You are on page 1of 7

Peptides 37 (2012) 612

Contents lists available at SciVerse ScienceDirect

Peptides
journal homepage: www.elsevier.com/locate/peptides

Regulation of prolactin in mice with altered hypothalamic melanocortin activity


Roxanne Dutia a , Andrea J. Kim a , Eugene Mosharov b , Eriika Savontaus c , Streamson C. Chua Jr. d ,
Sharon L. Wardlaw a,
a
Department of Medicine, Columbia University College of Physicians & Surgeons, New York, NY, United States
b
Department of Neurology, Columbia University College of Physicians & Surgeons, New York, NY, United States
c
Department of Pharmacology, Drug Development and Therapeutics, University of Turku, Turku, Finland
d
Department of Medicine, Albert Einstein College of Medicine, New York, NY, United States

a r t i c l e i n f o a b s t r a c t

Article history: This study used two mouse models with genetic manipulation of the melanocortin system to inves-
Received 13 June 2012 tigate prolactin regulation. Mice with overexpression of the melanocortin receptor (MC-R) agonist,
Received in revised form 4 July 2012 -melanocyte-stimulating hormone (Tg-MSH) or deletion of the MC-R antagonist agouti-related pro-
Accepted 6 July 2012
tein (AgRP KO) were studied. Male Tg-MSH mice had lower blood prolactin levels at baseline (2.9 0.3
Available online 16 July 2012
vs. 4.7 0.7 ng/ml) and after restraint stress (68 6.5 vs. 117 22 ng/ml) vs. WT (p < 0.05); however,
pituitary prolactin content was not different. Blood prolactin was also decreased in male AgRP KO mice
Keywords:
at baseline (4.2 0.5 vs. 7.6 1.3 ng/ml) and after stress (60 4.5 vs. 86.1 5.7 ng/ml) vs. WT (p < 0.001).
Melanocortin
-MSH
Pituitary prolactin content was lower in male AgRP KO mice (4.3 0.3 vs. 6.7 0.5 g/pituitary, p < 0.001)
AgRP vs. WT. No differences in blood or pituitary prolactin levels were observed in female AgRP KO mice vs.
Prolactin WT. Hypothalamic dopamine activity was assessed as the potential mechanism responsible for changes
in prolactin levels. Hypothalamic tyrosine hydroxylase mRNA was measured in both genetic models vs.
WT mice and hypothalamic dopamine and 3,4-dihydroxyphenylacetic acid (DOPAC) content were mea-
sured in male AgRP KO and WT mice but neither were signicantly different. However, these results do
not preclude changes in dopamine activity as dopamine turnover was not directly investigated. This is
the rst study to show that baseline and stress-induced prolactin release and pituitary prolactin content
are reduced in mice with genetic alterations of the melanocortin system and suggests that changes in
hypothalamic melanocortin activity may be reected in measurements of serum prolactin levels.
2012 Elsevier Inc. All rights reserved.

1. Introduction portal blood and subsequently binds to dopamine-type 2 (D2)


receptors in lactotrophs and inhibits prolactin synthesis and release
Prolactin is a lactogenic hormone secreted by the anterior pitu- [1]. Although prolactin releasing factors do exist, prolactin secre-
itary that normally increases during pregnancy and lactation [8]. tion is primarily under tonic inhibitory dopamine control such that
Although a number of different factors have been shown to modu- antagonism of D2 receptors causes a robust stimulation of prolactin
late prolactin release, the most critical factor is dopamine produced release [1]. Prolactin is also regulated by a short-loop feedback
by tuberoinfundibular dopamine (TIDA) neurons in the arcuate system, in which prolactin inhibits its own release by binding to
nucleus of the hypothalamus [1]. These neurons project to the prolactin receptors on TIDA neurons [17,22]. Many factors can reg-
median eminence where dopamine is released into hypophyseal ulate prolactin release via modulation of the TIDA system. The
hypothalamic neuropeptides -MSH and AgRP are part of the brain
melanocortin system and have been shown to inhibit and stimu-
late prolactin release, respectively, when injected icv in rodents
Abbreviations: ACTH, adrenocorticotropin; AgRP, agouti-related protein; - and primates [1315,27,38,40,47]. These peptides are produced by
EP, -endorphin; CMV, cytomegalovirus; D2R, dopamine type-2 receptor; DHBA,
POMC and AgRP neurons in the arcuate nucleus and play a critical
3,4-dihydroxybenzylamine; DOPA, 3,4-dihydroxyphenylalanine; DOPAC, 3,4-
dihydroxyphenylacetic acid; MBH, mediobasal hypothalamus; MC-R, melanocortin role in regulating energy balance and metabolism [21]. Proopi-
receptor; -MSH, -melanocyte-stimulating hormone; PCA, perchloric acid; POMC, omelanocortin (POMC) is post-translationally processed to -MSH
proopiomelanocortin; Tg-MSH, MSH-overexpressing mice; TIDA, tuberoinfundibu- which is the agonist for MC3-R and MC4-Rs in the brain and pro-
lar dopaminergic.
motes negative energy balance, while AgRP is the antagonist for
Corresponding author at: Department of Medicine, Columbia University College
these receptors and promotes positive energy balance [21]. The
of Physicians & Surgeons, 630 West 168th Street, New York, NY 10032, United States.
Tel.: +1 212 305 3725; fax: +1 212 305 2282. melanocortin system also has a number of neuroendocrine effects
E-mail address: sw22@columbia.edu (S.L. Wardlaw). on the thyroid, gonadal and adrenal axes [11,19,37]. With respect

0196-9781/$ see front matter 2012 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.peptides.2012.07.006
R. Dutia et al. / Peptides 37 (2012) 612 7

to prolactin secretion, acute central injection of -MSH suppresses multiple tissues, including the hypothalamus and pituitary. Mice
basal blood prolactin levels as well as blunts increases in prolactin were backcrossed to a coisogenic C57BL/6J line, C57BL/6J-AwJ strain
due to stress, interleukin 1- administration, estrogen treatment, for six generations, and used for the current studies. This is a white-
or the surge on the day of proestrus [15,27,38,40]. Conversely, AgRP bellied agouti-colored line, which was used instead of black mice
has been shown to increase prolactin release and AgRP-induced to visualize the darkening effect of MSH on coat color. Studies were
increases in prolactin are blocked by -MSH [47]. The effects of performed in transgenic homozygous mice with control mice being
-MSH on prolactin release have been shown to be mediated by wild-type (WT) animals generated from the backcross at the N6
dopamine as -MSH cannot block dopamine-receptor antagonist generation.
induced increases in prolactin levels [15,38]. Furthermore, icv -
MSH increases DOPAC and 3,4-dihydroxyphenylalanine (DOPA) 2.1.2. AgRP KO
content specically in the median eminence [23]. The AgRP KO mouse line was obtained from Dr. Van der
There is evidence that endogenous -MSH may play a physi- Ploeg [31]. Mice were backcrossed to a coisogenic C57BL/6J line,
ological role in prolactin regulation as icv injection of an -MSH C57BL/6J-AwJ strain for seven generations. AgRP KO and WT mice
antiserum has been shown to enhance basal and stress-induced were generated from homozygous matings and mice were used
prolactin release in the rat [13]. There is also evidence of an anatom- in the experiments as indicated. Mice were genotyped using the
ical connection between POMC and TIDA neurons as revealed following primers: F1: 5 GCTTCTTCAATGCCTTTTGC 3 , F2: 5 GCCA-
by electron microscopy showing synaptic connections between GAGGCCACTTGTGTAG 3 , R: 5 GTTTCGGAGCCAAATGGTTA 3 .
POMC immunoreactive axon terminals and tyrosine hydroxylase-
immunopositive cell bodies and dendrites [10]. However, in 2.1.3. Stress-experiments
contrast at the pituitary level, there are some reports of stimulatory Animals were placed under light restraint stress for 5 or 15 min
effects of -MSH on prolactin including stimulation from cultured using TV-150 (Braintree Scientic, Braintree, MA) and 25 l of blood
mouse pituitary cells [25,45,46]. was obtained after stress.
It was unknown how chronic changes in hypothalamic
melanocortin activity would affect pituitary prolactin content and 2.2. Experimental procedures
release. Therefore, in this study, genetic models of increased
melanocortin signaling were employed to determine if chronic acti- 2.2.1. Experiment 1
vation of the melanocortin system by either increasing -MSH Effects of transgenic MSH overexpression on blood and pituitary
or eliminating AgRP signaling would suppresses prolactin levels. prolactin levels. Experiment 1a: A trunk blood sample was obtained
We used mice with overexpression of an N-terminal POMC trans- at sacrice from non-stressed male Tg-MSH and WT mice (n = 40
gene (Tg-MSH) that includes - and 3 -MSH (but not ACTH or or 43/group). Experiment 1b: A trunk blood sample was obtained
-EP) which were previously reported to possess a leaner pheno- at sacrice in male Tg-MSH and WT mice (n = 910/group) after
type, and mice with selective AgRP deletion, which were reported 5 min of restraint stress. Experiment 1c: At sacrice, pituitary was
to possess a metabolic phenotype similar to WT counterparts collected from male Tg-MSH and WT mice (n = 8 or 10/group).
[20,31,36]. Although the metabolic phenotypes have been carefully
described, the effects on prolactin regulation are unknown. In both 2.2.2. Experiment 2
mouse models, we investigated blood prolactin levels under both Effects of AgRP deletion on blood and pituitary prolactin lev-
unstressed and stressed conditions and measured pituitary pro- els. Experiment 2a: A submandibular blood sample was obtained
lactin content. Male mice were used in most experiments but these from non-stressed male AgRP KO and WT mice (n = 17 or 20/group)
parameters were investigated in female AgRP KO mice as well. For acclimated to handling. Experiment 2b: Trunk blood was obtained
comparison, basal and stress-induced corticosterone levels were at sacrice from non-stressed male AgRP KO and WT mice (n = 8 or
measured in parallel in several of these experiments. To investi- 11/group). Experiment 2c: Mice from Experiment 2a recovered and
gate the mechanism responsible for alterations in prolactin levels were subjected to restraint stress. Measurements were obtained
we measured mediobasal hypothalamic (MBH) tyrosine hydroxy- 5 and 15 min after stress (n = 1718/group). Experiment 2d: Male
lase activity and dopamine and DOPAC content, as well as the effects AgRP KO and WT mice (n = 16/group) were sacriced and the pitu-
of functional dopamine receptor antagonism. itary was collected. Experiment 2e: Female AgRP KO and WT mice
(n = 910/group) were utilized in this experiment. The stage of the
estrus cycle was monitored by daily vaginal smear. Blood samples
2. Materials and methods
were obtained on metestrus to minimize cyclic uctuations in pro-
lactin [2]. After 5 and 15 min of restraint stress, a blood sample was
2.1. Animals and treatment protocols
obtained. Mice were sacriced approximately 1.5 h later and the
pituitary was collected.
All animals were housed under barrier conditions with a 12-h
light, 12-h dark cycle. Animals had ad libitum access to water and
2.2.3. Experiment 3
rodent chow. Mice were handled regularly to limit any stress while
Effects of transgenic MSH overexpression or AgRP deletion
procedures were performed. All protocols were approved by the
on MBH tyrosine hydroxylase mRNA levels. Experiment 3a: Male
Columbia University Institutional Animal Care and Use Committee
Tg-MSH and WT mice (n = 8/group) were sacriced and an MBH
and were conducted in accordance with the NIH guide for the care
dissection was obtained for RNA analyses. Experiment 3b: Male
and use of laboratory animals.
AgRP KO and WT mice (n = 78/group) were sacriced and an MBH
dissection was obtained for RNA analyses.
2.1.1. Tg-MSH
Transgenic mice were generated as described previously 2.2.4. Experiment 4
to overexpress NH2-terminal POMC under the control of the Effects of AgRP deletion on MBH dopamine and DOPAC con-
cytomegalovirus (CMV) promoter [36]. The transgene contained tent. Male AgRP KO and WT mice (n = 7/group) were sacriced
part of the 5 UTR, the signal sequence, the sorting sequence, 3- and an MBH dissection (10 mg tissue) was collected for high-
MSH, the joining peptide, and -MSH, including the COOH-terminal performance liquid chromatography (HPLC) analyses. Samples
glycine necessary for amidation. The transgene was expressed in were homogenized in 0.1 N perchloric acid (PCA) with 50 ng/ml
8 R. Dutia et al. / Peptides 37 (2012) 612

Fig. 1. Effects of transgenic MSH overexpression on blood and pituitary prolactin levels. (A) Baseline plasma prolactin levels were signicantly lower in Tg-MSH mice vs. WT
mice. (B) Prolactin levels were signicantly lower in Tg-MSH mice vs. WT mice after 5 min of restraint stress. (C) Pituitary prolactin content was similar between Tg-MSH
and WT mice. *p < 0.05.

of 3,4-dihydroxybenzylamine (DHBA), which was utilized as an 3. Results


internal standard. Dopamine and DOPAC content were determined
by HPLC-EC and normalized to protein content in each sample as 3.1. Experiment 1: effects of transgenic MSH overexpression on
previously described [26]. blood and pituitary prolactin levels

Three different groups of mice were used in this experiment.


2.2.5. Experiment 5 In the rst group, male Tg-MSH mice were found to have signi-
Effects of AgRP deletion on serum prolactin levels after cantly lower baseline plasma prolactin levels at sacrice compared
dopamine receptor antagonism. Male AgRP KO and WT mice (n = 9 to WT mice (p < 0.05, Fig. 1A). A second set of mice were exposed to
or 11/group) were utilized in this experiment. A submandibular restraint stress for 5 min and then sacriced; plasma prolactin lev-
blood sample was obtained from non-stressed mice. After 2 weeks, els were also found to be lower in these Tg-MSH mice vs. WT mice
mice received a subcutaneous metoclopramide injection (2 g/g (p < 0.05, Fig. 1B). Notably, plasma corticosterone levels were not
body weight), and a blood sample was obtained after 30 min. different in these mice (WT 22.8 2.4 vs. Tg-MSH 20.7 1.0 g/dl,
p = 0.40). In another cohort of mice, pituitary prolactin content was
found to be similar between Tg-MSH and WT mice (Fig. 1C).
2.3. RNA and hormone measurements
3.2. Experiment 2: effects of AgRP deletion on blood and pituitary
2.3.1. Measurement of hypothalamic RNA levels
prolactin levels
RNA isolation was performed using the RNeasy Lipid Tissue
Mini Kit (Qiagen USA, Valencia, CA) in conjunction with the RNase-
3.2.1. Experiments 2a,b
Free DNase set (Qiagen USA) under the manufacturers instructions
Baseline serum prolactin levels obtained from a submandibu-
and total RNA was quantied using spectrophotometry. cDNA was
lar bleed were signicantly lower in male AgRP KO mice (p < 0.05,
synthesized using the Superscript III First-Strand cDNA Synthe-
Fig. 2A). Serum corticosterone levels were also measured in these
sis Kit (Life Technologies Corporation/Invitrogen, Grand Island,
mice and were found to be similar between groups (WT 1.9 0.3
NY) and was analyzed using quantitative RT-PCR performed with
vs. AgRP KO 1.6 0.3 g/dl, p = 0.64). In a separate cohort of AgRP
Lightcycler 480 SYBR Green I Master (Roche Applied Science, Indi-
KO mice, plasma prolactin levels at sacrice were also signicantly
anapolis, IN) in the Lightcycler 480 Real-Time PCR system (Roche
lower (KO 3.4 0.5 vs. WT 7.9 1.6 ng/ml, p < 0.05).
Applied Science). Samples were normalized to -actin. Primer
sequence: Tyrosine Hydroxylase: F5 CGAGGTGCCCAGTGGCGACC
3.2.2. Experiment 2c
3 , R5 GGTCCAGGTCCAGGTCAGGG 3 .
Mice from Experiment 2a were subjected to restraint stress
which increased serum prolactin levels; however stress-induced
2.3.2. Blood and pituitary hormone measurements prolactin levels were still signicantly lower in AgRP KO vs. WT
Blood was collected as plasma or serum and stored at 80 C. mice at both the 5 and the 15 min timepoints (p < 0.001, Fig. 2B).
The pituitary was homogenized in 0.1 N HCl and used for analyses. Serum corticosterone levels were analyzed in a subset of these
Prolactin levels were measured by a double antibody RIA with an mice after stress (n = 9 or 11/group) and it was found that stress-
antiserum to mouse prolactin and reference preparations provided induced corticosterone levels were not signicantly lower in AgRP
by the National Hormone and Pituitary Program. Puried mouse KO vs. WT mice at either the 5 or the 15 min timepoints (data not
prolactin was iodinated with I-125 by the lactoperoxidase method shown).
for use as tracer. Corticosterone levels were measured using a sen-
sitive double antibody RIA from MP Biomedicals (Irvine, CA, USA) 3.2.3. Experiment 2d
[30]. In another cohort of male mice, pituitary prolactin content was
found to be signicantly lower in AgRP KO vs. WT mice (p < 0.001,
Fig. 2C).
2.4. Statistical analysis
3.2.4. Experiment 2e
Statistical analysis was performed with Students t-test. p < 0.05 The estrous cycle of female AgRP KO and WT mice was mon-
was considered statistically signicant. Results are reported as itored daily and measurements were obtained on metestrus.
mean values SEM. Stress-induced serum prolactin levels were not different between
R. Dutia et al. / Peptides 37 (2012) 612 9

Fig. 2. Effects of AgRP deletion on blood and pituitary prolactin levels in male mice. (A) Baseline prolactin levels were signicantly lower in male AgRP KO vs. WT mice. (B)
Prolactin levels were signicantly reduced after 5 and 15 min of restraint stress in male AgRP KO vs. WT mice. (C) Pituitary prolactin content was signicantly lower in male
AgRP KO vs. WT mice. *p < 0.05, **p < 0.001.

Fig. 3. Effects of AgRP deletion on blood and pituitary prolactin levels in female
mice. (A) Prolactin levels were similar in female AgRP KO mice compared to WT
mice after both 5 and 15 min of restraint stress. (B) Pituitary prolactin content was
not different between female AgRP KO and WT mice (p = 0.23).
Fig. 5. Effects of AgRP deletion on mediobasal hypothalamic dopamine and DOPAC
levels. Dopamine and DOPAC levels were measured in AgRP KO and WT mice and
were found to be similar between groups.
AgRP KO and WT mice after either 5 or 15 min of restraint stress.
Pituitary prolactin content tended to be lower in AgRP KO vs. WT
mice; however this did not reach signicance (p = 0.23) (Fig. 3A and 3.4. Experiment 4: effects of AgRP deletion on MBH dopamine and
B). DOPAC content

MBH dopamine and DOPAC content were measured by HPLC


3.3. Experiment 3: effects of transgenic MSH overexpression or
from AgRP KO and WT mice. Analyses revealed that dopamine and
AgRP deletion on MBH tyrosine hydroxylase mRNA levels
DOPAC content were not different between groups (Fig. 5).

As tyrosine hydroxylase is the rate-limiting step in dopamine


3.5. Experiment 5: effects of AgRP deletion on serum prolactin
synthesis [5], we sought to investigate mRNA levels in the MBH
levels after dopamine receptor antagonism
of AgRP KO and WT mice and Tg-MSH and WT mice. Both the
AgRP KO (p = 0.29) and the Tg-MSH (p = 0.08) mice tended to have
Baseline serum prolactin levels were signicantly lower in
higher tyrosine hydroxylase mRNA expression compared to their
AgRP KO vs. WT mice (p < 0.05, Fig. 6A). Mice were injected
respective WT counterparts; however, this did not reach signi-
subcutaneously with metoclopramide and prolactin levels were
cance (Fig. 4A and B).
measured 30 min later. Serum prolactin levels increased with meto-
clopramide treatment; however, these levels were still signicantly
lower in AgRP KO mice (p < 0.001, Fig. 6B). The fold-increase in
prolactin levels from baseline was also similar between groups
(Fig. 6C).

4. Discussion

This study demonstrates that prolactin levels are lower with


two different genetic manipulations of the melanocortin system
resulting in either overexpression of the MC-R agonist -MSH, or
deletion of the antagonist AgRP. In male Tg-MSH and AgRP KO
mice, both baseline and stress-induced blood prolactin levels were
Fig. 4. Effects of transgenic MSH overexpression or AgRP deletion on MBH tyrosine signicantly lower compared to WT mice, and further, pituitary
hydroxylase mRNA expression. (A) No signicant difference in tyrosine hydroxylase
prolactin content was lower in male AgRP KO mice. However, no
mRNA was detected between AgRP KO and WT mice (p = 0.29). (B) Tyrosine hydrox-
ylase mRNA was not signicantly different between Tg-MSH vs. WT mice, however differences in serum or pituitary prolactin levels were detected in
expression tended to be higher in Tg-MSH mice (p = 0.08). female AgRP KO mice. As dopamine is well recognized to inhibit
10 R. Dutia et al. / Peptides 37 (2012) 612

Fig. 6. Effects of AgRP deletion on serum prolactin levels after dopamine receptor antagonism. Serum prolactin measurements were obtained from AgRP KO and WT mice
before and after metoclopramide treatment. (A) Baseline prolactin levels were lower in AgRP KO vs. WT mice. (B) Thirty minutes after metoclopramide injection prolactin
levels were still lower in AgRP KO vs. WT mice. (C) The fold-increase in prolactin levels after metoclopramide treatment was similar between groups. *p < 0.05, **p < 0.001.

prolactin secretion [1], dopamine metabolism was also inves- Furthermore, it should be noted that the failure to detect changes
tigated. Tyrosine hydroxylase mRNA, the rate-limiting step in in static measurements of dopamine and DOPAC content does not
dopamine synthesis [5], was measured in the MBH of both mouse preclude a role for dopamine in mediating the observed effects
models, and although a trend for increased levels was evident, it on prolactin, as dopamine turnover was not directly assessed. We
did not reach signicance in either group. Hypothalamic dopamine also used a D2R antagonist metoclopramide to investigate if block-
and DOPAC content were also examined in male AgRP KO and WT ing this receptor would yield a greater fold increase in prolactin
mice; however, no differences were detected. Finally, we used the release in AgRP KO mice compared to WT mice. However, we found
D2 receptor antagonist metoclopramide to investigate functional that prolactin levels were elevated to a similar degree after D2R
dopamine receptor antagonism and found that prolactin levels antagonism in AgRP KO and WT mice. It is possible that the chron-
were similarly increased in both groups after treatment. ically lower pituitary prolactin content in these mice affected their
Previous studies have shown that the melanocortin system response to metoclopramide.
can acutely regulate prolactin secretion. Central injections of - It is of interest that despite similarly lower blood prolactin lev-
MSH can suppress prolactin levels [15,27,38]. Oppositely icv AgRP els in male AgRP KO and Tg-MSH mice, pituitary prolactin content
increases prolactin levels and these increases can be blocked by was only lower in the AgRP KO mice. It should be noted that Tg-
-MSH [47]. Furthermore, the mu-opioid receptor agonist -EP, MSH mice express the transgene in the pituitary as well and have
which is not part of the melanocortin system per se, is also derived higher circulating levels of -MSH [36]. It is possible that -MSH
from POMC and interacts with -MSH to regulate prolactin secre- acting at the pituitary level prevented the fall in pituitary prolactin
tion by modulating hypothalamic dopamine turnover [6,9,44]. content in the Tg-MSH mice. This would be consistent with the
There is evidence that endogenous -MSH may play a physio- stimulatory effect of -MSH on prolactin release reported in vitro
logical role in prolactin regulation as icv injection of an -MSH in cultured lactotrophs [45]. However, given that basal and stress-
antiserum has been shown to enhance basal and stress-induced induced prolactin release is suppressed in Tg-MSH mice, the effects
prolactin release in the rat [14,15]. In contrast, there are several of -MSH on the dopaminergic regulation of prolactin appears to
reports demonstrating stimulatory effects of -MSH on prolactin. predominate.
-MSH has been shown to stimulate prolactin release and DNA In several experiments, we observed that while prolactin lev-
replication in cultured mouse lactotrophs and to sensitize these els were suppressed at either baseline or after stress in AgRP KO
cells to other secretagogues [25,29]. This appears to be via stimula- or MSH-Tg mice, corticosterone measured in the same mice were
tion of the MC3-R that is expressed by lactotrophs [25]. There is also not different between groups. This is important as it shows that
a report that an -MSH antiserum attenuates stimulation of pro- the mechanisms responsible for stress-induced prolactin and cor-
lactin by leptin [45]. Thus -MSH may modulate prolactin release ticosterone release in these models are distinct and only prolactin
at both the pituitary and the hypothalamic level. Most studies have release was affected by these genetic manipulations. A sexually
only investigated the relatively acute effects of -MSH on prolactin dimorphic effect of AgRP deletion on prolactin levels was also noted
release. Our study is the rst to demonstrate that chronic altered in this study. Although reproductive function was not formally
melanocortin signaling can affect prolactin levels. assessed, AgRP KO and WT mice appeared to reproduce with equal
Several lines of evidence support a role for hypothalamic frequency and yield similar litter sizes. As prolactin levels are crit-
dopamine in mediating the effects of -MSH on prolactin secretion. ical for reproduction and nursing including maternal behavior, it
For example, icv -MSH can no longer inhibit prolactin secre- is possible that there was developmental compensation in females
tion in the presence of a dopamine-receptor antagonist [15,38]. and hence lower prolactin levels were not evident in female mice
Anatomic studies have also shown that POMC-immunoreactive as they were in male mice [8]. Indeed, there is evidence for devel-
terminals contact tyrosine hydroxylase-positive cell bodies and opmental compensation in AgRP KO mice with respect to energy
dendrites in the hypothalamus of rats [10], showing a physical balance [31]. In this study, only stress-induced prolactin release
interaction between these neurons. Although the MC3-R is highly and pituitary content were measured in female AgRP KO mice at
expressed in the arcuate where TIDA neurons are localized, it is at one stage of the estrus cycle; however, there could be changes
present unclear which MC-R mediates effects of -MSH on TIDA under other conditions such as pregnancy or suckling that were
activity. In this study, we were unable to show that increased not examined.
dopaminergic activity was responsible for the suppression of pro- In addition to the data showing that -MSH may regulate
lactin levels in AgRP KO mice. We investigated tyrosine hydroxylase dopamine turnover in the hypothalamus, there is evidence that
gene expression and dopamine and DOPAC content in the MBH of dopamine may regulate POMC in the hypothalamus [24,33,43]. Fur-
AgRP KO and WT mice. Although we did not detect a change in tyro- thermore, a positive correlation was reported between Pomc mRNA
sine hydroxylase mRNA levels, this does not preclude a change in and tyrosine hydroxylase mRNA in the MBH of the rat suggesting
enzyme activity as tyrosine hydroxylase activity was not measured. coregulation or functional interaction between these two neuronal
R. Dutia et al. / Peptides 37 (2012) 612 11

systems [32]. Thus there is evidence for bidirectional interactions [17] Kokay IC, Grattan DR. Expression of mRNA for prolactin receptor (long
between the hypothalamic dopamine system and melanocortin form) in dopamine and pro-opiomelanocortin neurones in the arcuate
nucleus of non-pregnant and lactating rats. J Neuroendocrinol 2005;17:
pathways that play critical roles in maintaining energy homeostasis 82735.
[4,12,18,39,42]. [18] Lacruz A, Baptista T, de Mendoza S, Mendoza-Guillen JM, Hernandez L.
This study provides additional evidence to support func- Antipsychotic drug-induced obesity in rats: correlation between leptin,
insulin and body weight during sulpiride treatment. Mol Psychiatry 2000;5:
tional interactions between the hypothalamic melanocortin and 706.
dopaminergic systems that may be reected by plasma pro- [19] Lechan RM, Fekete C. The TRH neuron: a hypothalamic integrator of energy
lactin levels. Prolactin is known to affect energy balance and metabolism. Prog Brain Res 2006;153:20935.
[20] Lee M, Kim A, Chua Jr SC, Obici S, Wardlaw SL. Transgenic MSH overexpression
fuel metabolism and has also been shown to stimulate AgRP
attenuates the metabolic effects of a high-fat diet. Am J Physiol Endocrinol
[3,7,28,35,41]. There is some evidence that prolactin is elevated Metab 2007;293:E12131.
in human obesity and it has been postulated that the eleva- [21] Lee M, Wardlaw SL. The central melanocortin system and the regulation of
energy balance. Front Biosci 2007;12:39944010.
tions in prolactin may result from decreased inhibitory input from
[22] Lerant A, Freeman ME. Ovarian steroids differentially regulate the expression
hypothalamic dopaminergic neurons [16,34]. It may thus be that of PRL-R in neuroendocrine dopaminergic neuron populations: a double label
elevated prolactin levels are a marker for decreased brain dopamin- confocal microscopic study. Brain Res 1998;802:14154.
ergic activity which in turn reects a decrease in hypothalamic [23] Lindley SE, Lookingland KJ, Moore KE. Activation of tuberoinfundibular but not
tuberohypophysial dopaminergic neurons following intracerebroventricular
melanocortin activity. The current study shows that prolactin levels administration of alpha-melanocyte-stimulating hormone. Neuroendocrinol-
are reduced in genetic models of increased melanocortin signal- ogy 1990;51:3949.
ing and suggests that melanocortin induced changes in dopamine [24] Matera C, Wardlaw SL. Dopamine and sex steroid regulation of POMC
gene expression in the hypothalamus. Neuroendocrinology 1993;58:
turnover may be reected in measurements of serum prolactin lev- 493500.
els. The hypothesis that circulating prolactin levels may serve as [25] Matsumura R, Takagi C, Kakeya T, Okuda K, Takeuchi S, Takahashi S. Alpha-
a biomarker of central melanocortinergic and dopaminergic tone melanocyte-stimulating hormone stimulates prolactin secretion through
melanocortin-3 receptors expressed in mammotropes in the mouse pituitary.
deserves further study. Neuroendocrinology 2003;78:96104.
[26] Mosharov EV, Larsen KE, Kanter E, Phillips KA, Wilson K, Schmitz Y, et al.
Interplay between cytosolic dopamine, calcium, and alpha-synuclein causes
Acknowledgments selective death of substantia nigra neurons. Neuron 2009;62:21829.
[27] Newman CB, Wardlaw SL, Frantz AG. Suppression of basal and stress-induced
prolactin release and stimulation of luteinizing hormone secretion by alpha-
This work was supported by NIH Grant DK080003 (S.L.W.). melanocyte-stimulating hormone. Life Sci 1985;36:16618.
We would like to thank Kana Meece and Shveta Dighe for their [28] Noel MB, Woodside B. Effects of systemic and central prolactin injections on
food intake, weight gain, and estrous cyclicity in female rats. Physiol Behav
technical assistance.
1993;54:1514.
[29] Nunez L, Frawley LS. Alpha-MSH potentiates the responsiveness of mam-
motropes by increasing Ca2+ entry. Am J Physiol 1998;274:E9717.
References [30] Papadopoulos AD, Wardlaw SL. Endogenous alpha-MSH modulates the
hypothalamicpituitaryadrenal response to the cytokine interleukin-1beta.
[1] Ben-Jonathan N. Dopamine: a prolactin-inhibiting hormone. Endocr Rev J Neuroendocrinol 1999;11:3159.
1985;6:56489. [31] Qian S, Chen H, Weingarth D, Trumbauer ME, Novi DE, Guan X, et al.
[2] Butcher RL, Collins WE, Fugo NW. Plasma concentration of LH, FSH, prolactin, Neither agouti-related protein nor neuropeptide Y is critically required
progesterone and estradiol-17beta throughout the 4-day estrous cycle of the for the regulation of energy homeostasis in mice. Mol Cell Biol 2002;22:
rat. Endocrinology 1974;94:17048. 502735.
[3] Byatt JC, Staten NR, Salsgiver WJ, Kostelc JG, Collier RJ. Stimulation of food [32] Rasmussen DD, Jakubowski M, Allen DL, Roberts JL. Positive corre-
intake and weight gain in mature female rats by bovine prolactin and bovine lation between proopiomelanocortin and tyrosine hydroxylase mRNA
growth hormone. Am J Physiol 1993;264:E98692. levels in the mediobasohypothalamus of ovariectomized rats: response
[4] Cincotta AH, Tozzo E, Scislowski PW. Bromocriptine/SKF38393 treatment ame- to estradiol replacement and withdrawal. Neuroendocrinology 1992;56:
liorates obesity and associated metabolic dysfunctions in obese (ob/ob) mice. 28594.
Life Sci 1997;61:9516. [33] Rasmussen DD, Liu JH, Wolf PL, Yen SS. Neurosecretion of human hypothalamic
[5] Daubner SC, Le T, Wang S. Tyrosine hydroxylase and regulation of dopamine immunoreactive beta-endorphin: in vitro regulation by dopamine. Neuroen-
synthesis. Arch Biochem Biophys 2011;508:112. docrinology 1987;45:197200.
[6] Deyo SN, Swift RM, Miller RJ. Morphine and endorphins modulate dopamine [34] Rojdmark S, Rossner S. Decreased dopaminergic control of prolactin secretion
turnover in rat median eminence. Proc Natl Acad Sci U S A 1979;76:30069. in male obesity: normalization by fasting. Metabolism 1991;40:1915.
[7] Freemark M, Fleenor D, Driscoll P, Binart N, Kelly P. Body weight and fat depo- [35] Sauve D, Woodside B. The effect of central administration of prolactin on food
sition in prolactin receptor-decient mice. Endocrinology 2001;142:5327. intake in virgin female rats is dose-dependent, occurs in the absence of ovar-
[8] Grattan DR, Kokay IC. Prolactin: a pleiotropic neuroendocrine hormone. J Neu- ian hormones and the latency to onset varies with feeding regimen. Brain Res
roendocrinol 2008;20:75263. 1996;729:7581.
[9] Gudelsky GA, Porter JC. Morphine- and opioid peptide-induced inhibi- [36] Savontaus E, Breen TL, Kim A, Yang LM, Chua Jr SC, Wardlaw SL. Metabolic
tion of the release of dopamine from tuberoinfundibular neurons. Life Sci effects of transgenic melanocyte-stimulating hormone overexpression in lean
1979;25:1697702. and obese mice. Endocrinology 2004;145:388191.
[10] Horvath TL, Naftolin F, Leranth C. Beta-endorphin innervation of dopamine [37] Savontaus E, Conwell IM, Wardlaw SL. Effects of adrenalectomy on AGRP,
neurons in the rat hypothalamus: a light and electron microscopic double POMC, NPY and CART gene expression in the basal hypothalamus of fed and
immunostaining study. Endocrinology 1992;131:154755. fasted rats. Brain Res 2002;958:1308.
[11] Israel DD, Sheffer-Babila S, de Luca C, Jo YH, Liu SM, Xia Q, et al. Effects of [38] Scimonelli T, Celis ME. A central action of alpha-melanocyte-stimulating
leptin and melanocortin signaling interactions on pubertal development and hormone on serum levels of LH and prolactin in rats. J Endocrinol
reproduction. Endocrinology 2012;153:240819. 1990;124:12732.
[12] Jones B, Basson BR, Walker DJ, Crawford AM, Kinon BJ. Weight change and atyp- [39] Scislowski PW, Tozzo E, Zhang Y, Phaneuf S, Prevelige R, Cincotta AH. Bio-
ical antipsychotic treatment in patients with schizophrenia. J Clin Psychiatry chemical mechanisms responsible for the attenuation of diabetic and obese
2001;62(Suppl. 2):414. conditions in ob/ob mice treated with dopaminergic agonists. Int J Obes Relat
[13] Khorram O, Bedran de Castro JC, McCann SM. Physiological role of alpha- Metab Disord 1999;23:42531.
melanocyte-stimulating hormone in modulating the secretion of prolactin and [40] Shalts E, Feng YJ, Ferin M, Wardlaw SL. Alpha-melanocyte-stimulating hor-
luteinizing hormone in the female rat. Proc Natl Acad Sci U S A 1984;81:80048. mone antagonizes the neuroendocrine effects of corticotropin-releasing
[14] Khorram O, Bedran de Castro JC, McCann SM. Stress-induced secretion of alpha- factor and interleukin-1 alpha in the primate. Endocrinology 1992;131:
melanocyte-stimulating hormone and its physiological role in modulating the 1328.
secretion of prolactin and luteinizing hormone in the female rat. Endocrinology [41] Strader AD, Buntin JD. Changes in agouti-related peptide during the ring dove
1985;117:24839. breeding cycle in relation to prolactin and parental hyperphagia. J Neuroen-
[15] Khorram O, Mizunuma H, McCann SM. Effect of alpha-melanocyte-stimulating docrinol 2003;15:104653.
hormone on basal and stimulated release of prolactin: evidence for dopamin- [42] Szczypka MS, Rainey MA, Kim DS, Alaynick WA, Marck BT, Matsumoto AM,
ergic mediation. Neuroendocrinology 1982;34:4337. et al. Feeding behavior in dopamine-decient mice. Proc Natl Acad Sci U S A
[16] Kok P, Roelfsema F, Frolich M, Meinders AE, Pijl H. Prolactin release is enhanced 1999;96:1213843.
in proportion to excess visceral fat in obese women. J Clin Endocrinol Metab [43] Tong Y, Pelletier G. Role of dopamine in the regulation of proopiomelanocortin
2004;89:44459. (POMC) mRNA levels in the arcuate nucleus and pituitary gland of the female
12 R. Dutia et al. / Peptides 37 (2012) 612

rat as studied by in situ hybridization. Brain Res Mol Brain Res 1992;15: [46] Watanobe H, Schioth HB, Wikberg JE, Suda T. The melanocortin 4 recep-
2732. tor mediates leptin stimulation of luteinizing hormone and prolactin surges
[44] Van Vugt DA, Bruni JF, Sylvester PW, Chen HT, Ieiri T, Meites J. Interaction in steroid-primed ovariectomized rats. Biochem Biophys Res Commun
between opiates and hypothalamic dopamine on prolactin release. Life Sci 1999;257:8604.
1979;24:23617. [47] Xiao E, Xia-Zhang L, Vulliemoz NR, Ferin M, Wardlaw SL. Agouti-related
[45] Watanobe H, Schioth HB, Izumi J. Pivotal roles of alpha-melanocyte-stimulating protein stimulates the hypothalamicpituitaryadrenal (HPA) axis and
hormone and the melanocortin 4 receptor in leptin stimulation of prolactin enhances the HPA response to interleukin-1 in the primate. Endocrinology
secretion in rats. J Neurochem 2003;85:33847. 2003;144:173641.