You are on page 1of 12

Journal of Biotechnology 129 (2007) 421432

Embryonic stem cells remain highly pluripotent following long term


expansion as aggregates in suspension bioreactors
Nicole I. zur Nieden a,1,2 , Jaymi T. Cormier b,1,3 , Derrick E. Rancourt a,4 , Michael S. Kallos c,
a
Institute of Maternal & Child Health, University of Calgary, Calgary, Alberta, Canada T2N 4N1
b
Department of Medical Science, Faculty of Medicine, University of Calgary, Calgary, Alberta, Canada T2N 4N1
c Pharmaceutical Production Research Facility (PPRF), Schulich School of Engineering, University of Calgary, Calgary, Alberta, Canada T2N 1N4

Received 25 August 2006; received in revised form 8 December 2006; accepted 3 January 2007

Abstract
Increasing attention has been drawn towards pluripotent embryonic stem cells (ESCs) and their potential use as the primary material in various
tissue engineering applications. Successful clinical implementation of this technology would require a quality controlled reproducible culture system
for the expansion of the cells to be used in the generation of functional tissues. Recently, we showed that suspension bioreactors could be used in
the regulated large-scale expansion of highly pluripotent murine ESCs. The current study illustrates that these bioreactor protocols can be adapted
for long term culture and that murine ESC cultures remain highly undifferentiated, when serially passaged in suspension bioreactors for extended
periods. Flow cytometry analysis and gene expression profiles of several pluripotency markers, in addition to colony and embryoid body (EB)
formation tests were conducted at the start and end of the experiment and all showed that the ESC cultures remained highly undifferentiated over
extended culture time in suspension. In vivo teratoma formation and in vitro differentiation into neural, cardiomyocyte, osteoblast and chondrocyte
lineages, performed at the end of the long term culture, further supported the presence of functional and undifferentiated ESCs in the expanded
population. Overall, this system enables the controlled expansion of highly pluripotent murine ESC populations.
2007 Elsevier B.V. All rights reserved.

Keywords: Embryonic stem cells; Suspension bioreactor; Long term culture; Pluripotency; Embryoid body formation

1. Introduction As a result, our research efforts have focused on the development


of ESC culture methods in suspension bioreactor systems.
With their multi-lineage differentiation capability and capac- Recent studies by Oh et al. (2005) and Fong et al. (2005)
ity for long term self renewal, embryonic stem cells (ESCs) are presented static culture perfusion systems for murine and
an effective option as the basic material for a variety of tissue human ESC expansion, respectively. In both studies, the
regeneration applications, and therefore may offer a potential perfusion systems yielded a substantially higher cell expansion
treatment alternative for many non-curable degenerative dis- than the regular static culture flasks. Although this expansion
eases and injuries (Smith, 2001). Successful clinical implemen- method was efficient, the use of a static culture perfusion
tation of tissue engineering products generated from ESCs will system for generating clinically relevant cell numbers would
rely on the development of a quality controlled, reproducible cell only be applicable for a per-patient treatment basis. For a
culture system for the expansion and differentiation of the cells. bioprocess in which cells are generated for numerous patients,
static culture flasks are disadvantageous because many flasks
would be required; the process would be labour intensive
Corresponding author. Tel.: +1 403 220 7447; fax: +1 403 284 4852. and time consuming and would introduce culture-to-culture
E-mail addresses: nicole.zur.nieden@gmx.net (N.I. zur Nieden), variability. Alternatively, suspension culture bioreactors offer
cormierj@ucalgary.ca (J.T. Cormier), rancourt@ucalgary.ca (D.E. Rancourt), several advantages over the conventional use of static culture
mskallos@ucalgary.ca (M.S. Kallos). flasks. First, these systems facilitate the large-scale expansion
1 These authors contributed equally.
2 Tel.: +1 403 220 8684; fax: +1 403 283 8727. of the cells in a homogeneous culture environment, decreasing
3 Tel.: +1 403 220 4549. the risk of culture variability. They are also less labour-intensive
4 Tel.: +1 403 220 2888; fax: +1 403 283 8727. to operate and offer the possibility for computer control and

0168-1656/$ see front matter 2007 Elsevier B.V. All rights reserved.
doi:10.1016/j.jbiotec.2007.01.006
422 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

monitoring of the culture conditions, including temperature, second day. ESC medium consisted of high glucose DMEM
pH and oxygen levels. With respect to ESCs, we envision a (4.5 g glucose/L, Gibco) supplemented with 15% FBS (Gibco,
scenario in which a complete bioprocess would exist for the chosen batches), 50 U/mL penicillin and 50 g/mL strepto-
bioreactor expansion and subsequent differentiation of the mycin, 1% non-essential amino acids (Gibco) and 0.1 mM
ESCs to generate the specialized cell type of interest. The -mercaptoethanol (Sigma). Bioreactors from NTS Technolo-
specialized cell populations could then be used for cell therapies gies (264501-125) for stirred suspension cultures contained
or combined with scaffolds to produce tissue constructs. For 100 mL of ESC medium and 1000 U/mL of LIF. The suspension
the latter application, the bioreactors would also facilitate cell cultures were run in duplicate, designated as Susp.Prolif A and
seeding of the scaffolds, due to the stirred culture environment, Susp.Prolif B, and were seeded with a single cell suspension
a further advantage over the use of static culture flasks. at 3.75 104 cells/mL and agitated at 100 rpm. Daily samples
Although bioreactors have been used in a variety of biotech- were taken for cell counts, using the trypan blue exclusion
nology applications, including cell culture, protein and virus method. The suspension cultures were passaged every 4 days by
production, and waste water treatment (Martin et al., 2004), dissociating the ESC aggregates, using 0.25% Trypsin/EDTA
little progress has been made towards the development of proto- and DNase I, and inoculating new suspension systems with
cols for the expansion of ESCs in these systems, as it has been single cells. Samples for growth rate determination, metabolite
found that excessive agglomeration and spontaneous differen- and amino acid concentrations in the medium were collected
tiation led to a diminished proliferative capacity (Dang et al., as described (Cormier et al., 2006). All static and suspension
2002, 2004). cultures were maintained in a humidified incubator at 37 C
Previous work in our laboratory however, has shown that and 5% CO2 .
suspension bioreactors can be used to expand undifferentiated
mammalian stem cell populations, specifically neural stem cells 2.2. Oxygen uptake rate
(NSCs) (Kallos et al., 2003). These results formed the basis
for our current ESC studies. Recently, we reported a success- The oxygen uptake rate of the murine ESCs was determined
ful protocol for the large-scale expansion of undifferentiated using batch experiments in a modified suspension culture flask.
ESCs in suspension bioreactors (Cormier et al., 2006), in which The vessel, which consisted of a regular spinner flask that
agglomeration of the cells was effectively controlled through was modified at the University of Calgary, had a volume of
the agitation rate and inoculation density. Another recent study approximately 250 mL and was operated with no head space, so
presented a similar suspension culture system for the expansion that no atmospheric oxygen was supplied to the culture (other
of ESCs (Fok and Zandstra, 2005). The current study extends than that originally dissolved in the media). For each run, the
that work to demonstrate that large-scale expansion of highly modified flask was filled with 250 mL of pre-warmed ESC cul-
undifferentiated ESC cultures is possible in suspension culture ture medium, ESCs were added at 5.0 105 cells/mL and the
bioreactors over extended time periods. dissolved oxygen concentration was monitored using a probe.
To assess the pluripotency of the ESCs following serial pas- Oxygen consumption rates were determined, as described pre-
saging in suspension, biological and functional attributes of the viously (Kallos and Behie, 1999), for intact ESC aggregates and
cells were examined at the end of a 28-day culture period and for a single cell suspension of ESCs, both derived from day 4
compared to static controls from the start of the experiment. suspension cultures (Susp.Prolif).
Flow cytometry analysis and gene expression profiles, including
2.3. Immunouorescence
pluripotency markers Oct-4, Nanog, SSEA-1, rex-1 and alkaline
phosphatase were used to determine the fraction of undifferen- ESCs were fixed with ice-cold methanol:acetone (7:3) for
tiated cells present over the course of the expansion. Additional 10 min at 20 C. Cells were permeabilized with PBS/0.1%
characterization of the cells involved embryoid body formation Triton-X 100 and unspecific binding was blocked by incubation
and colony forming assays, in vivo teratoma formation and in with PBS/1% BSA for 30 min at room temperature. Undifferen-
vitro multi-lineage differentiation, all of which confirmed that tiated ESCs were identified through an anti-Oct4 (Chemicon,
the functional attributes of undifferentiated ESCs were not lost MAB 4305), an anti-Nanog (Chemicon, AB 9920), an anti-
as a result of expansion in a suspension culture system. Over- SSEA-1 (Chemicon, MAB 4301) and an anti-ALP antibody
all, this study offers a comprehensive analysis of the efficacy of (R&D Systems, MAB 1448). Differentiated EBs were probed
suspension culture bioreactors for the expansion of ESCs over with an anti-GFAP (Chemicon, MAB 360) and an anti-NF
several passages. 200 kDa (Sigma, N-4142) antibody. The cells were overlaid with
the primary antibody and incubated at 4 C overnight. The appro-
2. Materials and methods priate Alexa Fluor 488 or Alexa Fluor 546 conjugated secondary
antibody (Molecular Probes) was diluted in PBS and 5% goat
2.1. Cell culture serum (Sigma) and applied to the cells for 2 h at 4 C.

Murine R1 ESCs were routinely cultured as a monolayer 2.4. FACS analysis


in static cultures, designated as Stat.Prolif, in the presence
of Leukemia Inhibitory Factor (LIF, 1000 U/mL, Gibco) to Static cultures and suspension culture aggregates were disso-
maintain their undifferentiated status and passaged every ciated into single cells and subjected to fluorescence-activated
N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 423

cell sorting on day 0 (static), day 4 (suspension) and day 28 PCR master mix (Biorad, Hercules, CA), with the following
(static and suspension). Ten thousand events were registered cycle conditions: an initial denaturation step at 95 C followed
per sample with a FACS Calibur instrument and CellQuest soft- by 40 rounds of cycling between 30 s at 95 C and 45 s at the
ware from Becton Dickinson as described (Cormier et al., 2006). respective annealing temperatures (see Table 1). Expression of
Only events that showed >99% fluorescence intensity compared genes of interest was normalized to the house-keeping gene
to cells that were incubated with the secondary antibody alone GAPDH, which does not alter its expression levels during ESC
were registered as positive. differentiation (Murphy and Polak, 2002).

2.5. RNA isolation 2.7. Embryoid body and colony forming cell assays

Cells were harvested for RNA isolation from biological trip- As a means to assess pluripotency, ESCs were tested for their
licates at various stages of static and suspension culture and capability to form embryoid bodies in methylcellulose and to
from embryoid bodies as indicated. Total RNA was isolated reform colonies as modified from Palmqvist et al. (2005). In
using the RNeasy Midi Kit (Qiagen) according to the manufac- brief, varying numbers of ESCs were diluted in methylcellulose-
turers instructions with on-column DNase digest. Yield of RNA based medium plus 15% FBS, 2.2 mM l-glutamine, and 127 nM
was determined with the Ribogreen RNA quantitation reagent monothioglycerol in IMDM (Gibco) and seeded into low adher-
(Molecular Probes) as before (zur Nieden et al., 2001). Com- ent dishes. Cell were incubated at 37 C, 5% CO2 and >95%
plementary DNA was synthesized from 500 ng of RNA with humidity and emerging EBs from n = 6 dishes were counted
Superscript II (Invitrogen) as described (zur Nieden et al., 2005). after 5 days. For the CFC (Colony Forming Cell) assay, three dif-
ferent concentrations of ESCs were seeded onto gelatin-coated
2.6. RT-PCR and quantitative PCR gridded dishes and grown in regular ESC maintenance medium
containing 1000 U/mL of LIF. Emerging colonies were counted
Primer sequences that were not found in the literature were after 5 days. Differentiated colonies were distinguished from
designed with Primer3 available at http://frodo.wi.mit.edu/cgi- the undifferentiated colonies through the appearance of colony
bin/primer3/primer3 www.cgi and subjected to a BLAST search outgrowths and counted as well.
(http://www.ncbi.nlm.nih.gov/BLAST/). PCR reactions were
composed of 0.8 M of each of the primers (see Table 1), 2 mM 2.8. ESC differentiation
MgCl2 , 0.1 mM of each of the dNTPs and 2.5 U of Taq Poly-
merase in 1 PCR buffer (Invitrogen) in a total reaction volume Differentiation was carried out in hanging drops as described
of 25 L using 75 ng of cDNA. Following a 5 min denaturation, (zur Nieden et al., 2004). In brief, 20 L drops of the stem
reactions were cycled through 35 rounds of 30 s at 94 C, 30 s cell suspension, containing approximately 750 cells per drop,
at the corresponding annealing temperature (see Table 1) and were placed onto the top lid of a Petri dish filled with PBS
30 s at 72 C. Obtained DNA product was fractionated on 23% and then incubated at 37 C with 5% CO2 . The resulting EBs
agarose gels at 70 V for 45 min. were transferred into non-adherent suspension cultures at day
Quantitative PCR was carried out with 50 ng cDNA essen- 3. At day 5, intact EBs, which consisted of approximately
tially as described (zur Nieden et al., 2004). A two-step PCR 50,000 cells/EB were plated into primaria treated flasks. Car-
run was performed in an iCycler iQ system using a SYBR green diogenic differentiation was examined through spontaneous

Table 1
Primer sequences used for the amplification of stem cell specific genes and early differentiation markers
Gene Forward primer Reverse primer Tm ( C) References

Oct-4 GCCTTGCAGCTCAGCCTTAA CTCATTGTTGTCGGCTTCCTC 61


nanog ATGCCTGCAGTTTTTCATCC GAGGCAGGTCTTCAGAGGAA 60 Palmqvist et al. (2005)
ALP GTGCCCTGACTGAGGCTGTC GGATCATCGTGTCCTGCTCAC 60 zur Nieden et al. (2003)
rex-1 TGGCTTCCCTGACAGATACC CCTTCGAACGTGCACTGATA 60 Palmqvist et al. (2005)
NF 68 AGTGGCTTTCTGGCTTGCTG TCTGTGTGATTCACATTGCCATAG 59
NF 160 GCTTTCCTGCGGCGTAATC TTGCGCTCTACCGTGATGTG 62 zur Nieden et al. (2004)
FGF-5 GGCAGAAGTAGCGCGACGTT TCCGGTTGCTCGGACTGCTT 50 Johansson and Wiles (1995)
CK 18 AGAGAGCCTGAGGGAGGTGG GCACACATCAACACCTATCGAA 50 Wang et al. (2004)
AFP CCCACTTCCAGCACTGCCTGCGG GGCTGCAGCAGCCTGAGAGTC 58 Wilkinson et al. (2005)
5T4 AACTGCCGAGTCTCAGATACC ATGATACCCTTCCATGTGATCC 55 Ward et al. (2003)
Eomesodermin CCACTGGATGAGGCAGGAGATTTCC AGTCTTGGAAGGTTCATTCAAGTCC 56 Kimura et al. (1999)
Brachyury GCTGTGACTGCCTACCAGCAGAATG GAGAGAGAGCGAGCCTCCAAAC 58 Ginis et al. (2004)
osteocalcin CCGGGAGCAGTGTGAGCTTA TAGATGCGTTTGTAGGCGGTC 60 zur Nieden et al. (2003)
aggrecan GATCTGGCATGAGAGAGGCG GCCACGGTGCCCTTTTTAC 61 zur Nieden et al. (2005)
/-MHC ACCTGTCCAAGTTCCGCAAG CTTGTTGACCTGGGACTCGG 62 zur Nieden et al. (2001)
GAPDH GCACAGTCAAGGCCGAGAAT GCCTTCTCCATGGTGGTGAA 60 zur Nieden et al. (2004)

Sequences are depicted in 5 3 direction.


424 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

differentiation of the cells in ESC maintenance medium with- read at t = 0 and t = 20 min at 405 nm. Enzyme activity was cal-
out LIF. Osteogenic differentiation was induced with 10 mM culated as described before (zur Nieden et al., 2003).
-glycerophosphate, 50 g/mL ascorbic acid and 5 108 M
1,25-OH2 vitamin D3 (zur Nieden et al., 2003). For differentia- 2.13. Teratoma formation
tion along the chondrocyte lineage, EBs were supplemented with
TGF1 (10 ng/mL), BMP-2 (10 ng/mL), insulin (1 g/mL) and CB17SC-M SCID mice (genotype C.B-Igh-1b /IcrTac-
ascorbic acid (50 g/mL) as described previously (zur Nieden et Prkdcscid) were obtained from Taconic and housed in the
al., 2004). ESCs were forced to differentiate into neuronal cell single-barrier animal facility of the Faculty of Medicine, Uni-
types using lineage selection (Okabe et al., 1996) with minor versity of Calgary. Mice were fed ad libitum with a standard
modifications as described in zur Nieden et al. (2004). diet and water. A quarter million cells were injected as a sin-
gle cell suspension into the skin fold of the inner thigh, using a
2.9. Histochemical stains for bone and cartilage 27 gauge syringe, of four mice per group. After 23 weeks, ani-
mals were sacrificed and emerging tissue material was dissected.
Mineralized nodules were identified by the von Kossa method Animal protocols were carried out as approved by the Univer-
(McGee, 1958) after 30 days of osteoblast culture as described sity of Calgary animal protocol # 157-GM. Tissue was fixed
(zur Nieden et al., 2003). Proteoglycans secreted by ESC derived in formalin and embedded in paraffin. Sections were stained in
chondrocytes were stained with Alcian Blue. Cultures were fixed hematoxylin/eosin according to standard procedures (Loken et
in 2.5% glutaraldehyde, 25 mM sodium acetate, 0.4 M MgCl2 al., 2004).
containing 0.05% Alcian Blue (Sigma) for 48 h.
2.14. Statistical analysis
2.10. Ca2+ determination
Significance of quantitative PCR results, Ca2+ determina-
tion and Image analysis was determined with a Students
Matrix incorporated calcium was quantified using the purple
t-test using a web-based program from the Physics Depart-
substrate Arsenazo III (DCL). Calcium reacts with Arsenazo III
ment of the College of Saint Benedict/Saint Johns University
at neutral pH to yield a blue colored complex, whose intensity is
(http://www.physics.csbsju.edu/stats/t-test.html).
proportional to the calcium concentration. Cells were intensively
washed with PBS to remove any traces of medium. Values are
3. Results
calculated from a standard, which was measured along with the
samples at 650 nm in a Benchmark Plus microplate spectropho-
3.1. Long term passaging of ESCs as aggregates in
tometer (Biorad). Values obtained for osteogenic cultures were
suspension
normalized to spontaneously differentiated control cultures of
the same type of cell to filter out unspecific incorporation into
In the current study, we developed a serial passaging proto-
the EB matrix.
col, which allowed for the propagation of ESCs in suspension
culture. For passaging, ESC aggregates were harvested from the
2.11. Lowry protein assay suspension cultures (Susp.Prolif) at day 4 (96 h), as this would
ensure that the cells were still in the exponential growth phase
Calcium content of EBs was normalized to the total pro- (Cormier et al., 2006). The aggregates were dissociated into sin-
tein content of the samples. After Ca2+ determination, EBs gle cells, and then inoculated into subsequent suspension culture
were rinsed twice in PBS and lysed in RIPA buffer (150 mM systems at a cell density of 3.75 104 cells/mL (Cormier et al.,
NaCl, 10 mM Tris, pH 7.2, 0.1% SDS, 1% Triton X-100, 1% 2006). Following this same procedure every 4 days, ESCs were
deoxycholate, 5 mM EDTA) containing 1 mM phenylmethylsul- carried through seven passages (P1P7) for a total of 28 days of
fonyl fluoride, 10 mM benzamidine, 2 g/mL leupeptin, 100 M culture. Static cultures (Stat.Prolif), which were run simultane-
sodium orthovanadate and 10 mM p-nitrophenylphosphate. ously, went through 13 passages over the same 28 days.
After gentle rocking for 30 min, lysates were collected, cen- Through daily cell counts of the suspension cultures, viable
trifuged and an aliquot of the supernatant mixed with DC cell density and cell viability were assessed. ESC growth kinet-
protein assay reagents from Biorad. After 15 min incubation at ics over the first two passages were found to be consistent with
room temperature, absorbance was read in a Benchmark Plus those typically seen for ESCs cultured under suspension con-
microplate spectrophotometer (Biorad) at 750 nm. Protein quan- ditions (Cormier et al., 2006). However, the peak density by
tities in samples were taken from a BSA standard curve. the third passage was diminished (Fig. 1A). During the first
three passages, cell loss was observed when dissociating the
2.12. ALP assay aggregates and the passaging protocol was therefore modified
slightly from the fourth passage on. Instead of dissociating the
Alkaline phosphatase activity was determined from the ESC aggregates enzymatically as a pellet, the pellet of aggre-
protein lysates using p-nitrophenyl phosphate (Sigma) as a sub- gates was transferred to a sterile culture dish and then dissociated
strate. The production of yellow p-nitrophenol was stopped with using Trypsin/EDTA. Following this modification, the cultures
3N NaOH after a 20 min incubation at 37 C. Absorbance was again reached normal peak densities (Fig. 1A). Over the course
N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 425

Fig. 1. Serial passaging of embryonic stem cells in suspension culture. (A) Cell densities and viability over the course of seven passages of ESCs in suspension.
Cultures were inoculated at 3.75 104 cells/mL and agitated at 100 rpm. (B) Morphology of the suspension cultures remained consistent over the course of the
28-day culture period. Scale bars: 200 m.

of the long term passaging, the morphology of the ESC aggre- cultures, which yielded an expansion of approximately 10-fold
gates remained consistent (Fig. 1B). Further, the viability of over 2 days. Although the static culture flasks offer a greater
the cultures remained greater than 85% for the duration of the efficiency for ESC expansion, it should be highlighted that 37
experiment (Fig. 1A). static culture flasks would be required to obtain the same total
The cumulative expansion of the ESCs achieved through cell number obtained over one passage in one bioreactor. For
serial passaging of the suspension bioreactors (Susp.Prolif) was clinical applications, ESC expansion in bioreactors is therefore
2.5 billion-fold over the 28-day culture period, with a mean advantageous as labour and time requirements are drastically
doubling time of 14.5 0.2 h for passages 1, 3 and 7. The mean decreased and culture-to-culture variability is avoided. In addi-
doubling time for the static cultures was 15.0 1.7 h over the tion, as the risk of contamination and errors increases with the
13 passages. Although the cumulative expansion in suspension number of passages, the reduced number of passages required
was lower than that observed for the static cultures (Stat.Prolif), in suspension cultures is also advantageous.
of approximately 76.4 trillion-fold over the same period of time,
it should be noted that the static cultures were passaged twice as 3.2. Oxygen uptake rates of ESCs in suspension bioreactors
many times over the 28-day period. On a per passage basis, the
suspension culture bioreactors yielded a greater ESC expansion, To determine the oxygen consumption rate of the sus-
of approximately 31-fold over 4 days, compared to the static pension culture ESCs, a probe was inserted into a modified
426 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

250 mL suspension system with no head space and the con- 13 passages, but decreased to a lesser extent in the suspension
centration of dissolved oxygen was measured over a period of cultures (Susp.Prolif d28, 27.8%).
45 min. The oxygen consumption rate of the suspension cul- Although 99% of the cells in the static cultures (Stat.Prolif)
ture murine ESCs (Susp.Prolif) was found to be approximately at day 28 still expressed Oct-4 as quantified by FACS anal-
4.0 1017 mol O2 /cell s, with no statistical difference between ysis, gene expression levels were down-regulated to 20 7%
a single cell suspension of ESCs and intact ESC aggregates. compared to static controls from d0, as measured by quanti-
This value is comparable to the average range of consumption tative PCR (Fig. 2E). However, Oct-4 gene expression levels
rates reported in literature for mammalian cell types (Kallos remained high in suspension cultures (Susp.Prolif) through-
and Behie, 1999). At this consumption rate, the maximum cell out the duration of the experiment. Nanog expression levels
density that could be supported in the bioreactor system was increased slightly in the long-term passaged suspension cultures
calculated to be 3.75 106 cells/mL, using equations described (Susp.Prolif) as compared to the initial ESC population (p < 0.1).
previously (Kallos and Behie, 1999). Therefore, at the peak cell Rex-1 expression levels remained unchanged, whereas ALP lev-
density of approximately 1.0 106 cells/mL observed on day els decreased after 28 days in the static culture (Stat.Prolif)
4 of each passage in the current study, the oxygen supply was as well as in suspension (Susp.Prolif). Further, cells from the
deemed adequate. Interestingly, the similarity in consumption suspension cultures (Susp.Prolif) did not express detectable lev-
rates between the single cell suspension of ESCs and intact ESC els of mesodermal markers, such as Eomes and BMP-4, and
aggregates may suggest that the ESC aggregates are packed Brachyury was expressed at lower levels in the suspension cul-
loosely, facilitating oxygen and nutrient mass transfer (i.e. no tures (Susp.Prolif) than in static cultures (Stat.Prolif) (Fig. 2F).
mass transfer limitations). Markers for early ectodermal (NF68, FGF-5) and endodermal
(CK18, AFP) differentiation were expressed only in long-term
3.3. ESC aggregates form colonies and embryoid bodies static cultures (Stat.Prolif). The general marker for early differ-
entiation, 5T4, was expressed at low levels in our ESC line as
As a means of assessing pluripotency of d28 suspension we have shown previously (Cormier et al., 2006). This expres-
culture ESCs, cells were examined for their capacity to sion, however, was not seen after long term culture in suspension
form new colonies. Cells from the d28 suspension cultures (Susp.Prolif). The absence of all early differentiation markers in
(Susp.Prolif d28) as well as d28 static cultures (Stat.Prolif the suspension culture aggregates strongly suggests that suspen-
d28) formed new colonies at rates that were not statistically sion culture supports the expansion of highly undifferentiated
different from the d0 static culture ESCs used to initiate the ESC cultures.
experiments (Stat.Prolif d0) (Fig. 2A). However, d28 suspen-
sion culture ESCs (Susp.Prolif d28) colonized more efficiently 3.5. ESC aggregates retain the capability to differentiate
than d28 static cultures (Stat.Prolif d28) with p-values of into distinct lineages in vitro
0.03 and 0.1 for the biological duplicates respectively. Dishes
contained similar percentages of colonies with undifferentiated A true characteristic of stem cells is their ability to differ-
morphology (static d0 2.41%, static d28 1.59%, suspension entiate into functional progeny of a particular lineage. ESCs
d28 1.68%). Long-term static (Stat.Prolif) and suspension specifically differ from other stem cells in their capacity to dif-
(Susp.Prolif) cultures also retained the ability to form EBs ferentiate into all three germ layers. Thus, we performed an in
in hanging drops (Fig. 2B) and in methylcellulose (Fig. 2C), vitro differentiation study comparing long-term expanded ESCs
at rates that were not statistically different from the static d0 from static and suspension cultures.
cultures. On day 28 of the expansion study, ESCs were induced to dif-
ferentiate into the cardiac, osteoblast, neural and chondrocyte
3.4. ESC aggregates express markers of the lineages by applying the hanging drop method (zur Nieden et
undifferentiated state al., 2004). Spontaneous differentiation to cardiomyocytes was
carried out in regular ESC medium without LIF. After 9 days,
Expression levels of four characteristic ESC proteins were clusters of spontaneously beating cardiomyocytes appeared in
examined through FACS analysis (Fig. 2D). Cells from day the EBs (Fig. 3A). The number of EBs containing beating car-
0 static cultures (Stat.Prolif d0) were used as a control and diomyocytes was counted and calculated as percentage of the
compared to day 4 suspension (Susp.Prolif d4) and day 28 static total number of EBs plated. It has been found that R1 ESCs have a
(Stat.Prolif d28) and suspension culture (Susp.Prolif d28) cells. considerably lower potential to differentiate spontaneously into
Cells from suspension cultures (Susp.Prolif) were assessed contracting cardiomyocytes than other ESC lines, such as D3,
on the fourth day of a given passage as this would assure that CCE or CM7/1 (Zandstra et al., 2003). In the current study, only
they were in the exponential growth phase. Overall, Oct-4 and 8.3 1.76% of EBs generated from static controls (Stat.Prolif)
Nanog levels remained high, greater than 90%, for all cultures. developed contracting clusters. However, this percentage was
SSEA-1 levels decreased in static cultures (Stat.Prolif) from significantly higher in spontaneously differentiated cells from
99.9% at d0 to 87.3% at d28. However, the levels of SSEA-1 the duplicate suspension cultures (Susp.Prolif): A (14.7 2.41,
remained high in the cells from the suspension culture ESCs p < 0.1) and B (17.7 2.79, p < 0.01). Hence, cells from the sus-
(Susp.Prolif) at 96.7% by d28. ALP levels declined from 68.7% pension cultures seemed to have retained a higher capacity to
to 7.8% in the static cultures (Stat.Prolif) over the course of differentiate into cardiomyocytes, a finding that was supported
N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 427

Fig. 2. Pluripotency markers are preserved in suspension culture aggregates. (A) CFC assay. ESCs from suspension culture aggregates (Susp.Prolif) form new
colonies with a slightly higher efficiency than static controls (Stat.Prolif) of the same age. (B and C) Suspension ESCs maintain the capacity to form EBs through
hanging drops. (D) Pluripotency markers Oct-4 and Nanog persist to be expressed in the suspension culture ESCs (Susp.Prolif) as revealed by FACS analysis. ALP
levels drop over time in culture, however not as fast in suspension as in static controls. (E) Quantitative real-time PCR analysis for pluripotency marker genes. Values
represent expression levels normalized to GAPDH of n = 3 independent experiments S.D. standardized to static control values at d0. (F) RT-PCR for pluripotency
and early differentiation genes. * p < 0.1; ** p < 0.01; *** p < 0.001.

by expression levels of the /-cardiac myosin heavy chain osteoblasts. Osteogenic differentiation was carried out accord-
gene (Fig. 3B). Gene expression levels were 1.4 0.12-fold and ing to zur Nieden et al. (2003) using vitamin D3 as an inducer.
1.66 0.29-fold up-regulated in EBs from the duplicate suspen- After 25 days of culture, von Kossa staining, which is indicative
sion cultures (Susp.Prolif A and B) respectively compared to of mineralized cells, showed that embryoid bodies differentiated
EBs from static controls (Stat.Prolif) (p < 0.01 and p < 0.001). from suspension culture ESCs (Susp.Prolif) contained a similar
We further examined the ability of the bioreactor- number of osteoblasts as static controls (Stat.Prolif) (Fig. 3C).
expanded ESCs to undergo induced directed differentiation into This was further supported through subsequent image analy-
428 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

Fig. 3. In vitro differentiation into mesodermal lineages. (A) Embryoid bodies containing clusters of spontaneously beating cardiomyocytes were counted in all
three experimental groups on day 10 of differentiation. (B) Embryoid bodies generated from suspension aggregates (Susp.Prolif) contained a higher percentage
of cardiomyocytes, which was confirmed by quantitative expression analysis for the cardiomyocyte marker gene alpha/beta-cardiac myosin heavy chain. (CG)
Differentiation into the osteoblast lineage was induced with 1,25-OH2 vitamin D3 . (C) von Kossa staining confirmed the presence of mineralized calcium after 4
weeks of differentiation. Scale bar: 100 m. (D) Image analysis for mineralized cells was performed on pictures taken in (C). (E) Calcium content of the cultures. (F)
ALP activity of the cultures. (G) Quantitative expression analysis for the bone marker genes osteocalcin (OCN) and bone sialoprotein (BSP). None of these assays
showed a significant difference in the potential of suspension culture vs. static control ESCs to differentiate into the osteogenic lineage. (H and I) Chondrogenic
differentiation was carried out with BMP-2. Alcian Blue staining showed increased presence of matrix proteoglycans in static controls (Stat.Prolif) and suspension
culture aggregates (Susp.Prolif) as compared to cells cultured in medium without chondrogenic supplements (Control). Scale bar: 0.5 cm. (I) Quantitative PCR
results point to increased chondrogenesis in suspension aggregates (Susp.Prolif). All quantitative expression values represent means S.D. of three independent
experiments and were normalized to GAPDH expression. Static control values were set as 1. * p < 0.1; ** p < 0.01; *** p < 0.001.

sis for black mineralized areas on the photomicrographs of the 2005). A spontaneously differentiated control was included and
von Kossa stains (Fig. 3D). Calcium content and ALP enzyme a representative Alcian Blue stain is shown in Fig. 3H. Staining
activity were also used to measure the degree of mineraliza- was significantly darker in cells treated with chondrogenic sup-
tion. Again, neither of these tests showed a significant difference plements. Moreover, EBs made from suspension culture cells
in osteoblast generation from the suspension (Susp.Prolif) and (Susp.Prolif) contained reproducibly higher amounts of chon-
static control cultures (Stat.Prolif) (Fig. 3E and F). Moreover, drocytes, as judged from the darker Alcian Blue stain and further
expression levels of the bone marker genes osteocalcin and bone determined through expression levels of collagen type II, a
sialoprotein in the differentiated cultures generated from suspen- gene exclusively expressed by mature chondrocytes (Fig. 3I).
sion cultures (Susp.Prolif) were comparable to those from static Compared to the static control (Stat.Prolif), aggrecan expres-
controls (Stat.Prolif) (Fig. 3G). sion levels were 1.51 0.27 and 1.91 0.04-fold up-regulated
In contrast, suspension culture ESCs (Susp.Prolif) showed in EBs from the duplicate suspension cultures (Susp.Prolif) A
a greater potential to differentiate into the chondrocyte lineage and B respectively (p < 0.001).
when induced with BMP-2, TGF1 , ascorbic acid and insulin. As neural differentiation is known to be a default dif-
EBs generated from d28 suspension ESCs (Susp.Prolif) were ferentiation of ESCs, it was not surprising that suspension
stained with Alcian Blue on day 32 of differentiation, a time (Susp.Prolif) and static control (Stat.Prolif) ESCs retained the
where they contain fully mature chondrocytes (zur Nieden et al., capability to differentiate into neurons and astrocytes after 28
N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 429

Fig. 4. In vitro differentiation into neural lineages. Differentiation was induced according to the lineage selection protocol by Okabe et al. (1996). (A) Mature neurons
and glia, which stain positive for neurofilament 200 kDa and GFAP, respectively, can be detected after 28 days in culture. Scale bar: 10 m. (B) ESCs from suspension
aggregates (Susp.Prolif) differentiated into the neuronal lineage with a similar rate as static culture ESCs (Stat.Prolif) as revealed by quantitative PCR, n = 3 S.D.
Static control values were set as 1.

days of expansion. Positive immunostaining for neurofilament 2-month-old SCID beige mice. Further, static control cells
200 kDa and GFAP allowed for the conclusion of successful (Stat.Prolif) were induced to differentiate into embryoid bodies,
differentiation with comparable outcomes between cells from using hanging drops, and the day 4 EBs were also injected, as
the two culture systems (Fig. 4A). When normalized to the a negative control (Stat.Diff d4). After 14 days, teratomas were
static control (Stat.Prolif), expression levels of the neuronal excised and weighed (Fig. 5A and B). Teratomas formed from
marker NF68 kDa in both suspension ESC cultures (Susp.Prolif suspension culture ESCs (Susp.Prolif) were slightly but sig-
A 1.05 0.1 and Susp.Prolif B 1.17 0.2 n-fold expression), nificantly smaller than tumors from static control (Stat.Prolif)
remained statistically the same as static controls. The same was cultures. Differentiated cells from embryoid bodies (Stat.Diff
true for the astrocyte marker GFAP (Susp.Prolif A 0.98 0.06 d4) did not form teratomas in 50% of the cases and when they
and Susp.Prolif B 1.02 0.03 n-fold expression), which was did, the teratomas were significantly reduced in size (Fig. 5A
also normalized to the static control levels (Fig. 4B). and B). Teratomas from static control ESCs (Stat.Prolif) as
well as from suspension culture ESCs (Susp.Prolif) contained
3.6. ESCs from suspension culture aggregates form all tissues representative of all three germ layers (Fig. 5CH). On
three germ layers in vivo the contrary, cells from day 4 embryoid bodies (Stat.Diff d4)
formed unorganized tissue structures within major portions
After 28 days of expansion, ESCs from suspension (Susp. of the teratomas (Fig. 5I and J). The structures most easily
Prolif) and static control (Stat.Prolif) cultures were trypsinized identifiable in the teratomas formed from EBs were ectoderm
into separate single cell suspensions and 2.5 105 cells derivatives (Fig. 5K) and enormous keratin sheets (data not
from each were injected into the inner thigh skin fold of six shown).
430 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

Fig. 5. ESCs cultured in suspension form teratomas in vivo comprising all three germ layers. (A) Teratomas photographed in situ 15 days after injection of
2.5 105 cells taken from day 28 static control cultures (Stat.Prolif), day 28 suspension aggregates (Susp.Prolif) and 4-day old EBs formed in hanging drops
from static controls (Stat.Diff). (B) Average weight distribution of teratomas formed in four SCID mice. Differentiated ESCs (Stat.Diff) form significantly smaller
teratomas. (CK) H&E stain of tissue sections. (CE) Teratomas from static control d28 ESCs (Stat.Prolif) contain derivatives from all germ layers. (FH) Teratomas
formed from ESCs cultured in suspension (Susp.Prolif A) also contain representative tissues from all three germ layers. (IK) Differentiated ESCs from day 4 old
embryoid bodies do not form organized teratomas. Although ectoderm derivatives could be found (K), the majority of the teratoma contains unstructured tissue (I
and J). Additionally, these teratomas contain huge portions of keratin sheets. () Endoderm; ( ) mesoderm; () ectoderm.

4. Discussion (self-renewal) and (ii) give rise to different cell types (Smith,
2001; Lagasse et al., 2001). In the current study, both of these
Large-scale expansion protocols will be a prerequisite for the attributes were sustained through long term culture of ESCs in
therapeutic application of stem cells. Such procedures have been suspension bioreactors. Pluripotency of the ESCs was assessed
developed for hematopoetic stem cells and CD34+ hematopoetic in this study through a number of tests, with both the bio-
precursors (Zandstra et al., 1994; Kogler et al., 1998; Eridani et logical and functional attributes of the cells being considered.
al., 1998), neural stem and precursor cells (Kallos and Behie, Interestingly, the day 28 suspension ESC cultures (Susp.Prolif
1999; Gilbertson et al., 2006) and human mesenchymal progen- d28) seemed to possess more pluripotent cells compared to
itor cells (Baksh et al., 2003). However, embryonic stem cells the static controls (Stat.Prolif) that had been cultured for the
(ESCs) have long been thought to agglomerate and initiate dif- same duration. ESCs from suspension cultures (Susp.Prolif), for
ferentiation when cultured in stirred suspension. Only recently, example, had higher colony forming efficiencies than the d28
our research group along with one other group have reported the static culture cells (Stat.Prolif). Further, at the end of the experi-
development of effective culture protocols for the expansion of ment, ESCs cultured in suspension (Susp.Prolif) also possessed
pluripotent ESCs in stirred bioreactors (Fok and Zandstra, 2005; higher SSEA-1 and ALP protein expression levels compared
Cormier et al., 2006). to d28 static controls and had maintained high levels of Oct-4
Stem cells are defined by two fundamental functional prop- gene expression, which showed a significant drop in the d28
erties: the ability to (i) generate cells of identical properties static controls. Loss of pluripotency in the static culture cells
N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432 431

(Stat.Prolif) was further confirmed by the presence of early ecto- zebrafish. They concluded that the cells in the developing heart
dermal and endodermal differentiation markers, which were not were especially sensitive to this type of culture environment
seen in the ESCs cultured in suspension (Susp.Prolif). It is also and attributed this characteristic to their susceptibility to mor-
interesting to note that the 5T4 marker, found previously to phological changes resulting from the shear forces associated
be an effective general marker for early differentiation (Ward with blood flow. Similarly, several studies have examined the
et al., 2003), was detected in low levels in the d0 static cells mechanobiology of cells comprising skeletal tissues in order to
(Stat.Prolif), which were used to inoculate the suspension culture determine the effect of mechanical/physical conditions on osteo-
systems, but not in the d28 suspension culture cells (Susp.Prolif). and chondrogenesis (Carter et al., 2004; Mullender et al., 2004;
These results suggest that the loss in pluripotency over 28 days Carter et al., 1998). Overall, it has been found that the cell type
observed in the static culture systems did not occur in the suspen- generated during differentiation of skeletal progenitor or stem
sion culture systems. We hypothesize that the increased number cells is affected by the magnitude, type and orientation of extra-
of pluripotent cells in the suspension culture system may be cellular mechanical forces. In particular, Carter et al. (1998)
the result of a cell type selection process, whereby the prolif- found that bone formation occurs in regions of low to moderate
eration of undifferentiated ESCs is enhanced, or conversely the tensile strain and chondrogenesis is promoted in areas of hydro-
expansion of differentiated cells is impeded, and hence the cell static compressive stress. From the results in these studies, we
population is maintained highly pluripotent. postulate that although the presence of hydrodynamic shear in a
As there are distinct differences between the culture envi- suspension bioreactor permits the expansion of a highly undif-
ronments in the suspension culture systems as opposed to the ferentiated ESC population, the shear may also predispose the
static vessels, including the formation of aggregates, exposure cells to favor the generation of cell lineages that are sensitive to
to shear forces from agitation, and homogeneity in the culture mechanical loading, such as cardiomyocytes and chondrocytes.
from mixing, we postulate that the culture conditions in the As in previous work, including the original isolation of ESCs
suspension systems enhance the expansion of undifferentiated (Martin, 1981; Evans and Kaufman, 1981; Thomson et al.,
ESCs as compared to the static culture systems. The maximum 1998), murine ESCs have commonly been used as a model sys-
shear stress in the Susp.Prolif cultures reached 0.78 Pa, which tem for human ESCs. Compared to human ESCs, murine ESCs
is at the top of the range 0.300.75 Pa previously described for are readily available and are of low cost, making them highly
neural precursor cells (Gilbertson et al., 2006). One possible beneficial to protocol development studies. Although the direct
mechanism for the cell type selection process observed in the application of this process to human ESC expansion may not be
bioreactors (Susp.Prolif) could be shear induced mechanotrans- possible, the current study provides an important starting point
duction in the cells. The G protein Ras has been associated with for future studies in human ESC expansion.
the regulation of many cellular activities, including progression
through the cell cycle, differentiation and gene transcription, and Acknowledgements
in endothelial cells Ras has been found to attenuate STAT3 (Ni et
al., 2003). In ESCs, Ras activation has been observed to increase We thank Dr. A. Nagy for providing us with the R1 ESC line.
during EB formation and has been linked to Nanog downregula- NZN and DER are funded by the Alberta Heritage Foundation
tion and endoderm differentiation (Yoishida-Koide et al., 2004; of Medical Research and the Canadian Stem Cell Network. JC is
Hamazaki et al., 2004). Further, shear stress and Ras activation supported by scholarships from the Natural Sciences and Engi-
have been found to alter cell response to cytokine signaling (Li et neering Research Council of Canada (NSERC) and the Graduate
al., 1996). From these studies, it appears that shear-activated Ras Studies department at the University of Calgary. MSK is funded
signaling may be contributing to the differences in proliferation by a grant from NSERC. The authors would like to thank Shi-
and differentiation between static (Stat.Prolif) and suspension Ying Liu and Lesley Davis for maintenance of the SCID mice
(Susp.Prolif) ESC cultures in the current study. Further studies and assistance in sectioning the teratomas.
should be undertaken to better characterize these mechanisms
in the bioreactor ESC cultures.
References
The functionality of the cells cultured in suspension
(Susp.Prolif) was compared to that of the cells from static Baksh, D., Davies, J.E., Zandstra, P.W., 2003. Adult human bone marrow-derived
culture (Stat.Prolif) by assessing their capacity for multi- mesenchymal progenitor cells are capable of adhesion-independent survival
lineage differentiation. Overall, there were greater efficiencies and expansion. Exp. Hematol. 31 (8), 723732.
for chondrogenesis and generation of spontaneously beating Carter, D.R., Beaupre, G.S., Giori, N.J., Helms, J.A., 1998. Mechanobiology of
cardiomyocytes from the cells that were expanded in the suspen- skeletal regeneration. Clin. Orthop. 355S, S41S55.
Carter, D.R., Beaupre, G.S., Wong, M., Smith, R.L., Andriacchi, T.P., Schurman,
sion culture system (Susp.Prolif). Outcomes for osteogenesis D.L., 2004. The mechanobiology of articular cartilage development and
and neurogenesis were similar between static and suspension degeneration. Clin. Orthop. Relat. Res. 427S, S69S77.
culture cells. The greater potential for cardiomyocyte and chon- Cormier, J., zur Nieden, N.I., Rancourt, D.E., Kallos, M.S., 2006. Expansion of
drocyte generation from the ESCs cultured in suspension could undifferentiated murine embryonic stem cells as aggregates in suspension
be explained by the presence of shear within the system. A pre- culture bioreactors. Tissue Eng. 12 (11) (Epub ahead of print).
Dang, S.M., Kyba, M., Perlingeiro, R., Daley, G.Q., Zandstra, P.W., 2002. Effi-
vious study by Shimada et al. (2005) found that exposure to low ciency of embryoid body formation and hematopoietic development from
levels of shear and microgravity, within a suspension bioreac- embryonic stem cells in different culture systems. Biotechnol. Bioeng. 78
tor, influenced gene expression during the early development of (4), 442453.
432 N.I. zur Nieden et al. / Journal of Biotechnology 129 (2007) 421432

Dang, S.M., Gerecht-Nir, S., Chen, J., Itskovitz-Eldor, J., Zandstra, P.W., 2004. Murphy, C.L., Polak, J.M., 2002. Differentiating embryonic stem cells: GAPDH,
Controlled, scalable embryonic stem cell differentiation culture. Stem Cells but neither HPRT nor beta-tubulin is suitable as an internal standard for
22, 275282. measuring RNA levels. Tissue Eng. 8, 551559.
Eridani, S., Mazza, U., Massaro, P., La Targia, M.L., Maiolo, A.T., Mosca, A., Ni, C.W., Hsieh, H.J., Chao, Y.J., Wang, D.L., 2003. Shear flow attenuates
1998. Cytokine effect on ex vivo expansion of hematopoetic stem cells from serum-induced STAT3 activation in endothelial cells. J. Biol. Chem. 278
different human sources. Biotherapy 11 (4), 291296. (22), 1970219708.
Evans, M.J., Kaufman, M.H., 1981. Establishment in culture of pluripotential Oh, S.K.W., Fong, W.J., Teo, Y., Tan, H.L., Padmanabhan, J., Chin, A.C.P., Choo,
cells from mouse embryos. Nature 292, 154156. A.B.H., 2005. High density cultures of embryonic stem cells. Biotechnol.
Fok, E.Y., Zandstra, P.W., 2005. Shear-controlled single-step mouse embryonic Bioeng. 91 (5), 524533.
stem cell expansion and embryoid body-based differentiation. Stem Cells Okabe, S., Forsberg-Nilsson, K., Spiro, A.C., Segal, M., McKay, R.D., 1996.
23 (9), 13331342. Development of neuronal precursor cells and functional post-mitotic neurons
Fong, W.J., Tan, H.L., Choo, A., Oh, S.K.W., 2005. Perfusion cultures of human from embryonic stem cells in vitro. Mech. Dev. 59, 89102.
embryonic stem cells. Bioprocess Biosyst. 27, 381387. Palmqvist, L., Glover, C.H., Hsu, L., Lu, M., Bossen, B., Piret, J.M., Humphries,
Gilbertson, J.A., Sen, A., Behie, L.A., Kallos, M.S., 2006. Scaled-up produc- R.K., Helgason, C.D., 2005. Correlation of murine embryonic stem cell gene
tion of mammalian neural precursor cell aggregates in computer-controlled expression profiles with functional measures of pluripotency. Stem Cells 23,
suspension bioreactors. Biotechnol. Bioeng. 94 (4), 783792. 663680.
Ginis, I., Luo, Y., Miura, T., Thies, S., Brandeberger, R., Geretch-Nir, S., Amit, Shimada, N., Sokunbi, G., Moorman, S.J., 2005. Changes in gravitational force
M., Hoke, A., Carpenter, M.K., Itskovitz-Eldor, J., Rao, M.S., 2004. Dif- affect gene expression in developing organ systems at different developmen-
ferences between human and mouse embryonic stem cells. Dev. Biol. 269, tal times. BMC Dev. Biol. 5 (1), 10 (ahead of print).
360380. Smith, A.G., 2001. Embryo-derived stem cells: of mice and men. Annu. Rev.
Hamazaki, T., Oka, M., Yamanaka, S., Terada, N., 2004. Aggregation of Cell Dev. Biol. 17, 435462.
embryonic stem cells induces nanog repression and primitive endoderm Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J.,
differentiation. J. Cell Sci. 117 (23), 56815686. Marshall, V.S., Jones, J.M., 1998. Embryonic stem cell lines derived from
Johansson, B.M., Wiles, M.V., 1995. Evidence for involvement of activin A and human blastocysts. Science 282, 11451147.
bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic Wang, Z., Dooley, T.P., Curto, E.V., Davis, R.L., VandeBerg, J.L., 2004. Cross-
development. Mol. Cell. Biol. 15 (1), 141151. species application of cDNA microarrays to profile gene expression using
Kallos, M.S., Behie, L.A., 1999. Inoculation and growth conditions for high-cell UV-induced melanoma in monodelphis domestica as the model system.
density expansion of mammalian neural stem cells in suspension bioreactors. Genomics 83, 588599.
Biotechnol. Bioeng. 63 (4), 473483. Ward, C.M., Barrow, K., Woods, A.M., Stem, P.L., 2003. The 5T4 oncofoetal
Kallos, M.S., Sen, A., Behie, L.A., 2003. Large-scale expansion of mam- antigen is an early differentiation marker of mouse ES cells and its absence
malian neural stem cells: a review. Med. Biol. Eng. Comput. 41 (3), 271 is a useful means to assess pluripotency. J. Cell Sci. 116 (22), 45334542.
282. Wilkinson, D.S., Ogden, S.K., Stratton, S.A., Piechan, J.L., Nguyen, T.T., Smu-
Kimura, N., Nakashima, K., Ueno, M., Kiyama, H., Taga, T., 1999. A novel lian, G.A., Barton, M.C., 2005. A direct intersection between p53 and
mammalian T-box-containing gene, Tbr2, expressed in mouse developing transforming growth factor beta pathways targets chromatin modification
brain. Dev. Brain Res. 115, 183193. and transcription repression of the alpha-fetoprotein gene. Mol. Cell. Biol.
Kogler, G., Callejas, J., Sorg, R.V., Wernet, P., 1998. An eight-fold ex vivo expan- 25, 12001212.
sion of long-term culture-initiating cells from umbilical cord blood in stirred Yoishida-Koide, U., Matsuda, T., Saikawa, K., Nakanuma, Y., Yokota, T.,
suspension cultures. Bone Marrow Transplant. 21 (Suppl. 3), S48S53. Asashima, M., Koide, H., 2004. Involvement of Ras in extraembryonic
Lagasse, E., Shizuru, J.A., Uchida, N., Tsukamoto, A., Weissman, I.L., 2001. endoderm differentiation of embryonic stem cells. Biochem. Biophys. Res.
Toward regenerative medicine. Immunity 14, 425436. Commun. 313 (3), 475481.
Li, Y.S., Shyy, J.Y.J., Li, S., Lee, J., Su, B., Karin, M., Chien, S., 1996. The Zandstra, P.W., Eaves, C.J., Piret, J.M., 1994. Expansion of hematopoetic pro-
Ras-JNK pathway is involved in shear-induced gene expression. Mol. Cell. genitor cell populations in stirred suspension bioreactors of normal human
Biol. 16 (11), 59475954. bone marrow cells. Biotechnology (NY) 12 (9), 909914.
Loken, S.D., Norman, K., Hirasawa, K., Nodwell, M., Lester, W.M., Demetrick, Zandstra, P.W., Bauwens, C., Yin, T., Liu, Q., Schiller, H., Zweigerdt, R.,
D.J., 2004. Morbidity in immunosuppressed (SCID/NOD) mice treated with Pasumarthi, K.B., Field, L.J., 2003. Scalable production of embryonic stem
reovirus (dearing 3) as an anti-cancer biotherapeutic. Cancer Biol. Ther. 3 cell-derived cardiomyocytes. Tissue Eng. 9, 767778.
(8), 734738. zur Nieden, N.I., Ruf, L.J., Kempka, G., Hildebrand, H., Ahr, H.J., 2001. Molec-
Martin, G.R., 1981. Isolation of a pluripotent cell line from early mouse embryos ular markers in embryonic stem cells. Toxicol. In Vitro 15, 455461.
cultures in medium conditioned by teratocarcinoma stem cells. Proc. Natl. zur Nieden, N.I., Kempka, G., Ahr, H.J., 2003. In vitro differentiation of embry-
Acad. Sci. 78 (12), 76347638. onic stem cells into mineralized osteoblasts. Differentiation 71, 1827.
Martin, I., Wendt, D., Heberer, M., 2004. The role of bioreactors in tissue zur Nieden, N.I., Kempka, G., Ahr, H.J., 2004. Molecular multiple endpoint
engineering. Trends Biotechnol. 22 (2), 8086. embryonic stem cell testa possible approach to test for the teratogenic
McGee, S.M., 1958. Histochemical methods for calcium. J. Histochem. 6, potential of compounds. Toxicol. Appl. Pharmacol. 194, 257269.
2241. zur Nieden, N.I., Kempka, G., Rancourt, D.E., Ahr, H.J., 2005. Induction of
Mullender, M., El Haj, A.J., Yang, Y., van Duin, M.A., Burger, E.H., chondro-, osteo- and adipogenesis in embryonic stem cells by bone mor-
Klein-Nulend, J., 2004. Mechanotransduction of bone cells in vitro: phogenetic protein-2: effect of cofactors on differentiating lineages. BMC
mechanobiology of bone tissue. Med. Biol. Eng. Comput. 42 (1), 1421. Dev. Biol. 5, 115.

The author has requested enhancement of the downloaded file. All in-text references underlined in blue are linked to publications on ResearchGate.