NAMA : SYAMSUDDIN B

NIM : 1514141004

KELAS : BIOLOGI SAINS

TUGAS MEMBUAT POHON FOLOGENETIK

1. Menentukan nukleotida semua spesies

2. Membandingkan nukleotida spesies dengan menggunakan BLAST

3. Hasil blast nukleotida antara 2 spesies .

Memasukkan susunan sequences pada sequenced in any supported format dengan kode >Nucseq1 dst .4. Menentukan Phylogenetic tree menggunakan Clustal omega 5.

Step 2 set your parameters dan pilih FASTA 7. Klik submit 8. Didapatkan Aligments seperti dibawah Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa ------------------------------------------------------------ Nuqsec3Ficusbenjamina ------------------------------------------------------------ Nuqsec5Ficuselastica ------------------------------------------------------------ Nuqsec4Ficuscarica -----------------------------------------CGATTT------------- Nuqsec2>Artocarpusheterophylus AAAGATGCCTCTTCTTTGCATTTATTACGGTTTTTTCTTCACGATTATTTTAATCGGAAT Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ . 6.

Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa ------------------------------------------------------------ Nuqsec3Ficusbenjamina ------------------------------------------------------------ Nuqsec5Ficuselastica ------------------------------------------------------------ Nuqsec4Ficuscarica --------TAGTCCTGGAAAGATT--------------GGTTGGAACTACCAAGTGATAC Nuqsec2>Artocarpusheterophylus ACTCTTATTATTCCAAATAAATATATTTCTATTTTTTCAAAAAGTACTCCAAGATTATTC Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa -----------------------------------AAAAGCATTTTCCTTTAA------- Nuqsec3Ficusbenjamina -----ATTGTTGAGGGTCTCATG-------------ACTACCGTGCAC-----TCCATTA Nuqsec5Ficuselastica -----ATTGTTGAGGGTSTCATG-------------ACTACCGTGCAC-----TCCCCTA Nuqsec4Ficuscarica TTTCAAATTCAGAGAAACCCTGGAATTAAAAATGGGAAAACCTGAGC------------- Nuqsec2>Artocarpusheterophylus T-TCTTTATATATAATTCTCATGTT-------TGTGAATA-CGAATCCATCTTACTTTTT Nuqsec1Artocarpusaltilis ----------------------------------------------------ATCTTTGG Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa -----TCTCCAGACTCCAATCAGGCA----------------GTCCATTGTTGACCAAAA Nuqsec3Ficusbenjamina CTGCAA-CCCAGAAAACTGTTGATGG---TCCATCAT----------------------- Nuqsec5Ficuselastica CTGCAA-CCCAGAAAACTGTTGATGG---TCCATCMT----------------------- Nuqsec4Ficuscarica ---CAAATCCGGTTTTCTGAAA-ACAA-ACAAGGGTTCAGAAGGCGAT-AATAA------ Nuqsec2>Artocarpusheterophylus CTACGTAACCAATCTTCTCATTTACGATTAACATCTTCTGGAGGCTTT-TTTGAGCGAAT Nuqsec1Artocarpusaltilis AGATGATTCCGTACTACAA----------------------------------------- Nuqsec7Morusalba ------------------A----------------------------------------- Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa A---ACAAAAGGGCATGAGT------------GGTGTTGG------------CACCACTA Nuqsec3Ficusbenjamina ------CGAAGGACTGGAGAGG--------TGGAAG------------------------ Nuqsec5Ficuselastica ------CGAAGGACTGGAGAGG--------TGGAAG------------------------ Nuqsec4Ficuscarica ------AAAAGGATAGGTGCAGAGACTCAATGGAAG------------------------ Nuqsec2>Artocarpusheterophylus ATATTTCTATGGAAAAATAAAACATCCCG-TAGAAGAAGTCTTTGCTAATGATTCTCCGA Nuqsec1Artocarpusaltilis ----TTCGGTGG------------------------------------------------ Nuqsec7Morusalba ----AACGATG------------------------------------------------- Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa CTTACAGATGAGTAGGTTCCAAAGTGGGACCCACATCCCACGAATTAGTAGTAGTGGTAC Nuqsec3Ficusbenjamina --------------------------AG--CCGCTTCATTCAACATCAT---------TC Nuqsec5Ficuselastica --------------------------AG--CCGCTTCATTCAACATCAT---------TC Nuqsec4Ficuscarica -------------------------------CTGTTCTAACAAATG-------------- Nuqsec2>Artocarpusheterophylus CTAGCTT-----ATGGTTCCT-CGAGGA--TCTCTTCATGCATTATGTTA-----GATAT Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa CGGGCACCACTGA------------TGCCTAATAGCACTGATCTCATCATTTCTTTCA-- Nuqsec3Ficusbenjamina CCAGCAGCACCGGAGCAGCCAAGGCTGTCGGAAAGGTTCTGCCATCTCTTAACGGGAAA- Nuqsec5Ficuselastica CCAGCAGCMCCGGAGCAGCCAAGGCTGTCGGAAAGGTTCTGCCATCTCTTAACGGGAAA- Nuqsec4Ficuscarica -----------------GAGTTGGCTGC---GGTG-----------------CGT----- Nuqsec2>Artocarpusheterophylus CAAGGAAAA-----TCAATTTTGGCTTC---AAAGGATACG---CCTCTTTTCATGAATA Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa ---------------------TATTCTGACAGAGAA--------------TTACTGAACA Nuqsec3Ficusbenjamina -----------------------------------------------------CTGACTG Nuqsec5Ficuselastica -----------------------------------------------------CTGACTG Nuqsec4Ficuscarica ----------------------------------------TAG-TAAAGGAATCACTCCA Nuqsec2>Artocarpusheterophylus AATGGAAATATTACCTTGTCCTTTTATGGCAATGTCATTTTTATGTGTGGTCTC-AACCA Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca ------------------------------------------------------------ Nuqsec6Ficusreligiosa AGCTGGTGTTGTTCTATCCCTGGATCCAAA-ACCAATTGAGGTAATCCATAGGAAAATCA Nuqsec3Ficusbenjamina GAA-----------TGTCCT----TCCGTGTTCCTACAGTGGACGT----------CTCA Nuqsec5Ficuselastica GAA-----------TGTCCT----TCCGTGTTCCTACAGTGGACGT----------CTCA Nuqsec4Ficuscarica GAAAGGATGAAGAATAAACCTATATACGTATACGTACTGAAATAGT----------ATCT Nuqsec2>Artocarpusheterophylus GGAAGGATGTATATAAACCAATTATGCA--AACAT------------------------- Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca -------------------------------------ATGGC------------------ Nuqsec6Ficusreligiosa CAAGATGATTATATTTTTCATTTTCCAAAAATTCTTCTTAGCCAATATTTAACATTT--- Nuqsec3Ficusbenjamina -----------------------------G------------------------------ Nuqsec5Ficuselastica -----------------------------G------------------------------ Nuqsec4Ficuscarica TCAAATGATTAATGA---C--AACCCAAAT---CCGTATTTCTTTTAATTTTCATGAAAA Nuqsec2>Artocarpusheterophylus ----------------------TCCCTCAG---CTTTTTG--GGCTATCTTTCAAGTA-- Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ .

: Nuqsec8MusaParadisiaca -------------------ATCACAAGGAGGGAGGAGGCGGAATAG-TGGAGAAGATCAA Nuqsec6Ficusreligiosa AGTAAAAATTTGAAAAAATATTTCT---TATATAACTGCTATAATGCTAA---------- Nuqsec3Ficusbenjamina --------------------------------------------------TTTGGGT--- Nuqsec5Ficuselastica --------------------------------------------------TTTGGGT--- Nuqsec4Ficuscarica AGTAAGA----GGAA----AATCCGT---------CGACTTTAAAAATCGTGAGGGTTCA Nuqsec2>Artocarpusheterophylus -------------TA---TTGACCGATTTGTGTGT------------------------- Nuqsec1Artocarpusaltilis AGCATGT----GTAA---AAGCTCGTAATGAGGGACGTG-ATCTTGCTCGTGAGGGTAAT Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca GGAAAAGATC-------------CATGGCGG-AGAGGAACACGGGGAGAAGAAGAAGGAG Nuqsec6Ficusreligiosa --A--TAATC-----ACTGGTTTTTTGTAGTACAAAGAGCACGAGG-GAAG--------- Nuqsec3Ficusbenjamina ------------------------------T-------ACACTGAA-GATG--------- Nuqsec5Ficuselastica ------------------------------T-------ACACTGAA-GATG--------- Nuqsec4Ficuscarica ----------------------------AGTCC--------------------------- Nuqsec2>Artocarpusheterophylus ----------------------ATATG--------------------------------- Nuqsec1Artocarpusaltilis GAAATTATTCGTGAGGCTAGT-AAATGGAGTCCTGAACTAGCTGCT-GCTT--------- Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca AAGAAGAAGAAGGAGAAGAAGAAGCACGGTGAGGAGCACCATGGCGACAGC--AGCAGCA Nuqsec6Ficusreligiosa ---------ATGGAGGATACGAAGCTATT--AAGAAGGCGATTTTGAA------TCTGT- Nuqsec3Ficusbenjamina ---------ATGTTGTGT-C-------TA--CCGACTTCGTTGGTGACAG--------CC Nuqsec5Ficuselastica ---------ATGTTGTGT-C-------TA--CCGACTTCGTTGGTGACAG--------CA Nuqsec4Ficuscarica ---------------------------------------------------------CTC Nuqsec2>Artocarpusheterophylus -------------------------------CAGAAATCTTTTT---CATTATTACAGTG Nuqsec1Artocarpusaltilis ---------GTGAAGTGT-G-------GA--AGGAAATCAAATTTGAATTCGAAGCAATG Nuqsec7Morusalba -----------------------------------------------AATCGTTGCAATA Nuqsec8MusaParadisiaca G-----C--------AGCGACAGCGACTAG----------------- Nuqsec6Ficusreligiosa ----------------------------------------------- Nuqsec3Ficusbenjamina G---------------------------------------------- Nuqsec5Ficuselastica G---------------------------------------------- Nuqsec4Ficuscarica TATCCCCAAAA------------------------------------ Nuqsec2>Artocarpusheterophylus GATCCTCAAAAAAAAAGAGTTTGTATCGAGTAAAATATATACTTCGG Nuqsec1Artocarpusaltilis GATACTTTGTAA----------------------------------- Nuqsec7Morusalba GATGTT----------------------------------------- .Nuqsec8MusaParadisiaca ------------------------------------AGGAATCATTCACAAGATAGAGGA Nuqsec6Ficusreligiosa -------------------------------------GGATAAAATTTCTTGTTA----- Nuqsec3Ficusbenjamina ------------TTGTTGATCTCACTGTCAGGCTTCAGAAGTCT---GC----------- Nuqsec5Ficuselastica ------------TTGTTGATCTCACTGTCAGGCTTCAGAAGTCT---GC----------- Nuqsec4Ficuscarica ATTAAAGAATTATTGTAAATCAATTATTAAGTTGAAAAAAGAAT------TA-------- Nuqsec2>Artocarpusheterophylus -------------TGCAAATCAATCTTTCAGTAGTACGGAGTCAAATGCTAG-------- Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca GAAGCTCCATATCGGAGGAG----AGCA------------------------CA------ Nuqsec6Ficusreligiosa -TGTATTCACATCAACAGGGTGACTGGAATGGTGCA------------------------ Nuqsec3Ficusbenjamina -----------------------AAGCTATGATGAGATT--------------AAGCAGG Nuqsec5Ficuselastica -----------------------AAGCTATGATGAGATT--------------AAGCAGG Nuqsec4Ficuscarica -AATATTCATTA-------------------------ATCAAATCATTTACTCCATCAAA Nuqsec2>Artocarpusheterophylus -AAAATTCATTTCTAATGGAT-AATGCTATGAAGAAGATTGATACATTAGTTCCAATTAG Nuqsec1Artocarpusaltilis ------------------------------------------------------------ Nuqsec7Morusalba ------------------------------------------------------------ Nuqsec8MusaParadisiaca ---AGAAGGAGGAGCATAAGGAGGAAGGGTACCACAAGGAGGAGGAGAAGCACCACACGG Nuqsec6Ficusreligiosa ------------------------------------------------------------ Nuqsec3Ficusbenjamina CCATCAAGGAGG------------------------------AGTCTGAGGGCAAGCTGA Nuqsec5Ficuselastica CCATCAAGGAGG------------------------------AGTCTGAGGGCAAGCTGA Nuqsec4Ficuscarica --ATCTGATA-GATCTTTTGAAGAATGG--------------ATTAATCGGACGAGAATA Nuqsec2>Artocarpusheterophylus TCCTCTGATTGGATCGTTGGCTAAAATGAAAT---TTTGTAATGTATTAGGACATCCCGT Nuqsec1Artocarpusaltilis ---------------------------------------AGGAACTTTAGGACATCCTTG Nuqsec7Morusalba ----------------------------------------------------------TG Nuqsec8MusaParadisiaca AGGAAGGACACCACAAGGAG-GAGGAGAAGCACCAC------AAGGAGGAAGAAC----- Nuqsec6Ficusreligiosa --GGATGCCACACCAATTTCAGGTACTTAGCTATAAAAAATCAATGAGATAGATAAATAT Nuqsec3Ficusbenjamina AGGGTAT----------------------------------------------------- Nuqsec5Ficuselastica AGGGTAT----------------------------------------------------- Nuqsec4Ficuscarica AAGATAGAGTCCCATTTTACATGTCAATATCGACAACAA-----------TGAAATTTAT Nuqsec2>Artocarpusheterophylus TAGTAAGTCGACC-------TGGGCCGATTCATCGGATT-----------TTGATAT--- Nuqsec1Artocarpusaltilis GGGAAATGCACCC-------GGTGCCGTAGCTAATCGAG-----------TAGCTCTAGA Nuqsec7Morusalba GTATAAAGCAACC-------TATT--------TATCG----------------------- .

9. Dihasilkan pohon filogenetik .