitaban ambientes similares y tenían necesidades comunes. Philippe y Gael Clément. etc. pero pone huevos y tiene pico de ave). todos ellos tienen un pa­ trón sim ila r en los huesos de las patas. Por ejemplo. pues no hay evidencias fósiles de ello.6 Por último. Lo mismo ocurre con la supuesta separación incremental de la articulación del hombro respecto de la cabeza. en proceso de evolución. ha puesto en duda la veracidad de esta secuencia evolutiva. N° 2 (2003). Ver también: www. pp. Según es posible notar. 111-117. “Palaeontology: muddy tetrapod origins”. “The Fossil Record of ‘Early’ Tetrapods: Evidence of a Major Evolutionary Tran- sition?”. huesos de las aletas. un reciente hallazgo.).crea- tion. Los datos muestran un conjunto de fósiles claramente separados en dos grupos: peces de aletas lobuladas y anfibios. o al menos su datación.

No se encuentran ver­ daderas formas de transición con nuevas estructuras parcialmente desarrolladas. y este hecho lo reconocen los propios científicos evolucionistas. citado en: A.9 8 R. Bailcy. MD: Review and Herald Publisfaing Association. Raup. muestran poco o ningún cam­ bio a lo largo de su existencia y luego desaparecen completamente. Rotb. y antiguo presidente de la Sociedad Paleontológica. cuyas aletas contienen espinas óseas. Boletín 50. 9D. sarcopterigios y actinopterigios. completamente forma­ dos. Si retrocedemos en el registro fósil buscando las formas de transición que llevaron al desarrollo de los pulmones en los peces sarcopterigios. En su lugar. M.183. profesor de Zoología de la Universidad de Michigan. son muy diferentes de los actinopterigios. 9. t. entonces. en los estratos del Devónico Medio. M. con­ servador de Geología del Museo de Historia Natural de Chicago. declara que los geólogos no observan en el registro geológico el desarrollo gradual de la vida. También están ausentes los ancestros de los peces osteictios. en un antepasado de los peces sar- copterigios. 442. señala que los fósiles de este grupo aparecen repentinamente. Según él: “Parece claro. McGraw-Hill Encyclopedia o f Science and Technology (New York: McGraw-Hill Book Company. David M. Estos peces.pueden interpretarse de maneras distintas. pertenecen a la clase Ostei- chthyes (peces con esqueleto óseo). A. sin antepasados evolutivos evidentes ni especies inter­ medias. Field Museum of Natural His- tory. grupo que incluye a la mayoría de los peces que conocemos. encuentran especies que aparecen repentina­ mente en las secuencias geológicas. y no se explica la aparición de los pulmones. p. Bailey. 1960). Rccvc M. pp. Conflicts between Darwin and Palaeontology. 1998). pp. o la secuencia que demuestre cómo los dos grupos se separaron a partir de un an­ cestro común. . Origins: Linking Science and Scrip- twe (Hagerstown. El Dr. de aletas lobuladas. El Dr. Raup. Ambos gru­ pos. que debieron surgir anteriormente. la aparición repentina de especies completamente constituidas.8 En realidad. “Osteichthyes”.1979. es lo habitual en el registro fósil. no las encontramos. que la historia [la ascendencia evolutiva] del grupo se extiende más atrás en el pasado de lo que el registro fósil revela hasta ahora”. 22-29. 182.

pero se trata de cambios leves en la forma o el tamaño de estructuras preexistentes.11 Una vez más. Briggs y P. pero siguen siendo sin duda polillas y guppys. el vuelo ya está comple­ tam ente desarrollado. Es cierto que hay algunos ejemplos de cambio gradual en el registro fósil. Se trata de un fenómeno similar a lo que tratamos en el capítulo 4. ahora extintos). e incluso un evento de especiación: dos especies muy similares que surgen a partir de una sola. de la Universidad de Exeter. este hecho supone miles y miles de bases de A D N que contengan toda la información necesaria para codificar las estructuras y las funciones respon­ sables del vuelo. la autoridad en insectos Dr. muchos especímenes fósiles que supuestamente tienen millones de años son prácticamente idénticos a especies actuales. es de esperar que la evolución gradual del vuelo haya dejado evidencias en el registro fósil. El Dr. Trends in ecology & evolution. vol. Volar es una función m uy especializada. Raup han sido percibidas también por otros científicos. al explicar los típicos ejemplos de evolución de los li­ bros de texto: polillas o guppys que cambian de color. Un ejemplo es la diatomea Rhizosolenia. En el registro fósil de Rhizosolenia. 405-411. Crowther. 72-75. 1990). Por ejemplo. por lo tanto. pp. En realidad. se observa un cam­ bio gradual en la forma de la capsula silícea del alga. aparezcan por azar en el genoma de insectos l0Michae! J. Las observaciones del Dr. E. Palaeobio- logy: A Synthesis (Oxford: Blackwell Scientific Publications. “Speciation in the fossil record”.101Lo importante es que al final del proceso seguimos teniendo el mismo tipo de organismo: diatomeas Rhi­ zosolenia. Robín W ootton. pp. No obstante.. los seres voladores se dividen en cuatro grupos principales: insectos. aves y murciélagos. Raup señala que la mayoría de los fósiles no muestran los cambios esperados a medida que se asciende en las capas de roca. reptiles voladores (ptero- saurios. Wootton. . explica que cuando los insectos fósiles aparecen en la columna geológica por prim era vez. que además de alas requiere muchas caracte­ rísticas. N° 7 (2001). Benton y Paul N. respectivamente. en D. 16. 11R. J. '‘Flight: Arthropods”. un alga unicelular microscópica que forma parte del plancton. G. R. Pearson. eds.

pero estas evidencias no aparecen en el registro fósil. el sistema respiratorio incorpora estructuras únicas: los sacos aéreos. pero permiten el deslizamiento. la cantidad de información genética nueva necesaria para todos estos cambios es enorme. Asimismo.. Estos sacos almacenan aire y actúan como fuelles. Las aves poseen huesos huecos reforzados con tirantes entrecruzados. Las plumas. Si bien se supone que las plumas de las aves evoluciona­ ron a partir de las escamas de un reptil ancestral. lo que mantiene un volumen fijo de aire fresco. ilustran aún mejor este punto. y los convierta en voladores en tan corto tiempo que no dejen ninguna evidencia fósil de evolución gradual. En las aves. ibíd. 185. Igual que en los ejemplos anteriores. p. El aceite lubricante procede de la glándula uropigial. que actúan como un velero.13 tienen estructuras complejas muy diferentes de las escamas conocidas. debido a un ingenioso sistema de lengüetas y barbas (protuberancias y ganchos). señala que los pterosaurios voladores. esta nueva información es fruto de mutaciones aleatorias que se fueron acumulando poco a poco. que tam­ bién proporciona impermeabilidad al plumaje. Ariel Roth. deberíamos encontrar numerosas evidencias fósiles de la evolución gradual de las aves. graduado de la Universidad de M ichi­ gan y editor de la revista Origins por más de veinte años. a Ibíd. para satisfacer la alta demanda de oxígeno del vuelo. para que el sistema funcione. o glándula del acicalado. como afirma la 'Icorta de la Evolución.no voladores. es necesaria una correcta lubricación que impida que la delicada es­ tructura de enrejado de la pluma se deshiladle. y permite a las aves 12Roth. que caracterizan a todas las aves. El zoólogo Dr. que circula por los pulmones y aum enta la eficiencia del intercambio gaseoso.12 El vuelo requiere cambios anatómicos m uy importantes. Las plumas son resistentes al viento. que reducen el peso conservado la fortaleza estructural. las aves y los murciélagos tam ­ bién aparecen repentinamente en los estratos fósiles como cria­ turas voladoras desarrolladas por completo. . Si.

133. Walker y P. 232 (1986). formadas por completo y en abundancia. p. p. pero no se ha encontrado ninguna. . pp. Ver también: Barbara J. ibíd. la ausencia de evidencias fósiles para una evolución progresiva es aún más pronunciada. pp. Whybrow. Las plantas con flores (Angiospermas) aparecen súbitamente. pero to­ dos aparecen completamente formados. C. La evolución de plumas funcionales a partir de escamas requiere la aparición. Charig. “Archaeopteryx Is Not a Forgery”. pp. El registro fósil contiene muchos ejemplares de tortugas. Milner. No hay evidencias en el registro fósil de criaturas con escamas transformándose en plumas.. Stahl. 18A. A. 7-35.16 Un ejemplo similar es el de los dinosaurios con cuernos.18 Si revisamos los estratos de la columna geológica. 7. p. Greenaway. 15A. “Palaeobotany: Perspectives in 1980”. A. Evolution: The Challenge o f the Fossil Record (El Cajón. de manera simultánea. Rothwell. Tal como señala el Dr. cabría esperar encontrar numerosos fósiles de etapas intermedias en la evolución de las tortugas. 1986). Journal ofEvolutionary Biology. C.volar bajo la lluvia y sumergirse en el agua sin mojarse. Science. 622-626. N° 1 (1981). 350. Vertébrate History. Roth. 124. Knoll y G. mas no se encontraron evidencias de un desarrollo progresivo de estos. Gish. Problems in Evolution (New York: Dover Publications. 16Roth. Se han hallado miles de fósiles de dinosaurios con cuernos y sin ellos. encontramos fósiles de criaturas con plumas completa­ mente desarrolladas. CA: Crea- tion-Life Publishers. H. F. como el famoso reptil-ave. 182. 9 (1996). vol. de información genética nueva que codifique las intrincadas estructuras que forman las plumas y la información ne­ cesaria para crear la glándula del acicalado.15 O tro grupo cuya evolución carece totalmente de intermedia­ rios en el registro fósil es el de las tortugas. Palaeobiology. vol. El plan corporal de las tortugas es único entre los vertebrados. “On the Origin of Feathers”. W. El caparazón se forma a partir de placas de hueso y supone una modificación drástica de la caja torácica. vol. empezando 14A.14 En vez de ello.17 En el caso de las plantas. Archaeopteryx. J. 1985). J. 17Duane T. 349. Brush. H.

U n ejemplo de la ele­ vada diversidad presente en los estratos cámbricos se aprecia en los fósiles procedentes del yacimiento de Burgess Shale. con len­ tes individuales capaces de enfocar la luz desde cualquier dis­ tancia. tam bién encontramos fósiles de trilobites completa­ m ente desarrollados. y la Marrella splendens.20 Los ojos de los trilobites presentaban una gran complejidad. 21K.21 A pesar de la abundancia de fósiles de trilobites. Bell. “Trilobite Eyes: Calcified Lenses”. G. Science. encontramos grandes cantidades de fósiles de ani­ males diversos totalm ente desarrollados.por la base y prestando atención a cómo y a cuándo aparecen los distintos fósiles. 1. el mismo patrón se hace evidente una y otra vez. 179 (9 de marzo de 1973).000 especímenes de esta formación rocosa. Collier. en las Rocosas Canadienses. Briggs. 2. pa­ tas articuladas y ojos compuestos. una criatura multisegmen- tada con muchas extremidades. . D. en la mayoría de los cuales se aprecian estructuras corporales y detalles anatómicos tan bien conservados que han proporciona­ do información m uy valiosa sobre el modo de vida de estos or­ ganismos. Por el contrario. por entero distinta a cualquier especie conocida de la actualidad. los investigadores extrajeron más de 73. pp. los fósiles son bastante infrecuentes y corresponden principal­ m ente a algas. un animal parecido a un langostino. pp. 424-427. famoso por la excelente preservación de criaturas de cuerpo blando. 1994).19 En los años 90. C. vol. Algunos casos curiosos de artrópodos procedentes de Burgess Shale son los Waptia fieldenis. t. pertenecientes al Precámbrico. y unos pocos organismos marinos de pequeño tamaño. “Cambrian”. no se han descubierto en el registro fósil evidencias de su evolución: 19D. bacterias. J. Erwin y F. H. The Fossils oftlie Burgess Shale (Washing­ ton. con su típico exoesqueleto trilobular. estaban conformados por múltiples facetas colocadas en diferentes direcciones.007-1. al llegar a los estratos del Cámbrico. E. DC: Smithsonian Institution Press. 20W. En los estratos inferiores.011. McGraw-Hill Encyclopedia o f Science and Technology. Towe. En las rocas del Cámbrico inferior.

-VÜLíJaüN

sus complejas estructuras corporales aparecen de manera repen­
tina, plenamente formadas y funcionales. Otros seres hallados
en las rocas del Cámbrico inferior incluyen esponjas, medusas,
corales, anémonas, gusanos, cangrejos herradura, caracoles, bra-
quiópodos y erizos de mar, por nom brar algunas de las especies
más conocidas.22 Los nautiloideos, cefalópodos similares a los
calamares, son abundantes. 23Estas criaturas eran m uy similares
a los nautilos actuales, cazadores inteligentes y agresivos, con so­
fisticados sistemas de propulsión a chorro.24 Se han encontrado,
incluso, fósiles de vertebrados en forma de peces cartilaginosos,
lo que implica que estos animales existían en la época en la que
las rocas del Cámbrico inferior fueron depositadas.25 Com o se
indicó anteriormente, los paleontólogos han llamado “explosión
del Cám brico” a la aparición repentina de tal abundancia y di­
versidad de especies.
La explosión del Cámbrico supone un problema para la Teoría
de la Evolución. La ausencia de intermediarios no puede ser expli­
cada alegando que faltan estratos, ya que hay multitud de ejemplos
en que cientos ele metros de estratos precámbricos no fosilíferos, sin
evidencias de erosión o interrupción geológica entre las capas, yacen
bajo rocas cámbricas ricas en fósiles de trilobites.26 Para explicar la
explosión del Cámbrico dentro del marco convencional de la Teoría
de la Evolución, es preciso aceptar que un gran número de muta­
ciones aleatorias sucesivas produjeron, a partir del A D N de unos
pocos organismos sencillos del Precámbrico, toda la información
genética necesaria para construir los miles de organismos diferentes

22 Roth, ibíd., pp. 164, 165.

23 Berg, Martin y Solomon, ibíd., pp. 393-395.

24J. B. Wood, “Fossil Cephalopods”, Bermuda Institute ofOcean Sciences, 2010. En línea:
www.thecephalopodpage.org/FosCephs.php. Ver también: www.ucmp.berkeley.edu/taxa/
inverts/mollusca/cephalopoda.php.

25 X. G. Zhang y X. G. Hou, “Evidence for a Single Median Fin-fold and Tail in the Lower
Cambrian Vertébrate, Haikouichthys Ercaicunensis”, Journal o f Evolutionary Biology, vol.
17 (2004), pp. 1162-1166.

26 Bell, ibíd., p. 425.

que aparecen en las rocas del Cámbrico, en un período de tiempo
lo suficientemente corto como para que no aparezcan en el registro
fósil. Como ya hemos argumentado en capítulos anteriores, las m u­
taciones raramente son beneficiosas,27 y no son capaces de generar
información genética nueva. Una vez más, llegamos a la conclusión
de que no existe una explicación conocida ni evidencias fósiles de
cómo la evolución pudo dar lugar a tal diversidad biológica por
medio de mutaciones aleatorias y selección natural.
Por el contrario, en el registro fósil sí encontramos numerosas
evidencias de que las especies se m antienen en el tiempo sin
grandes cambios. Entre otros, podemos citar el caso de los cela-
cantos vivos, capturados en Sudáfrica en 1938, que eran prácti­
camente idénticos a los celacantos fósiles.28
El Dr. Cari Werner, biólogo y médico de la Universidad de Mis­
souri, y su esposa, Debbie, diplomada en Ciencias, desarrollaron
un ambicioso proyecto que consistía en fotografiar decenas de es­
pecímenes fósiles expuestos en museos y hacer una comparación
con fotografías de animales actuales. Su trabajo ha sido publicado
en dos obras ilustradas de 260 páginas cada una, con fotografías a
color de alta calidad, bajo los títulos Evolution: The Grand Experi-
ment [Evolución: El gran experimento] y Living Fossils, Evolution:
The Grand Experiment [Fósiles vivientes. Evolución: El gran expe­
rimento].29 Tal como su nombre indica, esta última obra provee de
evidencias fotográficas de que muchas especies han permanecido
esencialmente inalteradas desde las formas fósiles hasta las formas
vivientes del presente. Los libros del matrimonio Werner presen­
tan fotografías de fósiles encontrados en los mismos estratos que
los dinosaurios, junto a sus homólogos existentes en la actualidad.
Estos incluyen estrellas de mar, ofiuras, erizos de mar, pepinos de

27 D. H. Erwin y J. W. Valentine, “ ‘Hopeful Monsters’, Transposons and Metazoan Radia-
tion”, Proceedings ofthe National Academy o f Sciences, vol. 81 (1984), pp. 5.482, 5.483.

28 Dawkins, ibíd., p. 163.

29 Cari Werner, The Questfor an Answer, Evolution: The Grand Experiment (Green Forest,
AR: New Leaf Press, 2009), 1.1; Werner, Living Fossils, Evolution: The Grand Experiment
(Green Forest, AR: New Leaf Press, 2009), t. 2.

mar, crinoideos, langostinos, langostas, cangrejos de río, cangrejos,
cangrejos de herradura, nidos de termita, libélulas, saltamontes, in­
sectos acuáticos, avispones, escarabajos, moscas escorpión, efíme­
ras, grillos, cucarachas, vieiras, almejas, mejillones, ostras, caracoles,
nautilos, escafópodos, braquiópodos, quitones, lombrices de tierra,
gusanos tubícolas, esponjas, corales, esturiones, celacantos, peces
pulmonados, peces aguja, Amia calva, anguilas, arenques, tiburones
ángel, rayas, mixinos, salamandras, caimanes, cocodrilos, serpien­
tes, boa constrictor, lagartijas, tortugas, avoceta (un ave de hoy en
día fosilizada junto a un Tyrannosaurus rex y a un Triceratops en Hell
Creek, Montana), mamíferos varios, conos de semillas y ramas de
secuoya, pifias de Cook, cicadas, ginkgos, heléchos, equisetos, mus­
gos, rododendros, lirios, sasafrás, álamos, y otros árboles y plantas.
Los ejemplos que Cari y Debbie Werner han coleccionado no
son exhaustivos, pero sirven para mostrar que muchas especies de
animales y de plantas que conocemos hoy vivieron al mismo tiem­
po que los dinosaurios, y que las especies supervivientes son simi­
lares a las fósiles, sin signos de evolución. El Dr. Werner afirma
en su libro que entre 100 y 200 millones de fósiles se encuentran
conservados en museos en todo el m undo.30
Durante el curso de su investigación y la filmación de la serie
Evolution: The Great Fxperiment [Evolución: El gran experimen­
to], Werner entrevistó a muchos conservadores de museos, a los
cuales preguntó acerca de los fósiles de sus colecciones, muchos
de los cuales no se encuentran expuestos para la exhibición públi­
ca, sino que están en los depósitos de los museos. Puede ser que
los lectores desconozcan que los paleontólogos han encontrado
más de 430 especies de mamíferos fosilizados junto con los dino­
saurios, lo que demuestra que estos animales fueron contemporá­
neos.31 No obstante, el Dr. Werner reporta que no vio expuesto
un solo esqueleto completo de mamífero, de los encontrados en

30Werner, The Q uestfor anAnswer, Evolution: The Grand Experimenta t. 1, p. 77.

31 Z. Kielan-Jaworowska, R. L. Cifelli, y Z. X. Luo, Mammalsfrom the Age o f Dinosaurs:
Origins, Evolution, and Structure (New York: Columbia University Press, 2004).

los estratos de dinosaurios, en ningunos de los 60 museos que vi­
sitó. W erner afirma que los estratos ricos en fósiles de dinosaurios
contienen fósiles representativos de los principales filos animales,
incluyendo a las aves, que supuestamente evolucionaron a partir
de estos. También hay fósiles de los principales grupos de plantas.
De su estudio exhaustivo de los fósiles de los museos y su com­
paración con plantas y animales actuales, Werner concluye que el
registro fósil no proporciona evidencias de que la evolución haya
tenido lugar.32
Empezamos este capítulo comentando que muchos libros de
texto afirman que los fósiles constituyen una prueba directa de
la evolución, y que populares científicos como Richard Dawkins
defienden que hay abundantes evidencias de esta en el registro
fósil. Aun así, un análisis detallado parece indicar más bien lo
contrario. La carencia de pruebas fósiles de la evolución ha sido
reconocida desde hace algún tiempo. Stephen J. Gould, famo­
so paleontólogo de la Universidad de Harvard, admitió la au­
sencia de evidencias para las etapas intermedias requeridas en
las principales transiciones evolutivas. También destacó que el
desarrollo incompleto de una estructura nueva carecería de uti­
lidad para el organismo y, por lo tanto, no podría ser objetivo
de la selección natural. En sus propias palabras: “¿Qué posible
uso podría tener para un reptil el dos por ciento de un ala?”33
La eminente paleóntologa Barbara J. Stahl, diplomada por la
Universidad de Harvard, tam bién ha señalado los defectos de
las supuestas evidencias fósiles de la evolución,34 y ya hemos co­
mentado anteriormente que el Dr. Raup, conservador de Geo­
logía en el Museo Field de Historia Natural de Chicago, sostiene
que los geólogos no encuentran evidencias de evolución en el

32Werner, Living Fossils, Evolution: The Grand Experiment, t. 2, pp. 241-243.

33 Stephen Gould, “Is a New and General Theory of Evolution Emerging?”, en M. Ruse,
ed., But Is It Science? (Buffalo, NY: Prometheus Books, 1988), cap. p. 12, 177-194; citado
en: Colin Mitchell, The Case for Creationism (Alma Park, Grantham: Autumn House Li­
mited, 1994), p. 129.

34 Stahl, ibíd.

The Panda ’s Thumb: More Reflections in Natural History (New York: W. los libros de texto de referencia sobre Biolo­ gía y Evolución continúan om itiendo toda discusión relativa a las actuales objeciones a la teoría. Según Stephen J. De hecho. Roth concluye su libro de 380 páginas sobre los orígenes con esta frase: “Me sorprende que el concepto de evolución persista. 362. Norton and Co. los árboles evolutivos que adornan nuestros libros de texto están ba­ sados principalmente sobre inferencias. . p. la au­ sencia de evidencias de la evolución en el registro fósil no se en­ seña a los estudiantes de Biología. en vista de la escasez de pruebas sólidas que lo respalden”.35 A pesar de ser reconocida por muchos paleontólogos.. 36Stephen J. El Dr. y no evidencias fósiles.registro fósil. p. 181. ibíd. 1980).36 35Roth.. W. Gould. Gould. ni se divulga entre el público general.

y rocas magmáticas. como la lava de los volcanes. como el granito y el basalto. Las metamórficas proceden de otras rocas que se modifican por acción de la temperatura y la presión. cubren aproximadamente el 75% de la superficie terrestre. Esta observación no es rebatida por los geólogos. cuyos materiales son depositados principalmente por la acción del agua. los . como el mármol. El resto de la superficie terrestre está cubierta por rocas metamór- ficas. siendo esquistos. areniscas y calizas las más abundantes. A pesar de su amplia distribución. Las rocas magmáticas se conforman por solidificación de materiales fundidos procedentes del interior de la Tierra. DILUVIO UNIVERSAL: EVIDENCIAS GEOLÓGICAS ran parte de la superficie de nuestro planeta está cubier­ G ta por estratos de roca que se formaron bajo el agua. Las rocas sedi­ mentarias. las rocas sedimentarias solo representan un 5% del volumen de la corteza terrestre. Según estas cifras.

(Chichester. The Nature ofthe Stratigraphic Record. en Groenlandia. Zumberge. o de los cementerios masivos de fósiles que hemos comentado en capítulos anteriores. por el contrario. 1995). ascenso y disminu­ ción de los niveles del mar. el eminente geólogo Derek Ager. resulta significativa a la hora de decantarse por una u otra respuesta. del C o­ legio Universitario de Swansea. The New Catastrophism: The Impórtame ofthe Rare Event in Geológica! History (Cambridge. 3o ed. Es de destacar que el desarrollo de teorías para explicar estos y miles de otros depósitos masivos continúa siendo un importante campo de estudio para los geólogos. la misma combinación de estra­ tos sedimentarios se encuentra en diferentes partes del mundo. de inmensos lechos de caliza depositados por agua. Ele- ments o f Geology. J. 44. Siever. los estratos fosilíferos del Cámbrico inferior se encuentran sobre estratos de un tipo especial de arenisca llama­ 1R. “Sedimentary Rocks”. en Es­ tado Unidos—. 2o ed. t. La existencia de formaciones geológicas -com o los casi dos kilómetros de profundidad de estra­ tos depositados por agua en el Gran Cañón del Colorado. se formó en un período de tiempo relativamente breve. . sedimentos constituyen una capa extensa. McGraw-Hiü Encyclopedia o f Science and Technology (New York: McGraw-Hill Book Company. sostiene que los estratos de roca de todo el m undo indican que ha habido períodos de cambio gradual lento (conocido como “gradualismo” en el modelo del uniformitarianismo). El reconocimiento del papel de las catástrofes a gran escala en el modelado de la superficie terrestre ha crecido en épocas recientes. 2Derek V. 1963). pp. 12. (New York: John Wiley and Sons.12 Una de las observaciones im portantes del profe­ sor Ager es que. Ver también: Derek V. pero relativamente fina. 1992). etc. Ager. 1960). alteraciones en mares y lagos debidas a terremotos y erupciones volcánicas. En Gran Bretaña. Entre otros. 129-135. p.1 Cabe preguntarse si dicha capa de sedimentos se depositó a lo largo de cientos de millones de años de eventos locales repetitivos (inundaciones. a causa de un gran evento de inundación global.H. en las Rocosas Canadienses y en Australia. NY: John Wiley and Sons. muchas veces. sobre la superficie de la Tierra.) o. UK: Cambridge University Press. Ager. puntuado por inmensos desastres natura­ les ocasionales.

ibíd. 4W. El pro­ fesor Ager señala que esta capa de cuarcita tiene una distribución global. . como un conglomerado basal de guija­ rros y materiales redondeados cementados con arenisca. miles o incluso millones de años. pero en este caso. Por debajo de la cuarcita. seguido de esquistos marinos y de calizas finas.3 Esto significa lo siguien­ te: los estratos del Cámbrico inferior. que contienen fósiles de muchos tipos de organismos. p. McGraw-Hill Encyclopedia o f Science and Technology (New York: McGraw-Hill Book Company. “Cretaceous”. p. estando todo o gran parte de este cubierto por agua. sí se aprecian señales de erosión en la superficie de separación. Ambos grupos de estratos están separados por lo que en estratigrafía se llama “paraconfor­ m idad”. y coincidente con la extinción de los dinosaurios. Según la interpretación convencional de la columna geológica. esperaríamos además encontrar evidencias de erosión entre las series de estratos. se encuentra una gran variedad de rocas precámbricas. Es difícil imaginar cómo una serie de eventos locales. 1960). Cobban. podría haber dado lugar al mismo patrón de deposición. pasaron más de 3Ager. siguiendo el mismo patrón de deposición en todo el planeta. en diferentes lugares separados entre sí por cientos. las extinciones masivas se han sucedido a lo largo de la historia de la Tierra. En el Capítulo 5 citamos los grandes depósitos de creta en todo el mundo. 542. causada por los agentes climáticos que actua­ ron sobre la superficie de la Tierra durante todo ese tiempo. los reptiles voladores y muchos otros organismos marinos.4Teóricamente. que no contiene fósiles.. 3. La semejan­ za del patrón estratigráfico sugiere que las mismas condiciones ambientales prevalecieron alrededor del m undo. t. A. y se encuentra asociada con una combinación de estratos fácilmente identificables. fueron depositados por la acción del agua sobre otras capas de rocas sedimentarias. una línea paralela a los estratos en la que no se apre­ cian señales de erosión. los grandes reptiles marinos. Si tal fuera el caso. 11. que se formaron durante un período de inun­ dación de la superficie terrestre.do cuarcita.

ed. “Geology and Geography of the Zion Park Región. Esta capa. J. Gregory. GeologicalSurvey ProfessionalPaper. con gran fuerza. “Phanerozoic Biodiversity Mass Extinctions”. y durante el Devónico. N° 220. en M. Ver también: R.S. S. P. En línea: www. Utah and Arizona. que generalmente tiene menos de 30 metros de espesor. p.”. Evidencias de estas extinciones se observan en estratos correspondientes al final del Ordovícico. ¿apuntan estos a una sucesión de inundaciones locales distribuidas a lo largo de cientos de millones de años. 27-50. C. “The Chinle Group: Revised Stratigraphy and Biochronology of Upper Triassic Non-marine Strata in the Western United States”. K. el Pérmico y el Triásico. Ayala.. “Aspects of Mesozoic Geology and Paleontology of the Colorado Plateau”. Morales. 7 S.7 J.org/content/105/Supple- m ent_l/l 1453. pueden verse afloramientos del conglomerado Shinarump.5 lo que implica inundaciones periódicas separadas por decenas o cientos de millones de años. U. E. arenisca y madera fosilizada. el material de este depósito tuvo que ser transportado y dispersado por una enorme masa de agua. pp. “In the Light of Evolution II: Biodiversity and Extinction”. . 1 (12 de agosto de 2008). 127-155. Y el con­ glomerado Shinarump es solo un integrante de la formación Chin- le. G. un grupo de rocas sedimentarias que están dispersas sobre un area estimada de 800.6 Para quedar distribuido de manera casi ininterrumpida en una zona tan extensa. Lucas. Animal Review ofEarth and Planetary Sciences.3 millones de kilómetros cuadrados.C f L ü c ? -m ■400 millones de años entre la inundación mundial del Cámbrico y la inundación mundial del Cretácico. Por ejemplo. 65. Hubbell y F. vol. Unseum o f Northern Arizona Bulletin. o su­ gieren más bien un gran evento de inundación global más reciente? Una de las primeras pistas que encontramos a favor de una inun­ dación global es la existencia de extensos depósitos sedimentarios que contienen fósiles de organismos terrestres. No. 59 (1993). Proceedings o f the National Academy o f Sciences o f the USA. La pregun­ ta permanece: si consideramos el conjunto de los datos geológicos y paleontológicos. E y . supl. Avise. 34 (2006).000 a 2.full. pp. 6 H.000 kilómetros cuadrados. en el parque nacional Zion.pdf. se extiende de manera casi uniforme sobre una extensión de 250. pp. 11453-11457.pnas. Bambach. una roca sedimentaria que contiene guijarros. en Utah. pero el registro fósil indica que hubo varias extinciones masivas más en el período de tiempo intermedio.

que enterró a miles de anim a­ les terrestres. pp. la deposición cruzada presente indica que fue agua que fluía rápidamente lo que produjo dunas submarinas en la formación Coconino.000 kilómetros cuadrados. “Fossil Footprints from the Grand Canyon: Second Contribution”. Roth. Ver también: R. R. Brand y T. en casi todos los casos. “Fossil Vertébrate Footprints in the Coconino Sandstone (Per- mian) of Northern Arizona: Evidence for Underwater Origin”. y se extiende sobre aproximadamente 1. p. A partir de la forma y el tamaño de las 8 L. 11 L. t. 2. . O tro caso de roca que contiene fósiles de animales terrestres es la famosa formación Morrison. La formación de arenisca de Coconino. vol. 9 A. 1998).101Además. El estudio de estas huellas ha demostrado que. Este depósito. 2009). N° 3 (1927). “Wading Newts May Explain Enigmatic Tracks”. W. Gilmore.8 Esto representa otro flujo masivo de sedimentos sobre una vasta área. aunque se supone que esta formación es de origen eólico. Monastersky. Geology Studies Special Publication. MD: Review and Herald Publishing Association. Brigham Young University”. A. Smi- thsonian Miscellaneous Collections.9 La mitad inferior de la arenisca de Coconino contiene cientos de rastros fosilizados de pisadas de anfibios y reptiles. N°7 (1988). y tiene un grosor medio de tan solo 100 metros.11 En la misma línea. 10 C. Geology. desde Texas a Canadá. vol. vol. Tales depósitos de rocas sedimentarias sumamente extensos. A. cubre una extensión de 520. Origins: Linking Science and Scripture (Hagerstown. Tang. TX: Institute for Creation Research. 5. 1. 19 (1991). p. p.201-1. son más consistentes con la deposición por un diluvio catastrófico que con una formación lenta y gradual de los estratos sedimentarios. con una profundidad me­ dia de 150 metros. es otro ejemplo. pero relativamente finos. p. estudios experimentales sugieren que las huellas en­ contradas no fueron impresas en dunas secas.204. rica en fósiles de dinosaurio. 80. Sneüing. 221. Science News. 141 (1992). 1-78. F. pp. incluyendo sus areniscas asociadas. sino bajo el agua. expuesta en el Gran Cañón. 51. Earth’s Catastrophic Past (Dallas. Esta formación se encuentra en el oeste de los Estados Unidos. “Geologic History of Utah.5 millones de kilóme­ tros cuadrados. los rastros se dirigen cues­ ta arriba. citado en: A. 509. Hintze.

. El volumen de arena presente en esta formación de arenisca se estima en el orden de 42. C. Evidencias similares de deposición cruzada puede observarse en las formaciones de arenisca del grupo Supai expuestas en el Gran Cañón. Dicha corriente transportaba una cantidad masiva de arena que. 313-347. por lo que los sedimentos tienen que haber sido transportados desde largas distancias por inmensos flujos de agua. por enormes corrientes de agua en rápido movimien­ to. ed. presenta un escenario similar. Esta velocidad es característica de las corrientes oceánicas profundas que observamos hoy. “Geologic Evolution of Arizona”. A partir de sus características minerales. o de las corrientes generadas por eventos de tipo tsunami. “Pennsylvanian and Permian Geology of Arizona”. P. se ha estimado que se generaron por corrientes de agua que circularon aproximadamente a 1. pp. de una masiva formación de arena deposi­ tada por agua. no existe ninguna fuente cer­ cana pata esta aiena. al depositarse rápidamente sobre un área inmensa de miles de kilómetros cuadrados. situadas varios estratos por debajo de la formación Coconino. p. CA: W. 280. 1 . hvs dunas. Jenney y S. ibíd. 505-510. por lo que tuvo que haber sido arrastrada desde algún lugar en el norte. Shelton. en el sur de Utah. enterró las huellas de los ani­ males y permitió su fosilización. pp. J. en J. 13Ibíd. Ver también: Snelling. vol. En este caso.13 Sin embargo. 1966). Sin embargo.5 metros por segundo. 17 (1989). sin una fuente cercana conocida. Blakey y R. a lo largo de cientos y cientos de kilómetros. los científicos '-R . las partículas de arena contienen pequeñas cantidades de zircon con inclusiones de uranio. en el interior de una corriente de agua que fluía a gran velocidad.14 La formación de arenisca Navajo. en este caso. 14J. S. Freeman. Geology Illustrated (San Francisco.000 kilómetros cúbicos.12 El cuadro general que obtenemos al estudiar esta formación rocosa es una imagen de animales que se movían cuesta arriba. Knepp. tampoco existe ninguna fuente cercana para estos enormes depósitos de arena. Arizona Geológica! Society Digest. Reynolds. que permite identificar su origen.H.

15 Si esta hipótesis es correcta. vol. H. de rocas de las M ontañas Apala­ ches de Pensilvania y de Nueva York. Según la interpretación geológica convencional. 761-764. USA: Paleogeographic Implications". R. No obstante. et a l. Esto puede com­ probarse en muchos lugares donde las capas quedan expuestas a la vista. Por el contrario. “Combined Single-Grain (U-Th)/He and U/Pb Dating of Detrital Zircons from the Navajo Sandstone. Utah”. N° 9 (2003). 163 (2003). Geology. M. Reiners. Un segundo aspecto que resulta problemático para el modelo del uniformitarianismo es la ausencia de cañones. el viento.000 o 4. I. pp. “U-Pb Ages of Detrital Zircons from Permian and Jurassic Eolian Sandstones of the Colorado Plateau. E. Si los depósitos sedimentarios alrededor del m undo se estuvieron formando du­ rante cientos de millones de años. vol. significa que los inmensos volúmenes de arena que constituyen esta formación fueron transportados a lo largo de más de 2.000 kilómetros. la superficie del terreno es m uy irregular. Si la deposición de las capas de sedimentos se producía en la antigüedad de una manera simi­ lar al modo en que ocurre en la actualidad. Ver también: S. Campbell. como en los cortes verticales artificiales junto a carre­ 15 J. e incluso de antiguas m on­ tañas de Canadá. en forma de superficies irregulares entre los estratos.000 años.W. probablemente. esperaríamos descubrir num e­ rosas evidencias de erosión en la columna geológica. las superficies de erosión son escasas en la columna geológica. Sedimentary Geology. 29-66. ya que está constantem ente afectada por la lluvia. 31. todas las evidencias anteriores apuntan a movimientos catastróficos de agua a una escala nunca registrada en los últimos 3. Rahl. P. desfiladeros. JViO UNIVERS videncias geológa han sugerido que los sedimentos depositados en la arenisca N a­ vajo proceden. valles y hondonadas preservados en los estratos. . estos depó­ sitos se formaron lentamente a lo largo de millones de años. a través de lo que actualmente es América del Norte. los estratos deberían m ostrar las mismas irregularidades. Gehrels. En nuestro m undo m oderno. pp. las corrientes de agua y los cambios de temperatura. Pero no existen procesos geológicos graduales conocidos capaces de transportar y depositar volúmenes tan grandes de material a tales distancias. Dickinson y G.

“Temple Butte Formation”. Beus y M. otra vez sin señales importantes de erosión.200 metros. supuestamente deposita­ das con millones de años de diferencia sin señales significativas de erosión en la superficie de separación de los estratos. existe un hiato de 14 millones de años. que empieza con la arenisca cámbrica Tapeats y conti­ núa hasta la caliza Kaibab del Pérmico tardío.. o hiatos. Granel Canyon Geology (Oxford and New York: Oxford University Press.17 El Gran Cañón no es el único lugar donde encontramos capas sedimentarias paralelas horizontales. cubre un período de casi 300 millones de años. Los geólogos conocen la existencia de estas brechas. 1990). desde hace mucho tiempo. formado por estratos horizontales donde se observa una capa sobre otra sin señales significativas de erosión. existe m uy poca o ninguna evidencia de erosión entre las capas. sin tiempo suficiente para que haya erosión. Blakey. en Beus y Morales. 11b . Beus. o en una sucesión relativamente breve a lo largo de días o meses. pp. pp. hay un acantilado de 1. 11R. Morales.16 En otra parte de la secuencia. aproximadamente.*1 16S. en los acantilados costeros o en los desfila­ deros de los ríos. S. ■' V \ teras y autopistas. En la pared del extremo oriental. Si recordamos que la deposición de los sedimentos implica normalmente corrien­ tes de agua de gran caudal. 147-182. S. ibíd. En la mayoría de los casos. C. la ausencia de señales de erosión es aun más problemática cuando consideramos los estratos geológicos ausentes. 107-117. Esta secuencia de estratos.. 7 . es muy difícil imaginar cómo pudieron dichas corrientes no afectar a las capas subyacentes. “Supai Group and Hermit Formation”. en S. Aunque faltan estratos correspondientes a 100 millones de años. A lo largo de la secuencia del Gran Cañón encontramos un hiato donde deberían estar las capas del Ordovícico y del Silúrico. Resulta más lógico pensar que los estratos fueron depositados al mismo tiempo. y no hay prácticamente señal alguna de irregularidad. ¿Cómo es posible evitar la erosión durante semejante período de tiempo? Si cabe. Muchos lectores habrán visto fotografías de las gruesas pilas de estratos horizon­ tales paralelos que conforman las paredes del Gran Cañón. ed. las ca­ pas inferior y superior son paralelas entre sí.

Ver también. 1-5. vol. de ma­ nera que capas antiguas que estaban en la parte inferior acaban encima de otras más recientes. En Lochseite. Comenta cómo los hiatos que se hallaron en los depósitos de carbón australianos y en los Alpes europeos son difíciles de explicar dentro del modelo de largas edades. nombre que recibe esta secuencia anómala de estratos. 36 (2003). pp. separados por una paraconformidad (superficie de separación sin irregularidades ni señales de erosión. Existen varios ejemplos destacados de este fenómeno en diferentes lugares del mundo. A. ya que los estratos supuestamente más antiguos se sitúan paralela­ mente sobre los más recientes. . 75-92. Roth. que en teoría tienen 60 millones de años. situadas sobre rocas del Eoceno. pero dudosa en este escenario particular. Ariel Roth. las rocas habrían tenido que desplazarse 34 kilómetros desde su posición original para llegar al lugar donde se encuentran hoy. “Those Gaps in the Sedimentary Layers”. A.18 Otro indicio que apoya la idea de que gran parte de los estratos que forman la columna geológica y los fósiles que contienen fueron depositados simultáneamente durante un evento catastrófico glo­ bal. son los múltiples casos en los que los estratos aparecen en un orden distinto al que deberían. En el cabal­ gamiento del Glarus. “Implications of Paraconformities”. encontramos rocas del Jurásico. con una antigüedad estima­ da de 180 millones de años. Geoscience Reports. Roth. A. pero no se observa evidencia alguna de dicho desplazamiento. bVIUhNC OLOG ¡ P A Q El Dr. idéntica a la que separa dos estratos que se han depositado sucesi- 18A. Origins (GRI). La explicación convencional para que los estratos aparezcan en orden invertido es el llamado “cabalgamiento”. Suiza. pp. quien dirigió el Instituto de Investigación de Geociencia de la Universidad de Loma Linda. vol. y se adecúan mejor al modelo de un diluvio universal reciente. Esta explicación es aplicable en m u­ chos casos. cita varios ejemplos de hiatos encontrados en diferentes partes del m un­ do. _UVIO UNIVER. una estructura geológica causada por fuerzas de compresión que provocan la rotura de un bloque de estratos y el desplazamiento relativo de una de las partes sobre la otra. en California. 15 (1988).

. Como resultado. •E n el Parque Nacional de los Glaciares. England: Autumn House Limited. 100. en ese escenario. E V O L U C IÓ N & vamente uno sobre otro). The Casefor Creationism (Alma Park. Texas. Nuestros conocimientos actuales sobre las tasas de erosión indican que es m uy difícil que estratos ordovícicos relativamente blandos hayan resistido la erosión durante cientos de millones de años. las calizas del Ordovícico Superior (450 MA) recubren estratos del Cretáci­ co Inferior (130 MA). vol. “Folded Mountains and Isostasy”. sin provocar erosión masiva. pp. Un diluvio universal catastrófico proporcionaría una explicación razonable pues. 38 (1927). Lawson.19 Que un bloque gigantesco de roca se haya desplazado semejante distancia y haya terminado asentándose sobre una secuencia de estratos más reciente. La razón es que la enorme ten­ sión requerida para empujar bloques de estratos a distancias supe­ riores a media milla sería tan grande que se aliviaría automática­ mente por medio de rupturas sucesivas y deslizamiento de bloques más pequeños unos sobre otros. al sur de Alberta y las montañas Chief. rotura ni plegamiento de los estratos subyacentes. 20A. Analicemos algunos ejemplos más de formaciones donde los es­ tratos aparecen en un orden que no concuerda con su edad estimada: • En las montañas Franklin. se observaría una estructura repetitiva formada por bloques menores imbricados. en lugar de una gran losa de estratos desplazada a gran distancia y depositada sobre un bloque subyacente pasivo. y hayan permanecido en su lugar hasta que ser empujados y colocados sobre rocas mucho más recientes. no pare­ ce razonable. hace unos años se reportó en la literatura geológica que los cabalgamientos de más de media m illa (casi un kilómetro) son poco defendibles. p. que se extiende aproximadamente l9Colin Mitchell. 253-273. en Montana. Bulletin o f the Geológica1 Society o f America. cerca de El Paso.20 La ausencia de imbricación en el cabalgamiento del Glarus sugiere que la enorme fricción se redujo de algún modo. De hecho. se producirían fuerzas hidráulicas de gran magnitud y suficiente lubricación para impulsar el deslizamiento de los grandes bloques de roca implicados en esta formación. D. 1994).

conocido como el “cabalga­ miento de Lewis”. p. y que los organismos fosilizados en las capas del Cámbrico y del Cretácico existieron simultáneamente. incluyendo la falta de señales de erosión entre los estratos. En este zona. que facilitaron dicho movimiento. o con m uy poca diferencia temporal. la explicación más razonable para la formación de los cabalgamientos es que las capas implicadas se depositaron y desplazaron durante un diluvio masivo. separados una vez más por una paraconformidad. . encontra­ mos calizas precámbricas (600 MA). deslizándolas de Oeste a Este sobre los estratos más recientes. Los geólogos han intentado explicar el orden anómalo de los fósiles teorizando sobre un cabalgamiento gigantesco. depositados con 400 millones de años de antelación. El problema es que no se observan siquiera evidencias de superposición o de ruptura. y otros sedimentos paleozoicos que yacen sobre es­ quistos cretácicos que contienen fósiles de dinosaurios (100 MA).. hay un área de varios miles de kilómetros cuadrados donde el orden de fósiles no sigue el patrón evolutivo convencional. 100. cámbricas (500 MA. como veremos en un capítulo posterior. durante el período de 400 millones de años que supuestamente separa los dos tipos de rocas. puedan ser desplazados sobre otra capa sin de­ jar señales de ruptura o de los efectos de la fricción. aproxi­ madamente). ibíd. 21Mitchell. las pérdidas de material por erosión habrían sido suficien­ tes para eliminar completamente las M ontañas Rocosas varias veces.800 kilómetros a lo largo de las Montañas Rocosas. una vez más. Además. la existencia de fuerzas hidráulicas de gran enverga­ dura.21 Este tipo de estructuras sugieren. que habría desplazado las rocas entre 50 y 100 kilómetros. Resulta poco creíble que miles de kilómetros cuadrados de estratos sedimentarios. Cuando consideramos el conjunto de evidencias relacio­ nadas con los cabalgamientos. la escala convencional de millones de años debe ser cuestionada seriamente. Teniendo en cuenta la ne­ cesidad de contrarrestar fricciones descomunales.

pp. así como en la ladera de Specimen Ridge.22 Resulta sumamente difícil imaginar cómo podría formarse este tipo de estructura si los estratos más antiguos hubieran sido empujados lateralmente sobre los más recientes. relativo a la tasa de formación de los depósitos sedimen­ tarios. 621-654. en Nueva Escocia. W. Phüosophical Transactions ofthe Royal Society ofLondon. Estados Unidos. En este caso. . O tro problema que enfrenta el modelo geológico de largas edades. cuya da- tación indica más de 200 millones de años. N° 2 (1882).23 Investigaciones recientes han confirmado la presencia de troncos fosilizados de hasta 5 metros de alto y 75 centímetros de diámetro. W Dawson estudiaron los árboles fósiles verticales de Joggins. íñ iG U S a Ú M iM P D u X lu : -E n Arizona. recubren sedimentos cretácicos de alrededor de 100 millones de años. Lyell y J. Dawson. 23J. de manera que los depósitos del Pérmico se incrustan en hondos surcos presen­ tes en material cretácico subyacente. En los despeñaderos de Joggins. el deslizamiento lateral de las rocas pérmicas sobre ella debería haber destruido los relieves. Todos estos casos de estratos aparentemente desordenados su­ gieren que la visión convencional que implica el transcurso de millones de años para la deposición de las capas de la columna geológica es errónea. es la presencia de árboles fosilizados en posición vertical que atraviesan un gran número de estratos. con cerca de 100 especí- 22Ibíd. la superficie de separación entre ambos es muy irregular. 173. o al menos haber dejado marcas visibles como superficies pulidas. los geólogos C. vol. La forma de esta superficie de contacto se ha comparado con engranajes formados por ruedas den­ tadas. las rocas pérmicas de la montaña Empire. “On the Results of Recent Explorations of Erect Trees Containing Animal Remains in the Coal-formation of Nova Scotia”. en el Parque Nacional Yellowstone. señales de raspado o materiales arrancados. Ya en el siglo XIX. e informaron sobre restos de animales fosi­ lizados dentro de algunos de ellos. se encuentra una gran cantidad de estos fósiles. Aun si la superfi­ cie original de las capas del Cretácico hubiera estado erosionada en forma de grandes surcos antes del cabalgamiento.

pp. M. Geology Today. 25 C. Los informes de árboles fósiles casi verticales que atraviesan múltiples estratos se encuentran con frecuencia en la literatura. 390. 26 D. explica que estas capas de carbón presentan una estructura re­ petitiva y contienen troncos de árboles fosilizados en posición vertical. particularmente en asociación con depósitos de carbón de di­ ferentes partes del m undo. Muchos de los troncos están huecos y rellenos de sedimentos que. pp.26 N o lejos de donde vivo. El Dr. incluyendo numerosos invertebrados y 11 tipos diferentes de vertebrados. según los mineros. 1992). que atrapó a los diferentes animales que se encuentran fosilizados. se encuentra Newcastle Coal Measures. DILUVIO i. 1992). . vol. Francis. McCabe y J.. en la parte exterior de los árboles. Diessel. ed. que se movían a velocidad vertiginosa y arrastraban a su paso seres vivos y enormes cantidades de sedimento. T. 385-393. Yo mismo he visto algunos de estos fósiles cerca del M ar de Swan. H. Algunos de los árboles se asientan sobre una veta de carbón. Parrish. F. J. Snelling señala que. 10. “Carboniferous Fossil Forests”. atraviesan los estratos superiores y alcanzan la siguiente veta. Controls on the Distribution and Quality o f Cretaceous Coals. El investigador Dr. probablemente. Coal-bearing Depositional Systems (Berlín: Springer-Verlag. (Boulder. N° 6 (1994). I. C. Colorado. K. E.25 El conjunto de datos sugiere que estos grandes árboles en posición vertical fueron enterrados rápidamente por corrientes de agua. en P. diplomado por la Universidad de Sídney. LAS menes en su interior. The Geological Society of America Inc. Calder. “The Potential for Cretaceous Coal in Antartica”. Andrew Snelling. algunos de los troncos m iden hasta 9 metros de longitud y atraviesan varias 24A. 213-217.24 También se han hallado restos fosilizados de reptiles y anfibios en los estratos adyacentes. Scott y J. p. incluyendo la Antártida. al norte de Sídney.JNIVEF )C r. una famosa formación rica en carbón. Macdonald y J. La presencia de estratificación cruzada en areniscas del interior de los troncos también confirma la circulación rápida de corrientes de agua. fueron transportados hasta allí por una corriente de agua a gran velocidad.

de más de 30 metros de espesor. cuando miles de árboles flotaron en posi­ ción vertical hasta el lago Spirit. 298. y tam bién de las raíces y de la parte inferior del tronco. a pesar de que algunos de estos troncos tienen varios metros de largo. 566. com­ puesto por más de 100 capas finas. t. “Erect Floating Slumps in Spirit Lake. Washington”. donde quedaron enterrados rápidamente. p. 11 (1983). en la mayoría de los casos. Evidencias concluyentes de que los árboles fosilizados en posición vertical no tienen por qué encontrarse en su ubicación original. carecen de sistema radicular y no suele haber evi­ dencias de la superficie en la que originalmente crecieron. Geology. pp. se formó en un solo día: el 12 de junio de 1980. 1993). Según el Dr. G. UK: Cambridge University Press. en Gales. vol. 567. ge­ neralmente. The New Catastrophism (Cambridge.28 Derek Ager. Helens: se formaron capas estratificadas de hasta 130 metros de espesor. 49. a causa de las avalanchas de lodo y la preci­ pitación de ceniza volcánica. . la parte superior del tronco está rota y. Uno de estos depósitos. las copas de los árboles no se encuentran conservadas con ellos. y estaba ubicado entre un de­ pósito de corriente de lodo de 5 metros y una capa de ceniza de 27 Snelling. ibíd. pp. considera que los árboles fósiles en posición vertical son evidencia de sedimentación m uy rápida en el pasa­ do. además de estratos de arenisca y otros sedimen­ tos. en el Estado de W ashington. Dicho depósito contenía un estrato de 8 metros. En todos los casos. los árboles fueron arrancados de su lugar de origen y transportados a una nueva ubicación. con frecuencia. 2. este proceso violento habría causado la pérdi­ da de las copas de los árboles. 29 Derek V. en 1980. Helens.. se obtuvieron tras la erupción del m onte St. 28 H.29 Eso es exactamente lo que ocurrió durante la erupción del m onte St.27 Una de las características comunes de estos fósiles es que. profesor emérito de Geología en la Universidad de Swansea. tam bién falta la parte inferior. Snelling. evüí ución iMpesiaii: vetas de carbón. En la ma­ yoría de los casos. Coffin. 299. Ager. esto sugiere que.

si estas formaciones se dataran a partir de las tasas de sedimentación ac­ tuales siguiendo el modelo del uniformitarianismo. N° 2 (1976). en África. La formación de este tipo de depósitos multicapa se ha visto tam bién tras la actividad de huracanes y torm entas. 8. como anzuelos y arpones. Kropelin. aparentarían tener una edad m ucho mayor. B. Por ejemplo. 17 veces mayor. 38. 37.i r 8 metros. en el pa­ sado. tenía casi 1. vol. Granel Canyon. D. El lago Chad. Pachur y S.000 kilo- metros de largo. pp. A continuación. 237 (1987). con una entrada de agua 16 veces superior a la actual. muchos lagos eran más grandes que en la actualidad. p. aproximadamente. procedentes de la estrati­ grafía y de la paleontología. sino tam bién una intensa actividad sísmica y volcánica. 31H. Austin. Shaw. pp. N l . Hemos descrito numerosos datos. y el Manly. vol.30 Estas observaciones nos perm iten afirmar que en un escenario como el diluvio universal. y evidencias de presencia humana. incluso las formaciones geológi­ cas de mayor envergadura podrían haberse desarrollado en un período de tiempo relativamente breve. “Wadi Howar: Paleoclimatic Evidence from an Extinct River System in the Southeastern Sahara”. Environment and Prehistory in the Sahara”. y tam bién fósiles de cocodrilos e hipopótamos. cu- 30 Steven A. ed. Se ha descubierto antiguos cursos de ríos. un lago de 180 metros de profundidad. World Archaeology. “Climate. cuyas condiciones catastróficas podrían incluir no solo movimientos masivos de agua.31 También sabemos que. 1994). 142. Esto sugiere que esa área fue mucho más húm eda en la antigüedad. UiLUVí UNIVERSAL UC . 298-300. bajo las arenas del desierto de Sahara. y nos preguntaremos hacia dónde apuntan dichas evidencias. J.. tan grandes como el Nilo. CA: Institute for Creation Research. Sin embargo. el Gran Lago Salado de Utah era. analizaremos evidencias geológicas de cómo ha cambiado el cli­ m a a lo largo de la historia de la Tierra. que han demostrado ser más com ­ patibles con el modelo de un diluvio universal catastrófico que con el modelo convencional de largas edades. Monument to Catastrophe (Santee. Science. .

Hooke. los cambios en los niveles de radiación son demasiado pequeños 32R. seguidas por la Edad de Hielo y un calentamiento gradual posterior. existen también abundantes evidencias de extensa glaciación y vastas llanuras de hielo. y la inclina­ ción del eje de la Tierra cambian periódicamente. pp..33 A pesar de esto. Oard. 97. On the Track o f Ice Age Mammals (Cambridge. al menos. CA: Institute for Creation Research. Qua- temary Research. 1985). la distancia al Sol en el momento de los solsticios y los equinoccios. AR: Master Books Inc. Sutcliffe. 33 Michael J. son exactamente el escenario propuesto por el meteo­ rólogo Michael O ard dentro de su modelo de diluvio universal. fiWAUjeiÓMSNi < bría parte del Valle de la Muerte. Según Milankovitch. debido a las influencias gravitatorias de los demás planetas del Sistema Solar. California”. 2004). L. y se combinan de forma compleja en los llamados “ciclos de Milankovitch”. Frozen in Time (Green Fo- rest.32 Estos son indi­ cadores de una hum edad elevada. Los cambios climáticos cíclicos necesarios para explicar repetidas edades de hielo se han explicado por medio de la teoría astronómica propuesta por el astrofísico serbio M ilutin Milanko- vitch. MA: Harvard University Press. J. p. y han obtenido fechas que se remontan a cientos de miles de años en el pasado. en California. los glaciólogos que adhieren al modelo de lar­ gas edades han datado las capas de hielo de las regiones ártica y antártica por métodos convencionales. vol. lo que habría provo­ cado múltiples edades de hielo a lo largo de la historia del planeta. 22. “Lake Manly Shorelines in the Eastem Mojave Desert. p. A. Condiciones climáticas de hum edad alta y temperaturas cáli­ das. los parámetros astronó­ micos del movimiento de la Tierra varían cíclicamente a lo largo de los milenios. El resultado de estos ciclos son variaciones periódicas leves en la can­ tidad de radiación solar recibida en la Tierra. Esta teoría presenta problemas importantes. An Ice Age Cansed by the Génesis Flood (El Cajón. Ver también: Michael Oard. por 30 edades de hielo sucesivas. 328-336. Por otro lado. 1990). como los m am uts lanudos. . que se formaron en el pasado coincidentemente con la extinción de grandes animales. Su conclu­ sión es que la Tierra ha pasado. La forma de la órbita de la Tierra. 52 (1999). En prim er lugar.

and the Environment. 38 M. pp. datos procedentes de los núcleos de hielo de Groenlandia indican una única Edad de Hielo. vol. Clausen. Reviews ofGeophysics. 325-346. Oard. 10 UNIVERSAL: EVIDENCIAS GEOL como para provocar una Edad de Hielo. Gundestrup. N° 3 (2001). AR: Master Books Inc„ 2004). Dansgaard. Raynaud. Petit y D. “Glacial Cycles: Toward a New Paradigm”. pp.37 El modelo de diluvio universal ofrece explicaciones razona­ bles para la deposición de hielo en los polos durante un periodo de tiempo relativamente breve. Geochemistry. The Frozen Record (Santee. 37Michael J. B. 2005). R. .000 años.69-106. 39. “An Analytic Young-earth Flow Model of Ice Sheet Formation During the ‘Ice Age’ ”. Frozen in Time (Oreen Forest. pero los ciclos de M ilankovitch no se corresponden con esa periodicidad. H. que no podemos comentar aquí en detalle. las dataciones de los núcleos de hielo indican que hubo una Edad de Hielo cada 100. Por ejemplo. Paillard. Creation Science Fellowship (Pittsburgh. Oard. American Geophysical Union. Geophysical Monograph. “Palaeoclimatic Information from Ice Cores: the Vostok Records”. Proceedings ofthe Third International Conference on Creationism. CA: Institute for Creation Research. louzel.34 En segundo lugar. pp. 36W.38 De hecho. 33-46. se ha argumentado que el modelo de edad de hielo posdiluviana es el único modelo científico que ha sido capaz de explicar con éxito el desarrollo de las llanuras de hielo donde sabemos que una vez existieron. 71-76. Vardiman. 81 (1990). Transactions ofthe Royal Society ofEdinburgh.35 Y en tercer lugar. vol. J. También propone que los desiertos que hoy encontramos alrededor de los 30 grados de latitud eran ambientes húmedos y exuberantes durante la Edad de Hielo. jubilado del Servicio Climático del gobierno estadounidense. y para la extinción de la mega- fauna. et a l . N.39 La Tierra está llena de evidencias a favor del diluvio univer­ sal. “Dating and Climatic Interpretation of Two Deep Greenland Ice Cores”.36 Una crítica detallada de la teoría de M i­ lankovitch y de las interpretaciones convencionales de los datos procedentes de los núcleos de hielo. pp. Greenland lee Core: Geophysics. ha sido recopilada por el meteorólogo Michael Oard. 39 L. 349-355. lo que coincide con los datos observados. N° 33 (1985). 1994). 35 D. los 34I. pp. 561-568. PA.

(Dallas. y no por millones de años de deposición lenta de sedimentos y cambios graduales. ¡bíd. El lector puede encon­ trar una evaluación extensiva de las evidencias geológicas a favor de un diluvio global catastrófico en los dos volúmenes recien­ tem ente publicados de la colección Earth’s Catastrophic Past [El pasado catastrófico de la tierra] . fósiles fuera de orden. 1. Finas capas de sedi­ mentos que se extienden sobre continentes enteros. * A. . acompañada por tormentas y actividad volcánica a nivel planetario. árboles en posición vertical y datos paleoclimáticos sugieren una gran inundación catastrófica. Trataremos este tema en el próximo capítulo. como el Gordon River Splits. sugieren que la elevación de las cordilleras se produjo de manera subsiguiente a la inundación. Snelling.2. Además de las evidencias geológicas. S V ü tU C IÓ N IM P G ríos que atraviesan cordilleras. 2009). TX: Institute for Creation Research. en Tasmania. A. he intentado demostrar que el cuadro geológico general de la superficie fue moldeado por un diluvio universal catastrófico. como el es­ cenario más probable para la deposición de la colum na geoló­ gica. t. existe una cantidad sustancial de evidencias históricas de que este diluvio universal catastrófico ocurrió y que fue relativamente reciente.40 En el presente capítulo.

Su relato describe cómo. pp. aproximadamente. pp. In the Minds o f Men (Toronto. 39-48.. y una com­ paración con la fecha calculada por James Ussher en 1650 d.DILUVIO UNIVERSAL: EVIDENCIAS HISTÓRICAS comienzos del siglo XIX. pp.C. Moisés.C. 350. 1984). la interpretación geológica de los estratos de roca se enseñaba en el contexto del diluvio de Noe. y que vivió entre 1526 y 1406 a. 3Para detalles del modo de calcular estas fechas a partir de registros históricos. ver el Apéndice. un antiguo libro hebreo cuyo presunto autor. 89-95. 2T. en universidades como Oxford y A Harvard.C. “Introduction to Génesis”. 66. 2007). 110. alrededor de 2303 a. Cañada: TFE Publishing. . IL: Crossway Bibles. Este rela­ to de un diluvio universal se conserva en el Génesis. Alexander. era un hebreo que fue adoptado por la familia del faraón y heredero del trono egipcio. AR: Master Books.i23 las fuentes de las pro- i tan T. ESV Study Bible (Wheaton. Unwrapping the Pharaohs: How EgyptianAr- chaeology Confiráis the Biblical Timeline (Green Forest. John Ashton y David Down.. 2008).. D. Taylor.

Por consiguiente. El relato del Génesis registra que Noé fue advertido por Dios de que se aproximaba un diluvio que destruiría laTierra. explica que existen múltiples relatos legendarios sobre el diluvio. Describe cómo se secó laTierra. el relato de un diluvio universal. El nivel del agua se elevó hasta cubrir totalmen­ te la Tierra. £■ ELUCIÓN sMPKS <¡¡1* fundidades de la Tierra se abrieron y empezaron a arrojar aguas torrenciales. el “Diluvio de Noé” es considerado. con innumerables detalles. Sin embargo. del que solamente se salvaron unas pocas personas. que duró 40 días. El relato del Génesis está escrito de una manera considerablemente factual e histórica. e indica que Dios dio a Noé instrucciones precisas a fin de construir la nave que salvaría a su familia y a los animales.También hay breves referencias al diluvio como hecho histórico. en forma simultánea con un evento global de lluvias. un mito religioso. Pido la indulgencia del lector para revisar tales evidencias en el resto de este capítulo. En primer lugar. si revisa­ mos la información disponible en estos momentos. su mujer y sus tres hijos con sus esposas (ocho per­ sonas en total). Un hombre llamado Noé. dice que el agua cubrió la Tierra durante 150 días y que luego bajó lentamente durante los siguientes 150. Debido a la naturaleza milagrosa del relato. y dos ejemplares de cada especie animal fueron sal­ vados en el interior de un barco de madera gigantesco. como la Epopeya de Gilgamesh. Informa del día y el mes en que empezó el diluvio. quien fue direc­ tor jefe de los Museos Nacionales de Francia. las tradiciones de muchos pueblos antiguos de todas partes del mundo incluyen. de una manera u otra. la mayoría de los geólogos y los científicos actuales descarta la idea de un diluvio universal reciente como hecho histórico o científico. El arqueólogo y profesor André Parrot. encontramos una cantidad asombrosamente grande de evidencias históricas y científicas que respaldan la idea de que el diluvio universal ocurrió realmente en un pasado no m uy lejano. a m enu­ do. conocido como el Arca de Noé (Génesis 6:9-8:18). y destruyó toda la vida sobre la superficie. y cómo la familia de Noé y los animales abando­ naron el arca unos 70 días después (Génesis 7:24-8:13). como la que aparece en la lista de los reyes del prisma .

6 D. 5Apollodorus y R. después de flotar durante nueve días. 456. que vivió en Nínive en el siglo VII a. un héroe de nombre Gilgamesh va en busca de Utnapisbtim. La versión asiria se encontró en unas tablillas cuneiformes de la biblioteca de Ashur- banipal. enviando un gran diluvio. 1994). y un diluvio sumergió por completo al m undo y destruyó a la hu­ manidad. Una vez más.C. IL: William Benton Publisher. Leeming.6 4 André Parrot. Solamente Deucalión y Pirra se salvan en un barco. A. Cuando una de las aves. En este caso. 9. se encontró en Nippur (Babilonia). Utnapishtim relata a Gilgamesh cómo el dios Ea le advirtió que construyera una nave y que entrara en ella con su familia. el dios Zeus decide destruir a la raza humana. 2008). Una versión romana es registrada por Ovid en Metamorphoses Li­ bro 1. Pindar. Leeming y M. A. pp.. La literatura griega antigua también describe el diluvio. A Dictionary o f Creation Myths (New York: Oxford University Press. Un fragmento de este relato. 1967). no re­ gresó. de manera que se convierten en los nuevos padres de la humanidad. lo menciona explícitamente. el rey Deucalión.C. DILUVIO UNIVERSAL i DONO de Weld-Blundell. se explica que los dioses decidieron enviar un diluvio para destruir a la raza humana.45En la narrativa sumeria del diluvio. The Library ofGreek Mythology (Oxford World’s Cíassíes) (New York: Oxford University Press. . Hard.C. “Flood (in Religión and Myth)”. que se ha corrompido. los supervivientes salieron del arca. 236.. La lluvia inunda la Tierra y.. la nave se asentó en una montaña. un cuervo. p. pero Prometeo aconseja a su hijo. siguiendo las instrucciones de un dios que tuvo compasión de él. Se enviaron algunas aves al exterior. quien sobrevivió al diluvio. los dioses deciden destruir a la humanidad. 455. sus artesanos y sus animales. Se desencadenó una tormenta. Después. y una ver­ sión completa se puede encontrar en el compendio griego de mitos y leyendas heroicas Bibliotheca (Pseudo-Apollodorus)? En el relato grie­ go. pero que el rey Ziusudra fue salvado en una embarcación gigante que construyó. t. que vivió en el siglo V a. que data del siglo XIX a. el arca se asienta en una montaña. Encyclopaedia Britannica (Chicago. trad. que construya un arca en la que él y su esposa pudieran sobrevivir.

"Ibíd.89Los aboríge­ nes Aranda. durante el diluvio. ibíd. poseen un relato mítico en el que la creación salió mal y fue eliminada por un diluvio. a los nativos americanos Cheyenne de las llanuras. en el centro de África Occidental. del norte de Australia.209. 12Ver: www.. 204. Se le dijo que construyera un barco y.7 El pueblo Mande de Malí. 145. que se aproximaba y destruiría a toda la hum anidad. 14.12 7 Parrot. 230. quien fue advertido por un pez sobre un diluvio. han descrito muchas otras narraciones sobre el diluvio. pp. presentes en las tradiciones de los pueblos del con­ tinente americano.. gvnrjJCJÓN «m p c s ik í El diluvio se m enciona tam bién en el sánscrito Shatapatha Brahmana del siglo VI.n La página web del Museo Ashmolean de Arte y Arqueo­ logía (en la Universidad de Oxford). de Atizona. 8 Leeming y Leeming.ashmolean. 180. Esta historia de la antigua India habla de M anu.10* David Leeming y Margaret Leeming. .C. incluyendo a los esquimales. el pez remolco el barco a un lugar de descanso sobre una cumbre. 86.0 Los indios Arikara.php. 181. a los indígenas Yuma y Pima. cuya civilización se remonta al menos al 300 d. 200. a los indígenas Pomo y Salina. de la Universidad de Ca­ lifornia en Santa Bárbara.org/ash/faqs/q001007. 47. de Groenlandia. 16. Solo se salvaron unos pocos gigantes buenos. ibíd. de Perú. al pueblo Ipurina. y a todos los primeros animales y plantas. 302. y los ma­ yas Quiché. 186.. cuentan una historia de gigantes que no sentían respeto por su Creador y fueron destruidos por un gran diluvio. de Guatemala. al pueblo Netsilik. 239. 10Ibíd. 9 Ibíd. tanto en fuentes orales como escritas. de Brasil. de las llanuras estadounidenses. también señala que los relatos de un diluvio universal que ocurrió en la antigüedad se extienden alrededor del mundo. de California. a los antiguos Myscas. tiene un mito de la creación sobre un arca que atracó en una mon­ taña.. a los Navajos del suroeste de Estados Unidos. El arca contenía a los ocho antepasados originales de los seres humanos.

ibíd. Mizraim.1314 Evidencias adicionales de la exactitud histórica del registro del Génesis se conservan en los símbolos pictográficos de un anti­ guo manuscrito chino. Rumania. quien compiló una concordancia de la Biblia en 1879. Egipto recibe su nom bre del nieto de Noé. 13Parrot. también. TN: ReadBooks. God's Promise to the Chínese (Dunlap. etc. y explican que el diluvio fue decretado por los dioses debido a la perversidad de la humanidad en aquel tiempo. Chock. 1966). (London: Lutterworth Press. en otras narraciones. Australia.11 El Dr. se la llama la “tierra de Cam” (Salmo 105:23.. En realidad. etc. Xisuthrus. en la ma­ yoría de las historias. comentó que a Noé se le llama Yao o Fo-Hi (Fu Hsi) en la literatura china antigua. Robert Young. 15 E. se envían aves al exterior tras finalizar la lluvia. p. hay características comunes. incluyendo el diluvio y el nombre de Noé. Polinesia. R. 105-119. Borneo. una nave que atraca en una montaña. Broadberry y G. que fueron ocho las personas salvadas. Chock. la re­ gión donde se estableció una persona llamada Egipto. 698. 1997). el de Génesis sería visto por la mayoría de los eruditos como el mas creíble e históricamente exacto. T. p. y Deucalión.. Rusia oriental. y sus coautores comentan estos símbolos en el contexto de varias narraciones anti­ guas. Por ejemplo. Ginger T. mencionan el arco iris. . 14 Robert Young. LL. probablemente. Nueva Guinea. 27). los manuscritos antiguos se refieren a Egipto como la “tierra de Egipto . a veces. sur de Asia. Algunas versiones mencionan. diplomado por la Universidad de Stanford. El profesor Parrot ha listado historias del diluvio procedentes de regiones de todo el m undo: China. E. y llegan a la conclusión de que apoyan el relato de Génesis. Muchas de las narraciones comparten detalles con el relato del Génesis: incluyen animales. Lituania y Gales.D. Parrot señala que. R. Nelson. Melanesia. como la sal­ vación de un pequeño grupo de personas en una embarcación. es decir.. El historiador de arte chino Dr. Sumatra. Analytical Concordance to the Holy Bible. específicamente.15 De todos los relatos del diluvio. 8o ed.

en Manetho. “Book of Sothis App. traducción al inglés de W. que fue sacerdote en el templo en ficliópolis durante la era griega. iV ú iM a m im m j ! y Mizraim era el hijo de Cam. “después del diluvio”. p. ya que en la antigüedad los pueblos y los países eran nombrados según las personas que los fundaron. o Mestraim”. El relato del Génesis tam bién fue corroborado por un his­ toriador egipcio de nombre M anetón. . 7. 18/fó ¿ . p. De acuerdo con Herodoto. 1657 AM-1762 AM. secc. 181. G. G. En los mapas.663 años des­ de su origen bajo Mizraim. xi. que era hijo del tataranieto de Noé.C. p. hasta la 16 The World Book Great Geographical Atlas (Sydney. aproximadamente 106 años después del diluvio. el reino de Egipto duró 1. The Annals ofthe World (1658). las tribus empezaron a separarse. En línea: www. que es el nom bre egipcio nacional16 Esta es una evidencia sólida de que Egipto (Mizraim) y Cam eran personas reales.archive. en 2188 a. hijo de Cam. se especifica que esta disper­ sión tuvo lugar cinco años después del nacimiento de Peleg. engendró a “Aegyptus. el Libro de Sothis. 17 Manetho. Waddell. hijo m enor de Noé.C. Ver también: James Ussher.17 M anetón registró la historia de Egipto y escribió que.C.18 En una de las otras obras de M anetón. Es revelador que el Lempriére’s Classical Dictionary [El diccio­ nario clásico de Lempriére] afirme: “De acuerdo con los cálculos de Constantino Manasés. El nombre “Egipto” que usamos hoy es la versión griega m oderna de “M i­ zraim”. Egipto aparece a m enudo como Misr. alrededor del año 270 a. traducción al inglés de W. nacido 101 años después del diluvio. MA: Harvard University Press.Ltd. Cam. “Manetho’s History of Egypt”. en Manetho. Este fue el primero en asentarse en el área que actualmente ocupa Egipto. 19 Manetho. Australia: World Book Australia Pty.19 Según estos datos.. IV”..p . cuando las tribus empezaron a dispersarse. Waddell (Cambridge. 1964). 1984). los Heliopolitanos eran los más eruditos entre los egipcios. el hijo de Noé.org/details/AnnalsOfTheWorld. 239. más o menos alrededor de 2195 a.

8a ed.)”. y es una fecha razonable. 22 Eusebius. justo después de la dis­ persión.21 Esto nos rem onta al año 2233 a. y publicó el siguiente informe después de visitar las ruinas de Babilonia: “Cuando Alejandro conquistó Babilonia.conquista de Cambyses. 40 años después.903 años también puede encontrarse en la traducción latina medieval de Guillermo de Moerbeke (a.22 Esta parece ser la fecha cronológica más antigua atribuida a un reino griego.C.C ..C.C. Davies Publishers. está en estrecha concordancia con las fechas que se calculan a partir de las genealogías listadas en los manuscritos hebreos antiguos. y que también atribuye la fundación de Egipto al nieto de Noé. 1812).C.M . dada la distancia que la tribu tuvo que 20 J. pp. 1-14. usando la fecha del cuarto año del reinado del Rey Salomón como punto de referencia histórico. Chronici Cánones (London: Humphredum Milford. “Aegyptus”.. A. El historiador del siglo cuarto Eusebio de Cesárea registró que Egialeo. Las cronologías de otras civilizaciones antiguas tam bién coin­ ciden en asignar fechas similares a la dispersión de las tribus que previamente se ubicaban cerca de la localidad de Babilonia (Génesis 11:8. .. empezó su reinado en 2089 a. 21 Thomas Maurice.C. lo que concuerda perfectamente con la fecha para el comienzo de la dispersión de las tribus desde los alrededores de Babilonia. (London: T. Su fecha de 2188 a. 1215- 1286) de un manuscrito en griego de Simplicio. que fue asistente de bibliotecario en el Museo de Londres a co­ mienzos del siglo XIX. un rey griego. Este es el caso de Tilomas M aurice.”..903 años antes del período en que se logró la conquista (330 a. 145. las cuales se rem ontaban 1.C. London Review and Literary Journal (agosto de 1817).20 Manasés era un cronista bizantino que vivió en el siglo XII d.d. los sacerdotes caldeos informaron a Calístenes que te­ nían observaciones astronómicas grabadas en ladrillos cocidos al horno. AEL. en 525 a.313 años antes de la primera Olimpíada de 776 a. p. Cadell and W. p. Nótese que la cifra de 1. Corresponde a tan solo 100 años después de la dispersión. 1. Lampriére. 1923). “Maurice’s Observations on the Ruins of Babylon”. 9). A Classical Dictionary: Containing a Copious Account o f All the Proper Ñames Mentioned in Ancient Authors. aproximadamente.

IL: William Benton Publisher. de acuerdo con Josefo. Macedonia. Todos estos datos procedentes de distintas fuentes de reco­ nocida validez vinculan a numerosos pueblos de Europa con los nietos de Noé. Grecia y Siria. y se usa para hacer referencia a los descendientes de Javán y sus naciones. J. Jonia.1. The Complete Wor­ ks o f Flavius Josephus (Green Forest. Jafet (Joel 3:6. lo que da más credibilidad al Génesis y sugiere que es posible considerar el relato del diluvio desde una perspec­ 23 R. 533. en W. quien fue otro nieto de Noé a través de su segundo hijo. A los griegos se los identifica como “los hijos de Javán”. fue M adai (Génesis 10:2). 534.26 Jafet tenía otro hijo llamado Magog. J. los hijos de Gomer. 437. Encyclopaedia Britannica (Chicago. 8o ed.23 El Dr. 422. Dowsett.. habiendo sido nom bra­ das muchas localidades geográficas y pueblos en honor de sus hijos y nietos. Charles. p. a saber. y nieto de Noé. a quienes los griegos llamaban Medos y que. Whiston. Isaías 66:19).25 Por ejemplo. p.24 El historiador romano Josefo también enumera muchas de las tribus de Europa. Analytical Concordance to the Holy Bible. AR: Master Books. 26 C. . £VÍ?LÜCíÓM IM PO StóiX recorrer desde Babilonia. ibíd. quien a su vez tam bién era hijo de Jafet. 41. 24 Ibíd.27 que eran un pueblo que habitaba el área correspondiente a Rusia septentrional y a Ucrania. 1967).6. 10:1. padre de los Madeanos. probablemente. Young señala que Jafet es. p. 27 Josephus. “Armenia”. F. 41. O tro de los hijos de Jafet. Génesis 5:32. Young. trad. 2. p. (London: Lutterworth Press.. “The Antiquities of the Jews”. Josefo señala que los griegos lla m a b a n escitas a los magogitas. Dowsett. 1. a quien los griegos consideran el antepasado de la raza hum ana. t. como descendientes de Jafet. el original de Japetus o Iapetus (Jápeto). 1966). 2008). 25 Josephus. incluyendo a Grecia. Javán es tam bién el nom bre hebreo para Grecia. señala que los antiguos escritores armenios llaman a su pueblo “descendientes de Togarma o Askenaz”. en la Universidad de Londres. de la Es­ cuela de Estudios Orientales y Africanos.. F. vivieron en la región sur del M ar Caspio. pp.

la tierra de Canaán se extendía desde Sidón hasta Lasa. England: New Wine Press. Jopa y Damasco.C. da como fecha de inicio de la prim era dinas­ tía en C hina 1994 a. Gomorra. como Asia oriental. por ej.29Ambas fechas son posteriores a la fecha de la dispersión de las tribus des­ de Babilonia y. Encyclopaedia Britannica. Según el Génesis. U na evidencia adicional de la exactitud histórica del Génesis proviene del descubrimiento en 1974 de un archivo de alrede­ dor de 20. aunque existe una fecha revisada alter­ nativa que sitúa la primera dinastía (Hsia) en 2183 a. en Ebla.000 tabletas cuneiformes m uy antiguas. Datos de regiones incluso más lejanas. 5. El uso de términos como “la tierra d e . Canaán fue el padre de Sidón. Meggido. Estos cuatro pueblos. señala que una de las cronologías chinas más antiguas conservadas. al igual que pueblos y regiones como Hazor. lugares bien conocidos para historiadores y arqueólogos.. y nieto de Noé. L. y llegaron a conclusiones similares. de sus fundadores. Laquis. 575. Canaán era otro hijo de Cam. Estas tabletas hacen referencia a los cananeos que vivieron en “la tierra de Canaán”.. en la costa este del m ar Mediterráneo. p. 1995). profesor de Chino en Colum bia University.. Adma y Zeboim (Génesis 10:6-20). “China”. B. DILUVIO UNIVERSAL: EVIDENC tiva histórica. por lo tanto. Carrington Goodrich. Otros autores han analizado en detalle este asun­ to. en direc­ ción a Sodoma. La mención de Canaán y las 28Ver. . armonizan con el relato del Génesis.C. que no existen en la actualidad. Sinaí. t. concuerdan tam bién con este relato. llamada “los Anales de Bambú”. y el pueblo que fundó se convirtió después en la ciudad principal de la antigua Fenicia. Los pueblos y los países reciben casi siempre sus nombres a par­ tir de personas reales. C. Gaza. Goodrich. After the Flood (Chichester. Cooper. normalmente.. en el norte de Siria.” tam bién fortalece la creencia de que las personas nombradas son reales. 29 L. y hasta este m om ento solamente se mencionaban en el Génesis y en otra literatura hebrea.28 Es sumamente inusual nom brar pueblos y regiones con el nom bre de personas ficticias. aparecen tam bién nombrados en las table­ tas de Ebla.

aparte del que aparece en el Génesis. El investigador en genética de la Universidad Cornell.orinst. que vivió “solamente” 777 años. 1991). Giovanni C. y reyes de después del diluvio. que gobernaron por períodos de tiempo m ucho más breves. las edades disminuyen rápidamente. Ver: www. los dioses o las personas tom an forma de diferentes animales.ac. en otros libros de Moisés y en otras fuentes de la literatura histórica hebrea de diferentes escrito­ res. profesor de Asiriología en la Universidad de Roma. se registra una lista de ocho patriarcas antediluvianos con una longevidad bastante constan­ te. Pettinato. Elba: A New Look at History (Near Eastem Studles) (Baltimore. J. por ejemplo. el más verosímil. E. Detalles del contenido de las tabletas de Ebla han sido explicados por el epi­ grafista que las tradujo. “The Sumerian King List: Translation”.htm.uk/section2/tr211. presentan detalles m uy poco realistas como. Zólyomi.000 años. MD: The Johns Hopkins University Press. Esta lista nom bra ocho reyes que vivieron antes del diluvio y gobernaron por períodos de tiempo m uy prolongados. el Dr. SIJUtlIOÓM IMPCISilLS cuatro ciudades de la llanura provee fuertes evidencias de que el Génesis contiene información histórica factual. Se puede citar los relatos sumerios sobre el diluvio que aparecen en el prisma Weld-Blundell. el padre de Noé. y en otras tabletas y manuscritos antiguos. A. por lejos. cientos de años.ox.31 En el relato paralelo del Génesis. Después del diluvio. Flückiger-Hawker. Cunningham. decenas de miles de años. después del 30 Giovanni C. Robson. G. Estos registros de duración de la vida de las personas durante un período de casi 2. etc. J. Black. y uno. Dr. el diluvio dura solamente siete días. el re­ lato del Génesis es. Por otro lado. En otras versiones. que se va desde 895 hasta 969 años. Taylor y G.etcsl. 31 J. The Electronic Text Corpus ofSumerian Literature (1998-2006). . que contienen lo que se conoce como la “lista sumeria de reyes”. personas que son salvadas en una canasta o un barco con forma cúbica. a través de los siglos.30 La mayoría de los relatos que se han preservado sobre el dilu­ vio. E. John Sanford. ha reflejado en un gráfico los datos de longevidad pos­ diluviana registrados en el Génesis. Ebeling. Pettinato.

lo que significa que el ajuste de los datos es m uy bueno. (New York: Marcel Dekker. p. o “agua de deuterio”. .. pues provienen de fuentes diferentes que abarcan varios siglos. reafirma su validez y su fiabilidad históricas. 2000). reflejan la forma de una curva de decadencia biológica ex­ ponencial. Geochimica et Cosmochimica Acta. Mazor. Quizás esta agua. El lector puede preguntar: “¿Por qué la longevidad disminuye repentinamente después del diluvio?” Aunque no sabemos con certeza qué causó este efecto. parte del agua del diluvio surgió desde las profundidades de la Tierra. E. Sanford. El Dr.90.33 Los efectos del deuterio en 32 John C. Chemical and Isotopic Groundwater Hydrology. un elemento si­ milar pero más pesado. Herczeg. podemos teorizar una explicación científica. un porcentaje del agua en la naturaleza es agua pesada. Estos datos no pueden ser falsificados fácilmente. vol. se obtiene lo que se llama “agua pesada”. Las aguas subterráneas contienen niveles relativamente altos de agua pesada. p. Ma- yeda. que no estaba accesible para el ser hum ano antes del diluvio pero sí después. NY: FMS Publications. Environmental Tracers in Subsurface Hydrology (New York: Kluwer Academic Publishers. G. L. mientras que la nieve ártica tiene niveles mucho más bajos. CookyA. 2008). W. “Variations of the 180/160 Ratio in Natural Waters”. 33Ver. teniendo en cuenta qué factores ambientales cambiaron de antes a después del diluvio. DiLUVIO UNIVERSO 0/iDER ¡AS Hi: URICAS diluvio.P.32 El estudio del Dr. Las moléculas de agua están formadas por un átomo de oxígeno y dos de hidrógeno. Sanford muestra cómo se pueden obtener datos científicos del libro del Génesis y. pero no se encuentra en la mis­ ma proporción en todas partes. 213. Sanford señala que la curva obtenida es muy similar a las curvas teóricas que reflejan la degeneración del genoma con el paso del tiempo. porej. K. Según el relato del Génesis. El coeficiente de correlación de la curva es de 0. 155. Si en las moléculas de agua se sustituye el hidrógeno por deuterio. 4 (1953). De forma natural. por tanto. pudo tener alguna relación con la dis­ minución de la longevidad. Genetic Entropy & The Mystery o f the Genome (Waterloo. lo que signifi­ caría que la disminución de la longevidad hum ana tras el diluvio podría deberse a la degeneración del genoma causada por acu­ mulación de mutaciones en el A D N .. 2003). ed. Epstein y T. 3a ed.

. Effect o f Deuterium Depletion (Buda­ pest: lst Books. con ello. vol. los patriarcas antediluvianos so­ lían tardar de 60 a 100 años en tener su primer hijo) y vivieran mucho más tiempo. hasta llegar al actual nivel de 150 partes por millón. Somlyai. Kovács. Defeating Cáncer! The Biológica!. Somlyai y K. Si 34 G. podríamos buscar evidencias de que el contenido de deuterio en el agua era inferior en el pasado. los niveles de deuterio aumentaron y. 548-556. pero cuando las plantas se cultivan con agua muy pobre en deu- terio. crecen más despacio. Investigadores del Instituto Húnga­ ro de Investigación Central de Física y de la Universidad Médica Semmelweis han descubierto. G. Los niveles bajos de deuterio antedilu­ vianos ralentizaban el metabolismo (crecimiento y desarrollo) de los seres vivos. 35 Gbor Somlyai. G. I. 2 (2011). podríamos proponer la siguiente hipótesis: el agua de la Tierra an­ tes del diluvio contenía muy poco deuterio. Jancsó. Ver también: A. pero cuando fueron liberadas las aguas subterráneas a la biosfera el resultado fue un aumento en el nivel medio de deuterio. y esto hacia que las personas tardaran más tiempo en tener hijos (según Génesis 5. Después del diluvio. el número de mutaciones en el A D N celular también aumenta. I. .34 También se ha observado que cuando el contenido de deuterio en el agua se incrementa. y se han hecho interesantes observaciones. que se acumularon en el A D N y provocaron una degeneración de la especie y un envejeci­ miento prematuro. Molnár. et al. recientemente. pp. M. “Deuterium Depletion May Delay the Progression of Prostate Cáncer”. que el crecimiento del cáncer se ralentiza e incluso se detiene con agua desprovista de deuterio. Krempels. Journal o f Cáncer Therapy. 28. 27. las mutaciones. Proceedings o f the Interna­ tional Scientific Conference on Nutraceuticals and Functional Foods (Zilina. p. Jákli.35 A partir de estos datos. pp. del 8 al 12 de junio de 2009). “Application of Deuterium Depletion in Cáncer Treatment and Prevention”. Por ejemplo. 2002). Una cantidad muy elevada de agua pesada es letal para los animales y las plantas. 45. Krempels. Guller. Eslovaquia. Esto es una muestra de cómo el modelo del diluvio provee hipótesis científicas y permite hacer predicciones que pueden ser verificadas. K. E v m im é m m p los organismos vivos han sido estudiados por varios equipos cien­ tíficos.

. 62. descubrimos que. et al. varía ligeramente a causa de fuerzas astronómi­ cas como la atracción gravitatoria de los otros planetas hacia la Tierra. que demuestra que en su interior había capacidad suficiente para contener y m antener con vida a los animales ne­ cesarios para.4377°. B. la su­ perficie de cubierta era de 8. una gran nave. 227 (Io de febrero de 1985). La inclinación teórica del eje de Tierra para cualquier m om ento del pasado o del futuro se puede calcular por medio 361. D. B. efec­ tivamente.. es el res­ ponsable de las estaciones. CA: Institute for Crea- tion Research. vol. ibíd. J. valores apropiados en términos de arquitectura naval y estabilidad en el mar. 23 metros de ancho y 14 metros de altura. conocido como “oblicuidad de la eclíptica . El ángulo de inclinación de la Tierra.. Se ha calculado que. Ya hemos comentado que el arca resulta bastante más realista que la canasta o el navio cúbico mencionados en otras narraciones.000 toneladas. Este ángulo. Winograd. el desplaza­ m iento (peso que alcanza una embarcación cuando está sumer­ gida hasta la línea máxima de carga) era de 43. 519-522. 1997). Alexander.36 Retomemos a continuación el tema de la viabilidad del arca del Génesis. Science. que en la actualidad es de 23. JV!0 l. repoblar la Tierra y dar lugar a la variedad de animales terrestres que existen en la actualidad.ÍNIVEf ■irte: HISTÓRICAS examinamos en la literatura científica.890 metros cuadrados. pp. J. “Génesis 6:15“ (comentario). En medidas modernas.38 Una última evidencia en favor del diluvio se descubrió gracias a registros históricos de observaciones astronómicas relativas a la inclinación del eje de la Tierra. 38 John Woodmorappe. después del diluvio. sin lugar a dudas. 37 El arca era. “Two-million-year Record of Deuterium Depletion in Great Basin Ground Waters”. el arca tenía aproxima­ damente 140 metros de largo. Szabo. se han encontrado evidencias de que el agua en el pasado contenía una m enor cantidad de deuterio.. Copien. p. Noah’s Ark: A Feasibility Study (El Cajón. T. 37 T. la capacidad interior del arca era de 39. aproximadamente. El geólogo John W oodmorappe ha publicado un estudio de viabilidad bien fun­ damentado.644 metros cúbicos.

Debido a que los solsticios eran fechas importantes para muchas culturas. ambos números deberían coincidir.C. el astrónomo australiano George F. Dodwell pasó a recoger tantas mediciones de la oblicuidad de la eclíptica como pudiera encontrar entre las marcas de los solsticios en m onum entos y otros registros anti­ guos. que mostraba una alteración im portante en la inclinación. que contenía datos desde la época de Tales. a partir de la posición del sol en el día más largo del año (solsticio de verano) y en el día más corto (solsticio de invierno). Dodwell obtuvo una curva s i n u s o i d al logarítmica.C.C. Las medidas reflejadas en los m onum entos antiguos se desvían significativamente de los valores de la fórmula. en teoría.C.). Por otra parte. Dodwell analizó medicio­ nes antiguas del ángulo de la eclíptica procedentes de una reco­ pilación realizada por el astrónomo belga Godefroid Wendelin. En 1936. pero esto no es lo que ocurre. Las mediciones más antiguas se encontraban muy alejadas de las predicciones de Newcomb. alrededor de 558 a. que tiene en cuenta el efecto de todas las fuerzas conocidas. fácilmente. pasando por Eratóstenes (230 a.). alcanzándose el equilibrio . pyjcsóM de una formula empírica desarrollada por el astrónomo estadou­ nidense Simón Newcomb. Hiparco (135 a. El resultado de la representación gráfica de estos datos fue una curva más precisa. hasta 1616 d.). Ptolomeo (126 d. sino que siguen un patrón definido. el ángulo real de inclina­ ción del eje puede calcularse. pero con el paso del tiempo ambas líneas se habían iban acercando.. Dodwell descubrió que estas desviaciones no ocurren al azar. la posición del sol en tales m omentos solía marcarse en los m onum entos anti­ guos.) y varios astrónomos medievales. Al representar los datos en una gráfica.C.C. Armado con este descubrimiento. incluyen­ do a Tycho Brahe (1587 d. dichas marcas pueden usarse para calcular el ángulo de inclinación de la Tierra correspondiente a m omentos específicos del pasado. debida a una fuerza desconocida que afectó el eje en la antigüedad. seguida de una recuperación lenta hacia los valores predichos por Newcomb. Si comparamos la inclinación predicha por la fórmula de Newcomb para una fecha determina­ da con la de una medición conocida. por lo tanto.

a partir de los datos históricos de la oblicuidad de la eclíptica. AR: Master Books. La diferencia podría deberse a que el cálcu­ lo es una extrapolación influenciada en exceso por el dato más antiguo representado en la curva.setterfield. hasta desa­ parecer por completo en 1850 d. Esa es la razón por la que la anomalía no había sido detectada por los astrónomos del siglo XX. in Ancient Times and Up to the Present” (1962). Este corresponde a medicio­ nes obtenidas en el templo solar de Amon-Ra. 2007).html. cuya fundación se rem onta supuestamente a 2045 a.org/Dod- well_Manuscript_l . cuándo ocurrió exac­ tam ente ni qué efectos tuvo sobre el planeta. que se sitúa en el año 2303 a. no sabemos qué even­ to específico pudo causar dicha desviación.39 La fecha obtenida por Dodwell. Mediaeval. o poco tiempo después. Umvrapping the Pharaohs: How Egyptian Archaeology Confirms the Biblical Timettne (Green Forest.. En cualquier caso.194 años. Egipto. la Tierra fue testigo de un brutal evento físico 39 George F. Dodwell propuso que un disturbio muy im portante en el eje de rotación de la Tierra ocurrió alrededor del 2345 a. 40 John Ashton y David Down. Una fecha alternativa para el reinado de Am enemhat es 1703 a. and Modem Observations of the Obliquity of the Ecliptic.C. lo que cambiaría la fecha extrapolada por Dodwell a unos cien años después del diluvio. . Dodwell. p. y produjo un tambaleo. podemos afirmar que alrededor de la fecha del diluvio de Noé.C. 2345 a. Se­ gún la curva obtenida.. 206. Measuring the Inclination of the Earth’s Axis.C. construido por Am enemhat I en Karnak. Sin embargo.C.C.40 Aunque parece razonable relacionar los catastróficos eventos del diluvio con la desviación del eje de Tierra. es m uy próxima a la fecha calculada para el diluvio del Génesis. que posteriormente fue disminuyendo con lentitud a lo largo de 4..C. JVíO UNIVERSAL nU A S Hl alrededor de 1850 d.C . Es posible que la alteración del eje de la Tierra estuviera relacionada con el rápido movimiento de las placas tectónicas y la producción de cordille­ ras como el Elimalaya o los Alpes. la cronología egipcia es problemática y m uy polémica. En línea: www. eventos que pudieron ocurrir algún tiempo después del diluvio. “The Obliquity of the Ecliptic: Ancient.

las cronológicas de distintas naciones y las múltiples narraciones sobre el diluvio conservadas en culturas antiguas al­ rededor del m undo. Cuando consideramos el conjunto de evidencias históricas revisadas en este capítulo. podemos afirmar que considerables datos históricos son consistentes con la evidencia geológica y apoyan el modelo de un diluvio univer­ sal reciente. la asignación de nombres de pueblos y países. Si a eso añadimos evi­ dencias científicas como las observaciones del astrónomo Dod- well sobre un evento de gran m agnitud que afectó el ángulo de inclinación de la Tierra en torno a la época del diluvio. . obtenemos un respaldo significativo para la exactitud histórica del relato del Génesis. m m M c x m m p im m M de suficiente m agnitud como para provocar una desviación sig­ nificativa del ángulo de inclinación de su eje.

Y OTRAS EVIDENCIAS EN CONFLICTO CON LA DATACIÓN RADIOMÉTRICA .______ na de las bases fundamentales que sustentan la evolución es la U presunción de que la Tierra es muy antigua y.. me encuentro con un folleto informativo o un mural de la región. ¿Son realmente tan antiguos los fósiles y las rocas? ¿Por qué oímos esa afirmación una y otra vez? El cada ocasión en que visito un parque nacional. se escuchan comentarios casuales sobre tal o cual caracte- . que las rocas que forman la columna geológica y sus fósiles tienen decenas o cientos de millones de años. FALENCIAS DE LA DATACIÓN RADIOMÉTRICA - JASAS DEEROSIOÑ Y SEDÍMEÑ lACIÓN. especialmente. En casi todos los documentales sobre la naturaleza. cuya leyenda explica que las formaciones de roca de la zona tienen millo­ nes de años de antigüedad.

EVOLUCIÓN IMPOSl rística de un animal o una planta que evolucionó hace “x” millones de años. Considerare­ mos algunos de ellos en el resto del capítulo. y que el diluvio universal ocurrió en una fecha relativamente reciente. pero no de edades absolutas. es decir. En el capítulo 5. no millones. . Expe- lled: No Intelligence Allowed. la presencia de la evolución en todas partes no debería sorprendernos. Menciono este punto ahora porque existe una gran can­ tidad de evidencias sólidas que apoyan la idea de que la Tierra es joven. podría considerarse un indicador de edades relativas.com. y la posibilidad de una intervención divina en la historia de la humanidad. La extensión y la gravedad de esta censura se ha ilus­ trado en el documental Expelled: No Intelligence Allowed [Expulsado: No se admite Inteligencia]. 2008). En realidad. vimos que H utton usó las tasas de sedimenta­ ción de los deltas de los ríos para calcular la antigüedad de las for- 1Ver: J. Slaughter ofthe Dissidents: The Shocking Truth about Killing the Ca- reers ofDarwin Doubters (Port Orchard. en lugar de ser el resultado de procesos aleatorios. En mi opinión. es muy importante que el polémico asunto de la datación de las rocas sea evaluado con todos los métodos disponibles. Como máximo.1 Uno de los principales apoyos al modelo de largas edades para la historia de la Tierra proviene de la datación radiométrica. Bergman. Pero una de ellas es las implicaciones que supondría considerar siquiera la perspectiva de una Tierra joven: la aceptación de la Biblia como do­ cumento histórico fiable. Las razones para este apoyo incondicional a la Teoría de la Evolución son variadas. Ben Stein. WA: Leafcutter Press. hace miles de años. Por desgracia. de Ben Stein. la intolerancia de la comunidad científica con respecto a este tema es tal que los investi­ gadores que apoyan la idea de que la vida en la Tierra fue diseñada de forma inteligente.expelledthemovie. ya que la cosmovisión de largas edades para la historia de la Tierra se encuentra exhaustivamente arraigada en la comunidad científica y en la educación secular. Aunque trataré este método de datación en detalle en el próximo capítulo. quiero recordar aquí que la datación radiométrica se basa sobre su­ posiciones que no pueden ser demostradas. sufren con frecuencia una grave marginación por parte de colegas e instituciones. www.

Los sedimentólogos han calculado tales estimaciones para un grupo de ríos y regiones montañosas del mundo.8 / 71 Alpinos San Juan (EUA) 13 / 340 Adigio 2.7 / 120 Garona Ganges 22 / 560 4. 3“ ed.6 / 65 Irrawady 1 1 /2 8 0 Savannah 1 . (London: Longman Group. ed. que desembocan en lagos u océanos.2Algunos de estos resultados se muestran en la Tabla 1. pues. 509. W ei-H o 53 / 1.6 / 1 5 2 B. que finalmente encuentran su camino hacia los ríos. “Geographies for Advanced Study”.! maciones de rocas sedimentarias y los fósiles que contienen. . Beaver. Sparks.350 Yangtse 6. A través de un repetido muestreo del contenido de residuos del agua de los ríos en su desembocadura.. pp. 510. La llu­ via y la nieve proporcionan agua a los continentes. las evidencias geológicas a la luz de los conocimientos actuales: Las plantas y los animales necesitan agua para sobrevivir. trans­ porta partículas de materiales erosionados de las rocas y el suelo. podemos estimar la cantidad de sedimento que está siendo transportado y la velocidad con que la topografía se está erosionando. H. Geomorphology. en S.3 /3 3 Tigris 10 / 260 Potomac 0 . tenemos datos mucho más exactos sobre las tasas de ero­ sión y sedimentación en diferentes ambientes.0 / 100 y Colorado Rin y Ródano 13 / 340 Amazonas 2. 1986). El exceso de agua escurre desde las montañas hacia los ríos. En la actualidad.7 / 170 Hwang-Ho 35 / 900 Po 4. FALENCIAS DE LA DATACIÓN RADIOK¡ÉTR!CA .W. Cuando el agua de lluvia fluye sobre la superficie. Examinemos.

04 / 1 | Tabla 1: Dism inución promedio de la topografía drenada por grandes ríos (en pulgadas/milímetros por cada 1. los sedimentos arrastrados o empujados a lo largo del fondo por la corriente de agua.5 / 13 Tíber 7. que supuestamente se remontan 500 millones de años atrás. El Río Co­ lorado corre por el Gran Cañón. ¿cómo es posible que los estratos fosilíferos sigan ahí después de cientos de millones? Una explicación posible es que estas rocas más viejas fueron enterradas bajo rocas más jóvenes que sí se ero­ sionaron. . y contiene estratos portadores de fósiles. 1995). que no se observan con facilidad en las estaciones de medición).5 / 240 Nilo 0. p.3 /7 Indo 7. Los procedimientos de medición tampoco tienen en cuenta el transporte adicional de material que tiene lugar durante eventos catastróficos pun­ tuales. Venkatakrishnan.1 no incluyen la carga del lecho del río (es decir. Por ejemplo. Esto significa que las tasas reales de erosión a largo plazo podrían ser m ucho más elevadas. 217.1 / 180 Connecticut 0. Chemicoff y R. Muchos de los valores de la Tabla 9. como grandes inundaciones. en la Tabla 9.000 millones.6 kilómetros.1 vemos que la topografía en torno al Río Colorado se erosiona 100 milímetros cada 1.000 años. Consideremos las implicaciones de estas tasas de erosión. Geology: An Introduction to Physical Geology (New York: Worth Publishers. entonces. Isére 9. el área debería haberse erosiona­ do completamente en menos de 20 millones de años. basándonos sobre la tasa actual de erosión. La profundidad de este es de 1. aproximadamente.000 años). y rocas de hasta 3. Teniendo en cuenta que las rocas de la cumbre del Gran 3S.5 /1 9 0 Sena 0 .3 No obstante.

Beaver.500 millones de años.000 años. o casi dos veces la altura del M onte Everest. Judson y D. FALENCIAS DE LA DATACIÓN RAD! Cañón tienen. “Rates of Regional Denudation in the United States”. Ritter. H. afirma que las tasas de erosión del Rio Amarillo (I Iwang- EIo) podían erosionar un área con una altura media igual a la del M onte Everest en solo 10 millones de años. 155. 8R. 4 Ibíd.4 kilómetros. Eso corres­ pondería a extender sobre un área equivalente a la de los Estados Unidos una capa de sedimentos de casi tres veces la altura del M onte Everest. se ha señalado que el continente norteamericano. Annual Review o f Earth and Planetary Sciences. W. Catastivphism: Systems o f Earth History (London: Edward Amold. Kroner. 1988). McLennan y S. los continentes se formaron hace más de 2. si la erosión era tan rápida? Las tasas de erosión en las regiones montañosas son incluso más altas.395-3.45y dada una tasa de erosión de 0. pp.'’ el espesor de sedimentos debería ser de aproximadamente 14. 5 S. 232. vol. tal como 60 milímetros por cada 1. Dott Jr. supuestamente. ibíd. vol. 7 De acuerdo con las dataciones radiométricas.. pp. 1 Ibíd. Desde los años 50. y R. Huggett. “Evolution of the Archean Continental Crast”. debería erosionarse totalmente en diez millo­ nes de años. vol. Natare. H. 6 S. p. p. 49-74. 4“ ed. B.401. (New York: McGraw-Hill Book Co. F.8 ¿Cómo pudieron sobrevivir estratos tan antiguos en los continentes. . 3. para haber sobrevivido hasta la actualidad. 1990). 169-172. que tiene una altura media de 620 metros. Taylor.000 años. Batten. pp. que es una tasa estimada habi­ tual para los cálculos de erosión en los continentes. S. M. Sparks. A. R.1 metros por cada 1. 306 (1983). 240 millones de años. según las tasas de erosión estimadas. tendrían que haber sido enterradas bajo aproximadamente 24 kilómetros de se­ dimentos. Evolution ofthe Earth. Journal o f Geophysical Research. Sedimentation Rates and Growth of Continental Crast”. “Continental Freeboard. Aun usando un valor inferior. 13 (1985). L. que tendría que haber sido erosionada y arras­ trada hacia el océano.6 Esta cuestión no es nueva para los geólogos. como se muestra en la Tabla 2. 69 (1964). R. Datos similares se obtie­ nen de otras partes del mundo: un geólogo de Cambridge.

a 975 metros). Esto significa que la sobrecarga requerida para preservar los estratos desde. centenares de millones de años hasta la actualidad. que se convir­ tieron en los depósitos de carbón que encontramos alrededor del m undo. sería de muchas decenas de kilómetros. Por el registro fósil. En m omentos puntuales.000 años). en caso de haber existido.. del orden de algunos de los valores que aparecen en la Tabla 9. (8. a nivel del mar). que generalmen­ te se relacionan con tasas de erosión superiores. 11 Montañas en la frontera entre México y 3 6 /9 2 0 Guatemala. 14 315 / 8. el grosor medio de sedimentos en el fondo marino es de aproximadamente 450 . Sin bien. dicha sobrecarga de de­ pósitos más jóvenes habría term inado en los océanos. 12 Los Himalayas.. 10 Cordillera de los Hidrógrafos (Papúa Nueva 20 / 520 Guinea. supuestamente. 15 750/19. durante eventos catastróficos como aquellos que enterraron a los dinosaurios. Washington.000 Volcán en Papúa Nueva Guinea.Cordillera de los Hidrógrafos (Papúa Nueva 3 /8 0 Guinea.000 Tabla 2: Tasas de erosión en regiones montañosas (pulgadas/milí- metros por cada 1. Por el contrario.2.000 a 19. no se ha encontrado en el fondo marino las capas de sedimentos de varios kilómetros de espesor que debería haber tras cientos de millones de años de erosión.000 Monte Rainier. sabemos que en el pasado había bosques exuberantes y grandes cantidades de vegetación. El clima correspondiente a ese tipo de vegetación incluye un gran número de precipitaciones.000 años). las tasas de erosión habrían sido aún mayores.000 milímetros en 1.13 3 9 /1. y m uy poco realista.

En línea: www.metros. Zeitschriftfiir Geomorphologie. D. 13H. “Some Rates of Regional Erosión”. McDougal. Menard. pp. Washington”. 12J. 78-80. “Vitesse de L’erosión”. 4 (1976). H. 154-161. 15-28. pp. 15 La capa relativamente fina de sedimentos que recubre los fondos oceánicos puede proporcionarnos nuevas pistas sobre la edad de los continentes. J. “Estimated Erosión Rates on Mount Rainier. 545-561. 16 Colin Mitchell. Zeitschrift fü r Geomorphologie (1971).9 Estas observaciones nos llevan a la conclusión de que los continentes no se han estado erosionando durante cientos de millones de años. Nótese que el espesor promedio de los sedimentos varía entre los océanos. vol.101. en el Pacífico varía entre 300 a 600 metros. Después de corregir el cálculo teniendo en cuenta los sólidos eliminados en las salpicaduras provocadas por el viento y el romper de las olas. American Journal o f Science. Corbel. mientras que en el Atlántico es de alrededor de los 1. Journal o f Geology. El geógrafo Dr. 15 C. 401-406.com/ EBchecked/topic/424338/ocean-basin. las contribuciones volcánicas y el polvo arrastrado por el viento. obtuvo un resultado de 26. vol. The Case fo r Creationism (Alma Park.16 Mitchell calculó el tiempo necesario para deposi­ tar los sedimentos presentes en el fondo marino utilizando una estimación antigua de su grosor medio (900 metros). 14.800 millones de toneladas de sólidos incorporados anualmente a los océanos del m undo. 1994). W. 69 (1961). 265 (1967).britannica. 14 H. vol. “Erosión of a Young Volcano in New Guinea”. Ollier y M. . pp. F. P. Aun así. u . Encyclopedia Britannica. Colín Milcbell estimó la velocidad a la que los sedimentos se incorporan a los océanos. P. Grantham. En algunas áreas oceánicas es de solo 100 metros de espesor. 11 Ibíd. 12. pp. pp. Por ejemplo. Luyendyk. England: Autumn House Limited. 13. “Denudation Rates in Northeast Papua from Potassium-ar- gon Dating of Lavas”. Mills. la 9B. Las evidencias sugieren enérgicamente que los estratos sedimentarios portadores de fósiles encontrados alrede­ dor del m undo deben ser relativamente recientes. Brown. “Ocean basin”. 1-28.000 metros. vol. Ruxton y I. usando datos de los materiales sólidos arrastrados por ríos y gla- ciares. 3 (1959). y que los estratos y sus fósiles no tienen 500 millones de años. pp. Geology. 10B.

A partir de datos obtenidos de las erupciones volcánicas ocurridas entre 1940 y 1980.9 millones de kilómetros cua­ drados y un valor promedio de densidad para el sedimento de 2.17 El biólogo marino Dr. 268. en 1815. 4 (2010). Ariel Roth realizó un cálculo similar utilizando una tasa de deposición de 24. aproximadamente. p. podemos deducir que la actividad volcánica era notablemente mayor en el pasado. Nótese que MitcheU utiliza un área oceánica de 360.3 toneladas por metro cúbico. Earth-Science Reviews. 102. 1998). et al. D. 80. Roth. Bryan. “The Largest Volcanic Eruptions on Earth”. 20 S. para los pará­ metros marinos (450 metros de grosor medio. E. y la de Lago Taupo (Nueva Zelanda) emitió. 267.5 millones de años. . han emitido volúmenes m uy superiores.. Si además tuvié­ ramos en cuenta el rápido transporte de grandes cantidades de sedimento ocurrido durante las catástrofes que enterraron a ani­ males y plantas. sin embargo. W. p. N° 3. 1. Incluso sin tener en cuenta 17Ibícl.20 La erupción de Tambora (Indonesia).19 Algunas erupciones. que obtuvo del promedio de 12 estudios de sedi­ m entación oceánica. el tiempo requerido se reduciría enormemente. Peate. U. m io w a m s u p u s is t e deposición de dicha capa de sedimentos habría requerido sola­ mente 28 millones de años. 360. 19Ibíd. realizados entre 1950 y 1993. pp. expulsó entre 100 y 300 kilómetros cú­ bicos de materia. MD: Review and Herald Publishing Association. 207-229. 265.9 millones de kilómetros cuadrados de área y 2. Además. más precisos..100 kilómetros cúbicos. I. O tra fuente de información sobre la edad de la Tierra es el material liberado por los volcanes. 18Ariel A.3 toneladas por metro cúbico de densidad del sedimento) concluyó que el tiempo necesario para depositar la capa de sedimentos presente en el suelo oceá­ nico sería de solamente 15. se ha estimado que los volcanes alrededor del m undo expulsan cada año un promedio de cuatro kilómetros cúbicos de material hacia la superficie terrestre. pp. Peate.. teniendo en cuenta el gran número de volcanes inactivos que observamos en la actualidad. Origins: Linking Science and Scripture (Hagerstown.18 Utilizando esta estimación y valores modernos.108 millones de tone­ ladas por año. vol.

la antigüedad de los continentes sería. y asumiendo el modesto valor medio de cuatro kilómetros cúbicos de materia por año.6 kilómetros. FALENCIAS DE LA DATACiÓN RADíOMÉTRiCA . 268.22 No es de esperar que las estructu­ ras tisulares de base proteica sobrevivan más allá de unas decenas de miles de años. lo que reduciría enormemente el tiempo disponible para la evolución. que asignan a los continen­ tes antigüedades de 2. N o obstante. H. supuestamente. p. En el capítulo 5. “Biomolecular Characterization and Protein Sequences of the Campa­ nean Hadrosaur B. Science. como máximo.I ambas observaciones. vol. comentamos el descubrimiento de tejidos blandos en restos de dinosaurios que. debido a la degradación natural de las cadenas moleculares. 22M. este período de tiempo podría verse considerablemente reducido. pp.500 millones de años. Además de las evidencias geológicas en contra de las largas dataciones de los fósiles. El descubrimiento de secuencias de proteína intac- 21 Roth.21 Si usamos la misma tasa de emisión para calcular su antigüedad. Esa cantidad de material habría sido suficiente para cubrir la superficie completa de la Tierra (océanos incluidos) hasta una altura de 19. durante ese tiempo se habrían acumulado 10.000 millones de kilómetros cúbicos de materia volcánica. cuatro kilómetros cúbicos anuales. se ha calculado que la superficie de la Tierra contie­ ne solamente 135 millones de kilómetros cúbicos de material de origen volcánico. y de la deposi­ ción de material volcánico. 324 (2009). Origins: Linking Science and Scripture. tenían 80 millones de años. si los continentes realmente hubiesen tenido 2. Vemos una vez más cómo se acumulan evidencias fehacientes en contra de las edades radiométricas. 626-631.500 millones de años. . existen muchas otras de que la vida so­ bre la Tierra es bastante más joven de lo que sugieren las edades radiométricas. Canadensis”. Teniendo en cuenta que en el pasado las erupciones eran más intensas y frecuentes. Schweitzer. estos materiales se habrían depositado en menos de 34 millones de años. Según los datos pro­ cedentes de las tasas de erosión y de sedimentación. del orden de decenas de millones de años.

y utilizando la tasa de acumulación de mutaciones observada actualmente. ha calculado que el A D N hum ano acumula la increíble cantidad de 90. sugieren enérgicamente que la antigüedad real de dichos estratos es de tan solo miles de años. supuesta­ m ente tras 250 millones de años. EVOLUCIÓN tMÍNIGSlS tas en fósiles de dinosaurio constituye una fuerte evidencia de que esos restos tienen miles de años de antigüedad. L.. 32. K. Scientific American. vol. y que se está deteriorando con una rapidez alarmante. 24 T. “New Evidenee for 250 Ma Age of Halotolerant Bacterium from a Permian Salt Crystal”. En 6 millo­ nes de años. Hace unos años se descubrió que el A D N humano tiene una elevada velocidad de mutación. y es inconcebible que el material genético sea todavía 23 C. But Why Wo- rry?”. 280. “Quantifying the Genomic Decay Paradox Due to Muller’s Ratchet in Human Mitochondrial DNA”. vol. 133-159. R. N° 4 (1999). “Mutations Galore: Humans Have High Mutation Rates. Loewe. Cálculos basados sobre la acumulación de mutaciones perjudiciales tan solo en el AD N mitocondrial sugieren que la línea evolutiva ancestral que conduce a la aparición de los seres humanos se habría extinguido después de 20 millones de años. y no millo­ nes. pp.000 errores en solo 6. Lowenstein. Geology. 33 (2005). 25 L.23 En capítulos anteriores. Por razones similares. 265-268. 36.24 Si los seres humanos y sus antepasados hubieran existido durante tanto tiempo como supone la historia evolutiva convencional. et al. Esto significa que 0. investigador en Genética de la Universidad Cornell. Beardsley. hemos comentado el papel de las mutaciones. Genetics Research.000 años. el 3% del A D N (uno de cada 33 fragmentos) esta­ ría dañado. Cambridge. pp.000 años. . que resultan noto­ riamente perjudiciales para los organismos vivos. Satterfield. H. también. el Dr. pp. John Sanford. 87 (2006). vol. cambios aleatorios en el ADN. Vreeland.003% del A D N se vuelve inoperante en menos de 10. las bacterias viables que se han aislado de cristales de sal encontrados en estratos del Pérmico.25 Considerando el genoma completo. el genoma se habría degenerado lo suficiente como para llevar a la especie a la extinción hace mucho tiempo. T.

A. como las aves y los mamíferos. A. sangrare­ mos hasta morir. 27 B. Genetic Entropy and the Mystery ofthe Genome (Waterloo. Aun­ que los genes que codifican la síntesis de los microARNs representan menos del 1% del total de genes humanos. el linfoma. 2. 2008). La evolución requiere la producción de A D N nuevo por medio de procesos naturales aleatorios. Resultados similares seguirán a cualquier cambio que inutilice una de las miles de rutas bioquímicas críticas para el organismo. FALENCIAS DE LA DA1ACIÓN RADIOMÉTRiCA . volviéndose afuncional y poniendo en peligro la continuidad de la especie. 2gIbíd. en términos de enfermedad. está codificada en el ADN de estos. John. J. PLoS Biology. Y esto no ocu­ rre solamente en el caso del ser humano. los efectos de las mutaciones se multiplican por el hecho de que existen partes del genoma que son interdependientes. Las mutaciones de algunos de estos genes se han vinculado con enfermedades humanas como la leucemia. Aravin. si la información genética que codifica la pro­ ducción de células beta está dañada. et a l. la especie ha­ bría desaparecido mucho antes de alcanzar los 6 millones de años. Enright. las muta­ ciones en los genes que codifican los microARNs tienen efectos muy amplificados. Por ejemplo.28 26 John C. el cáncer de próstata. 1a sumamente compleja e interdependiente bioquímica de todos los organismos superiores. N °1 1(2004). el cáncer colorrectal. NY: FMS Publications. sufriremos diabetes.26 En otras palabras. pero los cambios en el A D N desequilibran el sistema y causan graves perjuicios. Sanford. un tras­ torno hereditario que causa retraso mental. pero lo que observamos en la naturaleza y en los laboratorios de investigación es el proceso diametralmente opuesto: A D N que se deteriora lentamente. Si se altera la información responsable por la síntesis de una de las proteínas que participan en el mecanismo de coagulación de la sangre. que tienen la capacidad de regular a otros genes. . otros tipos de cáncer. Se puede citar el caso de los microARNs.I funcional en esas condiciones. ácidos nucleicos cortos de cadena simple. “Human MicroRNA Targets”. y el síndrome de Martin-Bell. p. o del X frágil. estos regulan la síntesis de proteínas de más del 10% del genoma. Además. vol. 153.27 Por esta razón.

estos mecanismos son. . Las tasas de ero­ sión continental. Las tasas de m utación del A D N que observamos en el presen­ te indican edades m ucho más cortas para la vida sobre la Tierra que las calculadas por datación radiométrica. es im portante analizar en detalle este método de datación y.000 años. o incluso del uno por diez mil. respectivamente. podemos concluir que el A D N Homo no puede tener más de 200. y probablemente no tiene más de 20. en particular. Según estos datos. se adecúa bien a los datos que ob­ servamos y sugiere que la edad de los continentes y de los fósiles es relativamente joven. como los seres humanos. Evidencias sólidas y consistentes procedentes de fuentes distintas contra­ dicen las edades obtenidas por datación radiométrica. Por esta razón. susceptibles al daño por m utación. El modelo de diluvio universal.000 años de mutaciones acumuladas. lo que corresponde a 200. las suposiciones que lo sustentan. las tasas de sedimentación en los océanos y la deposición de material volcánico indican que los continentes no pueden tener miles de millones de años. en cambio. Si se tienen en cuenta los eventos catastróficos y la edad de las rocas y de la vida fósil contenida en ellas. se ve m ucho más reducida. EVCüiCiÓM ¡MPs Aunque existen mecanismos naturales para proteger a los organismos de las mutaciones y para reparar el A D N dañado. de solamente miles de años.000. Para organismos complejos.000 y 20. en sí mismos. la especie tiende a la extinción cuando los niveles de deterioro del A D N alcanzan proporciones del uno por mil.

La mayoría de elementos químicos que en­ contramos en la naturaleza. que intentaré ex­ plicar de forma sencilla. . el hidrógeno. FALENCIAS DE LA DATACIÓN RADIOMÉTRICA. y que constituyen las partículas básicas de la materia a nuestro alrededor (como el oxígeno. Para poder entender correctamente el contenido de este capítulo.II LOS MÉTODOS DE DATACIÓN RADIOMÉTRICA ARROJAN EDADES ANTIGUAS PARA ROCAS JÓVENES. fenómeno que más tarde sería conocido como “radiac­ tividad”. se ha descubierto un considerable número de elementos que sufren desintegración radiactiva. Desde entonces. se descubrió que el uranio emitía radiación nuclear E lenta. es im­ portante conocer unos pocos conceptos técnicos. Y OTRAS EVIDENCIAS DE GRANDES PROBLEMAS CON ESTE MÉTODO DE DATACIÓN n 1896.

al cabo de 5. Al elemento inestable que se desintegra se denomina “elemento padre”.000 átomos de carbono 14. tendrá solamente 125 átomos del elemento padre. Durante los siguientes 5. La vida media. EVCLUCSÓ-'Í iLIFOSILLS el carbono. que es el elemento hijo. a la vez que emiten radiaciones peligrosas. Pongamos un ejemplo: la vida media del carbono 14. Teóricamente. Sin embargo. La transformación del elemento padre al elemento hijo ocurre a una tasa determinada. de un elemento radiactivo es el tiempo necesario para que la mitad de los átomos del elemento padre se transforme en elemento hijo. Si tomamos una muestra con 1.700 años. en 1947 se publicó una edición revisada. Los períodos de semidesintegración de algunos elementos ra­ dioactivos fueron medidos. el cálculo de la antigüedad de dicho material resultará relativamente sencillo. existen algunos elementos como el uranio. inicialmente. es de aproximadamente 5. que depende de cada pareja de elementos. son estables y no cambian con el tiempo. El hecho de que la desintegración radiactiva se produzca de forma regular permite usar el contenido de un elemento radiactivo en un material para calcular su antigüedad. cuyos átomos son inestables y de manera espontánea se transfor­ man en otro elemento. nitrógeno 14.700 años más. y al que se obtiene al final se lo llama “elemento hijo”. De esta forma. y 875 del elemento hijo. fundamentada en el contenido de uranio encontrado en minerales de cinco niveles diferentes de la columna geológica. Holmes en 1913. o período de semidesintegración. que es un elemento radiactivo que se usa para datar restos de seres vivos. la mitad (500) se habrá transformado en nitró­ geno 14. el silicio o el hierro). a comienzos del siglo XX.100 años. nuestra muestra.700 años.700 años. y en 5. la mitad de los restantes. y si pode­ mos medir el contenido actual del elemento padre o hijo. . Esta se basaba sobre mediciones relativamente pobres. Sin embargo. la mitad de los 500 que quedaban (250) se transformará en nitrógeno.000 átomos de carbono 14. después de 17. si conocemos el contenido inicial del elemento radiactivo y su período de semidesintegración. y la primera escala de tiempo basada sobre mediciones ra- diométricas fue propuesta por A. que originalmente tenía 1. y la otra mitad estará todavía en forma de carbono 14.

siguiendo la suposición de que la longitud de cada período geológico es proporcional al grosor máximo de las rocas sedimentarias formadas durante ese perío­ do. El uranio 235 se desintegra hasta el plomo 207. como hemos visto en capítulos previos. El problema de la datación radiométrica es que no es un método de datación directo. A continuación. Las fechas de Holmes para las distintas secciones de la colum­ na geológica se usaron hasta que a principios de los años 60 se obtuvieron nuevos datos. p.470 millones de años. t. se m idieron 5 puntos y se hicieron interpolaciones para los períodos intermedios. “Geological Time Scale”. Algunos de los elementos radiactivos más usados son los siguientes: En el método uranio-torio-plomo. se ha establecido en 4. L. En vez de ello. átomos de uranio. ya que depende de varias suposiciones que de­ ben cumplirse necesariamente para que el resultado de la datación sea válido. Cuando la colum na geológica fue datada. La vida media para esta reacción. las edades atribuidas a los diferentes estratos se fueron actualizando. se desintegran a través de una serie de pasos intermedios hasta el plomo 206. ENCIAS DE 1. 1J. es decir. 1960). con un peso atómico de 238. Kulp. y tiene una vida media de 704 millones de años. a m edida que se iban recopilando nuevos resultados de datación radiométrica. hay claras evidencias de que no se cumple a causa del pasado catastrófico de la Tierra. las capas sedi­ mentarias y sus fósiles se datan a partir de las edades de las rocas volcánicas superiores e inferiores. 135-137. 6. el tiempo requerido para que la m itad del uranio 238 inestable se transforme en plomo 206 estable.1Esta suposición de tasas constantes de sedimentación basada sobre el uniformitarianismo se usó para calcular las antigüedades de los períodos de tiempo intermedios en la columna. vamos a analizar con más detalle cómo funciona este método de datación. aunque. . Desde entonces. McGraw-Hill Encyclopedia o f Science and Techno­ logy (New York: McGraw-Hill Book Company.A DAXACION RADIOME-TRIGA Los estratos sedimentarios no pueden ser datados directamen­ te por métodos radiométricos.

100 millones de años. en ocasiones. Las suposiciones que deben cumplirse para garantizar la validez de los resultados de la datación radiométrica son las siguientes: Cuando la rocafu e formada. El potasio 40 se transforma en argón 40. con una vida media de 14. se desintegra hasta plomo 208.730 años. Durante el tiempo transcurrido entre la form ación de la roca y . con una vida media de 48. Para datar una roca es necesario medir con mucha exactitud la concentración de los diferentes elementos radioactivos que contiene. Para un sistema simple. las matemáticas necesarias para calcular la antigüedad se complican considerablemente. no estuviese presente ninguna canti­ dad del elemento hijo. con una vida media de 1.693) ln [(B +1) /A ] Donde T es la edad de la roca en millones de años. Sabiendo las proporciones entre los elementos padre-hijo. aplicaríamos la siguiente fórmula: T = (t/0. también en millones de años. t es el período de semidesintegración. B es la concentración de átomos hijo presente en la mues­ tra. ya hemos hablado del carbono 14. es necesario te­ ner en cuenta los efectos que tiene sobre otro material radiactivo la radiación emitida por un elemento al desintegrarse. y utilizan­ do fórmulas matemáticas específicas. Por ejemplo. El rubidio 87 se descompone a estroncio 87. El torio 232. Es decir.800 millones de años. del elemento radiactivo. con una vida media de 106 mil millones de años.250 millones de años. y ln es una operación matemática llamada logaritmo neperiano. El samario 147 se transforma en neodimio 143. que todos los átomos hijo presentes sean producto de la desintegración radiactiva del elemento padre. Por último. En sistemas complejos donde se combinan varios elementos radiactivos o se producen varios elementos hijo distintos. con una vida media de solo 5. A es la concentración de átomos padre presente en la muestra. se puede calcular la edad de la roca. que se desin­ tegra a nitrógeno 14.

Durante el mismo período. porque no permite detectar algunos procesos. según el método potasio-argón. Faure. La tasa de desintegración no ha cambiado. de G. por medio de la cual se calculan las proporciones de isótopos padre e hijo para diferentes minerales de la misma muestra de roca. Este problema puede ilustrarse con numerosos casos en los que. En otro caso. utilizando diferentes elementos radiactivos. pero el resul­ tado de la datación por rubidio-estroncio fue de edades de 570 y 870 millones de años. O tra roca del mismo período fue datada en 1. decenas a miles de millones de años) el sistema ha permanecido cerrado. con antigüedades de menos de 1. Dos dataciones de lava del Mioceno Superior al Plioceno dieron un re­ sultado de 5 a 9 millones de años. y se representan juntas en un mismo gráfico. La edad de la roca se calcula. y . cita varios ejemplos. la lava se dató estratigráficamente como del Plioceno-Ho- loceno. la datación isócrona de la misma roca ha resultado en edades m uy dispares.500 millones de años por el método de rubidio-estroncio. Para detectar y reducir los errores debidos al incumplimiento de las suposiciones 1 al 3. No obstante.3 millones de años. entonces. es decir. el resultado se considera de confianza y se asumen pérdidas mínimas de material. con un resultado de 773 millones de años. y de 31 a 39 millones de años según el rubidio-estroncio. de m anera que no se han eli­ minado o retirado de la roca átomos ni del elemento padre ni del hijo. como la mezcla en el pa­ sado de rocas jóvenes y antiguas en estado fundido. El libro de Geología Isotópica. que podrían afectar el resultado de la datación. la técnica isócrona no hace al método infalible. FALENCIAS DE LA DATACIÓN RADIOME'TRICA . Muestras de lava desde el Pleistoceno hasta el presente. a partir de la pendiente de la recta.6 millones de años. se ha desarrollado una técnica llama­ da “isócrona”. Si los datos se ajustan a una línea recta. de menos de 5. se dataron por el método rubidio-estroncio. no se ha añadido ningún átomo adi­ cional del elemento padre o del elemento hijo que no pueda ser explicado por el proceso de desintegración radioactiva.II la datación (generalmente. según su posición en las capas de roca.

Principies oflsorope Geology. la edad ob­ tenida fue de 393 millones de años. A. han seguido dando resultados discordantes. Snelling y E. de la región oriental del Gran Cañón. ¿cuál es la antigüedad de la intrusión? ¿174 millones de años? ¿1.425 ± 1. La datación isócrona dio un resultado de 174 millones de años.3 En este trabajo. Cuando las mismas muestras se data­ ron por el m étodo de isócrona de rubidio-estroncio.4 Entonces.2 El Dr. en Queensland. se calculó una edad de 259 millones de años. mp« íeb!í : una del Mioceno-Holoceno (es decir. Vardiman. y con el m étodo de isócrona de samario-neodimio. en L. (New York: John Wiley and Sons. ed.000 millones para la misma intrusión de roca. geólogo. de menos de 24 millones de años según la datación estratigráfica convencional) fue datada en 1.. A. “Isochron Discordances and the Role of Inheritance and Mixing of Radioisotopes in the Mantle and Crust”. 4 Ibíd. 393-524. El m étodo plomo-plomo dio una edad de 1. de 216 a 225 millones de años). La edad con- 2G. F. Faure. 3Andrew A. 2o ed. el rango de edades estimadas por medio del método potasio-argón fue de 183 a 252 millones de años. se describen es­ tudios recientes de datación isócrona de muestras múltiples de roca que. e v m :.200 millones de años por el mismo método. y analiza otros intentos de explicar los resultados dispares que se obtienen en la datación radiactiva de una misma muestra de roca por distintos m étodos. ha escrito un informe téc­ nico en que se explica detalladamente la influencia de la mezcla de materiales preexistentes en los resultados de las isócronas. con un error estimativo de solo ± 9 millones de años. para 15 muestras de roca de una intrusión convencionalmente datada del Jurási- co-Triásico (supuestamente. Radioisotopes and the Age o f the Earth (El Cajón.. CA: Institute for Creation Research and Chino Valley. a pesar de usar métodos m uy precisos de análisis quí­ mico. en Somerset Dam .425? ¿Alguna de las edades intermedias? ¿O una totalm ente diferente? Encontramos otro ejemplo en la datación del basalto Cárdenas. Snelling. Andrew Snelling. 2005). pp. en Arizona.üíq« . pp. 145-147. Australia. 1986). pp. Chaffin. ¡SO . 405-414. AZ: Creation Research Society. Por ejemplo.

S.000 años por el método de uranio-helio. Fall Meeting Supplement.385 ± 950 millones de años. y por el método de isócrona fue de 516 ± 30 millones de años. mientras que las mediciones de plomo-plomo dieron una edad isócrona de 1. A. AbstractV32C. R.500 millones de años por el método uranio-plo­ mo. . entonces. en Boulder.655 ± 40 millones de años. Baumgardner y A.0 1 3 + 37 millones de años. 84. R. 7D. Las mediciones de samario-neodimio del mismo laboratorio dieron una edad isócrona de 1. Massachusetts. y 892 ± 82 millones de años para otras 22 muestras.Transactions o f the American Geophysical Union. por samario-neodimio fue de 1. N° 46 (2003). pp. vol. A. la misma pre­ gunta: ¿Cuán antiguo es el basalto? ¿516 millones de años? ¿1.¡I vencional obtenida de dataciones radiométricas previas era 1. Austin. Un caso ex­ tremo es la diferencia abismal entre las edades estimadas para los gra­ nos de zircón presentes en la granodiorita Jemez. 5lbíd.103 ± 66 millones de años. Sin embargo. FALENCIAS DE LA DATADOS RADIOMETRICA . Snelling..5 Surge. 6Ibíd. y por plomo-plomo fue 1. y en solamente 6.6 En total. situadas cerca de la base del Gran Cañón. Otros autores han encontrado discrepancias similares. por el método potasio-argón.588 millones de años? ¿Quiere usted mismo escoger? Un último caso citado por Snelling es la dispersión en la estima­ ción de la edad de las rocas que se obtuvo de la datación de unas 20 muestras de las rocas anfibolitas de Brahma. EOS .883 ± 53 millones de años. fue de 577 ± 1 2 a l .588 ± 170 millones de años.-1047.240 ± 84 millones de años. de Nuevo México. que fue datada en 1.111 ± 81 millones de años para 19 muestras.7 O tro caso interesante son las rocas volcánicas cuya antigüedad se conoce con exactitud porque se formaron en épocas históricas. J. Humphreys. más de 600 millones de años de diferencia. obtuvo edades isócronas basadas sobre rubidio-estroncio de 1. La edad estimada por rubidio-estroncio fue de 1. El rango de edades obtenido en los La­ boratorios Geochron. el Laboratorio de Isótopos de la Universidad de Co­ lorado. Colorado. 416-418. “Recently Measured Helium Diffusion Rate for Zircon Suggests Inconsistency with U-Pb Age for Fenton Hill Granodiorite”. Cambridge.

en Canberra. UK and NY: Cambridge University Press. vol. Ivey Jr. PA: Creation Science Fellowship Publishers.. de 197 +160 millones. 30 de junio de 1954 y 14 de julio de 1954. La isócrona de rubidio-estroncio dio una edad aparente de 133 ± 87 millones de años.answersingenesis. New Zealand. and Pb-Pb Isotope Systematics to Elucidation of the Génesis and History of Recent Andesite Flows at Mt. “A Critical Examination of Radioactive Dating of Rocks”. vol. T. 4 de junio de 1954. Pueden encontrarse muchos ejemplos debatidos en: A. Dos o tres muestras de roca de dos o tres kilos se recolectaron de cada uno de los siguien­ tes flujos de lava: 11 de febrero de 1949. de la Escuela de Investigación de Ciencias de la Tierra de la Universidad Nacional Australiana.. L. “Potassium-argon Dates and the Cenozoic Mammalian Chronology of North America”. pp.10 Si rocas con una antigüedad conocida de menos de 100 años son datadas como si tuvieran cientos o miles de millones de años. en la isla norte de Nueva Zelanda. También se tomaron dos muestras de los depósitos de avalancha de la erupción del 19 de febrero de 1975. que dieron resultados de 3. 9 S. G. Creation Research Society Quarterly. 8 J. en R.8 También tenemos rocas volcánicas proceden­ tes de erupciones históricas de las Azores. 145-198. F. Tristan da Cunha y el Vesubio.9 Por último. 10 A. de solamente cientos de años de antigüedad. EVOLUCIÓN I y que según las dataciones radiométricas se remontarían a cientos de millones de años. 7 (1970). realizado a finales de los años 90. pp. (Pittsburgh. de 3. Proceedings o f the Fifth International Conference on Creationism.908 ± 390 millones. pp. Savage. U n ejemplo son los flujos de lava en Hawai. Curtís y G. y la de plomo-plomo. D. 2003). and the Implicatíons for Radioisotopic Dating”. Radiogenic Isotope Geology (Cambridge. Ngauruhoe.340 millones de años. E. Sm-Nd. podemos citar un cuidadoso estudio de datación radiométrica de los flujos de lava de las erupciones de 1949 y 1954 del volcán Ngauruhoe. American Journal o f Science. En línea: www. . P. Dicken. que dieron resultados de 100 a 10. 285-303. 1995). 137-141. Clementson. para su análisis isotópico por rubidio-estroncio.org/articles/ aid/v5/nl/mt-ngauruhoe-isotope. H. Parte de las muestras se enviaron al laboratorio PRISE. Snelling.500 millones de años según el método del uranio-plomo. A. la de samario-neodimio. de solo unos siglos de antigüedad. “The Relevance of Rb-Sr. P. samario-neodimio y plomo-plo­ mo. James. Evemden. ed. 262 (1964).

Bosch. Aunque esta suposición parece ra­ zonable. .phys. N° 26 (1996). N° 4. 13En línea: www. Bassett y J. 1.112 Más recientemente. Hensley.answersingenesis. 1. pp. T.104 (1973).193. e ta l. 77. esto daría la apariencia de edades más antiguas a las rocas datadas por métodos radiométricos. F. W. 5. que la mayoría de los geólogos sue­ len ignorar: si la datación radiométrica no refleja el momento real en que los materiales se depositaron en la columna geológica. R.165 12F. a temperaturas extremadamente elevadas.org/ articles/tj/v 15/n2/acceleration. un artículo publicado hace unos años en la revista Science sugirió que los cambios en la presión física podían cambiar las tasas de desintegración. sus resultados tampoco pueden utilizarse para calcular las antigüedades de los materiales sedimentarios intercalados entre ellas. K. FALENCIAS DE I.13 No sabemos de qué modo las fuerzas ambientales. Otro factor crucial del que depende la validez de las dataciones radiométricas es la suposición de que las tasas de desintegración han permanecido constantes. A. de ser cierto. pp. De todas formas. “Observation of bound-state b . sí tenemos evidencias geológicas de desintegración radiactiva acelerada en algunos momentos. Physical Review Letters.II ¿cómo podemos fiarnos en absoluto de los resultados de las datacio- nes radiométricas? Estas anomalías en las dataciones se han explica­ do argumentando que los resultados no representan el momento de solidificación de la lava en la superficie. pudieron afectar las tasas de desintegración en el pasado.html#jCp. Heine. sino la edad de las fuentes de roca del manto. Informes científicos sobre las 11W. vol. los científicos han sido capaces de producir en experimentos de laboratorio tasas de desintegración radiactiva aceleradas hasta mil millones de veces.A DATACiüN RADÍOS!ÉTRICA . J. Friese.164.190-5.11 Desde los años 90.org/news202456660. mucho más antiguas. Este razonamiento tiene implicaciones muy importantes. un equipo de científicos de las universidades de Purdue y Stanford ha descubierto que la desintegración de los isótopos radiactivos fluctúa en sincronía con la rotación del núcleo del sol. “Pressure Dependence of the Radioactive Decay Constant of Beryllium-7”. Pueden encontrarse más debates y experimentos similares en: ww. u otros ti­ pos de fuerzas. vol. 181.decay of fully ionized 187Re”. Faestermann. Science. Huizenga.

en: Ibíd. J. sobre todo cuando se usan isótopos con largos períodos de semidesin- tegración.3 . apoyan también la existencia de desintegración radiactiva acelerada. Potratz. lo que a su vez desafía seria­ mente la validez de los resultados de las dataciones radiométri- cas. o aquellas que quizá fueron reescritas a fin de hacerlas coincidir con las fechas 14 D. “Radiohalos in Granites: Evidence for Accelerated Nuclear Decay”. A. Humphreys. A.16 Hay otras suposiciones metodológicas que se aplican a la data­ ción radiométrica. Radioisotopes and the Age o f the Ear- th. vol. entonces. R. W. S. .. en granitos y en rocas metamórficas. Science. 55-58. en: Ibíd.17 Esto suscita gran cantidad de cuestionamientos respecto de las fechas radiométricas que no deben de haberse publicado por no concor­ dar con la edad estándar de la columna geológica. 25-100. S. Austin. 149 (1965).. Broecker. Vardiman. 17D. y la formación rápida y relativamente reciente de determinados tipos de roca. R. Snelling y Chaffin. Y si fuera verdad que las tasas de desintegración sufrieron importantes aceleraciones en el pasado. 735-772. 15A. Baumgardner. L. la datación radiométrica no es de confianza. pp. Thurber. en Vardiman. 16L. Snelling. pp. Nuevo México. “Young Helium Diffusion Age of Zircons Supports Accelerated Nu­ clear Decay”.14 Otros estudios de comparación de radiohalos de uranio-238 y radiohalos de po- lonio. et a l.15 Estos hallazgos cuestionan el cumplim iento de la suposición de que las tasas de desintegración radiactiva han sido constantes durante miles de millones de años.. pp. ed. A. Blanchard y H. R. tales como la afirmación de algunos científicos de que si la edad radiométrica no es compatible con los datos estratigráficos. sugieren tasas de desintegración radiactiva enormemente aceleradas en el pasado reciente. 101-208. esto además implicaría que las edades reales de las rocas serían m ucho m eno­ res que las estimadas por medio de datación radiometrica. pp. “Uranium-series Ages of Pacific Atoll Coral”. . L. E V O L U C I Ó N t f . “Summary of evidence for a Young Earth from the RATE Project”. r ' r e ­ tasas de acumulación y de difusión de helio procedente de desin­ tegración radiactiva en rocas graníticas del Precámbrico en Fenton Hill.

21 O tra suposición metodológica que podría provocar un sesgo e influir en los resultados de las dataciones está relacionada con 18 F. hay un depósito volcánico llamado KBS Tuff. W. “FissionTrackAge of the KBS Tuff and Associated Homi- nid Remains in Northern Kenya”. 213-215. C. McDougall. Fitch. 20 G. E. H. N° 5. Nature. de aproximadamente 2 millones de años.20 Durante los siguientes cinco años. R. y originalmente fue datado con una antigüedad de entre 212 y 230 millones de años. el depósito fue redatado por los mismos investigadores empleando distintas muestras. y los estratos fueron. Watkins y J. pp. Gleadow. Drake. Keyna”. redatados por investigadores de la Universidad Australiana.. R Sutherland-Hawkes y A. 230.previamente consensuadas para la historia evolutiva del planeta. H. I. pp. Kenya”. en Berkeley.9 millones de años.19 Estratos similares a los hallados debajo del KBS se habían encontrado también en el río Orno. en un estudio pos­ terior realizado por investigadores de la Universidad de Califor­ nia. vol. pp. 211. en un estrato que contenía también herramientas primitivas y había sido datado en unos 2. vol. R. vol. en Kenia. se volvieron a datar los estratos del KBS Tuff y el resultado fue una nueva edad. valores compatibles con la edad estándar de los mamíferos fósiles encontrados.A. una vez más.89 millones de años. J. y se obtuvo una nueva edad de 2. según la escala de tiempo evolutiva. Gleadow. ibíd. vol. Nature. 226-228. East Rudolf. R. Ver también: A. 258 (4 de diciembre de 1975). E. 225-230.87 y 1. W. J. así que.61 millones de años. se realizaron estudios adicionales de da- tación radiométrica. No obstante. Curtís.J. “K-Ar Age Estímate for the KBS Tuff. 251 (20 de septiembre de 1974). que es rico en fósiles. . Nature.18 El famoso antropólogo Dr. p. de 1. East Turkana. Cerling y J.242 (18 de abril de 1970). Miller. “Dating of the Rock Succession Containing Fossil Hominids at East Rudolf. pp. “Age of KBS Tuff in Koobi Fora Formation. Por ejemplo. J. y se habían datado con una edad inferior.6 millones de años. T. Estos reportaron edades de 1. 284 (20 de marzo de 1980). Nature. en Etiopía. 226. Fitch y J. como esta edad no se ajustaba al registro fósil presente. A. “Radioisotopic Age Determinations of Lake Rudolf Artefact Site”. Kenya”. 395-398. 19 F. Richard Leakey descubrió un cráneo similar al de un ser hum ano moderno debajo del KBS Tuff. T. Miller. Hampel. Maier. Findlater.

Kulp.22 Esto implica suponer de antem ano la edad de la roca que se está intentando datar. no suelen ser analizados con carbono 14. 11. J. McGraw-Hill Encyclopedia o f Science and Technology. por lo tanto. pues es­ tos ni siquiera se encuentran dentro del rango de medición. que son esencialmente carbono en formas diferentes. siendo el carbono el elemento principal del esqueleto de las cade­ nas de dichas moléculas. cuando algunos científicos poco ortodoxos decidieron no seguir esta recomendación y dataron materiales con base de carbono. cuyo período de semidesintegración es de tan solo 5. se 22 J. Las plantas toman su carbono del dióxido de carbono del aire. Kulp. Antes de comentar algunos casos. “Rock (Age Determination)”. básicamen­ te. e impide la obtención de resultados m uy dispares a lo esperado. 591-594. supuestamente m uy antiguos. La mayoría del carbono que integra a los seres vivos es carbono 12.la recomendación del Dr. para rocas antiguas. obtuvieron resultados sorprendentes. de que el elemento radiactivo escogido para realizar una datación debe tener un período de semidesintegración del mismo orden de m agnitud que el lapso a medir. . tienen antigüedades de cientos de millones de años y. hidrógeno. Kulp sugirió que. L. debían escogerse los isótopos con períodos de semidesintegración de cientos de millones de años. Como producto de desecho de este proceso. A pesar de esto. por medio de la fotosíntesis. Un ejemplo práctico son las dataciones de carbón o de diamantes. Los seres vi­ vos están conformados por moléculas orgánicas que. con el m étodo del carbono 14.730 años. Este elemento se incorpora a la materia viva desde la atmósfera. y lo utilizan para fabricar moléculas orgánicas que se acumulan en la planta y la hacen crecer. porque se asume que están fuera de su alcance. pp. oxígeno y nitrógeno. lo que predispone a los investigadores hacia un tipo determinado de resultado. son compuestos de carbono. Se asume que estos materiales. profesor de Geoquímica en la Universidad de Columbia. t. L. veamos de qué m anera fun­ cionan las dataciones con carbono 14: La vida en la Tierra está basada sobre el carbono.

por lo que puede formar moléculas de dióxido de carbono. Sin embargo. Si se analiza una muestra orgánica. la cantidad de carbono 14 restante sería nula. No obstante. mientras están vivos. Uno de los problemas relacionados con la datación con car­ bono 14 es que se asume que el contenido de carbono 14 en la atmósfera ha sido constante con el tiempo. Aproximadamente. La diferencia principal entre el carbono 12 y el 14 es que este último es radiactivo. esta técnica de datación no sería válida dado que. con posterioridad. la cantidad de carbono 14 que queda en su interior nos permitirá calcular la fecha de la muerte del ser vivo del que procede la mues­ tra. es la misma que en la atmósfera.solo quedará la mitad. la proporción de carbono 14 en plantas y en animales. dejan de incorporar el carbono 14 de la atmósfera y el nivel disminuye lentamente. En la parte superior. Como la producción de carbono 14 en las capas altas de la atmós­ fera es más o menos constante. enton­ ces. algunos de los átomos de nitrógeno se convierten en carbono 14 cuando son golpeados por neutrones procedentes de rayos cósmicos. ser incorporado por las plantas en la fotosíntesis y. Eso significa que después de 5. Además de oxígeno y dióxido de carbono. la atmósfera terrestre contiene una gran cantidad de nitrógeno. uno de cada un billón de átomos de carbono de la atmósfera es carbono 14. o tan pequeña que resultaría indetectable. El carbo­ no 14 tiene propiedades m uy similares al carbono 12.produce oxígeno. Los rayos cósmicos están formados por protones de alta energía que . si la antigüedad de la muestra fuera m uy grande. esta suposición requiere que el flujo de rayos cósmicos que llega a la Tierra haya sido constante durante millones de años.730 años -la vida media del carbono 14 . y las plantas no distinguen los dos tipos de carbono. cuando los seres vivos mueren. Ya hemos comentado que el carbono 14 se forma a causa de los rayos cósmicos. según la fórmula de desintegración descrita con anterioridad. que las plantas liberan a la atmósfera. pasar a los animales por medio de la cadena alimenticia. Los átomos de carbono 14 desin­ tegrarán con el tiempo y se convertirán de nuevo en nitrógeno. del orden de millones de años. después de tantas “vidas medias” transcurridas.

200 y 44. en: Vardiman. su impacto en la atmósfera está afectado por el campo magnético de la Tierra. Giem publicó una evaluación de los resultados de datación con carbono 14 de unas 70 mediciones AMS de fósiles. de la misma mane­ ra que podría haber cambiado el campo magnético de la Tierra. por ejemplo.23 Si la acti­ vidad de los rayos cósmicos hubiese sido inferior en el pasado. que el m omento magnético dipolar de la Tierra se ha reducido en un 6. Solar Physics. el Dr. La intensidad de los rayos cósmicos provenientes del espacio exterior podría haber cambiado considerablemente en el pasado.700 ± 950 años. sino también determinaron edades recientes para ellas. Snelling las envió a un laboratorio comercial que usaba tecnología AMS. Bobik. Radioisotopes and the Age o f the Earth. Según su posición en los estratos de roca.tienen carga positiva. 24 J. Snelling y Chaffin. Kudela y P.5 % desde el año 1900. 423-431. pp. R. p. Los resultados no solo confirmaron la presencia de carbono 14 en las muestras. cuando estuvieron disponibles las técnicas de espectrometría de masas con aceleradores (Accelerator Mass Spectrometer. “Long-term Variations of Geomanetic Rigidity Cutoffs”.. era de entre 40 y 250 millones de años. o AMS). en muchos casos. pp. millones. 224 (2005). A finales de los años 90. 51 (2001). por lo tanto. vol. estas muestras de carbono fósil tenían más de 100. de entre 20.25 Ninguna de estas muestras debería 23 K. 6-30. según su posición en la columna geológica. Baumgardner “ 14C Evidence for a Recent Global Flood and a Young Earth”.24 El Dr. las dataciones darían edades mayores que las reales. de la Universidad de Loma Linda. reportadas entre 1984 y 2001. La medida exacta de la proporción entre los carbonos 14 y 12 fue también problemática hasta comienzos de los años 80. “Carbón-14 Content of Fossil Carbón’-. para su datación por este método. 589. Aunque en teoría estas muestras tan antiguas no deberían contener carbono 14. vol. Paul Giem.000 años y. Sabemos. es un médico de Urgencias con gran interés en la datación por carbono 14.700 ± 1. 25 Paul Giem. Origins (Geoscience Research Insti- tute). En 2001. Andrew Snelling tenía en su po­ der varias muestras de madera fosilizada cuya antigüedad. . ed.

claramente.000 años. que los fósiles no pueden ser tan antiguos como afirma la escala de tiempo geológico. En otras palabras. El hecho de que se detecte carbono 14 prueba. Estas muestras de carbón fueron analizadas cuidadosamente por medio de técnicas AMS.000 años. y procedían de depósitos asig­ nados a los períodos Eoceno. y las edades obtenidas solo variaban entre 44. que deben te­ ner menos de 300. El Dr. menos de 100. firmemente.000 y 50. El trabajo del Dr.000 y 57. Todas las muestras dieron niveles medibles de carbono 14. en muestras de carbón de entre decenas y cientos de millones de años. Giem observó que muchas mues­ tras. Esto concuerda con el modelo de creación-inundación. Diez fueron obtenidas del Banco de Muestras de Carbón del Departamento de Energía de los Estados Unidos. y en un pasado re­ ciente. Asimismo.000 años no debería quedar ni un solo átomo de carbono 14 en una muestra de un gramo de carbón fósil. a pesar de ello. a comienzos del siglo XXI. El Dr. que propone que la mayoría de los estratos que contienen fósiles se depositaron en un breve período de tiempo. daban edades similares en la datación por carbono 14. Giem fue continuado. en la Universidad Estatal de Pensilvania. si las muestras tuvieran realmente esa antigüedad. con edades asociadas de entre 40 y 300 millones de años. Giem señala que después de 300. y corregidas para los efectos de fondo estándar. Cretácico y Pensilvano en la colum­ na geológica. aun cuando procedían de períodos de tiempos geológicos m uy diferentes. ~ALt NCIAS Dt DATAC haber tenido una cantidad cuantificable de carbono 14 pero.000 . la mayoría de ellas dieron resultados de edades entre 40. los estratos portadores de carbón no pueden tener ni remotamente la edad que la columna geológica estándar les ha asignado. Las muestras eran bloques de 180 kilogramos de carbón fresco.000. por un riguroso estudio del contenido de carbono 14 en muestras de carbón procedentes de diferentes lugares de los Es­ tados Unidos. En consecuencia. no podría haber niveles detectables de carbono 14. la persistencia de carbono 14 en un número tan grande de muestras fósiles procedentes de distintas ubicaciones sugiere. extraídos de minas de carbón activas y almacenados en gas argón. y en términos de análisis prácticos.

-o. El autor del citado informe.. Baumgardner. Esta posibilidad ha sido consi­ derada.. como el uranio. la pro­ porción de carbono 14 generada por rayos cósmicos habría sido menor. John Baumgardner. como veremos a continuación. Diamantes de esa antigüedad no deberían contener nada de carbono 14 pero. pueden generar carbono 14 en la corteza terrestre. lo que explicaría la aparición de este elemento en muestras antiguas. años. si la proporción de carbono 14 respecto del 12 era m enor en el pasado.26 Estos resultados desafían seriamente las edades convencio­ nales asignadas a la columna geológica. como revelan los extensos depósitos de carbón y piedra caliza. 27 Ibíd. señala que si en el pasado existió un contenido de carbono m ucho más alto en la biosfera. por lo tanto. estas edades aun son excesivas para ajustarse al modelo de crea­ ción-diluvio siguiendo la cronología bíblica. 587-609. p. se obtienen edades de aproximadamente 5. 28 Ibíd. no justificaría ninguno de los resultados observados. pero la cantidad producida sería tan pequeña que estaría m uy por debajo del nivel detectable por AMS y.27 U n estudio complementario se llevó a cabo con diamantes cuya datación convencional se sitúa entre 1.28 26 J. pp. las da- taciones revelaron altos niveles de este elemento. N o obstante. 588. geofísico y miembro jubilado del personal técnico de la División Teórica del Labo­ ratorio Nacional Los Álamos.000 y 3.000 millo­ nes de años. € . etc.. ibíd. R.. Se ha sugerido que los neutrones térmicos generados por otros elementos ra­ diactivos. 614-616. Dr. Si en el cálculo se emplea un valor estimado inferior para el nivel de carbono 14 en el pasado. A pesar de situarse en el rango de unos pocos miles de años. lo que sí con­ cuerda con el resto de evidencias científicas e históricas en favor del diluvio universal. el torio. es posible que las edades aparezcan aumentadas..000 años para estas muestras. 170 . y no dejan tiempo sufi­ ciente para que la evolución haya podido suceder. pp.

como las narraciones del diluvio en nu­ x Ibíd. publicados en 2007 por investigadores de la Universidad de California.600 ± 500 años. El conjunto de evidencias revisadas hasta el m om ento en este libro indican. cuatro de las minas de De Beers. Los resultados de la datación dieron un promedio de edad de 55. los mismos investigadores dataron seis diamantes adicionales de Namibia. Southon. 282-287 . “Use of Natural Diamonds to Monitor 14C AMS Instrument Backgrounds”. N° 1 (junio de 2007). usando el espectrómetro de alta precisión Keck Carbón Cycle AMS. FALENCIAS DE LA DATACiON RADiOMÉTRiC Cinco diamantes procedentes de chimeneas de kimberlita. y todos contenían niveles detectables de carbono 14. biológicas. obtuvieron resultados similares. datados convencionalmente en miles de millones de años. pp. Seis fragmentos de un mismo diamante dieron resultados de entre 69. Evidencias geológicas.300 ± 500 y 70. pp. en Botsuana. Taylor y J.000 años. y se obtuvieron niveles de carbono 14 en todos ellos. y uno de Kimber- ley. más un diamante procedente de un depósito aluvial de Guinea.000 ± 1. se analizaron por el método de AMS. 30 R. Nuclear Instruments and Methods in Physics Research Section B: Beam Interactions with Materials and Atoms.30 Todos los resultados anteriores fueron estadísticamente sig­ nificativos. 609-630. como las ve­ locidades de erosión y sedimentación..100 años. claramente. con estos resultados. en Sudáfrica. Com o ya hemos comentado antes.700 años.29 Más tarde. e históricas. Estudios posteriores. deben tener menos de 100. Da­ taron varios diamantes por el método del carbono 14. y obtu­ vieron edades que se extendían desde los 64. y proporcionan evidencias sólidas de que estos dia­ mantes.900 ± 400 años hasta los 80. E. que la edad de la vida en la Tierra es m uy inferior a la propuesta por el modelo convencional y que la evolución no ha ocurrido. como los teji­ dos blandos encontrados en fósiles de dinosaurio y las tasas de mutación. 259. la historia geológica del planeta queda tan reducida que no da tiempo suficiente para la ocurrencia de una evolución tal como la propuesta por el m ode­ lo evolutivo estándar. vol.

merosas culturas. que constituyen en la actualidad la base principal del modelo de largas edades. . pueden utilizarse para cuestionar dicho modelo. si consideramos las discrepancias con otros métodos de datación y los resultados “anómalos”. Incluso los resultados de las dataciones radiométricas. son firmemente opuestas al concepto de que la Tierra. los estratos y los fósiles tienen millones de años de an­ tigüedad. como la presencia de carbono 14 en muestras en las que debería estar ausente.

por ej„ N. N° 7 (2003). pp. vol. oxígeno y carbono. Astronomy. así como muchos otros factores. hacen posible que la tem peratura permanezca dentro de un rango compatible con la vida. hacen que la Tierra sea un lugar aparen­ tem ente perfecto para la vida. La abundancia de agua. LA TEORIA DEL BIG BANG NO ESTÁ RESPALDADA PO r T Ó s I dATOS OBSERVADOS uestro planeta es un entorno realmente extraordinario.1 haciendo referencia al cuento infantil * 'Ver. “Goldilocks and the Three Planets”. Esto es lo que quieren decir los astrónomos cuando hablan de un planeta Ricitos de O ro (en inglés Goldilocksplanet). 31. 36-41. . N diferente de cualquiera en nuestro sistema solar o en nin­ gún otro lugar conocido del espacio cercano. Lubrick. y la distancia entre este y la Tierra. El tamaño del Sol.

está basada sobre el carbono. de la Universidad de Cambridge. En el universo conocido. Llegó a la conclusión de que.pdf.2 Hoyle señaló. 8-12. Los científicos han propuesto que este y otros elementos se formaron por una fusión nuclear en las estrellas.caltech. ni m uy frío ni m uy caliente.calteches. para que el carbono tuviera sus propiedades químicas únicas. para conformar los biopolímeros capaces de sustentar la vida. etc. vol. tal cual la conocemos. Engineering and Science. a partir de partículas atómicas más ligeras. si interpretamos los datos científicos con sentido común. Se ha propuesto que las primeras moléculas orgánicas aparecieron y se acumularon en ambientes determinados de la Tierra primitiva. “The Universe: Past and Present Reflections”. como el material genético. ni m uy duro ni m uy blando. las enzimas responsables del metabolismo celular y otras moléculas esenciales. edu/527/2/Hoyle. Esto permite a los átomos de carbono formar el esqueleto de m ultitud de biopolímeros que constitu­ yen las estructuras de nuestras células. como lagunas costeras o chimeneas hidroter­ 2 Fred Hoyle. estudió las reacciones necesarias para producir carbono y cal­ culó los niveles de energía de sus átomos. igualmente. . En línea: www. N° 2 (noviembre de 1981). pp. hay una cantidad relativamen­ te grande de carbono. . debe­ ríamos concluir que un intelecto súper calculador debió haber diseñado las propiedades del átomo de carbono. que aun más ridículo es suponer que los átomos de carbono pueden juntarse a través de procesos aleatorios. La vida. El famoso astrónomo Sir Fred Hoyle. Escribió que. elemento químico que tiene propiedades particulares. incluyen­ do la capacidad de establecer enlaces con hasta otros cuatro áto­ mos o cadenas de átomos. sus niveles de energía tenían que estar ajustados con tal precisión que la probabilidad de que hayan sido generados por las fuerzas ciegas de la naturaleza era minúscula. 45.‘MIus­ en el que una niña escoge entre objetos de características varia­ das según las que le resultan más convenientes: ni m uy grande ni m uy pequeño.library.

Hoyle y C. todavía resultaría improbable.llegaron a exis­ tir. . 23-33.. 4Hoyle. incluyendo algunos científicos y astrónomos. que literalmente significa “La gran explosión”. 5Ver: www. pp. Wickramasinghe. realizaremos una revisión general de lo que se conoce como la “teoría del Big Bang caliente”: Es im portante empezar señalando una falsa idea m uy exten­ dida respecto de lo que esta teoría entraña. tenemos menos probabilidades de equivocarnos si suponemos que el origen de la vida fue un acto intelectual de­ liberado. nitrógeno e hidrógeno. se suele explicar en las clases de ciencias de la mayoría de las universidades y los colegios en relación con la “teoría del Big Bang”.3 Hoyle pensaba que. ibíd. en lugar de aceptar la ínfima probabilidad de que la vida haya aparecido mediante las fuerzas ciegas de la naturaleza. 12. quien en realidad rechazaba la teoría. creen que el Big Bang describe el escenario de “algo” (científicamente referido como una “singularidad”) con propiedades extremas como den- 3F.5 La teoría del Big Bang es una construcción increíble de su­ posiciones astronómicas no demostradas. LA TEORÍA DEL BíG BAÑO males. Hoyle y su colega.physicsworld.com/cws/article/news/2615. Dent & Sons. el matemático C handra W ickramasinghe. 1981). calcularon que las probabilidades de que los átomos de carbono hayan podido unirse a fin de crear las enzimas necesarias para la form a de vida más simple -q u e deberían haber aparecido si­ m ultáneam ente en el lugar y en el m om ento apropiados. y formaron lo que se conoce como “sopa prim ordial”. p.M. oxígeno. “The Universe: Past and Present Reflections". Este nombre fue acuñado originalmente por Hoyle. junto con los demás elementos.son tan pequeñas que incluso si el universo entero estuviera forma­ do por dicha “sopa prim ordial”. A continuación. Evolutionfrom Space (London: J. que trata de dar una explicación natural a la formación del universo.4 El modo en que los elementos químicos que com ponen de la vida -carbono. Muchas personas.

crearon una teoría que explica que pa­ rece que estamos cerca del centro porque es así como se ve el uni­ verso desde cualquier punto en el que esté situado un observador 6W. (New York: Springer-Verlag.6 Esta imagen puede ser difícil de captar. 212. nunca ha sido observado o detectado. Pero. Cuando observamos el universo desde la Tierra. . como si estuviéramos cerca del centro. pues lo que propone es que. el espacio en sí mismo se expandió en un hiperespacio tetradimensional. adoptando el concepto de hiperespacio. Sin em­ bargo. 2o ed. era necesario a los fines de desarrollar una teoría en la que el universo sea esféricamente simétrico des­ de donde quiera que se lo examine. a propósito. así que. implica que el universo no tiene bordes y. General and Cosmological. tenemos una superficie bidimensio- nal que se dilata en el espacio tridimensional. Así que. 1977). A medida que esta materia/energía en expansión se enfriaba. EVOLUCIÓN sidad y calor infinitos. en el espacio que conocemos como universo. algunos cosmólogos querían una teoría en la que la Tierra no estuviera cerca del centro del universo. en una posición privilegia­ da para estudiar la estructura y la naturaleza del espacio. Este supuesto. Essential Relativity: Special. en el Big Bang. Rindler. por lo tanto. se formaron galaxias y estrellas como islas. y además se alejarán unos de otros. no tiene centro. Si dibujamos círculos pequeños en la superficie del globo. da la sensación de ser esféricamente simétrico (isotrópico) a nuestro alrededor. y es solo una suposición inventada). que apareció repentinam ente en el vacío y se expandió con rapidez en el espacio tridimensional. con un espacio tridimensional que se dilata en el hiperespacio tetradimensional (que. la teoría es en realidad aún más ingeniosa. a m edida que este se expande los círculos tam bién se expandirán. pp. llamado el “principio cosmológico” o el “principio de Copérnico”. Una observación im portante es que la superficie del globo no tiene centro. 213. usaremos como analogía la expansión de un globo que está siendo inflando. La teoría del Big Bang. En este caso.

Ellis. 134.html. Hawking y G. 8Notas de una conferencia de Astronomía en la Universidad de Tennessee (en inglés): “Problems with the Big Bang”. Por ejemplo.7 En otras palabras. la teoría del Big Bang requiere un número creciente de entidades hipotéticas que nunca han sido demostra­ das ni observadas. La 7 S. En su intento por conseguir una explicación mecanicista de nuestros orígenes. The Large Seale Structure ofSpace-Time (Cambridge.potencial. pp.8 Son invenciones no comprobadas.csepl0. 135. algunas de las cuales no pueden ser justificadas basándose sobre las leyes conocidas de la Física.utk. Sin estas presuntas —y totalm ente inventadas— condiciones. En otras palabras.edu/astrl62/lect/cosmology/ bbproblems. . 1973). como lo que la teoría predice y lo que los astrónomos observan no con­ cuerda. desconocida hasta el m om ento.phys. UK and New York: Cambridge University Press. • La energía oscura. Las más prominentes de estas son: • La teoría inflacionaria. la teoría del Big Bang no funciona. F. los teóricos desarrollan nuevos artefactos para tratar de conseguir que funcione. los cosmólogos introdujeron el concepto de “energía inflacionaria”. W. la teoría del Big Bang incluye una hipótesis construida específicamente de modo de asegurar que la Tierra no está ubicada en un lugar especial del universo. R. Se puede citar el grado de uniformidad que se observa en el universo. que no es compatible con la formulación inicial de la teoría pues el universo debería hacerse expandido demasiado rápido para desarrollar esta uniformidad. pero necesarias para dar forma a la teoría. • La materia oscura. en lugar de una sobrenatural que implique un Creador Inteligente. Ver: www. A fin de superar esta dificultad. la teoría del Big Bang contiene varias supo­ siciones forzadas adicionales. que sería respon­ sable por la separación entre sí de los objetos del universo.

9 En 2004. físicos y otros científicos han añadido sus nombres a la lista. y Thomas Gold.. . Hermann Bondi. la teoría había fracasado en ofrecer alguna predicción cuantitativa que pudiera ser validada científicamente. “Bucking the Big Bang”. La “energía oscura” es una entidad hipotética similar. han tenido lugar dos congresos titulados “Crisis en la Cosmología”.11 Desde que la carta fuera publicada en New Scientist. los cosmólogos han propuesto la existencia de un tipo hipotético de “materia oscu­ ra”. por ej. E. New Scientist (22 de mayo de 2004). ver: homepages. encontramos a Halton Arp. Sin ella. la teoría predice la ridicula situación de que el universo es miles de millones de años más joven que algunas de las estrellas de nuestra galaxia. superando incluso la velocidad de la luz. 1992). decenas de los principales astrónomos y físicos firmaron una carta.nz/~hardy/cosmo- logystatement. la teoría del Big Bang postula una pro­ porción de materia y de antimateria en el universo m uy diferen­ te de la que observamos. The Big Bang Ne###BOT_TEXT###gt;er Happened: A Startling Refutation ofthe Do- minant Theory ofthe Origin ofthe Universe (London: Vintage. en 2005 y 2008. se consigue explicar la estabilidad (isotropía) de la radiación de fondo de las microondas cósmicas. Además. y cientos de astrónomos.101Entre los astrónomos y cosmólo­ gos ilustres que firmaron la carta.xnetco. publica­ da en la revista New Scientist. 10E. 11 Para una lista completa de los suscribientes. de la Universidad Cornell. p.html. en lugar de descartar la teoría debido a la acumulación de datos en contra. en Alemania. De esta manera. 20. del Instituto Max Planck de Astrofísica. Lemer. 9Ver. mientras los cuerpos permanecen en reposo en relación con él. Así que. Lemer. de la Universidad de Cambridge. De m odo semejante. EVSLIfCSDM í MPOÍ? ■ explicación es que el espacio entre los objetos es lo que se expan­ de a gran velocidad. Estos importantes defectos de la teoría del Big Bang son cono­ cidos por los científicos desde hace décadas. que no emite suficiente radiación electromagnética para ser detectada por los medios técnicos actuales. señalando que se estaba recurrien­ do continuamente a nuevas entidades hipotéticas para llenar los huecos entre la teoría y la observación.

relacionados con 31 grupos de galaxias. . 11. “The Top 30 Problems with the Big Bang”. Pero. ‘T he Sunyaev-ZeTdovich Effect in a Sample of 31 Clusters: A Comparison Between the X-ray Predicted and WMAP Observed Cosmic Microwave Background Temperature Decrement”. Lieu. P. I. Buscaban evidencias de las sombras que deberían haber proyectado las galaxias situadas en primer plano.13 En realidad. J. pp. señala que tan solo vemos el 1% del número de galaxias que la teoría predi­ ce. pp. Sin embargo. Meta Research Bulletin. Según Kroupa. presentó cál­ culos termodinámicos rigurosos que demostraban que la supuesta “bola de fuego” inicial del Big Bang no podía haber producido el espectro de cuerpo negro casi perfecto que observamos. hiltonratdiffe. 13R. la radiación de fondo de microondas que observamos tiene más sentido y coincide mejor con los valores calculados.A TEORIA DEL BiG BANG La radiación cósmica de fondo de microondas también se cita como una de las principales evidencias de la teoría. N° 1 (2002). no se detectó ni una sola sombra relacionada con ninguno de los 31 grupos. 14T. educado en la Universidad de Oxford.14 O tro gran problema con la teoría del Big Bang es que fa­ lla totalm ente en su predicción de galaxias satélite.12 Por otro lado. en la radiación de fondo de microondas procedente de la supuesta explosión. esta es la evidencia más clara de que hay algo 12 H. “The Second Crisis in Cosmology Conference” (2008). 6-13. educado en la Universidad de Cambridge y profesor de Astronomía en la Universidad de Bonn. en Alemania. el Dr. Mittaz y Z. 176-199. por sus siglas en inglés). en la conferencia de 2008. vol. En línea: www. 648. Pavel Kroupa. D. en Huntsville. lo que es una po­ derosa evidencia de que la Gran Explosión nunca ocurrió. vol. El Dr. Van Flandern. analizaron datos procedentes de la Sonda Espacial W ilkinson para Anisotropía de Microondas (WMAP. el investigador en Termodinámica Ber- nard Bligh. Astrophysical Journal. Shuang-Nan.com/45. si se interpreta únicamente como la tem peratura del espacio calen­ tado por la luz de las estrellas. Ratcliffe. Richard Lieu y sus compañeros de trabajo de la Universidad de Alabama. N° 1 (2006).

J. es que describe un universo en expansión. 17 E. “Falsification of the Expanding Universe Model”. solo se observa un efecto de ensanchamiento. 18Ver. pp. Chown. por ej. ibíd. hasta la fecha. American Institute o f Physics Conference Proceedings. 822 (21 de marzo de 2006). pp. Robert Herrmann. pp.datarealm. en: Ibíd. Pese a esto. los datos obtenidos en las mediciones de la luminosidad superficial de las galaxias son consistentes con los cálculos de un universo que no se expande. Profesor de Matemáticas (re­ tirado). el sitio web del Dr. PhD. 15 O tro aspecto de la teoría del Big Bang.. si estuviera ocurriendo realmente. pp. se po­ dría proponer un sinnúmero de cosmologías alternativas.. 37-39.18 N o obstante.19 15 M. 16 T.com/herrmann/main. estudiando los anchos de las curvas de luz de las supernovas. pero. cuyo resultado sería dos efectos de ensanchamiento en las curvas de luz de las supernovas. . “Mystery of the Missing Mini-galaxies”. Academia Naval de los EEUU: www. Andrews. vol. el modelo de creación instantánea del universo. 60-74. 3-22. Esta expansión. De hecho.html. por ej. Van Flandem. porque son de naturaleza excesivamente técnica. New Scientist (22 de agosto de 2009). no se ha propuesto ningún m o­ delo mecanicista que se adecúe a todos los datos observados. Aunque tampoco es posible demostrar su veracidad. 6-13. existen otros serios proble­ mas con la teoría del Big Bang que no vamos a explicar aquí. que ya hemos comenta­ do anteriormente. “Evidence for a Non-Expanding Universe: Surface Brightness Data From HUDF”..users. m M m n m p ü m s í? . . absolutamente erróneo en el modelo del Big Bang como expli­ cación del origen de las galaxias que observamos en el espacio. es necesario buscar otro modelo. por lo tanto. B. concuerda bien con lo que en realidad observamos.17 Además de los nombrados aquí. pero es realmente difícil que lleguemos a demostrar lo que en verdad ocurrió. Lemer. 19 Ver. produciría fenóme­ nos de dilatación temporal. tal acumulación de problemas debería llevarnos a la conclusión de que el Big Bang no puede explicar el origen del universo y.16 Del mismo modo. con la Tierra cerca de su centro. Es cierto que algunos modelos parecen más factibles que otros.. .

encontramos evidencias abrumadoras de que ocurrió como consecuencia de la voluntad de un Dios Creador todopoderoso. W. no puede ser refutado sobre la base de la observación. I. R. las características de nuestro planeta y su posición en el Sistema Solar. no puede ser enseñada en una clase de ciencias. que es una idea filosófica no comprobable. BANü La teoría del Big Bang se enseña en escuelas. Como nos recuerda el internacionalmente renombrado astrofísico George Lilis. Scientific American. N° 4 (octubre de 1995). “Profile: George F. . institutos y univer­ sidades. no ven en absoluto problemático enseñar la teoría inflacionaria. 20 W. no hay ninguna teoría probada de cómo llegamos a existir los seres humanos y nuestro bello planeta. y gran parte de la pro­ pia cosmología trata de esconder este hecho. el “ajuste fino” del universo refuerza la afirmación. un universo simétricamente esférico. Su argumen­ to principal es que la Creación no es una teoría científica verifi- cable y que. 273. Gibbs. Y aun así. Según Lilis. Sin embargo. con la Tierra en su centro. junto con la baja probabilidad de que todo eso se combine por azar para dar lugar a un escenario “perfecto para que exista la vida”. en consecuencia.A f tQKíA DLL Bit:. Ellis”. simplemente porque es popular entre los científicos que no quieren llevar ninguna noción de Dios a las aulas. los cosmólogos están utilizando criterios filosóficos con el propósito de elegir su modelo de origen del universo. p.20 Cuando consideramos todos los conocimientos que hemos ido acumulando sobre la física y la química del universo y de la Tierra. 55. para tratar de salvar la teoría del Big Bang. del profesor Fred Hoyle: el universo y la vida son el resultado de un acto deliberado de una inteligencia infinitamente superior. vol. de hace ya déca­ das. Actualmente.

edité un libro en el que 50 científicos con docto­ rados en ciencias explicaban por qué rechazaban la evolución . CIENTIFICOS NO EVOLUCIONISTAS CIEN I incas Al JAMENTE CALDCADOS RECHAZAN LA . he presentado evidencias significativas de E que los procesos evolutivos naturales no pueden explicar el ori­ gen de la vida.PEORÍA DE LA EVOLUCIÓN n los capítulos previos. múltiples evidencias apoyan la idea de que la vida sobre la Tierra es relativamen­ te reciente. ¿por qué no hay otros científicos que lo señalen? La respuesta es que en realidad sí los hay. En 1999. Es posible que los lectores se estén preguntando: si existen tantas evidencias de que la evolución es imposible. Este capítulo es una compilación de escritos y declaraciones de numerosos científicos actuales que se atreven a hablar abiertamente de sus dudas acerca de la Teoría de la Evolución. y de que las largas edades para la vida en la Tierra no han sido demostradas científicamente. Por el contrario.

se ha publicado m ucho tra­ bajo en el campo de la ‘Investigación de la Creación. y percatarme de que hay enormes problemas 1J.. profesores y catedráticos de distintas universidades. La prim e­ ra parte de este capítulo recoge algunas de las expresiones mas destacadas de estos científicos. pero en esta sección se encuen­ tran desarrollados con más detalle o desde otra perspectiva. En estas citas.12 Algunos de los temas tratados en estos textos ya han sido comentados anteriormente. Gower. cliquear sobre el nombre del autor que se en­ cuentra a la izquierda). M i objetivo en este capítulo no es cubrir de nuevo todas las evidencias. 2Ibíd. doctor en Bioquímica y profesor emérito de Bioquímica de los Esteroides en la Universidad de Londres. sino mostrar que..1 Entre los colaboradores. se incluían científicos ilustres.creation. expresó su opinión experta sobre algunas de las “evidencias de la evolución” más des­ tacadas: “D urante las tres últimas décadas. el profesor David B. Ver: www. otros son nuevos aspectos de lo que no hemos hablado por falta de espacio. Esto me ha estimulado a criticar la Teoría Evolutiva en tres áreas que me son de particular interés: “1) Mis conocimientos químicos me han permitido compren­ der las críticas a los métodos de datación radiométrica para las muestras de roca. dentro de la com unidad cientí­ fica. evi­ dencias contundentes para rechazarla. y que son muchos los científicos expertos en diferentes campos que encuentran.com/in-six-days-preface y www. se han om itido las notas y las referencias.com/isd (para leer cada capítulo. pero están disponibles en la versión impresa de In Six Days: Why 50 Scientists Choose to Believe in Creation [En seis días: Por qué 50 científicos eligen creer en la Creación]. . creation. CIENTÍFICOS NO EVOLl. F. Ashton. en sus respectivas áreas de investigación.iCIONISTAS y se inclinaban en favor de la creación reciente de la vida en la Tierra. En el mencionado libro In Six Days. ed„ In Six Days: Why 50 Scientists Choose to Believe in Creation (Green Forest. no existe un apoyo generalizado a la Teoría de la Evolución. AR: Master Books. 2001).

pp. no han sido demostrados y. John K.3 El profesor Gower afirma que los procesos aleatorios de la evolución. G. 267. “3) Mis propios estudios sobre numerosos mecanismos bio­ químicos de control. “Dicha complejidad aparece en prácticamente todas las ramas de la ciencia. Kramer escribe: 3D. Kramer es un investigador ilustre que tra­ baja en Agriculture & Agri-Food. los azúcares. puede ser criticado de muchas maneras y en muchos niveles. y la extraordinaria complejidad. y es especialmente evidente en el campo de la naturaleza. . El Dr. ibíd. y fue uno de los científicos responsables por evaluar las propiedades toxicológicas y bioquímicas del aceite de cañóla. requiere un diseño inte­ ligente y asombrosamente brillante. me convencen de que todos estos procesos están ordenados con suma precisión. w m m a& H M Pm m M con la interpretación de los datos. 266. son completamente consecuen­ tes. Más que señalar hacia la formación por los aleatorios procesos de la evolución. Gower. con la existencia de un Creador. en Canadá. Este orden. por el que se me otorgó el título de D octor Superior en Ciencias (DSc). y algunos de los “componentes bási­ cos” esenciales para las proteínas y el ácido desoxirribonucleico (ADN) podrían formarse tan solo por la interacción de descargas eléctricas. como la regulación hormonal. en su opinión de especialista. mi opinión es que las rocas no son ni remotamente tan antiguas como se alega. especialmente en el control de la forma­ ción de hormonas esteroides. Por consiguiente. Tiene un doc­ torado en Bioquímica por la Universidad de M innesota. la idea de que los aminoácidos. la ex­ traordinaria complejidad de los mecanismos bioquímicos de control. todo esto me habla claramente de un Creador Todo­ poderoso”. supuestamente capaces de crear y modificar la vida. capaz de crear tal diseño por sí mismo.. B. en mi opinión. con una atmósfera primitiva de naturaleza reductora. “2) Desde un punto de vista bioquímico.

. ¿cómo puede aceptarse. plantas. en vez de ésteres. la investigación de los lípidos: “En las últimas décadas. no ganancia. por medio de una combinación de un gradiente de sodio más la fuerza protón-motriz. animales y el hombre. 47. Además. y siempre implican pérdida. Además. sin más. son predom inantem ente destructivos. p. muchas personas especulan sobre vínculos evolutivos entre bacterias. en niveles superiores? Las interminables compa­ raciones de secuencias de A D N no demuestran el pa­ rentesco evolutivo. porque algunos científicos creen que son las formas de vida más antiguas y más simples.4 Kramer prosigue. en vez de en las posiciones 1 y 2. . utilizando un ejemplo de su propia área de especialidad. producen su energía en forma de trifosfato de adenosina (ATP). en vez de solamente con la fuerza protón-motriz que usan las células de los mamífe­ ros. ¿No están formadas to­ das las estructuras superiores por células individuales con moléculas complejas? Si la macroevolución es im­ probable a nivel molecular. y los grupos alquilo están en las posiciones 2 y 3 del esqueleto central de glicerina. de información y de complejidad”. y aun así. CIENTÍFICOS NO EVOLUCIONISTAS “Nadie ha demostrado nunca cambios macroevo- lutivos a nivel molecular. que crecen bajo condiciones de temperatura y salinidad extremas. Kramer. los cambios (mutaciones) que observamos a nivel molecular. ibíd. como ocurre en los sistemas de los mamíferos. por ejemplo en el A D N . respecti­ vamente. se ha realizado un extenso traba­ jo sobre las bacterias termófilas y halófilas. [Para soportar las duras condiciones ambientales en las 4 John K. Los lípidos de estas bac­ terias presentan enlaces químicos llamados eteres. Estas bacterias se han clasificado como arqueobac- terias. G.

Methanobacteria thermoautotrophicum sigue siendo Methanobacteria thermoautotrophicum. de acuer­ do con su información genética: una bacteria que crece bajo condiciones de alta temperatura y salinidad”. 48. podría incluso considerarse engañoso. Habla de creencias filosóficas propias. aunque eso podría no ser la explicación completa. En realidad. La integración del gradiente electroquímico de protones y el gradiente de sodio aún no se comprende. muchos de los cuales son similares a los de las células de los mamíferos. El hecho de nom brar a estas complejas células y sus estructuras usando el prefijo ar­ queo-’ sirve para comunicar la jerarquía evolutiva. al implicar que estos lípidos y mecanismos productores de energía podrían evolucionar de manera diferente bajo condiciones ambientales distintas. Pero ¿cómo? Los enlaces éter son indudablemente más estables que los enlaces éster. necesitan estar protegidos. EVOLUCIÓN IMPOSIBLE que habitan] las frágiles estructuras y procesos bioquímicos de estas bacterias. he llegado a la conclusión de que se obtiene una mayor es­ tabilidad porque estos lípidos-éter forman complejos con iones de sodio. describir a estas bacterias como las formas de vida más simples es distorsionar totalmente su complejidad. “Por lo tanto. A partir de los resultados de mi investigación. . 49. Las arqueobacterias son tan comple­ jas como las células de los mamíferos. pero no proporciona ninguna evidencia científica.. pero no añade conocimien­ to científico. pp. aunque se sabe que este último inicia el crecimiento celular. y representan un asombroso diseño. perfectamente adecuado para las condiciones de temperatura y salinidad extremas en las que viven. Cada célula se desarrolla según la informa­ ción contenida en su AD N . ibíd. después de millones de ge­ neraciones.5 5Kramer. Las evidencias demuestran que.

Sin embargo. El Dr. y necesariamente se deduce de ello un origen com ún para todas las formas de vida? ¿Hay alguna ra­ zón por la que Dios debiera haber creado las diferentes especies. etc. géneros.. Alian. para lectores y estudiantes desinformados.. mayor el grado de semejanza.] “Presento a continuación dos aspectos que surgen de este tipo de interrogantes. y deduce que las especies. las familias. doctor en Genética por la Universi­ dad de Edimburgo. por lo tanto. pero ¿implica esto una relación genética en el sentido normal. La Teoría de la Evolu­ ción asume un origen com ún para todas las formas de vida.. intraespe- cífico. Es cierto que todos los seres vivos portan algunos genes con estructura y función similares. Este es un fenómeno básico en la ciencia genética. funcionales y de conducta. “1) El citocromo c es una pro teína. CIENTÍFICOS NO cVOLUCIONIS IOS Nótese esta im portante puntualización del Dr. La semejanza se debe al hecho de que los parientes tienen genes en común. Escocia. Funciona como una enzima clave en las reacciones . etc. Cuanto más cercana es la relación. más grande es la proporción de genes en com ún y. usa sus conocimientos expertos de Genética para cuestionar la afirmación consensuada de que la semejanza genética implica necesariamente parentesco. están genéticamente relacionados. los órdenes. los géneros. y utiliza cálculos convencionales de genética de poblaciones para refutar la supuesta evolución del ser humano: “Los parientes tienden a parecerse en sus caracte­ rísticas físicas. Kramer: dar a las bacterias un nom bre científico que insinúa que son más primitivas que otras no prueba que lo sean. producto de un gen. James S. aplicados a la supuesta evolución del hombre. el nom bre expresa el m en­ saje sutil de que se ha demostrado que se trata de las bacterias ancestrales más primitivas. de maneras totalm ente diferentes y con genes completamente distintos? [.

44. 14. Las diferencias en la identidad y la posi­ ción de los 93 aminoácidos restantes son consideradas el resultado de la sustitución por mutaciones durante el curso de la evolución. cerdo y ovejas. ¿Su­ ministra la constitución de aminoácidos del citocromo c evidencias legítimas para llegar a dicha conclusión? “El hecho de que el citocromo c tenga un número fijo de 112 aminoácidos es una señal de la importancia de la estructura tridimensional de la molécula. “Información de esta naturaleza se utiliza para cons­ truir árboles filogenéticos con la presunta relación genéti­ ca entre los organismos. y hay solo una diferencia entre el citocromo c hum ano y el del mono Rhesus (el aminoácido isoleucina en posición 66 se sustituye por treonina en este último). 35 y levadura. 13. serpiente de cascabel. y parece estar presente en prácticamente cada organismo viviente. gallina y pavo. es razonable llegar a la conclusión de que no hay ninguna restricción funcional para la sustitución de los mismos. solo 19 de los 112 son idénticos en todos los organismos eva­ luados. El número de diferencias entre el citocromo c hum ano con otras es­ pecies comunes es: vaca. 19 de los cuales aparecen exactamente en el mismo orden en todos los organismos comprobados. trigo. a la conclusión de que el hombre y el chimpancé tienen un antepasado común relativamente reciente.de oxidación. El citocromo c consta de una cadena de 112 aminoácidos. Esto se presenta como evidencia en favor de la evolución a nivel molecular y se llega. Por otro lado. caballo. 23. mosca. Podemos deducir que existe una restricción estructural sobre el número total de aminoácidos. 25. excepto en casos específicos como entre el hombre y el chim­ pancé. Dado que la identidad y la posición de los 93 aminoácidos restantes difiere entre organismos. 12. . La secuencia de aminoácidos del citocromo c hum ano es idéntica a la del chimpancé. tiburón. entre otras. 10 aminoácidos.

el coste de la sustitución de cada nuevo gen m utante. la falta de diferenciación en la constitución del citocromo c entre los seres humanos y los chimpancés es atribuible a una tasa m uy lenta (0. encuentro que hay una extraordinaria falta de evidencias sobre la ‘evolu­ ción del hom bre’. es decir. Sin embargo. esta afirmación es inaceptable.000. Mis razones son las siguientes: “[J. mientras los seres hum anos y los chimpancés evolucio­ naron por separado a partir de un antepasado com ún hasta diferenciarse en esos 5. B.3 x 10-9) de sustitución de aminoácidos en el citocromo c. en una población. el presunto núm ero de diferencias en genes mutantes entre etapas evolutivas. los seres hum anos y los chim ­ pancés difieren en muchos miles de otros genes. ¿Cómo se determina esta tasa de sustitución? Resulta que se calcula sobre la base del presunto m om ento en que las especies se bifurcaron. digamos que son 5. deriva genética y selección natural antes de la aparición del ‘hom bre m oderno’. De acuerdo con Weaver y Hedrick (1989). no hubo nin­ gún cambio en los 93 aminoácidos especificados por el gen del citocromo c. y el tam año de población necesario para complacer tal cantidad de mutaciones sucesivas. en términos de la cantidad de ‘muertes genéticas’. S. ¿Debo aceptar esta clase del razonamiento? “2) La teórica evolución del hom bre a partir de su presunto antepasado en común con el chimpancé re­ quiere millones de años de m utación. Lo que la Teoría de la Evolución afirma es que. CIENTÍFICOS NO EVOLUCIONISTAS “Aparte del gen que controla la secuencia de aminoá­ cidos del citocromo c.] Haldane llegó a la conclusión de que el núm ero de muertes genéticas necesario para asegurar "189 . En mi opi­ nión. H a­ ciendo una estimación conservadora. cuando considero las tasas de mutación. a pesar de no existir ninguna res­ tricción funcional sobre el cambio de ellos.000 genes. la afirmación se asume demostrada bajo la suposición de que es verda­ dera.

el nitrógeno (N 2). los otros 6 James S.000 genes m utantes sucesivos en una población de tam año constante. Boudreaux es profesor emérito de Q uí­ mica en la Universidad de Nueva Orleans. Alian. Esto implica unos 150 mil millones de an­ cestros del ‘hom bre m oderno’. herramientas o lo que sea. como el hidrógeno (H 2).). el tam año de la población debería estar. por supuesto. a través de selección natural. en el orden de 1 millón. Bodudreaux escribe acerca de la sorprendente especificidad de las moléculas que forman parte de los seres vivos: “El elemento oxígeno (O) existe libremente en la na­ turaleza como molécula la diatómica gaseosa O r Otros elementos representativos tam bién existen como m o­ léculas diatómicas libres. ¿Por qué hay escasez de evidencias en forma de fósiles. de la existencia de tan vasto núm ero de prehumanos parecidos al australopithecust “Puede argumentarse. llamados australopi- thecus. a m enu­ do. ancestros que. y tiene un doctorado en Química teórica otorgado por la Universidad Tulane. por lo menos. estaba en el rango de 30 veces el núm ero de individuos en una generación.. sino tam bién a la factibilidad de tales cifras de población total”. £Ví S5.ix :í6*4 s: la sustitución de un gen por otro. Sin embar­ go. el oxígeno diatómico es la única molécula de este tipo que posee dos electrones desapareados. que vagaban por la sabana africana. que este inm en­ so núm ero de individuos se distribuyó a lo largo de millones de años. pp. pero yo lo encuentro problemático no solo debido a falta de evidencias. pue­ de calcularse el coste de sustituir 5. el flúor (F2) y el cloro (CL. Usando esta cifra. . ibíd.6 El Profesor Edward A. Con una tasa media de m utación de 10-6. 128-132. son representados como pertenecientes a pequeños grupos de cazadores cavernícolas.

no hay análogos sin hierro de la hemoglobina que tengan las propiedades requeridas para transportar 0 2 en el metabolismo sanguíneo. aproximadamente un 80% más eficiente que cualquier fotocélula fabricada por el hombre. en el flujo de sangre y luego liberarlo. como el monóxido de carbono (CO) y el m onóxido de nitrógeno (N O ) pueden reemplazar al 0 2 en su unión con la hemoglobina. el 0 2 no sería capaz de unirse a los áto­ mos de hierro (Fe) de la hemoglobina. tenemos clorofila. y el átomo de hie­ rro se reemplaza por magnesio (Mg). Sin los dos electrones desapareados. Otras moléculas. Si la porfirina se traslada a otro ambiente biomolecular. Por lo tan­ to. Aunque el calcio (Ca) y algunos metales pueden reemplazar al magnesio en la clorofila. estos pro­ ductos no replican en absoluto su eficiencia fotoeléctrica. Esta singular y notable regla del par electrónico para la estabilidad de los elementos no tiene explicación conocida. un componente clave para el metabolismo vegetal y la célula fotoeléctrica más eficiente conocida. “La parte estructural de la hemoglobina que enlaza al hierro es el llamado ‘anillo de porfirina. Los aminoácidos son compuestos de carbono e hi- . el 0 2 todavía es químicamente estable. “D e forma semejante. con la cantidad precisa de energía necesaria para transportar el O . razón por la cual el azufre no existe en esta forma. CIENTÍFICOS NO EVOLUCIONISTAS tienen apareados todos sus electrones. Sin embargo. La otra única molécula con un arreglo de electrones exacta­ m ente igual al oxigeno es el azufre. hay otros metales de transi­ ción comparables al hierro que pueden reemplazarlo en la hemoglobina y unirse tam bién al O z. “Las proteínas están compuestas por moléculas de ami­ noácido químicamente enlazadas entre sí por enlaces pep- tídicos. A pesar de esto. pero destruyen totalm ente la fun­ cionalidad de la hemoglobina al hacerlo. el S2 es una molécula m uy inestable. pero el enlace resulta demasiado fuerte o demasiado débil.

que a su vez están formadas por tres componentes: una base nitrogenada. o sacáridos. -N H R o -NR.iT drógeno que contienen un grupo amino. ambas formas. D y L. pue­ den presentarse en forma de anillos cerrados.. que son compuestos de carbono-hidrógeno-oxígeno. En ausencia de un control externo. -NH. El azúcar y el grupo fosfato (-PCL) están unidos en una secuencia alterna. “Los aminoácidos existen en dos formas estructura­ les. está presente como uno de los tres componentes moleculares fundam enta­ les de las estructuras del ADN y del ARN. sola­ mente 20 forman parte de las estructuras proteicas. una molécu­ la de azúcar (ribosa o desoxirribosa) y un grupo fosfa­ to. Cada nucleótido está unido a un átomo de carbono específico de la ribosa del 19:' . los azúcares. Aunque hay miles de variedades de aminoácidos. que son reflejos especulares opuestos que no pueden superponerse entre sí. o ácido desoxirribo- nucleico. y ARN. además de un grupo ácido (-COOH) enlazado al mismo átomo de C. “Los ácidos nucleicos (ADN. que les perm iten efectuar funciones únicas y cruciales. tan solo la ribosa. De entre las m u­ chas variedades de azucares de 5 átomos de carbono que pueden formar una estructura de anillo. Los ácidos nucleicos son cadenas de unidades complejas llamadas ‘nucleótidos’. pues contie­ nen una variedad mayor de unidades moleculares. y únicamente su forma D. en cierta manera. (donde R representa uno o más compuestos de carbono-hidrógeno) enlazados a un átomo de C. más complejos que las proteínas. es decir. D y L. y producen lar­ gas cadenas enrolladas en espiral. o ácido ribonucleico) son. existien­ do tam bién formas isómeras D y L. “De manera similar. EVOLUCIÓN II-:' « 5IBI. Estos nucleótidos están unidos siguiendo patrones m uy específicos. todas las proteínas están formadas solamente por aminoácidos tipo L. aparecerán de forma natural en cantidades esencialmente iguales. sin embargo.

pp. N ingún proceso evolutivo aleatorio puede explicar tal precisión en el diseño”. ¿por qué solamente fosfato. Adenina y guanina son purinas. organi­ zados en secuencias específicas a lo largo de la cadena. CIENTÍf ICOS NO EVOLUCiONíSTAS siguiente nucleótido de la cadena. mientras que citosina. que contiene cuatro nucleótidos di­ ferentes (adenina. porque solo funciona el fosfato. y específicamente su isó­ mero D. Boudreaux. ¿Por qué solo encontramos ribosa. enrollada hacia la derecha. En el caso del ARN. Sus característi­ cas desafían la probabilidad de que ocurriera por azar. y no otros sacáridos diferentes en el A D N y el ARN? De igual modo. Tiene un doctorado en Geofísica por la Univer­ 7EdwardA. que contiene tam bién cuatro nucleótidos. La estructura del A D N consta de una doble hélice enrollada hacia la derecha.¿. Baumgardner trabajó como científico investiga­ dor en la División Teórica del Laboratorio Nacional Los Alamos. Cada ARN presenta una secuencia diferente de los cua­ tro nucleótidos. la estructura es una espiral de hebra única. durante 20 años. . ¡¿>. la ribosa es solo una de entre un gran número de moléculas llamadas ‘sacáridos’. tim ina y uracilo son pirimidinas.7 El Dr. citosina. guanina y uracilo). y no sulfato o silicato? Pues. pero solamente estas selec­ tas cinco determinan las estructuras y las funciones del A D N y del ARN. “De forma semejante. “Los nucleótidos pertenecen a dos especies de m o­ léculas llamadas purinas’ y pirimidinas’. “Estos pocos ejemplos contienen evidencias claras de un complejo diseño responsable por la elevada efi­ ciencia de funciones m uy específicas. y la tim ina reemplaza al uracilo. Hay cientos de variedades de purinas y pirimidinas. Tres de estos son iguales que en el ARN. 207-210. John R.

El núm ero máximo de billetes de lotería que una persona puede comprar corresponde al número máximo de moléculas de proteína que puede haber existido en la historia del cosmos. En su contribución al libro In Six Days. relativamente sencillo. un límite superior razona­ ble para el número de moléculas que se pudieron for­ m ar a lo largo y lo ancho del universo durante toda su historia. “Establezcamos.080 como un cálculo aproximado . hace una disertación muy convincente acerca de las propiedades lingüísticas del material gené­ tico. para demostrar que las probabilidades de la creación de proteínas funcionales por medio de procesos aleatorios son tan bajas que se pueden considerar nulas. que sugieren el origen no material de la información: “Muchos evolucionistas están persuadidos de que los 15. EVOLUCIÓN IMPOSIBLE sidad de California en Los Ángeles (UCLA). digamos. Los boletos premiados corresponden al dim inuto conjunto de tales proteínas. A continuación. una bacteria simple. pueda construirse con éxito. Baumgardner usa un cálculo matemático. un programa 3-D para modelar el manto y la litosfera de la Tierra. con las propiedades especiales correctas para que un or­ ganismo viviente.000 millones de años que se asumen como la edad del cosmos es tiempo suficiente para que interacciones aleatorias entre átomos y moléculas generen la vida. primero.. El núm ero de com ­ binaciones posibles de la lotería corresponde al número total de estructuras de proteína (de un rango de ta­ maño apropiado) que es posible ensamblar desde sus componentes básicos estándar.. “Esta lección de aritmética es similar a calcular las probabilidades de ganar la lotería. y fue el desarrollador principal de TERRA. Tomamos 1. Una sencilla lección de aritmética revela que esto no es más que una fantasía irracional. También tiene un máster en Ingeniería eléctrica por la Universidad de Princeton. y se ha especializado en simulacio­ nes numéricas complejas.

Ignoremos también el hecho de que solo aquellos con simetría izquierda (L) aparecen en las proteínas de los seres vivos.110 como un límite supe­ rior m uy generoso del núm ero total de interacciones interatómicas que pudieron haber ocurrido durante la larga historia cósmica postulada por los evolucionistas. generoso para el núm ero total de átomos en el cosmos.000 moléculas de pro­ teína necesarias para la forma de vida más primitiva. llegamos a la conclusión de que pudieron haber existido en el universo durante toda su historia no más de 10. obtenemos 10. y 1. supongamos que. de algún modo.018 segundos (cerca de 30. 1. Si a continuación suponemos que cada interacción in­ teratómica produce siempre una molécula única (supo­ sición sumamente generosa). Evidencias teóricas y experimentales . que nos dará esa última proteína especial. “Consideremos ahora las implicaciones de exigir que un proceso puramente aleatorio produzca el conjunto mínimo de aproximadamente 1.110 moléculas únicas.012 para un límite superior generoso para el número medio de interacciones interatómicas por segundo por átomo. Restrinjamos nuestra consideración al conjunto específico de 20 aminoácidos que forman parte de los sistemas vivos.000 millones de años) como un límite superior para la edad del univer­ so. ya hemos encontrado 999 de las 1.000 proteínas diferentes requeridas y necesitamos solamen­ te una secuencia mágica final de aminoácidos. en la tarea de obte­ ner una secuencia apropiada de aminoácidos que pro­ duzca una estructura proteica 3D con un grado mínimo de funcionalidad. Ignoremos también la increíblemente desfa­ vorable cinética de las reacciones químicas implicadas en la formación de cadenas peptídicas largas en cualquier tipo de ambiente químico inanimado plausible. “Concentrémonos. simplemente. Para simplificar drásticamente el problema. Entonces. y hagamos caso omiso de los cientos que no forman parte de la vida.

por supuesto. si no se puede esperar obtener. ni siquiera la estructura de una proteína sencilla como la del ejemplo. necesarias para las formas de vida más simples. jubilado del Laboratorio N a­ cional de Los Álamos. teniendo conocimiento cons­ ciente de estos datos. Para una proteína relativamente pequeña que conste de una cadena de 200 aminoácidos. Esta línea de argu­ m ento se aplica.100 (100 hipares posibles con 20 candidatos para cada sitio) o. frente la asombrosa cantidad de alternativas posibles. mucho menos se podrá obtener el conjunto completo de cerca de 1. no solo a la abiogénesis. ¡¡Esto es cien (nilones de veces el límite superior que habíamos calculado para el número total de moléculas que han po­ dido existir en la historia del cosmos!! Entonces. 10. M i intención fue escoger deliberadamente una velocidad de reacción tan gigantesca (un billón de reacciones por átomo por segundo. ¿cómo puede un científico con algún sentido de la honestidad apelar a interacciones aleatorias para explicar la complejidad que observamos en los sistemas vivientes? Hacer esto. de ningún proceso aleatorio. “Un químico colega. sj w im . objetó mi argumento dicien­ do que om ití los detalles de la cinética de la reacción química. como media) que 186 . sino también a cómo podrían surgir nuevos genes/pro- teínas por alguna suerte de proceso de macroevolución. es una irracio­ nalidad absoluta que una persona crea que las interac­ ciones químicas aleatorias pudieron alguna vez dar lugar a un conjunto viable de proteínas funcionales. “Ante tales probabilidades extremadamente desfavo­ rables. el número de intentos necesarios para obtener una probabilidad razonable de aceitar una secuencia útil es del orden de 20. como promedio. Por lo tanto. representa en mi opinión una grave falta de integridad científica. deben ser especificadas con precisión la mitad de las posiciones de los aminoá­ cidos. indican que.130 intentos. aproximadamente.000 proteínas. .

Baumgardner. el eminente cosmólogo británico. la reparación. afirmó que yo había empleado mal las reglas de la probabilidad en mi análisis. CIENTIFICOS NO EVOLUCIONISTAS cualquier consideración de ese tipo sería completamen­ te irrelevante. ibíd. “Otro científico. Le respondí que la comunidad cien tífica había sido confrontada con este ar­ gumento básico en el pasado. el funcionamiento especializado y la reproducción de cada célula viva es la materialización de algoritmos co­ dificados almacenados en su A D N . 223-226. sugirió. Fred Hoyle. imaginar que hay un modo de armar polipéptidos del orden de cientos de unidades de aminoácidos de longitud. pero que. de permitirles plegarse en sus estructuras tridimensionales y de ex­ presar sus propiedades únicas. revolucionaría el mundo científico. Esto nos conduce a una cuestión primordial: ¿de dónde surgieron las largas y complejas cadenas de información tipo lenguaje que codifican las estructuras y funciones celulares? 8John R. entrenada en Quím ica o Física. La mayoría de los científicos se colocaron las manos sobre las orejas y se negaron a escuchar”. Si mi ejemplo fuera correcto. todo dentro de una pe­ queña fracción de un picoscgundo!? Los compromisos metafíisicos anteriores lo forzaron a tal irracionalidad.. 197 . publicó cálculos similares hace dos décadas. simplemente. ¿¡Cómo puede una persona razonable. se comprometieron en una negación masiva. un físico en los Laboratorios Nacionales Sandia.8 Baumgardner continúa: “Uno de los descubrimientos más dramáticos de la Biología del siglo XX es que los seres vivos son la materialización de estructuras expresadas en lenguaje codificado. pp. Toda la detallada complejidad química y estructural asociada con el metabolismo.

dominios magnéticos ali­ neados sobre un disco flexible o patrones de voltaje en una red de transistores. en la televisión o en Internet. procesando o difundiendo datos lingüísti­ cos. un aspecto central en la cues­ tión del origen de la vida. por co­ rreo. patrones de tinta sobre papel. El significado o mensaje no depende de si se representa como ondas de sonido en el aire. PC “Este es. El mensaje de que una persona ha ganado 100. consta de tres letras del alfabeto genético de cuatro letras). El no fue capaz de identificar ningún medio . Einstein señalaba a la naturaleza y al origen de la información simbólica como una de las cuestiones profundas acerca del m undo tal como lo co­ nocemos. por teléfono.000 millones de dólares en la lotería es el mismo ya sea que esa persona reciba la información de alguien que llama a su puerta. un vo­ cabulario. Muchos de no­ sotros pasamos la mayoría de nuestras horas de vigilia generando. “Esta conclusión se alcanza al observar que la infor­ mación lingüística. por supuesto. Rara vez reflexionamos sobre el hecho de que las estructuras del lenguaje son claras manifestaciones de una realidad inmaterial. en sí misma. y un conjunto de reglas gramaticales para transm itir o registrar el pensamiento. Estos al­ goritmos codificados de un millón de palabras de lon­ gitud ¿pueden surgir espontáneamente por medio de algún proceso natural conocido? ¿Hay algo en las leyes de la física que sugiera de qué forma pueden aparecer tales cadenas de información de modo espontáneo? La respuesta franca es simple: nuestros conocimientos de termodinámica y de teoría de la información argumen­ tan persuasivamente que ni lo hacen ni pueden hacerlo. o palabra genética. “El lenguaje implica un código simbólico. es independiente de su soporte material. Las bacterias más simples tienen genomas que constan de cerca de un millón de codones (cada codón. “De hecho.

entonces. pero con solo reflexio­ nar un m om ento llegamos a la conclusión de que. en última instancia. si tenemos en cuenta consideraciones cau­ sales. es 199 . no es irracional sospechar que una entidad capaz de crear información lingüística también sea. es simple y claramente falso. en nuestra era de la información. y con su presuposición fundamental de que no existe ninguna realidad no material. Los lingüistas se refieren a esta Actualmente. o lenguaje. nadie discute que la información lingüística es objetivamente real. ade­ más. Pero ¿cuál es la naturaleza de la mente humana? Algo tan real como la información lingüística tiene existencia independiente de la materia y la energía. CIENTÍFICOS NO EVOi. por lo tanto. Resul­ ta asombroso que esta falsedad sea tan trivial. “Las implicancias son también inmediatas cuando hablamos de evol ución. “¿Dónde se origina. La clara implicancia de este hecho es que la información simbólica. no material en su naturaleza esencial. representa una cate­ goría de realidad distinta de la materia y de la energía. transporta o transmite esa información lingüística. UCIONISTAS por el que la materia pudiera otorgar significado a los símbolos. conectamos inme­ diatamente el lenguaje que creamos y procesamos con nuestras mentes. para los manuales de operación y para los sofisticados mecanismos retroali- mentados de control de la compleja nanomaquinaria química presente incluso en el ser vivo más simple. “La conclusión inmediata de estas observaciones con respecto a la información lingüística es que el materialis­ mo -q u e durante mucho tiempo ha sido la perspectiva filosófica dominante en los círculos científicos—. La suposición evolutiva de que existe una explicación materialista para las extremada­ m ente complicadas estructuras lingüísticas que consti­ tuyen los planos de construcción. su realidad es cualitativamente diferente de la del sustrato material/energético que almacena. la información lingüís­ tica? En nuestra experiencia humana.

Cualquier cambio debería ser sintácticamente legal. el Prof. y no debe su estabilidad a la presión de la selección actuando sobre variaciones aleatorias’. modificar una estructura preexistente de lenguaje genético para producir otra con alguna novedad significa­ tiva. al menos. Esta es la evidente deficiencia de cualquier mecanismo materialis­ ta propuesto para explicar la macroevolución. Funcionan y manifiestan sus asom­ brosas capacidades? La respuesta es obvia: se requiere indiscutiblemente un Creador Inteligente. afirmó hace varios años que las modificaciones aleatorias de estructuras formales del lenguaje no logran tales haza­ ñas mágicas. como tan desesperadamente quieren creer los evolu­ cionistas? Sobre esta pregunta. “En resumidas cuentas. un especialista en Teoría de la Información y Lenguas Forma­ les del Instituto de Tecnología de Massachusetts (MIT). Pero. En mi opinión. El significado se destruirá casi con toda seguri­ dad. ¿son capaces de. EVOLUCIÓN IMPOSIBLE básicamente errónea. La vida depende de complejas estructuras de lenguaje no mate­ rial. Murray Edén. ¿cómo se expli­ ca la existencia de este lenguaje simbólico que se erige como el ingrediente crucial por el que todos los seres vivos se desarrollan. Los cam­ bios aleatorios en las letras del alfabeto genético no tie­ nen más capacidad de producir nuevas estructuras pro­ teicas útiles que la generación de cadenas aleatorias de aminoácidos discutida en la sección anterior. En sus propias palabras: ‘Ningún lenguaje formal existente en la actualidad puede tolerar cambios aleatorios en la secuencia de los símbolos que expresan sus oraciones. “Y ¿qué pasa con la macroevolución? Los procesos físi­ cos de la esfera de la materia y la energía. Los procesos materiales son completamente incapaces de crear tales estructuras o modificarlas para . que especifican detalladamente su forma y funcio­ namiento. la respuesta es: No. lo que uno podría llamar “gramaticalidad genética” tiene una explicación determinista. entonces.

¡considere cuánto más inimaginable es para el materialista la tarea de obtener los cerca de 100.. Las estructuras de lenguaje codificado son no materiales en su naturaleza y. 10En línea: www.). A su vez.com/herrmann/main. pp. al que ya hemos citado en capítulos previos. es famoso por coinventar la pistola de genes que inició la ingeniería genética.000 genes necesarios para definir la maquina­ ria celular de una bacteria es inimaginable dentro de un marco materialista. ex profesor de Matemáticas de la Academia Naval de los Estados Unidos. . hasta publicaciones de divulgación.000 genes requeridos para definir a un mamífero! “A pesar de los millones de páginas de publicaciones evolucionistas -desde artículos científicos en revistas especializadas y libros de texto. Otros exponen sus objecio­ nes a la evolución en sus páginas web. y se desempeñó como profesor adjun­ to en la Universidad Cornell durante más de veinte años.. el 1)r. en Madison. En su libro Genetic Entropy and the Mys- 9Baumgardner.html. presenta algunos argumentos científicos m uy detallados contra la evolución y en favor de una creación reciente. Si la tarea de crear los cer­ ca de 1. determinar nuevas funciones. requieren una explicación no material”. tiene un doctorado en Genética Vegetal de la Universidad de Wisconsin. (En seis días..datareata. por lo tanto..'’ Esta es solamente una pequeña muestra de los escritos de algunos de los científicos que participaron como autores en el libro In Six D ays.que asumen que los procesos materiales son completamente capaces de lograr el milagro de la macroevolución.910 Algunos científicos se han tom ado incluso el tiempo para escribir libros enteros sobre las evidencias científicas que refutan la evolución: • John Sanford. Es una completa fantasía. no hay ninguna base racional para tal creencia.. Por ejemplo.uscrs. Robert H errm ann. 227-230. ibíd.

13 D. i IMPOSIBLE tery o fth e Genome [La entropía genética y el misterio del ge- noma]. 2008). Esta obra muestra de qué modo el registro fósil no apoya la Teoría de la Evolución. Gish. en Berkcley. y refuta así la premisa de que las diferentes formas de vida son. En sus libros Evolution: The Fossils Say No! [Evolución: ¡Los fósiles dicen: No!] y Evolution: The Challenge o fth e Fossil Record [Evolución: El desafío del registro fósil]. Cañada: Ama- zing Discoveries. Veith.11 • Walter J. Evolution: The Challenge ofthe Fossil Record (El Cajón. doctor en Zoología por la Universidad de Cape Town y ex jefe del Departamento de Zoología en la Universidad de Western Cape. 2002). BC. escribió el libro The Génesis Conflict: Putting the Pieces Together [El conflicto del Génesis: Juntando las piezas]. Gish. T. Veith.112 • Duane T. Gish. argumenta que la falta de intermediarios evolutivos supone una evidencia feha­ ciente de que la evolución no ha ocurrido.13 • George Javor es profesor de Bioquímica en la Escuela de Me­ dicina de la Universidad de Loma Linda y tiene un doctorado 11 J. Evolution: The Fossils Say No! (San Diego. Sanford. el Dr. 1976). y D. The Génesis Conflict: Putting the Pieces Together (Delta. y recoge numerosos descubrimientos modernos en Biología y Zoología que respaldan la Creación. . doctor en Bioquímica por la Universidad de California.000 años. 1986). C. NY: FMS Pu- blications. Proporcio­ na poderosas evidencias teóricas de que los genomas no pueden evolucionar ascendiendo en el árbol evolutivo. 12W. como la Teoría de la Evolución requiere. Genetic Entropy & the Mystery ofthe Genome (Waterloo. trabajó durante años en investigación bioquímica médica en las Universidades de California y de Cornell. T. resultado de mutaciones y selección natural. Sanford argumenta que el A D N debe tener menos de 100. sino que arruinan consistentemente la información genética. J. CA: Crea- tion-Life Publishers. Basándose sobre rigurosos estudios científicos y modelos matemáticos. Sanford argumenta que las mutaciones no crean información. simplemente. Sudáfrica. CA: Creation-Life Publishers.

and the Flood [El pasado catastrófico de la Tierra. Esta obra incluye referencias exhaustivas y recoge evidencias 14G. 1994). Creation. 15 Colín W. Javor. MD: Review and Herald Publishing Association. El Dr.14 • Colín W. The Case fo r Creationism (Alma Park. doctor en Geología por la Universidad do Sídney y ya conocido por los lectores.100 páginas en dos volúmenes. 273 .S NO J. Geology. ha escrito recientemente una obra de 1. í! CONISTAS en Bioquímica por la Universidad de Columbia. Grantham. Spetner recibió su doctorado en Física en el prestigio­ so Instituto de Tecnología de Massachusetts (MIT). 1997 ). y enseñó Teoría de la Información y la Comunicación en la l Jniversitlad Johns Hopkins durante diez años. O tN !'íl 'K . Mitchell tiene un doctorado en Geografía por la Uni­ versidad de Cambridge.1516 • Lee M. En su libro The Casefo r Creationism [Argumentos para el crea­ cionismo]. En esta obra. Escribió el libro Evidences fo r Creation: N atural Mysteries Evolution Can- not Explain [Evidencias para la creación: Misterios naturales que la evolución no puede explicar]. la evolución es imposible.1'1 • Andrew A. el Dr. la geología y la datación radiométrica que refutan la evolución. titulada Earth’s Catastrophic Past. desde una perspectiva bioquímica. Creación y el d+iluvio]. y ejerció como consultor especialista en el desarrollo de tierras áridas para los gobiernos de 16 países. Spetner. Spetner escribió No! by Chance: Shattering the Modern Iheory <j Erolitlion |N<> por casualidad: Demoliendo la teoría moderna de la evolución]. 2005). donde expone evidencias que refutan poderosamente el con­ cepto evolutivo de que las mutaciones aleatorias pueden pro­ ducir nueva información genética. 16Lee M. England: Autumn House. Snelling. Not By Chance: Shattering the Modern Theory o f Evolution (New York: Judaica Press. Mitchell. Geología. Javor explica cómo. Evidences fo r Creation: Natural Mysteries Evolution Cannot Explain (Hagers- town. la paleontología. examina concienzudamente las evidencias científi­ cas procedentes de la biología.

2009). Roth escribió un libro titulado Origins: Linking Science and Scripture [Orígenes: Relacionando las ciencias y las Escrituras]. Roth. Snelling. El Dr. que también ha sido citado en varias oportunida­ des en capítulos anteriores. y desempeñó durante años el puesto de jefe de departamento y profesor de Biología en la Universidad de Loma Linda. Vols. sino que requiere un Creador inteligente. y fue profesor de Termodinámica y Teoría de la Combustión en la Universidad de Leeds. In the Beginning Was Information (Oreen Forest. 1. A. También incluye una explicación detalla­ da de los principales problemas relacionados con la datación radiométrica.18 • Werner Gitt. que proporciona un resumen exhaustivo de las evidencias científicas que respaldan una creación reciente y un diluvio universal. Creation & the Flood. en California. AR: Master Books. TX: Institute for Creation Research. doctor en Ingeniería por la Universidad Técnica de Aachen y director del Instituto Federal Alemán de Física durante años. MD: Review and He- rald Publishing Association. En su libro In the Beginning Was Information [En el principio fue la información]. Earth’s Catastrophic Past: Geology. Presenta poderosos argumentos que explican por qué razón la información biológica codificada en moléculas como el ADN no puede surgir por procesos alea­ torios. Origins: Linking Science and Scripture (Hagerstown.17 • Ariel A. Roth. 1998). es una autoridad en Teoría de la Información. y presenta evidencias obtenidas por métodos de datación alternativos que dan resultados de solo miles de años de antigüedad para los materiales de la Tierra. H a participado en proyectos de diseño de reactores para aeronaves. en oposición a la evolución.19 • Andy M clntosh tiene un doctorado en Matemáticas por la Uni­ versidad de Gales. 2006). A. . tiene un doctorado en Zoología de la Universidad de Michigan. y ha aplicado estos conocimientos para analizar la complejidad del vuelo de 17A. 0» geológicas detalladas de eventos catastróficos recientes de tipo inundación global. Gitt discute cómo la Teoría de la In­ formación refuta la evolución. 2 (Dallas. 18A. el Dr. 19Werner Gitt.

Esto implica que la información genética requerida para codificar estructuras complejas como las proteínas requiere que dicha información provenga de una fuen­ te externa. el Dr. Hartnett.21 Este trabajo de investigación proporciona un poderoso apoyo al concepto de un Diseñador súper inteligente externo. 2005). “Information and Entropy . • John Hartnett posee un doctorado en f ísica por la Universidad de Australia Occidental. Hartnett. I lartnett ha escrito un libro que ofrece una explicación científica detallada de la paradoja de la luz de las estrellas y el tiempo en un universo joven. responsable por la compleja información contenida en cada lipo de ser vivo. . 351-385. and the New Physics (Eight Mile Plains. N“ 4 (2009). 21 Mclntosh. 23 A. 2007). donde trabaja actualmente como profe­ sor investigador de física. en el que demuestra que las estructuras biológicas contienen instrucciones codificadas que no están definidas por la materia y la energía de las moléculas que portan esta información. Génesis fo r Today: Showing the Relevance o fthe Creation/Evolution Debate to Today’s Society (Epsom.20 En 2009. y argumenta que existen evidencias científicas muy poderosas a favor de la Crea­ ción y del diluvio universal. C.23 “ A. Starlight. Mclntosh. vol. Mclntosh presenta evidencias funda­ mentales de orden y diseño en nuestro mundo. International Journal ofDesign & Nature atul Ecodynamics. 1997). 4. Mclntosh publicó un innovador trabajo de investigación en la revista International Journal ofDesign & Nature and Ecodynamics. el Dr. u c io n is t a s los organismos vivos.22 También ha coescrito un libro que expone defectos y problemas importantes de la teoría del Big Bang. England: Day One Publications. y no pue­ de surgir como resultado de una entrada de energía aleatoria. La información tiene una naturaleza no material. El 1)r. 22 J. pp. Surrey. También es experto en el mecanismo de defensa del escarabajo bombardero. c e n t í f i c o s n o e v o i. Queensland: Crea- tion Book Publishers. AR: Master Books. y no puede surgir de fuerzas ambientales de la natura­ leza. Dismantling the Big Bang (Creen Forest. Time.Top-Down or Bottom-Up Development in Living Systems?”. En su libro Génesisfor Today [Génesis para hoy]. Williams y J.

M atti Leisola. Faulkner escribió el libro Universe by Design [El universo por diseño]. 2004). Smalley. astrónomo diplomado por la Universidad de Indiana.aspx.26 Podría continuar alargando la lista. R.creation.tuskegee. y laureado con el Premio Nobel de Q uím ica en 1996.com. el Dr. . es profesor de Astronomía y Física en la Universi­ dad de Carolina del Sur. El Dr. simplemente. Richard E. Stuart Burgess. El Dr. y la necesidad de buscar modelos alternativos. 24 Para más detalles y entrevistas con muchos otros científicos. ya que mi intención es. Larry Thacte. investigador de Biología Celular en la Uni­ versidad Noroccidental de Chicago. en Nueva Zelanda. AR: Master Books. pero no creo que sea nece­ sario.2425 El rechazo a la evolución por parte de un creciente sector de la com unidad científica no se aprecia solamente en pági­ nas web y publicaciones. Sus razones están basadas sobre los resultados 24 D.edu/Articles/scholarship_convocation_speaker_challen- ges_scholars_to_serve_the_greater_good. decano de la Facultad de Ciencias Químicas y de los Materiales de la Universidad de Alto. ver: www. el Dr. M uchos científicos están exponiendo públicam ente sus opiniones sobre la incapacidad de la evolu­ ción para explicar la complejidad de la vida. demostrar que son muchos los científicos competentes y altamente calificados que han declarado públicamente y en detalle su rechazo de la Teoría de la Evolución. David King. EV0LUC90 IPOSiBLi • Danny R. confe­ renciante superior en la Escuela de Medicina en la Universidad de Otago. Universe by Design (Green Forest. El Dr. y el Dr. Faulkner. En línea: www. ex astrónomo del gobierno de Nueva Gales del Sur.23 Otros investigadores han explicado sus razones para rechazar la Teoría de la Evolución en entrevistas personales: por ejemplo. profesor de Diseño en Ingeniería en la Universidad de Bristol. expresaba su rechazo a la evolución y su respaldo a la narración del Génesis en sus conferencias públicas. Finlandia. 25 “Scholarship Convocation Speaker Challenges Scholars to Serve the Greater Good” (2004). el Dr. Faulkner. en Lancaster. Ross Pettigrew. doctor en Q uím ica por la Universidad de Princeton. que argu­ menta a favor de un universo creado.

2a cd. En 2009. el Dr. CIENTIF COS NO EVOLUCIONISTAS de sus propias investigaciones o en hallazgos reportados en la literatura científica. En 1999. Sin embargo. que recibió amplia promoción en librerías. Second Edition” [Ciencia y creacionismo: Una visión de la Academia Nacional de Ciencias. y las mutaciones y la selección na­ tural no tienen capacidad para producir nuevas formas de vida. 1999). han llegado a la conclusión. no se debaten en las aulas de ciencia. No se plantean que algunas de las suposiciones en las que se apoya todo su campo de investigación podrían ser erróneas. generalmente. La vida no pudo aparecer espontánea­ m ente por procesos naturales. Después de examinar concienzudamente las supues­ tas evidencias de la evolución. de que las evidencias científi­ cas no respaldan la teoría. Profesores y conferenciantes confían en las afirmaciones de los libros de texto. la mayoría de los que apoyan la visión convencional no son conscientes de la existencia de las obras men­ cionadas en este capítulo porque. acostumbrados a evaluar objetivamente los datos científicos. Hemos mencionado numerosos científicos ilustres que rechazan la evolución. desde m uy distintos campos de estudio.27 En la página 28.nap. Richard Dawkins es­ cribió el libro The Greatest Show on Earth: The Evidence fo r Evo- lution [El espectáculo más grande del mundo: Evidencias de la evolución]. se trata de expertos in­ vestigadores. sin ser conscientes de la gran cantidad de evidencias científicas que refutan la evolución. 2o edición] . Esta aseveración es falsa. Ver: www. (Was­ hington. DC: National Academy Press.html. y muchas 27 Science and Creationism: A View from the National Academy o f Sciences. la declaración afirma que el consenso científico sobre la evolución es abrumador y que ningún científico prominente la rechaza. 2 07 .edu/catalog/6024. ni se promocionan en los medios de comuni­ cación. En todos los casos. La mayoría de los científicos que adhieren a la evolución trabajan en campos de investigación muy especializados y basan sus investigaciones sobre los resultados de investigaciones previas. la Academia Nacional de Ciencias de los Estados Uni­ dos publicó una declaración titulada “Science and Creationism: A View from the National Academy of Sciences.

EVOLUCIÓN IMPOSIBLE revisiones y críticas en todo tipo de publicaciones. 2010). y exhaustivamente referenciada.2*28 Sin embar­ go. no sean conscientes de que en 2010 el doctor Jonathan Sarfati. MD: Adler & Adler.29 Es necesario que la comunidad científica y la población en general sean informadas de las graves deficiencias que presenta la Teoría de la Evolución. químico y experto en lógica. 29 J. probablemente. de la mayoría de las evidencias de la evolución de Dawkins. la evolución es una teoría en crisis. publicó una refutación poderosa. Sarfati. la mayoría de los científicos y los profesores. The Greatest Hoax on Earth? Refiiting Dawkins on Evolution (Atlanta. Com o señaló hace 25 años el biólogo molecular Michael D entón. 30 M. 1986) 208 . The Greatest Show on Earth: The Evidence fo r Evolution (London: Bantam Press. GA: Creation Book Publishers. 2009). Evolution: A Theory in Crisis (Bethesda. 2SRichard Dawkins. Dentón.

2 Herbert Butterfield. N° 2 (noviembre de 1981). pp. hizo una observación similar. Christianity and History (London: Fontana Books. la química y la biología su­ gerían que un “superintelecto” ha intervenido en la naturaleza. . 143. Engineering and Science. 45. sugi­ riendo que podríamos pensar que una inteligencia superior se ha estado moviendo continuamente a lo largo de toda la historia. EVIDENCIAS DE LA EXISTENCIA DE DIOS UN DIOS QUE IN I ERVIENE EN LA HISTORIA F INI Í'E FRACT IJA CON LA ESPECIE HUMANA n un capítulo anterior me referí a la afirmación del astró­ E nom o británico Sir Fred Hoyle de que abrumadoras evi­ dencias procedentes de la física. 8-12. que tra­ bajó como profesor de Historia M oderna en la Universidad de Cambridge en los años 50.1 El eminente historiador británico H erbert Butterfield. “The Universe: Past and Present Reflections”. vol.12 1Fred Hoyle. p. 1958).

Daniel. yo personalmente me decanto por la descrita en el relato bíblico. donde la especie hum ana convivió en arm onía con el resto de los animales y las plantas. que no solo diseñó y creó la vida en la Tierra. Esta narración incluye la creación reciente de un m undo perfecto. A continuación. en lugar de aceptar otras posibilidades como la panspermia (que propone que la vida llegó a nuestro planeta desde el espacio exterior) o alguna versión de evolución teísta (en la que Dios dirige la evolución) son varias. lo que confirma su veracidad. he decidido presentar algunas evidencias que. como he intentado demostrar. Las razones por las que creo literalmente en la historia bíbli­ ca. que destruyó la vida y transformó drásticamente la superficie de la Tierra. Ya hemos comentado anteriorm ente que existe m ultitud de datos históricos extra bíblicos que concucrdan con las narracio­ nes del Génesis. Sin embargo. es necesario buscar otro modelo para el origen del universo. la evolución es imposible. muerte y lucha por la super­ vivencia. Algunos lectores se estarán preguntando qué hace este tipo de material en un libro cuyo tema principal son las evidencias científicas en contra de la evolución. y por lo tanto falsa. De entre todas las posibles alternativas. y tam bién un diluvio universal posterior. la Tierra y la vida. apoyan la existencia de una inteligencia so­ brenatural. vamos a comentar dos historias que encontramos en otro libro de la Biblia. EVOLUCIÓN IMPOSIBLE En este capítulo. Algunas son de carácter personal y filosófico: mi visión de Dios como un ser personal que ama y se preocupa por sus criaturas es incompatible con la idea de ese mismo Dios que forja a dichas criaturas a través de un proceso de millones de años de sufrimiento. que tam bién han sido corroboradas por 210 . La respuesta es simple: si. tal como el lector ya habrá deducido. existen razones de carácter más objetivo que refuerzan mi confianza en la historia bíblica. sino también interviene en la historia e interactúa con la especie hum a­ na. Muchos de los cientí­ ficos que he citado en capítulos anteriores también comparten esta cosmovisión. en mi opinión. y esas razones constituyen el lema de este capítulo.

Unos años después. Nabucodonosor fue un rey del antiguo Imperio Babilónico. llamado Daniel. pecho de plata. Uno de estos cautivos era un joven par­ ticularmente talentoso. Al final. una noche. para el disfru­ te de su esposa. '‘Babylon”.3 En el año 605 a. y describe la visión que recibió durante la noche. Tras este suceso. pp. pero que no podía recordar. estómago y mus­ los de bronce.'i . una de las “siete maravillas del m undo antiguo”. quien más tarde fue consejero de Nabucodonosor y funcionario superior en la corte del rey.C. a menos que pudieran revelar el sueño. del Antiguo Testamento de la Biblia cristiana. IL: Encyclopedia Britannica Inc. 1967). E. Daniel y los demás consejeros del rey fueron puestos bajo pena de muerte. una piedra “no cortada por mano de hom bre” golpeaba los pies de la estatua y la hacía caer. Daniel describe que. Cuando informó sobre el sueño al rey.. Encyclopedia Britannica (Chicago. Mallowan. posteriorm ente. Nabucodonosor derrotó a los ejércitos egipcios en la batalla de Karkemish. piernas de hierro y pies de hierro mezclado con barro. 949-951. 2. Amytis. Nabucodonosor tuvo un sue­ ño que lo atormentó. EVIDENCIAS DE LA EXISTENCIA DE DIOS evidencias históricas. y Jerusalén pasó del control egipcio al control babilónico. L. lo que la destruía 3 M. varios nobles hebreos fueron hechos prisioneros y trasladados a Babilonia. O . Daniel cuenta cómo oró al Dios que creó los cielos y la Tierra para que le revelara el sueño. El sueño es realmente asombroso. junto con otros eventos que incluyen la caída de Babilonia. que recibe el crédito de haber hecho construir los Jardines Colgantes de Babilonia. este confirmó que eso era exactamente lo que había visto. Daniel registró el sueño del rey. y las vidas de los consejeros fueron perdonadas. registrado en el capítulo 2 del libro de Daniel. Daniel vio la imagen de una gran estatua con cabeza de oro. y que ilustran las dos tesis contenidas en el título de este capítulo: que Dios interviene en la historia y que interactúa con los seres humanos. La prim era historia se refiere a un sueño de Nabucodonosor. en el libro que lleva su nom bre y que llegó a formar parte de la Biblia hebrea y.. t.

Daniel explicó al rey la interpretación de todo esto. Wiseman. Le dijo que el mismo Dios que le había revelado el sueño también le había mostrado su significado. que al final se dividiría en varios más débiles.. representados por el pecho de plata y el estóma­ go de bronce. que se estableció cuando Alejandro Magno derrotó al rey persa Darío III. t. La estatua era una ima­ gen de lo que sucedería en el futuro. Este fue seguido por el imperio griego. La cabeza de oro represen­ taba a Nabucodonosor y su reino. Así. EVOLUCIÓN !Mi 0811LE por completo. Estos tratarían de unirse. que Babilonia cayó frente a los medo-persas cuando el general Gobrias tomó la ciudad. cuando Egipto finalmente cayó bajo su poder. la piedra crecía hasta transformarse en una m ontaña que llenaba toda la Tierra. en una batalla cerca de Arbela. el sueño tuvo lugar en el segundo año del rei­ nado de Nabucodonosor. 3. Entonces. Aun así. Las piernas de hierro simbolizaban un reino muy fuerte. por la historia. representado por el estómago y los muslos de bronce.. fue sustituido por el Imperio Romano a medida que los ejércitos de Roma conquistaban varias secciones entre los años 168 y 30 a. pero no lo lograrían. cuyo cauce pasaba por en medio de la ciudad. representados por los pies de hierro y barro. más de 2. Encyclopedia Britannica. p. La piedra que destruía la estatua y se convertía en una montaña representaba el final de la Historia.C.C.C. los hérulos derroca­ 4 D.. 212 . que sería seguido por otros de menor esplendor.C.500 años después. el 1° de octubre de 331 a. A continuación. El Imperio Griego. J.4Así. el Imperio Medo-persa correspondería al pecho de plata. des­ pués de desviar el río Eufrates. En el año 476 d. el Imperio Ro­ mano corresponde al reino representado por las piernas de hierro. Sabemos. que corresponde aproximadamente al año 603 a. Según Daniel. 458. El Imperio Romano sucumbió gradualmente a olas sucesivas de invasores bárbaros.C. “Belshazzar”. el 12 de octubre del año 539 a. predijo con exactitud asombrosa una serie de eventos que sucedieron posteriormente y que llegan hasta el presente. cuando Dios destrui­ ría los reinos terrenales y establecería un Reino eterno.

Siendo que el mismo Daniel identifica a esta inteligencia como “el Dios que creó los cielos y la Tierra”. Rómulo Augusto. EVIDENCIAS DE LA DIOS ron al último emperador romano. Este es un ejemplo sorprendente de una visión detallada del fu­ turo revelada con mucha antelación. probablemente. y durante el siguiente siglo y medio los ataques continuaron hasta que se completó el proceso de invasión. ha habido repetidos intentos de unificar las naciones de Europa con m atrimonios concertados y por medio del poder militar. No se me ocurre ningún medio por el cual Daniel por sí solo pudiera haber sabido lo que iba a ocurrir cientos de años después de su tiempo. y el éxito de los que lo hicieron fue relativamente efímero. pero que no lo conseguirían. capaz de ver y.500 años. Podemos concluir que el sueño del rey babilónico reveló con exactitud el futuro de Occi­ dente hasta la época actual. en 1800. A través de los siglos. en 1520. La fuente de tal información tiene que ser una Inteligencia supe­ rior. es un logro realmente impresionante. y la de Adolfo Hitler a la Segun­ da. que solo habría otros tres imperios en el m undo conocido. el antiguo gran imperio que fue Roma permanece dividi­ do. predecir al­ rededor del año 600 a.C. Hoy. La persecución de una ambición similar por el Káiser Guillermo II llevó a Europa a la Primera Guerra M undial. Carlomagno lo intentó en el año 800 d. y que además decidió interactuar con los seres humanos y comunicarles sus intenciones.C. Carlos V de España. a los que seguirían una serie de reinos separados que nunca llegarían a unirse totalmente. pero nunca se consiguió una auténtica unión duradera.500 años. La segunda historia también se encuentra en el libro de D a­ niel y registra detalladamente los eventos que tuvieron lugar la 213 .. exactamente como se indicó en el sueño. Muchos no consiguieron sus objetivos. y estar en lo correcto du­ rante 2. y Napoleón Bonaparte. controlar el futuro. En mi opinión. en un esfuerzo por lograr la unión. después de casi 1. parece razonable aceptar su palabra y considerar al Dios de la Biblia como una entidad real capaz de realizar grandes hazañas. Daniel predijo que los gobernantes de estos reinos menores se “mezclarían entre sí por medio de m atrim onios”.

El anciano Daniel. cuando Gobrias entró en el palacio. en el futuro inmediato. EVOLUCIÓN IMPOSIBLE noche de la caída de Babilonia. Y así ocurrió.55 U n detalle curioso es que el antiguo historiador griego Jenofonte cuenta el m odo en que el impío rey de Babilonia fue asesinado al pie de su trono. dado que en pocas horas los persas invadieron la ciudad. Hasta el siglo XIX. era el rey de Babilonia cuando el general persa Gobrias tomó la ciudad sin resistencia. Nabonidus. después de que gran parte de los sucesos de la profecía ya se hubiesen cumplido. Daniel leyó el texto. y el rey m urió asesinado. y predijo con todo detalle lo que iba a ocurrir. a partir de 1860 se descubrió un gran núm ero de textos cuneiformes que confirmaron que Belsasar. En medio de la juerga. que en ese m om ento era Belsasar. queriendo decir que no es posible escapar de las consecuencias de un determinado suceso. por lo que los eruditos dudaban de la exactitud histórica del relato. el nombre del rey Belsasar no había sido encontrado en ningún escrito. . o que el relato se escribió con posterioridad. la noche en que los persas5 5 Ibíd. fue llamado por el rey para in­ terpretar el escrito. sino de manera sobrenatural ante cientos de personas. una es­ critura sobrenatural apareció en la pared del salón de banquetes. y explicó que era una advertencia de parte de Dios de que el reinado de Belsasar termi­ naría esa noche. Y una vez más Daniel recibió información privilegiada de parte de Dios. En esta ocasión el rey. aparte del libro de D a­ niel. Jenofonte tam bién relata que. pero no menciona el nom bre del rey en toda la na­ rración. Sin embargo. en el salón de banquetes. En esta ocasión. estaba celebrando un banquete para mil de sus nobles en el palacio. Algunas personas escépticas han sugerido que las historias registradas en el libro de Daniel nunca ocurrieron. corregente con su padre. Es de este relato de donde procede la expresión “Está escrito en la pared”. Dios se manifestó no en un sueño a una per­ sona en particular. sin ver la luz de un nuevo día. esta vez. que había servido como consejero de todos los reyes desde Nabucodonosor.

Al verlos. ed„ The Complete Works o f the Learned and Authentic Jewish Historian Flavius Josephus (Lon- don: J. F. pp. abrir las puertas y salir decididamente. lisa noche. Josefo escri­ be que. La Biblia describe a Dios como un Ser atemporal. soñó que los sacerdotes debían llevar puestas sus prendas de ves­ tir sacerdotales.. Alejandro desmontó de su caballo y se inclinó ante ellos. 238. sin fecha). es­ cribe que cuando los ejércitos de Alejandro se estaban acercando a Jerusalén. historiador romano del siglo primero. para encontrarse con Alejandro. También hay evidencias de que. 8Flavius Joseplnis. los sacerdotes le m ostraron el libro de Daniel. garantizándole la conquista. 8. 21. 26-30.7 Por consiguiente. cuando Alejandro entró en la ciudad. definitivamente. 15. 7 Para detalles de otra visión del futuro registrada por Daniel. 20. cuando Alejandro Magno invadió Judá.C. ver: Daniel 8:7. r : . Las profecías que se han cumplido con extraordinaria exactitud nos dicen que la Biblia no tiene un origen plenamente hum ano. 16. se estaba celebrando una gran fiesta durante la cual toda Babilonia bebía y disfrutaba de la juerga. Así lo hicieron.6 Estos es­ critos independientes respaldan la exactitud de la descripción de los eventos registrados en el libro de Daniel. Josefo. los judíos fueron tratados muy favorablemente por Alejandro. Cuando Dios dice algo. y nos animan a confiar no solo en el Libro. Whiston. el sumo sacerdote de aquel entonces. pp.Book 11. Jaddua. en: W. oró al Dios del cielo pidiendo protección para la ciudad. Book vii. 5. sino tam ­ bién en su Autor. el libro de Daniel existía antes del año 332 a. todopoderoso y om ­ 6 Cyropaedia. EVIDENCIAS DE LA EXISTENCIA DE DIOS tom aron la ciudad.8 El libro de Daniel es otra muestra de que podemos encon­ trar información histórica fiable en las narraciones bíblicas. seguidos por el pueblo. pero también nos sugiere que la Biblia es mucho más que un libro de historia. cap. 10. que contenía la descripción de un griego que llegaría y destruiría a los persas. se cumple. Tallis. 13. Cuando se le preguntó después por qué había hecho eso. respondió que en su juventud había tenido un sueño en el que un hom bre vestido con idénticas prendas sacerdotales lo había invitado a ir a Asia. 237. ‘T he Antiquities of the Jews”.

La Biblia describe a Dios como un Ser cercano. y no interviene en la vida humana solo cuando se trata de eventos de envergadura mundial. Quiero term inar el capítulo compartiendo dos de estas historias que me llamaron poderosamente la atención. durante la noche que pasó en su interior rodeado de leones ham­ brientos un ángel lo protegió. Josué 6. que se preocupa de manera especial por cada uno de los seres humanos que habitan la Tierra. La historia completa puede leerse en el capítulo 6 del libro de Daniel. que desea tener una relación personal con cada uno de ellos. el Dios de la Biblia no se comunica solo con los reyes y los gobernantes de los grandes imperios. por ej. sin necesidad siquiera de que se lo soliciten. Muchas de estas intervenciones divinas incluyen algún elemento sobrenatural o inexplicable. en ocasiones puntuales como en el caso del diluvio o en otros m omentos (ver. y son normalmente conocidas como milagros. EVOLUCIÓN IMPOSIBLE nisciente. a veces en respuesta a una pe­ tición directa. en esta instancia reconozco que no poseo ese tipo . interviene de forma sobrenatural cambiando el curso de los acontecimientos. que tiene la historia de la hum anidad bajo su control desde el principio y que. tras ser traicionado por los otros ministros del reino a causa de su integridad. y a lo largo del tiempo he escuchado numerosos testimonios de personas que afirman haber experimentado milagros en algún m om ento de sus vidas. 2 Reyes 6. En la Biblia encontramos decenas de historias que describen cómo Dios actúa en las vidas de las personas para protegerlas y ayudarlas en situaciones difíciles. y que se describe a sí mismo como un Padre amoroso. ¿Es posi­ ble que el Dios de la Biblia siga en la actualidad interviniendo activamente en las vidas de las personas. y los animales no lo tocaron. Pero.. Dios no cambia (Malaquías 3:6). El mismo Daniel experimentó uno de estos milagros. Estos engañaron al rey Darío y consiguieron que Daniel fuera condenado a morir en el foso de los leones. Así como en el resto del libro he intentado en todo m om ento presentar evidencias científicas objetivas para reforzar mis ar­ gumentos. 7). Sin embargo. Según la Biblia. incluso de forma mi­ lagrosa? Yo personalmente creo que sí. otras.

la abuela explicó que mientras estaba lavando la ropa. Lanzó la cámara al agua y su esposo pudo m an­ tenerse a flote hasta ser rescatado por unos pescadores cercanos. dejó lo que estaba haciendo y fue corriendo hacia donde él y los otros niños estaban jugando. Más tarde. dejando el m otor encendido. invito amablemente al le c to r escéptico convencido a que deje de leer en este punto y pase directam ente al capítulo siguiente. y lo encontró intentando nadar en un mar agitado que lo había barri­ do del arrecife. quizás algo de lo que encuentren a continuación les pueda ser útil. EVIDENCIAS DE LA EXISTENCIA DE DIOS d e evidencias para esta sección. La segunda historia me la contó una buena amiga. unas pocas semanas antes de escribir este capítulo. con una cáma­ ra de rueda de tractor inflada. de pronto. Una amiga de Joy que había llegado a casa en su automóvil con su hija de cinco años. durante varios años en la década de los 90. ella corrió hasta el lugar con la rueda. los anime a p e d ir ayuda a Dios cuando se encuentren ante una situación com plicada. Zimbabue. buscó ayuda. E n mi iglesia local. Sabiendo que el abuelo había ido a pescar a un arrecife que distaba aproximadamente dos kilómetros de la casa. y estaba jugando con sus primos en el hogar de sus abuelos. explicarle lo que había ocurrido y salir en per- 2 . tuvo una visión sobre la superficie del agua de que su marido se estaba ahogando. La madre. porque los ladrones solían conducir inmediatamente a través de la frontera para venderlos en el país vecino. pero pasó cierto tiempo hasta que consiguió llamar la atención de otro conductor. Joy y su m a­ rido estuvieron trabajando en Harare. Asiendo la cámara. que trabaja como capellán en un hospital de Sídney. Un individuo que estaba escondido detrás de un seto saltó al asiento del conductor y se marchó. los robos de vehículos eran habituales en esa zona y resultaba muy difícil recuperarlos. Tenía aproximadamente seis años. salió del vehículo para abrir la puerta. Por eso. los haga replantearse el tipo de Dios en el que creen o. Joy Butler. A los demás. la abuela salió corriendo calle abajo. incluso. desesperada. En esa época. con la niña todavía en el asiento trasero. Su abuela estaba lavando ro p a pero. un hombre mayor contó una curiosa experiencia de su niñez.

o cualquiera del resto de las historias que se encuentran en la Biblia. po­ dríamos añadir los fenómenos sobrenaturales de los que hemos hablado en este capítulo y otras entidades que nos son bien co­ nocidas. ni del origen de la vida. ni de dónde salieron las leyes de la física y la química. habla sobre varias in­ tervenciones de ángeles. que ha sido confirmada por diferentes fuentes extrabíblicas. pero. El automóvil se detuvo en el acto. se trata de una decisión per­ sonal. A esta lista. ¿De dónde sale el conocimiento innato que tienen todas las personas de cualquier cultura de que . cuando vio aparecer un ángel sobre la parte delantera del automóvil. Cuando más tarde el vehículo fue revisado. En particular. las intervenciones de ángeles. Unos pocos kilómetros más adelante. que está escrito como una narración histórica factual de la iglesia cristiana temprana. La niña les contó que estaba suplicándole al ladrón que la llevara de regreso con su mamá. N o existe una explicación mecanicista del origen del universo. í : IÓN secución del secuestrador. En la Biblia. se descubrió que el embrague había fallado. el libro de los Hechos de los Apóstoles. los milagros. encontraron el automóvil parado en medio de la ca­ rretera. he presentado numerosas evidencias de que la Biblia contiene in­ formación factual fiable. con la niña sana y salva en su interior. como la conciencia. oraron a Dios pidiendo que el automóvil de la mujer se averiara. Sabiendo que era difícil que pudieran alcanzarlo por sus propios medios. también. En este y en capítulos anteriores. así como las narraciones de la Creación y el diluvio. que atravesó el capó con una espada larga y brillante. al final. que hay muchas cosas que la ciencia no puede explicar. El libro es m uy exacto en sus detalles geográficos e históricos de ese período del siglo I. lo que sugiere que los registros sobre los ángeles son igual de legítimos. ni de cómo apareció la información codificada en el AD N . Usted puede decidir creer o no en la historia de Daniel. A lo largo de este libro hemos visto. a pesar de que nunca antes había tenido problemas de embrague. tanto el Antiguo Testamento como el Nuevo Testamento registran narraciones de ángeles que intevienen en las vidas de las personas.

sino también para nuestra propia existencia. la existencia de una Inteligencia sobrena­ tural independiente del espacio y del tiempo. AH LA EXISTENCIA DE DIOS hay ciertas cosas que no son correctas? La ciencia no puede ex­ plicarlo. 219 ~~ . L 1 . ofrece una explicación llena de significado no solo para todas estas cuestiones. que se preocupa por la hum anidad en general y por cada persona en particular. un Dios “creador del cielo y de la Tierra”. Sin embargo. que interviene en la historia e interactúa personalmente con aquellos que lo buscan.

“Education Ministry Chief Scientist’s Dismissive Remarles on Fun­ damental Tenets of Science Spark Calis for His Ouster”.1 1O. Rinat. Se lo citó diciendo: “Si los libros de texto plantean explícitamente que hay que buscar los orígenes de los seres humanos en los monos. En línea: www. . Gavriel Avital. . el científico jefe del M inisterio de Edu­ E cación Israelí.com/print-edition/news/scientists-irate-after-top-educationoffi- cial-questions-evolution-1. . Haaretz (21 de febrero de 2010). me gus­ taría que los estudiantes exploraran otras opiniones.263673.haaretz.. . Dr. RESUMEN DOCE RAZONES BASADAS EN EVIDENCIAS CIENTÍFICAS PARA RECHAZAR LA EVOLUCIÓN n febrero de 2010. . Hay muchas personas que no creen que el relato evolucionista sea correcto”. . Kashti y Z. provocó furor entre los académicos universitarios locales cuando el periódico Haa- retz informó que estaba anim ando a los estudiantes a examinar de forma crítica las enseñanzas evolucionistas que les eran im ­ puestas.

mientras varios académicos expresaban indignación o consternación. 3Ibíd. Si todos los libros de texto de Biología de todos los colegios y las univer­ sidades enseñan la Teoría de la Evolución. Es asombroso que el científico responsable de un Ministerio del gobierno pueda decir cosas tan bizarras”. RESUMEN En una entrevista anterior. ¿no es completamente lógico que este funcionario del M inisterio de Educación sea despedido por atreverse a animar a los estudiantes a cuestionar esa teoría? ¿Por qué debería ser tolerada una persona con semejantes ideas 2ibíd. 3 Estas reacciones no deberían sorprendernos. Avital fuera depuesto. Cuando tu doctrina está basada sobre la Teoría ele la Evolución de Darwin y sus implica­ ciones. al decir: “La Biología. O tro profesor de la Universidad de Tel Aviv afirmó: “Estas declaraciones son el equivalente a decir que hay que darle espacio en los libros de texto a la opinión de que la Tierra es pla­ na y que el sol gira a su alrededor. . U n profesor emérito de Ciencias de la Tierra en la Universidad Hebrea dijo: “Negar la evolución es como negar la ciencia misma”. te estás sosteniendo sobre cimientos poco fiables”. Avital ya había añadido leña al fuego. y si los medios de comunica­ ción se unen en la divulgación de sus presupuestos y conclusio­ nes sin el m enor asomo de duda.2 Estas declaraciones dieron lugar a peticiones para cpie el Dr. la ciencia ele la vida y del medio ambiente. si las declaraciones oficiales de la com unidad científica afirman que la evolución es un hecho indiscutible de la ciencia. es otro campo científico problemático.

Las mutaciones no producen nueva información genética significativa.icr.datarealm.com . Uno de los propósitos de este libro ha sido presentar las evidencias que llevan a científicos honestos como el Dr. 2. en un puesto tan influyente que puede afectar la educación de los futuros científicos de un país desarrollado? Asimismo. fáctico o teórico.users. Y quiero term inar este trabajo con una recopilación de 12 razones concretas que constituyen un resumen de todo lo expuesto en los capítulos anteriores. creo que hemos presentado evi­ dencias suficientes para rechazar objetivamente la Teoría de la Evolución. Nunca se ha observado la evolución de una nueva especie como consecuencia del surgimiento de información genética nueva.org. aun a riesgo de perder su prestigio y sus puestos de trabajo. 3. 5.answersingenesis.creation. y además. perturbadoras. cabe también preguntarse por qué un científico ca­ lificado. No hay ningún mecanismo conocido. También es estadísticamente im­ posible. 4.org/csc. www.org. que explique cómo podría formarse una célula viva a partir de molé­ culas inanimadas (abiogénesis). y todos los experi­ mentos para.www . Existen más evidencias en contra de la evolución y el modelo de largas eda­ des. www.html. resulta estadísticamente imposible. EVOLUCION ¡¡r.discovery.4 N o obstante. 1.www. No hay ningún mecanismo demostrado que explique de qué modo podría aparecer nueva información genética signifi­ cativa a partir de procesos naturales aleatorios. pondría en juego su carrera haciendo declaraciones tan controvertidas y animando a los estudiantes a buscar alternativas a la evolución. 4 Ver: www.org. que se pueden encontrar explicadas con detalle en varios sitios en Internet. en un puesto de tanta responsabilidad.com/herrmann/main. Avital a enfrentarse a la comunidad científica y a rechazar la explicación convencional del origen de la vida.creationre- search. La abiogénesis nunca ha sido observada. Los datos que he presentado no son exhaustivos.iniciarla han fallado.www. .

no existen fósiles demostrados de organismos intermedios. sería impensable plantear estas objeciones con­ tra la evolución en una revista científica. Las tasas de erosión actuales son demasiado rápidas para que los continentes y su contenido fósil puedan tener las edades que se les asignan convencionalmente. Algunas de las rocas más antiguas portadoras de fósiles con­ tienen animales complejos completamente desarrollados. y nunca ocurrió! Por supuesto.000 años. Además. Simplemente. 9. 12. no un registro de la evolución de formas de vida. 8. 7. como edades muy antiguas para rocas recientes. tienen en realidad menos de 100. la presencia de carbono 14 en carbón y diamantes implica que dichos materia­ les. El registro fósil no muestra el esperado desarrollo progresivo de las novedades evolutivas. La conclusión es evidente: ¡la evolución es imposible. 10. los resultados de edades que se obtienen teniendo en cuenta los datos reales son m ucho menores que el tiempo m íni­ mo estimado necesario para la evolución biológica.000 años. tienen que haber exis­ tido millones de formas de transición entre organismos. arrojan resultados anómalos. 11. El registro fósil es un registro de extinción de animales y plantas completamente formados. RESUMEN 6. La velocidad de mutación del A D N observada en la actua­ lidad sugiere también una antigüedad de menos de 100. Las dataciones radiométricas no son fiables puesto que. como los trilobites. inten- . También en este caso. con frecuencia. Las cantidades de sedimentos oceánicos y materiales vol­ cánicos presentes en la superficie del planeta no se corresponden con las antigüedades propuestas por los geólogos. según la Teoría de la Evolución. o resultados dispares para la misma muestra datada con distintos métodos. Las estimaciones de an­ tigüedad obtenidas son demasiado cortas para que la evolución pudiera tener lugar. supuestamente de millones de años de antigüedad. Aunque. sin que se haya encontrado evidencias de sus su­ puestos antepasados evolutivos.

. a la hora de tom ar decisiones en los distintos aspectos de la vida. 74. vol. he podido escoger un modelo alternativo coherente con los datos observa­ dos. 6 Estos profesores me acusaron de utilizar argumentos basados sobre una creencia religiosa. que nadie refutó mis argumentos por medio de evidencias científicas. pp. y no sobre la ciencia. Chemistry in Austra­ lia. “Your say.3 tT tarlo generaría un escándalo y un rechazo similares a los que experimentó el Dr. . Brooks y A. íLTAL A. N° 3 (2007). vol. pero creo que ha quedado refutada con creces a lo largo de este libro. Todas las personas se ven influidas por sus convicciones filosóficas y sus creencias personales. se lim itaron a expresar su conmoción por el hecho de que un artículo de esas características pudiera ser publicado en una reputada revista científica.. y que incluye la intervención divina porque m i cosmovisión no excluye a priori dicha posibilidad. después de comprobar repetidamente que la Teoría de la Evolución no puede explicar la realidad que observo a m i alrededor. pp. La restricción mental que produce una concepción puram en­ te materialista del m undo impide a algunos científicos seguir las evidencias hacia donde estas apuntan. 6 Ver: C. 2. R. 19. 29. N° 4 (2007). un artículo que publiqué en la revista científica Chemistry in Australia. 20. 74. Muchos científicos actuales se aferran desesperadamente a la Teoría de la Evolución porque su concepción materialista del universo no les permite siquiera considerar otras opciones. pero los argumentos que he utilizado con el fin de rebatir la evolución proceden del análisis de datos científicos. Chemistry in Aus­ tralia. Avital.”. Este tipo de afirmación se esgrime con frecuen­ cia contra aquellos que rechazan la evolución. “A Creationist’s View of the Intelligent Design Debate”. Es cierto que tengo una creencia religiosa.5 Es revelador. Whittaker. 5 John Ashton. Bamer-Kowollik. obtuvo una respuesta muy hostil por parte de algunos científicos. En mi caso. que llamaba la atención sobre algunas de las suposiciones no demostradas que sostienen la Teoría de la Evolución. sin embar­ go. Lo hemos repetido hasta la saciedad a lo largo del libro: para que la evolución ocurra. De hecho.

RESUMEN

para que la rana se convierta en príncipe, una enorme cantidad
de información genética nueva tiene que aparecer como por arte
de magia. En el popular cuento de hadas, el milagro ocurre ins­
tantáneam ente en respuesta al beso de la doncella. En el cuento
de la evolución, demora m ucho más tiempo, cientos de millones
de años; pero alargar el tiempo no lo hace menos “milagroso”.
Los procesos aleatorios de la naturaleza no pueden proporcionar
el “beso” transform ador (la información genética nueva que per­
m itiría convertir un anfibio anuro en un ser hum ano de “sangre
azul”), incluso contando con eones de tiempo. Com o señala el
eminente científico y escritor Paul Davies, la información bio­
lógica no está codificada en las leyes de la química y la física,
y esta información no puede llegar a existir espontáneamente.
En sus propias palabras: “N o existe ley física conocida capaz de
crear información de la nada”.7 La evolución es, pues, una teoría
“deseo”, no m uy distinta de un cuento de hadas, pero que se alza
como única alternativa posible para los científicos que desean
m antener un modelo puram ente mecanicista de la existencia.
La evidencia geológica y paleontológica es consistente con
una inundación de gran envergadura, acompañada de actividad
volcánica y tectónica, en un pasado reciente. La ciencia no pue­
de explicar el origen de los seres vivos, pero encontramos abru­
madoras evidencias de diseño en todos los rincones de la natura­
leza, que parecen provenir de una asombrosa Superinteligencia.
El escenario de Creación-diluvio de la Biblia se adecúa m uy bien
a estas evidencias. Sin embargo, quedan en el aire dudas im por­
tantes. Algunos lectores se estarán preguntando: ¿Y qué hay de
todo el dolor y el sufrimiento que vemos a nuestro alrededor?
¿Cómo puede formar parte de la creación “perfecta” de un Dios
bueno y todopoderoso? La mayoría de nosotros lidiamos con esa
pregunta alguna vez.8 A lo largo de este libro, hemos llegado a

1 Paul Davies, “Life Forcé”, New Scientist (18 de septiembre de 1999), pp. 27-30.

8Ver, por ej., J. Paulien, “The Problem of Evil”, en: John Ashton y Michael Westacott, ed.,
The BigArgument: Does God Exist? (Oreen Forest, AR: Master Books, 2006), pp. 179-196.

EVtHUClOhlffvSfñí-5' ? -

la conclusión de que la Biblia es una fuente fiable de informa­
ción, por lo que probablemente es también un buen lugar para
buscar respuestas. En la Biblia, Dios nos cuenta que la Tierra y
el universo fueron creados en seis días literales hace aproxima­
damente 6.000 años (Génesis 1:1-2:1). El resultado era “muy
bueno”, pero poco después las cosas se torcieron y se alejaron
progresivamente del plan original de Dios. El ser hum ano uti­
lizó su libre albedrío para alejarse de su Creador (Génesis 3), y
como consecuencia, la naturaleza se corrompió y la violencia se
multiplicó sobre la Tierra. La situación de perversidad extrema
condujo a la destrucción de la hum anidad y de la mayor parte
de la vida sobre la Tierra por medio de un diluvio universal, hace
aproximadamente 4.300 años (Génesis 6:5-7:24).9 Afortunada­
mente, Dios tenía un plan de rescate preparado (Efesios 1:4-10;
1 Pedro 1:20), que se puso en marcha en el propio Jardín del
Edén (Génesis 3:15) y cuyo desarrollo se pone de manifiesto a
través de toda la Biblia.
La hum anidad fue creada a imagen de nuestro Dios Creador
súperinteligente (Génesis 1:26, 27). A pesar de la degeneración
sufrida a lo largo de miles de años, esa imagen todavía se encuen­
tra presente en nosotros. Por eso, nuestras mentes tienen la habi­
lidad de descubrir y comprender los asombrosos misterios de la
naturaleza. No evolucionamos de los monos: somos mucho más
especiales que eso. M uy lejos de nuestro presunto origen prima­
te, hemos sido dotados de capacidades asombrosas, reflejo de las
ilimitadas cualidades de nuestro Creador. Podemos usar nuestros
conocimientos y capacidades para mejorar nuestra vida y nuestro
entorno, sabiendo que nuestra existencia tiene sentido, que no
somos producto del azar sino de un cuidadoso plan de amor, cuyo
desenlace está próximo. Se trata de una existencia con trascendencia
y propósito, y la promesa de un futuro eterno sin dolor, injusticia
ni muerte. No restrinjamos nuestro acceso a estos maravillosos
dones en favor de una teoría imposible.

9 Para el cálculo de la fecha aproximada del diluvio, ver el Apéndice.

226

CALCULO DE LAS FECHAS
APROXIMADAS PARA LA
CREACIÓN Y EL DILUVIO,
EMPLEANDO DATOS DEL
REGISTRO BÍBLICO

l capítulo 5 del Génesis registra cuántos años tenía cada pa­

E triarca cuando tuvieron hijos: Adán, 130; Set, 105; Enós,
90; Cainán, 70; Mahalaleel, 65; Jared, 162; Enoc, 65; M a­
tusalén, 187; Lamec, 182.
A su vez, en el momento del diluvio Noé tenía 600 años. Su­
mando estos datos, se llega a un total de 1.656 años desde la Crea­
ción hasta el diluvio (Aclaración: estas edades pueden ser de 1 año
más para cada uno de los diez patriarcas, dependiendo de si fue­
ron padres justo antes o justo después de su fecha de cumpleaños.
Es decir, 1.656 es el número mínimo de años, y 1.666 el máximo,
estando el valor exacto en algún lugar entre ambos.)
Génesis 11:10 al 25 registra la edad a la que procrearon los pa­
triarcas posdiluvianos: Sem, 2 años después del diluvio; Arfaxad,

a los 35 años; Sala, a los 30; Heber, a los 34; Peleg, a los 30; Reu, a
los 32; Serug, a los 30; Nacor, a los 29; Taré, a los 130 (murió con
205 años, cuando Abraham tenía 75, Gén. 11:32; 12:4). Abra-
ham dejó Harán a los 75 años, e hizo un pacto con Dios (Gén.
12:4). Sumando estos años, obtenemos un total de 427 desde el
diluvio hasta el pacto de Dios con Abraham. Igual que en el cálcu­
lo anterior, el total podría aumentar hasta en diez años, por lo que
nos encontramos ante un número máximo de 437.
Las fechas aproximadas para el diluvio y la Creación se pue­
den calcular usando como referencia la fecha del cuarto año del
reinado de Salomón, que se considera que fue el año 967 a.C.
El Exodo ocurrió 479 años antes, es decir, en 1446 a.C. (1 Rey.
6:1). El pacto con Abraham tuvo lugar 430 antes del Exodo
(Exo. 12: 40-4 1; Gál. 3:16-17). Siendo que el pacto con Abra­
ham fue 427 años después del diluvio, el tiempo transcurrido
entre el diluvio y el Exodo fue de 857 años.
Por lo tanto, el diluvio ocurrió en 1.446 + 857 = 2.303 años a. C..
La Creación en 2.303 + 1 .6 5 6 = 3 .9 5 9 años a.C. (aproximadamente).

Nota 1: Según Ussher, el cuarto año del reinado de Salomón
fue en 1012 a.C., 45 años antes de la fecha actualmente asignada
a este evento. Por tanto, la fecha de Ussher para la Creación sería
4004 a.C. - 45 = 3959 a.C. Los cálculos mostrados en este apén­
dice son consistentes con los cálculos de Ussher, pero dependen de
la exactitud de la fecha histórica para el cuarto año de Salomón.
Nota 2: El margen de incertidumbre para la fecha del diluvio
sería de 10 años y, en el caso de la Creación, de 20. Es decir, el
diluvio pudo haber ocurrido hasta 10 años antes de 2303 a.C. y
la Creación hasta 20 años antes de 3959 a.C.

bio­ química. C jüüü 9 7 8 9 8 7 7 lio 1 4 4 . • Por quélasmutacionesnuncaproduceninformacióngenéticanueva. TRABAJA COMO PROFESOR ADJUNTO DE CIENCIAS BIOMÉDICAS Y CIENCIAS APLI­ CADAS EN MELBOURNE. • Por qué no pueden formarsepor azar célulasvivasy nuevas especies deorganismos. Llevando lasevidencias que refutan laevolución aun nuevo nivel. POPULAR EDITOR DE LIBROS CREACIONISTAS. en un lenguaje sencillo. JOHN F. con análisis detallados y datos procedentes de una gran variedad de fuentes. • Cómo losdatosgeológicos minan lasescalasdetiempo seculares. esteesun libro delecturaobligatoriaparaestudiantes. educa­ dores cristianos. geología. doce poderosas razones por las que laTeoría de la Evolución de Darwin es solo un mito. SOBRE ELAUTOR EL DR. científicos y todos aquellos que quieren comprome­ tersecon lacosmovisión bíblica respecto delos orígenes. datación radiométrica y otras disciplinas cien­ tíficas. John Ashton explica capítulo por capítulo. AUSTRALIA. ASHTON LLEVA CERCA DE CUARENTA AÑOS EN EL CAMPO DE LA INVESTIGACIÓN CIENTÍfiCA Y DE LA ENSEÑANZA. Aprenda: • Cómo losfósilessonevidencias deextinción. el Dr. EVOLUCION IMPOSIBLE D [i I na de las refutaciones actuales ala evolución más po- I derosay autorizada! I V v Usando recientes descubrimientos en genética. no deevolución.