You are on page 1of 2

pET-23a-d(+) Vectors

TB051 12/98
The pET-23a-d(+) vectors carry an N-terminal T7•Tag® sequence plus an optional C-terminal
His•Tag® sequence. These vectors differ from pET-21a-d(+) by the “plain” T7 promoter instead
of the T7lac promoter and by the absence of the lacI gene. Unique sites are shown on the circle
map. Note that the sequence is numbered by the pBR322 convention, so the T7 expression region
is reversed on the circular map. The cloning/expression region of the coding strand transcribed
by T7 RNA polymerase is shown below. The f1 origin is oriented so that infection with helper
phage will produce virions containing single-stranded DNA that corresponds to the coding strand.
Therefore, single-stranded sequencing should be performed using the T7 terminator primer (Cat.
No. 69337-3).

Cat. No.
69745-3
69746-3
69747-3
69748-3

pET-23a DNA
pET-23b DNA
pET-23c DNA
pET-23d DNA

pET-23a(+) sequence landmarks

303-319
302
207-239
158-203
140-157
26-72
1450
2211-3068
3200-3655

Sty I(57)
Bpu1102 I(80)

NgoA IV(3525)
Drd I(3429)
Dra III(3424)

f1

5)
0-365
320
(
n
igi
or

BsaH I(2818)
Sca I(2761)

Pvu II(979)

1 130

Pst I(2526)

(3666bp)

Tth111 I(1133)
Bst1107 I(1159)

)

45

68

0)

Pvu I(2651)

pET-23a(+)
Ap (22

The maps for pET-23b(+), pET-23c(+) and
pET-23d(+) are the same as pET-23a(+)
(shown) with the following exceptions:
pET-23b(+) is a 3665bp plasmid; subtract
1bp from each site beyond BamH I at 198.
pET-23c(+) is a 3664bp plasmid; subtract
2bp from each site beyond BamH I at 198.
pET-23d(+) is a 3663bp plasmid; the BamH I
site is in the same reading frame as in pET23c(+). An Nco I site is substituted for the
Nde I site with a net 1bp deletion at position
238 of pET-23c(+). As a result, Nco I cuts
pET-23d(+) at 234, and Nhe I cuts at 229.
For the rest of the sites, subtract 3bp from
each site beyond position 239 in pET-23a(+).
Nde I does not cut pET-23d(+). Note also
that Sty I is not unique in pET-23d(+).

Xho I(158)
Not I(166)
Eag I(166)
Hind III(173)
Sal I(179)
Hinc II(181)
Sac I(190)
EcoR I(192)
BamH I(198)
Nhe I(231)
Nde I(238)
Xba I(276)
Bgl II(334)
Msc I(359)
Dsa I(360)
Bpu10 I(494)
Bbs I(506)
Bsg I(548)
Eco47 III(642)

(1

T7 promoter
T7 transcription start
T7•Tag coding sequence
Multiple cloning sites
(BamH I - Xho I)
His•Tag coding sequence
T7 terminator
pBR322 origin
bla coding sequence
f1 origin

Bgl I(2401)

or

i

Sap I(1272)
Afl III(1388)
BspLU11 I(1388)

Ahd I(2281)

AlwN I(1804)

T7 promoter primer #69348-3
T7 promoter

Bgl II

rbs

Xba I

AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGA
Nde I Nhe I

pET-23a

T7•Tag

BamH I EcoR I Sac I

Hinc II
Sal I Hind III

Eag I
Not I

Xho I

His•Tag

TATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA
MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGluPheGluLeuArgArgGlnAlaCysGlyArgThrArgAlaProProProProProLeu
pET-23d

Nco I

...TACCATGGCTAGC...
MetAlaSer...

pET-23b

...GGTCGGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA
...GlyArgAspProAsnSerSerSerValAspLysLeuAlaAlaAlaLeuGluHisHisHisHisHisHisEnd

pET-23c,d

...GGTCGGATCCGAATTCGAGCTCCGTCGACAAGCTTGCGGCCGCACTCGAGCACCACCACCACCACCACTGA
...GlyArgIleArgIleArgAlaProSerThrSerLeuArgProHisSerSerThrThrThrThrThrThrGlu
T7 terminator

Bpu1102 I

GATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG
T7 terminator primer #69337-3

pET-23a-d(+) cloning/expression region
Novagen • ORDERING 800-526-7319 •

TECHNICAL SUPPORT

800-207-0144

pET-23a(+) Restriction Sites
Enzyme
AccI
AceIII
AciI
AflIII
AluI
AlwI
Alw21I

# Sites
2
5
49
1
18
13
7

Alw44I
AlwNI
ApoI
AvaI
AvaII
BamHI
BanI
BanII
BbsI
BbvI
BccI
Bce83I
BcefI
BcgI

3
1
3
2
5
1
2
2
1
21
5
5
2
7

BfaI

8

BglI
BglII
BpmI
Bpu10I
Bpu1102I
BsaI
BsaAI
BsaBI
BsaHI
BsaJI
BsaWI
BsaXI
BsbI
BscGI

1
1
2
1
1
2
2
2
1
3
5
1
2
10

BsgI
BsiI
BsiEI
BslI
BsmAI
BsmBI
BsmFI
BsoFI
Bsp24I

1
2
5
12
4
1
2
33
6

Bsp1286I 8
BspEI
BspGI
BspLU11I
BsrI
BsrBI
BsrDI
BsrFI
Bst1107I
BstYI

2
1
1
15
3
2
2
1
10

Cac8I
CjeI
CjePI
CviJI
CviRI
DdeI

16
12
12
56
13
10

DpnI
DraI
DraIII

19
3
1

Locations
180
1158
897
1038

1340

2580

3264

1388

159
2867
1202
1804
192
158
352
198
2229
190
506
2318
21
1890
160
2786
70
2136
2401
334
915
494
80
301
1140
333
2818
57
2
3372
1104
44
2061
548
1561
169

190
2952
1702

382

3226
338
394

3237

1206

1706

2948

673

2419

2641

3461
3499

2442
1479
3450
194
2820
232
2471

2729
1777
228
277
3575

3414
2018
965
402

3431
2886

1883

2342
3424
585

3331
364
2282

1548
1594

749
2306

1741

1082
2828

Enzyme
DrdI
DrdII
DsaI
EaeI
EagI
Eam1105I
EarI
EciI
Eco47III
Eco57I
EcoO109I
EcoRI
EcoRII
FauI

# Sites
3
1
1
3
1
1
2
3
1
2
3
1
4
8

FokI

8

FspI
GdiII
HaeI
HaeII

2
2
4
6

HaeIII
HgaI

13
6

HgiEII
HhaI
Hin4I
HincII
HindIII
HinfI

1
23
2
1
1
9

HphI

9

MaeII
MaeIII
MboII

12
15
8

MmeI
MnlI
MscI
MseI
MslI

3
19
1
22
6

MspI
MspA1I

17
6

MwoI
NciI

18
7

NdeI
NgoAIV
NheI
NlaIII
NlaIV
NotI
NspI
Pfl1108I
PleI

1
1
1
15
15
1
3
1
6

Psp5II
Psp1406I
PstI
PvuI
PvuII
RcaI
RsaI
SacI
SalI
SapI
Sau96I

2
4
1
1
1
2
2
1
1
1
10

999

2351

360
577

TB051 12/98

2572

1715
3518

2945
1304

1728

2651

301
1029
659

1029

2342

3118

201
2091
159
2867
2
914
1388

233

1881

1913

2059

190
2952
577

382
3499

1206

1706

1321
2342
2361
1159
132
2040

3122
2516
3525

3568

198
2126

334
2138

2800

3639

80
1196

101
1663

136
2072

2147
3424

2166

2858

580
2906

494
2238

2029
2923

656
2778

Locations
1081 1496
3429
360
166
357
166
2281
1272 3076
1462 1608
642
1936 2948
53
352
192
354
1414
318
403
1101 3561
607
669
2247 2428
369
2503
166
2669
359
1403
561
644
3583

3379

2669

2436

Enzyme
Sau3AI
ScaI
ScrFI
SfaNI
SfcI
SspI
StyI
TaqI

# Sites
19
1
11
13
5
2
1
7

TaqII

6

TfiI
ThaI
TseI
Tsp45I

3
17
21
6

Tsp509I

9

Tth111I
Tth111II
UbaJI
VspI
XbaI
XhoI
XmnI

1
4
12
2
1
1
2

394
1535
684
3630
747
2715

1548
870

1091

933

1074

1414
1266

1866
1636

1499

2077

3575

924
3641
1974

1081

2807

2280
181
173
309
1759
433
2767

2354

438
2276
1008
2973

942
3351
1017
3008

1288
3373
2124
3425

1363

506
2954
1603

1259
3063
1787

2050
3564
3401

2121

2876

375
3051

570

961

2533

2692

84
2916

979

1098

1730

1975

398
2464
238
3525
231

726
2815

1032

1067

1768

1025

1392

1282

1767

2270

3359

394
2507

2880

3209

394
2419

673
2641

2351

3116
2761

352
2402

2761

302
3085
57
159
2932
1290
3328
438

1653
3216

1844

2522

3643

180
3457
2629

190

331

1488

2814

2967

2984

942

1363

827
3597
192
2709
1133
849

1040

1135

2537

2748

268
3200

318
3226

2148
3237

2454

1978

1985

2017

317
276
158
946

2453

2880

Enzymes that do not cut pET-23a(+):
AatII
AflII
AgeI
ApaI
AscI
AvrII
BaeI
BclI
BseRI
BsmI
BspMI
BsrGI
BstEII
BstXI
Bsu36I
ClaI
EcoRV
FseI
HpaI
KpnI
MunI
NarI
NcoI
NruI
NspV
PacI
PflMI
PmeI
PshAI
RleAI
RsrII
SacII
SfiI
SgfI
SgrAI
SmaI
SpeI
SphI
SrfI
Sse8387I
SunI
SwaI
XcmI

359

166
733
2299
317
3367
352
713
2526
2651
979
2108
1194
190
179
1272
53
2323

Locations

860
3415

Novagen • FAX 608-238-1388 • E-MAIL novatech@novagen.com

ApaBI
BmgI
BssHII
EcoNI
MluI
NsiI
PmlI
SexAI
SnaBI
StuI