You are on page 1of 6

LEONES POR LA SALUD

Leones por la Salud les enva un saludo, espero que


este banco les sirva, y que ms que leer bancos realmente estudien y no se les olvide el
libro! Cudense
P.D. Disculpen faltas ortogrficas o errores que puedan haber.

Cual es la importancia biolgica de que la doble hlice de DNA est unida por puentes de
hidrgeno y no por enlaces covalentes
para que se mantenga unida todo el tiempo como una estructura rgida
para evitar que sucedan mutaciones
para permitir que la doble hlice se separa con facilidad en el proceso de replicacin
para poder interactuar ms fcilmente con protenas nucleares

Fase del ciclo celular en que se presenta la mayor actividad de la DNA polimerasa delta
Mitosis
Go
G1
G2
S

La secuencia de nucletidos en la cadena molde de DNA que corresponde al aminocido


metionina es
AUG
ATG
CAT
TAC

Todas las siguientes son caractersticas de un RNA transcrito primario excepto


es ms grande que el RNA maduro.
Contiene secuencia de nucletidos que no estn presentes en el RNA funcional.
Puede contener informacin para producir ms de una protena.
Contiene la caja TATA

Fase durante la divisin celular en la cual el DNA se encuentra menos compactado


G1
M
G2
S

Son elementos requeridos para la sntesis de protenas en eucariotes a excepcin de


RNAm
Ribosomas
GTP
20 diferentes aminocidos en la forma de aminoacil-tRNAs.
Factores transcripcionales

LEONES POR LA SALUD VOZ UNIVERSITARIA


LEONES POR LA SALUD

El proceso de replicacin del DNA en eucariotas es


Semiconservador, unidireccional, simultneo
Bidireccional, semiconservador, multifocal y simultneo
Semiconservador, monofocal, bidireccional
Unidireccional, secuencial, simultneo, semiconservador y multifocal

Cuntos aminocidos formaran el polipptido codificado en este RNAm La secuencia kozak


conteniendo el codn de iniciacin se especifica en letras negritas:
5capGCAGCCACCAUGGCAAACUACUCGGCGGUUGCCGCAUAGUUAACUAGCUA-Poli A 3
9
10
8
Impredecible

Los fragmentos de Okazaki son:


Tramos largos de DNA sintetizados en la cadena lder durante la replicacin del DNA
Tramos cortos de DNA que actan como iniciadores (primers) durante la replicacin del DNA
Segmentos de DNA producidos por enzimas de restriccin
Tramos pequeos de DNA que se agregan al final de los telmeros durante la replicacin del DNA
Tramos cortos de DNA sintetizados en la cadena retrasada durante la replicacin del DNA

La estructura primaria del DNA est definida por


El tipo de histonas que se le unen
El nmero de nucleosoma
La secuencia de nucletidos
El empaquetamiento del cromosoma

Es una purina
Timina
Adenina
Citosina
Ninguna

Si la tetraciclina impide la fijacin del RNAt-aa en el sitio A de la subunidad menor del ribosoma, se
interrumpe el proceso de
Replicacin
Transcripcin
Traduccin
Ninguno de los anteriores

Durante el proceso de transcripcin en eucariotes


La RNA polimerasa II sintetiza el RNAt
Los exones e intrones se transcriben formando el RNAhn
Se requiere de una ligasa para unir las hebras discontinuas
Solo se transcriben los exones

Es un proceso que no participa en la maduracin del RNAm


Los intrones son removidos del RNAhn
La cola de poli A se agrega al RNAm naciente
La secuencia primaria de nucletidos del RNA es alterada postrancripcionalmente
Al RNAm se le agrega la 7 metil guanosina en el extremo 5.

LEONES POR LA SALUD VOZ UNIVERSITARIA


LEONES POR LA SALUD

Propiedad del DNA que permite que la doble hebra se separe en el proceso que se llama
desnaturalizacin por calor y que adems al enfriar lentamente la hebras se vuelvan a unir
la absorbancia de luz uv a 260 nm
Poca solubilidad a pH neutro
Los surcos mayores y menores
La complementaridad de bases
El enlace fosfodiester

Caracterstica que no pertenece a las clulas procariotas


Membrana Celular en forma de mosaico fluido
Ribosomas
DNA en forma de doble hlice
Mitocondrias

Cual de estas caractersticas no corresponde al DNA de eucariotes


Contiene la informacin gentica
Est formado por una cadena sencilla de nucletidos
Contiene Timina en lugar de Uracilo
Presenta desoxirribosa como azcar
Los nucletidos se unen mediante enlace fosfodiester

Cual de estos elementos no es necesario para la replicacin del DNA


RNA cebador
Factor Transcripcional
DNA polimerasa
Helicasa
dATP, dCTP, dGTP, dTTP

RNA polimerasa dirigida por DNA que sintetiza al cebador


Topoisomerasa
Helicasa
Girasa
Primasa
DNA polimerasa delta

El complejo formado por histonas y DNA se llama


Solenoide
Octmero
Nucletido
Nucleosoma

Investigador que en 1869 descubre la nuclena


Avery, MacLeod y McCarty
Mendel
Watson y Crick
Jacob y Monod
Frederick Miescher
Ninguno de los anteriores

A qu se refiere el dogma central de la biologa molecular


El DNA es la nica molcula de la herencia
La transcriptasa reversa es la base del dogma Central
El flujo de informacin gentica es DNA , RNA, Protena
El flujo de la informacin gentica es : RNA, Protena, DNA

LEONES POR LA SALUD VOZ UNIVERSITARIA


LEONES POR LA SALUD

Conjunto de reacciones por medio de las cuales se duplica el DNA


Cdigo gentico
traduccin
Retrotranscripcin
Replicacin

Son componentes de un nucletido


Base nitrogenada, hexosa azcar
Nuclesido y grupo fosfato
Base nitrogenada, grupo fosfato y hexosa
Pentosa y nuclesido

La complementariedad de bases se da entre


A-T G-C
A-C T-G
G-A C-T
ninguna

Es el tipo de enlace que mantiene unidas las 2 hebras de DNA


Puente peptdico
Puente de hidrgeno
Enlace glucosdico
Enlace fosfodister

Es una caracterstica de la doble hlice de DNA


las cadenas individuales no son helicoidales
los puentes de hidrgeno se forman entre una base de purina y una pirimidina en la misma cadena
la adenina de una cadena est unida por puentes de hidrgeno a la timina en la otra cadena
las uniones fosfodister estn orientadas hacia el interior de la hlice

El solenoide est compuesto por


ncleo y ribosomas
seis nucleosomas
nucleolo y protenas
DNA y RNA ribosomal

Elemento que no se encuentra en el DNA


Oxigeno
Nitrgeno
Carbono
Azufre
Fsforo

Fase durante la divisin celular en la cual los cromosomas se encuentran condensados


G1
M
G2
G0
S

La funcin de la telomerasa es
Remover regiones de DNA no pareada (de una sola hebra) en el extremo de los cromosomas

LEONES POR LA SALUD VOZ UNIVERSITARIA


LEONES POR LA SALUD

Remover los iniciadores de RNA localizados en los extremos del DNA


Sintetizar DNA en los extremos de la cadena sin el uso de iniciadores
Sintetizar iniciadores especiales al final de DNA

Es una pirimidina
Timina
Adenina
Guanina
Ninguna

La edicin del RNA es un proceso en el que


Los intrones son removidos del pre-RNAm
La cola de poli A se agrega al RNAm naciente
La secuencia primaria de nucletidos del RNA es alterada postrancripcionalmente
El RNA se traduce a una protena

Modificacin postranscripcional que determina la vida media del RNAm


Eliminacin de intrones y empalme de exones
Adicin de la caperuza en el extremo 5
Adicin de la cola poli A en el extremo 3
Adicin de la cola poli C en el extremo 3

Para que se lleve a cabo la replicacin se necesita


RNA cebador
dATP, dCTP, dGTP, dTTP
Ambas
Ninguna

Para que se lleve a cabo la transcripcin de genes en eucariotes se necesita


Factores transcripcionales
RNA-pol
Ambas
Ninguna

Cual de las siguientes enzimas puede encontrarse con gran actividad durante la interfase del ciclo
celular
DNA polimerasa
RNA polimerasa II
Ambas
Ninguna

El producto de la transcripcion por la RNA polimerasa III es


RNAr 18S, 28 S y 5.8S
RNAhn
RNAt y RNAr 5S
RNA mitocondrial
Ninguna de las anteriores

Cual caracterstica no corresponde a la molcula de DNA


Est formada por desoxinucletidos
Forma complementaridad de bases con A-G y C-T
Es la molcula que sirve de molde durante la sntesis de protenas
Se replica en el ncleo de la clula eucaritica en la fase S

LEONES POR LA SALUD VOZ UNIVERSITARIA


LEONES POR LA SALUD

Contiene dos hebras antiparalelas

Protena que no participa en la replicacin


Ligasa
Telomerasa
Helicasa
RNA polimerasa
SSBP

Genes que transcribe la RNA polimerasa tipo I


rRNA de 28S, 18S y 5.8S
RNAm
RNAt y RNAs pequeos
RNAsn

Un promotor es
Una protena que participa en el inicio de la transcripcin
Una secuencia en el DNA donde se unen factores transcripcionales
La regin en el RNAm que determina la terminacin de la transcripcin
Una secuencia en el DNA que favorece el proceso de la traduccin

Es el enlace que mantiene unida las 2 hebras de DNA


Puente peptdico
Enlace fosfodiester
Puente de hidrgeno

LEONES POR LA SALUD VOZ UNIVERSITARIA