You are on page 1of 624

Vulnerabilidad social y biológica ante el cambio climático
en la Reserva de la Biosfera Selva El Ocote

Vulnerabilidad social y biológica ante el cambio climático
en la Reserva de la Biosfera Selva El Ocote

Lorena Ruiz-Montoya, Guadalupe Álvarez-Gordillo,
Neptalí Ramírez-Marcial y Bárbara Cruz-Salazar
Editores

ECOSUR

EL COLEGIO DE LA FRONTERA SUR

EE
574.522209727
V9
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote
/ Lorena Ruiz-Montoya, Guadalupe Álvarez-Gordillo, Neptalí Ramírez-Marcial y Bárbara Cruz-Salazar,
editores.- San Cristóbal de Las Casas, Chiapas, México: El Colegio de la Frontera Sur, 2017.
622 p. : fotografías., ilustraciones, mapas, retrato. ; 22x16 centímetros.
Incluye bibliografía

ISBN: 978-607-8429-40-0

1. Cambios climáticos, 2. Vulnerabilidad social, 3. Vulnerabilidad biológica, 4. Hábitos alimentarios,
5. Medios de vida, 6. Ictiofauna, 7. Insectos, 8. Anfibios, 9. Reptiles, 10. Aves, 11. Mamíferos, 12.
Árboles, 13. Estufas ecológicas, 14. Conservación biológica, 15. Manejo de recursos naturales, 16.
Reserva de la Biosfera Selva El Ocote (Chiapas, México), I. Ruiz Montoya, Lorena (editora), II. Álvarez
Gordillo, Guadalupe del Carmen (editora), III. Ramírez Marcial, Neptalí (editor), IV. Cruz Salazar,
Bárbara (editora)

Fotografía de portada: Marco Girón Sántiz.

Primera edición 2017

Vulnerabilidad social y biológica ante el cambio climático
en la Reserva de la Biosfera Selva El Ocote

DR© El Colegio de la Frontera Sur, 2017
www.ecosur.mx
El Colegio de la Frontera Sur
Carretera Panamericana y Periférico Sur s/n
Barrio de María Auxiliadora
C.P. 29290
San Cristóbal de Las Casas, Chiapas

Esta obra es producto del proyecto CONACYT PDCAPN-2013-01/214659 a cargo de personal académico de
El Colegio de la Frontera Sur, y en colaboración con personal
de la Secretaría de Medio Ambiente e Historia Natural de Chiapas,
Universidad de Ciencias y Artes de Chiapas.

Los contenidos de esta obra fueron sometidos a un proceso de evaluación externa de acuerdo con la
normatividad del Comité Editorial de El Colegio de la Frontera Sur

Para reproducir total o parcialmente esta obra se requiere autorización: lruiz@ecosur.mx

Impreso y hecho en México / Printed and made in Mexico

Índice

Revisión técnica............................................................................................................. 11

Prólogo........................................................................................................................... 15

Introducción.................................................................................................................. 17
Lorena Ruiz-Montoya, Neptalí Ramírez-Marcial,
Guadalupe Álvarez-Gordillo y Bárbara Cruz-Salazar

Zonificación climática actual y escenarios de cambio climático............................ 25
para la Reserva de la Biosfera Selva El Ocote en Chiapas, México
Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón

Vivir en la Reserva: ...................................................................................................... 67
las comunidades rurales, actores de la conservación
Carla Beatriz Zamora-Lomelí

Una visión conceptual de vulnerabilidad social y biológica................................... 87
ante el cambio climático en las áreas naturales protegidas
Guadalupe del Carmen Álvarez-Gordillo,
Christiane Junghans y Lorena Ruíz-Montoya

Vulnerabilidad social ante el cambio climático......................................................117
en la Reserva de la Biosfera Selva El Ocote
Magaly Carolina Morales-López
y Guadalupe del Carmen Álvarez-Gordillo

7
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Índice

Ictiofauna de la Reserva de la Biosfera Selva El Ocote...........................................153
Alfonso A. González-Díaz, Rocío Rodiles-Hernández
y Miriam Soria-Barreto

Diversidad de insectos colectados en cuatro localidades......................................171
de la Reserva de la Biosfera Selva El Ocote
Benigno Gómez, Carmen Pozo, León Felipe de la Mora-Estrada,
Martín R. Domínguez, M. Edivaldo Rodríguez y Lorena Ruíz-Montoya

Diversidad local y regional de árboles......................................................................255
en la Reserva de la Biosfera Selva El Ocote, Chiapas
Neptalí Ramírez-Marcial, Miguel Martínez-Icó,
Alfonso Luna-Gómez, Chlöe Buet y Nathaline Elena Taylor-Aquino

Diversidad y relaciones genéticas de especies arbóreas.........................................309
en la Reserva de la Biosfera Selva El Ocote, Chiapas, México
Bárbara Cruz-Salazar, Maricela García-Bautista,
María Zenaida López-López, Trinidad Alejandro Guillén-Díaz
y Lorena Ruiz-Montoya

Riqueza y diversidad de anfibios y reptiles..............................................................355
en Nuevo San Juan Chamula y Veinte Casas, Reserva
de la Biosfera Selva El Ocote
Roberto Luna-Reyes, Candelario Cundapí-Pérez,
Patricia Elizabeth Pérez-López, Alexander López-Villafuerte,
Miguel Ángel Rodríguez-Reyes y Javier Alejandro Luna-Sánchez

Diversidad de anfibios y reptiles en la Reserva.......................................................395
de la Biosfera Selva El Ocote: su vulnerabilidad
ante la fragmentación y el cambio climático
Luis Antonio Muñoz-Alonso, Jorge Nieblas-Camacho,
Marina Alba Chau-Cortez, Alondra Berenice González-Navarro,
Jaime López-Pérez y Juan Pérez-López

8
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Índice

Aves vulnerables a cambios ambientales en cuatro localidades...........................449
de la Reserva de la Biosfera Selva El Ocote, Chiapas, México
Marco Antonio Altamirano González-Ortega y José Raúl Vázquez-Pérez

Mamíferos pequeños silvestres como indicadores.................................................481
de conservación en la Reserva de la Biosfera Selva
El Ocote, Chiapas, México
Alejandra Riechers-Pérez, Víctor H. Mendoza-Sáenz y Anna Horváth

Diversidad genética de mamíferos pequeños.........................................................521
en la Reserva de la Biosfera Selva El Ocote
Maricela García-Bautista, Bárbara Cruz-Salazar,
Alejandra Riechers-Pérez, Víctor Hugo Mendoza-Sáenz

Uso de estufa ecológica para la nutrición y la salud...............................................551
en una comunidad de la Reserva de la Biosfera
Adriana Caballero-Roque, Luis Omar Zepeda-Coutiño,
Patricia Ivett Meza-Gordillo, Gabriela Palacios-Pola
y Nein Farrera-Vázquez

Propiedades dendro-energéticas de los árboles......................................................567
utilizados para leña en comunidades de la Reserva
de la Biosfera Selva El Ocote, Chiapas, México
Mirna Ivett Márquez-Reynoso, Neptalí Ramírez-Marcial,
Héctor Sergio Cortina-Villar, Susana Ochoa-Gaona

Percepciones de agricultores tsotsiles sobre el clima.............................................593
variabilidad climática y sus cambios en la localidad
“Veinte Casas”, Reserva de la Biosfera Selva El Ocote, Chiapas
María Silvia Sánchez-Cortés y Tania Yesabé Martínez-Alcázar

9
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Revisión técnica

Para el cuidado técnico se recurrió a reconocidos investigadores e investigadoras,
quienes amablemente nos ofrecieron sus observaciones y sugerencias a capítulos
individuales y también dos revisores anónimos dieron sugerencias de mejora a la
obra completa. Sin embargo, el contenido y su presentación es responsabilidad de
los autores.

Revisores de capítulos

Alejandro Ortega Argueta
Manejo sustentable de cuencas y zonas costeras,
El Colegio de la Frontera Sur

Benjamín Ortiz Espejel
Instituto de Investigaciones Interdisciplinarias en Medio Ambiente
“Xavier Gorostiaga”, Universidad Iberoamericana

Carolina Orantes García
Facultad de Ciencias Biológicas,
Universidad de Ciencias y Artes de Chiapas

Carlos Alberto Hernández Jiménez
Benemérita Universidad Autónoma de Puebla

Carlos García Estrada
Universidad del Mar

11
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Revisión técnica

Christian Wehenkel
Instituto de Silvicultura,
Universidad Juárez del Estado de Hidalgo

Consuelo Lorenzo Monterrubio
Departamento de Conservación de la Biodiversidad,
El Colegio de la Frontera Sur

Cornelia Flora
Departamento de Sociología,
Low State University

Daisy Escobar Castillejos
Facultad de Ingeniería,
Universidad Autónoma de Chiapas

Esperanza Terrón Amigón
Universidad Pedagójica Nacional Ajusco

Esteban Pineda Diez de Bonilla
Instituto de Ciencias Biológicas,
Universidad de Ciencias y Artes de Chiapas

Gorgonio Ruiz Campos
Facultad de Ciencias,
Universidad Autónoma de Baja California

Héctor Salvador Espinosa Pérez
Instituto de Biología,
Universidad Nacional Autónoma de México

12
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Universidad Nacional Autónoma de México Laura Ruiz Meza Universidad de Ciencias y Artes de Chiapas Marcia Leticia Durand Smith Centro Regional de Investigaciones Multidisciplinarias. Universidad Autónoma de México 13 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Universidad Nacional Autónoma de México José Luis Navarrete Heredia Centro Universitario de la Costa Sur. Revisión técnica Janett Vallejo Román Instituto de Investigaciones Antropológicas. Universidad de Guadalajara Julieta Vargas Cuenca Instituto de Biología. Universidad de Ciencias y Artes de Chiapas Moisés Armando Luis Martínez Facultad de Ciencias. Universidad Nacional Autónoma de México Miguel Ángel Pérez Farrera Herbario Eitzi Matuda. Universidad Nacional Autónoma de México Marcela Meneses Reyes Instituto de Investigaciones Sociales.

Universidad Nacional Autónoma de México Oscar Gustavo Retana Guiascón Centro de Estudios en Desarrollo Sustentable. Universidad de Guanajuato Rogelio Cedeño Vázquez Departamento de Sistemática y Ecología Acuática. Revisión técnica Omar Hernández Ordónez Facultad de Ciencias. Universidad Autónoma de Campeche Rebeca Monroy Torres Departamento de Medicina y Nutrición. El Colegio de la Frontera Sur 14 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

reúne trabajos que versan sobre diferentes temas de in- vestigación y cada capítulo está escrito para que pueda ser leído por un público 15 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . que este mismo grupo definió como prioritarias para la reserva. se tuvieron al menos tres talleres para discutir e integrar resultados. en el seno de la Red de Asesores Científicos de la Reserva de la Biosfera Selva el Ocote (RAC). También se han escrito los capítulos de manera que puedan ser leídos de forma independiente. A lo largo de los casi dos años de trabajo de campo. A esta invita- ción respondieron investigadores de El Colegio de la Frontera Sur. La RAC esta formada por académicos de distintas instituciones y de muy variadas disciplinas. Prólogo La presente obra es resultado de un proyecto de investigación que se gestó en el 2012. La red fue impulsada por la Dirección de la Reserva con la finalidad de poder obtener información científica que no puede ser producida por la Comisión Nacional de Áreas Naturales Protegidas. El grupo conformado formuló el proyecto a través de dos talleres. El grupo de trabajo logró financiamiento de parte del CONACYT en la convocatoria liberada por el Progra- ma de Desarrollo Científico para la Atención de Problemas Nacionales 2013. El resto fueron discusiones vía electrónica y el proceso de integración de documento estuvo a cargo de los editores de este libro. Pese a estos esfuerzos de integración se optó por poner a disposición la información de forma capitulada y disciplinaria para ofrecer más información de la que sería posible bajo una perspectiva multidisciplinaria. A todos los integrantes de la RAC se les invitó a participar en la formulación de un proyecto que permitiera atender las líneas de investigación. por no estar facultada para ello. El libro. entonces. quienes aglutinaron a otros académicos así como a un numeroso grupo de estudiantes. uno de integración y otro para definición de preguntas de investigación precisas para el proyecto. Universidad de Ciencias y Artes de Chiapas (Instituto de Biología y Facultad de Nutrición) y de la Secretaría de Medio Ambiente e Historia Natural.

cada capítulo tuvo de una a dos revisiones por especialistas y además se tuvo un arbitraje de obra completa conducido por el área de Fomento Editorial de El Colegio de la Frontera Sur. Los capítulos. y otros analizan la situación reciente de distintos aspectos sociales de algunas de las comunidades de la REBISO. Lorena Ruiz-Montoya medianamente especializado. Sin duda el reto es la continuidad de estas investigaciones y un uso apro- piado de la información para la generación de estrategias de manejo renovadas y adaptadas al momento actual. además de ofrecer datos recientes. Esto ofrece mayor confianza en la información y calidad en la presentación. las problemáticas de conservación o sociales. Lorena Ruiz-Montoya Junio de 2017 16 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Para fines de calidad académica. así como para el fortalecimiento de la organización local e institucional que contribuyan a la reducción de la vulnerabilidad en sentido amplio. Algunos capítulos describen los patrones de diversi- dad de varios grupos biológicos. incluyen análisis reflexivos y/o teóricos sobre la vulnerabilidad ante el cambio climático. y las posibles formas de abordar y solucionar las problemáticas.

Barrio María Auxiliadora. y que es consecuencia en gran medida del acelerado uso de energías fósiles para satisfacer numerosas demandas productivas de la sociedad. además de otras múltiples actividades humanas poco sustentables. México) 2 Departamento de Sociedad y Cultura.P. E-mail lruiz@ecosur. los aspec- tos regionales. El Colegio de la Frontera Sur. El Colegio de la Frontera Sur. Introducción Lorena Ruiz-Montoya.mx Las tendencias globales de la variación del clima es ya una realidad y sus efectos son percibidos tanto en las escalas ecológicas como sociales. Chiapas. El fenómeno del cambio climático tiene múltiples facetas y hay consenso en señalar que sus principales efectos se han deja- do sentir a partir de los últimos 60 años.1 Guadalupe Álvarez-Gordillo2 y Bárbara Cruz-Salazar1 1 Departamento de Conservación de la Biodiversidad. Departamento de Conservación de la Biodiversidad. C. la gestión de riesgos y la elaboración de una respuesta mediante la adaptación y la mitigación (IPCC 2014). Chiapas. Carretera Panamericana y Periférico Sur s/n. Estos patrones de uso de energías tecnificadas repercuten en las variaciones del 17 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Unidad San Cristóbal. Chiapas.1 Neptalí Ramírez-Marcial. Unidad San Cristóbal (San Cristóbal de Las Casas. El Colegio de la Frontera Sur. Unidad San Cristóbal (San Cristóbal de Las Casas. Hasta recientemen- te el Grupo Intergubernamental de Expertos sobre el Cambio Climático (IPCC) aprobó oficialmente los efectos del cambio climático global sobre la humanidad. Se le ha dado especial atención a la evaluación de los aspectos socioeconómicos del cambio climático y sus consecuencias para el desarrollo sostenible. México. 29290 San Cristóbal de Las Casas. México) Correspondencia: Lorena Ruiz-Montoya.

2009). Neptalí Ramírez-Marcial. En el caso de las plantas cultivadas pueden reducir su productividad por situaciones de estrés ambiental o porque se favorece la presencia de plagas. cuyas consecuencias son graves tanto para la salud humana. por ello es necesario involucrar a diversos sectores de la sociedad para conjuntamente planificar y poner en marcha distintas estrategias de mitigación y adaptación al cambio climático. Universidad de Ciencias y Artes de Chiapas (UNICACH) y de la Secretaría de Medio Ambiente e Historia Natural de Chiapas (SEMAHN). La exposición a estos fenómenos promueve cambios en distintos aspectos de las especies silvestres que pueden alterar su reproducción y supervivencia. 2003. Guadalupe Álvarez-Gordillo y Bárbara Cruz-Salazar clima. Para atender la problemática nacional de conservación y desarrollo sustenta- ble. tanto como a la flora y fauna asociadas. Con la aplica- ción de metodologías propias de cada disciplina. como para el funcionamiento de los sistemas biológicos y sociales. especialmente la temperatura y en las fluctuaciones en la cantidad y distri- bución de la humedad atmosférica. un grupo de académicos de El Colegio de la Frontera Sur (ECOSUR). propusimos enfrentar el reto que significa unificar dos visiones de un mismo fenó- meno tradicionalmente disociados: las ciencias naturales y sociales. en la intensidad y frecuencia de los vientos. Lógicamente esta estrategia impone la nece- sidad de trabajar a distintas escalas geográficas y esquemas de trabajo acordes a cada contexto. en el que la degradación del ambiente se revierte en una mayor vulnerabilidad de la población y viceversa. Para el caso específico de la Reserva de la Biosfera Selva El Ocote (REBISO). creando un círculo vicioso. y fluctuaciones en las corrientes marinas. promueven la contracción o expansión de su distribución geográfica (Money et al. El efecto por si solo o combinado de todos estos factores traen aparejados diferentes riesgos e impactos a las poblaciones humanas. IPCC 2014). en el contexto de cambio climático. actualmente coexisten diversos sistemas socio-ambientales en los que las poblaciones humanas reproducen sus modos de vida locales a partir del uso y manejo de los recursos naturales. entre los efectos más notables (Smith et al. definimos una serie de preguntas que nos permitieran reconocer adecuadamente el estado o condición de diversos 18 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . La magnitud de causas y efectos de estas problemáticas globales rebasan por mucho la capacidad de intervención y posible solución de instancias indi- viduales. las cuales son mane- jadas a través de un uso indiscriminado de plaguicidas. Lorena Ruiz-Montoya1.

¿Los cambios referidos por la gente se correlacionan con los cambios potenciales en los patrones de biodiversidad y estructura genética de especies de las selvas húmedas?. actitudes y prác- ticas hacia la biodiversidad y cambio climático en la REBISO?. ¿Los cambios del entorno natural que la gente percibe han propiciado cambios en sus hábitos alimenticios? Este libro es el producto de la integración de esta basta información genera- da por los grupos participantes. al mismo tiempo que valorar la condición de vulnerabilidad social que los grupos humanos locales están enfrentando actual- mente en la REBISO. con limitado acceso a servicios básicos. Definimos preguntas específicas como ¿Cuáles son los riesgos y vulnerabilidad social y biológica para la conservación biológica y de procesos sociales ante el cambio climático en la REBISO?. Lo que se puede señalar es que. y otras que han llegado posteriormente de otras regiones de Los Altos de Chiapas (CONANP 2016). ¿Cuáles son los conocimientos. Nuestro análisis es esencialmente descriptivo para satisfacer la necesidad de vacíos de información. ¿La gente reconoce cambios en la incidencia de enfermedades o se aprecian enfermedades nuevas por los cambios ambientales referidos por la gente?. En cada capítulo se responden una o varias de las preguntas anteriormente señaladas y se exponen y evalúan los riesgos e impactos observados y percibidos por las poblaciones locales en torno al clima cambiante de su entorno inmediato. Introducción grupos biológicos de flora y fauna. depende además de la naturaleza y severidad de los eventos. por lo que son identificados como grupos altamente vulnerables. El grado en el que estas comunidades son propensas a los impactos del clima cambiante. Estas comunidades utilizan los recursos naturales disponibles en sus entornos inmediatos y a su alcance. de otros factores externos y los factores intrínsecos en las comunidades humanas (sensu Gavito et al. ¿Qué conjunto de organismos estudiados de las selvas de la REBISO son más vulnerables al cambio climático?. en el contexto socio-ambiental de la REBI- SO. hay comunidades que han estado ahí desde poco antes de la creación oficial como área natural protegida. 19 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . aunque intentamos extender el análisis del contexto biológico y social de la REBISO. presentamos una interpretación de los posibles efectos del cambio climático en el corto y mediano plazo sobre cada grupo biológico y social analizado. 2014). en la zona de amortiguamiento y áreas de influencia. ¿Cuáles son los cambios del entorno natural que la gente percibe y que se pueden asociar al cambio climático?.

en la cual se incluyen aspectos geográficos. Inicialmente se seleccionaron los ejidos Ing. pero comunes en los diferentes estudios que aquí presentamos.el esfuerzo del trabajo de campo en las mismas comunidades. 2007. que apre- cian cambios en la disponibilidad de alimentos en los sistemas naturales y en la frecuencia de enfermedades humanas. Armando Zebadúa. muchos de los participantes en este proyecto desconocía- mos varios aspectos acerca de la percepción y actitud que la gente tiene al sentirse parte de un área natural protegida. Partimos de suponer que los pobladores actuales de la REBISO reconocen los efectos y riesgos del cambio climático global en su entorno natural que incluye sus sistemas productivos. Lorena Ruiz-Montoya1. esperaría- mos encontrar distintas estrategias de prevención y adaptación local ante cambios ambientales. Si la gente valora a los sistemas naturales como fuentes importantes de recursos y servicios para autoabastecerse. la comunidad de Armando Zebadúa decidió no participar en el proyecto. tanto dentro como fuera de las reservas naturales. La cobertura geográfica de este libro abarca desde la visión regional. los grupos participantes coincidieron en realizar-en la medida de lo posible. Vásquez Sánchez y March Mifsut 1996). hasta aspectos locales más específicos. que anticipan la posibilidad de eventos de desastre en su entorno inmediato. y Emilio Ra- basa en las localidades del El Carrizal (asentamiento humano pequeño) y El Enca- jonado (Campamento de la CONANP). biológicos y sociales inherentes a toda la REBISO. también ignorábamos acerca de sus estrategias para resolver sus necesidades de sus modos de vida locales. Sin embargo en el transcurso del proyecto. nos propu- simos responder cómo las limitaciones o ventajas de que la población se localice dentro del área de influencia de un área natural protegida y modos de vida locales afectan en el presente y hacia el futuro a la conservación y uso de la biodiversidad y la persistencia de estos modos de vida campesinos. Todo lo anterior debiera tener impactos positivos en la conservación biológica y baja vulnerabilidad social. Por tanto. La conjugación de las dos perspectivas de análisis biológico y social nos permite alcanzar un mejor entendimiento de los procesos ecológicos y sociales involucrados con la conservación de la riqueza bio- lógica. Neptalí Ramírez-Marcial. Por ello. Guadalupe Álvarez-Gordillo y Bárbara Cruz-Salazar Aunque disponíamos de algunos antecedentes relevantes sobre algunos grupos biológicos de la REBISO (Flamenco Sandoval et al. Poco después el esfuerzo de trabajo iniciado en las localidades de El Encajonado y El 20 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Veinte Casas (todos en el Municipio de Ocozocoautla de Espinosa).

este estudio muestra que de seguir las tendencias actuales. trabajado por Ulises Manzanilla-Quiñones y Oscar A. se observan siete capítulos que abordan temáticas parti- culares a grupos taxonómicos específicos. González-Díaz et al. Como consecuencia. Igual- mente en el siguiente capítulo. además del listado taxonómico actualizado.. El siguiente capitulo lo presenta Carla Zamora. Ramírez-Marcial et al. quien nos describe el dilema de la conserva- ción biológica a partir de la percepción de los pobladores que habitan las cuatro comunidades dentro de la zona de amortiguamiento de la REBISO. El contenido del libro está estructurado en 16 capítulos. considerando a las comunidades de árboles presentes en las cinco localidades de la REBISO y analizan su posible relación a lo largo de un gra- diente altitudinal. ambos en el Municipio de Ocozocoautla. A partir de este punto. describen la composición. nos presentan una descripción de los conceptos de vulnerabilidad y cambio climático global desde las perspectivas social y biológica que nos sirve de telón de fondo para presentar el contexto socio-ambiental en la que se insertan los demás estudios específicos sobre diversidad biológica y la vulnerabilidad social de los medios de vida de las comunidades campesinas dentro de la REBISO. aborda la zonificación climática actual y escenarios de cambio climático. Por lo anterior. Posteriormente Cruz-Salazar et al.16oC.58 y 1. Gómez y Gómez et al. Enseguida Álvarez et al. El primer capítulo. Morales-López y Álvarez-Gordillo nos exponen un ilustrativo estudio de los capitales de cuatro comunidades de la REBISO con el objetivo de analizar la condición de cada comunidad al ser parte de un espacio regulado por políticas gubernamentales exógenas a los modos de vida locales. información sobre su distribución y se hacen recomendaciones de investigación para el futuro. Por su parte. tuvo que abandonarse debido a que no reunía las condiciones mínimas de seguridad para el grupo de trabajo. se prevé aumento en la temperatura promedio anual entre 0. se incluyeron otras dos comunidades que estuvieron dispuestas a participar. cada grupo trabajó en una. nos presentan la relación actualizada de la riqueza de la ictiofauna asociada a los cuerpos de agua que rodean a la Reserva y se ofrece. analizan a partir de muestras 21 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . escarabajos y cucarachas. Aguirre-Calderón. dos o hasta en cinco de estas localidades. estructura y diversidad local y regional de árboles. las cuales fueron: Nuevo San Juan Chamula y San Joaquín el Progreso. los cuales siguen un orden temático. Introducción Carrizal. presentan una aproximación a los patrones de diversidad de insectos como los papilionoidea.

Lorena Ruiz-Montoya1. Finalmente Sánchez-Cortés y Martínez-Alcázar nos presentan una descripción del conocimiento del calendario agrícola del maíz como una vía para analizar la percepción y capacidad de adaptación de un grupo 22 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la última parte del libro está compuesta por tres capítulos cuya información tiene grandes posibilidades de constituir el fundamento para la innovación tecnológica apropiada a la comuni- dades de la localidad. describen y analizan la composición. en cinco localidades de la Reserva. Guadalupe Álvarez-Gordillo y Bárbara Cruz-Salazar de hojas y cambium vascular de la corteza. Más específicamente. mientras que Muñoz-Alonso et al. García-Bautista et al. discuten la relación en términos de la disponibilidad del recurso energético en cuatro localidades de la REBISO. Márquez-Reynoso et al. Los elementos aportados por los estudios multi-taxonómicos presentados con anterioridad proporcionan información relevante para orientar procesos de educación. Por su parte. De la misma forma. se presenta un análisis del estado nutricio de niños y mujeres de la localidad de Nuevo San Juan Chamula y describen la experiencia de presentar el uso de un prototipo de estufa ecológica para la preparación de alimentos a partir de plantas comestibles disponibles en la localidad. Riechers et al. Posteriormente Luna-Reyes et al. comunicación. Altamirano et al. presentan la composición taxonómica y proponen una clasificación para recono- cer a las especies por categorías espacio-temporales y gremios alimenticios de la riqueza de aves en la Reserva. nos describen la situación de los mamíferos terrestres pequeños y de los murciélagos como un gru- po indicador de conservación o perturbación en la REBISO. participación social y políticas públicas que lleven a la construcción de comunidades sustentables. analizan la vulnerabilidad de ese grupo en Emilio Rabasa y San Joaquín el Progreso. riqueza y diversidad local. presentan un análisis comparativo del consumo y uso preferido de especies de árboles para leña y estos criterios de preferencia los comparan con las propiedades dendro-energéticas de las especies. Neptalí Ramírez-Marcial. con base en atributos ecológicos de las especies de dichos grupos y de algunos efectos de las actividades humanas en el ecosistema.. En cuanto a las aves. En tal sentido. regional y la similitud de anfibios y reptiles presentes en las localidades de Nuevo San Juan Chamula y Veinte Casas. la diversidad genética de 17 especies ar- bóreas y la contrastan con la diversidad ecológica de árboles descrita en el capítulo precedente de Ramírez-Marcial et al. En el caso de Caballero-Roque et al. realizan un análisis de la diversidad genética del ratón Peromyscus mexicanus y de ocho especies de quirópteros.

. Jalisco. Investigación Ambiental 6: 109-126. 151 pp.. H. Nava-Mendoza. y Huq S.. Cotler. M. Introduction. 2007. Introducción de origen indígena ante el cambio local del clima en la localidad de Veinte Casas. Climate Change 2014: ­Synthesis Report. 2009. Jaramillo. Referencias Flamenco-Sandoval A.J. A.R.. Pachauri and L.. Gavito M. pues estamos aún identifi- cando nuevas oportunidades de incidir en proyectos a futuro en los que se puedan discutir colectivamente con los grupos de interés las posibles estrategias de manejo y fortalecimiento de la organización local que contribuyan a la reducción de la vulnerabilidad. Martínez-Meyer. L. J. S. Assessing ­implications of land-use and land cover change dynamics for conservation of a highly diverse tropical rain forest. Mace G. Yahara T. R.. Hoegh-Guldberg O. Switzerland. M.. K.B.)]. Palmer M. Esperamos que las contribuciones que encontrarán en la presente obra es- timulen a otros actores a sumarse en esta tarea aún pendiente. Siddique. Klein R. I. Martínez-Yrizar. M. V.E. and ecosystem services. Mazari. En Smith J. Scholes R. Martínez-Hernández. Cesario M.T. R. climate change. Ortega. Ayala. R.. Contribution of Working Groups I. E. Renton. Larigauderie A. Current Opinion in Environmental Sustainability 1: 46-54 Smith J.M. Maass..) Climat change: Adaptive capacity and development.K. Londres. Money H. ­Balvanera.. Lavorel S. P. Geneva. Martínez-Ramos M.. Meyer (eds.A. Biodiversity.. Ayala. 2014. 2003. Klein. y Huq S. MaseraO. Ahedo.B. Biological Conservation 138: 131-145. Consideramos que esta oportunidad de exponer nuestras distintas visiones de una misma problemática está lejos de terminarse. Araiza. R. Benítez. (Eds. 2014.A. II and III to the fifth assess- ment report of the Intergovernmental Panel on Climate Change [Core ­Writing Team.. al cambio global: un análisis de sus componentes ecológicos y sociales. Intergovernmental Panel on Climate Change (IPCC). 23 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . B..J. La vulnerabilidad del socio-ecosistema de bosque tropical seco de Chamela. Imperial College Press.T. IPCC. M.. Elmquist T.

(ECOSFERA).1996. Neptalí Ramírez-Marcial.. Lorena Ruiz-Montoya1. I.C. March Mifsut. El Colegio de la Frontera Sur (ECOSUR)-Comis- ión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO). Guadalupe Álvarez-Gordillo y Bárbara Cruz-Salazar Vásquez-Sánchez M. Centro de Estudios para la Conservación de los Recursos Naturales. A. 24 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Conservación y desarrollo susten­ table en la Selva El Ocote. San Cristóbal de Las Casas. Chiapas.A.

México) Correspondencia: Ulises Manzanilla-Quiñones.5. Linares. que posibilitan la generación de escenarios de cambio climático y la toma de medidas de adaptación o mitigación. Nuevo Léon. Universidad Autónoma de Nuevo León (Linares. 67700. El objetivo de este estudio fue generar escenarios de cambio climático a futuro cercano (2039) para la Reserva de la Biosfera Selva El Ocote (REBISO) en Chiapas. México. México Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Facultad de Ciencias Forestales. estas modificaciones hacen del estudio del cambio climático un tema relevante y prioritario hoy en el mundo. El recurso empleado para evaluar el impacto del clima a futuro son los Modelos de Circulación Global (MCG). Facultad de Ciencias Forestales.com Resumen Las alteraciones en la variabilidad climática por la actividad antropogénica han afectado los ecosistemas terrestres y marinos del mundo. Se recortaron las capas climáticas al tamaño de la REBISO con ayuda del programa Global Mapper 16®. Zonificación climática actual y escenarios de cambio climático para la Reserva de la Biosfera Selva El Ocote en Chiapas. México. Se descargaron las capas climáticas mensuales a una resolución espacial de 1 km2 para precipitación y temperatura de los MCG CRNMCM5 y HADGEM2_ES con un RCP 4. E-mail: ulisesmanza@gmail. Carretera Nacional. Se clasificaron la precipitación y temperatura actuales en 10 categorías y se calcularon las diferencias entre el clima actual y futuro en 10 clases con intervalos iguales de 25 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . C. Universidad Autónoma de Nuevo León.P. Nuevo León. lo que significa que las trayectorias en las concentraciones de carbono actuales serán similares a las del futuro cercano (2039). kilómetro 145.

26 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Introducción El clima en nuestro planeta ha cambiado a una velocidad nunca antes registra- da durante los últimos siglos. Los resul- tados de la modelación del cambio climático indican un aumento en temperatura y una disminución en precipitación. la distribución y comportamiento de las especies en la REBISO. Desde siempre la humanidad ha enfrentado los efectos del clima como parte de los diversos fenómenos naturales a los que ha tenido que adaptarse para so- brevivir. Velasco 2014). Baena y Halffer 2008. En la actualidad se percibe una preocupación alarmante acerca de los pro- blemas derivados por el cambio climático. ANP y SIG. los niveles se clasificaron como: Bajo. De acuerdo con el panel intergubernamental de cambio climático (IPCC). Hoy en día. aumento en la temperatura. Palabras clave: proyección climática. con un porcentaje de afectación del 31% de su superficie. lo que sumado a la variabilidad climática observada durante ciertos lapsos produce anomalías en la temperatura y precipitación del planeta (IPCC 2007a). los recursos naturales y la economía constituyen uno de los problemas más preocupantes para la mayoría de los países del mundo (IPCC 2007b). el cambio climático es más que evidente en todo el mundo y sus impactos adversos en la población. tal vez porque la magnitud de los cam- bios no parece punto de comparación (IPCC 2007b). Recientemente se han documentado claras evidencias que indican a la humanidad como principal responsable de modificar o alterar el clima en muchas partes del planeta (IPCC 2007b. Medio. Los niveles de afectación por cambio climático se obtuvieron a partir de las diferencias entre el clima actual y futuro de los MCG. Alto y Muy alto. el cambio climático se define como los cambios en el clima atribuidos de manera directa o indirecta a la actividad humana que altera la composición de la atmósfera. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón modificación en precipitación y temperatura. estos resultados señalan a los escenarios del MCG HADGEM2_ES como los más riesgosos para la reserva. Los cambios en precipitación y temperatura alterarían los ecosistemas. MCG.

Existen evidencias de que los patrones o tendencias de precipitación y tem- peratura están cambiando en muchas partes del mundo (Watson et al. el cual se manifiesta en disminución de la precipi- tación. CONAFOR 2013. señaló en los resultados de la evaluación del 2007. y para ese mismo periodo. las concentraciones de bióxido de carbono aumentaron de 280 a 375 ppm (partes por millón) desde la revolución industrial hasta el año 2011. Los efectos del cambio climático.74 °C de forma irregular en el planeta (IPCC 2007a). 2006). Adger et al. la humanidad ha modificado de manera gradual el medio ambiente a escala global (Ludevid 1997). han trastornado los procesos naturales de la variabilidad climática. CONANP 2015). en particular el aumento de la temperatura. A partir del inicio de la Revolución Industrial. y en la actualidad es uno de los principales retos (IPCC 2007b. 2013). causando un cambio climático que afecta a todos (Euscategui 2002). El calentamiento global inducido ha mo- dificado los elementos climatológicos. Debido a estos procesos. como consecuencia de estas modificaciones se han deteriorado los sistemas ecológicos (Lim et al. principalmente a la quema de combustibles de origen fósil y a la deforestación (IPCC 2007b). Zonificación climática actual y escenarios de cambio climático El cambio climático se manifiesta no sólo como un problema ambiental de dimensiones globales y con expresiones evidentes como el derretimiento de los polos. que afectan a la agricultura de temporal (CONAGUA 2011. Las prin- cipales consecuencias de estos aumentos fueron el incremento en los últimos 100 años de la temperatura de 0. el año 1998 fue el más cálido (Aguirre y Chamba 2010). Hoy en día. la concentración de CO2 era de ±280 ppm. mientras el óxido nitroso aumentó de 295 a 325 ppm (Stocker et al. un calenta- miento global evidente asociado a la actividad antropogénica. que son los principales factores que han modificado el clima (IPCC 2007b). principalmente a la quema de com- bustibles fósiles y al proceso del cambio de uso de suelo. y en especial en la segunda mitad del siglo pasado. El IPCC. las concentraciones de 27 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . y se mantuvo estable durante varios milenios. Esto se encuentra asociado a las acciones humanas. 2007). sequías e inundaciones. las cantidades de metano pasaron de 722 a 1803 ppm. 1997). La alteración en la variabilidad climática histórica afecta directamente a los sistemas ambientales y humanos. de los cuales. sequías más intensas y duraderas. Antes de la revolución industrial.

estos gases atrapan el calor que emite la superficie de la Tierra.5 °C y cambios significativos en los patrones de la precipitación. Cuanto mayor es la concentración de los GEI. siendo los valores más altos registrados en los últimos 420. debido al cambio climático. se desarrollaron para representar los posibles escenarios futuros de las emisiones y concentraciones de GEI. dióxido de carbono (CO2). Existen cuatro caminos o trayectorias: RCP 8. RCP 4. En la atmósfera de la Tierra.6 también 28 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .5 y RCP 2.1 hasta 4. El efecto in- vernadero consiste en que parte de la energía absorbida resulta atrapada localmente.000 años (IPCC 2007b). Efecto invernadero El nombre de efecto invernadero proviene de su similitud con las instalaciones cons- truidas para cultivar plantas en un ambiente más cálido que el exterior. Oxido de carbono (CO). lo que provoca que la superficie del planeta se caliente (Stratus 2004. 2015a). los gases de efecto invernadero presentes son: vapor de agua (H2O).5. Al aumentar su concentración. IPCC 2007b). Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón CO2 superan los 375 ppm. dando origen a que se eleve la temperatura superficial del planeta. Forzamiento radiactivo RCP (Representative Concentration Pathways) Los RCP (por sus siglas en inglés) son rutas de concentración representativa. aumentará la temperatura del planeta hasta 2°C hacia mediados del XXI (Garreaud 2011).0. menor es la cantidad de radiación infrarroja que el planeta regresa al espacio exterior. RCP 6. Un gas de efecto invernadero (GEI) es un gas que absorbe radiación emitida por la superficie de la Tierra y las nubes (Fernández-Eguiarte et al. metano (CH4) ozono (O3) dióxido de azufre (SO2). Se estima que. se incrementa la cantidad de calor encerrada en la atmósfera. Se centran en las concentraciones de los gases de efecto invernadero. las cuales conducen directamente a trayectorias en las concentracio- nes de los gases de efecto invernadero a una determinada escala temporal. dióxido de nitrógeno (NO2) entre otros (IPCC 1995). Dentro de los impactos más importantes señalados por el IPCC en el 2007 se encuentra el aumento en la temperatura del planeta de 1. óxido nitroso (N2O). por lo que un incremento en estos es suficiente para modificar las propiedades del clima (Stratus 2004).

Modelos de Circulación Global (MCG) El recurso utilizado en las evaluaciones del impacto del clima a futuro son los Modelos de Circulación Global. Un forzante positivo tiende a calentar el sistema (más energía recibida que emitida). incluyendo mitigación de emisiones y análisis de impacto del cambio climático (Van Vuuren et al. Por ejemplo. medios (RCP 6.0). constituyen una herramienta clave para la investigación climáti- ca ya que proporcionan una base potencial para las investigaciones y evaluaciones adicionales. Los MCG simulan procesos físicos en la atmósfera. Estos Modelos son una representación numérica tridimensional de la dinámica atmosférica y por tanto de la circulación general alrededor del planeta. en los 29 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Como concepto general. Estos se deben a cambios en la radiación solar incidente. Los números de cada RCP se refieren a la cantidad de forzamiento radiativo producido por los gases de efecto invernadero. constantes (RCP 4. un forzante radiativo en climatología significa cualquier cambio en la radiación (calor) entrante o saliente de un sistema climá- tico. El forzamiento radiativo es una medida de la energía absorbida y retenida en la atmósfera (Wayne 2013). Zonificación climática actual y escenarios de cambio climático conocido como RCP 3. forzante radiativo en climatología significa cualquier cambio en la radiación (calor) entran- te o saliente de un sistema climático.5 Vatios por metro cuadrado (w/ m²). El propósito principal de los RCP es proporcionar información sobre las posibles trayectorias de de los principales agentes forzadores del cambio climático (Moss et al. un RCP 8. 2015a). y se miden en cantidad de Vatios por metro cuadrado (w/m2) (Fernández-Eguiarte et al.5).0) y altos (RCP 8.5 tiene un forzamiento radiativo de 8. o a cambios en las propiedades reflectivas superficiales del planeta (IDEAM et al. mientras que uno negativo lo enfría (más energía perdida que recibida). Como concepto general. 2015a). 2011). y hace referencia a un proceso que altera el balance energético del sistema climático global o parte de él (Fernández-Eguiarte et al.0.5). 2015) Los RCP de acuerdo a su forzamiento radiactivo. Un forzamiento radiativo es un cambio impuesto en el balance radiativo de la Tierra. El término “forzamiento radiactivo” ha sido empleado por el IPCC. se clasifican en bajos (RCP 3. incrementos en la con- centración de gases efecto invernadero y aerosoles. 2010).

and Japan Agency for Marine-Earth Science and Technology (MIROC) MIROC5 Atmosphere and Ocean Research Institute (The Uni. National Intitute for Environmental Studies. National Intitute for Environmental Studies. Norwegian Noruega Meteorological Institute (NCC) REA INECC (IMTA. 2007 e IPCC 2013). Lista de los Modelos de Circulación Global disponibles en el mundo Modelo Institución País BCC_CSM1 Beijing Climate Center. 30 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . en la criósfera y en la superficie terrestre y son la herramienta disponible más avanzada que se tiene para simular la respuesta futura del clima global ante los aumentos de los gases efecto invernadero en la atmósfera a diferentes escalas espaciales y temporales (Solomon et al. CCA-UNAM Y CICESE) México océanos. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Tabla 1. Japón versity of Tokyo). China Meteorological China Administration CAnESM Canadian Centre for Climate Modelling and Analysis Canadá (CCCma) CRNMCM5 Centre National de Recherches Météologiques Francia (CNRM-CERFACS) CSIRO_Mk3 Commonwealth Scientific and Industrial Research Australia Organisation (CSIRO) GFDL_CM3 Geophysical Fluid Dynamics Laboratory (GFDL) Estados Unidos GISS_E2_R NASA Goddard Institute for Space Studies Estados Unidos (NASA-GISS) HADGEM2_ES Met Office Hadley Centre (MOHC) Reino Unido INM Russian Institute for Numerical Mathematics Rusia IPSLcm5a_lr Institut Pierre Simon Laplace (IPSL) Francia MIROC_esm Atmosphere and Ocean Research Institute (The Uni. Japón versity of Tokyo). and Japan Agency for Marine-Earth Science and Technology (MIROC) MPI_ESM_LR Max Planck Institute for Meteorology (MPI-M) Alemania MRI_CGCM3 Meteorological Research Institute (MRI) Japón NCC_NorESMI1 Bjerknes Centre for Climate Research.

esto fue posible gracias al apoyo del grupo UNIATMOS del Centro de Ciencias de la Atmósfera de la UNAM (INE 2009). en el planeta se han generado diversos Modelos de Cir- culación Global. obteniéndose así escenarios de precipitación y temperatura para las 13 regiones de México (INE 2000). que estima los incrementos de la temperatura global en función de las diferen- tes emisiones de GEI. se generaron escenarios climáticos utilizando el software MAGICC/SCENGEN 4. Los escenarios de cambio climático constitu- yen una alternativa de visualización de cómo puede comportarse el clima a futuro (Conde 2003). Los escenarios se generaron utilizando series de datos de 92 estaciones me- teorológicas para temperatura y 279 para precipitación del periodo 1951-1980. Zonificación climática actual y escenarios de cambio climático Al emplearse en los estudios de cambio climático. la primera es un Modelo simple del clima (MAGICC). 2008). respectiva- mente) para el periodo de 1950 a 2000. institución y país de origen de los principales Modelos de Circulación Global del mundo. se generaron proyecciones utilizando una climatología de muy alta resolución (1°x1° y 10°x10°. mayor será la incertidumbre generada (IPCC 2007b). los cuales son proyectados a diferentes horizontes o escalas de tiempo (Conde et al. Los resultados de los experimentos desarrollados con MCG se pueden com- binar con las salidas de Modelos climáticos más simples para poder evaluar los resultados de los primeros bajo una gran variedad de supuestos sobre las futuras emisiones de GEI (Magaña y Caetano 2007). Para la Cuarta Comunicación del año 2009. Escenarios de cambio climático Desde la Primera Comunicación de México ante la Convención Marco de las Na- ciones Unidas sobre cambio climático del año 2000. utilizando las salidas de los Modelos GFDLR3. los MCG se convierten en escenarios de cambio climático. combina el MAGICC con los resultados de los MCG para desplegar la información en un mapa reticular con resolución de 5°x5° a distintos horizontes o escalas de tiempo (INE 2006). se han generado escenarios de cambio climático. el cual consta de dos partes. 31 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . En la actualidad. La otra parte (SCENGEN). Durante la Tercera Comunicación Nacional celebrada en el año 2006. La Tabla 1 describe el nombre. entre más lejana sea su proyección.1.0.

señalan que los bosques templados. se utilizó la metodología empleada por los grupos de trabajo I. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Para ­construir los escenarios. y las conclusiones a las que llegaron fueron un aumento en la temperatura de hasta 4. correspondientes a varias décadas a futuro para México. Por otra parte. Villers-Ruiz y Trejo-Vázquez (2004) en su estudio sobre el cambio climá- tico y vegetación. 2000).5 a 2 °C para el 2030 y de hasta 3. El Instituto Nacional de Ecología y la UNAM realizaron un proyecto deno- minado Estudio País: México. lo que se traduciría en periodos de sequía más largos hacia el norte del país. este sistema utiliza el método de confiabilidad por promedios en los ensambles (REA. Para la Quinta Comunicación de México en el año 2012. es decir. con un ascenso de la temperatura en la próxima década que podría llegar hasta 2 °C (CONAFOR 2013). por sus siglas en inglés). Entre los principales estudios efectuados en la República Mexicana. donde modelaron varios escenarios de cambio cli- mático regionales utilizando Modelos de Circulación General.7 °C y un cambio en los patrones de precipitación de ±2. Para la obtención de cada escenario. II y III del IPCC (2007b). la información de cada Modelo se ponderó de acuerdo con criterios de veracidad en la predicción de datos climáticos conocidos y del comportamiento del Modelo mismo. destacan los siguientes. 2000).7% para el 2030 (Magaña et al. científicas y universitarias que se dedican a evaluar y estudiar el cambio climático. para ensamblar distintos Modelos (Montero y Pérez 2008). Los incrementos podrían ser más notables en el norte del país. En nuestro país existen diversas instituciones gubernamentales. Los datos se obtuvieron a partir de datos climáticos que incorporan distintos escena- rios de cambio climático. los cuales tenderían a desaparecer al aumentar la temperatura. Trabajos o estudios de caso en México Las proyecciones de los escenarios de cambio climático para México en el siglo XXI señalan un aumento en la temperatura promedio anual de 0.7 °C para finales de siglo (Magaña et al. se elaboró la regio- nalización SEDEPECC que es el Sistema para la Exhibición de Datos del Ensamble Ponderado de Escenarios de cambio climático para México (INECC 2012). fríos y semicálidos serían de los ecosistemas más sensibles y afectados por los efectos del cambio climático. los 32 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

SEMARNAT-WWF 2001). prevé que en ese esta- do gran parte de los habitantes poseen una capacidad adaptativa reducida ante los efectos del cambio climático. La Reserva de la Biosfera Selva El Ocote (REBISO) La Reserva de la Biosfera Selva El Ocote en Chiapas. Los Chimalapas en Oaxaca y Uxpanapa en Veracruz. 33 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . constituye un área de gran interés biológico para la conservación. Las superficies templadas disminuyeron su área 23% en prome- dio bajo los dos Modelos Un estudio realizado por Palma-Grayeb et al. Zonificación climática actual y escenarios de cambio climático bosques tropicales secos y espinosos aumentarían su área de distribución. (2007) llevaron a cabo un estudio sobre el comportamiento de la vegetación bajo escenarios de cambio climático en la Reserva de la Biosfera Barranca de Metztitlán. Gómez et al.4% bajo los dos Modelos. Los Modelos empleados fueron GFDL (Geophysical Fluids Dynamics Laboratory) y HADLEY (del Centro Hadley) para los años 2020 y 2050. La Selva El Ocote en Chiapas. son consideradas como una de las áreas de mayor superficie de selva tropical húmeda y otros tipos de vegetación primaria. Los resultados mostraron un incremento para el clima árido de 62. debido a que forma parte de las regiones hidrológicas prioritarias (Malpaso-Pichucalco) y terrestres (selva Zoque-La Sepul- tura) del país establecidas por la Comisión Nacional Para el Uso y Conocimiento de la Biodiversidad (Arriaga et al. por lo que el cambio climático tendería a favorecerles. México. por lo que la población rural podría llegar a perder entre 12 y 35% de su ingreso per cápita y los cultivos básicos se verían muy afectado por los impactos del fenómeno. Hidalgo. continuos. (2008) para la zona de Perote- La Gloria en Veracruz sobre las percepciones y estrategias de adaptación al cambio dentro del Programa Veracruzano ante el cambio climático. El objetivo fue simular y cuantificar los cambios en las condiciones climáticas en un posible aumento en las concentra- ciones de GEI en la Reserva. 2000). en Mesoamérica (Cuarón 1991.

chicozapote (Manilkara sapota). comestibles y ornamentales) como la caoba (Swietenia macrophylla). representando el 45% de los vertebrados de Chiapas y el 23% del país (Programa de Manejo REBISO 2001). Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Valores biológicos La reserva cuenta con una superficie importante de selvas altas y medianas. barbasco (Dioscorea composita) y la cícada (Ceratozamia mexicana) (Programa de Manejo REBISO 2001). medicinales. siendo las de mayores dimensiones la de Pastrán. Valores socioculturales En general. Se reportan también 4 sitios en el municipio de Cintalapa y cinco en Jiquipilas. canshán (Terminalia obovata). mojú (Brosimum alicastrum). varias especies de palma shate (Chamaedorea sp. En el municipio de Ocozocoautla. Para el caso de vertebrados. 58 reptiles 460 de aves y 104 mamíferos. La importancia de la reserva radica en que contiene representantes de selva alta perennifolia y mediana subperennifolia. así como numerosas especies de importancia económica (maderables. distribuidos de la siguiente forma: 24 anfibios. El Grupo La Venta. Problemática en la REBISO De acuerdo con el programa de manejo de la Reserva de la Biosfera Selva El Ocote (2001). Estructura Ejidal. Alto del Zapote y El Tigre. dentro de la Reserva Selva El Ocote se ubican importantes sitios ar- queológicos. alrededor del Cañón del río La Venta. carac- terísticas del trópico húmedo mexicano. se ubican los sitios López Mateos. cedro rojo (Cedrela odorata). la principal problemática ambiental de la reserva está representada por: 34 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Emiliano Zapata. El Zapote (Cintalapa). Tiltepec y Cuahutémoc (Jiquipilas) (Programa de Manejo REBISO 2001). Rastrojo del Nopal. reporta la existencia de 105 sitios ar- queológicos en el ANP (Programa de Manejo 2001).). se han encontrado huellas de ocupación: fragmentos cerámicos y restos óseos humanos. en este refugio se han reportado un total de 646 especies de vertebrados terrestres.

54% para el periodo 1995-2000 (Flamenco-Sandoval et al. descargas de aguas residuales y desechos sólidos. 35 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . e) Contaminación de suelo y agua por el uso de agroquímicos. la interpretación de los mismos se convierte en punto clave para la conservación de la diversidad biológica. incluyendo especies endémicas o bajo alguna categoría de riesgo. h) Aprovechamiento forestal sin manejo. c) Incendios forestales. Sumado a toda esta problemática interna. favoreciendo el desplazamiento de la flora y fauna nativas. Sin embargo. alterando la estruc- tura y diversidad vegetal original. 2007). extinción de especies y erosión. Zonificación climática actual y escenarios de cambio climático a) Fragmentación. la tasa de deforestación anual se incrementó a 2. f) Saqueo. destrucción y tráfico de piezas y monumentos arqueológicos. la Reserva de la Biosfera Selva El Ocote no cuenta con escenarios de cambio climático a corto plazo. los cuales son muy importantes hoy en día en cualquier estudio sobre biodiversidad y su futuro a corto.05% anual. que trae como resultados la reducción de la superficie forestal y la introducción de especies de flora y fauna exóticas que compiten con las especies nativas y en muchos casos las desplazan. y dada la importancia biológica de zona. g) Pesca clandestina. que propician el establecimiento de pastos y especies secundarias. principalmente de maderas pre- ciosas como la caoba y el cedro rojo. La tasa de deforestación estimada en la Reserva para el periodo 1986-2000 fue de 1. principal- mente por actividades agrícolas y ganaderas. d) Crecimiento de asentamientos humanos. mediano y largo plazo. b) Extracción ilícita de especímenes de flora y fauna silvestres con fines comerciales y en menor escala para autoconsumo. además de la incidencia de plagas y enfermedades forestales. modificación y destrucción de los ecosistemas por el avance de la frontera agropecuaria. lo que provoca pérdida de la cubierta vegetal. manejo y administración deficiente del recurso pesquero. provocados frecuentemente por los habitantes para abrir superficies destinadas a actividades agropecuarias.

15 ha (Programa de Manejo REBISO 2001. Figura 1). es factible simular el com- portamiento del clima a futuro. (c) se hizo una estimación de de las diferencias climáticas actuales y futuras en precipitación y temperatura a corto plazo. en los Municipios Ocozocoautla de Espinoza. y finalmente (d) se hizo una clasificación de los niveles de afectación en precipitación y temperatura por los efectos del cambio climático. el cambio climático es un fe- nómeno atmosférico de escala global que amenaza con alterar a muchos ecosistemas en el planeta. endémicas y en peligro de extinción. control o mitigación de los efectos del fenómeno.288. de manera específica: (a) se se realizó una zonificación climática actual y futura. Dependiendo del forzamiento radiactivo empleado. estas modificaciones en la temperatura y precipitación ocasionan que especies de flora y de fauna migren. los cuales ayudan a construir escenarios de cambio climático para una zona geográfica y escala temporal de interés (Conde 2003. El objetivo principal de este estudio fue generar escenarios climáticos a futuro cercano (2039) para la Reserva de la Biosfera Selva El Ocote en Chiapas. 36 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Los escenarios de cambio climático ayudan a tomar decisiones a corto. 2012). Cintalapa de Figueroa. 2008). El área natural protegida comprende una superficie de 101. muchas de las cuales están catalogadas como raras. Materiales y métodos Área de estudio La Reserva de la Biosfera Selva El Ocote se localiza en las coordenadas geográficas 16°45’42” y 17°09’00” latitud norte y 93°54’19” y 93°21’20” longitud oeste. IPCC 2007b. Su importancia radica en que da albergue a un sinnúmero de especies de flora y fauna. se generan diversos Modelos climáticos. (b) se generaron escenarios de cambio climático. Tecpatán de Mez- calapa y Jiquipilas en el Estado de Chiapas. Conde et al. Con ayuda de los Modelos de Circulación Global. En la actualidad. se readapten o se desplacen hacia zonas más templadas o frías en busca de un refugio climático (Peterson et al. lo que permite implementar medi- das preventivas para una posible adaptación. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón La REBISO es una de las selvas altas húmedas tropicales más importantes de México y Mesoamérica. mediano y largo plazo. México. 2002 y Sáenz- Romero et al.

La temperatura media anual es mayor de 18 °C. • Cálido subhúmedo Aw1. • Semicálido húmedo (A)C(m). • Cálido subhúmedo Aw2. Zonificación climática actual y escenarios de cambio climático Figura 1. 37 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ubicación geográfica del área de estudio Clima Dentro del área de estudio se encuentran los siguientes tipos de clima: • Cálido húmedo Am(f). una temperatura del mes más frio menor a 18 °C. presenta una temperatura media anual mayor a 22 °C y una temperatura del mes más frio mayor a 18 °C (García 1988). la temperatura del mes más cálido es mayor a 22 °C (García 1988). • Cálido subhúmedo Aw0. Clima dominante en la reserva. Temperatura media anual mayor a 22 °C y temperatura del mes más frio mayor a 18 °C (García 1988). Tiene una temperatura media anual mayor a 22 °C y una temperatura del mes más frio mayor a 18 °C (García 1988). Tiene una temperatura media anual mayor a 22 °C y una temperatura del mes más frio mayor a 18 °C (García 1988).

Climas existentes en el área de estudio • Semicálido húmedo (A)C(m)(f). la Altiplanicie y Montañas del Norte. temperatura del mes más frio menor a 18 °C y tempera- tura del mes más caliente mayor a 22 °C (García 1988). Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 2. hasta desembocar en el Golfo de México (Müllerried 1957). Hidrología La zona está incluida dentro de la cuenca hidrológica de la red fluvial del Río Gri- jalva. 38 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . En la Figura 2 se muestran los tipos de climas existentes dentro de la Reserva de la Biosfera Selva El Ocote. presenta una temperatura media anual mayor de 18 °C. atravesando la Depresión Central. la cual se origina en Guatemala y recorre el estado de Chiapas en dirección sureste-noroeste.

el Leptosol predomina en el área natural protegida (SEMARNAP 1998). Vegetación Los tipos de vegetación de la zona pertenecen principalmente a Selva alta pe- rennifolia. vegetación secundaria arbustiva de Selva mediana subperennifolia. La Figura 4 muestra los tipos de vegetación existentes reportados por INEGI en 2013. vegetación secun- daria arbustiva de Selva baja caducifolia. vegetación secundaria arbórea de Selva baja caducifolia. agricultura de temporal anual y permanente (INEGI 2013). vegetación secundaria arbórea de Bosque de encino. En la Figura 3 se describen los suelos predominantes y la hidrología de la Reserva de la Biosfera Selva El Ocote. Hidrología y edafología del área de estudio Edafología Los suelos presentes corresponden al tipo Leptosol cálcico (LPk) y Alison férrico (Alf). Zonificación climática actual y escenarios de cambio climático Figura 3. 39 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Sabanas. vegetación secundaria arbustiva de Selva alta perennifolia. Pastizal cultivado e indu- cido. vegetación secundaria arbórea de Selva alta perennifolia. Bosque de encino.

mx/atlas/kml/. 2014). Dichas capas fueron recortadas al tamaño de la Reserva de la Biosfera Selva El Ocote con ayuda del programa de análisis espacial Global Mapper 16® (Global Mapper. 40 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Tipos de vegetación del área de estudio Obtención de datos climáticos Se obtuvieron las capas climáticas históricas mensuales actuales para precipitación y temperatura de la página: http://atlasclimatico. Las series históricas de tiempo del clima con las que se generaron las capas climáticas mensuales abarcan el periodo de 1902-2011 y tienen una resolución espacial de 1 km2 (30 segundos de arco) y las cuales se encuentran disponibles en formato ASCII para todo el país. Depuración y análisis de datos climáticos Se descargaron las capas climáticas mensuales de precipitación y temperatura a una resolución espacial de 1 km2 para toda la República Mexicana.unam. la cual per- tenece a la Unidad de Información para las Ciencias Atmosféricas y Ambientales (UNIATMOS) de la UNAM. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 4.

Estos Modelos tienen una extensión en formato ASCII.5 y RCP 8. Generación de los escenarios de cambio climático Dentro de la plataforma de la UNIATMOS se encuentran cinco Modelos de Cir- culación Global (CRNMCM5.5 y RCP 8. RCP 4. HADGEM2_ES. 2014).5 bajo el supuesto de que las emisiones de carbono de hoy en día se mantendrán constantes al año 2039. GFDL_CM3. Para la elaboración de los escenarios de cambio climático se descargaron las capas climáticas mensuales a futuro cercano (2039) de los Modelos de Circulación Global CRNMCM5 y HADGEM2_ES para precipitación y temperatura. Dicha clasificación sirvió para identificar y delimitar zonas con cantidades diferentes en precipitación y temperatura dentro de la Reserva de la Biosfera Selva El Ocote. obteniéndose así los valores de precipitación acumulada anual y temperatura promedio anual actuales. Zonificación climática actual y escenarios de cambio climático Las capas mensuales fueron cargadas al Sistema de Información Geográfi- ca ArcGis 10. 2015b). Debido a que la plataforma solo presenta dos forzamientos radiactivos.5) proyectados a tres horizontes (futuro cercano 2015-2039. Zonificación climática actual Se cargaron las capas climáticas anuales de precipitación y temperatura previa- mente recortadas al área de estudio al programa ArcGis 10.3® (ESRI.3® (ESRI. futuro medio 2045-2069 y futuro lejano 2075-2099) disponi- bles en http://atlasclimatico. en donde con ayuda del módulo Algebra de Mapas se sumaron los valores de los 12 meses de precipitación y se promediaron los de temperatura. 41 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se decidió trabajar con el RCP 4.5. y fueron generados a partir de Modelos regionales del CMIP5 a una escala de 1 km2 (Fernández- Eguiarte et al. 2014). MPI_ESM_LR y ENSAMBLE REA) con dos forzamientos radiactivos o trayectorias en las concen- traciones de carbono (RCP 4. en donde se clasificó el gradiente climático en 10 categorías con intervalos de valores iguales en precipitación y temperatura.mx/AECC_descargas/.unam.

Afectación por cambio climático en precipitación y temperatura Los niveles de afectación por el cambio climático en la REBISO se obtuvieron a partir de las diferencias generadas entre los archivos raster del clima actual y el cli- ma futuro de los Modelos de Circulación Global. se sumaron los valores mensuales de precipitación y se promediaron los de temperatura. Las diferencias fueron clasificadas en 10 categorías con intervalos iguales de modificación en precipitación y tempera- tura del área analizada. las cuales de acuerdo a sus valores de modificación en precipitación y temperatura se definieron en niveles de riesgo: Bajo. Las discrepancias climáticas fue- ron clasificadas utilizando la extensión Reclass del programa ArcGis 10. aumento de 0. 2014).4 °C y 0.3® (ESRI. Diferencias en el clima actual y futuro Para poder calcular las diferencias climáticas actuales y futuras. g..1 a 0. 2014). Alto y Muy alto. 2014).5 °C). La clasificación de los valores de precipitación de los Modelos climáticos CRNMCM5 y HADGEM2_ES permitieron calcular el grado de afectación y la superficie en hectáreas afectadas por la modificación en los regímenes de preci- pitación. 2014) en cuatro categorías de afectación con valores de modificación iguales entre categorías (e. 0. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Se recortaron los valores mensuales de precipitación y temperatura a futuro cercano (2039) al tamaño del ANP con ayuda del programa de análisis espacial Global Mapper 16® (Global Mapper. donde se utilizó la herramienta Algebra de Mapas para calcular las diferencias entre el clima actual y el futuro de los Modelos de Circula- ción Global CRNMCM5 y HADGEM2_ES. media y mí- nima promedio anual para el año 2039. Medio. lo que permitió obtener la precipitación acumulada anual y la temperatura máxima. se cargaron las capas anuales de precipitación y temperatura del presente y futuro al programa ArcGis 10.2 °C.3°C.3 ® (ESRI.2 a 0.3 a 0. 42 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .4 a 0. Las capas recortadas fueron cargadas al programa ArcGis 10. en donde con ayuda del módulo Algebra de Mapas.3® (ESRI. 0.

55-31. este y sur 43 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . este y sur del ANP. la variación fue de 20.75 °C 14. media y mí- nima de los Modelos climáticos CRNMCM5 y HADGEM2_ES. lo cual ayudó a estimar el nivel de afectación y la superficie en hectáreas afectadas por la alteración en los patrones de temperatura de la Reserva de la Biosfera Selva El Ocote para el año 2039. Valores climáticos actuales y futuros de los MCG CRNMCM5 y HADGEM2_ES Temperatura Precipitación Temperatura Temperatura mínima Escenario acumulada máxima media promedio anual promedio anual promedio anual anual Presente 781-2459 mm 26.64-20.97 °C HADGEM2_ES 2039 773-2434 mm 27. media y mínima de los Modelos de Circulación Global CRNMCM5 y HADGEM2_ES para la Reserva de la Biosfera Selva El Ocote en Chiapas.97 °C 20.27 °C CRNMCM5 2039 714-2397 mm 26. En el caso de la temperatura media promedio anual.29 a 31.48 hasta 25.75 °C.48-25. Resultados En la Tabla 2 se observan los valores actuales y futuros (2039) para precipitación y temperatura máxima.64 °C 21. Para la temperatura máxima promedio anual. Las áreas con mayor cantidad de precipitación recibida se localizan en el noroeste del ANP (Figura 5).53 °C Zonificación climática actual Los resultados del clima actual indican un intervalo en la precipitación promedio anual acumulada de 781 a 2459 mm.89-21. el rango fue de 26. Las regiones cálidas se identificaron hacia el norte.21-32.29-31.93-26.54-26. México.32 °C. las zonas con menor cantidad de precipita- ción se encuentran hacia el sur y el este del ANP. las zonas más cálidas se encuentran en el norte.97 °C 15. Zonificación climática actual y escenarios de cambio climático Se promediaron los valores anuales de temperatura máxima.31-20.34 °C 15.32 °C 20. Las zonas menos cálidas se ubican hacia el oeste y centro de la zona estudiada (Figura 6). Tabla 2.

Zonificación de precipitación anual acumulada (PPT) en el área de estudio Figura 6. Zonificación de temperatura máxima promedio anual (TMAX) en el área de estudio 44 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 5.

64 a 20.55 hasta 31. Zonificación de temperatura media promedio anual (TMED) en el área de estudio del ANP.97 °C. Para la temperatura máxima promedio anual los valo- res fluctuaron desde 26. este y sur del ANP.97 °C. Los resultados para la temperatura mínima promedio anual indican una variabilidad de 14. Para el caso de la temperatura mínima promedio anual los valores oscilaron de 15. Los valores en la temperatura media promedio anual indicaron una variación de 20.34 °C. las áreas más frescas se localizan en el oeste y centro del área evaluada (Figura 7). Los resultados del Modelo de Circulación Global HADGEM2_ES indica- ron que para el año 2039 la variación en la precipitación promedio anual será de 45 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Zonificación climática actual y escenarios de cambio climático Figura 7.93 a 26. Zonificación climática a futuro (2039) Los resultados de la zonificación climática del Modelo de Circulación Global CR- NMCM5 para el año 2039 indican una variación en la precipitación promedio anual de 714 a 2397 mm. las áreas templadas se ubican hacia el oeste y centro de la reserva (Figura 8).27 °C. Las superficies con mayor temperatura se identi- fican en el norte.31 a 20.

64 °C. Para el caso de la temperatura máxima promedio anual. Para la temperatura mínima promedio anual los valores oscilaron de 15. sur y este del ANP (Figura 9).89 a 21. La variabilidad en la temperatura máxima promedio anual fue de 27.21 a 32.19 hasta 0. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 8.97 °C.99 °C. Las zonas más afectadas se localizaron hacia el oeste del ANP (Figura 10). 46 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .53 °C.54 hasta 26. Diferencias en los escenarios climáticos actuales y futuros De acuerdo con el escenario de cambio climático del MCG CRNMCM5 para la precipitación acumulada promedio anual proyectada al año 2039. En la temperatura media promedio anual se presentó una variación de 21. se identificaron cambios que muestran una disminución en los regímenes de la precipitación con valores que oscilan de -71 a 0 mm. se detectó una ten- dencia de aumento de 0. siendo las partes más afectadas las ubicadas en el centro. Zonificación de temperatura mínima promedio anual (TMIN) en el área de estudio 773 hasta 2434 mm.

Alteraciones en temperatura máxima promedio anual (TMAX) a 2039 47 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Zonificación climática actual y escenarios de cambio climático Figura 9. Alteraciones en precipitación acumulada anual (PPT) a 2039 Figura 10.

donde la variación en preci- pitación fue de -32 hasta + 59 mm. afectando la mayor parte de la reserva (Figura 12). sur y este de la reserva. siendo las regiones ubicadas hacia el oeste y noroeste del área de estudio las más afectadas (Figura 14).41 a 0. Para la temperatura media promedio anual el incremento fue de 1. Para la temperatura máxima promedio anual la tendencia encontrada fue de aumento.45 °C. las ubicadas hacia oeste y noroeste de la reserva (Figura 11). Las zonas que presentaron una tendencia hacia la disminución en la precipitación se hallaron en el noroeste. en donde los valores oscilaron de 0.87 hasta 1.58 hasta 0.83 °C. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 11. Los resultados del MCG HADGEM2_ES indicaron un comportamiento irregular en la distribución de la precipitación futura. Alteraciones en temperatura media promedio anual (TMED) a 2039 En cuanto al análisis de alteración en la temperatura media promedio anual. resultando las zonas más afectadas. noreste.65 °C. Para la temperatura mínima promedio anual. Las áreas con un patrón de aumento en la cantidad de precipitación se ubicaron en el oeste y suroeste del ANP (Figura 13). resultando las regiones hacia el oeste y noroeste del ANP las más afectadas 48 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .03 a 1. se identificó un patrón de aumento de 0.75 °C. la tendencia fue un aumento de 0.

Alteraciones en temperatura mínima promedio anual (TMIN) a 2039 Figura 13. Alteraciones en precipitación acumulada anual (PPT) a 2039 49 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Zonificación climática actual y escenarios de cambio climático Figura 12.

Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 14. Alteraciones en temperatura media promedio anual (TMED) a 2039 50 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Alteraciones en temperatura máxima promedio anual (TMAX) a 2039 Figura 15.

así como un ascenso de 0. 51 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la tendencia fue un claro aumento de 1. porcentaje y la superficie afectada por los escenarios de cambio climático del MCG CRNMCM5 en precipitación y temperatura pro- yectadas a 2039.33 °C.16 a 1. afectando principalmente el sur y este del ANP (Figura 16).99 °C.75 ° C en la temperatura mínima promedio anual de la Reserva de la Biosfera Selva El Ocote. Para el caso de la temperatura mínima promedio anual.83 °C en la temperatura media promedio anual. un incremento hasta de 0. Zonificación climática actual y escenarios de cambio climático Figura 16. Alteraciones en temperatura mínima promedio anual (TMIN) a 2039 (Figura 15). Los escenarios de cambio climático del MCG CRNMCM5 proyectados al horizonte 2039 indicaron alteraciones en la precipitación de hasta -71 mm. Niveles de afectación por cambio climático La Tabla 3 describe el grado. un au- mento en la temperatura máxima promedio anual de hasta 0.

317.99 Temperatura máxima prome.07 Muy alto 59% 59.84 Bajo 59% 60.257.98 Muy alto 1% 328.32 dio anual Alto 16% 16.08 promedio anual Alto 18% 18. Descripción del nivel de riesgo.43 promedio anual Alto 47% 47. porcentaje y la superficie afectada por los es- cenarios de cambio climático del MCG HADGEM2_ES en precipitación y tem- peratura proyectado a 2039.104.51 Precipitación acumulada Medio 10% 9.049.95 Muy alto 10% 492.59 Bajo 5% 5.857.100.45 Temperatura mínima Medio 38% 38.848. El aumento de la temperatura media promedio anual alteraría notoriamente un 19% de la superficie del ANP y un 57% de la zona aumentaría notablemente su temperatura mínima promedio anual.644. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Tabla 3.609.066. Medio 24% 24.09 Muy alto 10% 10.217.50 Temperatura media Medio 27% 27.396.89 Bajo 54% 54. El incremento promedio en las temperaturas afectaría notablemente un 31% del área de estudio (Figura 18).17 Los niveles de afectación para este escenario en precipitación y temperatura señalan que un 89% del área sufriría alguna modificación en sus patrones anuales de precipitación (Figura 17). La Tabla 4 describe el grado. porcentaje y hectáreas afectadas por los escenarios de cambio climático del Modelo CRNMCM5 en precipitación y temperatura a 2039 Variable climática Nivel de riesgo Porcentaje Superficie afectada de afectación (ha) Bajo 1% 1.893.73 anual Alto 30% 30. Un 16% se vería severamente afectada por el incre- mento en la temperatura máxima promedio anual.967. 52 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

Niveles de afectación en precipitación por cambio climático MCG CRNMCM5 Figura 18. Zonificación climática actual y escenarios de cambio climático Figura 17. Niveles de afectación en temperatura por cambio climático MCG CRNMCM5 53 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

427.648.65 °C en la temperatura máxima promedio anual.557.18 Temperatura máxima Medio 25% 25.80 promedio anual Alto 20% 20.59 Los escenarios de cambio climático del MCG HADGEM2_ES para 2039.45 °C y un aumento de 1. Los niveles de afectación para este escenario en precipitación y temperatura señalaron que un 31% del área sufriría una importante alteración en sus regímenes anuales de precipitación (Figura 19).653.33 Bajo 7% 6.217. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Tabla 4. Un incremento de 1.69 promedio anual Alto 41% 41.080.465.13 promedio anual Alto 19% 19.290. se señalan zonas con una disminución de hasta 32 mm y áreas con un aumento en la cantidad de precipitación de hasta 59 mm.324.33 ° C en la temperatura mínima promedio anual.98 acumulada anual Alto 29% 29. Las ano- malías identificadas en la precipitación fueron muy irregulares.260. porcentaje y hectáreas afectadas por los escenarios de cambio climático del Modelo HADGEM2_ES en precipitación y temperatura a 2039 Variable climática Nivel de riesgo Porcentaje de Superficie afectada afectación (ha) Bajo 58% 58.13 Temperatura media Medio 26% 26.205.271. Un 24% del área se vería afectada por el incre- 54 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .45 °C en la temperatura media promedio anual de 1.97 Temperatura mínima Medio 45% 45.57 Muy alto 1% 739.121.99 Bajo 51% 51.30 Muy alto 2% 2. indican la existencia de alteraciones en la precipitación y temperatura.222.90 Muy alto 7% 7.89 Precipitación Medio 12% 11.49 Muy alto 4% 4.664.68 Bajo 54% 55. Descripción del nivel de riesgo. 1.

El aumento de la temperatura media promedio anual modificaría un 20% de la superficie del ANP y hasta un 48% del área incrementaría su temperatura mínima promedio anual. el MCG CRNMCM5 fue catalogado como un escenario “optimista”. Niveles de afectación en precipitación (PPT) por cambio climático MCG HADGEM2_ES mento en la temperatura máxima promedio anual. Zonificación climática actual y escenarios de cambio climático Figura 19.6% del ANP (Figura 20). 55 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . El promedio de la temperatura máxima. Los niveles de afectación de los escenarios CRNMCM5 “optimista” y HADGEM2_ES “pesimista” para la Reserva de la Biosfera Selva El Ocote se describen en la Tabla 5. mientras que el HADGEM2_ES fue clasificado como un escenario “pesimista”. Por los resultados obtenidos. media y mínima afectaría un 30. como aumento. Discusión Muchos trabajos en el mundo y México están de acuerdo en que las principales consecuencias del cambio climático son el aumento en temperatura y un compor- tamiento errático en precipitación. disminución o desplazamiento de las lluvias a otras regiones geográficas.

094.56 Muy alto 4% 3.65 56 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .230.723.840. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Figura 20.560.190. Comparación de los niveles de afectación de los escenarios de cambio climático en la Reserva de la Biosfera Selva El Ocote Escenario Nivel de riesgo Porcentaje de Superficie afectada afectación (ha) Bajo 30% 30.90 HADGEM2_ES “Pesimista” Alto 27% 27.89 CRNMCM5 “Optimista” Alto 28% 28.37 Bajo 42% 42.696.36 Medio 25% 25.04 Medio 27% 27. Niveles de afectación en temperatura (T) por cambio climático MCG HADGEM2_ES Tabla 5.52 Muy alto 17% 17.239.

en donde estimaron una reducción en la superficie del hábitat de la Mariposa Monarca (Danaus plexippus) en un 37. sugieren un nivel de afectación por los efectos climáticos de 31% hasta 45% de la superficie del ANP. Lo anterior concuerda con el pronóstico de aumento de los escenarios de cambio climático para ese mismo horizonte de tiempo. Por lo que debido a su similitud ambiental con estos ecosistemas. y nula para la especies que ahora habitan las partes altas. es muy probable que la Reserva de la Biosfera Selva El Ocote se convierta en una zona más cálida y seca.13% para el 2050. (2015) realizaron un estudio en la Reserva de la Biosfera Mariposa Monarca. el escenario del Modelo CRNMCM5 señala un aumento en la temperatura promedio anual de hasta 0. (2012) en su estudio sobre el cambio de la cobertura forestal de Abies religiosa con escenarios de cambio climático para el Eje Volcánico Transversal. Islas-Báez et al. Las proyecciones de los escenarios de cambio climático para México para el periodo 2015-2039.45 °C. 57 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . indican un aumento en la temperatura promedio anual de 0. mientras que las cadenas montañosas podrían actuar como refugios para muchas especies. (2002) sugieren que las planicies del centro de México serían las más afectadas por los efectos del cambio climático. En este estudio. De igual modo. Sáenz-Romero et al. De acuerdo con los resultados de los escenarios de cambio climático de los Modelos estudiados.5 a 2°C.2% de la cubierta forestal para el período 2030. donde los incrementos tendrán un mayor impacto hacia el norte del país (CONAFOR 2013 y CONANP 2015). En la Reserva de la Biosfera Selva El Ocote. la REBISO tendría muchas posibilidades de convertirse en un lugar más seco y cálido. mientras que el escenario del Modelo HADGEM2_ES advierte un incremento en la temperatura promedio anual de hasta 1. Por otra parte. resaltan una disminución del 69.83 °C. Zonificación climática actual y escenarios de cambio climático Villers-Ruiz y Trejo-Vázquez (1998a) mencionan que las ANP con cober- tura forestal de bosque tropical caducifolio y subcaducifolio se convertirán en zo- nas más secas y calientes y algunos ejemplos son Chamela-Cuixmala. Peterson et al.59 % para el año 2030 y 49. Yum-Balam y el Triunfo. con escasa posibilidades de contar con refugios para las especies de zonas bajas actualmente cálidas. los resultados de los escenarios de cambio climático al 2039. Manantlán.

Dado a que los escenarios de cambio climático advierten que la reserva se convertirá en un lugar más seco y cálido. En este trabajo el escenario del Modelo HADGEM2_ES predice una disminución en la cantidad de precipitación de 32 mm. restauración y conservación que se realicen en la actualidad. con un porcentaje de afectación de 31% del ANP. sin embargo. este comportamiento a futuro dependerá en gran medida de las acciones de mitigación. En este sentido. entre un 20 y 30% de las especies de plantas y animales afrontarán un mayor riesgo de extinción. Según la FAO (2003) debido al cambio climático. media y mínima casi duplicaban los valores del Modelo CRNMCM5. Aunque el porcentaje de afectación de este Modelo fue menor al Modelo CRN- MCM5. La tasa de cambio podría ser advertida si fuera posible realizar estudios de escenarios de cambio climático junto con inventarios de las áreas de Recomendaciones Los escenarios de cambio climático son una simulación del posible comporta- miento del clima a futuro en la REBISO. la biodiversidad de la Reserva de la Biosfera Selva El Ocote presentaría cambios en la distribución de sus especies. fragmentación y cambios en sus eco- sistemas. los incrementos en temperatura máxima. Diversos estudios han demostrado y señalan que el calentamiento global afecta severamente a la biodiversidad en diferentes formas y escalas (Jiménez 2009). por lo que estos resultados hicieron que se le clasificará como el más riesgoso para la reserva. se propone realizar obras de restauración de suelos y reforestaciones con especies nativas hacia las zonas más degradadas y ac- tividades de conservación en las partes con mayor densidad de vegetación arbórea 58 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón La CONANP (2015) sugiere para el caso de la precipitación una disminu- ción de hasta 84% en algunas zonas del país para el año 2039. apuntan a los escenarios del Modelo HADGEM2_ES como los riesgosos para la reserva. mientras que el escenario del Modelo CRNMCM5 muestra un descenso de hasta 71 mm en la cantidad anual de la precipitación a futuro cercano (2039). Los resultados en el aumento de temperatura y disminución en precipi­ tación de este estudio.

87 °C.03 ° C en la temperatura media promedio anual y de 0. Las zonas más afectadas por el cambio climático se localizan hacia el sur y este del ANP. y la capacidad de adaptación biológica de especies ante los efectos adversos del clima. y estos a su vez ayudan a tomar decisiones de adaptación o mitigación ante los efectos del fenómeno. Implementar programas que regulen la tala inmoderada. con un porcentaje de afectación del 31% de la superficie de la reserva. Zonificación climática actual y escenarios de cambio climático del área natural protegida.16 °C para la temperatura mínima promedio anual. endémicas y bajo alguna categoría de protección y además es una reserva forestal de especies maderables 59 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . por lo que estas acciones ayudarían a mantener estables los patrones de precipitación y temperatura. En el peor de los escenarios climáticos.58 a 1. Los escenarios de cambio climático más riesgosos para el ANP son los del Modelo HADGEM2_ES. en la temperatura máxima promedio anual. El estudio del cambio climático a través de los diversos Modelos de Circula- ción Global permite pronosticar el futuro climático de una región. En el área natural protegida.41 a 1. el cambio de uso de suelo y la frontera agrícola dentro de la reserva. de 0. estas alteraciones han modificado y modificarán a muchos ecosistemas del mundo incluyendo a la Reserva de la Biosfera Selva El Ocote. Conclusiones Sin lugar a duda el clima del planeta ha cambiado y sigue en constante transforma- ción.19 a 0. Dar difusión sobre el futuro climático a corto plazo del ANP y tomar me- didas de adaptación y/o mitigación ante los efectos del cambio climático en las comunidades indígenas que habitan en las zonas aledañas a la reserva. se debe estar preparado para en- frentar las modificaciones en precipitación y temperatura por el cambio climático. existen especies raras. Los escenarios de cambio climático generados para la Reserva de la Biosfera Selva El Ocote indican que el clima a futuro cercano sería más cálido y seco que el actual. Se predice un aumento mínimo de 0. zona o área en particular. los incendios.

S. y J. Alcocer. 2010. M. Arriaga. A El Colegio de la Frontera Sur (ECOSUR). Todas estas especies son susceptibles a los cambios bruscos en la precipitación y temperatura.M. y Chamba López C. R. adaptation and vulnerability. Universidad Nacional de Loja.. las obligaría a desplazarse en busca de refugio hacia zonas más templadas. Conde. Takashi. Pulwarty. B. Agradecimientos Al Consejo Nacional de Ciencia y Tecnología (CONACYT) por el apoyo a tra- vés del proyecto PDCPN-2013/214650-Vulnerabilidad social y biológica ante el Cambio Climático en la Reserva de la Biosfera Selva El Ocote. C. W. Cambridge. pp. Aguirre Mendoza C. A mis asesores de Licenciatura y Maestría por su apoyo durante mi formación académica. Mirza. 717-743. por lo que un aumento en temperatura y una disminución drástica en precipitación. México. Reino Unido. 60 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . D. K. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón de importancia económica como el cedro rojo y la caoba. Ecuador. Patrones de comportamiento de 10 especies vegetales del páramo del Parque Nacional Podocarpus ante escenarios de cambio climático. una de las estrategias para minimizar el impacto del cambio climático sería un programa de adaptación local. Aguas continentales y diversidad biológica de México. Forestal. 2007. V. Smit y K. L. Chiapas. C. 2000. por la opor- tunidad de participar en este proyecto. J. Loja. Pulhin. Agrawala. Aguilar. Referencias Adger. ­Contribution of working group II to the fourth assessment report of the I­ntergorvermental Panel on Climate Change. unidad San Cristóbal de las Casas. Impacts. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO).L. O’Brien. Cambridge University Press. S. Tesis de Ing. Como última conclusión.

M. Dos estudios de caso en México. Colombia. Roma.. A. CA. A. 263-282. M. Seiler. 2002. México. 113 p. Estudios FAO: Montes 167. C. 2003. ArcGis Desktop: 10. CONAGUA. 2007. R. Zavala-Hidalgo. Universidad Nacional Hereda. México. 2011. Sistemas de Estudio de Postgrado. Chapter 14. CONAFOR. Anthony Nyong y Juan Pulhin (eds). Bosques.3 Environmental Systems Research Institute. Assessing i­mplications of land-use and land-cover change dynamics for conservation of a highly diverse tropical rain forest. Halffter. Conde. Fernández-Eguiarte. L. Euscategui. 300 p. Conde Álvarez. Estrategia de cambio climático desde las Áreas Naturales Prote- gidas: Una Convocatoria para la Resiliencia de México (2015-2020). Extinción de especies. 2008. Cambio y variabilidad climáticos. C. A. C. Martinez-Ramos y O. ­México. R. Universidad Nacional de Colombia. cambio climático y REDD+ en México Guía básica. En Neil Leary. 114 p. FAO. 62 p. pp. y Trejo-Vázquez. Climate Change and Vulnerability. D. Costa Rica. Cuidad de México. Cuarón Orozco. Estado de los glaciares en Colombia y análisis de la dinámica glaciar en el parque los nevados. 2013. 1: Conocimiento actual de la biodiversidad. R. Climatic Threat Spaces in Mexico and Argentina. Masera. A. En Capital natural de ­México. Estrada. CONABIO. Conservación de los Primates y sus Hábitat en el sur de México.. La fauna silvestre en un clima cambiante. Vinocur. Universidad Nacional Autónoma de México. Tesis de Maestría.. START. Comisión Nacional Forestal (CONAFOR). Coyoacán. Collazos. pp. 2015. CONANP. Bogotá. Earthscan. 2003. M. Tesis de Doctorado en Ciencias de la Tierra. asociada al cambio climático global. Jyoti Kulkarni. Cecilia Conde. (Maestría en Meteorología). 279-306. y G. 2008. ESRI. 1991. Estadísticas del agua en México. 2015a. F. Biological Conservation 138:31-145. J. Edición 2011. Secre- taría de Medio Ambiente y Recursos Naturales. Italia. 85 p. México.. México D. Gay.F. C. 2014. C. Actualización de los escenarios de cambio 61 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . México. Conde-Álvarez. Zonificación climática actual y escenarios de cambio climático Baena.. R ­ edlands. I. Romero-Centeno. TWAS. Vol. Flamenco-Sandoval. R.

. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón climático para estudios de impactos. México. R. R. Herramientas Científicas para la Toma de Decisiones. R. Instituto Nacional de Ecología. CANCILLERÍA. Zavala-Hidalgo.F. Número 93 Mar-Abr 2011. Conde-­ Álvarez. A.. Tercera comunicación nacional ante la convención Marco de las Na- ciones Unidas sobre el cambio climático (CMNUCC). 2007. Escenarios de cambio climático para Precipitación y Temperatura para Colombia 2011-2100. Gómez. Universidad Nacional Autónoma de ­México.. MADS. Revista Tierra Adentro INIA-Chile. López. Centro de Ciencias de la Atmósfera. Hidalgo. Cuidad de México. Primera comunicación nacional ante la convención Marco de las Na- ciones Unidas sobre el cambio climático (CMNUCC). 62 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Dis- ponible en http://www. Actualización de los esce- narios de cambio climático para estudios de impactos. Universidad Nacional Autónoma de México. México. R. Fernández-Eguiarte. J. Insti- tuto Nacional de Ecología y cambio climático. 2015b. 22 p. Centro de Ciencias de la Atmósfera. Modificaciones al sistema de clasificación climática de Köppen (para adaptarlo a las condiciones de la República Mexicana). 2011. D. A. México. Instituto Nacional de Ecología. 2006. Comporta- miento de la vegetación bajo escenarios de cambio climático en la reserva de la Biosfera Barranca de Metztitlán. C. vulnerabilidad y adaptación. Secretaría de Medio Ambiente y Recursos Naturales. Monterroso.bluemarblegeo. Global Mapper. D.. R. 279 p. INE. I. Romero-Centeno. Estudio Técnico Completo: Tercera Comunicación Nacional de cambio climático. y Trejo-Vázquez. DNP.. México. Blue Marble Geographics. 2015. vulnerabilidad y adaptación. D. Zonas Áridas 11: 61-69. INDAUTOR 04- 2011-120915512800-203. Global Mapper versión 16.com/products/global-mapper. A. García. J. 13-19. Colombia. 2000. 1988. PNUD. Cambio climático: Bases físicas e impactos en Chile. INE. Tinoco. J. Secretaría de Medio Ambiente y Recursos Naturales. Bogotá. Instituto Nacional de Ecología y cambio climático. 2014. y G. Garreaud. México.php. A. E. IDEAM.

Boschung. Reino Unido. Pérez-Miranda R. Programa de Educación para el Desarrollo y la Conservación del Centro Agronómico Tropical de Investigación y Enseñanza (CATIE). escala 1:250000. México. Marco de Políticas de Adaptación al cambio climático: Desarrollando Estrategías. Second A ­ ssessment Report for the IPCC. Lim. Riesgo del hábitat de la mariposa monarca (­Danaus plexippus) ante escenarios de cambio climático. E. 1995. Romero-Sánchez M. 2009. Jiménez Méndez. Programa de las 63 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .M. Glossary of terms. 2009. K. IPCC. IPCC. Cambridge University Press. IPCC.. Nauels. Cambridge.K.). 2013. Spanger-Siegried (Eds. Comisión Inter- secretarial de cambio climático. S. Ginebra. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. INEGI. Ra Ximhai 11: 49-59. 140 p. Midgley (eds. The Science of Climate Change.. Suiza. Contribución de los gru- pos de trabajo I. A. Cambridge University Press. Cambridge. Allen. Reino Unido. Plattner. Velasco-Bautista. Contribución del Grupo de trabajo I al Quinto Informe de Evaluación del Grupo Intergubernamental de Expertos sobre el cambio climático” en [Stocker. 2006. En: cambio climático 2013: Bases físicas. II y III al cuarto informe de evaluación del Grupo Intergu- bernamental de Expertos sobre el cambio climático. 2015. serie V (capa unión). T. Xia. The physical science basis. Bex and P. Turrialba. Resumen para responsables de políticas. Y. 2007b. J. 2012. V.). New York. Comisión Intersec- retarial de cambio climático. Cuarta comunicación nacional ante la convención Marco de las Na- ciones Unidas sobre el cambio climático (CMNUCC). M. INECC. Zonificación climática actual y escenarios de cambio climático INE. Islas-Báez A. Quinta comunicación nacional ante la convención Marco de las Naciones Unidas sobre el cambio climático (CMNUCC). 2013. IPCC. Qin. Tignor. Summary for policymakers of the synthesis report of the IPCC Fourth assessment.F. 2007a.E y E. Climate Change 2013. 2013. Escuela de Posgrado. G. Uso de suelo y vegetación. cambio climático 2007: Informe de síntesis. M. México. Escala 1:250000. México. Tesis de Maestro en Ciencias. 976 p. Instituto de Estadística y Geografía. Costa Rica. B. González-Hernández A. D. Politicas y Medidas. Intergovernmental Panel on Climate Change. Resiliencia de los ecosistemas naturales terrestres de Costa Rica al cambio climático.

2000. R.. A. M. 2002. Instituto Nacional de Ecología. ­Mitchell.B. Emori.R. 1997. México. 2000). Cambridge University Press..E. En Estudios para un Programa Veracruzano ante el cambio climático. D. El Cambio Global en el medio ambiente.. Hibbard K. Edmonds. The next generation of scenarios for ­climate change research and assessment. G. y E. Universidad Nacional Autónoma de México. (Ed. Programa de Manejo Reserva de la Biosfera Selva El Ocote. C. V. M. M.. B.F. Kainuma. Sánchez. Cap. Regionalización de proyecciones climáticas en México de precipitación y temperatura en superficie utilizando el mé- todo REA para el siglo XXI. Chiapas.E. Magaña. D. y D. Meehl. Colorado-Ruiz.R. J.B. Montero. México.. C. 2008. S. Pronóstico climático estacional regionalizado para la República Mexicana como elemento para la reducción de riesgo y para la identificación de opciones de adaptación al cambio climático y para la ali- mentación del Sistema: cambio climático por Estado y por Sector. Ortega-Huerta M.M. Escenarios climáticos. México. ­Buddemeier R. Instituto Nacional de Ecología y Embajada Británica en México. S.. España. 2001. K. Palma-Grayeb. Nakicenovic.K. J.. Smith.H. 1957. Nature 463: 747–756. N. Manning.. El cambio climático en México. Moss. C. Peterson A. Carter. Müllerried. México: una visión hacia el siglo XXI. R. S. Kram. L. Ludevid. Modelación climática y evidencia estadísticas. Pérez. 2010. R. p. 3. Gobierno Constitucional del estado de Chiapas. Ocozocoautla de Espinosa. Wilbanks.R. Rose. México. J. Riahi. Nueva York. 41 pp. M. Chiapas.A. Universidad Veracruzana.J. y L.: Instituto Nacional de Ecología. J. T. Conde-Álvarez. Gay.. Stouffer. Stockwell. M.. O y C. 180 pp. Nature 416:626-629. Evaluación de escenarios re- gionales de clima actual y de cambio climático futuro para México en Gay.A.. K. Conde..P. vanVuuren. 15-21. V..J. Sánchez-Cordero V. T. G. 2008. Alfaomega. Bartley J. Future projections for Mexican faunas under global climate change scenarios. Soberón J.F.... México. Weyant.H.P. Magaña.. Morales-Cortez y G. La geología de Chiapas. INE/A1- 006/2007. 64 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .J. Barcelona. y T.A. F.. Thomson.T. J. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Naciones Unidas para el Desarrollo. Tuxtla Gutiérrez. Caetano..A.

V. Chen. Resumen Técnico. Somerville.. (Eds. G. Krishna Kumar. K. J. L. Kainuma. Jansen.A.- M. Sub- secretaría de Recursos Naturales México. México.D. Meehl.. Manning. Qin. Matsuno. SEMARNAP. Bindoff. Tignor y H. G. Manning. Z.E. Inc. S. M. Van Vuuren. Wood y D.. N. B. Church. Escala 1:4000000. J. V. K. Masson-Delmotte. y R. Jouzel. Friedlingstein. Alexander. P.P. D.A. R. Allen. Stocker. 2011. Wratt. En: Cambios Climáticos 2007: Base Física de la Ciencia. Chimalapas: la última oportunidad. Oaxaca. N. V. D. N. Forest Ecology and M ­ anagement 275: 98-106. Talley. T. Chidthaisong.G.K. M. Cubasch. Mapa de suelos dominantes de la República Mexicana. Chen. Moreno L. Raga. Molina. M. Vaughan y S. U. Plattner.. D. Forster. Xie. Martínez M. M. Aportes del Grupo de Tra- bajo I al Cuarto Informe de Evaluación del Panel Intergubernamental sobre cambio climático [Solomon.A. Gregory. S. Magaña V. 66 p. F. Bindoff. L. Lohnmann. M. S. F. Alley. L. R. B. 2007. Marotzke.. Berntsen. M. Cambridge University Press. Rehfeldt G. G.I. Qin. Weyant. T. Rusticucci. Lemke. D. Qin. C. A. 2001. 2013. So- nora. D. V. Secretaría de Medio Ambiente. Emori. E. L. J. Adaptación al cambio climático: Hermosillo. Sabine. T. Recursos Naturales y Pesca. Mokhov. Piao. G. Bréon. Climatic Change 109:1-4.. Knutti. A special issue on the RCPs. P. R. Solomon. Heinmann. Hoskins. Averyt. Ramaswamy. Gregory. M. M. Miller (eds. U. Duval P. Marquis. Z.M. C. A ­ bies ­religiosa habitat prediction in climatic change scenarios and ­implications for monarch butterfly conservation in México. M.L. 65 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ramaswamy. K.)].. J. J. Contribución del Grupo de trabajo I al Quinto Informe de Evaluación del Grupo Intergubernamental de Expertos sobre el cambio climático. N. UK y USA. J. 2004. Kattsov. 77 p. Hartmann. I. Riahi y J. S. P.) UNAM.F. Hegerl. D. 1998.. Rojas. Reino Unido. Overpeck. P.-K. Ren. 2012. Shindell. Stratus Consulting. T. J. Landavazo O. J. México. A. D. R. B. D. Eakin H. ­Gillett. J. M. F. Cambridge University Press. S. Nicholls. B. Edmonds. Zonificación climática actual y escenarios de cambio climático Sáenz-Romero C. un caso de estudio desarrollado. M. Kirtman. SEMARNAT-WWF. Colegio de Sonora. V. Joos. P. Rhein. Randall.L.. Whetton. Stocker. Linding-Cisneros.

Skeptical Science. Facultad de Ingeniería. Impactos regionales del cambio climáti- co: evaluación de la vulnerabilidad (Informe especial del Grupo de trabajo II del IPCC Ed. 1998a. México. México. R. L. Zinyowera y Moss. Reino Unido. Trejo-Vázquez. R. 71 p. Versión 1. Evaluación de la vulnerabilidad en los ecosistemas forestales en: Martinez. M.. Villers-Ruiz. y A.0. Tesis profesional Ingeniero Civil. Wayne. P. G. pp. 25 p. Global Environmental Change 8:141-157. L. Cambridge University Press. Trejo-Vázquez. 2014. Impacto del cambio climático en los bosques y áreas naturales protegidas de México. 2004. Cambridge. 239-254. Ulises Manzanilla-Quiñones y Óscar Alberto Aguirre-Calderón Velasco Gutiérrez. “Climate change on Mexican forests and natural protected areas”. 66 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . e I. M. Interciencia 23:10-19. e I. INE/SEMARNAT. Ciudad de México.). Universidad Nacional Autónoma de México. Villers-Ruiz. Fernández-Bremauntz (eds). 1998b. e I. Villers-Ruiz. 2013. J. 1997. Watson. Vulnerabilidad del Sector Hídrico por Efectos del cambio climático en México. L. Cambio climático: una visión desde México. Trejo-Vázquez. The Beginner´s Guide to Representative Concentration ­Pathways.

México) Correspondencia: Carla Zamora Lomelí. Departamento de Agricultura. El Colegio de la Frontera Sur.mx Resumen Este trabajo analiza el esquema de conservación de la Reserva de la Biosfera Selva El Ocote a partir de la percepción de los pobladores que habitan en cuatro comu- nidades dentro de la zona de amortiguamiento. México. como por ejemplo realizar cambios vinculantes en las prácticas institucionales que atiendan a un diálogo entre actores locales y gubernamentales. Se delinean algunas propuestas. Chiapas. Palabras clave: Áreas naturales protegidas. La investigación cualitativa per- mitió reconocer dificultades y carencias que vive la población de manera cotidiana frente a la dinámica y las restricciones que acompañan el uso de un territorio com- prendido como área natural protegida. Unidad San Cristóbal (San Cristóbal de Las Casas. C.P. Carretera Panamericana y Periférico Sur s/n. actores de la conservación Carla Beatriz Zamora-Lomelí Departamento de Agricultura. 29290 San Cristóbal de Las Casas. vida cotidiana. Unidad San Cristóbal. Particularmente se estima la co- rrespondencia de las tareas institucionales en términos de gobernanza ambiental y se esbozan áreas de oportunidad para el fortalecimiento de la conservación de la Reserva de la Biosfera Selva El Ocote (REBISO). El Colegio de la Frontera Sur. políticas públicas 67 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Chiapas. E-mail: czamora@ecosur. Sociedad y Ambiente. Sociedad y Ambiente. gobernanza ambiental. a partir de observar que es necesario trabajar en el mejoramiento de la calidad de vida de las personas para articular el esquema de conservación ambiental con el desarrollo económico y social de la gente que vive en la reserva. Vivir en la Reserva: las comunidades rurales.

radican en las zonas rurales aledañas a áreas naturales protegidas. El objetivo es analizar la correspondencia entre los es- quemas de conservación y la vida cotidiana en las comunidades. Así. cuyos impactos en la población todavía presentan áreas de opor- tunidad en términos de justicia social y gobernanza ambiental. de forma que se trabaje en la conservación de la naturaleza y se promueva la calidad de vida de las personas. en el estado de Chiapas se han realizado esfuerzos para procurar que tal relación sea armónica. una de las siete reservas de la biosfera decretadas en la entidad. para posteriormente presentar los resultados obtenidos y emitir re- comendaciones generales a partir de los hallazgos. Se espera abonar en la con- solidación de una estrategia que derive en una relación virtuosa entre medio ambiente y sociedad. seguido de la exposición sobre la perspectiva metodológica. Estos esfuerzos están orientados hacia quienes se encuentran en situación de mayor vulnerabilidad social y climática y que en este caso. El capítulo comprende un apartado en donde se presentan los antecedentes del territorio declarado como área natural protegida. particularmente atendiendo a las cues- tiones vinculadas con el cambio climático y los riesgos que implica el aumento de la temperatura atmosférica para toda la población. La hipótesis que subyace a esta investigación propone que la vulnerabilidad social de la población que habita en 68 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . que recurrió a herramientas de investigación cualitativa. Este trabajo es una aproximación a las comunidades que viven en zonas de amortiguamiento en la Reserva de la Biosfera Selva El Ocote. Carla Beatriz Zamora-Lomelí Introducción La relación entre naturaleza y sociedad ha implicado en los últimos años la re- flexión con respecto a las formas de procurar el cuidado del medio ambiente y mejorar la calidad de vida de las personas. eco- nómica y cultural. a fin de abonar en la discusión en torno a los proyectos de conservación y emitir propuestas retomadas desde los propios pobladores para buscar esquemas de gobernanza y estrategias para la conservación considerando las dimensiones territorial. expresada desde la vida cotidiana de las comunidades que habitan el espacio destinado para la conservación. En este contexto. los gobiernos federal y estatal han implementado mecanismos para la conservación.

muchos de ellos en peligro de ex- tinción (SEMARNAT 2001). al este con la Sierra Veinte Casas y al oeste con los Ríos El Encajonado y La Venta.796. Ocozo- cuautla. tapir. Esta Reserva constituye uno de los espacios de mayor importancia biológica en tanto se ubica en […] una zona de transición de dos provincias neotropicales. Estas localidades tienen una propiedad de la tierra ejidal. seguido de indí- genas zoques y habitantes mestizos. Se trata de un espacio de 101 mil hectáreas de selva tropical húmeda que colinda con la presa Netzahualcóyotl al norte. servicios ecosistémicos y gran biodiversidad.580 personas. radica en la riqueza de la biodiversidad que existe en el territorio de 74. donde el 72% de los habitantes son indígenas tsotsiles.8% del total de la superficie nacional en donde habitan 4. actores de la conservación zonas destinadas a la conservación es un factor que puede detonar inconformidad y rechazo al diseño de políticas públicas formuladas en términos únicamente ambientales. aquí se encuentran bastos recursos naturales como ríos (dado que se encuentra dentro de la cuenca hidrológica del Río Grijalva). con excepción de dos comunidades que se rigen bajo la propiedad comunal de la tierra (entrevista al director de la REBISO 2015).415 km2 que corresponden al 3. En esta entidad del sur de México. de las cuales el 49% vive en zonas urbanas y el 51% en espacios rurales (INEGI 2014). al sur con el Río la Venta. Antecedentes La importancia de procurar una relación equilibrada entre el medio ambiente y la sociedad en el estado de Chiapas. 2013). mono araña y aullador. ubicada entre los municipios de Cintalapa. se encuentra la Reserva de la Biosfera Selva El Ocote (REBISO). Jiquipilas y Berriozabal. la Pacifiquense y la Tehuantepecana (Vásquez y March 1996 en Orantes y cols. cuyas condiciones topográficas y microclimas permiten varios tipos de vegetación y fauna silvestre como jaguares. murciélagos y reptiles que forman parte de las 646 especies de vertebrados terrestres. En este espacio habita una población de aproximadamente 17 mil personas quienes viven en sesenta y cuatro comunidades dentro de la zona de amortigua- miento. Vivir en la Reserva: las comunidades rurales. 69 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . ocelote.

N.5 80.75 Las Flores 134 591 24 15 37.68 12 56 1.5 7 27.5 5 de Mayo 206 1037 53 n/d 144.84 5.) por ejidatario del café (Ha.5 8.59 54 n/d n/d n/d 15 n/d n/d n/d n/d 64 moc Horizonte n/d 1.5 102.131.25 198 257.02 1.28 n/d n/d n/d n/d Nueva Nuevo San Juan 323 538.75 1 2 130 165.5 4.69 405 95.5 61 n/d n/d n/d n/d   Zapata Cuahuté- n/d 410.25 169 85.) No. frutales (ha) del maíz (Ha. Ha.25 51 33 26.5 85 165. Carla Beatriz Zamora-Lomelí Tabla 1.64 32.5 30. 815 4139 98 20 316.75 3 7.) Ejido Salina Cruz 170 833 39 20 69 17 38.5 9.46 66 n/d n/d n/d 100 n/d n/d n/d n/d   San Joaquín 25 168 33 20 n/d n/d n/a n/a n/d n/a n/a   El Rosario Fuente: SEMARNAT 2001.75 0.75 37.75 3 0.59 57 n/d n/d n/d 200 n/d n/d n/d n/d   Chamula Veinte 171 n/d 23 n/d 52 10 36 n/d n/d n/d n/d   Casas Emiliano 149 n/d 23 n/d 77. Uso de suelo en comunidades de la REBISO.1 9.93 6.5 Bravo San Anto- 208 400 31 13 50.) de chile (Ha.25 Nicolás 236 1490 31 20 58 17.21 10.5 7.5 271 321.) Promedio de hectáreas Sup. de habitantes No.59 Lázaro 257 700 34 n/d 28.75 Linda Vista 211 1190 33 20 82 15.25 188 231.04 8 12.23 173 257 Alianza Tierra   43.) del frijol (Ha.7 68 n/d n/d n/d 60 4.7 3.4 3 2 1.C.) Cabezas de ganado bovino Dotación ejidal (sup. acahuales (Ha.25 nio Texas C.5 1. 70 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .94 455 100 Cárdenas Nueva 272 1100 35 n/d 48.25 45.25 1 1. de ejidatarios Sup. 2001 Superficie dedicada al cultivo Superficie dedicada al cultivo Superficie dedicada al cultivo Superficie dedicada al cultivo Superficie con potreros (Ha.25 68 0.75 3. Programa de Manejo de la Reserva de la Biosfera Selva El Ocote.

tipo ecológico bosque lluvioso alto” en 1972. ha sido un territorio habitado en distintos periodos históricos por diversos grupos indígenas y mestizos. por lo tanto. Simojovel. la cual es concedida de manera gradual desde la década de los sesenta en el terreno que hoy comprende la REBISO (Figura 1). un recurso que se encuentra sobreexplotado en los Altos. De esta manera. toda vez que se realizan desmontes de bosques caducifolios para dar lugar a los pastizales (SEMARNAT 2001). y que en algunos casos eran tierras na- cionales y en otros terrenos de ranchos que fueron cediendo a través de procesos de compra-venta y que según narran algunos entrevistados. 71 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . en algunos casos fueron espacios concedidos por dotación ejidal con anterioridad al primer decreto estatal que catalogó diez mil hectáreas como “Área Natural y Típica del Estado de Chiapas. se da cuenta de que […] hasta el siglo XV de nuestra era. donde la práctica de ganadería extensiva ha re- presentado una amenaza para los fines de la conservación. Bochil. las poblacio- nes que ahora forman parte de la zona de amortiguamiento (ver Tabla 2) tienen su origen en la dinámica del reparto agrario en Chiapas. Por otra parte. zona donde existe mayor densidad poblacional y donde en promedio los productores poseen menos de media hectárea de tierra. actores de la conservación Se trata de comunidades que tienen como actividad principal el trabajo agrícola y pecuario (ver Tabla 1). Pue- blo Nuevo. retomando algunos antecedentes históricos de la zona. El Bosque. posteriormente 1 Provenientes de municipios como San Andrés Larráinzar. donde pobladores de comunidades de la zona de los Altos1 demandaron tierra al gobierno federal. territorio que fue disminuyendo paulatinamente durante los siglos siguientes debido a la llegada e invasiones de otros grupos (SEMARNAT 2001). 2012). Vivir en la Reserva: las comunidades rurales. aunque existen mecanismos para regular tales prácticas e incluso se han desarrollado alternativas desde la ganadería intensiva sustentable (Gómez-Castro y cols. es decir. En la época más reciente. la etnia Zoque ocupó todo el occidente de Chiapas. entre otros. buena parte de los primeros asentamientos derivados de la migración intermunicipal han tenido lugar entre 1968 y 1994. fueron fundados por personas que habían sido contratadas por rancheros para trabajar en la ganadería en Ocozocuautla o en los trabajos de construcción de la presa Malpaso y poco a poco llegaron en busca de tierra. Pantelhó y San Juan Chamula.

Carla Beatriz Zamora-Lomelí Tabla 2.240 Este 1 1979 833 Norte 7 1980 7.698 Norte 1 1978 1.253 Norte 2 1987 2. Programa de Manejo de la Reserva de la Biosfera Selva El Ocote Figura 1. Periodo de los asentamientos humanos en la zona de influencia y dentro de la poligonalde la Reserva No.750 Norte 1 1969 1.659 Noreste y este 1 1994 800 Sur Fuente: SEMARNAT 2001.226 Norte 2 1972 2. noreste y este 1 1982 570 Este 4 1984 4. Distribución y tasa de crecimiento anual de asentamientos humanos en la Reserva de la Biosfera Selva El Ocote Fuente: CONANP.REBISO s/f 72 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .840 Norte 3 1973 3.045 Noreste 2 1984 2.014 Norte. de Ejidos Año Superficie (ha) Zona 2 1968 2.

que en este caso es la vida al inte- rior de una reserva de la biosfera. Vivir en la Reserva: las comunidades rurales. 73 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . realizando trabajos empíricos que describen rutinas y significados de los sujetos que no son medibles. que es un método intencionado que repre- senta un vínculo entre observador. actores de la conservación en 1982 se declaró como “Zona de Protección Forestal y Fáunica Selva El Ocote” con 48 mil hectáreas y finalmente en el año 2000 se decretó como Reserva de la Biosfera. Materiales y métodos Este trabajo tiene como base la perspectiva sociológica del estudio de la vida co- tidiana y la construcción social de la realidad (Berger y Luckmann 1968) de tal forma que lo expuesto por la gente se utiliza para analizar si la conservación co- rresponde con la construcción social de una realidad que le es externa a los sujetos y a la cual se enfrentan desde distintos conocimientos. subjetividad y realidad observando el proceso social en sus condiciones cotidianas. se realizaron cuatro talleres participativos en los cuales se tra- bajó con grupos focales para conocer la percepción acerca de las estrategias de conservación y su correspondencia con las necesidades locales. Emilio Rabasa. se realizaron técnicas de investigación cualitativa a través de mé- todos interconectados que permitieron generar información sobre el objeto de estudio. resulta en distintas áreas de oportunidad para em- patar la correspondencia entre la población y su territorio desde la conservación. aproximándose desde los significados y representaciones de esa realidad. lo cual como se verá más adelante. De esta forma los pobladores de la zona han tenido que empatar una forma de vida rural vinculada a los decretos y restricciones que impone la normatividad ambiental. ampliando su extensión a 101 mil hectáreas (SEMARNAT 2001). se utilizó la técnica de observación participante. Nuevo San Juan Chamula y San Joaquín El Rosario. Todo lo anterior fue aplicado en las comunidades que constituyen el estudio de caso: Veinte Casas. tales como entrevistas semiestructuradas a actores clave que posibilitaron la reconstrucción de acontecimientos históricos no accesi- bles por otras fuentes. Para ello. además. así como la reconstrucción de procesos. Finalmente.

que la construcción social de la realidad refleja una armonía en la relación entre naturaleza y sociedad perceptible desde el aprecio al paisaje y el entorno. estamos muy contentos. A nivel subjetivo. Resultados De la revisión de documentos de orden institucional. es decir. dependiendo del tipo de servicio ambiental que se provea (INECC 2009). el cual se materializa a través de las instituciones que promueven proyectos productivos e incentivos económicos. una iniciativa que deriva de las políticas ambientales internacionales ante el cam- bio climático y busca disminuir el impacto por deforestación a través de acciones locales reconocidas dentro de los mercados de carbono. donde los ejidatarios reciben el pago por servicios ambientales. los animales comienzan acercarse más a la comunidad. en espe- cial la valoración de la biodiversidad y el respeto a la fauna que existe en la reserva. Dicha estrategia es un beneficio para los ejidatarios que acuerdan un plan de trabajo para procurar el cuidado del bosque y que implica desde la realización de brechas cortafuego hasta proyectos de reforestación con especies nativas. lo cual se concreta con el reparto monetario de hasta $2. hay alegría (talleres realizados en la comunidad de Veinte Casas y San Joaquín. y como ejemplo se exponen algunas respuestas sin ofrecer los datos personales de quienes las otorgaron. 74 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2016). Carla Beatriz Zamora-Lomelí Por cuestiones de protección a la identidad y respeto a los entrevistados. estas expresiones se manifiestan en palabras como […] es más bonito vivir en la selva. mientras el ingreso económico proveniente de este pago se distribuye equitativamente entre los ejidatarios que reciben el pago de manera anual hasta por cinco años. se siente un orgullo por la diversidad de espe- cies que conocen nuestros hijos a diferencia de los niños de la ciudad. se reconoce que el proyecto de conservación de la REBISO incluye un enfoque de desarrollo sustentable.313 pesos por hectárea. en este texto solamente se combinan las entrevistas. La conservación vista como un proceso de construcción social de la realidad se expresa en términos positivos a partir de las ventajas de vivir en una reserva de la biosfera y se asume como una responsabilidad compartida entre autoridades y pobladores. como ocurre en el caso de Veinte Casas y Nuevo San Juan Chamula.

lo cual fue una constante manifestada en distintos momentos del trabajo de campo. ha incentivado las tareas comunitarias para evitarlo. la opinión de los po- bladores también concibe la conservación en términos negativos. o lo toman o lo dejan. en tanto expresión de la subjetividad. Sin embargo. ello se expresa en palabras como […] no se siente un privilegio por la limitación del uso de recursos. tales como las brechas cortafuego o el monitoreo y reporte de cualquier amenaza potencial. que como se verá en el apartado de discusión. es decir. puede represen- tar una amenaza a los proyectos de conservación si no se impulsa el desarrollo de las capacidades de quienes habitan en la reserva. no nos dejan opción. no todos estamos convencidos de conservar porque no se obtienen beneficios de ello. ello deriva de años de una forma de ejercer el gobierno a través del asistencialismo. Por otra parte. en especial si se asocia con las posibilidades de ingresos económicos. ahora ya no hay tantos pero es bonito ver que ha aumentado y mejorado. son quienes tienen una percepción más positiva en términos de conservación. sin embargo. Vivir en la Reserva: las comunidades rurales. 2016). consideran que existe verticalidad en los procesos institucionales como expresa esta opinión: […] las dependencias traen lineamientos que se hacen desde la oficina. un programa de capacitación derivado desde las oficinas de la Comisión Nacional de Áreas Protegidas (CONANP) que operan localmente en la reserva. actores de la conservación lo cual se enfatiza en quienes colaboran como monitores biológico . No obstante. de ver no se come” (talleres realizados en la comunidad de Veinte Casas y Nuevo San Juan Chamula. 2016). hay necesidades de la familia que obligan a tomar programas que se ofrecen aunque esos no tienen sentido y no sirven (taller realizado en San Joaquín. como se expresa en el significado de esta frase […] antes [del incendio] había más plantas y animales y cuando iba a campo podía verlos. que en estos casos la construcción social de la realidad asocia la conservación con limitaciones que no conllevan ganancias económicas para la población. con respecto a la gobernanza las comunidades muestran interés en trabajar en proyectos de desarrollo sustentable. lo cual aunado a factores como el riesgo de sufrir nuevamen- te un incendio.ambientales. ¿de qué sirve tener la vegetación y cuidarla? si no hay un apoyo para cuidarla. en otros términos. 75 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . que no es lo mismo estar en la oficina que estar aquí. los pobladores que vivieron la emergencia ante un incendio fo- restal de grandes proporciones ocurrido en la reserva en 1998.

la percepción de los pobladores para conservar está más relacio- nada con factores culturales. c) Presión por la ampliación de la frontera agrícola. Con respecto al primer punto. Carla Beatriz Zamora-Lomelí Con todo. Veinte Casas 2015). ¿de qué vamos a vivir? Ya no 76 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . pues como ellos mismos expresan. es beneficio para ellos (entrevista a ejidatario. mis hijos van a quedar. Problemas y soluciones Las principales problemáticas identificadas se establecen como: a) Incompatibilidad entre los objetivos de conservación de los recursos naturales y los de desarrollo de las poblaciones que habitan en las zonas de amortiguamiento. la comunicación de resultados del trabajo en campo en términos que sean accesibles para la población o en acciones que redunden en beneficios directos para los habitantes del espacio de amortiguamiento del área natural protegida. b) Establecimiento de relaciones clientelares basadas en premios y castigos que niegan los intereses de la población. como la relación de la comunidad indígena con su entorno y con la noción de futuro de la comunidad: […] si yo muero hoy. no para mí. e) Falta de compromiso de actores externos (investigadores. además. funcionarios y trabajadores de organizaciones no gubernamentales) para la conser- vación de la naturaleza y la cultura. conservar es para los que vienen. se tiene que los mecanismos implementa- dos a través de subsidios no tienen una perspectiva a largo plazo que permita la autosuficiencia de las comunidades y permita que los pobladores se apropien de sus propios procesos. como ocurre por ejemplo en el caso de la fauna que invade los cultivos y que no puede ser controlada por medios como el uso de químicos o incluso la caza debido a las limitantes para el cuidado de las especies de mamíferos en la REBISO. […] hay programas que vienen pero no se adaptan a la comunidad. d) Restricciones legales que limitan el desarrollo de actividades relaciona- das con el aprovechamiento de especies no maderables. la cual radica en la escasa perma- nencia de los actores en el territorio y en ocasiones.

tal como expresó un entrevistado. Un ejemplo de ello es el pretendido fortalecimiento de capacidades de la propia población. en este caso vinculadas al proyecto conservacionista. En otros términos. actores de la conservación se vive uno así. lo que implica una complejidad que va más allá del manejo progra- mático de la institución a cargo del área natural protegida. la intencionalidad de la puesta en marcha de programas y ac- ciones de gobierno. sin embargo. Veinte Casas 2015). reproducen esquemas derivados de un diseño distante a la realidad de los habitantes en las comunidades. pudiesen no necesariamente tener el matiz de clientelismo. Nuevo San Juan Chamula 2015). pero no es todo) lo cual ha dado lugar a la apari- ción de políticas asistencialistas que buscan ser el camino para reducir la pobreza y la vulnerabilidad (Rueda 2014). […] falta que haya interés en la comunidad y que se dé seguimiento a los programas. Por otra parte. Vivir en la Reserva: las comunidades rurales. si existen relaciones de poder que en lugar de partir del conocimiento y la cultura local. estamos ante una población cuya vulnerabilidad social se expresa como […] una dinámica social de carácter histórico y estructural que se sostiene en procesos de desigualdad e injusticia económica. la puesta en marcha de los proyectos de desarrollo co- munitario suelen basarse en relaciones clientelares que ha sido práctica de nume- rosos gobiernos en la entidad como prácticas del clientelismo político donde la población es objeto de intereses como potenciales votantes para el partido político que tenga predominio en el poder ejecutivo y legislativo estatal y en ello se tejen alianzas y estrategias desde la estructura política para ofrecer beneficios simulados a la población. donde se identificaron omisiones importantes como el uso de la lengua en la cual se imparten cursos de capacitación (español) en comunidades con mayoría de hablantes de lengua indígena e incluso con proyectos que no re- presentan un interés genuino de las comunidades y su cultura. 77 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . social y política [donde] es pertinente señalar que en la identificación de grupos o comunidades vulnerables se ha buscado la asociación de la vulnerabilidad con la pobreza (que forma parte de la vulnerabilidad. que venga estipulado hasta cuántos años queda como tutor la dependencia y así la comunidad se compromete más (entrevista realizada a ejida- tario. Aunado a ello. se bajan pocos proyectos (entrevista realizada a ejidatario.

los productores expresaron desconfianza ante tal iniciativa. hacen que los pobladores se cuestionen sobre el balance entre la conser- vación y las actividades agrícolas. 78 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . si se tumba deja de llover y perdemos muchos cultivos. No obstante. por lo cual crece la tensión en torno a los límites de la frontera agrícola. además de problemas para la producción de cultivos de temporal como la falta de lluvia. Un punto no menos importante en la problemática identificada es la frontera agrícola. dado que en una ocasión anterior se les hicieron llegar nuevas plantas que no lograron adaptarse al lugar. y frente a lo cual la política gubernamental envió nuevas plantas de café a fin de promover la re- cuperación de tal producción. Carla Beatriz Zamora-Lomelí La problemática vista desde la vulnerabilidad social. cada vez hay menos cosechas por la destrucción y por eso conviene conservar. se percibe a partir de la situación de alta marginación social y económica y de un tejido social comunitario que en tales circunstancias opta por la iniciativa individual más que atender a la po- sibilidad de organización colectiva. Otro punto de tensión entre la aplicación de la política pública y la respuesta de la población. […] el que gana aquí es el dueño del inver- nadero nada más (entrevista realizada a ejidatario. es la falta de información sobre la normatividad que rige en térmi- nos del proyecto de conservación y cuyo acato ocurre más por temor al castigo que por conocimiento. dado que tradicionalmente las familias campesinas heredan la tierra a sus descendientes y el crecimiento demográfico en las comunidades ha ido en aumento. afectado severamente durante el 2015 por la roya (una enfermedad que afecta a la planta de café impidiendo su desarrollo y posterior cosecha del fruto). Así por ejemplo. pero la falta de recursos nos empuja a cultivar más. tenemos muy poco terreno para trabajar. de tal modo que los campesinos que habitan en la zona de amortiguamiento de la REBISO se enfrentan de manera individual a los problemas de producción y mercado. […] nosotros como dueños de la tierra tenemos la responsabilidad de conservar. la falta de control de la fauna que se come los cultivos (por ejemplo como ocurre en el caso de los tejones). nuestras parcelas son en su mayoría pura montaña. o problemáticas concretas como plagas o enfermedades en los cultivos. Se dice que es el pul- món de Chiapas pero tenemos muy poco para sembrar (entrevistas a ejidatarios. existen restricciones que limitan el desarrollo de actividades relacionadas con el aprovechamiento de especies no maderables y que generan confusión para la población que carece de otro tipo de combustible. San Joaquín 2015). sin embargo. Nuevo San Juan Chamula 2015). como se percibió a partir del cultivo del café.

en la construcción de alternativas y acciones para intentar revertir los efectos de tal degradación. entre otros desastres. huracanes. ha sido un asunto del cual se ha ocupado la política pública mexicana prácticamente desde inicios del siglo XX. la conservación de la naturaleza con relación al desarrollo de las sociedades. no siempre se ha tenido un emprendimiento fuera de tensiones. donde las emisiones por gases de efecto invernadero por efecto de actividades hu- manas han aumentado en 70% entre 1970 y 2004 (IPCC. De esta manera. tornados. resulta evidente la magnitud de la degradación ambiental y la importancia de emprender acciones en todos los niveles de la estructura social. provocando con ello diversos cambios ambientales desde la emergencia de fenómenos hidrometeorológi- cos (sequía. tuvo en sus ini- cios un enfoque conservacionista que anulaba la relación entre medio ambiente y 79 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Empero. 2007). en especial cuando las decisiones colectivas implican la dimensión espacio-territorial. etc. ha tenido consecuencias catastróficas en términos ambientales. los campesinos optan por migrar como jornaleros agrícolas a otras enti- dades o migran a las ciudades como trabajadores asalariados que perciben entre uno y tres salarios mínimos. La complejidad de cada problemática va más allá de esbozar soluciones. En este contexto. como en buena parte de los territorios rurales de México. implica una serie de factores. actores y prácticas cotidianas donde la realidad social se presenta adversa a la población en la paradoja donde se vive en zonas de basta riqueza natural en condiciones de pobreza y vulnerabilidad crecientes. como se refleja en el aumento de la temperatura atmosférica como efecto de los procesos antropogénicos. pero difícilmente encuentran mejoras económicas con proyectos al interior de las comunidades.) que se potencian con la crisis ambiental donde predominan la contaminación de fuentes de agua. Discusión El crecimiento demográfico vinculado al actual modelo de producción y consumo. originalmente la política ambiental que establece por de- creto reservas territoriales como las áreas naturales protegidas. el agotamiento de recursos naturales y la pérdida de la biodiversidad. Vivir en la Reserva: las comunidades rurales. suelos y aire. actores de la conservación Ante estas problemáticas. Así.

Todo ello a cambio del abandono de derechos de acceso al espacio y a los recursos bajo protección (Tejeda. por ejemplo. se ha trabajado desde la definición gubernamental de áreas naturales protegidas. que las áreas naturales protegidas […] se han decretado de manera unilateral por parte del go- bierno mexicano en nombre del interés público (conservación de la biodiversidad y recursos estratégicos para el país y la humanidad en general) con escasa o nula participación por parte de las comunidades locales. es decir que se trata de territorios normados donde la población que lo habita debe regirse bajo la reglamentación (pocas veces consensada con el conjunto de la sociedad). en donde el ambiente original no ha sido esencialmente alterado y que producen be- neficios ecológicos cada vez más reconocidos y valorados. control y uso de los recursos naturales entre actores diferentes (De Castro y cols. diseños y ejecución de los procedimientos y prácticas que configuran el acceso. 2015) y que para el caso que nos ocupa. que en varios casos los decretos fueron impuestos a la población residente en las zonas. es preciso señalar. entendidas por la instancia reguladora como […] porciones terrestres o acuáticas del territorio nacional representativas de los diversos ecosistemas. donde de acuerdo con Carlos Tejeda […] los proyectos de conservación se buscan también mediante incitaciones más que por la negociación. concebida como el […] proceso de formulación y refutación de imágenes. los programas de ordenamiento ecológico y los res- pectivos programas de manejo (CONANP 2015). o mediante pequeños proyectos de desarrollo y de infraestructura. 2009). a través de la distribución de una parte de los beneficios derivados del manejo del área. Se crean mediante un decreto presidencial o través de la certificación de un área cuyos propietarios deci- den dedicar a la conservación y las actividades que pueden llevarse a cabo en ellas se establecen de acuerdo con la Ley General del Equilibrio Ecológico y Protección al Ambiente. En la actualidad diversos au- tores apuntan a la pertinencia de la gobernanza ambiental. Este enfoque conservacionista ha ido cambiando a partir de las discusiones en espacios académicos y de toma de decisiones donde se ha valorado la conve­ niencia de la acción de los pobladores en tales territorios tanto para la conserva- ción como para el propio desarrollo comunitario. Asimismo. Si bien estos decretos no son 80 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . es decir. coincidiendo con el mismo autor. con lo cual se coartaba la participación social para el cuida- do del medio ambiente y el uso de los recursos naturales. su Reglamento. Carla Beatriz Zamora-Lomelí s­ ociedad.

mitigar o responder a situaciones de desastre (Garza 2004). lo que impide su capacidad de prevenir. en este sentido. mientras que la vulnerabilidad social se obser­va en la ausencia de organización comunitaria para responder a procesos de desastres naturales derivados del cambio climático. la crisis de institucionalidad atraviesa por una crisis de ciuda- danía y la puesta en marcha de las políticas públicas se encuentra con la reproduc­ ción del clientelismo y el asistencialismo. En el caso que nos ocupa. la gobernanza ambiental se encuentra anulada toda vez que no existen condiciones reales para la incidencia de la sociedad que habita en los territorios de las áreas naturales protegidas con respecto a los esquemas de conservación. dado que exis- ten necesidades de la vida cotidiana que no han logrado subsanarse. sí imponen una serie de normas y regulaciones que restringen los cambios de uso del suelo. estos procesos se asumen como es- trategias de conservación que en buena medida llegan a través de las instancias gubernamentales. organizaciones no gubernamentales y actores académicos para que los pobladores realicen los trabajos más cercanos a la conservación. 81 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . situación que se traduce en una suerte de despojo de los derechos de los pobladores al acceso y control de su territorio”(Tejeda. como los cargos de guardaparques y monitores. como el de la política ambiental. la REBISO. el aprovechamiento de los recursos naturales y acotan las actividades productivas. por lo que la gobernabilidad aparece como una estrate- gia para el modo de gobernar que implica un proceso de dirección de la sociedad (Kooiman 2003) frente a tal déficit institucional. Vivir en la Reserva: las comunidades rurales. el déficit de institucionalidad es una de las principales causas generadoras de inequidades y desigualdades que reproducen la pobreza y la degradación del ambiente. actores de la conservación expropiatorios. 2009). Aunado a lo anterior. además de una amplia brecha en las relaciones entre actores sociales e instituciones que dificulta la constitución de go- bernanza y democracia ambiental. las acciones resultan todavía insuficientes para generar impactos en el conjunto de la población. con base en el diseño de políticas públicas multisectoriales. no obstante. Sin embargo.

de tal forma que se dependa cada vez menos de estímulos externos y se generen mecanismos para la reproducción de la vida acordes a la cultura de los distintos grupos sociales. Este proceso no supone el retiro del Estado. 2014). además de fortalecer las capacidades de actores locales y gubernamentales para facilitar una […] transferencia gradual de responsabilidades. dado que como apunta Alberto Betancourt […] no es posible concebir la conser- vación de la vida separada de la defensa de las culturas que en territorios concretos le dan sentido a la primera (Betancourt et al. funcio- nes y recursos a la comunidad. e) Promover la sinergia entre distintos actores sociales anclada en el respeto a la cultura y derecho de las comunidades. Para ello se propone: a) Realizar cambios vinculantes en las prácticas institucionales. se pueden emitir algunas recomen- daciones. valorando el conocimiento existente e impulsando áreas de oportunidad para fortalecerlo. f) Fomentar una cultura del ejercicio de derechos para que la población se apropie de los mismos y se comprometa en el cuidado de su territorio. Carla Beatriz Zamora-Lomelí Recomendaciones A pesar de la complejidad de tales problemas. particularmente pensando en términos de construir una gobernanza ambiental donde la población ejerza su derecho al territorio y asuma un compro- miso con la conservación desde el ejercicio de tales derechos. sino una nueva manera de ver la intervención estatal en un esquema de co. 2009). b) Crear espacios en donde se propicie el conocimiento mutuo de los inte- reses dentro de la REBISO. 82 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . d) Promover el fortalecimiento de los medios de gestión de la población que habita en la zona de amortiguamiento.administración de las ANPs y los recursos naturales (Tejeda. c) Revisar la armonización y observancia de los ordenamientos jurídicos para la conservación y el desarrollo sustentable.

mientras que los procesos de democratización del gobierno y la ciudadanía. armonización y observancia de los ordenamientos jurídicos podría abonar en el terreno de la confianza ciudadana si a su vez existieran cambios vinculantes en las prácticas institucionales y espacios en donde se propicie el conocimiento mutuo de los intereses dentro de las áreas naturales protegidas. aunque la operación de las áreas naturales protegidas considere una figura para la participación (los consejos asesores). Aquellos casos en que la conservación se asume como una tarea propia. Mientras no existan las condiciones que garanticen una vida digna para la población. limitan la conservación de los recursos naturales. el manejo sustentable de los mismos y agravan la desigualdad que padece la población. desde la recolección de leña para cocinar hasta el acceso a agua potable. tendrá mayores retos para el ejercicio de su ciudadanía en términos de la participación en las políticas públicas que afectan su territorio. 83 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se observaron entre personas que han tenido o tiene cargos comunitarios. derivadas de las limitaciones de nuestra democracia. 2014) Un principio de revisión. la conservación ambiental seguirá siendo percibida más como una im- posición que una tarea colectiva. Vivir en la Reserva: las comunidades rurales. desarrollados a través del diálogo social entre autoridades ambientales y población local. constituyen los medios más seguros para lograr una política ambientalmen- te sustentable y socialmente sostenible” (Legorreta et al. no así entre el resto de la población (jóvenes o mujeres por ejem- plo) que consideran el proyecto de la REBISO como un reto más en la difícil tarea cotidiana. Tim Trench y Conrado Márquez: […] las condiciones de déficit de ciudadanía y la correspondiente política ambiental predominantemente autoritaria e inconsistente con un estado de- mocrático de derecho. como se expresa en las comunidades de la REBISO que viven en situación de alta y muy alta marginación. Estos retos implican la construcción de un tejido comunitario con solidez organizativa capaz de interactuar e incidir en los espacios de toma de deci- siones. Tal como afirman Carmen Legorreta. actores de la conservación Conclusiones Una población cuyo acceso a los servicios básicos garantizados por la ley se en- cuentra mermado.

. la Maestra en Ciencias Karla Leal y su equipo de colaboradores. sustentable y sostenible entre el medio ambiente y la sociedad. Ante un modelo económico donde la producción y el consumo son cada vez más acelerados. T. no solo de aquellos que proveen de servicios ecosistémicos. Referencias Betancourt. Del monólogo a la poli- fonía: proyectos supranacionales y saberes indígenas en la gestión de áreas naturales protegidas. 2014. cuyo corte asistencial no contribuye al fortalecimiento de capacidades de las personas. También agrade- cemos a los ejidatarios y pobladores de las comunidades de Veinte Casas. Finalmente. Campos. Los desafíos ante la crisis ambiental que vivimos. Ciudad de México. y Cruz. en particular al ingeniero Roberto Escalante. San Joaquín y Emilio Rabasa por compartir su palabra y pen- samiento para esta investigación.. Nuevo San Juan Chamula. tanto urbana como rural. Arellano. México. se debe pensar en alternativas que permi- tan una relación armónica. agradecemos al CONACYT por el apoyo a través proyecto PDCPN-2013/214650-Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote. Universidad Nacional Autónoma de México. Carla Beatriz Zamora-Lomelí Lo anterior será posible en la medida en que se resuelvan las contradicciones sociales y la inequidad que difícilmente han combatido las políticas de combate a la pobreza. director de la REBISO. J. A. E. 84 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . requieren además la par- ticipación de todos los sectores de la sociedad. De igual manera. una política ambiental enfocada a la conservación requiere la apropiación del conocimiento y la revalorización de los saberes tradi- cionales donde se privilegie la relación entre naturaleza y sociedad. Agradecimientos Agradecemos al personal de la REBISO que hizo posible la operación del trabajo de campo.

Piñeiro] (editor). Universidad Autónoma de Chapingo. Instituto Nacional de Es- tadística y Geografía.. del Carpio y C. Áreas protegidas decreta- das. Chiapas. B. Chiapas Gobierno del Estado. Kooiman. M.gob. La seguridad nacional de México.2009. Rodríguez-Larramendi y R. Aguascalientes. 2014. Disponible en http://www. L.conanp. Guevara-Hernandez. Disponible en http://www. Nahed- Toral. 2015. C. F. Reserva de la Biosfera Selva El Ocote.mx/descargas/ con_eco/2009_sem_ser_amb_pres_04_emartinez. La construcción social de la realidad. C. M. Luckman. K. Ciudad de México. Instituto Nacional de Ecología y Cambio Climático. M.mx/que_hacemos/ De Castro. Orantes. Baud (coords. Londres. C. Pérez.. Sage. Mexico. Anuario estadístico y geográ- fico de Chiapas. Journal of Animal and Veteri- nary Advances 11: 831-840. Buenos Aires. Chiapas. Marco conceptual para el estudio de los desastres. 2003. Hernandez-Lopez. Gómez-Castro.gob. Gobernanza ambiental en América Latina. Comisión Nacional de Áreas Naturales Protegidas 2015. H. Páginas 107- 120 en [J. Chiapas. Inglaterra. Márquez y Trench. 2012. y M. J. J. T.). Governing as Governance. Leal. Vivir en la Reserva: las comunidades rurales. Comisión Nacional de Áreas Natu- rales Protegidas. C. México. Paradojas de las tierras protegidas en Chiapas. Buenos Aires.. Programa de Pago por Servicios Ambientales. Aprovechamiento del re- curso maderable tropical nativo en la comunidad de Emilio Rabasa. F. México.inecc. 1968. Centro Regional de Investigaciones Interdisciplinarias. Tejeda. México. Pinto-Ruiz. México. Legorreta. Ocozocuautla. actores de la conservación Berger P. 2004. 2015. Amorrortu editores. H. Madera y Bosques 19: 7-21. Argentina. Hogenboom. Consejo Latinoamericano de Ciencias Sociales. 2014. México. y T.pdf. Universidad Nacional Autónoma de México. Argentina. Centro de Investiga- ciones Interdisciplinarias en Ciencias y Humanidades. Instituto Nacional de Estadística y Geografía. 2013. Universidad Autónoma Metropolitana Azcapotzalco. Reserva de la Biosfera El Ocote. Garza.. 85 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Analysis of cattle raising and institutional perspectives regarding collective action in the El Ocote Biosphere Reserve.

Conservación de la biodiversidad y comunidades locales. El riesgo socioclimático en México (1995-2011). 86 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Programa de Manejo de la Reserva de la Biosfera Selva El Ocote. Cambio Climático: financiamiento y dependencia en América Latina. Carla Beatriz Zamora-Lomelí Rueda. Chiapas. Secretaría de Medio Ambiente y Recursos Naturales. Conflic- tos en las áreas naturales protegidas de la Selva Lacandona. M­éxico. 2009. 2001.Pdf. J. Disponible en: http://www. 2014. León. Universidad de Guanajuato. C. México. Guanajuato.mx/Que_Hacemos/ Pdf/Programas_Manejo/Ocote. Comisión Nacional De áreas Naturales Protegidas.conanp. Tejeda. Canadian Journal of Latin American and Caribbean Studies 34: 57–88. Tesis de docto- rado en Ciencias Sociales. C.gob.

Chiapas. Esta integración es una necesidad mayor para el manejo de las Áreas Naturales Protegidas (ANP) ante el cambio climático global que se agudiza. Sociedad y Ambiente. México. Confiamos que al incluir ambas perspectivas se armonice todo el conocimiento detrás de 87 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Chiapas. metodológicos y pragmáticos nutridos por las diferentes ramas del conocimiento. Unidad San Cristóbal (San Cristóbal de Las Casas. Chiapas. En el presente capítulo se hace un breve análisis de los conceptos de vulnerabilidad y cambio climático global desde las perspectivas social y biológica. 29290 San Cristóbal de Las Casas. Unidad San Cristóbal (San Cristóbal de Las Casas. El Colegio de la Frontera Sur Unidad. C.mx Resumen Las problemáticas ambientales y sociales que surgen ante el cambio climático glo- bal son un desafío para generar conocimiento que permita un mayor ajuste de las actividades humanas con los procesos de la naturaleza. México) *Autor para correspondencia. en particular de las ciencias sociales y las ciencias biológicas. El Colegio de la Frontera Sur. Chiapas. Para lograrlo surge la ne- cesidad de construir enfoques teóricos. Carretera Panamericana y Peri- férico Sur s/n. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas Guadalupe del Carmen Álvarez-Gordillo. San Cristóbal (San Cristóbal de Las Casas. México) 3 Departamento de Conservación de la biodiversidad. El Colegio de la Frontera Sur. Guadalupe del Carmen Álvarez Gordillo. México) 2 Departamento de Agricultura. E-mail: galvarez@ecosur. El Colegio de la Frontera Sur.1 Christiane Junghans2 y Lorena Ruíz-Montoya3 1 Departamento de Sociedad y Cultura. Unidad San Cristóbal.P. Departamento de Socie- dad y Cultura.

Bajo la premisa de una dependencia mutua del ser humano y la naturaleza. Palabras clave: Vulnerabilidad social. En este contexto. las situaciones y retos de las Áreas Naturales Protegidas ante el cambio climático. Mientras que anteriormente las sociedades buscaban cómo protegerse de ciertos eventos de origen natural. Por otro lado. por lo que experi- mentaron relaciones diversas con la naturaleza y aprendieron a sobrevivir con 88 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la relación sociedad-naturaleza ha sido tema de estudio de las distintas disciplinas sociales y naturales. Introducción El propósito de este capítulo es presentar brevemente algunos de los conceptos biológicos y sociales que están en relación directa con los objetivos y relevancia de las Áreas Naturales Protegidas y de los retos socio-ambientales que estas áreas enfrentan actualmente. Guadalupe del Carmen Álvarez-Gordillo. Christiane Junghans y Lorena Ruíz-Montoya estos conceptos y su importancia para la gestión integral de las Áreas Naturales Protegidas. en la búsqueda de encontrar un uso sustentable de los recursos naturales y la conservación de los mismos. ANP. se dibuja bre- vemente el panorama y debates en torno a la vulnerabilidad social y biológica en territorios tropicales mayas. en otras palabras “toda la historia de la humanidad es una historia de interac- ción entre la biosfera y el hombre” (Morín 1996). en particular frente al cambio climático global. pretendemos que este sea un capítulo introductorio para presentar nuestro enfoque de la vulnerabilidad. vulnerabilidad biológica. aplicado a estudios específicos sobre la conservación de la biodiversidad y la vulnerabilidad social de los medios de vida. hoy en día la naturaleza requiere protección ante la degradación que sufre a causa del encuentro con las sociedades humanas (von Mentz 2012). La relación entre la sociedad y la naturaleza ha cambiado a través del tiem- po. Tratamos de mirar hacia una alta complejidad de los objetos de estudio en las ciencias y las políticas públicas en concordancia con los actores sociales. Numerosas culturas a lo largo de la historia se han desarrollado bajo dis- tintas condiciones ambientales y disponibilidad de recursos. cambio climático.

que se reflejó en la declaración de las primeras áreas protegidas en Norteamérica y México. surgió la competencia por la tierra y el agua. es decir. entre otros. la sacralización de elementos naturales y un uso no destructivo de éstos (Toledo y Barrera-Bassols 2011). una extinción masiva de especies (Challenger 1998) y el cambio climático (IPCC 2007). Honduras y El Salvador) centraba la relación sociedad- naturaleza en el uso del espacio natural para la satisfacción de sus necesidades. Las consecuencias de estos daños al ambiente son. los cuales causaron contamina- ción de cuerpos de agua. se caracterizan por una sobreexplotación de los recursos naturales que ha llevado a la degradación de los mismos. sin la destrucción del mismo. El manejo de sus territorios y patrimonio biocultural. un deterioro de ecosis- temas y la reducción de hábitats. continúa la valo- ración de espacios de conservación y uso de los recursos naturales como parte de la vida cotidiana. Belice. 2003:15). que incorpora la preocupación por la des- trucción de los bosques y propone acciones de conservación y restauración. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas sus recursos locales mediante los conocimientos. Las problemáticas anteriores sucedieron y siguen presentándose a nivel mundial. principalmente “la cosmogonía de la cultura maya (Mé- xico. se han presentado grandes cambios en relación a las sociedades y el uso de los recursos naturales. Las sociedades que siguieron este modelo de desarrollo. Además de los pueblos originarios de América. lo que hoy calificamos como sustentabilidad” (Maza et al. Uno de los más importantes fue la transición de cazadores y recolectores a labradores sedentarios que tuvo efectos significativos sobre el ambiente y la organización social. que incluye recursos naturales. fue el paso hacia una sociedad cuyo desarrollo se basó en la industria. y se desalojaron y mataron animales silvestres (Castañeda-Rincón 2006). en el siglo XIX en Europa se inicia una importante corriente de pen- samiento. His- tóricamente. aún hoy en día. Otra gran transición inició a mediados del siglo XVIII en los países euro- peos. al crecer las aún incipientes ciudades. el suelo y la atmósfera. Para algunos de los pueblos originarios. Guatemala. Se hizo necesaria la explotación de combustibles fósiles. agroecosistemas tradicionales y la diversidad biológica 89 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se talaron vastas áreas de bosque por la demanda de madera para la construcción y como combustible. Dicha corriente tuvo una pronta influencia en América. vinculada al sector forestal.

Morín 2001 citado por Toledo 2005). la problemática ambiental actual es. Hoy en día. De esta ma- nera.Toledo 2009. relacionados al sistema de creencias y ligados a rituales y mitos. científica y tecnológica del mundo” (Leff 2003:11). Contrario a esta visión holística. es decir. herramientas metodológicas y 90 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . y se analiza solamente una o bien unas pocas variables de la realidad. se reconoce que la relación ser humano-naturaleza y la proble- mática ambiental son de carácter complejo al sujetarse a elementos físico-biológi- cos del entorno. los grupos originarios miran al mundo de forma holística y no diferen- cian entre conocimiento empírico y religión (Boege 2008. por lo que surge la necesidad de generar conocimiento que integre enfoques intra e interdisciplinarios. es transformación de la naturaleza inducida por la concepción metafísica. 2013. lo que plantea el desafío de desarrollar un marco teórico. más allá de una crisis ecológica. está basado en la conjugación entre praxis. el conocimiento ha desestructurado a los ecosistemas y desnaturalizado a la naturaleza (Leff 2004. confluyen múltiples procesos y se involucran varios subsistemas interrelacionados de diversos modos y a diferentes escalas. corpus y cosmos. en el sistema industrial. ética. von Mentz 2012). Castañeda-Rincón 2006. y que se caracterizan por la mutua dependencia de las funciones que cumplen dichos elementos dentro del sistema total. sin embargo. De esta manera. difícilmente se puede obtener un análisis de un sistema complejo por la simple adición de estudios disciplina- rios correspondientes a cada uno de los elementos. factores económicos. Levy-Tacher et al. los pueblos realizan sus prácticas productivas mediante un repertorio de conoci- mientos. Debido a esta heterogeneidad. Guadalupe del Carmen Álvarez-Gordillo. Christiane Junghans y Lorena Ruíz-Montoya domesticada. es un cuestionamiento al pensamiento ligado a la ciencia y la razón tecnológica con las que ha sido dominada la naturaleza y economizado el mundo moderno de la sociedad occidental: “La crisis ecológica actual por primera vez no es un cambio natural. filosófica. Los sistemas sociales y ambientales son simplificados. que les permiten interpretar la naturaleza a través de ese quehacer productivo. tecnológicos. con elementos hetero- géneos que están en dominio de distintas ramas de la ciencia. productivos y la organización social. Asimismo. se hace uso in- tensivo y depredador de los recursos naturales. La ciencia occidental construye el objeto de estudio al extraerlo de su ambiente complejo y tratarlo en una situación experimental no compleja. Los cambios catas- tróficos siempre han ocurrido en la naturaleza ligados a fenómenos naturales.

La primera ANP. Esta y otras iniciativas fueron secundadas por países en situación similar donde se empezó a crear áreas protegidas a través de decretos presidenciales y bajo decisiones que se tomaron sin reflexionar sobre la inclusión de las percepciones y necesidades de los pobladores. se obviaba la histo- ria social y cultural del territorio y no se permitía modificar o utilizar los recursos naturales para la producción y reproducción de los pobladores. originalmente. Al inicio. Las primeras Áreas Naturales Protegidas (ANP) fueron proclamadas por iniciativa de un movimiento con una visión esencialmente biológica de la proble- mática ambiental. Este planteamiento signi- fica también un cambio en la finalidad de la ciencia. 91 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Las reservas de la biosfera como instrumentos de conservación En el siglo XIX coincidieron hechos aparentemente contradictorios. estas áreas fueron concebidas únicamente como agregados de flora y fauna que se pretendían conservar in situ. el despojo de grandes territorios a México y la persecución de los pueblos que los habitaba. su creación se debió a que en Norteamérica. Castañeda-Rincón 2006). Leff 2003). el parque nacional Yellowstone. principalmente indígenas. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas prácticas que permitan la integración de estos enfoques. con el fin de preservar la flora y fauna en áreas que aún tenían su cobertura original. como la gue- rra de exterminio contra los pueblos originarios y su contra partida la “coloni- zación” del oeste. hoy en día se puede considerar que su principal propósito es cómo el ser humano se ajusta a la naturaleza de un territorio (García 2011. por lo que muchas regiones sufrieron el deterioro del suelo y la deforestación a un grado tal que hizo surgir la necesidad de recuperar y preser- var áreas que aún albergaban una diversidad biológica alta. se registraban áreas con abundancia en recursos como flora y fauna silvestre -es- pecialmente la madera. Dentro de los procesos de colonización apareció el interés por preservar la naturaleza y justificó la creación de las áreas protegidas. que residían en esas áreas (Agrawal y Redford 2006. fue proclamada en Esta- dos Unidos en 1872.y minerales que los nuevos colonizadores utilizaban y extraían rápidamente. mientras que anteriormente el conocimiento sirvió para conquistar y controlar la naturaleza.

Sin embargo. 92 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la tala ilegal y la sobreexplotación pesquera. entre ellas la de vigilancia. Toledo 2009). llevaron a criticar la decisión de excluir a la población humana de la protección de la vida silvestre. Hasta el momento. la cultura y las actividades productivas. mientras que para otros una conservación exitosa es inseparable del desarrollo social. En consecuencia. México. Este último aspecto coincide con el tercer tipo de problema que los países mencionan de manera recurrente y que tiene que ver con la falta de recursos humanos y eco- nómicos para cumplir correctamente con sus funciones. comentario personal). Según el Programa de las Naciones Unidas para el Medio Ambiente (Maza et al. Guadalupe del Carmen Álvarez-Gordillo. Diversos programas tanto de estados como de organizaciones no gubernamentales se han enfocado en conjuntar la conservación de la biodiversidad con el combate de la pobreza. Christiane Junghans y Lorena Ruíz-Montoya Los conflictos con la población de los asentamientos locales en los parques nacionales y resultados de los programas de conservación que no lograron cumplir las expectativas. algunos autores destacan la importancia de la ausencia de cualquier actividad humana en las áreas destinadas a la conservación. CONANP. y que constituyen violaciones al marco jurídico que regula las ANP. Los factores que sí están normados. Estos ilícitos ocurren debido a la ausencia de un verdadero control y aplicación de la ley y no por falta de regulación. aunque son situaciones que suceden en los contextos de ANPs. no se mencionan que las problemáticas y causas de fondo son la falta de una visión integral de los ecosistemas donde los seres humanos están participando 1 Director de la Reserva de la Biosfera Selva El Ocote. Guatemala y Perú lo vinculan específicamente a la pobreza y al crecimiento demográfico. a partir de los años 1980. son escasos los ejemplos en los que se logra la conservación y el bienes- tar humano simultáneamente (Escalante López1. aunque sigue el debate académico sobre la factibilidad de lograr ambos objetivos en conjunto (Agrawal y Redford 2006. por lo que es importante la coparticipación de las comunidades rurales y la atención de sus necesidades para asegurar su bienestar. se encuentran la cacería. la discusión académica sobre esta problemática está tomando dos posiciones an- tagónicas. 2003) las problemáticas y la falta de cumplimiento de los objetivos de las ANPs se describen por la deforestación y el crecimiento de la frontera agropecuaria son considerados prácticamente por todos los países como el principal problema que enfrentan las ANP.

Estas áreas geográfi- cas constituyen una porción única en su tipo en la tierra. UNESCO 1996). y propor- cionar oportunidades de recreación. En México.de los recursos basado en actividades compatibles con prácticas ecológicamente viables.55 ha. Dentro de estos se encuentran los de mantener la fauna y flora silvestre. agua. la de promover un desarrollo económico y humano sustentable. especies. y finalmente la de fomentar la inves- tigación. existen muchos retos sociopolíticos en relación a 93 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . así como salvaguardar los valores culturales asociados al territorio. Asimismo.839. es decir 77.62 ha de un total de 90. y son vistos sólo para el cumplimiento de normas y leyes. y después siguen las zonas de transición flexible en donde se permite el uso comercial de los recursos de forma sustentable y de bajo impacto (Bonnin y Velut 2009. educación y formación. educación e investigación científica (CONA- BIO 2016).521.6% de la superficie de las ANP en México. su delimitación tiene como objetivo la conservación de la biodiversidad y de los servicios ecosistémicos. las ANP son una herramienta de conservación que pretende cumplir varios objetivos y proporcionar una multitud de beneficios tanto para los pobladores de zonas aledañas como para la región. los pobladores y sus medios de vida de no son considerados. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas en la vida cotidiana de la relación con el ambiente que les da sustento.761. El 85. lo que revela la importancia de los estudios que aborden la problemática de su gestión (CONANP 2017). Aunque la CONANP se ha podido consolidar como instancia administradora de estas áreas. ecosistemas y paisajes. paisajes naturales y procesos ecológicos (carbón. Estas reservas se conciben como una forma de ordenamiento territorial que a través de un plan de gestión pretende lograr la integración de tres funciones: la de conservar para proteger recursos genéticos. El concepto de las reservas de la biosfera surgió para dar una respuesta a la inquietud de si se podía conciliar la preservación de los recursos biológicos y su diversidad con el uso y aprovechamiento sustentable de los mismos. las reservas de la biosfera constan de una o varias superficies centrales (núcleos) dedicadas a una conservación a largo plazo donde la única actividad humana permitida es la investigación cientí- fica. servir de testigos del cambio. suelo). el país y el planeta. corresponden a reservas de la biosfera. son biológicamente de alta diversidad y albergan especies únicas. luego sigue una zona de amortiguamiento en la que se permite un uso limi- tado -exclusivamente para el autoconsumo. Por lo anterior.530.

Durand y Jiménez (2010) consideran que sin el consenso y negociación con las poblaciones. comunidades o propiedades (Legorreta y Márquez 2014a). y cada vez se dispone de menos territorio para realizar las actividades económicas y de subsistencia (Porras-Murillo et al. es imposible mantener estos ecosistemas. Este segundo postulado tiene cuatro principales evidencias: (1) el traslape 94 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Aunque estas actividades se realizan con fines de subsistencia o bien para obtener un ingreso económico modesto. muchos eco- sistemas que se consideran aún prístinos en realidad son paisajes culturales que están bajo cierto tipo de manejo. ya que 30% de sus habitantes son indígenas. pero al no considerar las formas de manejo de la población local. Por otro lado. un axioma biocultural. No obstante. a pesar de que en su origen sí conciben la conservación y el desarrollo. pero en términos sociales son espacios de tensión y conflictos por el acceso y uso de los recursos naturales. nacional. que provocan desterritorialización. Según Reyes-García (2009). el denominador común es un ingreso econó- mico escaso. se genera información básica cada cinco años cuando los programas de manejo deben ser actualizados. el bienestar de los pobladores así como las valoraciones o percepciones ambientales. la gobernanza y el manejo sustentable de las ANP así como conflictos territoriales que se derivan de su establecimiento en zonas que fueron previamente dotadas como ejidos. En las reservas de la biosfera de México hay numerosos asentamientos humanos de tamaño variable que llevan a cabo actividades tales como la agricultura y la ganadería. 2011). Respecto a la eficiencia de la conservación a través de las ANP. ponen constantemente en riesgo la biodiversidad y los ecosistemas por los cambios de uso de suelo derivados de las actividades productivas. internacional. no es factible lograr la conservación biológica y cultural en las ANP de México. que pregona la imposibilidad de preservar la biodiversidad sin proteger la diversidad cultural y vi- ceversa. Guadalupe del Carmen Álvarez-Gordillo. global). Víctor Toledo (2003) abona a que la población indígena conserva la biodi- versidad. Figueroa y Durand (2011) mencionan que las ANP tienen un 60% de eficacia en la prevención de la pérdida de vegeta- ción original. lo que se aprecia en sus planteamientos de tres axiomas de la conserva- ción bioregional: “el axioma biosocial que supone una concepción de la conser- vación en íntima reciprocidad con el desarrollo social a diferentes escalas (local. regional. Se obtienen principalmente indicadores de la biodiversidad y por lo general no se contemplan indicadores del desarrollo. Christiane Junghans y Lorena Ruíz-Montoya la gestión.

Por lo que el territorio no existe fuera de sí mismo. en él se desarrollan los vínculos sociales más importantes y que se caracteriza por el modo en que se manifiestan el dominio. pertenencia y apropiación. adquieren una identidad mediante la cual se diferencia de otros grupos. no todos los pueblos indígenas y originarios en las ANP conservan sus territorios por su cultura propiamente.78). el término lugar no se debe entender como una ubicación geográfica precisa de al- guien o algo sino.del que se apropian para realizar su vida cotidiana. Montañéz 2001 citado por Durand 2010. Los grupos humanos tienden a delimitar un lugar -denominado territo- rio. Raffestin y Butler 2012). en el sentido antropológico. (3) la reconocida importancia de los pueblos indígenas como principales pobladores y manejadores de hábitats bien conservados y (4) la certificación de un compor- tamiento orientado al conservacionismo entre los pueblos indígenas. poder. 2010. como pueden ser la vestimenta particular. también es un ensamble de relaciones que 95 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . ma- trimonio y muerte. Sin embargo. por otro lado. sino por las reglamentaciones obliga- torias hacia el acceso de los recursos. los rituales relacionados con nacimiento. por su pertenencia a esta construcción singular con cierto modo de existir. como un espacio terrestre particular ocupado y manejado por un conjunto de personas quienes. su existencia surge en la relación con lo otro o los otros (Durand 2008. y la lengua. el territorio es un concepto que hace referencia a un espacio apropiado y valorizado -simbólica y/o instrumentalmente- por los grupos humanos. y en otros casos por necesidades de sustento se involucran en actividades que producen un ingreso como la venta de madera y venta de especies de animales llamados exóticos. realiza prácticas culturales ligadas a los recursos locales y desarrolla instituciones que dan sentido a la vida cotidiana. La apropiación del territorio sucede cuando un grupo social busca asegurar la reproducción y satisfacción de sus necesidades vitales (materiales o simbólicas) en ese espacio. derivado de su complejo de creencias conocimientos y prácticas de carácter premoderno. p. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas geográfico entre la riqueza biológica y la diversidad lingúistica y (2) entre los terri- torios indígenas y las regiones de alto valor biológico (actuales y proyectadas). Por lo tanto. En este contexto. el ciclo anual de fiestas. El tercer axioma es el bioproductivo que impulsa acciones que buscan combinar la creación de un sistema de regiones que combinen ANP con áreas bajo manejo de la biodiversidad y otros recursos y servicios de los ecosistemas” (Toledo 2005.

especies y ecosistemas. los habitantes se vieron limitados en sus medios de vida y su identidad (Durand 2010). relacional e histórico. en vez de crear territorialidad e identidad. mientras que el “no lugar” es aquel sitio donde no hay cabida para una identidad singular o relación alguna entre los grupos sociales y el ambiente. Veracruz. Aunado al riesgo de crear “no-lugares” y desterritorializar las áreas pro- tegidas. Al dar prioridad a la conservación de la biodiversidad e instaurar una normatividad y reglas para la relación hombre-naturaleza en las ANP. La percepción que una sociedad tiene de la naturaleza se construye a través de la interacción con ella. Una revisión de los casos de la Sierra de Huatla y los Tuxtlas. para la satisfacción de sus necesidades. su cultura y la forma en que se relacionan con el ambiente. Guadalupe del Carmen Álvarez-Gordillo. Al no considerarse esta necesidad de interacción. en la práctica de la conservación la discusión sobre la biodiversidad ha tomado matices más políticos que biológicos. Christiane Junghans y Lorena Ruíz-Montoya la sociedad mantiene con lo que está fuera de su territorio y con sus alteridades. al no tomar en cuenta sus necesidades. relación e historia que cargan de sentido al espacio. situación que probablemente se repite en la REBISO. en vía de lograr la mayor autonomía basada en el uso de sus recursos (Raffestin 1980. lo que reduce la sensación de bienestar de todos los involucrados (Durand 2010). y generalmente desconocían los objetivos y beneficios poten- ciales. revela que los habitantes son los últimos en ser consultados y tomados en cuenta para decretar y establecer un área protegida. perdiendo de esta manera sus diferentes componentes como genes. aunado a que debilitan la identidad. puede con- vertir a las ANP en “un enemigo invisible a vencer”. 96 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . el lugar antropológico puede definirse como un espacio de identidad. Agrawal y Redford (2006) exponen que la biodiversidad es etiquetada de forma general como “naturaleza”. al mismo tiempo que dificulta la labor de los encargados del manejo de la reserva quienes se enfrentan a un am- biente social de tensión constante y a momentos de enfrentamiento. se crean estos no-lugares que no tienen significado en la vida cotidiana ni razón de ser ya que no se identifi- can como espacios necesarios y creados mediante procesos participativos. se pueden ocasionar procesos de deste- rritorialización y la creación de “no-lugares”. Esta falta de territorio desde la perspectiva de los pobladores. en donde no se posibilita el cumplimiento de objetivos conjuntos de bienestar humano y conservación de la biodiversidad. Raffestin y Butler 2012). En estos casos. De acuerdo a Marc Augé (2000).

el objetivo ya no sigue siendo la conservación sino más bien la gestión y la distribución de los recursos y los derechos de acceso a ellos. En México. la sensibilidad que tienen organismos o bien grupos sociales respecto a ser afectados por esta situación. resistencia y mitigación de los cambios adversos que pueden suceder y lograr. y sistemas de compensación respecto a pérdidas y ganancias derivadas de su uso. una adaptación a la nueva situación. siguen siendo el principal instrumento de política ambiental y se busca la conservación de los recursos naturales a través de normar y regular el acceso y uso que determinada población hace de estos recursos (Legorreta y Márquez 2014b). Aunque no se ha podido concertar una definición generalmente aceptada de la vulnerabilidad de sistemas biológicos o sociales. Lavell 2003). De esta manera. derivado de las actividades hu- manas con modelos de desarrollo depredador (Leff 2004) y con consecuencias en los patrones climáticos (IPCC 2007). los autores coinciden en que ésta tiene que ver con el riesgo de daño en un sistema que está expuesto a una situación de tensión. región o país. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas así como sus atributos como composición. las normas institucionales que regulan su aprovechamiento. es el de vulnerabilidad. las demandas de la socialización de la naturaleza van más allá del rescate de un patrimonio natural y cultural en un territorio determinado. durante las últimas décadas los decretos para es- tablecer ANP y los reglamentos que posteriormente siguen. En este contexto. como los programas de manejo y ordenamientos ecológicos. pueden dar respuesta a situaciones de presión o perturbación. y la capacidad de respuesta para hacer frente a la tensión y sus impactos o consecuencias (Cardona 2001. a largo plazo. con la finalidad de adoptar medidas de prevención. plantea la necesidad de conocer cómo y en qué medida los sistemas biológicos y sociales de una comunidad. se presenta como una lucha por la apropiación del poten- cial ecológico de los recursos productivos (Leff 2004). La vulnerabilidad ha sido abarcada por diversas disciplinas con diferentes enfoques 97 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Uno de los conceptos que quiere explicar estos fenómenos. Vulnerabilidad social y biológica El deterioro ambiental como nunca antes visto. estructura y función que son afectados de manera distinta por el uso e influencia humana.

2010. pero tienen en común que consideran principalmente riesgos de y respuestas a desastres. por lo que la mayoría de los autores hacen referencia a la vulnerabilidad social. y dejan fuera ajustes y cambios a largo plazo. recuperarse o bien adaptarse. también es definido como el grado de pérdida potencial ante un desastre o evento dañino (Cutter et al. Miller et al. Guadalupe del Carmen Álvarez-Gordillo. La dis- cusión sobre el concepto de la vulnerabilidad surgió en ciencias sociales. y la capacidad (o bien falta de capacidad) de esta unidad potencialmente expuesta a hacer frente a esta situación. pobreza. La vulnerabilidad social tiene sus orígenes teóricos en el estudio de de- sastres relacionados con fenómenos naturales. o bien en las estrategias para enfrentar las consecuencias y recuperarse después de un desastre. Los estudios de vulnerabilidad refieren a las características y los medios de una persona o un colectivo en términos de su capacidad para anticiparse. mientras que la ecología política y las ciencias de la sustentabilidad tienen perspectivas más integradoras y complejas (Alwang et al. principalmente en tres categorías: riesgos de desas- tres incluyendo la epidemiología. Cada una abarca sus propias preguntas de investigación. Existen princi- palmente tres tendencias: la creación de modelos de exposición para identificar condiciones que hacen lugares o poblaciones vulnerables ante desastres de origen 98 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Los primeros estudios sobre la vulnerabilidad social se realizaron en el con- texto de la investigación en ciencias sociales sobre desastres y en salud con enfo- ques epidemiológicos. 2010. con distintos procedimientos metodológicos. 2010. Christiane Junghans y Lorena Ruíz-Montoya teóricos y. mientras que la vulnerabilidad biológica es escasamente tratada (Miller et al. las preguntas de investigación se centran en el análisis del riesgo de sufrir una tensión. Según la disciplina que estudia el fenómeno. resistir o recu­perarse del impacto de un desastre natural o antrópico. 2010). y cambio climático (Miller et al. por parte de disciplinas como la geofísica. la ecología humana y la ecología política. según sus enfoques y su direccionalidad. Pérez- Vizcaíno 2010). Pérez-Vizcaíno 2010). en consecuencia. Algunos de los enfoques son más tecnocráticos en función de solucionar situaciones concretas. hacer frente. En estos estudios se percibe la vulnerabilidad como el grado en el cual una unidad potencialmente expuesta es susceptible a sufrir daño por la exposición a una perturbación o estrés. Downing y Patwardhan 2005). Miller et al. 2010. conteniendo modos de vida y seguridad alimentaria. Los distintos estudios sobre vulnerabilidad pueden ser agrupados. 2003.

Desde los organismos internacionales en la segunda mitad de 1990. 2003). La fragilidad socioeconómica se estudia a través de las condiciones de vida. y la integración de la exposición potencial a un desastre con la resiliencia de la sociedad. En lo que respecta a la capaci- dad de resistencia incluye los aspectos de adaptación y recuperación. con el fin de identificar las entidades administrativas que son más vulnerables que otras ante los impactos de un desastre de origen natural. Cutter et al. (2003) integraron un índice de vulnerabilidad social (SoVI por sus siglas en inglés) con factores que causan vulnerabilidad basados en los datos estadísticos de municipios de Estados Unidos sobre ciertos rasgos socio-económicos como el bienestar personal. La fragilidad física está determinada por la concentración espacial de población e infraestructura económica. es decir distintas áreas geográficas pueden ser más vulnerables en diferentes momentos históricos. las di- ferentes disciplinas procuran ofrecer un cuerpo coherente y sistemático de con- ceptos y relaciones sobre el tema de la vulnerabilidad. En una valoración cuantitativa. Los autores señalan también la necesidad de vincular la vulnerabilidad social y la vulnerabilidad biofísica para investigar las complejas interacciones entre ambos componentes y a escalas locales. dependencia de infraestructura. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas natural. las desventajas y el bienestar (Kaztman y Filgueira 1999. Moser y Mclwaine 1999). así como la capacidad de la población de enfrentar los riesgos y las emergencias (Cilento 2005). edad y etnicidad. menciona que la vulnerabilidad tiene tres grandes componentes: la fragilidad física. cumpli- miento de bienestar a través de servicios y recursos. la pobreza. enfocada en un lugar o una región en particular (Cutter et al. Cardona (2001) en un abordaje holístico para su estudio. la medición de la resistencia o resiliencia de una sociedad ante un desastre bajo el supuesto que la vulnerabilidad es una condición social. dependencia económica de un solo sector. regionales y nacionales. la com- plejidad de las interconexiones de los elementos de las estructura urbanas y rurales. la fragilidad socioeconómica y la capacidad de resistencia. Una de las conclusiones del estudio es que la vulnerabilidad social es multifactorial y dinámica espacial y temporalmente. De estas relaciones se establece que la vulnerabilidad y la pobreza se derivan de un 99 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la desigualdad. los efectos sinérgicos de esta concentración y la falta de normas y cumplimientos para la seguridad de la población que incrementan la exposición y los riesgos.

el capital humano (salud y educación). comunitaria. la incapacidad de respues- ta y la inhabilidad para adaptarse a su materialización. la vulnerabilidad se usa para analizar y revelar las desigualdades de origen y de trayectoria que influyen sobre el desempeño social y pobreza. Según Busso (2008) existen cuatro dimensiones de VS de los hogares: el hábitat (medio ambiente y vivienda). Los actores sociales en vulnerabilidad La construcción social e histórica de la vulnerabilidad es diferenciada por las cla- ses sociales y el tipo de riesgos en terminos de la probabilidad de ocurrencia de una situación social extrema (epidemias. ya que es multi-causal y está compuesta por varias dimensiones analíticas. que deviene “signo” de la época y (3) Carencia u obsolescencia de activos. (2) La sensación de inseguridad y desprotección ante los riesgos y la evidencia de un debilitamiento de la capacidad de respuesta (estatal. con cambios estruc- turales que generan oportunidades y riesgos. En vez de enfatizar su carencia de ingresos mencionan la necesidad de contribuir a la apro- piada dotación y movilización de todos sus recursos y capacidades. po- líticas. Por tanto. el concepto de vulnerabilidad social difiere de connotaciones dependiendo del área o disciplina de estudio y se nutre de tres corrientes (Busso 2009): (1) La globalización y el nuevo modelo de desarrollo. reforzamiento y obsolescencia de capacidades. más control sobre varias dimensiones del entorno y mayor volatilidad y complejidad de otras. pues confluyen aspectos de los individuos u hogares y características económicas. De esta forma la vulnerabilidad es entendida como una situación a la que confluyen la exposición a riesgos de distinta naturaleza. la complejidad de la vulnerabilidad social (VS) es mayor. de hogares y personas) se capta con la noción de vulnerabilidad so- cial. incendios y otros de origen natural) y el grado en el cual 100 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Christiane Junghans y Lorena Ruíz-Montoya cambio radical en los supuestos de las políticas dirigidas a los pobres. Según el enfoque. la dimensión económica (empleo e ingresos) y el capital social y las redes de protección formal. Guadalupe del Carmen Álvarez-Gordillo. culturales y ambientales de la sociedad. las amenazas y los riesgos determinan el tipo de vulnerabilidad y responde a la pregunta ¿vulne- rabilidad a qué? Por tanto. hambrunas o guerras) o eventos físicos extremos (inundaciones.

y que tiene en cuenta los recursos que se poseen para enfrentar los riesgos y sus consecuencias. (2) diversificación de actividades para valorar activos y (3) adquisición o generación de diversos seguros (formales e informales) contra choques adversos. Se puede entender como un proceso encarado por una persona. grupo o comunidad. como se argumentó anteriormente. se han descrito: (1) movilización de activos. que es el enfoque de conservación que impera en las ANP y que contribuye al incremento de esa vulne- rabilidad. de forma dinámica y heterogénea. en términos de desastres. en el tema de las ANP. con lo cual. Por tanto. Kaztman 2000. no todos los recursos del entorno se pueden convertir en capitales. debido a las restricciones propias del mandato de la conservación. La vulnerabilidad social como un proceso social. Moser y MclIwaine 1999). grupo o comunidad en desventaja social y ambiental en el que cabe identificar los siguientes elementos: (1) existencia de riesgos externos a la persona. Se han estudiado diversas estrategias de las poblaciones para enfrentar los riesgos. Sánchez y Egea (2012). sin embargo en el caso espe- cial de las ANP. encuentran que la vulne- rabilidad no debe verse solamente como una característica (Kaztman y Filgueira 1999. la relevancia del enfoque de vulnerabili- dad se relaciona con la posibilidad de captar la forma y las causas por las que las condiciones macroestructurales y políticas permite que diversos grupos y sectores sociales estén sometidos. a eventos y procesos que atentan contra su capacidad de subsistencia (riesgos). grupos o comunidades. su acceso a mayores niveles de bienestar y al ejercicio de sus derechos ciudadanos. (2) proximidad a 101 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Por tanto. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas la comunidad absorbe dichos eventos y tiene las herramientas para recuperarse. Estas estrategias concuerdan con los llamados capitales en el modelo de análisis de medios de vida sustentable que nos interesó estudiar. grupo o comunidad que en un mo- mento determinado se encuentre en una situación desfavorecida o de desventaja con respecto a otras personas. el perfil del propio mandato contribuye a la vulnerabilidad de los medios de vida. y la definen como un proceso en cual puede estar inmerso en cualquier persona. político e histórico La VS es un proceso complejo. ocurrirán como una interface entre un evento extremo y una población humana en condiciones de vulnerabilidad (Downing y Patwardhan 2005).

pero también con el inconveniente que son vistos como una fotografía del presente o una comparación de un episodio histórico con el presente (Petschel-Held et al. define a la vulnerabilidad socioambiental “como el proceso que conlleva a situaciones críticas e irreversibles en torno a la calidad y cantidad de los recursos hídricos que ponen en riesgo el desarrollo humano y el funcionamiento de los ecosistemas” y define “la vulnerabilidad como el proceso por el cual la población humana y los ecosistemas están sujetos a riesgo de sufrir daños o amenazas ocasionadas por factores biológicos. 48). físicos y sociales” (p. originado por las actividades humanas. económica y cultural en que se desarro- lla. (4) capacidad y mecanismos para superar los efectos de esos riesgos. una vez enfrentadas las consecuencias de la actuación de dichos riesgos (Bohle 1993. Enfoques de vulnerabilidad desde las ciencias ambientales Patricia Ávila (2008) en su trabajo relacionado con la seguridad hídrica. El cambio cli- mático global actual. El enfoque que más se han utilizado para evaluar la vulnerabilidad social a escala local es de los medios de vida sustentables (MVS). Existen importantes aproximaciones sobretodo en evaluación por indicadores de vulnerabilidad que son bastante utilizados. Christiane Junghans y Lorena Ruíz-Montoya los mismos. Guadalupe del Carmen Álvarez-Gordillo. Por tanto. 102 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Pérez de Armiño 1999 citados por Sánchez-González y Egea-Jiménez 2012). Chambers 1989. es decir el nivel de acceso a los recursos sociales y naturales para enfrentar una situación adversa y para procurar el bienestar poblacional y utilizar los recursos de manera sustentable. En este sentido. con la consecuente dificultad de establecer las interrelaciones entre los diferentes ámbitos. ajustarse o presentar una respuesta frente a los cambios ambientales de origen natural o antropogénico. 1999). ecológica. escalas y temporalidad. ajustarse o perecer debido a esos cambios. (3) posibilidad de evitarlos. social. (5) situación final resultante. la vulnerabilidad como proceso es dinámica e implica la evaluación integral histórica. política. en el que se trata de defi- nir e integrar cuales son los capitales de la población. es similar a la vulnerabilidad social en su complejidad y con la capacidad de mantenerse. la vulnerabilidad de la diversidad biológica de un área dada. afecta directamente la diversidad biológica porque el ambiente físico es modificado y las especies pueden resistir.

ajuste y probabilidad de extinción de las especies por lo menos en los últimos 50 años. Vulnerabilidad biológica La biología de la conservación es una disciplina que ha abordado el concepto de resis- tencia. Mientras el IPCC ubica la amenaza. pero con la certeza de que cada región o localidad requiere de análisis biológicos y sociales particul­­­a­res. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas En la evaluación del cambio climático. Para tomar medidas y acciones de conservación de la diversidad biológica. para lograr acuerdos internacionales y posiblemente nacionales y locales. también ha sido una preocupación de los profesionales de la biología de la conservación. exposición. La vulnerabilidad es una función del caracter. en 1964 se promulgó un instrumento a nivel internacional de gran valor llamado la 103 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . magnitud. el IPCC promueve la definición de vul­ nerabilidad como “el grado por el cual un sistema es susceptible o incapaz de hacer frente a los efectos adversos del cambio climático. sin llegar a medidas generales. 2010). No obstante. con- secuencias y capacidad adaptativa en una sola canasta sin evaluar los escenarios y diferentes contextos socioculturales (Downing y Patwardhan 2005). es sensible y tiene capacidad adaptativa” (IPCC 2001:21). y acerca de la temporalidad y respuestas de mitigación de corto plazo o adaptación que implica un mayor plazo. y ha hecho énfasis en que las actividades humanas que implican el cambio de uso del suelo es la principal causa de extinción de las especies. en el plan al menos. Existe un debate importante en terminos de la articulación de las respuestas sociales y ambientales. y tasa de variación climática en el cual un sistema es expuesto. La preocupación de preservar las especies y la búsqueda de medidas compatibles con el desarrollo y bien- estar humano. algunas dis- ciplinas de las ciencias sociales se enfocan más a las respuestas de la población y se alejan de las implicaciones ambientales y ecológicas que posteriormente pueden aumentar la vulnerabilidad (Miller et al. así como el abordaje integral del riesgo y la vulnerabilidad. es nece- sario tener puntos de referencia que ayuden a tomar una decisión y la definición de acciones que. lleven a un punto deseado o definido por todos los actores o las partes que coinciden en un espacio y tiempo dado. incluyendo la variablidad y los extremos del clima.

comuni- dad o ecosistema debido a los cambios en los patrones climáticos. es decir del sistema social y ecológico en su conjunto. 2013) la evaluación de la vulnerabilidad y la implementación de medidas de adaptación deben realizarse a nivel local respondiendo a condiciones particula- res. El nivel superior de conservación es el ecosistema. las cuales son producto de procesos continuos de evolución en millones de años y este proceso de evolución se detiene cuando las especies se extinguen. Guadalupe del Carmen Álvarez-Gordillo. esto es. Según la Estrategia Nacional de Cambio Climático (LGCC. tamaño (poblacional para especies. Christiane Junghans y Lorena Ruíz-Montoya Lista Roja de la IUCN. entonces pue- de relacionarse directamente con el riesgo de extinción de unas especies. La vulnerabilidad social y ecológica genera el total de la vulnerabilidad del socioecosistema. La vulnerabilidad biológica ante el cambio climático (VACC). no se ha realizado. Para cada sitio se deben establecer diferentes líneas de acción que favorezcan las condiciones de reducción de la vulnerabilidad y aumento de la resiliencia de 104 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . y su delimitación se basa en clara distinción y singularidad de sus elementos como son comunidades y po- blaciones. análisis e integración a políticas públicas y sobre todo casos concretos de éxito hasta donde tenemos co- nocimiento. por la interrelación e interdependencia entre los servicios ecosistémicos y los medios de vida de la población. tamaños poblacionales y por tener un hábitat estrecho. la especie crece y se reproduce en un intervalo corto de factores físicos o bióticos (IUCN 2015). sin embargo la descripción. La estimación del riesgo se basa en los patrones de dis- tribución. La CONANP (2015) define la vulnerabilidad al cambio climático como el potencial o la predisposición de un sistema a ser afectado adversamente por los impactos del cambio climático. Menciona también que la vulnerabilidad está dada en función de la sensibilidad y de la capacidad adaptativa de dicho sistema. La sensibilidad se refiere al grado en el que un sistema resulta negativa o positiva- mente afectado por estímulos relacionados con el clima. en la que se enlistan las especies de todo el mundo en algún nivel de riesgo de extinción (International Unionfor Conservation of Nature’s Red List of Threatened Species). La VACC de las especies y de las comunidades puede ser una función de su distribución. La relación entre la vulnerabilidad social y biológica ante el cambio climá- tico global (CCG) en las ANP’s es de interés para las manejadores y tomadores de decisiones de las reservas. área para comunidades) y del potencial evolutivo (es- timado por la diversidad genética que albergan).

2010). y se define como la capacidad de respuesta y gestión integral. así como fortalecer la Gestión Integral de Riesgos de la población y una capacidad adaptativa de los ecosistemas definida como “la habilidad de los ecosistemas de ajustarse al cambio climático (incluida la variabilidad del clima y sus extremos) para moderar daños potenciales. 2013) En general. adaptación y mitigación. y se considera una meta (Miller et al. y por otro lado también la diversidad biológica medida como número de especies también puede ser poco variable. La resi­ liencia generalmente aplicada a la recuperación de los ecosistemas. los cuales se nutren de diferentes epistemologías. a la vez que promuevan la reducción de la vulnerabilidad socioambiental. 2010). prin- cipalmente la identificación y atención de zonas. asentamientos y grupos sociales prioritarios. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas la población y de los sistemas que contribuyen a una mejor calidad de vida. No obstante. tomar ventaja de las oportunida- des. por ejemplo el concepto de resiliencia. 105 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la estimación de la diversidad biológica y el contexto social de ANP’s. ahora se aplica a las poblaciones humanas. la a resiliencia tiene relación directa con la vulnerabilidad: “un sistema socio-ambiental vulnerable ha perdido resiliencia”. servicios instalados o ingresos económicos y se difiere escasamente entre comunidades. (2003 citado por Miller et al. Sin embargo a escalas regionales o locales no se conoce si esta relación persiste o se pierde. Para Turner et al. y hacer frente a sus consecuencias” (LGCC. El problema a nivel regional o local es que el desarrollo se ha medido por infraestructura. México muestra que hay una relación inversa entre la conser- vación de la diversidad biológica y el nivel de desarrollo de la población que las habita. es necesaria para el manejo y conservación de los recursos naturales y para el desarrollo de la política pública que promueva el bienestar humano de las comunidades que subsisten en las ANP. Enfrentando la vulnerabilidad socioambiental ante el cambio climático en las ANP Hasta ahora se han estudiado y debatido diferentes conceptos para enfrentar el cambio climático y sus consecuencias. por lo que los capitales de medios de vida pueden aportar mayor información a nivel de población local.

por lo que la definición de procesos y capacidades para dar atención. equidad y derechos humanos de esta y futuras generaciones (Aguilar 2009). Christiane Junghans y Lorena Ruíz-Montoya El cambio climático produce variaciones climáticas con impactos menos violentos pero constantes que afectan la disponibilidad del agua y llevan a efectos negativos en la salud humana. los otros 9 se refieren a captura de carbono y programas de adaptación al cambio climático. En este mismo documento. la cual tie- ne como objetivo fortalecer las capacidades de la institución y responder a los com- promisos contraídos por México en materia de mitigación y adaptación al cambio climático. se define a la mitigación como la “aplicación de políticas y acciones destinadas a reducir las emisiones de las fuentes. sin duda modifica el contexto para el ejercicio del desarrollo sustentable. Conde-Álvarez 2007. Prácticamente todos los países se ven rebasados para responder oportunamente a contingencias ambientales. El cambio climáti- co debiera ser entendido en todas sus dimensiones e incluso debiera considerarse un asunto de seguridad nacional. mitigar y promover la resiliencia social al cambio climático es cada vez más urgente. En el reciente documento sobre la Estrategia de Cambio Climático para Áreas Protegidas (ECCAP) hay una convocatoria explicita para incrementar la resiliencia (CONANP 2015). Es necesario fortalecer las distintas áreas de gestión de las ANP a fin de focalizar en las causas de la vulnerabilidad social y biológica. IPCC 2010). así como en las actividades agrícolas que dan sustento a la humanidad (CONANP 2015. los ecosistemas y los servicios que éstos prestan. o mejorar los sumideros de gases y compuestos de efecto 106 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Este panorama predice crisis en la segu- ridad alimentaria. para disminuir la pro- babilidad y el nivel de los impactos del cambio climático. justicia social. En la ECCAP se mencionan 10 objetivos de mitigación y adaptación al cambio climático de los cuales solamente uno esta mencionado como herramienta para evaluar la vulnerabilidad social. migración en masa de pobladores así como desastres sociales y ambientales de mayor intensidad y frecuencia. Ante el panorama de cambio climático y los desastres. en las políticas públi- cas se ha planteado la necesidad de un sistema de áreas protegidas “resiliente”. que no solamente tiene un papel fundamental en la adaptación al cambio climático y la mitigación de sus efectos adversos. Guadalupe del Carmen Álvarez-Gordillo. sino es una oportunidad para conservar el pa- trimonio natural y al mismo tiempo fomentar la economía y mejorar el bienestar de las poblaciones humanas que dependen de los servicios ambientales que proveen estas áreas.

no vinculada y en armonía con lo social y cultural. instituciones y población participen activamente en fortalecer 107 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . La vulnerabilidad es un proceso histórico y social. La vul- nerabilidad social y biológica ante el cambio climático se incrementa por la falta de estrategias locales y pocos avances en la consolidación y mejoramiento de las capacidades organizacionales y técnicas para la planeación e implementación de medidas de adaptación y mitigación al cambio climático. la con- servación y la restauración de ecosistemas para mantener la provisión de servicios ecosistémicos que permitan reducir los impactos del cambio climático. Conclusiones Las ANP que se establecen bajo el concepto de reserva de la biosfera. Si continúan las políticas ambientales sec- toriales y desarticuladas de las sociales y las económicas. que dan sentido a los patrimonios bioculturales. para ayudar a las personas a enfrentar los efectos adversos del cambio climático. tanto de bienestar poblacional como ambiental. Se prioriza el manejo sustentable. educación y salud. la búsqueda de medios de vida susten- tables para la población humana y más aspectos cualitativos como las percepciones socioculturales de los patrimonios y capitales o riquezas co­munitarias. responderán a las necesidades de los habitantes. tienen la intención de conservar la biodiversidad en conjunto con las comunidades situa- das dentro de sus límites mediante el fomento del bienestar de los pobladores y un uso sustentable de los recursos naturales. los factores externos cambian constantemente en el tiempo y espacio debido a acciones de múltiples atributos de los actores sociales. o bien como la “intervención humana para reducir las fuentes o me- jorar los sumideros de GEI” (IPCC 2013 citado por CONANP 2015). se construye una visión fragmentada de la naturaleza. La gestión conjunta de los territorios a conservar. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas invernadero”. esta propuesta de manejo debiera incluir explícitamente metas relacionadas al servicio de agua potable. Asimismo se presenta una propuesta de adaptación basada en Ecosis­temas (AbE). con toma de decisiones y la participación de redes sociales hacia políticas públicas. Sin embar- go. Es necesario que los diversos actores sociales. la cual propone el manejo de la biodiversidad y los servicios de los ecosistemas como parte de una estrategia más amplia de adaptación.

org/science Aguilar.wcs. Específicamente re- plantear de manera integral los objetivos de las ANP. Wildlife Conservation Society. habría que seguir preguntando para quién y quiénes definimos la sustentabilidad desde la ciencia y las políticas públicas. Guadalupe del Carmen Álvarez-Gordillo. et al. New York. Doi: 10.worldwatch.orgID 108 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . así como para los tomadores de decisiones. Christiane Junghans y Lorena Ruíz-Montoya los medios para cubrir sus necesidades básicas bajo preceptos de sustentabilidad. para vivir en áreas que consideren territorios construidos histórica y socialmente por las personas que las habitan y que dan sentido y definición a su patrimonio biocultural. Into a warming world. que derivan de un sistema capitalista y consumista. no negar las desigualdades sociales a diferentes escalas. Disponible en: http://www. Women and Climate Change: Vulnerabilities and Adaptive ­Capacities. Poverty. E. En el análisis y evaluación de los medios de vida sustentables. urge un fortalecimiento hacia la gestión integral. y K. Referencias Aguilar. D23107. Disponible en: www. 110.. que incluya las capacidades locales y su articulación con las institucionales hacia una mayor mitigación y adaptación socioambiental a diversas amenazas y del reto actual del cambio climático. A. 2006. 2005. development and biodiversity ­conservation: shooting in the dark? Working Paper No. Changes in precipitation and temperature extremes in ­Central America and northern South America.1029/2005JD006119. Agradecimientos Agradecemos al CONACYT por el apoyo a través proyecto PDCPN-2013/214650- Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Bios- fera Selva El Ocote. 26. 1961–2003. con la prioridad de calidad de vida de poblaciones y su ambiente. L. Redford. Agrawal. Journal of ­Geophysical Research. 2009. World Watch Institute.

2001.uni-hohenheim. Jorgensen. 18 p.. M. G. Vulnerability as viewed from dif- ferent disciplines.ub. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas Álvarez. Jolly. Un enfoque comparado Francia-Chile. 2002.org/bitstream/handle/11362/7167/ S028572_es. Siegel y S. de su origen precoz a su consolidación tardía.cepal. y D. Tabasco. y S. O. Instituto Nacional de Antropología e Historia. Ponencia: International Work Conference on Vulnerability and Disaster.Acuerdo de Cooperación CELADE-FNUAP (Fondo de Población de las Naciones Unidas. Vulnerabilidad socioambiental. 2008.. Conservation Ecology 5:18. Noviembre de 2009. de/fileadmin/einrichtungen/sfb564/events/uplands2002/Full-Pap-S1-1_­ Siegel. ­January 8-11. Adapting to climate change: Social-ecological resilience in a Canadian Western Arctic community. Vulnerabilidad y patrimonio biocultural en Tacotalpa. 2008. Ciencias 90:46-57 Alwang. 28 al 30 de junio. 2002. 2016. J. México. seguridad hídrica y escenarios de cri- sis por el agua en México.F.pdf Berkes.fr/file/index/docid/432202/filename/ BONNINVELUT2008. Theory and Practice. Disponible en:http://hal.htm 109 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .univ-brest.edu/geocrit/sn/sn-218-13. Wageningen. Vera y D. La necesidad de repensar de manera holística los conceptos de vulnerabilidad y riesgo. P. G. D. J. F. La contribución del concepto de Reserva de la Biosfera al desarrollo sustentable. P. G.pdf Busso. 2009. Halshs 00432202 versión 1. Castañeda-Rincón. Bonnin. Ramos. El patrimonio biocultural de los pueblos indígenas de México: hacia la conservación in situ de la biodiversidad y agrodiversidad en los territorios indígenas. Ávila. 2006. Boege. Vulnerabilidad sociodemográfica en Nicaragua: un desafío para el crecimiento. Las áreas naturales protegidas de México. Velut. E. Disponible en: URL: https://www. International Symposium Sustaining Food Security and ­Managing Natural Resources in Southeast Asia .L. Disponible en: http://www. 2008. IV Jorna- das de Derecho Ambiental. Oficina de Nicaragua) Centro Latino- americano y Caribeño de Demografíca (CELADE)-División de Población. Holanda. Revista Electrónica de Geografìa y Ciencias Sociales 218 (13). Política y Cultura 45:211-239. B.pdf?sequence=1 Cardona.Challenges for the 21st ­Century -. Disponible en: http://repositorio.

gob. Base de datos por entidad. S. Downing . C. México D.Utilización y conservación de los ecosistemas terrestres de ­México. CONAPO (Comisión Nacional de Población). Disponible en: http://sig.-The Nature Conservancy.conapo.php/74/ mod_resource/content/1/Climate_vulnerabilty_and_adaptation. 2011. 22 p. 23:23-30.mx/region/areasprot /beneficios. Boruff y W.gob. Disponible en: http://www. 2007 Cambio climático en América La- tina y el Caribe: Impactos. B. 2016. presente y futuro.) – TNC (The ­Nature Conservancy). Beneficios. 2017. Comisión Nacional de Áreas Naturales Protegidas (CONANP).mx/en/CONAPO/Indice_de_Marginacion_por_ Localidad_2010 Conde-Álvarez C. Shirley.C. vulnerabilidad y adaptación.J. et al. Comisión Nacional de Áreas Naturales Protegidas. Fondo Mexicano para la Conservación de la Naturaleza A.L. http://www. 2015.C. México.conanp.L.pdf Duarte. S. Cutter. biodiversidad. Social Science Quartely 84:242-261. 1998. Consulta en: http://eportalafrica. Guadalupe del Carmen Álvarez-Gordillo. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO). Saldaña-Zorrilla. Estrategia de Cambio Climático des de las Áreas Naturales Protegidas: Una Convocatoria para la Resiliencia de México (2015-2020). Espacio abierto 14:265-278 Challenger. Social Vulnerability to Environmental Hazard. México. Áreas Naturales Protegidas. Áreas Na- turales Protegidas Decretadas. Patwardhan. Pasado. Cambio global Impacto de la actividad humana sobre el 110 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .mx/ website/pagsig/datos_anp. Assessing Vulnerability for Climate Adaptation. A.F. 2005.html Comisión Nacional de Áreas Naturales Protegidas (CONANP) – FMCN (Fondo Mexicano para la Conservación de la Naturaleza A. 2010. Christiane Junghans y Lorena Ruíz-Montoya Cilento. Capacidad de resistencia.T.htm Comisión Nacional de Áreas Naturales Protegidas (CONANP). 2003. Secretaría de Medio Ambiente y Recursos Naturales. y S.com/pluginfile.gob. 2006. Technicl paper 3.. vulnerabilidad y cultura de riesgos. y A. Revista Ambiente y Desarrollo. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. Programa de adaptación al cambio climático en áreas naturales protegidas del complejo Selva Zoque.

Interdisciplinariedad y sistemas complejos. International Union for Conservation of Nature’s Red List of Threatened Species (IUCN). Jiménez 2010.pdf Huicochea. Universidad Nacional Autónoma de México. F. Contribution of Working Groups I. II and III to the Fourth Assessment Report of the I­ ntergovernmental Panel on Climate Change [Core Writing Team. Durand 2011. Figueroa. 104 p. Notas para México.iucnredlist.)].K and Reisinger. Revista Lider 16:59-72. Chiapas. G. academica.es/ranadon/ Ricardo_Anadon/docencia/DoctoradoEconomia/DuarteCambioGlobal. Versión electrónica: https://www. Geneva. 2008. ¿Nos importan las cuestiones sociales? El contexto social en los Programas de Manejo de las reservas de la biosfera en México. Dinámica y escenarios sobre los procesos de cambio de cober­ tura y uso del terreno en el sureste de México: El caso de la Selva El Ocote. Nueva Época.mx/jspui/bitstream/987654321/504/1/interdisciplinariedad_y_ sistemas_complejos. A. Switzerland.) España. y L. Disponible en: http://www. Tesis de Doctor en Ciencias.edu. 2015.L. J. 2013. Carlos M.ch/pdf/assessment-report/ar4/syr/ar4_syr_full_report. Disponible en: http://www. Santa Fe.org/ IPCC 2007. Revista Digital de Estudios en Patrimonio Cultural. Sobre áreas naturales protegidas y la construcción de no-lugares. L. Red Patrimonio. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas sistema Tierra. R. Patrimonio biocultural de Campeche en Patrimonio Cultural y Natural. 2007: Synthesis Report. ipcc. R. Human Ecology 36:383-394.colmich. Mexico. Pachauri. Durand. Disponible en: www. 2007.F. pdf Durand. A. Ponencia en V Congreso Iberoamericano sobre Desarrollo y Ambiente de REDIBEC 2011. Argentina. I (1). México D. (eds. The local perception of tropical deforestation and its relation to conservation policies in Los Tuxtlas Biosphere Reserve. Experiencias mexicanas en torno a su protección y su manejo”.unioviedo. Instituto de Ecología. 2011. Consejo Superior de Investigaciones Científicas. Flamenco. García. L. Climate Change. Revista Latinoameri- cana de Metodología de las Ciencias Sociales http://contenidosabiertos.mx/red. Programa de Doctorado en Ciencias Bio- médicas.pdf 111 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Duarte (coord.

Programa de las Naciones Unidaspara el Desarrollo (PNUD). Paradojas de las tierras protegidas en Chiapas. Comisión Económica para América Latina y el Caribe (CEPAL) Montevideo. en E. Trench (coordinadores). Páginas 129-171. M.F. Legorreta-Díaz. 2004. A. México D. y C. vulnerabilidad y estructura de oportunidades. ¿Es posible la conservación de las áreas protegidas por decreto? Retos sociopolíticos para la gestión ambiental democrática en las comunidades Nueva Palestina y Frontera Corozal. Christiane Junghans y Lorena Ruíz-Montoya Kaztman. 2013. Chiapas. México D. Consulta en: file:///C:/Users/guadalupe/Down- loads/1630198540. E. La reapropiación social de la naturaleza. Marco conceptual sobre activos.La gestión local del riesgo. Racionalidad ambiental. Universidad Autónoma Chapingo. México D.F. Leff (coordina- dor). Levy-Tacher. 2014a. Democracia y política ambiental en reservas de bios- fera en Chiapas. Uruguay. C. Centro de Coordinación para la Prevenciónde los De- sastres Naturales en América Central (CEPREDENAC). Siglo XXI editores S.. Trench (co- ordinadores). del C. Universidad Nacional Autónoma de México. Legorreta-Díaz. Introducción. Márquez-Rosano. Paradojas de las tierras protegidas en Chiapas. Páginas 509-518.V. S. Leff. Nociones y precisiones en torno al con- cepto y la práctica. Márquez-Rosano. Márquez-Rosano y T. Legorreta-Díaz. Conocimiento ecológico tradicional maya y rehabilita­ ción de selvas. Ocosingo. Notas sobre la medición de la vulnerabilidad social. 2014b. E. C. en M. México D. Universidad Nacional Autónoma de México y Programa de las Naciones Unidas para el Medio Ambiente. en Comisión Nacional para el Conocimiento 112 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .I. Pensar la complejidad ambiental. Guadalupe del Carmen Álvarez-Gordillo. et al.F. en M. 2000. Universidad Nacional Autónoma de México. del C. del C. 2003. Democracia y política ambiental en reservas de biosfera en Chiapas.A. M.A.V. Márquez-Rosano y T. del C. y C. Kaztman. Filgueira1999. Centro de investigaciones interdisciplinarias en ciencias y humanidades. de C. La complejidad ambiental. Páginas 7-53.. 2003. Siglo XXI editores S. R. Segunda edición.pdf Lavell.Notas%20sobre%20la%20medicion%20de%20la%20 vulnerabilidad%20social%20(1). BID- Banccoc Mundial-CEPAL. de C. C. Páginas 11-19.F. R. Legorreta-Díaz. Universidad Autónoma Chapingo. Leff.

El pensamiento ecologizado. Universidad Nacional de Colombia. 1: 10. Chiapas. Volumen I.edu. y M. Conservación y desarrollo sustentable en la selva El Ocote. et al. 1:1.uniandes. Patrimonio biocultural de Campeche. Programa de las Naciones Unidaspara el Medio Ambiente Oficina Regional para América Latina y el Caribe. Tesis Doctorado en Ciencias en Ecología y Desarrollo Sustentable. Environment & Urbanization 11:203-226. March-Mifsut. Centro de Estudios para la Con- servación de los Recursos Naturales. Factores que influyen en la riqueza y abundancia de mamíferos medianos y grandes en el sur de México. L. Consulta en: http://designblog.pdf 1993 Maza. E. 113 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .C. 2013. El Colegio de Michoacán. Universidad Autónoma de Campeche. 2000. R. 2010: Análisis de vulnerabilidad de los sistemas biológicos aplicado a la evaluación de impacto ambiental (EIA) en Colombia.A. 2003. Miranda-Redondo.R. Red Patri­monio. espacios del anonimato.. 1996. L. Marc-Augé. El Colegio de la Frontera Sur. 2011. Vásquez-Sánchez.. 1999. Pourune géographie du pouvoir. Páginas 209-262. I.gob. Revista Digital de Estudios en Patrimonio Cultural.pdf Miller. I. R . Los no lugares.net/10481/13582 Moser.. C.mx/red. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. San Cristóbal de Las Casas.8.. (editores). A.edu. 1996. Una antropología de la sobremodernidad.handle. México. Huicochea.C. Estado Actual de las Áreas Naturales Pro- tegidas de Améric Latina y El Caribe. en Vásquez-Sánchez. Participatory urban appraisal and its application for research on violence. 15:1-25. Selva zoque. M. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas y Uso de la Biodiversidad (CONABIO). Con- sulta en: http://hdl. Paris: Librairies Techniques (Litec). www. Resilience and vulnerability: complementary or c­ onflicting concepts? Ecology and Society. Consulta 26-Nov-2016 http:// bibliotecavirtual. tierra Tzotzil: La migración indígena a selvas tropicales. El Colegio de la Frontera Sur. Piguerón. J.colmich. Chiapas. Raffestin. Nueva Época.co/blogs/ dise2609/files/2009/03/marc-auge-los-no-lugares. 1980. C. Fiona. C. Gazeta de Antropología. Morín. Pérez-Vizcaíno.pe/biam/bitstream/id/734/BIV00285. 2010. McIlwaine.minam.Cadena y C. La Biodiversidad en Chiapas: Estudio de Estado..A. Porras-Murillo. Tesis de Maestría.L. A.

en F. Elizondo y D. 114 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . L. alta y media marginación (MMAM). Space. Programa de Manejo de la Reserva de la Biosfera Selva El Ocote. Programa de Empleo Temporal.M. 2012. Grupo permanente de trabajo. Reyes-García.2006-2012. Chiapas. Disponible en: http://www. Egea-Jiménez (2011).mx/work/models/SEDESOL/ Resource/1511/1/images/MMAM.gob. SEDESOL. Barrera-Bassols.Comisión Nacional de Áreas Naturales Protegidas (CONANP). Enfoque de vulnerabilidad social para investigar las desventajas socioambientales: Su aplicación en el estudio de los adultos mayores. A. V. SEMARNAT. Christiane Junghans y Lorena Ruíz-Montoya Raffestin. V. Ocozocoautla de Espi- noza. 152p. Butler. D: Society and Space 30:121-141. Sánchez-González. SCT.. SEDESOL. 2009. y S. Toledo. Universidad de Ciencias y Artes de Chiapas. Revista Papeles 107:39-55. territory and territoriality. Colección Jaguar.M. C. Reyes Escutia y S.pdf Secretaría de Medio Ambiente y Recursos Naturales (SEMARNAT) . Conocimiento ecológico tradicional para la conservación: dinámicas y conflictos. Las áreas voluntarias de conservación en Quintana Roo. México D. Saberes tradicionales y adaptaciones ecológicas en siete regiones indígenas de México. 17:151-185. Número 6.sedesol. Salick. N. Guadalupe del Carmen Álvarez-Gordillo.conanp. STPS. Páginas 7-24. Toledo. y C. Municipios de muy alta. J. Disponible en: http://www. Cultura y naturaleza en comunidades indígenas y mestizas de Méxi- co. 2010. Páginas 15-60. Environment and Planning. 2009. López-Merlín. Corredor Biológico Me- soamericano México Serie Acciones.. Tuxtla Gutiérrez.M. México. V. Saberes ambientales campesi- nos. 2005.pdf SEP (Secretaría de Educación Pública). Toledo. Chiapas.F. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. Byg. Oxford. Barrasa García (coordinadores). Papeles de población. gob. 2007. en C. 2011.mx/que_ha­ cemos/pdf/programas_manejo/ocote. 2001. D. Tyndall Centre for Climate Change Research. Repensar la conservación: ¿áreas naturales protegidas o estrate- gia bioregional? Gaceta Ecológica 77:67-83. V. (s/f).A. “Indigenous People and climate change”. SNIE (Sistema Nacional de Infor- mación de Escuelas) 2010. Prólogo.

A. en B.C. Chiapas. Chia­ pas. La Reserva El Ocote: Retrospectiva y reflexiones para su futuro.A. Vásquez-Sánchez. Vásquez-Sánchez. CIESAS. México. 2012. March-Mifsut (editores): Conservación y desarrollo sustentable en la selva El Ocote. Páginas 1-25. Von Mentz. Páginas 7-25. en M. Una visión conceptual de vulnerabilidad social y biológica ante el cambio climático en las áreas naturales protegidas UNESCO. 1996. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad. I. UNESCO. Reservas de biosfera: la estrategia de Sevilla y el marco estatuario de la red mundial. El Colegio de la Frontera Sur. (coordinador) La relación hombre-naturaleza: reflexiones desde distintas perspectivas disci- plinarias. Siglo XXI Editores. 1996. San Cristóbal de Las Casas. M. Centro de Estudios para la Conservación de los Recursos Naturales. 115 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Von Mentz. París. Introducción. B.A.

.

Departamento de Sociedad y Cultura. E-mail: galvarez@ecosur. Se obtuvieron bajos capitales social. México) *Autor para correspondencia: Guadalupe del Carmen Álvarez Gordillo. Undiad San Cristóbal. México. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Magaly Carolina Morales-López1 y Guadalupe del Carmen Álvarez-Gordillo2* 1 Posgrado. México) 2 Departamento de Sociedad y Cultura. Chiapas. ingresos dependientes de programas de gobierno y práctica de agricultura exclusivamente para autoconsumo. Las variables con menores valores fueron el nivel de escola- ridad (5% con escolaridad básica terminada). electricidad) y políticas de conservación que en general no incluyen la participación de la población para la definición de bienestar 117 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . La vulnerabilidad de las cuatro comunidades se analizó a través de un modelo integral construido a partir del Marco de los Capitales de la Comunidad (MCC). falta de servicios básicos (salud. El Colegio de la Frontera Sur. Chiapas. San Cristóbal de Las Casas Chiapas. escuelas. político y financiero. El Colegio de la Frontera Sur. Carretera Panamerican y Periférico Sur s/n. El Colegio de la Frontera Sur.mx Resumen Esta investigación tuvo como objetivo identificar la vulnerabilidad social en la Re- serva de la Biosfera Selva El Ocote (REBISO) a través del estudio de los capitales de cuatro comunidades. con la premisa que bajos capitales indican vulnerabilidad social. Unidad San Cristóbal (San Cristóbal de Las Casas. Unidad (San Cristóbal de Las Casas. cuyo espacio es regulado por políticas gubernamentales para la conservación y bienestar de las poblaciones que la habitan.

realizar propuestas de desarrollo que incluyan actividades económicas con bases sustentables. Introducción Las Áreas Naturales Protegidas (ANP) son áreas destinadas a la conservación de la biodiversidad pero que también tienen por objetivo fomentar el desarrollo de las comunidades que la integran a través del uso sustentable de los recursos naturales para mejorar el bienestar social y la calidad de vida. en la cual intervienen 118 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . En el entendido que la vulnerabilidad social es una construcción social e histórica. es la base para proponer estrategias de reducción de riesgos y vulnerabili- dades. que consideren contextos locales acordes a las reali- dades y necesidades de las personas. Los resultados de los capitales indican que las cuatro comunidades son altamente vulnerables tanto a los cambios climáticos como a los cambios políticos y sociales externos a las comunidades. Los capitales de la comunidad en áreas naturales protegidas han sido poco estudiados y permiten vislumbrar la vulnerabilidad social ante el reto del Cambio climático. restauración y desarrollo. en consecuen- cia deberían presentar menor vulnerabilidad social que las que se encuentran fuera de estas áreas (CONANP 2015). y pueden definir desde la misma población los criterios para su propio bienestar. de cobertura de servicios de educación y vivienda que pueden agudizarse en contextos del Cambio climático. Palabras clave: capitales de la comunidad. El conocimiento de la situación de vulnerabilidad de las localidades a través de sus capitales comunitarios y las capacidades o debilidades de las comu- nidades. Para cumplir con el objetivo. las poblaciones que las habitan están bajo políticas gubernamentales especiales y específicas de protección. pero también de enfrentar diversos pro- blemas de salud. conservación. Reservas de la Biosfera. además. área natural protegida. Los capitales también apoyan la evaluación de criterios de participación y gestión local de los riesgos. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo local y necesidades actuales. Así es como en la Reserva de la Biosfera Selva El Ocote (REBISO) tienen el reto de conservación de flora y fauna.

al conformarse por los activos que poseen. media y baja). para mejorar su situación de bienestar o impedir su deterioro” (p. El Grupo Intergubernamental de Expertos sobre el Cambio climático (IPCC. el estado y la Sociedad Civil a los individuos. hogar o comunidad de ser herido. lesionado o dañado ante cambios o permanencia de situaciones externas y/o internas” (p. p. la presente investigación trata de dar respuesta a la siguiente interrogante: ¿Cuál es la vulnerabilidad social de las comunidades asentadas en la REBISO? Los resultados fueron obtenidos mediante el método de encuesta y revi- sión de fuentes secundarias empleando el enfoque metodológico y conceptual del Marco de los Capitales de la Comunidad (MCC). su diversidad y su uso. denominados pasivos (Filgueira y Kaztman 1999. Así. la medición de los capitales se consideran un corte transversal. es decir. 281). las estrategias de uso de los activos y el conjunto de oportunidades que ofrece el mercado. este modelo de análisis permite considerar al cambio climático como el contexto ambiental actual en las localida- des de la REBISO. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote procesos de diferentes escalas globales y locales. que para un mayor bienestar debe de existir la capaci- dad de acceder y utilizar recursos y activos. Algunos recursos son necesarios para tener el acceso a otros y no puede pasarse por alto el hecho que existen factores que impiden que las oportunidades se puedan aprovechar. hogares y comunidades” (Busso 2001. resultando en un nivel de vulnerabilidad que puede relacio- narse a la exposición a riesgos de origen natural y social. Kaztman 2000). y por tanto no de relación causa y efecto. por sus siglas en inglés) define vulnerabilidad como la “Propensión o 119 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 13). dichos elementos son clave para determinar la capacidad de respuesta ante los riesgos (alta. 8). Busso (2001) define la vulnerabilidad como “un proceso multidimensional que confluye en el riesgo o probabilidad del individuo. Antecedentes ¿Qué es la vulnerabilidad social? Kaztman (2000) se refiere a vulnerabilidad social como “la incapacidad de una persona o de un hogar para aprovechar las oportunidades disponibles en distintos ámbitos socioeconómicos. ante tal exposición debe integrarse componentes como “los activos.

tanto desde las ciencias naturales. y de no tomarse en cuenta. hogares y comunidades. Las dimensiones y tipos de vulnerabi- lidad que propone son la física. política. la recuperación puede mermarse. cultural e ideológica. p. social. crecimiento de población y asentamientos humanos sin planeación y acceso limitado a poder. y pueden aparecer otras vulnerabilidades si no se abordan las problemáticas desde las causas de fondo. 1996). pueden considerarse en uno mismo. principalmente el modelo de desarrollo. planificada y correctamente distribuida que deben de realizar las autoridades y organizaciones locales. 5) y también reconoce la ausencia de un parámetro general donde todos los enfoques. económica. La vulnerabilidad permanece después de la ayuda de emergencia hasta en la planificación de la recuperación. política o social que tiene una comunidad de ser afectada o de sufrir daños en caso de un fenómeno desestabilizador de origen natural o antrópico se manifieste” (p. se incrementa la vul- nerabilidad a los fenómenos naturales. nacionales e inter- nacionales en pos de la recuperación y desarrollo. sin tomar en cuenta los patrones de vida de las personas involucradas. estructura y recursos (Blaikie et al. 5) y comprende ele- p mentos como la sensibilidad o susceptibilidad a ser dañado y la falta de capacidad de respuesta y adaptación. educativa. La vulnerabilidad social como resultado del cambio climático ha sido difícil de precisar y frente a esta problemática French y Bury (2013) abordan la 120 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . económica. ambiental. Aun cuando los fenómenos naturales y las condiciones de vida sean diferentes. principalmente desde los desastres. las ciencias aplicadas y ciencias sociales. y con el propósito de conocer los pro- cesos de recuperación ante desastres. Los estudios de vulnerabilidad social se han realizado desde diversas pers- pectivas. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo ­ redisposición a ser afectado negativamente” (IPCC 2014. el proceso de recuperación tiene varios aspectos en común. institucional. la necesidad de una asistencia oportuna. actitudes y motivaciones de las personas. y asevera que para entender la vulnerabilidad habrá que conocer las percepciones. ya que están de- terminadas por el tiempo y lugar específico. las políticas de gestión del riesgo. reducir la vulnerabilidad y definir estrategias de adaptación. El análisis de la vulnerabilidad social de una comunidad puede sesgarse al aspecto físico o material. En una perspectiva holística Cardona (2001) considera a la vulnerabilidad como “la predisposición o susceptibilidad física.

. A través de una encuesta abordaron las percepciones de la 1 La vulnerabilidad fue medida a través de la fórmula: Vulnerabilidad = exposición + sensibilidad – capacidad adaptativa 121 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ríos et al. Por otra parte. (2011) analizaron la vulnerabilidad al cambio cli- mático mediante tres elementos: la exposición. utilizaron dimensiones como la “sociodemográfica (composi- ción por edad y sexo. (2011) analizaron la vulnerabilidad social a tra- vés de un estudio de caso en el municipio de San Felipe en la Costa de Yucatán. estado de la infraestructura y una baja capacidad adaptativa.). así como de los recursos físicos y financieros con que cuentan los hogares” (p.. relación de parentesco y migración). escolaridad y capacita- ción. familia y comunidad. etc. del valor que los pobladores le asignan y la importancia de preservarlos. asociados al Cambio climático. transporte. En los resultados que obtuvieron destaca que el cambio climático afectó las actividades agrícolas. que habían impactado en ecosistemas naturales y la economía del lugar. Bayón y Mier (2010) realizaron un diagnóstico sobre las princi- pales fuentes y componentes de vulnerabilidad al deterioro de las condiciones de vida de las familias mexicanas en la Encuesta Nacional de Familia y Vulnerabilidad (Enfavu) del 2006. trabajo e ingresos [. además de la forma en que interactúa con situaciones de riesgo y las estructuras de oportunidades (familia. El enfoque de vulnerabilidad que emplean permite conocer los recursos y activos disponibles a nivel individuo. Los autores emplearon las percepciones de los pobladores sobre las variaciones climáticas y realizaron entre- vistas semiestructuradas con el enfoque de capitales de la comunidad. la sensibilidad y capacidad adap- tativa de un sistema social a las variaciones climáticas1. Una de las principales necesidades y desafíos identificados es que las autoridades compe- tentes no proponen y ejecutan estrategias de manejo y adaptación que incluyan la participación activa de la sociedad.] acceso a servicios sociales (educación. Por otro lado. comunidad. 13). Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote v­ ulnerabilidad social en función de la dependencia los ecosistemas y recursos. salud. que consiste en evaluar recursos y capacidades de la comunidad para enfrentar amenazas y reducir la vulnerabilidad. mercado de trabajo y estado). En México. Soares et al. lugar elegido por su vulnerabilidad derivada de eventos naturales como huracanes.

humano. financiero y físico o construido). Gutiérrez-Montes et al. su efecto en la economía local. tsunamis. la infraestructura. natural. el desempe- ño de las autoridades y formulación de nuevas alternativas. cultural. los servicios disponibles. Soares y Vargas (2012) identificaron las expresiones de vulnerabilidad so- cial frente al cambio climático incluyendo las percepciones de los diferentes acto- res sociales empleando seis capitales del MCC (social. Thomas-Bohórquez (2013) realizó un aporte metodológico para medir el nivel de vulnerabilidad social ante amenazas naturales (sismos. entre otros. (2014) estudian a la vulnerabilidad como la suscep- tibilidad en los capitales comunitarios: humano. inun- daciones y eventos hidrometeorológicos extremos) bajo una investigación de tipo geográfica y con el fin de obtener un indicador con validez estadístico. político. político. financie- ro o productivo. Las autoras mencionan la importancia de las políticas públicas y la necesidad de formular estrategias locales de adaptación par- tiendo de evaluar las vulnerabilidades locales y concluyen que los tipos y grados de impactos del cambio climático dependerán tanto de la exposición de las variables en cuestión. en función de un 122 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . además emplearon la observación como una herramienta para comprender la interacción diaria de la población y retomaron datos demográficos como la composición social. social. media o alta. de los activos con los que pueden hacer frente como de la capacidad adaptativa de la comunidad. describir e integrar las variables que la caracteri- zan por lo que realizó un Análisis de Componentes Principales (ACP). Los autores realizaron un Índice de Susceptibilidad de cada Capital y un Índice de Suscepti- bilidad de la Comunidad (ISC) asignando una condición de susceptibilidad baja. La vulnerabilidad social fue en- tendida como: “el nivel especifico de exposición y fragilidad que sufren los grupos humanos asentados en un lugar ante ciertos eventos peligrosos. técnica de análisis multivariado que pretende generar nuevas variables que expresen un conjunto original de datos al reducir la dimensión del problema estudiado y eliminar variables que aportan poca información. el grado de estudios. físico o construido y natural ante eventos extremos. El caso de estudio validó la utilidad del Marco de los Capitales de la Comunidad (MCC) para abordar la vulnerabilidad planteando el análisis entre el bienestar de las comunidades y de los recursos naturales. reconoció la complejidad de identificar. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo población sobre el cambio climático.

reducir la pobreza. nivel de escolaridad. Lo anterior se encuentra plasmado en las tres funciones principales que pretenden i­ntegrar: 123 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Los resultados obtenidos en estas últimas investigaciones reflejan especialmente cómo se asocia la pobreza con la vulnerabilidad de las viviendas o comunidades después de los desastres. psicológicos y culturales” (p. ingre- sos. físico y social. la Ciencia y la Cultura (UNESCO) son “zonas de ecosistemas terrestres o costeros/ marinos. Particularmente en el estado de Chiapas. financiero. respetar los valores culturales. Jiménez y Capote (2011) men- cionan que las mediciones realizadas para conocer la vulnerabilidad. mejorar la calidad de vida. natural. Jiménez y Capote (2011) analizaron la pobreza desde la percepción de las personas obtenidas a través de talleres participativos clasificaron en bienes o capi- tales humano. resultan in- eficaces al igual que las estrategias que se han empleado para combatirla. conocimientos del individuo y existencia de planes de prevención. Vulnerabilidad en las ANP Las Reservas de Biosfera. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote conjunto de factores socioeconómicos. transformó variables cualitativas a cuantitativas que permitieran correlacionarlas. reconocidas como tales en un plano internacional en el marco del Programa MAB (Man and the Biosphe- re)”. aunque los recursos públicos invertidos han aumentado con el transcurso del tiempo. además del inminente riesgo en el que se pone el futuro de los habitantes en con- secuencia del deterioro del ambiente natural y a la par la falta de estrategias de conservación (Jiménez y Capote 2011). 80). que buscan promover el desarrollo sostenible. por las condiciones socio-económicas. construyó indicadores de vulnerabilidad y un Índice Final de Vulnerabilidad Social (IVSA) asignando ponderaciones a cada indicador. social. y empleó variables como el grado de concentración de la población. según la Organización de las Naciones Unidas para la Educación. las categorizaron en cuatro grupos de acuerdo al nivel de exposición: por localización de la población. por empa- tía con la amenaza y por organización institucional frente a la amenaza. institucionales. o una combinación de los mismos. el intercambio de conocimiento y la capacidad de adaptación de la sociedad ante los cambios a través de la inte- gración armónica y participativa del ser humano con la naturaleza. Por tanto.

experiencias y uso de sus recursos. el monitoreo. 2016). Hernández y Hernández 2015) Las reservas no pueden concebirse sin existencia de población humana. acciones en que los pobladores se perciban incluidos y no obligados o frente a cuestiones impuestas y se cumpla con el propósito de conservación y desarrollo simultáneamente (Paz-Salinas 2008. Halffter 2011). sequias. que generalmente suelen ser pueblos indígenas. educación y capacitación (UNESCO 2015. por el contrario les son impuestos planes 124 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . y precisa- mente sobre ellos que recae el peso de las restricciones a las que está sujeto el lugar que habitan. Por lo tanto es importante conocer los recursos y la valoración del medio natural que habitan que resultan en capacidades. para después poder elaborar propuestas. por ello la gestión en las reservas debe de ser una alianza entre comunidades locales y la sociedad en conjunto. pueden dar como resultado la incapacidad de una comunidad de hacer frente ante riesgos (inunda- ciones. y apoyo logístico para la investigación. Las ANP se han considerado regiones naturales en las que el aspecto eco- lógico ha sido el eje central y han dejado al aspecto social como contexto. Esta situación se torna contradictoria al ser las comunidades que habitan en las ANP las que han de aplicar la “serie de reglas” establecidas en el plan de manejo a la que es sujeto el lugar donde habitan. desarrollo económico socio-cultural y ambien- tal sostenible. programas. haciéndolos vulnerables socialmente. de control y uso de recursos diferenciados. ya que son precisamente éstas las que propician la búsqueda de alternativas biológicas y so- ciales. incendios). Para estas poblaciones se han planteado algunos mecanismos de par- ticipación social. Las reservas deben de ser vistas desde un panorama más amplio que sea capaces de considerar la interacción con las poblaciones que se en- cuentran dentro de las mismas y aquellas que las rodean (Durand 2003. económicas. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo conservación de la biodiversidad. sin embargo éstas se conciben excluidas en la toma de decisiones y las necesidades no son consideradas. Las ANP están integradas por más de una localidad con circunstancias y condiciones sociales. La conservación de la biodiversidad requiere de la participación activa de las poblaciones locales. Los habitantes no deben de considerarse como el medio para cumplir con la meta de la preservación y conservación sino deben de incluirse como tomadores de decisiones y retomar sus conocimientos. La combinación de estas configuraciones internas y externas que las poblaciones no pueden controlar. culturales. políticas.

También señala a la pobreza como el principal factor que incrementa la vulnerabilidad ante el Cambio climático debido a la importante dependencia de las personas pobres a los recursos naturales. Respecto a la vulnerabilidad. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote de manejo. p. el Cambio climático impacta negativamente a los siste- mas humanos y naturales cuando confluyen la vulnerabilidad. política e institucionalmente son las más vulnerables al Cambio climático. incluso. con mayor grado de certidumbre. Para el Grupo Intergubernamental de expertos sobre el Cambio climático. por ello propo- ne que las comunidades sean capaces de adaptarse y de reducir la vulnerabilidad. 125 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . (2014). la información generada a nivel local es poco certera o. riesgos y hay expo- sición a los mismos. Además considera que los eventos extremos conexos al Cambio climático resultan en desorganización de producción de alimentos y suministro de agua. siste- ma o bien que los hacen susceptibles a los efectos dañinos del cambio climático y otras amenazas”(2010. plantea que el cambio climático ha provocado el aumento de los desastres a nivel global con efectos irreversibles. El IPCC proyecta que entre los riesgos previstos a corto tiempo. económica. señala que se da como resultado de procesos sociales con desigualdades en los que las personas marginadas social. Cambio climático y vulnerabilidad social Pettengell (2010) advierte que el cambio climático es real. no existe información. afectando el bienestar de pobres y de aquellas poblaciones con bajo acceso a infraestructura y educación. consecuencias desfavorables en el bienestar humano. ya que al reducirla también mejoran la salud humana. Según Halffter (2011) cuando se formulan programas y políticas que incluyen la participación social en las reservas debe de entenderse claramente el contexto y las condiciones de vida de las poblaciones. daños a la infraes- tructura y asentamientos. Para estos y demás impactos propone como primera medida la reducción de la vulnerabilidad. entendida como “las características y las circunstancias de una comunidad. cultural. aunque en la mayoría de los casos. IPCC por sus siglas. A pesar de ello. el bienestar social y económico y la calidad del ambiente. los medios de subsistencia. se encuentra la pérdida de medios de subsistencia e ingresos en zonas rurales. 7). y que todo ello repercute en la vulnerabilidad tanto de los sistemas naturales y humanos. dentro de los principios de adap- tación al Cambio climático.

además la carencia de servicios. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Ante el Cambio climático. 2) los que pueden ser almacenados y conservados. presentan degradacio- nes como consecuencias del Cambio climático. vulnerabilidad y adaptación (Bennett y Dearden 2013) reconociendo que el enfoque permite vislumbrar un marco holístico. financiero y político. humano. ya que reconoce la importancia del conocimiento local en la toma de decisiones en el uso de recursos. En relación a ello. El enfoque del MCC es el resultado de una ampliación del enfoque de Medios de Vida EMV2. capacidades y actividades requeridas para poder vivir. El Marco de los Capitales de la Comunidad (MCC) En general el enfoque del Marco de los Capitales de la Comunidad (MCC) ha sido empleado para medir las capacidades a nivel individual y comunitario. social. 126 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . El MCC incluye a los capitales cultural. en México. participación de pobladores y diferentes relaciones que se gestan en la comunidad (Gutiérrez-Montes y Siles 2008). El MCC plantea que todas las comunidades poseen recursos aunque pudieran ser reducidos o de acceso limitado. acuerdos de conservación y gestión comunitaria” (IPCC 2014. 8). la CONANP considera que el Cam- bio climático ha impactado a todas las ANP. y 3) los que 2 El enfoque de medios de vida abarca recursos. Pettengell 2010). educación y de capacidad de adaptarse a los cambios (Gutiérrez-Montes et al. aumentando los niveles de vulnerabili- dad (CONANP y GIZ 2014). p. Otra utilidad es la medición de impactos en comunidades en que se establecen áreas de conservación en contextos de cambio. situación agudizada por la falta de oportunidades y desatención de las instituciones y gobierno. 2012. clasificándolos en tres categorías: 1) los que pue- den ser consumidos. con objetivos como el desarrollo de turismo como una alternativa de medio de vida y de conservación en un área protegida (Bennett el al 2011). natu- ral. El incremento del grado de vulnerabilidad es especial en comunidades rurales donde la constante son los medios de vida o subsistencia dependientes de los recursos naturales que. los gobiernos en América Central y del Sur se avo- can al desarrollo de planes o estrategias de adaptación basados en ecosistemas “que comprenden áreas protegidas. en su mayoría. físico.

exenciones de impuestos. destrezas y capacidades individuales para acceder o ampliar el acceso a recursos que permiten vivir a las personas e incrementan los capitales de la comunidad. El capital político se relaciona con las voces de poder y la capacidad de la comunidad de influir en la toma de decisio- nes que realizan instancias externas que influyen en la distribución y manejo de recursos en el lugar donde viven. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote pueden invertirse para crear más recursos en diferentes horizontes de tiempo (corto. El capital físico o construido incluye toda la infraestructura física como vivienda. El capital social representa las conexiones entre personas y las relaciones formales e informales en que se pueden obtener diversas oportunidades y beneficios. comprende organizaciones comunitarias. 2014. mientras que los recursos materiales abarcan al natural. por ejemplo: si las personas poseen habilidades de comunicación (capital humano). y físico o construido. de tal forma que un capital fortalecido puede fortalecer otro u otros y disminuir la vulnerabilidad de la comunidad. social. Soares et al.Los capitales en la vida cotidiana se interrelacionan. conocimientos. acciones grupales. mediano y largo). inversiones. cultural y político. El capital natural comprende los recursos natu- rales relevantes para el bienestar de las personas. El capital financiero es la sumatoria de los recursos económicos internos o externos disponibles para la comunidad. remesas. incluye recursos productivos. Los recursos humanos inclu- yen el capital humano. lengua. Soares y Vargas 2012. Gutiérrez-Montes y Siles 2008. salud. trabajo en conjunto. 2011). liderazgo. su estado y cantidad disponibles a nivel local. Gutiérrez- Montes et al. aprendizajes. es mucho más que dinero en efectivo. cómo le asignan valor a las cosas y las cosas que definen que pueden o no ser cambiadas. El capital humano incluye todas las habilidades. sentido de un futuro compartido. motivaciones y capacidades para actuar en el presente y hacia el futuro. las orga- nizaciones estarán fortalecidas (capital social y político) y generar mejoras en la 127 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . creencias de las personas que les da identidad como una comunidad y refleja la forma en cómo la gente ve el mundo. donaciones cuyo fin sea la inversión y creación de recursos (Jacobs 2007. financiero (económico o productivo). El capital humano com- prende factores como la educación. tradiciones. éstos últimos conceptualizados como capitales y clasificados en primera instancia en capitales humanos y materiales. El capital cultural consiste en las costumbres. servicios y carreteras que son o pueden ser utilizadas para activi- dades sociales y productivas de la comunidad. créditos.

dentro de una ANP. Anteriormente se mencionó que diversos autores consideran impor- tante identificar a qué o ante qué se es vulnerable. Materiales y métodos A través de una encuesta se recabó información para analizar los capitales comuni- tarios en cuatro localidades de la REBISO: El Carrizal. servicios. Aunque este estudio no pretende analizar a la creación de espirales ascendentes o descendentes. riesgo de desastres. Lo contrario son los círculos viciosos o espirales descendentes generados por capitales débiles o reducidos impactando en mayor vulnerabilidad. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo infraestructura comunitaria (capital físico). reflejados en bajos capitales resultan en vulnerabilidad social. los impactos de estrategias que se llegaran a implementar para disminuir la vulnerabilidad. y viceversa. el que los gane seguirá ganando otros (Gunnar Myrdal 1957. continuará perdiéndolos mediante los efectos del sistema y de igual forma. a esto se le conoce como la creación de círculos virtuosos o de espirales ascendentes. educación. a mayores capitales la vulnerabilidad disminuye. considera que la carencia o escases de capacidades o ac- tivos. Por tanto retomamos el Cambio climático como un contexto en el que intervienen diferentes aspectos de salud. Kaztman (2000). Veinte Casas y Nuevo San Juan Chamula (Tabla 1 ) y se complementó con fuentes oficiales secun- darias para la descripción sociodemográfica de las localidades. entre otros. citado por Emery y Flora 2006) y permita identificar por ejemplo. Los capitales de la comunidad permiten la creación de un marco holístico y brindan una perspectiva de sistema que ayudará a analizar y comprender las in- teracciones entre los capitales y su impacto en la comunidad. Emilio Rabasa. Para la definición y valoración de los capitales se siguió la metodología de Bautista-Solís y Gutiérrez- 128 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Desde la perspectiva de que la vulnerabilidad social de una población puede incidir ante su capacidad de res- puesta ante situaciones internas y externas desestabilizadoras o que impidan su desarrollo. existen diversas amenazas al bienestar de la población desde lo amplio del Cambio climático hasta lo específico de un incendio o las enfermedades diarreicas o respiratorias. (Flora 2013 citado por Gutiérrez-Montes et al. pueda resultar un marco de referencia útil en el futuro para evaluar y comprobar la teoría de que “el lugar que pierde activos. 2014).

Después se obtuvo el promedio de la suma no ponderada de las variables.La encuesta fue de respuesta abierta.5). fue necesario adecuar las respues- tas dicotómicas por ejemplo: la variable de ‘Existe organización en la comunidad’ (capital social) retomó las calificaciones del nivel de organización en la comunidad ‘Nada organizada’ y ‘Poco organizada’ como negativa (no existe organización signi- ficativa). Veinte Casas se encuentra dentro de la 129 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . según el caso se consideró la población total o el número total de cuestionarios por localidad. y de conformidad con la metodología elegida para evaluar los capitales. Con base a Bennett (2011). los valores promedio se ubicaron en escalas de vulnerabilidad de la siguiente manera: muy alta vulnerabilidad (índice de capitales 0-0. 2011.75) y baja vulnerabilidad (capitales altos >0. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Tabla 1. Breve descripción de las localidades de estudio Las cuatro localidades son rurales y se ubican en el municipio de Ocozocoautla de Espinosa. media vulnerabilidad (capitales medios >0. Emilio Rabasa pertenece a la subzona de uso tradicional. El Carrizal se sitúa en la zona de influencia de la REBISO. Ríos et al. la calificación ‘Más o menos organizada’ y ‘Muy organizada’ significó que sí existe organización en la comunidad (Tabla 2). mientras que.25).5-0. Soares et al. lo que representó un índice del capital.25-0.75-1). Gutiérrez-Montes et al. Se utilizó una escala continua de 0 a 1 para cada variable analizada en cada capital comunitario. alta vulnerabilidad (capitales bajos >0. Distribución de la población encuestada por sexo para cuatro localidades la REBISO Localidad Mujeres Hombres Viviendas El Carrizal 11 3 14 Emilio Rabasa 11 8 19 Veinte Casas 16 9 25 Nuevo San Juan Chamula 22 12 34 Total 60 32 92 Fuente: elaboración propia Montes 2010. 2011. Bayón y Mier 2010. 2014.

Residencia. Variables por capital Capital Variables o componentes de los capitales de una población. Escolaridad. grupos social o comunidad Humano Población. número de personas que han tenido educación oficial. comparadas con la preva- lencia estatal y nacional ** Prevalencias en población total y en menores de 5 años. Prevalencia de infección respiratoria aguda (IRA)* Prevalencia de enfermedad diarreica aguda (EDA)** Acciones ante desastres Cultural Reconoce su patrimonio natural Ubica peligros Acciones de prevención de desastres Social Pertenencia a agrupaciones o instituciones Participación en las agrupaciones Organización de la comunidad Participación en elaboración de planes de manejo Participación en la gestión del riesgo de desastres Existencia de brigadas o comités de protección civil en la comunidad Político Capacidad del gobierno frente a desastres Gestión de autoridades ante desastres Relación comunidad-gobierno para desastres  El gobierno escucha las propuestas de la comunidad Conoce legislación sobre desastres o Cambio climático Conoce el Plan de Manejo de la REBISO Natural Conoce que vive en un ANP Prácticas de conservación de suelo Prácticas de conservación de flora Prácticas de conservación de fauna Buen estado del suelo Buen estado de las principales riquezas naturales Físico Agua entubada Clínica de salud Escuelas Casa comunal Electricidad Transporte Iglesia Financiero Acceso a financiamiento Ingresos por programas de gobierno Ingresos por remesas * Prevalencias en población total y en menores de 10 años. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Tabla 2. grupo de personas que comparten un tiempo y espacio dado. tiempo en el que personas o familias viven en un espacio dado. comparadas con la prevalen- cia estatal y nacional 130 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

55) y el cultural (0. las localida- des cuentan con un centro educativo preescolar y una primaria indígena excepto Emilio Rabasa.38). El capital financiero para el conjunto de las comunidades estudiadas fue de (0. Para otros datos sociodemográficos de las localidades ver Tabla 3.36) y el polí- tico (0. Además en Nuevo San Juan Chamula existe telesecundaria. Datos sociodemográficos de localidades de estudio El Carrizal Emilio Veinte Nuevo San Juan Rabasa Casas Chamula Viviendas habitadas 11 22 43 90 Promedio de hijos 3 4.64 3. En general son valores que sugieren una alta vulnerabilidad tanto a factores ambientales como sociales. Tabla 3.55.55).52).81 escolaridad básica Hablantes de lengua 12 16 225 446 indígena Grado de marginación Muy alto Muy alto Muy alto Alto (Clasificación INEGI) Fuente: elaborado a partir de CDI 2010 e INEGI 2010 Resultados Se encontraron valores de los capitales entre 0.02 3. 131 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote subzona de aprovechamiento de sustentable de los recursos naturales y Nuevo San Juan Chamula ubicada dentro de la subzona de recuperación (SEMARNAT y CONANP 2001).6 Población total 65 91 259 506 Grado promedio de 5.38 3. aquellos que resultaron en la categoría de media vulnerabilidad fueron el físico (0.65).25 y 0.05 3. donde se reporta la existencia de escuelas del nivel preescolar y primaria pertenecientes al Consejo Nacional de Fomento Educativo (CONAFE). De acuerdo al Sistema de Información de Escuelas (SEP 2010). natural (0. humano (0.25).92 4. el social (0.

6% Nuevo San Juan Chamula 20.5% en Nuevo San Juan Chamula. Solamente el 0.8% 5. 5.4% 14.4% en el Carrizal.4%).3% 9.7% 17. Veinte Casas y Emilio Rabasa dijeron ser origina- rios diferentes lugares de Chiapas.0% 25. Larráinzar.5% 6. Tuxtla Gutiérrez y. 8.0% Prevalencia local 19. 132 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .4% 11.7% primaria completa.4% 5.7% en Emilio Rabasa y 9. San Cristóbal de Las Casas.2% 5. 11% secun- daria y 1. la principal causa de la mi- gración fue la búsqueda de trabajo (16.4% Prevalencia nacional 2012 41% 11% Capital humano Los pobladores de El Carrizal. Mientras que los porcentajes de analfabetismo en personas mayores de 15 años fueron de 1.5% Prevalencia estatal 2012 40.3% la licenciatura. Nuevo San Juan Chamula presentó el menor porcentaje de emigración (32. Prevalencias de infecciones respiratorias agudas (IRA) y enfermedades diarreicas agudas (EDA) por localidad   IRA IRA EDA EDA (menores (general) (menores (general) de 10 años) de 5 años) El Carrizal 14.0% 16. Los sitios de origen que se mencionaron son los Municipios de Ocozocoautla de Espinosa ( Ejido La Lucha). tuvo el nivel de escolaridad básico obligatorio actualmente estable- cido por la Secretaría de Educación Pública (preparatoria terminada).8% 8. conjuntando las comunidades. 2. Según los entrevistados.8% 13. El grado de escolaridad en la población fue: 21. a otros estados de la República Mexi- cana como Oaxaca y Tabasco. En contraste la mayoría de la población de Veinte Casas (64%) dijo ser originaria de esta localidad.5% de la población.6% en Veinte Casas. y ninguno con este grado en El Carrizal y Emilio Rabasa.8%).8% 18. seguido por motivos familiares (9.7% Veinte Casas 12. Los municipios a los que más personas emigraron fueron Ocozocoautla. Jitotol y Bochil.7% 8.3%). El 50% de los entrevistados identificó por lo menos a un familiar que había emigrado. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Tabla 4.2% .6% Emilio Rabasa 31. en el caso de El Carrizal.

Capital humano total y por cada localidad estudiada de la Reserva de la Biosfera Selva El Ocote Sobre el estado de salud. fueron menores a la prevalencia estatal y nacional del año 2012.6% de las personas encuestadas indicó que emprendería alguna ac- ción en caso de desastres. Las acciones mencionadas con mayor frecuencia fueron 133 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Con relación a los desastres. el 78% de la población mencionó tener las posibilidades. El 22. evaluado a través de las prevalencias de EDA (En- fermedad Diarreica Aguda) e IRA (Infección Respiratoria Aguda) en la población total y por grupos de edades. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Figura 1. Las prevalencias de EDA en menores de 5 años en Emilio Rabasa y Veinte Casas resultaron mayores a la estatal y nacional (Tabla 4). capacidades o recursos para hacer frente a situaciones de riesgo de desastres (Figura 1).

28.5%). 9.1% y 61. En tanto que. el 70.3% adventista y 10. el 48.1. En esta última localidad se registraron las familias más grandes con 12 personas. Además.4%. Las cosas más valoradas por las personas fueron su familia. El 53% de la personas percibió que los desastres se pueden prevenir.4%).6% en Nuevo San Juan Chamula. salud. en las localidades estudiadas. En general. casa y te- rreno. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo acudir a las autoridades (locales y ambientales tal como la CONANP) (10.7%).46 y en Veinte Casas 5.2%) Respecto al número de integrantes de los hogares.5%) y ‘buscar un lugar seguro’ (3. Respecto a población bilingüe solo se encontró un 3.8%). el 22% fue ha- blante del español y el 7. expresado mediante la existencia de recursos o riquezas naturales en el lugar donde viven. el 85% reconoció su patrimonio natural (Figura 2). las poblaciones con variaciones fueron El Carrizal con predominancia del pentecostés. el 58 % de las personas entrevis- tadas ubicó algunos peligros en su localidad como las lluvias intensas (15. El promedio de hijos por mujer en Emilio Rabasa fue de 2.9.3%) y la tala de árboles (5.56.7% indicó que en caso de que se suscitara un desastre todas las personas se verían afectadas de igual manera 134 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .3%).4% de la población mayor de tres años de edad es indígena. En general. y Veinte Casas con 48% de la población adventista.4%. las principales causas de desastres son la acción humana (12. las lluvias (8. la moda fue de cuatro personas y el promedio de hijos fue de 3.9% bilingüe (español y tsotsil). animales peligrosos (10. ‘recoger las pertenencias’ (6. Según la población.8%). Capital cultural El 66. en Nuevo San Juan Chamula de 4. Aunque se encontraron importantes diferencias: en El Carrizal y Emilio Rabasa predominó la población hablante del español 93. en El Carrizal fue de 2.6%) y derrumbes (8. Específicamente. del 71.5% fueron hablantes de lengua tsotsil. en tanto que en Veinte Casas y en Nuevo San Juan Chamula el 96% y el 83.6%). respectivamente.6% en Emilio Rabasa y 14. el cambio climático (5.9% pentecostés. Los datos variaron de forma importante en función de la localidad. incendios (9.76.9% de la población encuestada indicó ser católica.4% en Veinte Casas. sin embargo no mencionaron cómo se pueden prevenir.

Al 16. 135 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . tala y uso de suelo. específicamente mencionaron permisos de caza y tala. Capital cultural total y por cada localidad estudiada de la Reserva de la Biosfera Selva El Ocote y lo que más les preocuparía perder fueron las vidas humanas y salud. mientras que un 43% indicó que no se pueden realizar cambios.1% de la población el hecho de vivir en un ANP significó ‘cuidar y conservar el área’ y para el 19. Para el 26. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Figura 2.6% fue ‘estar bien y seguro (a)’. El 43% mencionó sentirse limitado en sus actividades productivas principalmente debido a las prohibiciones caza.3% de las personas encuestadas les gustaría cambiar algo del Plan de Manejo de la REBI- SO. específica- mente las de familiares.

Capital social total y por cada localidad estudiada de la Reserva de la Biosfera Selva El Ocote 136 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Figura 3.

la actividad que mencionaron realizar en conjunto es la limpieza en distintos puntos como las escuelas. principalmente religiosas. fuentes de agua. aunque en menor medida. también participan en brigadas contra incendios y vigilancia del ANP. mientras que. pertenece a alguna agrupación. Por otra parte. sin embargo en- contramos respuestas en la que indicaron vigilancia en prevención de incendios y participación en proyectos dentro del ANP. no obstante. caminos y/o carretera. Los tipos de apoyo que reciben las personas fueron en su mayoría asistencia técnica y capacitación. El 23% de las personas encuestadas conocían la existencia de brigadas de protección civil en su localidad. de igual forma el 74% en Nuevo San Juan Chamula. del conjunto de las comunidades. el 79% de las personas encuestadas en El Carrizal opinaron que sí se organizan. Capital político En general. este indicador presentó las variaciones más relevantes en el caso de Nuevo San Juan Chamula 137 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . en Emilio Rabasa únicamente el 42%. educativas o de productores sin especificar su denominación. principalmente en Nuevo San Juan Chamula con el 41% (Figura 3). éstas fueron asimiladas por la población como acciones que pueden benefician a su comunidad y útiles en la prevención de desastres. pero sin toma de decisiones en esas actividades. el 72% en Veinte Casas. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Capital social El 53 % de la población. solamente el 20% de las personas encuestadas indicó haber participado en la elaboración del Plan de Manejo de la REBISO. En términos generales. Resultó relevante que solo el 29% indicó participar en la agru- pación a la que pertenece. el 44% de las personas consideró que las autoridades tienen la ca- pacidad para hacer frente a desastres. La organización en cada localidad fue percibida de diferente manera. Respecto a la gestión de las autoridades municipales ante desastres el 59% la consideró entre los parámetros ‘Regular’ ‘Buena’ y ‘Excelente’. se encontraron comentarios señalando que el hecho de que tuvieran la capacidad no había significado que los hubieran ayudado cuando lo necesitaban. casa de salud.

por ejemplo en El Carrizal solamente el 36% de las personas encuestadas 138 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se encontró desconocimiento de ello. Con relación a la normatividad en ANP. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Figura 4. Capital político total y por cada localidad estudiada de la Reserva de la Biosfera Selva El Ocote (77%) y Veinte Casas (48%). consideró que el gobierno escucha las propuestas de su comunidad. El 47% del conjunto de las comunidades. Además el 46% catalogó dentro de los parámetros antes mencionados la relación entre la comunidad y el gobierno ante desastres.

Res- pecto a los cambios en el clima percibidos en los últimos 10 años. tala y quema. primordialmente caza. el estado del suelo fue valorado por las personas como bueno por el 14. el 72. desde la perspectiva de la población. y en Nuevo San Juan Chamula fueron los incendios. indicaron con mayor frecuencia que era la CONANP.8% percibió el 139 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . seguida por El Carrizal (86%). 63% en Emilio Rabasa y 71% en Nuevo San Juan Chamula. difiere en cada localidad. En general. en Veinte Casas solamente la caza.2% señaló que mantener la vida de plantas y animales era el objetivo de la REBISO y los principales responsables de su resguardo era la misma gente que vive en la reserva. fauna. reforestación (sembrar árboles y plantas) y no explotación ni aprovechamiento de fauna (no cazar) y sembrar árboles y plantas. en el caso particular del El Carrizal mencionaron el agua y los peces. El 53. después prácticas dirigidas de flora (38%) y por último para fauna (40%). fue variable a lo largo de las localidades. Las prácticas de conservación que la población indicó realizar con mayor frecuencia fueron para conservación de suelo (45%). Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote conocieron el Plan de Manejo de la REBISO. la tala y caza ilegal. en Veinte Casas 16% y en Nuevo San Juan Chamula el 12% (Figura 4). la población mencionó que lo entendían como los cambios del clima y las lluvias.3% en El Carrizal. planteada para evaluar el capital natural. en Emilio Rabasa el 32%. En El Carrizal señalaron que el principal pro- blema es la pesca inmoderada. no quemar. En Emilio Rabas (90%) de las personas encuestadas respondieron sí saberlo. uso de composta. Capital natural Las respuestas a la pregunta ¿Conoce que vive en un ANP?. Además. Las principales riquezas naturales identificadas fueron la flora. El 80% de las personas encuestadas mencionó que el estado de estas riquezas era bueno (‘Conservado’ o ‘Muy conservado’). Entre las actividades de conservación del ecosistema más mencionadas por las personas entrevistadas fueron de no tirar basura. en Emilio Rabasa los incendios. 56% en Veinte Casas. después Nuevo San Juan Chamula (68%) y Veinte Casas (64%) (Figura 5).3% respon- dió que conocía al responsable del ANP. El problema principal del ANP. la montaña. El 63% dijo conocer las actividades prohibidas. el 65. Sobre la pregunta si escucharon sobre el concepto de cambio climático.

se identificó si las personas percibieron daños ocasionados por el Cambio climático en su for- ma de vida. 64. 140 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Conjuntamente. 50% en El Carrizal.6% en Emilio Rabasa. Capital natural total y por cada localidad estudiada de la Reserva de la Biosfera Selva El Ocote aumento del calor y el 45. 24% en Veinte Casas y 20. principalmente la temporada de siembra y la disposición de alimentos: 52. y la posibilidad de daños en la comunidad a causa del Cambio climático: 48% en Veinte Casas. 50% en El Carrizal.9% en Emilio Rabasa.6% en Nuevo San Juan Chamula. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Figura 5.7% en Nuevo San Juan Cha- mula y 78.7% un aumento en las lluvias.

aunque el único medio de transporte indicado para entrar o salir de la comunidad fue la lancha y mencionaron que hacer uso de ella resultaba muy costoso. En Veinte Casas tampoco reportaron la existencia de transporte. al igual que el 89. el 62% de las personas encuestadas indicó que el transporte era de regular a muy bueno. 96% en Veinte Casas y 26% en Emilio Rabasa mencionan tener acceso a un buen servicio de electricidad. 141 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Respecto a si existe alguna dificultad en el transporte para entrar o salir de la localidad. Solamente en Nuevo San Juan Chamula se re- portó existencia de clínica de salud. 85% en Nuevo San Juan Chamula y 84% en Emilio Rabasa y Veinte Casas. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Capital físico Este capital fue analizado a través de la existencia y la valoración que la población tiene de los servicios comunitarios. en El Carrizal el 92. 38. la cual representó un buen servicio para el 41% (Figura 6). Mientras que en El Carrizal consideró así en el 21%. el 86% en El Carrizal. 2010 solo hay registros de preescolar y primaria una escuela en cada una de las cuatro localidades y solamente telesecundaria en Nuevo San Juan Chamula.9% mencionó que sí tenían dificultad en alguna época del año. Para las personas. En todas las localidades.5% en Emilio Rabasa. En Nuevo San Juan Chamula.2% en Nuevo San Juan Chamula y 36% en Veinte Casas. Por otra parte. clínica de salud ni casa ejidal. La encuesta reveló que el 100% de las personas encuestadas en Nuevo San Juan Chamula consideran que la casa ejidal proporciona un buen servicio y el 58% en Emilio Rabasa. el servicio mejor evaluado fue la escuela. el agua entubada fue buena en Veinte Casas (80%) y en Nuevo San Juan Chamula (71%). En segunda instancia. aunque en general existió carencia de los ser- vicios. represen- tado por el 91% de las personas encuestadas. el 97% en Nuevo San Juan Chamula. a pesar que de acuerdo a la SEP. casa ejidal ni agua entubada. La población de El Carrizal no contaba con clínica de salud. En Emilio Rabasa no tenían transporte. clínica de salud ni agua entubada. la iglesia fue la segunda mejor valorada 93% en El Carrizal.

ya que la mayor parte es para autoconsumo. 142 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . La agricultura resultó ser la principal actividad económica.8%). Aunque no todos proporcionaron información sobre los ingresos obtenidos de la agricultura. Seguro Popular (29.7%). princi- palmente de Prospera (36. y en el caso de comercializar las personas pre- fieren no responder por incertidumbre de que les quiten los apoyos del gobierno. En los hogares suele recibirse apoyo de más de un programa de gobierno (Figura 7). Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Figura 6.1%) y Procampo (15. Capital físico Capital financiero El 95% de los hogares reciben ingresos de algún programa de gobierno.

Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Figura 7. 143 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . también reportaron dedicarse a la pesca. En el caso de El Carrizal. Veinte Casas y El Carrizal solo una persona de cada co- munidad respondió recibir financiamiento. estos bajos valores de los capitales sugieren un nivel de vulnerabilidad que debe preocupar a las diferentes autoridades que convergen en la REBISO. En Nuevo San Juan Chamula fueron dos personas que recibieron financiamiento de una agrupación religiosa y de una de productores. Capital financiero total y por cada localidad estudiada de la Reserva de la Biosfera Selva El Ocote pero también porque no conocen exactamente cuál es el ingreso de su hogar. En Emilio Rabasa. Discusión En general. los capitales con mayor puntaje se encuentran apenas por arriba de la mitad de la escala adoptada como referencia (0 a 1).

Sin embargo. y de ahí que el promedio de hijos va de 3 a 6. El monto es determinado por el número de hijos. educación. que no se incluyeron en este estudio. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo Figura 8. la agricultura. a medida que los ingresos ‘aumentan’ las necesidades también lo hacen y cuando los hijos e hijas ya no acuden a la escuela se les retira el apoyo. específicamente en la dependencia económica de la producción agrícola para satisfacer buena parte de su alimentación y por ser una actividad. 144 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . manteniéndose la necesidad de alimentación. una de las razones que revela el estudio es la falta de escuelas en las localidades y la carencia de transporte. por lo que sugiere tener más hijos puede ser visto como la oportunidad de acceder a mayores ingresos por parte de programas. sensible a los impactos del cambio climático. entre otros. proviene del programa de gobierno Prospera dirigido exclusivamente a las mujeres. Se observó una baja continuidad de estudios. aunque también existen factores culturales y de género. y servicios de salud. Capitales de la REBISO e interpretación de vulnerabilidad Los valores del capital financiero coincide con el estudio Ríos et al. (2011) y Benett et al. La mayor parte del ingreso económico de las familias. y que pueden influir en suspender los estudios. (2001).

Los pobladores mencionan que las reglas restringen el acceso y uso recursos limitando las actividades y medios de vida de la población. la conservación de los recursos naturales de la Reserva (capital natural). para evitar las consecuencias y no precisamente con el fin de cumplir el objetivo de la conservación “mantener a largo plazo la disponibilidad de bienes y servicios que provee la naturaleza a la sociedad. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote En el Plan de Manejo de 2001 se menciona que participaron algunas pobla- ciones entre las que se encuentran Nuevo San Juan Chamula y Veinte Casas. A pesar que las percepciones son de un mal desempeño de las autoridades ante desastres y de su carente relación con las comunidades. desastres y Cambio climático. por lo que de fondo puede presentarse la percepción de que los medios de vida y actividades tradicionales dejan de ser legales e incluso los pobladores pueden convertirse en infractores de las leyes (Aguilar-Cordero et al 2012. Por otro lado aun cuando los habitantes conocen que existe el Plan de Manejo lo que mencionan son algunas reglas de prohibición. La carencia de información tanto en ámbitos de conservación como los riesgos. La participación social constante en la gestión del ANP es necesaria ya que se ha convertido en herramienta de gestión (Aguilar-Cordero et al 2012). sin embargo ningún entrevistado recordó haber participado al menos en esa ocasión. especificar las estrategias sostenibles que puedan diversificar las fuentes de ingreso de las familias. las poblaciones presen- tan alta adherencia a organizaciones religiosas que junto con la buena valoración de las iglesias pueden representar redes de apoyo de acuerdo con Gutiérrez-Montes et 145 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . además de una débil relación entre la comu- nidad y autoridades locales repercuten en la baja participación en actividades de prevención e implica una disminución en capacidad de respuesta de las personas e incrementa la probabilidad de mayor vulnerabilidad social ante desastres sociales y ambientales. más que ser valorada como pa- trimonio natural (capital cultural) se realiza para cumplir las normas de prohibición. para beneficio de las generaciones actuales pero manteniendo su potencialidad para satisfacer las necesidades y aspiraciones de las generaciones futuras” (SEMARNAT y CONANP 2001: 66) que contempla el aprove- chamiento sostenible pero del cual las personas no hacen referencia. Por lo que se re- comienda integrar en las políticas públicas estrategias de comunicación eficiente en las comunidades sobre los programas de conservación y en el Plan de Manejo. Bennett y Dearden 2014). Por ello.

en la realidad y con base a datos en las localidades estudiadas. específicamente en una Reserva de la Biosfera. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo al. que son quienes tienen las experiencias co- tidianas de enfrentar los retos del cambio climático. tanto ambientales como sociales y políticos. La inclusión explícitamente de los contextos socioeconómicos es prioritario para que se enfrente de manera específica y contextual los efectos del cambio climático global. (2014) y pueden simbolizar solidaridad y ser refugios en caso de requerir ayuda como en el caso de desastres. las estrategias de conservación de los recursos naturales estarán estrechamente ligadas al bienestar o desarrollo de las personas que las habitan. debería ser un punto de encuentro de la conservación y preservación de la biodiversidad y en donde se promueva el desarrollo económico y humano. Los habitantes de los territorios son quienes protegen los recursos naturales porque conforme su patrimonio biocultural y los de sus descendientes. esto no se está logrando. es muy relevante para poder trasladar esta perspectiva 146 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . sin embargo. Así. En cuanto al MCC permitió analizar holísticamente las capacidades de las comunidades. y en ese sentido se sugiere que hay un alto grado vulnerabilidad a diversos factores. atendiendo las ne- cesidades sociales y de conservación de la diversidad biológica de la REBISO. lo que permitió estimar un nivel de vulnerabilidad social de las cuatro comunidades de la REBISO. tanto locales como estatales y nacionales. Las localidades estudiadas pertenecen a diferentes zonas o subzonas de la REBISO pero el resultado de capitales bajos es común en todas. así como el tener un mayor conjunto de comunidades en ANP. Conclusiones Vivir en un ANP. para valorar la constancia de los resultados observados en las cuatro comuni- dades de la REBISO. El enfoque y forma de intervención de las autoridades. Se sugiere que el aspecto ecológico deje de ser el centro único de atención en las mediciones de vulnerabilidad social e incluir las percepciones de los pobladores. Será interesante aplicar el modelo a comunidades que no tengan relación con ANP.

Es necesario que en los ámbitos educativos. y M. M. A la Dra. conservación. D. Cerón Gómez. Christiane Jungans por sus aportes en la elaboración y aplicación del cuestionario de la encuesta junto con la Dra. 49. D. Referencias Aguilar-Cordero. P. Serie técnica. Emilio Rabasa. Lorena Ruiz Montoya y la M. Veinte Casas y Nuevo San Juan Cha- mula por su participación en la encuesta. Será importante conocer y evaluar las oportunidades de gestión integral participativa en las ANP. ya que algunas tienen predominancia de lengua tsotsil (Nuevo San Juan Chamula y Veinte Casas) y bajos porcentajes de bilingüismo.. Existe la necesidad de implementar algunas estrategias de adaptación ante el Cambio climático que permita la diversificación de los modos de vida y de los sistemas productivos que los sustente. Alonzo-Parra. 2012. Agradecimientos A los pobladores de El Carrizal. 2010. E. en C. J. Agradecemos al CO- NACYT por el financiamiento del proyecto PDCPN-2013/214650-Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote. Bautista-Solís. Bayón. Turrialba. para la sustentabilidad desde los pobladores y para la conservación social y ambiental. Gutiérrez-Montes (editores). y I. salud. Canul-Rosado y J. Mier. 2012. W. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote ­integral entre lo social y lo biológico en realidades y en la disminución de vulne- rabilidades de la población. A. Capitales de la comu- nidad y la conservación de los recursos naturales: el caso del Corredor Bio­ lógico Tenorio-Miravalles. sean reforzados y que se tomen en cuenta las diferencias lingüísticas de las loca- lidades. Boletín Técnico Núm. C. Teoría y Praxis 12: 34-51. Centro Agronómico Tropical de Investigación y Enseñanza. Percepción social sobre los benecios de estar viviendo en un área natu- ral protegida: Otoch Ma´ax Yetel Koo. Guadalupe Álvarez Gordillo. Costa Rica. entre otros. Familias y vulnerabilidades en México: realidades 147 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

2001. 2001. 1996.redadultosmayores.marpol.php?option=com_content.jstor. Durand. Davis y B. Las diferen- tes expresiones de la vulnerabilidad social en América Latina y el Caribe. desenredando. Centro de Estudios sobre Desastres y Riesgos 1-18. L. 2010. N. Instituto de Investigaciones Sociales. A capital assets framework for appraising and building capacity for tourism development in aboriginal protected area gateway communities. P. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo y percepciones. Seminario Internacional.. 2014. Disponible en http://www. Lemelin. Why local people do not support ­conservation: Community perceptions of marine protected area livelihood impacts. Busso. Cardona. México. Disponible en http://doi. Una crítica y una revisión necesaria para la gestión.2013. R. Koster e I. Bogotá. Dis- ponible en http://doi. ­governance and management in Thailand. Catálogo de localidades indígenas 2010. G.2011. J. y P. H. Dearden.08. 2014. I.org/10. Marine Policy 44: 107-116.conanp.017. Recuperado el 19 de enero de 2015. Vulnerabilidad social: nociones e implicancias de políticas para Latinoamérica a inicios del siglo XXI. Tourism Management 33: 752-766.1016/j. Áreas protegidas decretadas. Bennett. 2012.. Universidad Autónoma Nacional de México. 148 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .mx/index.org/public/articulos/2003/rmhcvr/rmhcvr_may-08-2003. Santiago de Chile. Red de Estudios Sociales en Prevención de Desastres en América Latina. O.009. Wisner. Disponible en http:// www. Bennett. LA RED. N.mx/que_hacemos/.pdf. CDI.tourman. Vulnerabilidad.com. 2015. T. Comisión Nacional de Áreas Naturales Protegidas: México. La necesidad de repensar de manera holística los conceptos de vulnerabilidad y riesgo.pdf. R. Ecología Política 25: 103-110.08. Budke. Cannon. El entorno social.org/10.ar/ buscador/files/ORGIN011.org/ stable/20743291. D. ¿Para qué sirven las áreas naturales protegidas? La compresión local del ambientalismo en la Reserva de la Biosfera Santa Marta (Veracruz. México). Disponible en http://www. Colombia. Disponible en http://www.cdi.gob.gob. político y económico de los desastres.1016/j. a partir de http://www. CONANP. CONANP y GIZ. 2003. Blaikie. México. Herramienta para el análisis de vulnerabilidad social a los impactos climáticos a nivel local en Áreas Naturales Protegidas.

Soares. Hernández. 2014. Rivas. páginas 35- 36. páginas 143-185. San José. Uruguay. Gutiérrez-Montes. Reservas de la biosfera: problemas y oportunidades en México. 2010. Estrategia 100x100. 2010. en D. La vulnerabilidad social al cambio global. Halffter. de J.pdf. Ramírez. Comisión Económica para América Latina y el Caribe. G. M..gob. Síntesis para decisores. y J. Soares. Vulnerabilidad social ante el cambio climático: retos y propues- tas de políticas desde un enfoque de equidad social. PASOS 13: 73-88. Spiraling-Up: Mapping Community Transformation with Community Capitals Framework. Disponible en http:// www. Flora. 2008. Perú. Lima. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Emery. Filgueira. Morelos. Pinto. Principales resutados por 149 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . y J. Revista de Turismo y Patrimonio Cultural. México.cambioclimatico-bolivia. Proteger lo natural. Community Development 37: 19-35. vulnerabilidad y estructura de oportunidades. I. Gutiérrez (coordinadoras) Reflexiones y Expresiones de la Vulnerabilidad Social en el Sureste de México. G. 2013.mx/interna2. Gutiérrez-Montes. López. Diágnostico de medios de vida y capitales de la comunidad de humedales de medio queso. A. F. French. J. M. Censo de población y vivienda 2010. Kaztman. Costa Rica. 2012.php. INEGI. Gobierno Federal.estrategia100x100. G. M. 2006. Unión Internacional para la Conservación de la Naturaleza y de los Recursos Na- turalesos Naturales. H. Policy Brief. 2015. C.. y R. Análisis de la susceptibilidad de los recursos comuni- tarios ante eventos climáticos extremos en Sitalá Chiapas: retos y propuestas conceptuales desde el enfoque de equidad social. Siles. org/archivos/20130728193402_0. Montevideo. Los impactos del cambio global en las áreas naturales protegidas y sus zonas de influencia: el caso del Parque Nacional Huarcarán y la cuenca del Río Santa. Marco conceptual sobre activos. A. G. … R. Hernández. 2011. desproteger lo social. Acta Zoológica Mexicana 27: 177-189. D. Costa Rica. G. Vivir Mejor. Millán e I. Bury. Reflexiones de los impactos de la conservación de la naturaleza en México. 1999. Los Chiles. y C. ________. en Servicio Nacional de Áreas Naturales Protegidas por el Estado (edi- tor). Centro Agronómico Tropical de Investigación y Enseñanza e Instituto Mexicano del Agua. y E. Thibault. Disponible en: http://www. I.

sep. Extensión Extra.gob. 150 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Adaptación al cambio climático. Recursos Naturales y Am- biente 63: 21-29. R.org. Notas sobre la medición de la vulnerabilidad social. Magaly Carolina Morales-López y Guadalupe del Carmen Álvarez-Gordillo l­ ocalidades (ITER). C. México. Vulnerabilidad al cambio climático en comunidades indígenas cabécares de Costa Rica. 1-8. Jacobs. Representaciones sociales de la pobreza y bien­estar para zoques y tsotsiles. Ríos. C. Chiapas.U. 2010.org/sites/default/files/documentos/ files/100517_adaptacion. páginas 459-489. Disponible en http://www. Programa de Manejo Reserva de la Biosfera Selva El Ocote.mx/SNIESC/. IPCC.snie.inegi. Chiapas. E. Capacitar a las personas que viven en la pobreza para que puedan adaptarse. Con- tribución del grupo de trabajo II al Quinto informe de Evaluación del Grupo Intergubernamental de Expertos sobre el Cambio climático. Reino Unido. Disponible en http://www. Measuring success in communities: understanding the c­ ommunity capitals framework. M. Villasana Benítez y L. S. Paz-Salinas. H. 2014.pdf.mx/publica/librev/rev/nuant/cont/68/pr/pr4. Nueva antro­ pología. 2010. Revista de ciencias sociales 51-74. Pettengell. Universidad Autónoma de Chiapas. South Dakota State University. Jiménez. 2007.juridi- cas. Sistema Nacional de Información de Escuelas. E. Jiménez. 2008. M. Avances y Perspectivas Interdisci- plinarias para el Desarrollo.A. Series No.. E. Cambio climático 2014: Impactos. B. Community Capitals. México. 2011.oxfamintermon. Comisión Económica para América Latina y el Caribe.pdf. 2000. Louman y M. Suiza. en La medición de la pobreza: métodos y aplicaciones. en S.mx/siste- mas/consulta_resultad. F. adaptación y vulnerabilidad. Disponible en http://www. 2001. Dakota. SEMARNAT y CONANP. Kaztman. 2011. Disponible en http://www. Páginas 275-301. México. SEP. De áreas naturales protegidas y participación: conver- gencias y divergencias en la construcción del interés público. y R.unam. Ginebra. Capote. Memoria del 5° Taller Regional: Programa para el mejoramiento de las encuestas y la medición de las condiciones de vida en América Latina y el Caribe. Trujillo Olivera (coordinadoras).

unesco. 2011. Capitales de la comunidad. y S. Universidad Nacional Autónoma de México 100: 79-93. D. Soares. G. Turrialba. E. A. 2012. I. Yucatán. 2015. Paris. UNESCO. J. 2013. Rivas y G. Gutiérrez-Montes. Francia.Centro Agronómico Tropical de Investigación y Ense- ñanza. Investigaciones Geográficas. Programa El Hombre y la Biosfera (MAB). Capitales comunitarios y vulnerabilidad social frente al cambio climático en un municipio de Yucatan. R. López. Evaluación de la vulnerabilidad social ante amena- zas naturales en Manzanillo (Colima). R.unesco. D. G. medios de vida y vulnerabilidad social ante huracanes en la Costa Yucateca.pdf 151 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Red Mundial de Reservas de Biosfera.org/new/es/office-in-montevideo/ciencias-naturales/ecolog- ical-sciences/biosphere-reserves/. Trayectorias 14: 51-75. Boletín del Instituto de Geografía. 2016. Un acercamiento a través de la experiencia de San Felipe. Pinto. Thomas-Bohórquez. V. Dis- ponible en http://www. UNESCO.. Disponible en http:// www.de/fileadmin/medien/Dokumente/Wissen- schaft/2015_WNBR_World_Map_Web. Vulnerabilidad social ante el cambio climático en la Reserva de la Biosfera Selva El Ocote Soares. Vargas. Costa Rica. Romero.

.

En este capítulo se presenta la comparación y análisis de la in- formación de la ictiofauna. Ictiofauna de la Reserva de la Biosfera Selva El Ocote Alfonso A.mx Resumen La REBISO se ubica hidrológicamente en la región Grijalva-Tuxtla Gutiérrez. Unidad San Cristóbal. Carretera Pana- mericana y Periférico Sur s/n.1 Rocío Rodiles-Hernández1 y Miriam Soria-Barreto1. que se origina en la parte norte de la Sierra Madre de Chiapas y se une al río Negro. El Colegio de la Frontera Sur. Departamento de Conservación de la Biodiversidad. el río Cacahuanó que nace en las sierras de Veinte Casas y Sombrerón. San Cristóbal de Las Casas. La información procede de la revisión de la literatura. Barrio María Auxiliadora CP 29290.El Colegio de la Frontera Sur. las familias Cichlidae y Poeciliidae son 153 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Los trabajos publicados hasta la fecha reportan de 34 a 47 especies en los ríos de la reserva y zonas aledañas. para finalmente desembocar en la presa Nezahualcóyotl. Exclusiva- mente para la REBISO existen 41 especies. González-Díaz. su principal afluente es el río La Venta. Unidad San Cristóbal CONACyT . Chiapas. González-Díaz. la consulta de bases de datos de colecciones científicas y recolectas en el río La Venta durante 2015. los trabajos relacionados con el estudio de peces comenzaron hace casi una década. E-mail: agonzalez@ecosur. Departamento de Conserva- ción de la Biodiversidad. San Cristóbal de Las Casas 2 Correspondencia: Alfonso A. Colección de Peces. donde se incluye información sobre su distribución y se hacen recomendaciones de inves- tigación a partir del estado actual del conocimiento íctico. El Colegio de la Frontera Sur.2 1 Colección de Peces. La reserva es una zona importante por su diversidad. Además. desemboca en el mismo embalse. México. para elaborar un listado taxonómico actualizado.

se origina en la parte norte de la Sierra Madre de Chiapas y fluye a través de la Depresión Central. que se origina en las Sierras de Veinte Casas y Sombrerón. La distribución de las especies está determinada por el tipo y calidad del hábitat a lo largo del gradiente altitudinal. El estado de conservación de la ictiofauna es aceptable. 2013 y 2016. 2008. Chiapas. así como en la presa Nezahualcóyotl y sus 154 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Rocío Rodiles-Hernández y Miriam Soria-Barreto las más diversas. Anzueto-Calvo 2008. Introducción La Reserva de la Biosfera Selva El Ocote (REBISO) se encuentra ubicada en la región hidrológica Grijalva-Tuxtla Gutiérrez. En este sentido. Debido a las ca- racterísticas kársticas del suelo en esta región. Áreas Naturales Protegidas. Helbig 1976. en el sitio conocido como El Encajona- do. Es necesario enfocar esfuerzos para conocer la importancia de la integridad ambiental en la dinámica de la comunidad de peces. río Cacahuanó. mientras que los ríos superficiales son escasos. posteriormente se une al río Negro. Existen trabajos que han documentado la diversidad de peces en la REBISO y las zonas de influencia. En estos trabajos se mencionó la existencia de 34 hasta 47 especies. 2016). González-Díaz. Velázquez-Velázquez et al. a través de los años la estructura de la comunidad ha sufrido cambios. Alfonso A. CONANP-SEMARNAT 2000). la presencia de especies exóticas es cada vez más frecuente y la abundancia de algunas nativas ha disminuido. en la cuenca media del río Grijalva (Mülleried 1957. Destacan los estudios realizados por González-Díaz et al. sin embargo. una vez que ambos se unen desembocan en el embalse Nezahualcóyotl. río La Venta. por las localidades de Jiquipilas y Cintalapa. Otro río importante de la REBISO es el Cacahuanó. Palabras clave: Río Grijalva. que habitan en los principales ríos y arroyos que fluyen en la REBISO. gran parte de los acuíferos son sub- terráneos. el río La Venta es el afluente más grande e importante de la REBISO. Anzueto-Calvo et al. fluye por el límite de la Reserva hasta desembocar en el embalse Netzahualcóyotl (INEGI 1995. que nace en la región de Los Chimalapas en el estado de Oaxaca. existen dos especies endémicas y ocho están en alguna categoría de riesgo. así como por los procesos biogeográficos históricos que han afectado a la región.

Es necesario actualizar la nomenclatura taxonómica de algunos grupos. el presente trabajo compila la información procedente de diversas fuentes para la elaboración un listado taxonómico actualizado. McMahan et al. Materiales y métodos Se realizó una búsqueda detallada. es fundamental disponer de información actual e histórica sobre la distribución de las especies en los diversos cuerpos de agua de la reserva. Para las recolectas se emplearon redes agalleras. San Cristóbal (ECOSC). Říčan et al. A pesar que el conocimiento de la diversidad de peces de la REBISO es considerable. (2016). Los ejemplares fueron fijados en formalina al 10% para ser transportados al Laboratorio de Peces de El Colegio de la Frontera Sur. se identifican las necesidades prioritarias de investigación sobre la comunidad de peces. tratan sobre la ictiofauna de la cuenca del río Grijalva y del estado de Chiapas respectivamente. chinchorros. donde se incluyeron sitios ubicados en la reserva. a la fecha se siguen colectando especies no reportadas previamente. (2015) y Velázquez-Velázquez et al. 2015. Por último. Asimismo. Ictiofauna de la Reserva de la Biosfera Selva El Ocote tributarios. 2016). sin considerar la presa Nezahualcóyotl. En este sentido. donde fueron lavados con agua corriente y preservados en alcohol etílico al 155 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . debido a los recientes e importantes cambios sistemáticos en las familias Cichlidae y Poeciliidae (Mo- rales-Cazan y Albert 2012. comparación y análisis de las publicaciones existentes sobre la diversidad de peces reportada para la REBISO y zonas de in- fluencia. que representan interesantes hallazgos para el conocimiento y conservación de la ictiofauna de la región y del país (Gómez-González et al. 2014). Los trabajos de Gómez-González et al. se hicieron recolectas en seis localidades del río La Venta durante secas y lluvias del año 2015. donde se incluye la distribución de las especies que habitan exclusivamente en la REBISO. an- zuelos y el equipo de electropesca. Además. atarrayas. También se consultaron los registros del Sistema Nacional de Informa- ción sobre la Biodiversidad (SNIB proporcionados por la CONABIO) y el acervo íctico depositado en la Colección de Peces de ECOSUR. Durante cada evento de recolecta se registraron datos de calidad del agua y el hábitat.

Para conocer las categorías de protección y el estado de conservación de las especies se revisó la Norma Oficial Mexicana ECO-059 (NOM 059 2010). Alfonso A. Rocío Rodiles-Hernández y Miriam Soria-Barreto Figura 1. se dividió en tres partes dentro de la REBISO: alta (I). posteriormente. por último. se presenta la comparación de la com- posición íctica reportada de manera histórica. 2008). La distribución de las especies se limitó al río La Venta y el río Cacahuanó. Registros de la ictiofauna en la Reserva de la Biosfera Selva El Ocote (REBISO) 70%. la Lista Roja (UICN 2016) y el listado de la “American Fisheries Society” (Jelks et al. La parte alta (I) abarca 156 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se elaboró una lista taxonómica actualizada de los peces que se encuentran exclusivamente en la REBISO. donde se incluye información de su distribución y el estado de conservación. se depositaron en la Colección de Peces de ECO- SUR San Cristóbal (ECOSC). A partir de la información recabada. se determinaron taxonómicamente utilizando literatura y claves especializadas. En el caso del río La Venta. por ser los sistemas hidrológicos más importantes en la reserva y con mayor nú- mero de registros en las recolectas. media (II) y baja (III). González-Díaz.

donde se ubica la REBISO. (2016). Posteriormente. se incluyeron los ríos Negro. (2016). mientras que los géneros y especies se ordenaron alfabéticamente. Un año después. Negro y Caca- huanó. (2015) publicaron la fauna íctica de la cuenca del río Grijalva. Anzueto-Calvo et al. Negro y Cacahuanó. Anzueto-Calvo (2008). en este trabajo se consideraron los ríos La Venta. La Venta. Por último. González-Díaz et al. in- cluyendo fotografías y una clave taxonómica para la determinación de las especies. la media (II) desde la Colonia Emilio Rabasa hasta el sitio donde se une el río Negro con el río La Venta (la junta). obtenidas de las recolectas efectuadas durante 2004 a 2006. 157 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . y la parte baja (III) comprendió desde la desembocadura del río Negro hasta El Encajonado (Figura 1). En el caso de la nomenclatura. (2016). publicaron un listado de 42 especies de peces de la REBISO. sobre la ictiofauna dulceacuícola del estado de Chiapas se mencionaron 45 especies para la unidad geográfica Grijalva-Malpaso. De manera regional. reportaron 44 especies capturadas en los ríos La Venta. Ictiofauna de la Reserva de la Biosfera Selva El Ocote desde la Cascada El Aguacero hasta la Colonia Emilio Rabasa. así como en la presa Nezahualcóyotl. Gómez-González et al. Corozo y Cacahuanó y reconoció la existencia de 34 especies. a partir de recolectas efectuadas en los años 2007. en el trabajo de Velázquez-Velázquez et al. mencionaron la existencia de 47 especies para la REBISO. 2016. en este trabajo se visitaron 34 sitios de la REBISO durante 2007 a 2009. pre- sentó la diversidad ictiofaunística y su relación con algunas variables ambientales en la REBISO evaluada en 2007. Para el río Cacahuanó solo se enlistan las especies de la parte alta. debido a que es la sección que se ubica dentro de la REBISO. la Presa Neza- hualcóyotl y el río Totopac. En ese mismo año. (2008) reportaron 42 especies . Anzueto- Calvo et al. así como la Presa Nezahualcóyotl. (2013). donde incluyeron a la REBISO como parte de la sección denominada Malpaso. 2009 y 2014. 2008. autoridad y año de descripción se siguió el trabajo en línea de Eschmeyer et al. así como de la revisión de material depositado en la Colección de Peces de ECOSUR San Cristóbal (ECOSC) hasta 2005. El listado taxonómico para las categorías supragenéricas se elaboró siguien- do la clasificación de Nelson et al. Resultados Se encontraron seis trabajos relacionados con la ictiofauna de la REBISO y su zona de influencia.

2008 Ariidae Potamarius nelsoni (Evermann & Goldsborough 1902 Siluriformes Ictaluridae Ictalurus meridionalis (Günther 1864) Rhamdia guatemalensis (Günther 1864) Heptapteridae Rhamdia laticauda (Kner 1858) Astatheros macracanthus (Günther 1864) Amphilophus trimaculatus (Günther 1867) Cincelichthys pearsei (Hubbs 1936) Maskaheros regani (Miller 1974) Oreochromis mossambicus (Peters 1852) Oreochromis niloticus (Linnaeus 1758) Cichliformes Cichlidae Parachromis managuensis (Günther 1867) Petenia splendida Günther 1862 Thorichthys helleri (Steindachner 1864) Tilapia zilli (Gervais 1848) Trichromis salvini (Günther 1862) Vieja hartwegi (Taylor & Miller 1980) Vieja melanura (Günther 1862) Atheriniformes Atherinopsidae Atherinella alvarezi (Díaz-Pardo 1972) Hemiramphidae Hyporhamphus mexicanus Álvarez 1959 Beloniformes Belonidae Strongylura hubbsi Collette 1974 Tlaloc labialis (Günther 1866) Profundulidae Profundulus punctatus (Günther 1866) Cyprinodonti- Gambusia yucatana Regan 1914 formes Poeciliidae Poeciliopsis fasciata (Meek 1904) Poeciliopsis hnilickai Meyer & Vogel 1981 158 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Rocío Rodiles-Hernández y Miriam Soria-Barreto Tabla 1. Composición íctica actualizada de la REBISO Orden Familia Especie Autoridad Dorosoma anale Meek 1904 Clupeiformes Clupeidae Dorosoma petenense (Günther 1867) Cypriniformes Catostomidae Ictiobus meridionalis (Günther 1868) Astyanax aeneus (Günther 1860) Characiformes Characidae Brycon guatemalensis Regan 1908 Cathorops kailolae Marceniuk & Betancur-R. Alfonso A. González-Díaz.

y el Museo de Zoología la Universidad de Michigan (UMMZ) (Rodiles-Hernández y González-Díaz 2008. Poeciliopsis fasciata (casi amenazada en 159 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . procedentes de 26 localidades y depo- sitados en tres colecciones ictiológicas: la Colección de Peces de El Colegio de la Frontera Sur. se lograron capturar ejemplares pertenecientes a 29 especies. el Museo de Zoología de la Univer- sidad de Ciencias y Artes de Chiapas (MZ-UNICACH). en las recolectas realizadas durante el 2015 en el río La Venta. existen seis especies que se encuentran en alguna categoría de protección: Potamarius nelsoni (protección es- pecial en la Norma Oficial Mexicana NOM-059 y vulnerable para la American Fis- heries Society). Ictiofauna de la Reserva de la Biosfera Selva El Ocote Tabla 1. con 10 y 13 especies. Velázquez-Velázquez 2011). Unidad San Cristóbal (ECOSC). Priapella intermedia Álvarez & Carranza 1952 Poeciliidae formes Pseudoxiphophorus bi. Por otra parte. Las familias más di- versas son Poeciliidae y Cichlidae. (Heckel 1848) maculatus Xiphophorus clemenciae Álvarez 1959 Xiphophorus hellerii Heckel 1848 Synbranchiformes Synbranchidae Ophisternon aenigmaticum Rosen & Greenwood 1976 Perciformes Gerreidae Eugerres mexicanus (Steindachner 1863) Acanthuriformes Sciaenidae Aplodinotus grunniens Rafinesque 1819 El Sistema Nacional de Información sobre la Biodiversidad (SNIB) cuenta con 573 registros de peces para la REBISO. 2011. 15 familias y 33 géneros. En la REBISO habitan Poeciliopsis hnilickai y Vieja hartwegi. dentro de los límites de la REBISO. pertenecientes a 11 órdenes. Composición íctica actualizada de la REBISO (continuación) Orden Familia Especie Autoridad Poeciliopsis pleurospilus (Günther 1866) Poecilia mexicana Steindachner 1863 Poecilia sphenops Valenciennes 1846 Cyprinodonti. la base de datos y las recolectas recientes. Rhamdia guatemalensis y Priapella intermedia (protección especial en la Norma Oficial Mexicana NOM-059). especies en- démicas de la cuenca del río Grijalva. se reconoce que 41 especies se encuentran distribuidas en la REBISO. Como resultado de la integración del análisis bibliográfico. Por otra parte. respectivamente (Tabla 1). Rodiles-Hernández et al.

Estas seis especies se encuentran a lo largo del río La Venta y en la parte alta del río Cacahuanó. Esto puede ser el resultado del tiempo de la colecta y 160 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . La mayor diversidad de peces se encuentra en el río La Venta con 36 espe- cies. una es de la zona media. en esencia están dadas por la adición de especies recolectadas en sitios fuera de la Reserva como la presa Nezahualcó- yotl y algunos de sus afluentes. Ictalurus meridionalis y Vieja hartwegi. Esta última especie es objeto de reproducción en centros de producción acuícola con fines de repoblamiento impulsado por el Gobierno de Chiapas. Parachromis managuensis y Tilapia zilli. Alfonso A. muestra pocas diferencias en cuanto al número de especies. 11 se encuentran en las partes alta y media. cinco de las cuales solo se reportan para este sistema lótico. así como las exóticas. Se reportan cuatro especies introducidas: Oreochro- mis mossambicus. mientras que Vieja melanura es una especie traslocada de la cuenca del río Usu- macinta. Las especies nativas con mayor distribución en la REBISO son Astyanax aeneus. nueve se distribuyen a lo largo del río. no obstante aún no se ha registrado su presencia. González-Díaz. tres se comparten en las zonas media y baja y 12 fueron capturadas solo en la parte baja. Rocío Rodiles-Hernández y Miriam Soria-Barreto la Lista Roja de la UICN). Oreochromis mossambicus y O. En cuanto a la distri- bución. niloticus. Oreochromis niloticus. Durante las recolectas de 2015 sólo se capturaron 29 de las 36 especies re- portadas para el río La Venta. Discusión La composición íctica reportada en la literatura para la REBISO. Xiphophorus clemenciae (amenazada en la Norma Ofi- cial Mexicana y en la American Fisheries Society) y Vieja hartwegi (amenazada en la Norma Oficial Mexicana. En cambio. 22 de las cuales se reportan exclusivamente en este río. vulnerable en la Lista Roja de la UICN y la American Fisheries Society) (Tabla 2). Tal es el caso de la especie exótica Mayaheros uropthalmus (regionalmente conocida como mojarra castarrica). Es probable que algunas de especies penetren a la REBISO. Brycon guatemalensis. Entre los ríos La Venta y Cacahuano se comparten 14 especies (Tabla 2). que es capturada frecuentemente en la presa pero no ha sido reportada en la reserva. el río Cacahuano alberga 19 especies.

La riqueza de peces de la reserva corresponde al 45. A través de la revisión minuciosa de los ejemplares depositados en la Colección de Peces de ECOSUR San Cristóbal. corresponden a Vieja hartwegi. Cichlasoma trimaculatum. Se realizó la actualización nomenclatural y el cambio en la posición taxonó- mica para algunas especies de los órdenes Perciformes y Acanthuriformes (Nelson et al. Rhamdia guatemalensis y Ophisternon aenigma- ticum también se encuentran en la vertiente del Pacífico (Anzueto-Calvo 2008. las cuales presentan distribución restringida y que actualmente sufren presión fuerte por las actividades humanas. González- Díaz et al. 2015) y al 13% de la ictio- fauna dulceacuícola conocida para el estado de Chiapas (Velázquez-Velázquez et al. Astatheros macracanthus. 2016). 2015. Paraneetroplus cf zonatus y Theraps nebuliferus (González-Díaz et al. Ictiobus meridionalis y Potamarius nelsoni. Anzueto-Calvo 2008. guttulata. Profundulidae (Morcillo et al. Cichlidae (McMa- han et al. Říčan et al. la 161 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Mientras que Astyanax aeneus. son Thorhychthys helleri y Priapella intermedia. así como de las familias Characidae (Abe et al. Poecilia sphenops. la integridad del hábitat en la REBISO y zonas aledañas es fundamental para la sobrevivencia y conservación de las especies incluidas en alguna categoría de protección. Xiphophorus clemenciae. González-Díaz et al. En este sentido. que desde la perspectiva biogeográfica es relevante para valorar la comple- jidad e importancia histórica de la zona. que han sido reportada por pescadores locales en especies como Eugerres mexicanus. 2016). Desde el punto de vista ictiogeográfico la REBISO. los registros de las especies Paraneetroplus bi- fasciata. 2016) y Poeciliidae (Morales-Cazan y Albert 2012). 2008). Priapella inter- media y Maskaheros regani. 2016). 2016). Ictiofauna de la Reserva de la Biosfera Selva El Ocote las artes de pesca empleadas o bien por la disminución en la abundancia de algunas especies. P. 2014). De forma preliminar se estima que los ecosistemas acuáticos de la REBISO comparten 32 especies con la cuenca del río Usumacinta. Profundulus punctatus. 2008. se rectificaron algunas determinaciones taxonómicas. son especies que estaban reportadas solo para la cuenca del río Coatzacoalcos.6% de las especies re- portada para la cuenca Grijalva (Gómez-González et al. Poeciliopsis fasciata. En la REBISO se encuentran especies compartidas con otras cuencas hidro- lógicas. respectivamente. 2008). tiene afinidad con diferen- tes cuencas hidrológicas tales como la del río Coatzacoalcos (vertiente Atlántica). Poeciliopsis pleurospilus. Mientras que Thorhychthys cf callolepis y Priapella cf olmecae (Anzueto-Calvo 2008.

2008. Lista comparativa del conocimiento de la ictiofauna de la REBISO Zonas en río Cacahuanó La Venta Especie NOM IUCN AFS 1 2 3 4 5 6 7 Dorosoma anale X X X X X X X III Dorosoma petenense X X X X X X X III Ictiobus meridionalis X X X X III Astyanax aeneus X X X X X X X I. A = amenazada. 4= Gómez-González et al. Alfonso A. III X Brycon guatemalensis X X X X X X X II. II X Astatheros macracanthus X X X X X X X I. Rocío Rodiles-Hernández y Miriam Soria-Barreto Tabla 2. 2008. V= Vulnerable. 2016. II. Pr= Protección especial. 7= Recolectas 2015. III Trichromis salvini X X X X X X X 1= González-Díaz et al. II. II X Pr Rhamdia laticauda X X X X X X X I. II Amphilophus trimaculatus X X X X X X X I. II. 2015. 162 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . II. III X Oreochromis niloticus X X X X X X X I. III Thorichthys helleri X X X X X X III X Tilapia zilli X X X X X I. II Cincelichthys pearsei X X X X X X X III Maskaheros regani X X X X X X X II X Oreochromis mossambicus X X X X X X I. III X Rhamdia guatemalensis X X X X X X X I. 2013. 2= Anzueto. 5=Anzueto-Calvo et al. CA= Casi amenazada. III Potamarius nelsoni X X X X X X III Pr V Ictalurus meridionalis X X X X X X X II. II. 2016. González-Díaz. III X Parachromis managuensis X X X X X X I. 6=Velázquez-Velázquez et al. III Petenia splendida X X X X X X X I. II. 3= Anzueto et al. III X Cathorops kailolae X X X X X X X II.

II. II X Priapella intermedia X X X X X X Pr Pseudoxiphophorus X X X X X X X bimaculatus Xiphophorus clemenciae X X X X X A A Xiphophorus hellerii X X X X X X X Ophisternon aenigmaticum X X X X X X X I. II Profundulus punctatus X X X X X X X I. 7= Recolectas 2015. CA= Casi amenazada. 2008. 2016. II X Poecilia sphenops X X X X X X X I. V= Vulnerable. II X Eugerres mexicanus X X X X X X II. 2= Anzueto. 2015. 2016. 6=Velázquez-Velázquez et al. 2008. III X Poeciliopsis fasciata X X X X X X X I. II CA Poeciliopsis hnilickai X X X X III Poeciliopsis pleurospilus X X X X X X X I. III Aplodinotus grunniens X X X X X X X III 1= González-Díaz et al. 2013. 163 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ictiofauna de la Reserva de la Biosfera Selva El Ocote Tabla 2. II Gambusia yucatana X X X X II. 5=Anzueto-Calvo et al. 4= Gómez-González et al. A = amenazada. II Poecilia mexicana X X X X X X X I. III X A V V Vieja melanura X X X X X X III Atherinella alvarezi X X X X X X III Hyporhamphus mexicanus X X X X X X III Strongylura hubbsi X X X X X X III Tlaloc labialis X X X X X X X I. Pr= Protección especial. 3= Anzueto et al. Lista comparativa del conocimiento de la ictiofauna de la REBISO (continuación) Zonas en río Cacahuanó La Venta Especie NOM IUCN AFS 1 2 3 4 5 6 7 Vieja hartwegi X X X X X X I.

Profundulidae. Rocío Rodiles-Hernández y Miriam Soria-Barreto Chiapas-Fonseca (vertiente Pacífica) y la del Alto Usumacinta (vertiente Atlántica) (Abell et al. Alfonso A. las cuales se perdieron durante el Oligoceno y finales del Pleistoceno. Las diferencias en la composición íctica entre el río La Venta y el río Cacahua­nó podría deberse a que históricamente estas cuencas se encontraban se- paradas y posteriormente se unieron como resultado de la evolución morfológica fluvial de la zona (Guilivo 1999). La pesca para autoconsumo es frecuente en la parte media y baja del río La Venta. El río La Venta muestra una clara zonación altitu- dinal en la composición de la comunidad de peces. principalmente en las poblaciones de Cintalapa y Jiquipilas. el río aumenta su ancho y profundidad. Atherinopsidae. que pueden alcanzar tallas grandes y cuyos hábitos son preferentemente de aguas pro- fundas y velocidad de corriente de moderada a lenta. extracción de material pétreo. el cíclido más grande de Mesoamérica y el bagre (Ictalurus meridionalis). 164 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . en estas partes predominan especies que habitan zonas de inundación y con velocidad de corriente de moderada a rápida. las mojarras (familia Cichlidae) entre las que destaca la tenguayaca. cerca de la cascada El Aguacero. Cichlidae. como las tilapias (Oreochromis spp. aquí es común encontrar especies de las familias Ariidae. Desafortunadamente la presencia de especies exóticas. Belonidae. Las actividades antropogénicas tienen su efecto en los afluentes de la zona alta del río La Venta. por lo que la composición actual de la ictiofauna en la reserva El Ocote es evidencia de tales conexiones hidrológicas históricas. intensa actividad ganadera y agrícola que están afectando la salud del río. donde se realizan la descarga de aguas residuales. principalmente de las familias Characidae. Petenia splen- dida. y Tilapia zilli) y la mojarra pinta (Parachromis managuensis). principalmente por la intensa activi- dad geológica y volcánica de la región (González-Díaz et al. el río empieza a encañonarse. deforestación de la ribera del río. Poeciliidae y Heptapteridae. la cual está influenciada por los factores hidrogeomorfológicos. González-Díaz. En la parte alta. Río abajo. Sciaenidae y Gerreidae. 2008). reduciendo considerablemente su velocidad. incrementando progresivamente su velocidad y turbu- lencia hacia la parte media. cuando se une con el río Negro. De tal manera que la presencia y distribución de peces nativos en los ríos de la reserva están determina- das por factores históricos y ecológicos. 2008). entre las especies más apreciadas están el macabíl (Brycon guatemalensis).

De este modo. En cambio en 2016 la temporada de lluvias ha sido más intensa. con consecuencias en la funcionalidad natural de las comunidades biológicas (Woodward et al. calidad y cantidad de agua en la re- gión. Se recomienda realizar estudios ecológicos y el monitoreo de la comunidad de peces en la REBISO y su zona de influencia. aunque la abundancia puede considerarse baja. los cambios ambientales a nivel mundial evidenciados con la frecuencia e intensidad de las épocas de lluvia y estiaje afectan a las características físicoquímicas del río y por ende tendrán un efecto en la dinámica de la comunidad de peces en la reserva. Ictiofauna de la Reserva de la Biosfera Selva El Ocote es cada vez más común en la reserva. En la presa Nezahualcóyotl existe una fuerte actividad piscícola para las especies exóticas junto con la pesca de especies nativas. trayendo como con- secuencia la disminución en el caudal del río. Este fenómeno se puso en evidencia durante las colectas de 2015 en la REBISO. A pesar de los efectos negativos que han sufrido los ambientes acuáticos de la REBISO. 165 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2010). así como en la reglamentación de la actividad pesquera en la zona. que puede afectar dramáticamente la temperatura. los ambientes acuáticos han sufrido cambios en la intensi- dad y frecuencia de las lluvias como consecuencia del cambio climático global. sobretodo en el sitio El Encajonado. A nivel mundial. año que se presentó una intensa sequía. con la finalidad de conocer la relación entre la calidad del agua y el hábitat con la estructura y funcionalidad de la comunidad de peces a lo largo de la cuenca. la abundancia de estas últimas ha disminuido paulatinamente. Es conveniente identificar especies y hábitats fun- cionalmente importantes que permitan detectar cambios en la dinámica hidroló- gica de la zona. Por último. comparada con otros ecosistemas del estado. la mayoría de las cuales son aprovechadas para autoconsumo y comercialización. sin embargo. es necesario conocer y participar en los programas de introducción y repoblación de especies exóticas con fines de cultivo. existe una importante diversidad y abundancia de especies nativas.

establecer programas de monito- reo de la calidad del agua y el hábitat. Se observan diferencias en la distribución y la estruc- tura de la comunidad de peces. La distribución de las especies está determinada por factores históricos relacionados con la evolución fluvial de la zona. la cuales algunas son de importancia comercial y para el autoconsumo de varias comunidades locales. Las familias más diversas son la Cichlidae y Poeciliidae y con dos especies endémicas cada una de ellas.6% de las es- pecies reportadas para la cuenca del río Grijalva y el 13% de la ictiofauna dulcea- cuícola de Chiapas. Ictalurus meridionalis. Al personal de la CONANP 166 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . niloticus. La REBISO es un importante reservorio de especies nativas. Alfonso A. nueve con la vertiente del Pacífico y 32 con el río Usumacinta. por las características hidrogeomorfológicas de los diferentes ecosistemas acuáticos. Rocío Rodiles-Hernández y Miriam Soria-Barreto Conclusiones Las 41 especies de peces conocidas en la REBISO representan el 45. al Sistema Nacional de Información sobre Biodiversidad de la Comi- sión Nacional para el Conocimiento y Uso de la Biodiversidad (SNIB-CONABIO) por facilitar las bases de datos del proyecto FM005. Agradecimientos Agradecemos al CONACYT por el apoyo a través del proyecto PDCPN-2013/214650- Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote. Las especies con mayor distribución son Astyanax aeneus. así como. Oreochromis mossambicus y O. Existen seis especies en categoría de riesgo. así como conocer y participar en los planes de introducción de especies exóticas. mientras que en su totalidad la REBISO comparte tres especies con la cuenca del río Coatzacoalcos. Entre el río La Venta y el río Cacahuanó solo se comparten 14 especies. González-Díaz. Vieja hartwegi. Los ríos La Venta y Cacahuanó son los ecosistemas con más registros de peces en las colecciones científicas. Es necesario dar continuidad a estudios ecológicos de la comunidad de peces. Existe una correlación estrecha entre la presencia de ciertas especies con algunas características físico-químicas del agua y el hábitat. Brycon guatemalensis.

J. Oliveira. S. Heibel. D. N. Yuriria Olvera. N. E. Mariguela.. R.J. Bryer. Gómez-González. J. M. E. BMC Evolutionary Biology 14: 152.M. R. Sabaj Pérez. Olson. G.H. H. al Proyecto FOMIX-CHIS-2007-07-77187.V. Ng.. Robertson. Ictiofauna de la Reserva de la Biosfera Selva El Ocote por las facilidades brindadas para desarrollar el trabajo en la REBISO en especial a Carlos Morales. Rocío Rodiles-Hernández agradece el financiamiento otorgado por la CONABIO para realizar los proyectos FM020 y DC001 así como. M Abell. Olson. Reis. Velázquez-Velázquez. Bogutskaya. Diversidad Ictiofaunística y sus relaciones con las varia­bles ambientales en la Reserva de la Biosfera Selva El Ocote. Sindorf. Contreras Balderas. Coad. N. Anzueto-Calvo. ­Tuxtla Gutiérrez. Tuxtla Gutiérrez.E. T. Carlos Garita y Beatriz Naranjo por su ayuda en el trabajo de campo y recolecta de peces. Freshwater Ecoregions of the World: A New Map of Biogeographic Units for Freshwater Biodiversity Conservation. M. Abraham Aragón. Allen. 2014.L. Wikramanayake. B. M. P. A. C.58: 403-414.G. México. T.T. F. Chiapas. R. Tesis de Licenciatura. R.. K. ­Quiñones y B.C. Darío Navarrete por la elaboración del mapa. Alfonso A. Chiapas. Chiapas. 2013. Thieme. W. BioScience. A SAGARPA-CONAPESCA por el permiso de pesca PPF/DGOPA249/14. Avelino.L. Kottelat. López. P. G. Anzueto-Calvo. Revenga. México.R. A. Bussing. Higgins.E. Skelton. Universidad de Ciencias y Artes de Chiapas. J. y P. Karla Leal y Roberto Escalante. 167 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . M. Chiapas. Referencias Abe. A Miguel Ángel Trujillo. Universidad de Ciencias y Artes de Chiapas. Mandrak. Petry.S. Unmack. Naseka. M. Peces de la Reserva de la Biosfera Selva El Ocote. Lundberg. E. Stiassny. Armijo. 2008. M.J. Al Dr. Foresti y C. 2008.L. ­México. ­Systematic and historical biogeography of the Bryconidae (Ostariophysi: C ­ haraciformes) suggesting a new rearrangement of its genera and an old origin of ­ esoamerican ichthyofauna. González Díaz y Rocío Rodiles Hernández agradecen al SNI-CONACYT por el reconoci- miento otorgado. Anuar Caballero. M. México.

. 1999. Eschmeyer. Badino. Bernabei T. J. 1976.E. Belotti A. Velázquez-Velázquez y A.. Guilivo I. González-Díaz. Gómez-González. References [online]. El ambiente físico: Geografía y Geología. Gobierno del Es- tado de Chiapas.A.E. S.M. N.E. Chiapas.L. México. Geografía de un Estado Mexicano. Gobierno del estado de Chiapas. S.asp [acceso 30 May 2016]. Instituto Nacional de Estadística. A. E. W. Catalog of Fishes: ­Genera. van der Laan (eds). Helbig. Pri­ mer registro de Xiphophorus clemenciae (Cyprinodontiformes: Poeciliidae) en la cuenca del río Grijalva. Velázquez-Velázquez. Aguascalientes. Peces de la Reserva de la Biosfera Selva El Ocote y presa Nezahualcóyotl (­Malpaso) Chiapas. Revista Mexicana de Biodiversidad 87: 972–979. M.A. y R.. R. Fishes of La Venta River in Chiapas... E.. H. McCormick.S. en G. M. Giulivo (edi- tores). Rodiles-­ Hernández. 168 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . F.. Velázquez-Velázquez y M. Zootaxa 1685:47-54. México. Walsh. La Venta. Programa de Manejo. 2000.F. Rocío Rodiles-Hernández y Miriam Soria-Barreto Anzueto-Calvo. J. Lyons. Domenici D.J. Fishes of the Grijalva River basin of Mexico and Guatemala. Comisión Nacional de Áreas Naturales Protegidas-Secretaría de Medio Ambiente y Recursos Naturales. D.N. Comisión Nacional de Áreas Naturales Protegidas. Instituto Nacional de Estadística y Geografía. Check List 11: 1726. E. Tuxtla Gutiérrez. Consejo Estatal para las Culturas y las Artes de Chiapas. Páginas 19-30. Anzueto-Calvo y M. México. Gómez-González. Edición 1995.org/research/ichthyology/catalog/fishcatmain. Fricke. México. 2015. González-Díaz. Hendrickson. México. 1995.E. Species. Tipografia Turra. 2016. Geografía e In- formática. Alfonso A. e I. Reserva de la Biosfera Selva El Ocote. México. Burkhead. Chiapas. México. Revista Mexicana de Biodiversidad 85: 975–978. Anuario Estadístico del Estado de Oaxaca. 2016. Gómez-González. De Vivo A.M. Anzueto-Calvo. Río La Venta tesoro de Chiapas. A. Jelks. J. Disponible en http://researcharchive. E. Italia. R. Contreras-Balderas. Maza- Cruz. Díaz-Pardo.. Nelson. A. Quiñones. Mandrak. calacademy. C. N. 2008. 2014.M. Velázquez-Martínez y R.

Ictiofauna de la Reserva de la Biosfera Selva El Ocote

S.P. P ­ latania, B.A. Porter, C.B. Renaud, J.J. Schmitter-Soto, E.B. Taylor y
M.L. Warren Jr. 2008. Conservation status of imperiled North American
­freshwater and diadromous fishes. Fisheries 33: 372-407.
McMahan, C.D., W.A. Matamoros, K.R. Piller y P. Chakrabarty. 2015. Taxonomy
and systematics of the herichthyins (Cichlidae: Tribe Heroini), with the
­description of eight new Middle American genera. Zootaxa 3999: 211-234.
Morales-Cazan, A. y J.S. Albert. 2012. Monophyly of Heterandriini (Teleostei:
­Poeciliidae) revisited: a critical review of the data. Neotropical Ichthyology
10: 19-44.
Morcillo, F., C.P. Ornelas-García, L. Alcaraz, W.A. Matamoros e I. Doadrio 2016.
Phylogenetic relationships and evolutionary history of the Mesoameri-
can endemic freshwater fish family Profundulidae (Cyprinodontiformes:
A ­ ctinopterygii). Molecular Phylogenetics and Evolution 94: 242-251.
Müllerried, F.K.G. 1957. Geología de Chiapas. Gobierno del Estado de Chiapas,
Chiapas.
Nelson, J.S., T.C. Grande y M.V.H. Wilson. 2016. Fishes of the world. John Wiley
& Sons, Inc. New York.
Norma Oficial Mexicana. 2010. NOM-059-SEMARNAT-2010 Protección ambien-
tal especies nativas de México de flora y fauna silvestres-Categorías de riesgo
y especificaciones para su inclusión, exclusión o cambio-Lista de especies
en riesgo. Diario Oficial de la Federación. 30 de diciembre de 2010, México.
Říčan, O., L. Piálek, K. Dragová y J. Novák. 2016. Diversity and evolution of
the Middle American cichlid fishes (Teleostei: Cichlidae) with revised
c­ lassification. Vertebrate Zoology 66: 1-102.
Rodiles Hernández, R. y A.A. González Díaz. 2008. Computarización de la Colec­
ción de Peces de Chiapas (ECO-SC).El Colegio de la Frontera Sur Uni-
dad San Cristóbal de las Casas. Informe final SNIB-CONABIO proyecto
DC001. México D. F.
Rodiles-Hernández, R., González-Díaz, A.A. y E. Pérez-Mora. 2011. Inventario
ictiofaunístico en tres regiones hidrológicas prioritarias de la Cuenca del
Grijalva-Usumacinta en el Estado de Chiapas. El Colegio de la Frontera Sur
(ECOSUR-Unidad San Cristóbal). Informe final SNIB-CONABIO proyecto
No. FM020. México D. F.

169
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Alfonso A. González-Díaz, Rocío Rodiles-Hernández y Miriam Soria-Barreto

Unión Internacional para la Conservación de la Naturaleza. 2015. UICN Red List
of Threatened Species. Version 2015.4. Disponible en http://www.UIC-
Nredlist.org/ [acceso 10 May 2016].
Velázquez Velázquez, E. 2011. Inventario de peces y crustáceos decápodos de la
Reserva de la Biosfera Selva El Ocote y Presa Nezahualcóyotl (Malpaso),
Chiapas México. Universidad de Ciencias y Artes de Chiapas. Escuela de
Biología. Informe final SNIB-CONABIO proyecto FM005. México D. F.
Velázquez-Velázquez, E., J.M. López-Vila, A.E. Gómez-González, E.I. Romero-
Berny, J.L. Lievano-Trujillo y W.A. Matamoros. 2016. Checklist of the
­continental fishes of the state of Chiapas, Mexico, and their distribution.
ZooKeys 632: 99–120.
Woodward, G., D.M. Perkins y L.E. Brown. 2010. Climate change and freshwater
ecosystems: impacts across multiple levels of organization. Phil. Trans. R.
Soc. B 365: 2093–2106.

170
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Diversidad de insectos colectados en cuatro localidades
de la Reserva de la Biosfera Selva el Ocote

Benigno Gómez,1 Carmen Pozo,2 León Felipe de la Mora-Estrada,1
Martín R. Domínguez,1 M. Edivaldo Rodríguez1 y Lorena Ruíz-Montoya1

1
Departamento de Conservación de la Biodiversidad,
El Colegio de la Frontera Sur. Unidad San Cristóbal
2
Departamento de Conservación de la Biodiversidad,
El Colegio de la Frontera Sur. Unidad Chetumal.

Correspondencia: Lorena Ruiz Montoya. 1Departamento de Conservación de la Biodiversidad, El
Colegio de la Frontera Sur. Unidad San Cristóbal. Carretera panamericana y Periférico Sur s/n,
C.P. 29290 San Cristóbal de Las Casas, Chiapas, México. E-mail: lruiz@ecosur.mx.

Resumen

Se presenta la lista de especies de tres grupos de insectos: mariposas (Papilionoi-
dea), escarabajos estercoleros o rodacacas (Scarabaeinae) y cucarachas (Blattodea)
colectados en sitios de la zona núcleo y de amortiguamiento aledañas a cuatro
comunidades de la Reserva de la Biosfera Selva El Ocote (REBISO). Se analizó
la altitud como determinante potencial de la diversidad de especies de los tres
grupos de insectos en la REBISO. Se registró un total de 174 especies, de las cuales
102 corresponden a mariposas, 34 a escarabajos y 38 a cucarachas. Se registró por
vez primera 71 especies para la REBISO, 10 para Chiapas y una para México. En
la comunidad de San Joaquín el Progreso se registró la mayor riqueza de especies,
mientras que en Veinte Casas se observó la menor. La mayor similitud faunística
fue entre Nuevo San Juan Chamula y San Joaquín el Progreso para las mariposas,
mientras que el recambio de especies fue mayor entre Emilio Rabasa y Veinte Casas

171
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Benigno Gómez, Carmen Pozo, León Felipe de la Mora-Estrada, Martín R. Domínguez, M. Edivaldo Rodríguez y Lorena Ruíz-Montoya

para escarabajos y cucarachas. No se estableció relación alguna de las mariposas
porque con el esfuerzo de colecta se submuestreo la diversidad de este grupo. Se
encontró una relación altamente significativa entre la diversidad escarabajos la
altitud y las localidades. En el caso de las cucarachas no existió ninguna correlación
entre su diversidad y las variables estudiadas. Los escarabajos son el grupo posible-
mente más vulnerable al incremento de la temperatura en tanto que su diversidad
se relaciona negativamente con la altitud.

Palabras clave: mariposas, escarabajos, cucarachas, variación altitudinal.

Introducción

Los Hexapoda son el grupo dominante en la Tierra con una diversidad de 1,023,559
especies descritas (Giribet y Edgecombe 2013, Gullan y Cranston 2014). Se esti-
ma, con base en datos moleculares y paleontológicos, que el origen del grupo se
remonta al Cámbrico y su mayor diversificación fue probablemente en el Silúrico-
Devónico (± 420 millones de años), en estrecha correlación con el origen de las
plantas vasculares (Grimaldi y Engel 2005, Kenrick et al. 2012).
Entre los hexápodos se encuentra el grupo de los insectos, que constituye
alrededor de 75% de la fauna registrada en el mundo (Loxdale 2016). Los insectos
comparten con las otras Clases de Hexapoda, las características de seis patas y la
segmentación del cuerpo en tres regiones o tagmas (cabeza, tórax y abdomen);
sin embargo, se diferencian por su enorme diversidad morfológica, fisiológica,
ecológica y etológica. Los insectos colonizan y generalmente dominan los dife-
rentes ecosistemas, tanto terrestres como acuáticos (agua dulce) y aún se les pue-
de encontrar en ambientes marinos cerca de los límites continentales (Gullan y
Cranston 2014).
La diversidad en insectos está relacionada con la gama de funciones que estos
desempeñan en el ecosistema, teniendo un papel importante en la reproducción
de las plantas a través de la polinización y la dispersión de semillas; intervienen en
el reciclaje de nutrimentos al descomponer la hojarasca y la madera, eliminan la

172
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote

carroña y estiércol, así como facilitan la dispersión de hongos. Asimismo, tienen en
ocasiones una posición fundamental en las cadenas y redes alimenticias (tanto en
número como en biomasa). Se les atribuye que son determinantes de la estructura
de la comunidad animal a través de la transmisión de enfermedades, la depreda-
ción y el parasitismo; así como en la conformación de las comunidades vegetales
(Garrido et al. 2012). Estas funciones ecológicas tienen un efecto en la especie hu-
mana, ya que proporcionan una serie de servicios ecosistémicos fundamentales y
también pueden ser competidores de los recursos naturales (Triplehorn y Johnson
2005, Kremen et al. 2007, van Huis et al. 2014, Gullan y Cranston 2014).
Los insectos y sus potenciales beneficios se han visto amenazados por di-
versos factores tanto naturales como antropogénicos, que en conjunto modifican
la estructura poblacional o de las comunidades de estos artrópodos, con lo que
frecuentemente las especies quedan en riesgo de extinción (Menéndez 2007). Se
considera que incluso se extinguen especies sin que se hayan identificado y mu-
cho menos se conoce su función en el ecosistema ni los beneficios que la especie
humana pueda obtener de ellas (Losey y Vaughan 2008).
La erosión de la diversidad se ha magnificado en los últimos años con el ad-
venimiento del cambio climático global (CCG) (Wilson y Maclean 2011). Muchos
autores consideran que este fenómeno es la principal amenaza para la biodiversi-
dad; los insectos, son uno de los grupos taxonómicos en los que se ha podido de-
mostrar los efectos del CCG sobre la biodiversidad (Parmesan et al. 1999, Warren
et al. 2001, Thomas et al. 2004, Menéndez, 2007). Su desarrollo depende directa-
mente del clima, así como su reproducción y supervivencia, por lo que cambios en
parámetros climáticos alteran en poco tiempo la composición de sus comunidades
(Menéndez 2007, Vanhanen et al. 2007).
Los insectos son considerados especies clave debido a que la pérdida de
especies implica eliminar sus funciones ecológicas, lo que podría colapsar al eco-
sistema (Nuñez y Simberloff 2005, Gullan y Cranston 2014). Esta característica
intrínseca es aprovechada para anticipar el efecto del cambio climático en la diver-
sidad o en los servicios ecosistémicos, no obstante, son pocos los grupos de insec-
tos de los que se conoce relativamente bien su respuesta a los cambios del ambiente,
por ejemplo mariposas, polillas, libélulas, áfidos, entre otros; y se desconoce si
éstos grupos bien estudiados pueden ser buenos predictores de la respuesta de los

173
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Benigno Gómez, Carmen Pozo, León Felipe de la Mora-Estrada, Martín R. Domínguez, M. Edivaldo Rodríguez y Lorena Ruíz-Montoya

grupos incipientemente conocidos, por lo que es necesario generar información
de diferentes grupos de insectos y con ello tener una mejor comprensión de los
impactos del CCG y su repercusión en la biodiversidad (Menéndez 2007).
Pese a que los insectos pueden constituir una buena parte de un ecosistema,
su diversidad e importancia es escasamente conocida particularmente en las Áreas
Naturales Protegidas (ANP) de México. La REBISO (Reserva de la Biosfera Selva
El Ocote), no es la excepción, Gómez (2013a) compiló un total de 563 especies para
la zona registrados en diversas publicaciones (por ejemplo Desutter-Grandcolas
(1993), Gómez-Nucamendi et al. 1999; ver Apéndice 1) y de colectas personales.
La lista se compone de ocho órdenes, 31 familias y 287 géneros, para Lepidoptera
89 géneros y 173 especies y para Coleoptera 181 géneros y 363 especies.
Para contribuir al conocimiento de la diversidad de insectos en la REBISO
en este estudio presentamos los resultados de un muestreo de tres grupos de insec-
tos: mariposas (Papilionoidea), escarabajos estercoleros o rodacacas (Scarabaei-
nae), y cucarachas (Blattodea), realizado cada dos meses durante un año (2014-
2015). Los dos primeros son ampliamente conocidos en términos taxonómicos
por lo que son útiles para explorar los patrones de diversidad de insectos en áreas
escasamente estudiadas como la REBISO. Se espera que esta información sea útil
para la valoración de diversidad biológica que alberga la REBISO y para el diseño
de las estrategias de conservación y manejo de la misma.

Materiales y métodos

Área de estudio.
La Reserva de la Biosfera Selva El Ocote, se localiza entre los municipios de Oco-
zocoautla de Espinoza, Cintalapa de Figueroa, Tecpatán de Mezcalapa y Jiquipi-
las, situada entre los 16°45’42” y 17°09’00” latitud Norte y 93°54’19” y 93°21’20”
longitud Oeste, abarcando una superficie de 101,288 ha. Los subtipos climáticos
que predominan son el cálido húmedo con lluvias abundantes en verano Am (f)
y el semicálido subhúmedo con lluvias en verano A(C) W2. El paisaje predomi-
nante corresponde a montañas en el margen norte con dos serranías principales
(Monterrey y Veinte Casas), compuestas por calizas estratificadas e intensamente

174
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote

fracturadas, con una altitud variable entre los 800 y 1,500 msnm, dispuestas con
una orientación con dirección este – oeste. La precipitación media anual varía des-
de 1,500 a 2,500 mm, con una temperatura media anual mayor a 22°C y la media
mensual superior a los 18°C (CONANP 2001). El área cuenta con cuatro tipos de
suelo (leptosol, acrisol, feozem y regosol) y se encuentran representados diez tipos
de vegetación: selva alta perennifolia, selva alta o mediana subperennifolia, selva
mediana o baja perennifolia, selva baja caducifolia, selva baja espinosa caducifolia,
sabana, bosque de pino-encino, encinares, bosque caducifolio y vegetación secun-
daria (sensu Breedlove 1981).

Muestreo de insectos
El estudio se realizó en cuatro comunidades del municipio de Ocozocoutla de
Espinoza: Emilio Rabasa, Nuevo San Juan Chamula, San Joaquín el Progreso y
Veinte Casas, todas situadas en el polígono de la REBISO. Estas comunidades se
eligieron por presentar áreas con selva mediana subperennifolia conservada y ve-
getación alterada; así como, por la aceptación del proyecto por las comunidades
humanas ahí asentadas. Las comunidades seleccionadas se encuentran en zona
de amortiguamiento y limitan con la zona núcleo de la REBISO. Al interior de
cada localidad se ubicaron tres sitios de muestreo que difieren de forma gene-
ral en el estado sucesional de la vegetación, temperatura y altitud (Tabla 1). En
Emilio Rabasa y Veinte Casas el muestreo se hizo en ambientes de vegetación de
selva mediana subperennifolia y en Nuevo San Juan Chamula y en San Joaquín
el Progreso, la vegetación es del mismo tipo, pero secundaria (Tabla 1). La altitud
de cada punto de muestreo sobre el transecto se registró con un GPS (eTrex H).
En cada transecto se colectaron mariposas, escarabajos y cucarachas con métodos
propios para cada grupo.
Las colectas se llevaron a cabo de noviembre de 2014 a noviembre de 2015
cada dos meses. En cada localidad se trazaron tres transectos o estratos altitudina-
les (Tabla 1), y en cada uno se ubicaron siete sitios de trampeo, redeo y rastreo de
los insectos de interés. Se procuró obtener una diferencia de 100 m entre transectos
sin embargo por lo accidentado del terreno la diferencia entre transectos osciló
entre los 10 y 100 m.

175
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Benigno Gómez, Carmen Pozo, León Felipe de la Mora-Estrada, Martín R. Domínguez, M. Edivaldo Rodríguez y Lorena Ruíz-Montoya

Tabla 1. Características ambientales y coordenadas geográficas (UTM) de los estratos
altitudinales de colecta de insectos en la Reserva de la Biosfera Selva EL Ocote

Precipitación
Temperatura
media anual

media anual
Vegetación
Longitud O
altitudinal
Localidad

Latitud N
Estrato

Altitud

Clima
Emilio
1 837.1 15Q0434733 1869975 SMS 21.8 1500-2000 Am(f)
Rabasa
15Q0436544 1871722

2 841.2 15Q0434152 1870796

15Q0434170 1870788

3 918.6 15Q0433717 1871154

15Q0433790 1871150

Nuevo
San Juan 1 910 15Q0438721 1875492 SSMS 20.2 1200-1500 Am(f)
Chamula
15Q0438840 1875541

2 948.5 15Q0438840 1875541

15Q0439248 1875535

3 1006.6 15Q0439687 1875702

15Q0439772 1875832

San
1 942.3 15Q0448816 1870007 SSMS 20.9 1300 Am(f)
Joaquín
15Q0448886 1870111

2 951 15Q0451242 1870242    

15Q0451343 1870370

3 993.75 15Q0451401 1870513

15Q0451596 1870554

Veinte
1 927.5 15Q0439772 1875832 SMS 22.7 1500-2000 Am
Casas
15Q0441978 1877365

2 891.1578947 15Q0442275 1877503

15Q0442305 1877477
3 1004.428571 15Q0442433 1877499

15Q0442511 1877527

La altitud es el promedio de los puntos de trampeo. SMS, Selva mediana Subperennifolia; SSMS,
Selva mediana subperennifolia secundaria.

176
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote

Colecta, procesamiento curatorial y taxonómico de ejemplares

Mariposas. En cada piso altitudinal, se colocaron siete trampas tipo Van Someren-
Rydon (Rydon 1964) a una altura aproximada de 1.5 m por encima del suelo a
lo largo de un transecto. Se hizo el registro de la ubicación geográfica de cada
trampa con un GPS eTrex H en UTM (Universal Transverse Mercator) (altitud,
latitud y longitud). Cada trampa fue cebada con una mezcla de plátano macho,
piña y cerveza, fermentada durante 48 h (Andrade et al. 2013). Las trampas estu-
vieron expuestas 72 horas y cada 24 horas se revisaron y colectaron los individuos
capturados. Cada localidad fue visitada en dos ocasiones durante tres días, lo que
equivale a un esfuerzo de muestreo de seis días por localidad (26 días de esfuerzo/
REBISO), a excepción de Emilio Rabasa, que se tuvo oportunidad de dos días más
de muestreo. También se realizaron capturas con red aérea durante 30 minutos
por transecto y se tomó la trampa más cercana como referencia de la ubicación
geográfica.
El material colectado se sacrificó por presión digital en el tórax (Andrade et
al. 2013), para posteriormente colocarlas en bolsas de papel glassine con las anota-
ciones necesarias para su registro en bases de datos. La determinación taxonómica
se realizó en el Museo de Zoología de ECOSUR-Chetumal. La lista de especies de
Papilionoidea y la nomenclatura siguen las obras de Llorente et al. (2006) y Warren
(2000, 2002).

Escarabajos. Se capturaron ejemplares correspondientes a la subfamilia Scara-
baeinae (Coleoptera: Scarabaeidae), los cuales son removedores y consumidores
principalmente de excrementos (coprófagos) y cadáveres (necrófagos). Para su
recolección, se instalaron por cada transecto, 15 trampas de caída modificadas del
tipo CSS (cebo suspendido en la superficie) (Lobo et al. 1988). Éstas, fueron divi-
didas en tres lotes de cinco trampas y cada grupo fue cebado con: (a) excremento
vacuno, (b) calamar en descomposición, y (c) fermento de fruta (igual al ocupado
para mariposas). Se colocó al interior de cada trampa, 100 ml de etilenglicol (anti-
congelante comercial para vehículos), lo que permitió sacrificar a los insectos y al
mismo tiempo preservarlos mientras se encontraron activas las unidades de captu-
ra (Márquez-Luna 2005). Con el fin de evitar la interferencia olfativa de los cebos

177
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Benigno Gómez, Carmen Pozo, León Felipe de la Mora-Estrada, Martín R. Domínguez, M. Edivaldo Rodríguez y Lorena Ruíz-Montoya

empleados se siguió la propuesta de Larsen y Forsyth (2005) y se ­distanciaron las
trampas 50 metros entre sí.
Los ejemplares capturados se transfirieron a frascos plásticos con alcohol
al 80%, con ellos se ingresaron posteriormente los datos de colecta necesarios en
bases de datos. Para la determinación taxonómica, se procedió a la separación por
morfoespecie. Se tomaron dos ejemplares de cada morfoespecies para montarlos
en alfileres entomológicos (Gómez y Jones 2002) para proceder a la determinación
a nivel supra-genérico de acuerdo con las claves propuestas por Delgado et al.
(2000) y Vaz de Mello et al. (2011). Posteriormente, para la identificación a nivel
específico, se emplearon claves de acuerdo al grupo a determinar (e.g. Howden y
Cartwright 1963, Edmonds 1994, Rivera-Cervantes y Halffter 1999, Kohlmann
1997).

Cucarachas. Las colectas de ejemplares correspondieron al orden Blattodea, los
cuales son removedores y consumidores de materia orgánica, principalmente de
restos de frutos y detritos. Para la recolección de las cucarachas se empleó la misma
técnica que la de escarabajos, y de forma complementaria se utilizó una trampa
de luz y colecta manual de individuos adultos, según lo sugerido por Sormani-
Hernández (2007). La trampa de luz se colocó por una noche en cada localidad, en
las primeras horas de la noche (20:00 hrs) y hasta las 23:00 hrs, que corresponden a
las horas de mayor actividad para cucarachas (Grandcolas y Pellens 2012). La co-
lecta manual se realizó siguiendo los transectos de cada piso altitudinal, buscando
en el interior de troncos caídos, bajo cortezas, en hojas, flores, bromelias caídas
y en la hojarasca (Sormani-Hernández 2007), empleando un total de seis horas/
hombre por transecto.
Curatorialmente se procedió de la misma forma que con los escarabajos.
Los ejemplares fueron identificados de acuerdo a claves taxonómicas a nivel ge-
nérico y específico (e.g. Rehn y Morgan 1910, Gurney 1939, Fisk y Wolda 1979,
Sormani-Hernández 2007).
Todo el material biológico estudiado quedó depositado en las siguientes
colecciones científicas: Colección Lepidopterológica de ECOSUR Chetumal
(ECO-CH-L), Colección entomológica de ECOSUR San Cristóbal (ECO-SC-E),
y Colección entomológica de ECOSUR Tapachula (ECO-TA-E).

178
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote

Análisis
Para cada taxón se obtuvo la riqueza, abundancia, curvas de acumulación, y los
estimadores de diversidad de Hill como estimadores de diversidad para cada lo-
calidad y para la REBISO por grupo taxonómico.

Riqueza. La riqueza de especies se definió como el número de especies registradas
en una localidad, lo que representa el inventario faunístico (Favila y Halffter 199 7,
Gotelli y Colwell 2001, Jiménez-Valverde y Hortal 2003, Rocchini y Neteler 2012).

Abundancia. Fue considerada como la cantidad de individuos por especie por
localidad y para REBISO. Para cada grupo taxonómico se construyeron curvas
logarítmicas de rango abundancia por localidad y REBISO, con lo que fue posible
conocer el patrón de la distribución de la abundancia por localidad y al mismo
tiempo la riqueza de cada localidad que se registró con el esfuerzo de muestreo
aplicado. En la gráfica se colocó el nombre de las cinco especies más abundantes.

Curvas de acumulación de especies. Una de las mayores complicaciones en la es-
timación de la riqueza de especies de un lugar en un tiempo dado es la potencial
dependencia de las muestras, sensibilidad del estimador al número de individuos
muestreados, así como al número, tamaño y arreglo espacial de las muestras (Go-
telli y Colwell 2001, Magurran 2004), por lo que se procedió a realizar curvas
de rarefacción (interpolación/extrapolación) con base en el esfuerzo de muestreo
(Hsieh et al. 2013, Chao et al. 2014). Algunos autores sugieren que el esfuerzo sea
expresado preferentemente en unidades estándar, por ejemplo, unidad de mues-
tra (esfuerzo trampa/horas) por su aplicación en el diseño de inventarios, ya que,
si éste solo fuera registrado como el número de individuos, sería muy difícil la
planificación y la estimación del costo económico y de esfuerzo de dichos inven-
tarios (Moreno y Halffter 2001, Kraken-Castañeda y Cóbar-Carranza 2011). Por
lo anterior, se procedió a construir curvas de acumulación de especies utilizan-
do el programa Estimates 8.2 (Colwell 2006), siguiendo las recomendaciones de
Jiménez-Valverde y Hortal (2003), de aleatorizar los datos 100 veces para reducir
la variación en la forma de las curvas debido al orden en que se consideran las
diferentes muestras y por los sesgos temporales o espaciales en la distribución del

179
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Benigno Gómez, Carmen Pozo, León Felipe de la Mora-Estrada, Martín R. Domínguez, M. Edivaldo Rodríguez y Lorena Ruíz-Montoya

esfuerzo de muestreo en cada sitio (Colwell y Coddington 1994, Gotelli y Colwell
2001). Posteriormente los datos fueron ajustados al modelo del estimador Chao
1 como una forma de valorar la precisión del registro de la diversidad por grupos
taxonómico para la REBISO y para las localidades.
Debido a la incorporación de diferentes sistemas de captura de los insec-
tos estudiados, fue necesario diferenciar el esfuerzo de colecta para cada grupo
(Jiménez-Valverde y Hortal, 2003). Por lo tanto, para el caso de las mariposas, se
definió el día como la unidad de esfuerzo de muestreo, y que representa la riqueza
de especies registrada a través de la activación de siete trampas y la colecta por
captura con red aérea durante 30 minutos por día. Para los escarabajos y cucara-
chas, se definió como la activación de 45 trampas por 48 horas y en el caso de las
cucarachas, se incluyó la colecta manual en troncos caídos, flores, cortezas, hojas,
hojarasca y bromelias caídas, empleando seis horas/hombre por transecto. Poste-
riormente se anexaron los datos de las colectas mediante trampas de luz, pues al
no poder precisar la procedencia de los individuos no se contemplaron para las
curvas de acumulación.

Diversidad con base en los números de Hill. Actualmente hay un consenso en la
comunidad académica de ecólogos de utilizar números equivalentes para descri-
bir la diversidad alfa (dentro de comunidades), beta (entre comunidades) y gama
(regional), y una forma es la transformación de estimadores de diversidad que
resultan en lo que se conocen como números de Hill: 0D, 1D, 2D en donde el súper
índice indica el orden de diversidad con base en la presencia y abundancia de la
especies; y D es una estimación de diversidad en unidades de riqueza (número
de especies) (Chao et al. 2012). 0D es la riqueza de especies representadas con al
menos un individuo, 1D es un estimador que pondera las especies con abundancia
baja o media, y es equivalente al exponencial del índice de entropia de Shannon;
2
D es la diversidad cuando se ponderan las especies abundantes y es equiparable
al índice de concentración de Simpson (Jost 2006, Chao et al. 2014). Las curvas de
acumulación de la estimación de diversidad con números de Hill e integrando la
rarefacción (interpolación) y extrapolación con un esfuerzo de muestreo estanda-
rizados (por ejemplo, número de individuos) facilita la comparación de datos de

180
Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote

Poste- riormente se realizó un ANOVA para mostrar la diferencia en la riqueza por sitio sobre una matriz de distancias euclidianas con 500 permutaciones y una prueba de Tukey HSD con 95% de confianza posterior al ANOVA (Oksanen et al. 2011).0 y el máximo número de co- munidades que se comparan. 181 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .0. Ripley et al. Con el fin de explorar las posibles rela- ciones entre la diversidad de cada sitio y la altitud de los sitios de muestreo como variable explicativa. Oksanen et al.3. La diversidad beta mide las diferencias entre las especies de dos puntos o comunidades (Halffter y Moreno 2005). 2011.0. sus correlaciones son llamadas correlaciones canónicas. las mismas que miden la fuerza de asociación entre los dos grupos de variables (Ter-Braak 2014). el cual permitió identificar y cuantificar las asociaciones lineales entre dos grupos de variables (diversidad y altitud).0) con las rutinas BiodiversityR. Diversidad beta (β). Vegan y MASS (Kindt 2015. Moreno et al. La diversidad β toma valores entre 1. La idea fue determinar el par de combinaciones lineales que tienen la correlación más alta. para reconocer el grado en el que las comunidades se parecen. y así sucesivamente. Los efectos significativos de la altitud se ponderaron mediante la correlación con respecto a la riqueza de especies. 2015). luego el segundo par cuya correlación es menor o igual a la primera. cuyo valor indica el número hipotético de comunidades a partir del conjunto de datos disponibles. se recurrió al Análisis de Componentes Canónicos (ACC). 2015. La diversidad β entre pa- res de comunidades se obtuvo con base en las estimaciones de 0D. una β = 1 indica una sola comunidad. 2015). valores de β > 1 indica comunidades distintas y la diferencia de 1-β puede interpretarse como la proporción de especies en recambio constante (Jost et al. Relación entre la diversidad y la altitud. Todos los análisis se realizaron en el programa R (v. Chao et al. en el caso de cuatro comunidades el máximo valor es 4. 2014). 1D y 2D. Este análisis se acompaño de un análisis de similitud como el índice de Morisita-Horn. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote diversidad (Jost 2006. A estos pares de combinaciones lineales se les denomina variables canónicas. Este análisis estadístico multivariante se en- foca en la correlación entre combinaciones lineales pertenecientes a los grupos de variables. por consiguiente.

Benigno Gómez. Carmen Pozo. León Felipe de la Mora-Estrada. con 72 géneros y 102 especies. Edivaldo Rodríguez y Lorena Ruíz-Montoya Resultados Riqueza y abundancia Se capturó un total de 174 especies representadas por 2313 individuos de tres órdenes de insectos colectados (Tabla 2). Riqueza y abundancia de insectos en la Reserva de la Biosfera Selva El Ocote (REBISO) Taxón Riqueza Abundancia (Número de individuos) (Número de especies) Mariposas 102 309 (Lepidoptera) Escarabajos 34 1733 (Scarabaeinae) Cucarachas 38 271 (Blattodea) TOTAL 174 2313 Figura 1a. 2011). Curva de rango/abundancia (log10) de la abundancia relativa para mariposas (Papilionoidea) en la Reserva de la Biosfera Selva El Ocote 182 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . En el caso de las mariposas se capturaron un total de 309 individuos que pertenecen a seis de las siete familias de Papilionoidea (sensu van Nieukerken et al. Nymphalidae tuvo el mayor número de géneros y especies (Apéndice 2). Martín R. De las familias registradas. Se encontraron 63 registros nuevos de especies y 37 géneros más para la REBISO y por primera vez se reporta la Tabla 2. Domínguez. M.

Canthon vazquezae (Martínez. las especies más abundantes de mariposas colectadas fueron Hermeuptychia hermes (Fabricius. Ectobiidae fue la que presentó el mayor número de géneros (13) y especies (29). 1874).1780). 13 géneros y 34 especies (Apéndice 3). 1938). Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote familia Hesperiidae (con 10 géneros y 12 especies). Ateuchini fue la tribu con mayor número de géneros (cuatro). 1964). Se registraron 271 individuos de cucarachas (Blattodea) en la REBISO (38 estadios inmaduros y 233 adultos). 1981) y Eurysternus caribaeus (Herbst. De las seis tribus registradas. la curva de rango/abundancia indicó que. 1793). Heliconius charitonia vazquezae Comstock & Brown. Por último. Se obtuvieron nueve registros nuevos de Scarabaeinos para la REBISO. Halffter & Halffter. Curva de rango/abundancia (log10) de la abundancia relativa para escarabajos (Scarabaeinae) en la Reserva de la Biosfera Selva El Ocote 183 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . mientras que Corydiidae solo presentó una especie. 1950 e Yphthimoides renata (Stoll. 1789) (Figura 1b). Según la curvas de rango/abun- dancia (Figura 1a). los cuales se encuentran distribuidos en 38 es- pecies pertenecientes a cuatro familias (Apéndice 4). Deltochilum mexicanum (Burmeister. las especies más abundantes correspondie- ron a Deltochilum pseudoparile (Paulian. Onthophagus fue el género con mayor riqueza (siete especies). Según la curva de rango/abundancia. Anartia fatima fatima (Fabricius. Manataria hercyna maculata (Hopffer. 1848). Onthopha- gus maya (Zunino. 1775). mientras que para Eurysternini y Onthopha- gini se registró sólo un género. para Figura 1b. distribuidos en seis tribus. Se obtuvieron 1733 ejemplares de escarabajos pertenecientes a la subfamilia Scarabaeinae (Coleoptera: Scarabaeidae).

Curva de rango/abundancia (log10) de la abundancia relativa para cucarachas (Blattodea) en la Reserva de la Biosfera Selva El Ocote Figura 2a. mientras que dos son peridomiciliarias (Peripla- 184 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Anaplecta fallax (Saussure. 1868). Benigno Gómez. las especies más abundantes corresponden a Xesto- blatta sp 4. 1862) y Panchlora azteca (Saussure. M.8%) estan asociadas únicamente a ambiente silvestre. León Felipe de la Mora-Estrada. Carmen Pozo. Curva de acumulación de especies observadas (línea continua) y esperadas con base en el modelo de Chao 1 (línea discontinua) de mariposas en la Reserva de la Biosfera El Ocote (REBISO) las cucarachas de la REBISO. Domínguez. 1862) (Figura 1c). Anaplecta mexicana (Saussure. La gran mayoría de las especies encontradas (94. Edivaldo Rodríguez y Lorena Ruíz-Montoya Figura 1c. 1862). Martín R. Ischnoptera rufa occidentalis (Saussure.

Curva de acumulación de especies observadas (línea continua) y esperadas con base en el modelo de Chao 1 (línea discontinua) de escarabajos en la Reserva de la Biosfera El Ocote (REBISO) Figura 2c. brunea (Burmeister. cinco ya habían sido registradas para Chiapas. 1838). uno se reporta por primera vez para México (Anaplecta hemiscotia (Hebard. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Figura 2b. 1920). Curva de acumulación de especies observadas (línea continua) y esperadas con base en el modelo de Chao 1 (línea discontinua) de cucarachas en la Reserva de la Biosfera El Ocote (REBISO) neta australasiae (Fabricius. 1775) y P. El resto del material fue determinado a nivel de género. y a éste 185 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Se ­obtuvieron 15 nuevos registros de especies para la REBISO. mientras que 10 se consideran nuevos registros estata- les y de ellos. de éstas.

León Felipe de la Mora-Estrada. Carmen Pozo. Edivaldo Rodríguez y Lorena Ruíz-Montoya Figura 3a. 186 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Reserva de la Biosfera Selva El Ocote. Curvas de acumulación de especies de mariposas registradas en Nuevo San Juan Chamula. Domínguez. Martín R. mis- mos que representan registros nuevos para Chiapas y uno de ellos para México (Apéndice 4). La línea punteada indica especies observadas y la línea continua las estimadas Figura 3b. Curvas de acumulación de especies de mariposas registradas en Emilio Rabasa. La línea punteada indica especies observadas y la línea continua las estimadas nivel taxonómico se documentan cuatro registros nuevos para la REBISO. Reserva de la Biosfera Selva El Ocote. Benigno Gómez. M.

Curvas de acumulación de especies de mariposas registradas en Veinte Casas. ya que la gráfica obtenida no permite el ajuste a algún modelo asintótico. lo que indica submuestreo del grupo (Figura 2a). Reserva de la Biosfera Selva El Ocote. La línea punteada indica especies observadas y la línea continua las estimadas Figura 3d. De igual manera para cada una de las localidades las gráficas muestran un submuestreo de especies de mariposas (Figura 3a-d). Curvas de acumulación de especies de mariposas registradas en San Joaquín. 187 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Figura 3c. Reserva de la Biosfera Selva El Ocote. La línea punteada indica especies observadas y la línea continua las estimadas Curvas de acumulación de especies La diversidad estimada con base en el modelo Chao 1 indicó que con el actual esfuer- zo de muestreo para mariposas no es posible conocer el número esperado de especies.

d). La línea punteada indica especies observadas y la línea continua las estimadas Figura 4b. Curvas de acumulación de especies de escarabajos registradas en Nuevo San Juan Chamula. indicó que. Benigno Gómez. Reserva de la Biosfera Selva El Ocote. San Joaquín y Veinte Casas se ajus- tó a lo estimado con el modelo de Chao 1 (Figura 4a. c. 188 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Edivaldo Rodríguez y Lorena Ruíz-Montoya Figura 4a. mientras que para Nuevo San Juan Chamula aún es posible registrar alrededor de tres especies más (Figura 4b). Martín R. M. es el mismo número de especies registradas con el esfuerzo de muestreo realizado. Domínguez. La línea punteada indica especies observadas y la línea continua las estimadas La representatividad del esfuerzo de captura total de escarabajos mediante el estimador Chao 1 (Figura 2b). Carmen Pozo. Reserva de la Biosfera Selva El Ocote. El número de especies en Emilio Rabasa. Curvas de acumulación de especies de escarabajos registradas en Emilio Rabasa. León Felipe de la Mora-Estrada. en el área de estudio es probable que existan 34 especies.

Nuevo San Juan Chamula y San Joaquin el Progreso hubo una diferencia de 17. 4 y 69 especies (Figura 5a. Curvas de acumulación de especies de escarabajos registradas en San Joaquín. La línea punteada indica especies observadas y la línea continua las estimadas Figura 4d. Reserva de la Biosfera Selva El Ocote. d). con base en el modelo de Chao 1. En Veinte Casas es donde más se ajustó el número de especies observadas al número estimado por el modelo de Chao 1 (Figura 5c). Reserva de la Biosfera Selva El Ocote. indican que es probable encontrar alrededor de seis especies más de las 36 especies que se observaron en REBISO (Figura 2c). Curvas de acumulación de especies de escarabajos registradas en Veinte Casas. b. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Figura 4c. esto corresponde a un esfuerzo de muestreo de 87%. 189 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . La línea punteada indica especies observadas y la línea continua las estimadas Las curvas de acumulación para cucarachas. mientras que para Emilio Rabasa.

Curvas de acumulación de especies de cucarachas registradas en Nuevo San Juan Chamula. León Felipe de la Mora-Estrada. La línea punteada indica especies observadas y la línea continua las estimadas Figura 5b. Curvas de acumulación de especies de cucarachas registradas en Emilio Rabasa. La riqueza de especies poco y medianamente abundantes (1D) y abundantes (2D) no cambia si se incrementa el esfuerzo de muestreo (Figura 6a). Reserva de la Biosfera Selva El Ocote. Para los escarabajos se alcanzó la asíntota de la curva con los tres estimadores (Figura 6b). En el caso de las cucarachas. Domínguez. Carmen Pozo. M. Martín R. Reserva de la Biosfera Selva El Ocote. el estimador de riqueza 190 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Edivaldo Rodríguez y Lorena Ruíz-Montoya Figura 5a. Benigno Gómez. La línea punteada indica especies observadas y la línea continua las estimadas Diversidad con base en los números de Hill Las curvas de extrapolación de 0D para mariposas muestran que la riqueza de este grupo puede ser mayor a lo observado si se incrementa el esfuerzo de muestreo al doble de individuos (Figura 6a).

Con base en el número de Hill de primer orden (sin ponderar la abundancia de las especies) se encontró que el sitio más diverso para mariposas fue San Joa- quín. y Veinte Casas (Ta- bla 3). Curvas de acumulación de especies de cucarachas registradas en San Joaquín. Curvas de acumulación de especies de cucarachas registradas en Veinte Casas. seguido de San Joaquín. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Figura 5c. Al ponderar la abundancia de las especies proporcionalmente menos abun- dantes de mariposas se observó que Emilio Rabas fue el sitio más diverso. La línea punteada indica especies observadas y la línea continua las estimadas efectiva (0D) indica que es posible incrementar el número de especies (Figura 6c). Nuevo San Juan Chamula y por último Veinte Casas ­colocándose 191 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Reserva de la Biosfera Selva El Ocote. Nuevo San Juan Chamula. Reserva de la Biosfera Selva El Ocote. seguido por Emilio Rabasa. La línea punteada indica especies observadas y la línea continua las estimadas Figura 5d.

Mariposas (Lepidoptera) de la Reserva de la Biosfera Selva El Ocote (REBISO) 0 D = riqueza efectiva. Figura 6b. M. 192 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2D = riqueza efectiva de especies abundantes. León Felipe de la Mora-Estrada. Carmen Pozo. Curvas de extrapolación/interpolación para los números de Hill. Edivaldo Rodríguez y Lorena Ruíz-Montoya Figura 6a. Domínguez. 1D = especies poco o medianamente abundantes. Escarabajos (Scarabaeinae) de la Reserva de la Biosfera Selva El Ocote (REBISO) 0 D = riqueza efectiva. 1D = especies poco o medianamente abundantes. Benigno Gómez. Curvas de extrapolación/interpolación para los números de Hill. Martín R. 2 D = riqueza efectiva de especies abundantes.

La más alta riqueza de especies abundantes se observó en Emilio Rabasa. como el sitio menos diverso (Tabla 3). y Veinte Casas 193 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1D = especies poco o medianamente abundantes. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Figura 6c. El efecto de las especies de escarabajos más abun- dantes fue constante para las tres comunidades (Tabla 3). seguido de Nuevo San Juan Chamula. Al comparar propor- cionalmente las especies de cucarachas menos abundantes se confirma que Emilio Rabasa fue el sitio más diverso. seguido por Nuevo San Juan Chamula. Nuevo San Juan Chamula y Veinte Casas (Tabla 3). Emilio Rabasa y al final Veinte Casas (Tabla 3). los números de Hill de primer orden indicaron que el sitio con más riqueza fue San Joaquín el Progreso. las curvas de rarefacción/extrapolación con base en los números de Hill de primer orden (sin ponderar su abundancia) se encontró que el sitio con mayor riqueza de especies fue Emilio Rabasa seguido por San Joaquín el Progreso. y finalmente Veinte Casas (Tabla 3). Veinte Casas y Nuevo San Juan Chamula (Tabla 3). Para las cucarachas. Cucarachas (Blattodea) de la Reserva de la Biosfera Selva El Ocote (REBISO) 0 D = riqueza efectiva. seguido por San Joaquín el Progreso. Comparando las especies menos abundantes de escarabajos se observó que la mayor cantidad se presentó en San Joaquín el Progreso. seguido por Emilio Ra- basa. 2 D = riqueza efectiva de especies abundantes. Curvas de extrapolación/interpolación para los números de Hill. San Joaquín. En cuanto a los escarabajos.

León Felipe de la Mora-Estrada. Martín R. M. 1D = riqueza efectiva considerando las especies poco o medianamente abundantes. Tabla 3. 2D = riqueza efectiva considerando las especies más abundantes. se encontró que Emilio Rabasa sigue siendo el sitio dónde se registró el mayor número de especies abundantes. 194 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . pero ahora es seguido por Veinte Casas. con el mismo número de especies. finalmente Nuevo San Juan Chamula. Domínguez. Carmen Pozo. Número de especies con base en los números de Hill de los grupos de insectos estudiados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote (REBISO) Taxón (Papilionoidea) Número de Hill Scarabaeinae) (Coleoptera: Escarabajos Cucarachas (Blattodea) Mariposas Localidad 0 D 29 14 12 Nuevo San Juan Chamula 1 D 22 9 6 2 D 17 1 4 0 D 10 11 15 Veinte Casas 1 D 7 5 10 2 D 5 1 7 0 D 43 23 26 Emilio Rabasa 1 D 33 9 14 2 D 25 1 9 0 D 53 33 19 San Joaquín el Progreso 1 D 29 12 10 2 D 14 1 6 0 D = riqueza efectiva o basal. San Joaquín el Progreso y Nuevo San Juan Chamula (Tabla 3). Benigno Gómez. Al considerar el impacto de las especies de cucarachas abundantes. Edivaldo Rodríguez y Lorena Ruíz-Montoya (Tabla 3).

8 β 2D Emilio Rabasa 1. 16.0 Veinte Casas 1.53 - Nuevo San Juan .8 San Joaquín 1. y la similitud entre 10 y 17 % (Tabla 4). 2D Estimador Localidad Localidad Nuevo San Veinte Emilio Juan Chamula Casas Rabasa (a) Mariposas Nuevo San Juan .4 1.81. 17.70 y 1. Considerando la diversidad de especies poco o medianamente abundantes se encontró que la diver- sidad beta.80 1.4 Veinte Casas 1.62 1.0 42.6 40.0 38.37 .3 β 0D Emilio Rabasa 1.2 10. 45.0 Veinte Casas 1.81 .81 1.75 .25 .9 10.75. 10.3 14. Tabla 4. y las especies compartidas fueron de 10 a 40%.80 .5 1.85 .9 San Joaquín 1. Las comunidades que comparten más especies relativamente abundantes son San Joaquín y Veinte Casas (Tabla 4). Con base en 2D la diversidad beta varío entre 1.8 10.31 1. 58.41 - (b) Escarabajos Nuevo San Juan . va de 1.51 a 1.5 β 0D Emilio Rabasa 1.43 1. 41.75 1. 20.41 y 1.8 Veinte Casas 1.67 .42 1.1 San Joaquín 1.70 - Nuevo San Juan . 8.8 32.41 San Joaquín 1. entre pares de comunidades. 19. 30.8 33.8 52.51 1. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Diversidad beta (β) Los valores de diversidad beta para el caso de las mariposas con base en 0D osci- laron entre 1. y la similitud entre 20 y 32%. 1D. Las comunidades que menos especies comparten son Emilio Rabasa y Veinte Casas.23 - 195 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .82 1.81 10.81 1. Estimación de la diversidad β (Beta) entre pares de comunidades con base en las estimaciones de diversidad con los números Hill: 0D.2 β 1D Emilio Rabasa 1.66 . 61. 10.0 23.80.

M.54 β 1D Emilio Rabasa 1.86 1.22 .3 1.6 79.03 - (c) Cucarachas β 0D Nuevo San Juan . Carmen Pozo.1 70.9 56.62 1.89 17.11 - Nuevo San Juan . 93.1 San Joaquín 1.0 Veinte Casas 1.78 23. 11. Domínguez.8 1.45 . 52. 13.9 Emilio Rabasa 1.9 7 Veinte Casas 1.19 1.31 1.72 .8 52.3 San Joaquín 1.69 13.21 .9 San Joaquín 1. 64.22 .1 53.9 74. Benigno Gómez.48 .4 β 2D Emilio Rabasa 1.0 Veinte Casas 1.76 37. Edivaldo Rodríguez y Lorena Ruíz-Montoya Tabla 4.14 1.28 - 196 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .76 1. 80.0 Emilio Rabasa 1.3 .27 1.33 16 Veinte Casas 1. 42. León Felipe de la Mora-Estrada. 15.1 San Joaquín 1. 27.69 1. 56. 43.72 1.57 - β 1 D Nuevo San Juan .6 67. 63.45 1.79 .39 - β 2 D Nuevo San Juan .61 22.11 1.75 . 34. Martín R.4 10.17 1. 37. 63.39 .62 1.8 San Joaquín 1.7 Emilio Rabasa 1.4 Veinte Casas 1. (continuación) Nuevo San Juan .

72. P = 0.16. no así para el caso de las mariposas. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote En el caso de los escarabajos. con una similitud entre 37. P = 0.141). 11 = 1.45. Análisis canónico de la diversidad y variables ambientales Se presentan los resultados del análisis de componentes canónicos para escaraba- jos (Figura 7a) y cucarachas (Figura 7b) porque son los grupos en los que la co- bertura del muestro es aceptable. En cuanto a especies dominantes. la diversidad beta con base 0D demostró ma- yor similitud entre Emilio Rabasa y San Joaquín (61.48 y 1. Para las cucarachas los valores de diversidad β con base en 0D entre pares de comunidades estuvo entre 1.045) y de forma negativa pero no significativa con 197 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .39. 52% de similitud). con una β de 1. Los valores de β para 1D indicaron que la mayor similitud se encuentra entre Emilio Rabasa y Veinte Casas (β = 1. En los escarabajos los dos primeros componentes reunieron 40% de la variación de la abundancia de especies y 28% en cucarachas. mientras en cucarachas fue 66%. los valores de 2D indicaron que hay una similitud de de 93. Los dos primeros componentes aglutinaron 72% de la variación de la distribución de las especies con relación a las variables ambientales. y la similitud entre 15 y 34%.23. En el caso de cucarachas no se encontró relación entre la altitud o los sitios y su diversidad (F3.03 y 1. F3.23 y 1. y el de similitud del 43 al 74 %. La oscilación de la diversidad beta con base en 0D estuvo entre 1.5 y la similitud entre 33 y 61 (Tabla 4).8 (Tabla 4).03 entre Emilio Rabasa y San Joaquín.9. Este análisis mostró una relación altamente significativa entre la diversidad y el conjunto de las variables explicativas para el grupo de escarabajos (altitud. indicó que entre estas comunidades hay una de semejanza en la composición de especies del 80 %. 11 = 2.1 y 93. corresponde a la comparación entre Emilio Rabasa-Veinte Casas y San Joaquín-Nuevo San Juan Chamula (Tabla 4). Las co- munidades más similares con base la diversidad β para 2D fueron Emilio Rabasa y Veinte Casas (Tabla 4). 11 = 1. con una β de 1. En este caso la diversidad beta estuvo entre 1.38. P = 0.8% con una beta de 1. Para escarabajos se correlacionó de manera positiva y mar- ginalmente significativa con el componente canónico 1 (CCA1) con los variables ambientales (F1. El intervalo de variación de beta es de 1.3.11 a 1.9.006).8 %). y sitio. La diversidad beta con base en 1D.

Domínguez. P = 0. Escarabajos Figura 7b.52. 11 = 1. Análisis de Componentes Canónicos.059. 1869). F1.147).25. Martín R. Copris laeviceps (Harold. Para cucarachas no se encontró alguna relación entre los componentes canónicos y las variables ambien- tales (CCA1. 1964). 11 = 1. a nivel de especies se encontró que. Cucarachas el componente canónico 2 (CC2) (F1. 11 = 1. La abundancia de altitud se correlacionó de manera negativa y significativa. Análisis de Componentes Canónicos. P = 0. M. Finalmente. Edivaldo Rodríguez y Lorena Ruíz-Montoya Figura 7a. Halffter & Halffter. León Felipe de la Mora-Estrada. Dichotomius amplicollis 198 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Carmen Pozo. 1869). en el caso de las especies de escarabajos. Eurysternus angustulus (Harold.214).52. P = 0. Canthon vazquezae (Martínez. Benigno Gómez. CCA2. F1.

pues se tendrían mejores datos para demostrar que la REBISO está resguardando un diversidad de mariposas alta. podemos decir que la diversidad registrada es de consideración y que es im- portante incrementar los muestreos de mariposas. lo encontrado en la REBISO. 1873) se relacionaron positivamente con la altitud y se ubicaron en Emilio Rabasa y Nuevo San Juan Chamula. 1963) y Onthophagus anthracinus (Harold. Discusión El presente estudio representa un incremento de 87 especies (63 de mariposas. Luis-Martínez et al. Ateuchus rodriguezi (Preudhome de Borre. Esta estimación es sugerente de la alta diversidad entomo- faunística que se conserva en la REBISO. Onthophagus batesi (Howden & Cartwright. 1775) y Panchlora azteca (Saussure. de tal forma que el estudio en la REBISO aporta 15 registros nuevos para la REBISO. 1862). Se logró observar una riqueza de 174 especies para los tres grupos taxo- nómicos estudiados. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote (Harold.83% de la diversidad re- portada en Chiapas (1286 especies) (León-Cortés et al. 2003). 9 de escarabajos y 15 de cucarachas) al listado de insectos de la REBISO (Gómez 2013a). Para el caso de escarabajos (Scarabaeinae). constituye el 31. de los cuales nueve son registros nuevos para Chiapas (Blaberus craniifer 199 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1869). mientras que para las cucarachas registradas en el presente estudio supera por mucho lo registrado para el estado que hasta la fecha asciende a 16 especies (Estrada-Álvarez 2013). 2005. de acuerdo a los resultados de las curvas de acumulación de especies y a los números de Hill obte- nidos. Pese al disminuido esfuerzo de colecta se pudieron sumar 63 especies al número de especies de mariposas reportadas para la REBISO. lo que representa el 12. Para estos mismos sitios se encontró que las especies de cucarachas Periplaneta australasiae (Fabricius. La riqueza de mariposas (Papilionoidea) de la REBISO suma 165 especies con lo aportado en este trabajo. y tomando en cuenta que una característica de los ambientes tropicales es el presentar diversidades locales de bajas a moderadas pero con una alta diversidad beta. también se relacionaron positivamente con la altitud.7% del registro estatal (107 especies) (Gómez 2013b). 1886). Si consideramos que el muestreo realizado fue bajo.

sugiere la necesidad de continuar con estudios de diversidad. Edivaldo Rodríguez y Lorena Ruíz-Montoya (Burmeister. indica que en la REBISO pueden llegar a registrarse al menos 80 especies más de mariposas y 10 especies más de cucarachas. en particular para las mariposas se observó que la comunidad de Nuevo San Juan Chamula difiere de forma importante con la comu- nidad de San Joaquín (β para los tres número de Hill.03 < β < 1. Genier 2009).100 m (Morón 1994. La estimación de la riqueza esperada con base el modelo Chao 1. Carmen Pozo. lo que sugiere la formación de una a dos comunidades para cada grupo taxonómico. 1773). Periplaneta brunnea (Burmeister. Domínguez. asimismo. Chorisoneura gemmicula (Hebard. Kohlmann y Solís 2001. 1862). 1862). Anaplecta fa- llax (Saussure. pueden conducir a comunidades de insectos diferentes aún en las áreas que com- partan una historia ambiental común (ver De La Mora-Estrada et al. 1920). 1903). Pseudomops interceptus (Burmeister. Panchlora azteca (Saussure.76). Ischnoptera rufa occidentalis (Saussure. Benigno Gómez. Epilampra maya (Rehn. Estos factores. 1775). M. La tasa de recambio entre localidades considerando a todos los grupos fue de baja a alta (1. mientras que para escarabajos es próxima a la diversidad real. Lo que enfatiza el valor biológico de la REBISO como área de conservación protegida. I. particularmente de mariposas para tener una mejor idea de los patrones de diversidad de insectos en la REBISO. 1838). 1838). En el caso de los escarabajos y cucarachas. P.43-1. Mientras que para escarabajos y cucarachas la mayor tasa de recambio se observó entre los sitios más conservados (Emilio Rabasa y Veinte Casas). 2017). mientras que un sitio perturbado como 200 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1868). 1862). se encontró la mayor riqueza en el sitio con el ma- yor grado de conservación: Emilio Rabasa. 1868). 1916).81). En el caso de cucarachas. León Felipe de la Mora-Estrada. A. Panchlora nivea (Saussure. Martín R. rufa rufa (De Geer. El recambio de especies de mariposas entre Nuevo San Juan Chamula puede ser parcialmente explicado porque aun cuan- do se trata del mismo tipo de vegetación. australasiae (Fabricius. la similitud faunística entre sitios conservados se debe probablemente a la ecología de las especies que se comparten. Epilampra azteca (Saussare. la perturbación o sucesión vegetal. mexicana (Saussure. pero que difieren en el estado sucesional o grado de perturbación del sitio. 1.1838) e Imblattella fratercula (He- bard. 1920) es una especie registrada por primera vez en México. las cuales se caracterizan por ocupar hábitats selváticos húmedos y se han encontrado desde el nivel del mar hasta los 2. Anaplecta hemiscotia (Hebard. 1862).

donde pueden encontrar recursos tanto alimenticios como de refugio (Bell et al. 2013). La biodiversidad de las zonas con mejor grado de conservación tiene influencia de lo que existe fuera de ellas. el cual influye en la diversidad de especies de un hábitat particular (Battisti et al. Harvey et al. sino de lo que existe en sus áreas circundantes. Carrero et al. Arroyo-Rodríguez et al. en zonas menos conservadas (Laurance et al. así mismo es posible esperar que una composición diferente si las especies son disímiles en la resistencia al nivel de perturbación. Diversos autores han indicado que la riqueza de especies puede depender de factores como el tamaño de los relic- tos de selva. 2014). Los hábitos de las cucarachas silvestres mantienen a estos insectos en zonas húmedas con el cobijo de la selva. En Nuevo San Juan Chamula y San Joaquín el Progreso la colecta de insectos se hizo en fragmentos de selva rodeados de asentamientos humanos. 2007). La distribución de Scarabaeinae. y le sigan áreas con cobertura arbórea suficiente y con cierto nivel de continuidad (Guevara et al. áreas agrícolas (milpas). áreas de cafetales abandonados. que posiblemente no encuentran cuando la selva o bosques son perturbados. zonas de pastizales y zonas de recuperación (restauración). Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Nuevo San Juan Chamula presentó la menor cantidad de especies. 2004. lo que probablemente promueve una diferenciación de las comunidades por la posible limitación de movimiento entre fragmentos. 2006. formas. 1994. uno de los factores más importantes es el gradiente altitudinal. complejidad estructural y conectividad entre los fragmentos. siempre que el elemento dominante en el paisaje sean bosques o selvas conservadas. El análisis de componentes canónicos mostró una relación negativa entre la diversidad de escarabajos y la altitud y localidad. también está asociado a la disponibilidad de sus recursos alimentarios (heces de mamíferos) en combinación con factores climáticos (principalmente la temperatura y humedad) (Ruiz-Pérez et al. La correlación existente entre la diversidad de insectos y la altitud de un si- tio. 2012) por lo que el destino de la biodiversidad dentro de las REBISO dependerá esencialmente del manejo y conservación no solo de las especies dentro de las zonas núcleo. 2009). es un patrón ecológico y biogeográfico frecuentemente documentado (Rahbek 201 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . sin embargo. Estudios recientes de la di- versidad biológica muestran que una proporción considerable de la diversidad (taxonómica y filogenética) se conserva en los paisajes fragmentados.

M. Establecer claramente la relación entre la altitud y la diversidad de insectos en la REBISO puede ser útil para tener una mejor idea de los cambios en la composición y abundancia de las comunidades de insectos en función del incremento de la temperatura debidas al cambio climático (Parmesan 2006. Boggs y Murphy 1997). Los estimadores permiten augurar unas 243 especies más. En áreas tropicales particularmente. 2008. Par- mesan y Yohe 2003). Los Ateuchini fue la tribu de escarabajos (Coleoptera) con mayor número de géneros y Onthophagus el género con mayor número de especies. Carmen Pozo. 1993. la familia Nymphalidae (Papilionoidea) registró el mayor número de géneros y especies en los sitios estudiados. Deutsch et al. Con lo anterior aumentan a 26 el número de especies conocidas para Chiapas. los gradientes latitudi- nales de temperatura son débiles (Colwell et al. con lo que se podría alcanzar unas 877 especies. Domínguez. Sulca 2013). A nivel de género se registraron cua- tro nuevos y 22 morfoespecies. diez para Chiapas y uno para México. Conclusiones La lista de especies de insectos de la REBISO se incrementa con 87 especies. León Felipe de la Mora-Estrada. que están en proceso de determinación específica. y pese al corto intervalo de altitudinal de la REBISO es posible que esta migración pueda ocurrir. El presente estudio es una línea base de información que puede servir de referencia tanto para fines de manejo como para estudiar determinantes ecológicas de la diversidad de insectos en la REBISO. El sitio de San Joaquín el Progreso resultó el más rico en especies. Chen et al. mientras que Veinte Casas presentó la menor riqueza. Se obtuvieron 15 registros nuevos de cucarachas a nivel de especies para la REBISO. la familia Ectobii- dae presenta el mayor número de géneros y especies. Martín R. por lo que detectar cambios en las comunidades puede requerir de esfuerzos de muestro al menos del doble de lo que se presenta en este estudio. 2008). Edivaldo Rodríguez y Lorena Ruíz-Montoya 1995. Benigno Gómez. De las cucarachas (Blattodea). La similitud faunística entre los sitios 202 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2009. De las mariposas. principalmente de mariposas en las localidades de Nuevo San Juan Chamula y en San Joaquín el Progreso. alcan- zando con ello un total de 650 especies para esta ANP. La migración vertical es una respuesta esperada (Weiss et al.

Para los escarabajos se presentó una correlación negativa y significativa para dos de las variables explicativas (altitud y sitios). Este estudio fue financiado por CONACYT a través del proyecto PDCPN-2013/214650. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote estudiados fue mayor entre Nuevo San Juan Chamula y San Joaquín el Progreso para la fauna de mariposas. se agradece el apoyo en trabajos de campo y logística de Alejandro Guillén. así como al personal de la Comisión Nacional de Áreas Naturales Protegidas (CO- NANP) a través de la Dirección de la Reserva de la Biosfera Selva El Ocote. Agradecimientos Se agradece el apoyo logístico de los pobladores de las comunidades en estudio. Erick Hernández y Juan Antonio López. mientras que. A Noemí Salas por su apoyo en la deter- minación taxonómica de mariposas. Asimis- mo. En el caso de las cucarachas no existió ninguna correlación entre su diversidad y las variables estudiadas. ya sea en espacios pequeños (entre localidades). 203 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . como a nivel de paisaje (el conjunto de localidades estudiadas) permite tener una herramienta de evaluación de los poten- ciales impactos del cambio climático. principalmente sobre los que conducirían a extirpaciones o adaptaciones evolutivas que puedan ocurrir dentro del rango de distribución de las especies. el recam- bio de especies fue mayor entre Emilio Rabasa y Veinte Casas. Estos patrones de distribución y su correlación o no con variables como la altitud. para escarabajos y cucarachas.

E. A rapid range expansion in the pine processionary moth produced by the 2003 climatic anomaly.D. Cockroaches: ecology. Hsieh. Martín R. 2006. y D. Pineda. H. Flora of Chiapas.M. E. M. J. Carrero. V. H. 2009.K. Sander.. Global Ecology & Biogeography Letters 6: 39-48. C.H. Chen. J. . Shiu. D.C.G. Chao.R. Carmen Pozo. J.L. Flora of Chiapas. K. F. The California Academy of Scie. Bell. Sánchez y D. Tobar. The Johns Hopkins University Press. Revista de la Academia Colombiana de Ciencias Exactas. León Felipe de la Mora-Estrada. M. 1997. Proceeding National Academy Science USA 106: 1479-1483.. Triviño.L. Rarefaction and extrapolation with Hill numbers: a framework for sampling and estimation in species diversity studies. Part I. Holloway. Boletín Científico del Museo de Historia Natural 17: 168–188. Ecological Mono- graphs 84: 45-67. M. behaviour and natural history. L. R. Henao y P.. Conservation Biology 23: 729-739. y C. E. Domínguez.D. 2009.C.K. Part I. Gotelli.J. Flora of Chiapas. El- lison. Colwell y A. Benigno Gómez. 2014. Community composition in mountain eco- systems: climatic determinants of montane butterfly distributions. 1981. Diversidad y distribución de mari- posas diurnas en un gradiente altitudinal en la región nororiental andina de Colombia. preservación y montaje de Mariposas en estudios de biodiversidad y conservación.. Barlow. The California Academy of Sci- ences.K. Benedick. E. Thomas.. A.A Nalepa. (Lepidoptera: Hesperioidea – Papilionoidea). Value of small patches in the conservation of plant-species diversity in highly frag- mented rainforest. Stastny. San Francisco. Elevation increases in moth assemblages over 42 years on a tropical mountain. Físicas y Naturales 37: 311-325. Battisti. Murphy. A. 2013. Ma. S. Escobar y J.R. Larsson. San Francisco. Técnicas y procesamiento para la re- colección. Hill y C. Arroyo-Rodríguez. Estados Unidos de America..A. Roth. 2007.J. T. Chey. W. N. Edivaldo Rodríguez y Lorena Ruíz-Montoya Referencias Andrade. D.D.M. Buffo y S. Global Change Biology 12:662-671.S.E. Benítez-Malvido. Boggs. 204 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . The California Academy of Sci- ences.. California. V. I. Part I. Breedlove. Baltimore. E. 2013. L.

N. The use of indicator groups for measuring bio- diversity as related to community structure and function. Comisión Natural de Áreas Naturales Protegidas. Philosophical Transactions of the Royal Society of London Se- ries B: Biological Sciences 345: 101-118. L. R. Delgado.S. México. Edmonds. Blackaller. En prensa. Sheldon. T.D. Mayorga-Martínez. Secretaría de Medio Ambiente y Recursos Naturales. Brehm. Contribu- tions in Science 443: 1-105. Morón-Ríos. 2000. User’s Guide and application published at http://purl. International Journal of Speleology 22: 1-82. R. Programa de Manejo de la Reserva de la Biosfera Selva El Ocote. Chiapas. 1994.A. 205 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .F.K. W. Folia Entomológica Mexicana 110: 33-87. Desutter-Grandcolas.B. M. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Colwell.C. 1993.K. 2008. Gilman y J. Estrada-Álvarez. Ocozocoautla de Espinosa. Primera lista de las cucarachas de México (Dyctyotera: Blattodea).A. Coddington. 1994. 2013. Revision of Phanaeus Macleay. J. 2017. Impacts of climate warming on terrestrial ectotherms across latitude. G. Longino. Global warming. Estimates: Statistical estimation of species richness and shared species from samples. Revista Mexicana de Biodiversidad. Colwell. E. R. Claves para determinar a los taxones genéricos y supragenéricos de Scarabaeoidea Latreille.K. Grylloi- dea.  Deutsch.. México. Phalangopsidae. 2006. R. Chiapas. y G. Proceeding National Academy Science USA 105:6668-6672. Ruiz-Montoya. L. and lowland biotic attrition in the wet tropics. A. Halffter. L Cardelus. L. Huey y K. Scarabaeinae).. J. Estimating terrestrial biodiversity through extrapolation. C. Science 322: 258-261. De La Mora-Estrada. Colwell. 2001. J.J. 2008. M. A. The cricket fauna of Chiapanecan caves (Mexico): sys- tematics. Pérez. Ramírez-Marcial. a new world genus of Scara- baeinae dung beetles (Coleoptera: Scarabaeidae. L.. C. J.oclc. Boletín de la Sociedad Entomológica Aragonesa 53: 267-284. A.. Version 8. elevational range shifts. Acta Zoológica Mexicana 72: 1-25. phylogeny and the evolution of troglobitic life (Orthoptera. C. Luzarinae).C. Diversidad de chinches (Hemiptera: Het- eroptera) en bosques secundarios de pino-encino de San Cristóbal de Las Casas.org/estimates. Tewksbury. Favila. 1997. 1802 (Coleoptera) de México.

1979. Domínguez. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO) y Gobierno del Estado de Chiapas. Insectos do Brasil: Diversidade e Taxonomia. en L. 1824 (Scarabaeidae: Scarabaeinae: Oniticellini): Révision taxonomique et clés de détermination illustrées. Holos Editora. C. Giribert. México. Génier. Tapachula. Meave. M. Acta Bo- tánica Mexicana 28: 1-27. Simposio sobre conocimiento y manejo de la reserva de la biosfera Selva El Ocote: retos actuales. Part I: Flying species. Constantitno (editores). y G. León Felipe de la Mora-Estrada. P. Chiapas. 2013b. Castillo. Pellens.W. Gómez.J. Brasil. Gómez. 2002. 2005. G. E.S. P.A. Libro de resúmenes del 1er. Página 46. en A. Gotelli. The Arthropoda: A Phylogenetic Frame- work. Gómez. Pen- soft Series Faunistica 85: 1-430. N. Edivaldo Rodríguez y Lorena Ruíz-Montoya Fisk. Rafael. Springer-Verlag Berlín Heidelberg. Manual de métodos de colecta. Studies on Neotropical Fauna and Environment 14: 177-201. Casari y R. Grandcolas. y M. Moreno-Casasola. J. J. Edgecombe. y R. B. Laborde y S. 2009. F.R Melo. Evolution of the Insects.. G. New Phytologist 193: 445-453. Páginas 17-40. Páginas 333-346. El Colegio de la Frontera Sur/Universidad Autónoma de Querétaro. F.A. Andraca-Gómez y J.D. S. Quantifying biodiversity: procedures and pitfalls in the measurement and comparison of species richness. Hong Kong. en J. 2013a. preservación y con- servación de insectos. Cambidge University Press. de Carvalho. Keys to the cockroaches of central Panama. B. Ecology Letters 4: 379-391.A. Blattaria. G. y R. Garrido.. Le genre Eurysternus Dalman. Páginas 207-212. 1829. 2001. Entomofauna de la reserva de la biosfera Selva El Ocote: registros y situación actual. Benigno Gómez. y H. Carmen Pozo. Minelli. 1994. Wolda. 2013. B. San Cristóbal de Las Casas. Burmeister. Los escarabajos (Coleoptera: Scarabaeoidea). Colwell. La biodiversidad en Chiapas: Estudio de Estado. y R. Ve­ getación y flora de potreros en la sierra de Los Tuxtlas. Jones. G. en Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (edi- tores). México. Engel. Chiapas. D. Local adaptation: Simultaneously considering herbivores and their host plants. 206 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . México. Grimaldi. Muñoz (editor). Guevara. Ar- thropod Biology and Evolution. Fornoni 2012. Fusco (editores).B. 2012. Martín R.A.W.J. S.K. Boxshall y G.

3. Melic (editores).nthu. McGill (editores). Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Gullan. Schroth. y O. A timeline for terrestrialization: consequences for the carbon cycle in the Palaeozoic.M.U. Zaragoza. Ma y A. L. Ataroff. NewYork. iNEXT online: interpolation and extrapola- tion Version 1. 2006. Changes in the arthropod community along an elevational transect in the Venezuelan Andes. Hsieh. vol. Compositional similarity and beta diversity. Blackwell Science. Chazdon.. P.A. en G. Wellman. Chao y R. Páginas 5-18. Moreno. H. y C. D.. C. L. Chao. Magurran y B. Washington.B. Soler. beta y gamma. P. A revision of the neotropical genus Xestoblatta Hebard (Or- thoptera.C. C. Vera. Reyes. Howden. K.. Soriano y M. y P. England. Edgecombe. Harvey. Jost.U. 1976.S. Koleff y A. Oikos 113: 363-375. Janzen. Live fences.H. H. N.C. Oxford University Press. F. Gascon. 1963. Hortal 2003.J. T. Izac (editores).. Tucker y A. 4. Island press. P. Application published at http://chao. Rincon. M. 2012.L. 2004. Harvey. y J.B. 1939. Sobre diversidad biológica: El significado de las diversidades.A. Páginas 66-84.. E.stat. G. Blattidae. Halffter. Entropy and diversity. Halffter. Jiménez-Valverde. Fonseca. Scarab beetles of the genus Onthopha- gus Latreille North of Mexico (Coleoptera: Scarabaeidae). Significado biológico de las diversidades alfa.A. Revista Ibérica de Aracnología 8: 151-161.tw/ blog/software-download/. Cranston. isolated trees and wind breaks: Tools for conserving biodiversity in fragmented tropical landscape. E. C. 2005. Estrada.H.L.A. España. Agro forestry and biodiversity conservation in tropical landscapes. Las curvas de acumulación de especies y la necesidad de evaluar la calidad de los inventarios biológicos. G. en G. Monografías Tercer Milenio Sociedad Entomológica Aragonesa.0. Gurney A.D. C. M. The Insects: An Outline of Entomology. P.edu. Biological diversity: Fron- tiers in measurement and assessment. 2014. Fariñas.H. Jost. J. 2011. Proceeding of the Unites States National Museum 114: 1-143. en A. 207 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . D.A. 2013. Oxford. Vasconcelos y A. Proceedings of the Entomological So- ciety of Washington 41: 97–128.E. Biotropica 8: 193-203. Pseudomopinae). Kenrick. Schneider y G. H. A.L Cartwright. Soberón. A. N. S.N. A. Páginas 261-289.

L. 1997. Crone. Aizen. El género Onthophagus (Coleoptera: Scarabaeidae) en Costa Rica. Kohlmann. L. Uso de rarefacción para com- paración de la riqueza de especies: el caso de las aves de sotobosque en la zona de influencia del Parque Nacional Laguna Lachuá. P. C. Rendeiro. editorial Plaza y Valdés. E. G. A. Minck- ley. 2001. Biotropica 37: 322–325. Kalka. Klein. Ruiz-Montoya (editores. S. Cuernavaca. Diversidad de mariposas (Lepidoptera: Papilionoidea) en pastizales y zonas de restauración por sucesión ecológica de la reserva de la Biosfera Selva El Ocote (REBISO). S. Ricketts. T. Morelos. México. Adams. Revista de Biología Tropical 44. D. Re- getz. González-Espinosa. Diversidad Biológica en Chiapas. Benigno Gómez. y A. Martín R. Guatemala. Chipas. Larsen. Vázquez. Giornale Italiano di Entomologia 49: 159-261. 208 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .H. I.L. Domínguez. León-Cortes. Campbell. T. Trap spacing and transect design for dung beetle biodiversity studies. Application published at http://cran. Winfree. T. Sloan. et al. C. Edivaldo Rodríguez y Lorena Ruíz-Montoya Philosophical Transactions of the Royal Society B: Biological Sciences 367: 519–536. Laurence. 2015.. Cóbar-Carranza. S. R.G.).r-815 project. Gemmill-Herren. J. B. y A. Useche. 2015.P. 2012.45: 177-192. The Costa Rican species of Ateuchus (Coleoptera: Scarabaei- dae). N. T.. W.J. López-Gutiérrez S. Packer. en M.org/web/packages/BiodiversityR/index. J. Nature 489:290-294. Kraken-Castañeda.F. S. Averting biodiversity collapse in tropical forest protected areas. Ramírez-Marcial y L.A.S.M. R. Universidad Autónoma del Estado de Morelos.C. J. M. Tesis de Licencia- tura. Kindt. México.html. Bradshaw. Potts. Pollination and other ecosystem services produced by mobile organisms: a conceptual framework for the effects of land-use change. Facultad de Ciencias Biológicas. Génesis y estado del conocimiento. Lebuhn. D. M. Páginas 163-194. A. B. 2007.. Carmen Pozo. Natu- raleza y Desarrollo 9: 60-70 Kremen C. Steffan-Dewenter. León Felipe de la Mora-Estrada. M. Forsyth.H. Ecology Letters 10: 299–314. Ruiz-Montoya y A. J. y A. N. Kohlmann B.. 2005. Package BiodiversityR.M. Keitt. Greenleaf. Laurance. Solís.H.E. Morón-Ríos. Williams. La diversidad de in- sectos en Chiapas. 2005. L. R. M. Roulston. 2011. G. El Colegio de la Frontera Sur-Consejo de Ciencia y Tecnología de Chiapas.

Luis-Martínez e I.D. 2005. distribución estatal y provincias biogeográficas. y G. Vargas Fernández. Warren. D. J. Revista Mexicana de Biodiversidad 82:1249-1261. Morrone y J.P. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Llorente-Bousquets. Losey. M. J. Conserving the Ecological Services Privided by Insects. J. Apéndice general de Papilionoidea: Lista sistemática. Blackwell Publishing. Proceedings of the Entomological Society of Washington 105:209-224. 2001. 2006.E.D. Pineda y N. American Entomologist. Barragán. México. I.J. Moreno. F. 1994. Simberloff. Técnicas de colecta y preservación de insectos. F. Journal of Applied Ecology 38:487-490.E.M.org/vol10/iss1/resp4/ 209 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . E.. 54:1107-109 Loxdale H. en J.).a vulnerable disciplina? Entomologia Experi- mentalis et Applicata 159:121-134 Luis-Martínez. A. Vaughan. 2004.M. UNAM. Reanálisis de la diversidad alfa: alternativas para interpretar y comparar información sobre comuni- dades ecológicas. México. Boletín Sociedad Entomológica Aragonesa 37:385-408. ­Oxford. Ecology and Society 10(1 ):r4 [online] URL: http://www. ecologyandsociety. Martín-Piera y C. Llorente-Bousquets. Vol. Menéndez. Llorente-Bousquets (editores)..E. How are insects responding to global warming? Tijdschrift voor Entomologie 150:355-365. J. Vargas-Fernández y A. R. Márquez-Luna. Acta Zoológica Mexicana 63:7-59. Páginas 945-1009. C. 2008.A. 2005. F. Las Prensas de ciencias. Lobo. I. Características determinantes de su capacidad de captura. Insect science. Invasive Species and the Cultural Keystone Species Concept. A. II: 945-1009.. 1988. Moreno. y D. C. Revue D Ecolgie et Biologie Du Sol 25: 77-100. y M. Pavón. M. Union Kingdom. 2007. Las trampas pit-fall con cebo. Fauna de Coleoptera Lamellicornia en las montañas del nor- este de Hidalgo. Halffter. sus posibilidades en el estudio de las comunidades coprófagas de Scarabaeoidea (Col. J. 2003. Morón. Measuring Biological Diversity. 2016. Componentes Bióticos Principales de la Entomofauna Mexicana.. Núñez. 2011. A. Veiga.E. Magurran. H.A. Biodiversity and biogeography of Mexican butterflies (Lepidoptera: Papilionoidea and Hesperioidea). On the measure of sampling effort used in species accumulation curves.

La riqueza de blatarios (Dyctioptera: Blattaria) del suelo en tres localidades de un gradiente altitudinal del Estado de Veracruz. Evolution and Systematics 37: 637-669.org/web/packages/ MASS/MASS. D.L. R. Variación altitudinal de los Scarabaeidae (Coleoptera) en la Chinantla. Hill. F. y M. Package VEGAN. C. Morgan. J.r-project. Tammaru. Application published at http://cran. Bates. Universidad Veracruzana.E.  Rehn. 1995. Tennent. Thomas y M. Benigno Gómez. Caballero. Parmesan.J. A. Edivaldo Rodríguez y Lorena Ruíz-Montoya Oksanen. León Felipe de la Mora-Estrada. 1999. B. 2003. Journal of Lepi- dopterists’ Society 18: 51-58 Sormani Hernández. C. Henry y H. P. Annual Review of Ecology. Acta Zoológica Mexicana 77: 23-150. J. Parmesan. I. Monografía de las especies mexicanas de Canthon del subgénero Glaphyrocanthon (Coleoptera: Scarabaeidae: Scarabaeinae). Kaila. Neteler. Martín R. P. Hornik.K. Stefanescu.org/web/packages/ vegan/index. R. Parmesan. Oaxaca. Yohe. J. y G. Veracruz. International Journal of Remote Sensing 33: 4458-4470. C. Nature 421:37-42. Ryrholm. Pack- age MASS. J.. Domínguez. B. Carmen Pozo. Minchin. A. A Revision of the North American Species of the Genus Ischnoptera (Orthoptera). Kindt. Nature 399: 579–583. Solymos. Kullberg. 1910. K.r-906 project. 1964.. L. Huntley. H.html. Thomas. Spectral rank-abundance for measuring landscape diversity. W.J. C. N. Stevens. Simpson.D. M. México. 2015. Proceedings of the Academy of Natural Sci- ences of Philadelphia 62: 407-453.. Poleward shifts in geographical ranges of butterfly species associated with regional warming. J. H. y H. Entomología Mexicana 1: 1223-1227. T. B. 210 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Blanchet. C. M.A. Rivera-Cervantes. Rocchini. O’Hara. Venables. C. Ecological and evolutionary responses to recent climate change. y G.P. México. R. 1999. Gebhardt y D. 2014. Disponible en http://cran.B. M. Legendre. Firth. Rydon. Ruiz-Pérez. Rahbek.D. G. A globally coherent fingerprint of climate change impacts across natural systems. León y U.. 2006. Wagner. 2012. Halffter. 2015. C.G. The elevational gradient of species richness: a uniform pattern? Ecography 18: 200-205. Tesis de Licenciatura. Xalapa. Warren. L. 2007. Ripley. Notes on the use of butterfly traps on East Africa.pdf. Descimon. L.

Hesperioidea (Lepidoptera). Notes on the use of butterfly traps on East Africa. H.. Biodiversidad. Ortega- Huerta. 211 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . R. 2013. “Order Lepidoptera Linnaeus. L.University of Wageningen. Grainger. Paivinen. E. Climate Change and Range Shifts in Two Insects Defoliators: Gypsy Moth and Nun Moth – a Model Study. Blasius y M. A. Vantomme.S. Vanhanen H. Nature 427: 145–148. Florida. CRC Press. Boca Raton. J.D.F. FAO. Journal Lepi- dopterists’ Society 18:51-58 Sulca. II. Hannah. Miles.D. Kellomaki.A. Hughes.O. Italia. 1964. Paginas 535-580. Ocampo y P. Llorente- Bousquets.y P. Greenacre (editores)..C.C. Halloran. D. Brooks/Cole. Borror and Delong’s Introduction to the Study of Insects. México. L. A. W. Y. C. Mitter. Papavero (editores). C. A.P. L. S. B. M.N. en J. F. Collin- gham. Z. Johnson.. 2007. Van Itterbeeck. C.J. taxonomía y biogeografía de artrópodos de México: Hacia una síntesis de su conocimiento. J. G.E.L. UNAM-CONABIO-ECOSUR- BAYER. 2004.. Ecologia Aplicada 12: 141-145. G. A.J. F.F. Triplehorn. Kaila. y N. et al. E. M. M.E.C. F. Mertens. 2005. I. L. Páginas 62-74. Niemela. A. 2011. Edmonds. Townsend-Peterson. Bakkenes. N. Cameron.A. Silva Fennica 41: 621-68. L. E. O.. Williams. J. J. Thomson. A. Midgley. In: Zhang. 2011. van Nieukerken.) Animal biodiversity: An outline of higher-level classification and survey of taxonomic richness. Estados Unidos de America. S. Ter-Braak. van Jaarsveld. 1758”.- Q. Huntley. Visualization and verbaliza- tion of data. Thomas C. González-Soriano y N. 2000. A. Veteli. A. Estados Unidos de América.F. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Rydon. D.F. Lees. (Ed. E.D. Ferreira de Siqueira. Phillips y St. Zootaxa 3148: 212-221 Vaz-de-Mello.Kristensen. Zootaxa 2854:1-73. Klunder. Kitching. Muir y P. Erasmus. M. Green. Beaumont. L. Vol. Minet. Extinc- tion risk from climate change. 2014. Roma. Distribución de Rogadinae (Hymenoptera: Braconidae) en un gradi- ente altitudinal en los andes del sur del Perú. en J. Schoolmeesters. van Huis. History of Canonical Correspondence Analysis. B. T. Insectes comestibles: Perspectives pour la sécurité alimen- taire et l’alimentation animale.. Warren. Facultad de Ciencias. A mul- tilingual key to the genera and subgenera of the subfamily Scarabaeinae of the New World (Coleoptera: Scarabaeidae). 2014.

Journal of Insect Conservation 15: 259–268.D. CONABIO. D. 2001. 1993. M. Martín R. Carmen Pozo.G. Rapid responses of British butterflies to opposing forces of climate and habitat change.html. R. Jeffcoate. G.K. Greatorex-Da- vies. Domínguez.A.conabio. Roy. D. S. Oecologia 96: 261–270. Telfer.D.N.D. Willis. B.J. J. Moss y C. Huntley. Catálogos de especies. Disponible en: http://www. Wilson.M.G. Harding. Thomas. Thomas. Warren M. A. Adult emergence phe- nology in checkerspot butterflies: The effects of macroclimate. Nature 414: 65–69.. M.B. Asher. 2011. Hill. S. y I.S. Metzler. R. Murphy.. J. Recent evidence for the climate change threat to Lepidoptera and other insects. León Felipe de la Mora-Estrada. Maclean. topoclimate and population history. F. J. P. 2002. Fox. Weiss. S. D. Edivaldo Rodríguez y Lorena Ruíz-Montoya Warren.mx/informa- cion/catalogo_autoridades/doctos/electronicas. Jeffcoate. 212 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . R Ehrlich y C. Benigno Gómez. D.gob. P.B. J. World Wide Web (Elec- tronic Publication).

12. 2003 11. 12. 16. 2013 6 Hydrophilidae Hydrophilinae Hydrophilus  insularis Castelnau. 1999 5 Corynomalus perforatus Gerstaecker. Lista de especies registradas en la Reserva de la Biosfera Selva El Ocote Orden Familia Subfamilia Especie Referencia Plateros nicaraguensis Gorham. 34 1850) 213 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1888) 16. 17 Scarabaeidae Melolonthinae Phyllophaga densata (Moser. 16 Phyllophaga javepacuana Morón. 34 Phyllophaga ginigra Saylor. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 17 1850) Phyllophaga chimoxtila Morón. 1839) 9 Cleridae Tillinae Cymatodera limatula Burke. 17 Phyllophaga cinnamomea (Blanchard. 2013 Myrmecoderus rileyi Aalbu. 16 Phyllophaga cometes (Bates. 11. 16 Phyllophaga cholana Morón. 2003 11. 2005 Buprestidae Chrysochroinae Lampetis viridicolor Corona. 17. Elateridae Agrypninae 21 Coleoptera 1857 Passalidae Passalinae  Verres corticicola (Truqui. 1881 5 Lycidae Platerodinae Plateros ortegae Zaragoza. 16. Endomychidae Lycoperdininae 15 1857 Staphylinidae Staphylininae Homalolinus divisus (Erichson. 1857) 25 Phyllophaga aegrota (Bates. Andrews Salpingidae Dacoderinae 24 & Pollock. 1940 11. 1888) 16. 2005 22 Chalcolepidius oxydatus Candèze. 12. 1918) 16. 16 2003 Phyllophaga obsoleta (Blanchard. 1840 8 Operclipygus nicodemus Caterino & Histeridae Histerinae 2 Tishechkin.

18 Gory & Percheron. (continuación) Orden Familia Subfamilia Especie Referencia Phyllophaga ocozocuana Morón. 1888) 16. 1966 ( 16. 16 2003 Phyllophaga pruinosa Blanchard. 11. 16 1888) Phyllophaga xkumuka Morón. 17 Cotinis mutabilis (Gory & Percheron. 16. 20 Gory & Percheron. 16. 1847) 16. 1848) 16. Carmen Pozo. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. Martín R. M. 2000 12 Phyllophaga sturmi (Bates. 19 (Gory & Percheron. 19 1847) Euphoria candezei Janson. 16. Benigno Gómez. 1888) 16. 17. 2001 16 Phyllophaga xanthocoma (Bates. 34 Phyllophaga tenuipilis (Bates. 1875 16. 17. 1850) Phyllophaga stzotzilana Morón. 1851 34 Phyllophaga rugipennis (Schauffus. 19 Euphoria dimidiata 16. 17 1833) Cotinis fuscopicea Goodrich. 1833) Euphoria leucographa 16. 19 Cotinis pauperula (Gory & Percheron. 34 1858) Phyllophaga soctona Morón. 1850 16.12. 17 Phyllophaga testaceipennis (Blan- 34 chard. 18 214 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . León Felipe de la Mora-Estrada. 1833 Euphoria lineoligera Blanchard. Euphoria leseuri 16. Domínguez. 1999 12 Coleoptera Scarabaeidae Melolonthinae Amithao cavifrons (Burmeister. 17 Amithao haematopus (Schaum.

17. 1789) 16. 1767) 16. 1915 16. 16. 19. Aspidolea singularis Bates. 1767) 16. 18 Cyclocephala gravis Bates. 19. 19 (Gory & Percheron. 1842 Hoplopyga liturata (Olivier. 17. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 19 (Gory & Percheron. 1888 16. 17. 1888 20 Coleoptera Scarabaeidae Melolonthinae Coelosis biloba (Linné. 20 Cyclocephala amazona (Linné. 1833 ) 16. 1833) Gymnetis difficilis Burmeister 1842 16. 20 Burmeister. (continuación) Orden Familia Subfamilia Especie Referencia Euphoria pulchella 16. 1888 16. 18 215 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 20 Cyclocephala guttata Bates. 20 Hoplopyga ocellata 16. 20 Cyclocephala complanata 16. 19 (Gory & Percheron. 1775) Cyclocephala ovulum Bates. 1833) Hologymnetis margaritis 16. 19. 17. 20 (Fabricius. 16. 1992 Balsameda pulverulenta 16 Burmeister. 20 1847 Cyclocephala mafaffa Burmeister. 17. 1847 Cyclocephala deceptor Casey. 19. 20 Cyclocephala lunulata Burmeister. 18 Hologymnetis cinerea 16. 20 1847 Cyclocephala melanocephala 16. 20 Raccliffe & Deloya. 1888 16.

16. 17. 17. 19. 17. 20 ter. 20 Ligyrus cicatricosus Prell. 20 16. 1847 19 Golofa pizarro Hope. 1806) Homophileurus tricuspis Prell. Martín R. 1837 16. 1843 20 Coleoptera Scarabaeidae Melolonthinae 16. Euetheola bidentata Burmeister. Golofa tersander Burmeister. 20 1840 Cyclocephala signaticollis Burmeister. 17. 18 1847 16. 1902 20 16. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1789) 16. 1906) 16. 19. 1888) 20 Hemiphileurus punctatostriatus Prell. León Felipe de la Mora-Estrada. M. 16. 18 216 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Benigno Gómez. Cyclocephala stictica Burmeister. 18. 20 Dynastes maya Hardy. (continuación) Orden Familia Subfamilia Especie Referencia Cyclocephala sanguinicollis Burmeis- 16. 17 1914 Homophileurus quadrituberculatus 16. 17. 16. 17. 17. 2000 16 16. 1847 20 Dyscinetus dubius (Olivier. 1937 16. 19. 1847 20 Heterogomphus pehlkei (Kolbe. Cyclocephala sparsa Arrow. Domínguez. 1914 16. 17. Hemiphileurus dejeani (Bates. Carmen Pozo. 17. 20 16. 19. 1847 Cyclocephala sexpunctata Castelnau. 19. Enema endymion Chevrolat. 20 (Beauvois.

Spodistes mniszechi (Thomson. 20 Phileurus excavatus Prell. 1789) 20 Phileurus angustatus Kolbe. 18. 20 217 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 20 Strategus aloeus Linné. 17. 1918 20 16. 1958 16. 20 Diplotaxis denigrata Bates. 1887 16. 18. 17. 20 Diplotaxis poropyge Bates. 17. 1958 20 Diplotaxis maya Vaurie. 20 Ceraspis mexicana Harold. 1911 16. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 1888 16. 1775 16. 20 Ligyrus sallei Bates. 1847 16. 19 Megasoma elephas Fabricius. 17. 18. 19. 1860) 20 Stenocrates laevicollis Kirsch. 1918) 16. 20 16. 16. 20 16. (continuación) Orden Familia Subfamilia Especie Referencia Ligyrus nasutus (Burmeister. 1910 16. 1863 16. 19. 18. 18. 17 1976 Coleoptera Scarabaeidae Melolonthinae Strategus jugurtha Burmeister. 1889 16. 18 Diplotaxis puncticollis (Moser. Diplotaxis hirsuta Vaurie. 20 Diplotaxis crinigera Bates. 20 16. 17. 1847) 16. Diplotaxis carinifrons Bates. 20 Diplotaxis commixta Vaurie. Phileurus valgus (Olivier. 17. 17. 19. 20 16. 20 Phileurus didymus (Linné. 19. 1888 16. 19. 19 Strategus longichomperus Ratcliffe. 18. 18. Diplotaxis angustula Moser. 1758 16. 1889 19. 1758) 16. 1960 16. 1870 16. 17. 19.

19 Paranomala inconstans (Burmeister. 18 1834 Paranomala eucoma (Bates. 1887 16. 16 Nogueira. 1888 16. 1888) 16. 1887 16. 20 Macrodactylus lineatus Chevrolat. Benigno Gómez. 18 1884 Macrodactylus fulvescens Bates. 17. 19 1844) 218 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2002) Paranomala plurisulcata (Bates. 18 Diplotaxis simplex Blanch. 1855 16. León Felipe de la Mora-Estrada.. Carmen Pozo. 17 1834) Callistethus marginicollis(Bates. 19. 20 Diplotaxis yucateca Vaurie. 19 Callistethus cupricollis (Chevrolat. 19 1847) Paranomala marginicollis (Bates. 16. 19 Paranomala histrionella Bates. (continuación) Orden Familia Subfamilia Especie Referencia Diplotaxis rita Vaurie. Martín R. 1958 16. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 19 Macrodactylus dimidiatus Guérin. 1888) 16. 1888) 16. 18 Isonychus ocellatus Burmeister. 1851 16. 17 Calomacraspis splendens (Burmeister. 18. 1888) 16. 19 Coleoptera Scarabaeidae Melolonthinae Paranomala hoepfneri (Bates. 1888 16. 16. 16. 19 Paranomala mixeana (Morón & 12. 18 Hoplia argyritis Bates. 16 1888) Paranomala megalops (Bates. 16. 1887 16. 1888) 16 Paranomala valida (Burmeister. 16. 1960 16. 19 Paranomala flavizona Bates. 18 Hoplia inops Bates. 1844) 16. Domínguez. M.

17 Chlorota limbaticollis Blanchard. 1888 ) 16 Phalangogonia obesa Burmeister. 19 1844 Inca clathrata sommeri Westwood. 1888 16. 16 1850 Strigoderma vestita Burmeister. 1850 16. 18 Strigoderma mexicana Blanchard. (continuación) Orden Familia Subfamilia Especie Referencia Cnemida aterrima Bates. 19 Pelidnota punctulata Bates. 1888 16. 19 Chasmodia collaris Blanchard. 18 Strigoderma festiva Bates. 17. 1844) 16. 16 1881) Macropoides crassipes (Horn. 16. 16. 17. 17. 1850 16. 16. 19 219 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 19 Pelidnota strigosa Laporte. 19 1845 Trigonopeltastes sallei Bates. 1889 16. 20 1844 Pelidnota aurescens Bates. 1888 16. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 17 Macraspis aterrima (Waterhouse. 16. 1888 16. 17. 1888 16. 17. 19 Pelidnota centroamericana Ohaus 16. 19 Pelidnota notata Blanchard. 19 1873) Plesiorutela specularis (Bates. 19 Macropoidelimus mniszechi (Sallé. 17 Strigoderma sulcipennis Burmeister. 1850 16. 17. 1844 16. 1840 16 Pelidnota virescens (Burmeister. 19 1913 Coleoptera Scarabaeidae Melolonthinae Pelidnota guatemalensis Bates. 1866) 16.

2003 Ataenius sculptor Harold. 1936 1 Ataenius crenulatus Schmidt. 1859 31. 1933) 1 Labarrus pseudolividus (Balthasar. Domínguez. 3 1887) Canthon cyanellus LeConte. Carmen Pozo. 1869 1. Martín R. 1937 1 Martineziella vandykei (Hinton. 1887 1 Aphodius sallei Harold. 28 Ataenius communis Hinton . 1938 1 Ataenius jalapensis Bates. 32 Haroldiataenius limbatus (Bates. 1. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1867 1 Ataenius pseudousingeri Galante. 1874 1 Ataenius usingeri Hinton. Melolonthinae 16. 20 1988 Aphodius guatemalensis Bates. (continuación) Orden Familia Subfamilia Especie Referencia Trigonopeltastes glabella Howden. Benigno Gómez. 28 Ataenius chapini Hinton . 1887 32 220 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1. 1. 28 Ataenius texanus Harold. 1868 1. 32 1941) Ataenius aequalis Harold. 1880 1 Ataenius complicatus Harold. 1911 1 Ataenius perforatus Harold. 32 Scarabaeinae Canthon indigaceus LeConte. 1866 32 Canthon championi Bates. 4 1887) Haroldiataenius hintoni (Saylor. 1938 1 Aphodiinae Coleoptera Scarabaeidae Ataenius holopubescens Hinton. 1887 1 Ataenius languidus Schmidt. 1863 7. M. León Felipe de la Mora-Estrada. 12 Stebnicka & Verdú. 1936) 1 Parapsammodius integer (Bates. 1910 1.

2006 Canthidium pseudopuncticolle Solís y 31 Kohlmann. 1867) 32 Canthidium centrale Boucomont. 32 1863 Coprophanaeus gilli Arnaud. 31. 32 ter & Halffter) 1964) Deltochilium gibbosum sublaeve 31. 1858 32 Copris laeviceps Harold. 2004 Coprophanaeus corythus (Harold. 33 1887 Deltochilum scabriusculum Bates. 1997 31 Phanaeus endymion Harold. 31. 1887 Deltochilium mexicanum Burmeister. 32. 1863 31. 32 221 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1834 ) 10. Halffter & 10 Halffter. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 31. 32 1928 Canthidium pseudoperceptibile Kohl- 31 mann & Solís. 1964) Canthon vazquezae (Martínez. (continuación) Orden Familia Subfamilia Especie Referencia Canthon femoralis (Chevrolat. 32 1938 Deltochilium valgum acropyge Bates. 32 Bates. 31. 31 Canthon leechi (Martínez. 32 1848 Deltochilium pseudoparile Paulian. 31. 1869) 31 Dichotomius satanas (Harold. Halff- 10. 31 Coleoptera Scarabaeidae Scarabaeinae 1887 Copris lugubris Boheman. 1869 31 Dichotomius amplicollis (Harold.

1864)) 14 Chrysomelidae Cassidinae  Anisostena trilineata (Baly. Benigno Gómez. León Felipe de la Mora-Estrada. 1869 31 Ateuchus perezvelai Kohlmann.1844 31 Eurysternus magnus Castelnau. 31 2007 Uroxys microcularis Howden & Young. 32 Onthophagus rhinolophus (Harold. (continuación) Orden Familia Subfamilia Especie Referencia Phanaeus pyrois Bates. Carmen Pozo. 2006 Eurysternus caribaeus (Herbst. 1981 31. 32 Eurysternus foedus Guérin. 32 Onthophagus cyclographus Bates. Domínguez. 31. Martín R. 32 1869) Scarabaeidae Scarabaeinae Onthophagus yucatanus Delgado. 31 1887 Onthophagus incensus Say. M. 1961 Onthophagus crinitus Harold. 1887 31. 1863 31 Onthophagus carpophilus Pereira & 31 Halffter. 1862 31 Anisostena pilatei (Baly. 31 1981 Scatimus ovatus Harold. Harold. 1869 31. 2000 31 Ateuchus rodriguezi Preudhomme de 31 Borre. 1886 Uroxys deavilai Delgado y Kohlmann. 1789) 31. 1840 31 Eurysternus angustulus Harold. 1835 31 Onthophagus landolti Harold. 31 Coleoptera Peraza & Deloya. 1864)) 14 222 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 32 Phanaeus sallei. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1880 31 Onthophagus longimanus Bates 1887 31 Onthophagus maya Zunino.

13 1855) Charidotella opulenta (Boheman. 1995 13 Deloyala fuliginosa (OLivier. (continuación) Orden Familia Subfamilia Especie Referencia Charidotella bifossulata (Boheman. 1790) 13 Agroiconota vilis (Boheman. 1824) 27 Strongylaspis corticaria Erichson. 1997 223 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 27 Derobrachus sulcicornis LeConte. 27 1801). Prioninae Holonotus laevithorax (White. 13 Chrysomelidae Cassidinae 1855) Microctenochira ferranti (Spaeth. 1855) 13 Acanthoscelides sauli Romero. Cruz & Bruchidae Bruchinae 30 Kingsolver. 27 1848. 26 1880) Nemognathinae Cissites auriculata (Champion. 1860) 27 Brasilianus yucatecus Chemsak & 27 Noguera. 1853). 13 1926) Physonota convexa Borowiec. Cerambycinae Juiaparus mexicanus (Thomson. 26 Coleoptera 1880) Meloinae Meloidae Epicauta candezi (Haag-Rutenberg. 1892) 26 Stenodontes dasytomus (Say. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. Malacopterus tenellus (Fabricius. 13 1855) Helocassis testudinaria (Boheman. 2009 Epicauta vitticollis (Haag-Rutenberg. 27 Cerambycidae 1851.

1975 Aneflomorpha semirufa Linsley. León Felipe de la Mora-Estrada. 1935 27 Ironeus mutatus Bates. 1993 27 Eburia submutata 27 Chemsak and Linsley. 1993 Anelaphus piceus Chemsak. 1993. Martín R. 1885) 27 Elaphidion mimeticum Schaeffer. (continuación) Orden Familia Subfamilia Especie Referencia Coleoxestia nitida (Bates. 1872) 27 Eburia porulosa Bates. 1866. 1993 Orwellion gibbulum (Bates. 1973 Eburodacrys hesperidis 27 Chemsak and Linsley. Psyrassa sthenias Bates. 1880 27 Megapsyrassa chiapaneca 27 Giesbert. 1880). Carmen Pozo. Domínguez. 2005 23 Psyrassa basicornis Pascoe. 1892 27 Eburia schusteri Giesbert. 1935 27 Aneflus poriferus Giesbert. 1993 27 Anelaphus maculatus 27 Chemsak & Noguera. M. 1892 27 224 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1905 27 Conosphaerion concolorLinsley. 1970 Aneflomorpha giesberti 27 Chemsak & Linsley. Benigno Gómez. 23. 27 Pseudoperiboeum subarmatum 27 Linsley. 1962 27 Coleoptera Cerambycidae Cerambycinae Anopliomorpha reticolle (Bates. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1935 Psyrassa angelicae Toledo. 27 Psyrassa levicollis 27 Chemsak & Noguera. 1885 27 Ironeus pulcher Bates.

1892 27 225 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1872 27 Stenosphenus trispinosus Bates. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 27 Stenosphenus protensus Bates. 1867). 1885. 1970 Neocompsa ptoma Martins. 1872. (continuación) Orden Familia Subfamilia Especie Referencia Psyrassa tympanophora Bates. 1885 27 Obrium ruficolle Bates. 1860. 1885. 1867 27 Piezocera monochroa Bates. 1971 27 Coscinedes gracilis Bates. 27 Sphaerionillum pictum Bates. 1885. Stenosphenus languroides wappesi 27 Giesbert & Chemsak. 1860). 1824). Neocompsa exclamationis 27 (Thomson. 27 Coleoptera Cerambycidae Cerambycinae Neocompsa alacris (Bates. 1880 27 Stenosphenus rufipes Bates. 27 Terpnissa listropteria Bates. 1885 27 Pachymerola toledoi C 27 hemsak & Noguera. Neocompsa macrotricha 27 Martins. 1979 Acyphoderes cribricollis Bates. 27 Hexoplon calligrammum Bates. 1989 Stenosphenus ochraceus Bates. 1885) 27 Neocompsa clerochroa 27 (Thomson. 1872 27 Stizocera plicicollis (Germar. 1997 Acyphoderes amoena Chemsak & 27 Linsley. 1885 27 Stenosphenus cribripennis cribripennis 27 Thomson.

27 Acyphoderes yucateca (Bates. 1834) 27 Anthoboscus oculatus Giesbert. 1885. Martín R. 1993 Epimelitta postimelina Giesbert. Carmen Pozo. 1860) 27 Ochraethes pollinosa Chevrolat 1835 27 Placosternus difficilis 27 (Chevrolat. 1775) Plinthocoelium sapphirum 27 (Bates. Benigno Gómez. 1860) 27 Euderces pulcher (Bates. 1992 27 Dexithea fabricii (Chevrolat. 1855 27 Mionochroma vittatum 27 (Fabricius. 1996 27 Odontocera aurocincta Bates. (continuación) Orden Familia Subfamilia Especie Referencia Acyphoderes magna Giesbert. 1862) Plagionotus astecus (Chevrolat. 1879) Coleoptera Cerambycidae Cerambycinae Schwarzerion holochlorum 27 (Bates. 1993 Rhopalophora cupricollis 27 Guérin-Méneville. Domínguez. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1873 27 Odontocera fuscicornis Bates. 1885 27 Ischionodonta mexicana 27 Giesbert & Chemsak. 1991 27 Acyphoderes suavis Bates. 1885 27 Tomopterus vespoides White. M. León Felipe de la Mora-Estrada. 1874) 27 Cosmisoma reticulatum Bates. 1872) Ornithia mexicana (Sturm. 1892) 27 Crossomeles acutipennis Chemsak & 27 Noguera. 1873 27 Odonotocera clara Bates. 1844 226 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

1880 27 Lissonotus flavocinctus Dupont. 1847 27 Platyarthron bilineatum Guérin- 27 Méneville. 27 1838 Sphaenothecus maccartyi Chemsak & 27 Noguera. 27 1885 Lophalia cyanicollis (Dupont. 1885 27 Ischnocnemis caerulescens Bates. 1844) Sphaenothecus argenteus Bates. 1880 27 Sphaenothecus bivittatus Dupont. 1892 27 Chrysoprasis hypocrita Erichson. 1836 27 Ancylocera amplicornis Chemsak. 27 1935 Chrysoprasis guerrerensis Bates. 1997 227 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 27 1859. 1892 27 Hoegea distigma Bates. (continuación) Orden Familia Subfamilia Especie Referencia Rhopalophora lineicollis Chevrolat. 1880 27 Parevander xanthomelas (Guérin- 27 Méneville. 27 1859 Rhopalophora punctatipennis Linsley. 1838) 27 Metaleptus pyrrhulus Bates. 1844 Stenygra histrio Audinet-Serville. 1834 27 Deltosoma guatemalense Bates. Rhopalophora miniatocollis Chevrolat. Coleoptera Cerambycidae Cerambycinae 27 1963 Elytroleptus scabricollis Bates.

(continuación) Orden Familia Subfamilia Especie Referencia Sphaenothecus toledoi 27 Chemsak & Noguera. 1838 Stenobatyle eburata 27 Cerambycinae (Chevrolat. Stenobatyle miniaticollis 27 (Chevrolat. M. Carmen Pozo. 1880 27 228 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1862). Benigno Gómez. 27 1860) Taeniotes luciani Thomson. 27 1857 Lamiinae Parmenonta fulvosticta Bates. 1892). 1862). Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1997 Sphaenothecus trilineatus 27 Dupont. León Felipe de la Mora-Estrada. 1859 27 Tapeina transversifrons Thomson. 1885 27 Parmenonta ovatula Bates. 1969 27 Strangalia doyeni Chemsak & Linsley. Martín R. 27 Trachyderes mandibularis 27 Serville. 27 1976 Strangalia palaspina Chemsak. Domínguez. 1986 Plagiohammus spinipennis (Thomson. Stenobatyle prolixa (Bates. 27 1865) Plagiohammus decorus Chemsak & 27 Linsley. 1969 27 Lepturinae Mimolochus hoefneri (Thomson. 1834 Choriolaus howdeni 27 Giesbert & Wappes. 1999 Cyphonotida laevicollis Bates. 1880 27 Coleoptera Cerambycidae Strangalia bicolorella Chemsak.

1993 27 Oncideres rubra Franz. 1874 27 Desmiphora aegrota Bates. 1868) Oncideres albomarginata chamela 27 Chemsak and Giesbert. 1824) 27 Atrypanius implexus (Erichson. 1758) Myoxinus pictus (Erichson. 1880 27 Thryallis undatus (Chevrolat. 1778) 27 Lepturges infilatus Bates. 27 Acrocinus longimanus 27 Coleoptera Cerambycidae Lamiinae (Linnaeus. 1959 27 Taricanus truquii 1868 27 Atelodesmis unicolor Buquet. 1946 Lochmaeocles tessellatus 27 (Thomson. 27 Mecotetartus antennatus Bates. 1986 Oncideres cumdisci Noguera. 1847) 27 Canidia cincticornis balteatus 27 (Lacordaire. 1872 27 Lagocheirus simplicicornis Bates. 1872. 1852) 229 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. (continuación) Orden Familia Subfamilia Especie Referencia Lochmaeocles cornuticeps pacificus 27 Dillon & Dillon. 1857 27 Cymatonycha castanea Bates. 1847) 27 Oreodera glauca (Linnaeus. 1758) 27 Atrypanius conspersus (Germar. 1872 27 Lagocheirus undatus (Voet. 1834). 1872) Eutrichillus comus (Bates. 1872 27 Nyssodrysina haldemani 27 (LeConte. 1881) 27 Lagocheirus cristulatus Bates.

M. 1840) 230 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Domínguez. León Felipe de la Mora-Estrada. 2001 Acanthocephala alata 36 (Burmeister. 1872 27 Colobothea ramosa Bates. 39 1851) Pentatomidae Asopinae Apateticus lineolatus (Herrich-Schae- 39 ffer. 1999 27 Phaea kellyae Chemsak. 1775) Acanthocephala heissi Hemiptera 36 Brailovsky. 1840) 27 Aerenicopsis championi Bates. 2006 Ryhyparochro. 1857) 38 midae minae Alcaeorrhynchus grandis (Dallas. 1872 27 Phaea semirufa Bates. 1885 27 Carabidae Harpalinae Calleida kayae Casale. 1868 27 Phaea haleyae Chemsak. Martín R. 1999 27 Phaea rufiventris Bates. 1835) Coreidae Coreinae Acanthocephala femorata 36 (Fabricius. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 2008 29 Mozena perezae 37 Brailovsky and Barrera. Rhyparochro- Froeschneria piligera (Stål. 1999 27 Phaea maccartyi Chemsak. 1913 27 Mecas rotundicollis Thomson. 1852 27 Essostrutha laeta (Newman. 1872 27 Tetraopes discoideus LeConte. (continuación) Orden Familia Subfamilia Especie Referencia Oleonosus serrimanus Bates. Benigno Gómez. Carmen Pozo. 1999 27 Cerambycidae Lamiinae Coleoptera Phaea noguerai Chemsak. 1872 27 Colobothea sexualis Casey. 1858 27 Tetraopes umbonatus LeConte.

1993 Longuripes altaminor 40 Desutter-Grandcolas. 1993 Orthoptera Gryllidae Phalangopsinae Noctivox sanchezi 40 Desutter-Grandcolas. 1887 47 Lepidoptera Sphingidae Sphinginae Manduca occulta 47 Rothschild & Jordan. (continuación) Orden Familia Subfamilia Especie Referencia Oplomus dichrous 39 (Herrich-Schaeffer. 1862 39 Oplomus mundus Stål 1862 39 Hemiptera Pentatomidae Asopinae Perillus confluens 39 (Herrich-Schaeffer. 1993 Longuripes evanesca 40 Desutter-Grandcolas. 1775 47 Manduca dilucida Edwards. 1993 Noctivox ocote 40 Desutter-Grandcolas. 1775) 39 Longuripes sbordonii 40 Desutter-Grandcolas & Hubbell. 1844) 47 Manduca ochus (Klug. 1993 Niquirana chiapasi Gorochov. 1862 39 Stiretrus anchorago (Fabricius. 1838) Oplomus mutabilis Stål. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 1993 Noctivox hubbelli 40 Desutter-Grandcolas. 2007 41 Cocytius lucifer 47 (Rothschild & Jordan. 1839) Podisus affinis Distant. 1836) 47 231 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1903) Neococytius cluentius Cramer. 1903 Manduca lefeburei (Güerin.

1779) 47 232 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1856) 47 Hemeroplanes ornatus 47 (Rothschil & Jordan. 1758) 47 Pachyliodes resumens (Walker. Martín R. M. 1870 47 Sphinx merops Boisduval. 1771) 47 Lepidoptera Sphingidae Isognathus rimosus Grote. Benigno Gómez. 1782 47 Sphinx leucophaeta Clemens. 1775) 47 Manduca albiplaga (Walker. 1903) Manduca coralina (Druce. 1856) 47 Manduca florestan Cramer. 1771) 47 Adhemarius gannascur (Stoll. Carmen Pozo. 1770) 47 Erinnyis lassauxi (Boisduval. (continuación) Orden Familia Subfamilia Especie Referencia Manduca rustica (Fabricius. 1758) 47 Erinnyis oenotrus (Cramer. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. León Felipe de la Mora-Estrada. 1903 Pseudosphinx tetrio (Linnaeus. 1865 47 Erinnyis alope (Drury. 1779) 47 Madoryx pluto (Cramer. 1775) 47 Macroglossinae Pachylia ficus (Linnaeus. 1894) Hemeroplanes triptolemus 47 (Cramer. 1859) 47 Erinnyis ello (Linnaesus. Domínguez. 1856) 47 Manduca muscosa 47 (Rothschild & Jordan. 1870) 47 Protambulyx strigilis (Linnaeus. 1779) Madoryx oiclus (Cramer. 1782) 47 Erinnyis obscura (Fabricius. 1883) 47 Sphinginae Manduca lichenea (Burmeister. 1790) 47 Smerinthinae Adhemarius ypsilon 47 Rothschild & Jordan.

1777 47 Eumorpha anchemola (Cramer. 47 1777) Xylophanes belti (Druce. 1758) 47 Lepidoptera Sphingidae Macroglossinae Cauthetia spuria Boisduval. 1903) Callionima parce Fabricius. 1917 47 Nyceryx riscus Schaus. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 1780) 47 Eumorpha triangulum Rothschild & 47 Jordan. 1901) 47 Eumorpha satellita Linnaeus. 1777) 47 Perigonia lusca Fabricius. 1829) 47 Xylophanes ceratomiodes (Grote & 47 Robinson. 1875 47 Nyceryx mulleri Clark. 1777) 47 Enyo ocypete (Linnaeus. 1782) 47 Xylophanes amadis cyrene (Druce.1875) 47 Xylophanes porcus (Hübner. 1903 Eumorpha elisa (Smyth. 1775 47 Callionima falcefera (Gehler. 1877) 47 Xylophanes amadis (Stoll.1875) 47 Xylophanes pistacina (Boisduval. 1867) Xylophanes anubus (Cramer. 1758) 47 Enyo gorgon (Cramer. 1771 47 Eumorpha vitis (Linnaeus. (continuación) Orden Familia Subfamilia Especie Referencia Callionima innus 47 (Rothschild & Jordan. 1878) 47 233 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1943) 47 Enyo lugubris (Linnaeus. 1777) 47 Xylophanes tyndarus (Boisduval. 1890 47 Xylophanes pluto (Fabricius.

1788 48 Lepidoptera Heraclides thoas autocles 48 (Rothschild & Jordan. 1770 47 Macroglossinae Xylophanes libya (Druce. 1836 48 Parides panares lycimenes 48 (Boisduval. 1844) Anteos clorinde (Godart. Martín R. 1887) 47 Xylophanes turbata Edwards. 1758 47 Battus laodamas copanae 48 (Reakirt. 1775) 48 Phoebis philea philea (Linnaeus. M. 1824) 48 Anteos maerula (Fabricius. 1863) Papilionidae Parides erithalion Boisduval. 1779) 48 Eurema boisduvaliana 48 (Felder & Felder. Carmen Pozo. León Felipe de la Mora-Estrada. Benigno Gómez. Domínguez. 1763) 48 Phoebis sennae marcellina Pieridae 48 (Cramer. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1906) Dismorphia amphione praxione Dismorphiinae 48 (Doubleday. 1860) 234 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1782) 47 Xylophanes thyelia Linnaeus. 1836) Papilioninae Parides eurimedes mylotes 48 (Bates. 1777) Coliadinae Abaeis nicippe (Cramer. (continuación) Orden Familia Subfamilia Especie Referencia Xylophanes eumedon (Edwards. 1887 47 Xylophanes chiron nechus Drury. 1861) Heraclides anchisiades Esper. 1865) Eurema daira eugenia 48 (Wallengren. 1878) 47 Xylophanes neoptolemus (Stoll.

1870) 48 Rhetus arcius (Linnaeus.1790) 48 Napaea umbra Boisduval. (continuación) Orden Familia Subfamilia Especie Referencia Eurema mexicana mexicana 48 Pieridae Coliadinae (Boisduval. 1864 Mechanitis menapis doryssus 48 Bates. 1844) 235 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1867) 48 Apodemia palmeri (Edwards. 1866 Mechanitis polymnia lycidice 48 Nymphalidae Danainae Bates. 1809) 48 Riodinidae Riodininae Emesis emesia (Hewitson. 1836) Eureme salome jamapa (Rekirt. 1884 48 Pteronymia artena (Hewitson. 1863) Lepidoptera Lycorea halia cleobaea (Godart. 1870 48 Caria stillaticia Dyar. 1855) 48 Pteronymia cotytto 48 (Guérin-Méneville. 1819) 48 Dircenna klugii (Geyer. 1763) 48 Danaus gilippus thersippus 48 (Bates. 1837) 48 Melinaea lilis imitata Bates 1864 48 Mechanitis lysimnia utemaia 48 Reakirt. 1855) 48 Hypothyris lycaste (Fabricius. 1912 48 Lasaia agesilas Latreille. 1866) 48 Laothus oceia 48 Lycaenidae Theclinae (Godman & Salvin. 1864 Napeogenes tolosa (Hewitson. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 1887) Hemiargus hanno (Stoll. 1793) 48 Oleria victorine paula Weymer.

M. 1869 48 Cyllopsis pephredo (Godman. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1869 48 Caligo telamonius memnon 48 (Felder & Felder. Domínguez. 1780) 48 Lepidoptera Nymphalidae Opsiphanes tamarindi 48 Felder & Felder. Carmen Pozo. Martín R. 1808) 48 Satyrinae Cyllopsis hedemanni Felder. 1867) Cyllopsis gemma (Hübner. León Felipe de la Mora-Estrada. 1854 48 Morpho helenor (Cramer. 1861 Cepheuptychia glaucina (Bates. 1850 48 Eryphanis aesacus 48 (Herrich-Schäffer. 1775) 236 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1869) 48 Danainae Greta oto Hewitson. 1867) Caligo uranus Herrich-Schäffer. 1850) Morphinae Opsiphanes boisduvalii 48 Doubleday. Benigno Gómez. 1874) Cissia pompilia 48 (Felder & Felder. 1849. 1901) 48 Hermeuptychia hermes 48 (Fabricius. Opsiphanes cassina fabricii 48 (Boisduval. 1864) 48 Manataria hercyna maculata 48 (Hopffer. 1776) 48 Morpho polyphemus luna Butler. 1775) Megeuptychia antonoe 48 (Cramer. 1870) Opsiphanes quiteria (Stoll. (continuación) Orden Familia Subfamilia Especie Referencia Greta andromica lyra (Salvin.

1869) 48 Memphis perenna  Lepidoptera Nymphalidae 48 (Godman & Salvin. 1779) 48 Vareuptychia usitata Butler 1866 48 Consul electra (Westwood. 1775) Archaeoprepona demophon centralis 48 (Fruhstorfer. 1905 237 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1849) Fountainea eurypyle (Felder. 1850) 48 Consul fabius cecrops 48 (Doubleday. 1776 48 Satyrinae Taygetis thamyra (Cramer. 1869) 48 Memphis philumena xenica Charaxinae 48 (Bates. 1904) Archaeoprepona meander 48 (Cramer. 1862) 48 Memphis artacaena  48 (Hewitson. 1779) 48 Taygetis andromeda (Cramer. (continuación) Orden Familia Subfamilia Especie Referencia Pareuptychia metaleuca 48 (Boisduval. 1775) Prepona laertes octavia 48 Fruhstorfer. 1869) Memphis hedemanni (Felder. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 1904) Archaeoprepona demophoon gulina 48 (Fruhstorfer. 1884) Memphis pithyusa (Felder. 1864) Archaeoprepona amphimachus 48 (Fabricius. 1870) Pareuptychia hesione Sulzer.

48 1864) 238 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. 1836 48 Catonephele mexicana Jenkins & De 48 la Maza. 1861 48 Callicore lyca(Doubleday. 1848) 48 Hamadryas amphinome (Linnaeus. 1985 Catonephele numilia esite (Felder. Carmen Pozo. 1977 48 Adelpha leuceriodes l Beutelspacher. 1847) 48 Callicore tolima guatemalena ( Bates. 55 1917 Zaretis callidryas (Felder. 48 1866) Diaethria anna (Guérin-Méneville. M. Domínguez. 1848 48 Nessaea aglaura (Doubleday. 48 1844) Diaethria mixteca Maza. 48 1869) Myscelia cyaniris Doubleday. 48 1824) Epiphile adrasta Hewitson. 1823) 48 Biblidinae Hamadryas februa ferentina (Godart. León Felipe de la Mora-Estrada. 1779 48 Heliconiinae Biblis hyperia aganisa Boisduval. 1869) 55 Cyrestinae Marpesia chiron marius Cramer. 48 Lepidoptera Nymphalidae 1767) Hamadryas februa (Hübner. 1775) 48 Charaxinae Hypna clytemnestra mexicana Hall. (continuación) Orden Familia Subfamilia Especie Referencia Agrias amydon Hewitson. Martín R. Benigno Gómez. 48 1975 Limenitidinae Adelpha lycorias melanthe ( Bates. 1854 48 Siderone galanthis (Cramer.

(continuación) Orden Familia Subfamilia Especie Referencia Asterocampa idyja (Geyer. 1847 Heliconius charithonia vazquezae 48 Comstock & Brown. 1907 Chlosyne lacinia (Geyer. 1907 Siproeta epaphus (Latreille. 1758) 48 Astraptes brevicauda (Plötz. Pterogramma portalense Dipetar Limosininae 35 ridae Smith & Marshall. 1864) 48 Tegosa anieta luka Higgins. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 1. 1864) 48 Anthanassa ptolyca (Bates. 1773) 48 Anthanassa tulcis (Bates. 1758) 48 Anartia jatrophae luteipicta 48 Fruhstorfer. 1828) 48 Doxocopa laurentia cherubina Apaturinae 48 (Felder & Felder. 1775) 48 Smyrna blomfildia datis 48 Fruhstorfer. 1867) Doxocopa pavon (Latreille. 1981 48 Heliconius ismenius telchinia 48 Doubleday. 1813) 48 Siproeta stelenes biplagiata Lepidoptera Nymphalidae 48 Fruhstorfer. 1950 Heliconius erato (Linnaeus. 1809) 48 Colobura dirce (Linnaeus. 1886) 48 Astraptes anaphus (Cramer. 2004 239 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1758) 48 Historis odius (Fabricius. 1908 Anartia fatima (Linnaeus. 1837) 48 Nymphalinae Vanessa virginiensis (Drury. 1777) 48 Sphaeroce.

T. Acta Zoologica Cracoviensia. 1999. Acta Zoologica Cracoviensia 49B(1.2): 55-72. Verdú. R. 2011 Zelomorpha bejaranoi Braconiidae Agathidinae  45 Sarmiento. 2006 Referencias del Apéndice 1 1 Galante. Insecta Mundi. Galante. Puebla and Veracruz). Z. Domínguez.. 2005 Macrothemis tessellata  Odonata Libellulidae Trithemistinae 42 (Burmeister. and A. 4 Stebnicka & Skelley. S. A revision of the genus Haroldiataenius ­Chalumeau (Scarabaeidae: Aphodiinae: Eupariini). Tishechkin. 2004 Sphaeroce- Dipetar Limosininae ridae Robustagramma mirabile 40 Marshall & Cui. 1927 43. 2013. J. ZooKeys. III. M. 2003.44 Eupelmus (Episolindelia) fuscipectus Hemiptera Eupelmidae Eupelminae 46 Gibson.. Stebnicka. 5 Zaragoza-Caballero. Cantharoidea (Coleoptera) de México. El género Plateros Bourgeois (Lycidae: Erotinae: Olaterodini). 16 pp. Benigno Gómez. 46: 283–312. 240 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . The Aphodiinae and ­Rhyparinae (Coleoptera: Scarabaeidae) in southern states of Mexico (Chiapas. A new Neotropical genus of the Eupariini Psammodiini complex with comparative morphology of mouthparts structures and analysis of characters among related taxa (­Coleoptera: Scarabaeidae: Aphodiinae).R. 2009. E. Acta Zoológica Mexicana (nue- va serie) 78: 1-71. Insecta Mundi. Stebnicka & J. & E.K. A systematic revision of the ­genus ­Operclipygus Marseul. Oaxaca. 2 Caterino. León Felipe de la Mora-Estrada. Martín R. 2006. (continuación) Orden Familia Subfamilia Especie Referencia Pterogramma ochrofrons 39 Smith & Marshall. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 1. Z. 1839) Psocoptera Ptiloneuridae Loneura crenata Navás.S. M. Carmen Pozo. 2009. 271: 1-401 3 Verdú.

8:213-226. Six new species of Cymatodera from Mexico and Central America and the retention of  Cymatodera obliquefasciata  as a valid name (Cleridae. M. Tomaszewska & J. 45(2): 113-156 13 Borowiec L. Acta Zoológica Mexicana (nueva serie) 28(1): 118-132 10 Rivera-Cervantes L. E. Listado preliminar de los escarabajos (­Coleoptera: Melolonthidae) de la reserva “El Ocote”. 86: 155–223. Chiapas. Revista Mexicana de Biodiversidad. A. A. s. K. 2003. 7 Dellacasa.. Pp: 427-431.. Asiain. 84: 140–152. & J.& M. 24(1): 139-168. 2009.  2013. México (MXAL). The pilatei species group.W. Gordon & G. L. ­Guerrero. A. & Halffter G. Morón. Gómez y G ­ ómez. Primeros registros estatales de especies mexicanas de Staphylinidae (Insecta: Coleoptera). 2006. Tillinae). 15 Arriaga–Varela. A. 1998. Primer suplemento al Catálogo de tipos depositados en la colección M. 1994d.E.. Chiapas. 8 Arce-Pérez. M. M. Acapulco. 135: 213-302 12 Morón. Dellacasa. 2002b. C. Morón & B.s.S. Revision of the Phyllophaga s. L. (1594): 1–38 16 Pacheco-Flores. México 241 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 20: 615–722 G 14 Staines. Navarrete–Heredia. México. E. Morón. J. C.  El género  Hydrophilus  (Coleoptera: Hydrophilidae: Hydrophilinae) en Mexico y Centroamerica. D. R. In: Memo- rias del XXXIII Congreso Nacional de Entomología. Acta Zoológica Mexicana (n. Sociedad Mexicana de Entomología. R. A. A revision of the genus Anisostena Weise (­Coleoptera: ­Chrysomelidae.).F. A synopsis of the Endomychidae (Coleoptera: Cucujoidea) of México. 2013. 2012. Xalapa.  New records of Neotropical tortoise beetles (Coleoptera: ­Chrysomelidae: Cassidinae). schizorhina species group (­Coleoptera: Melolonthidae: Melolonthinae). Zookeys 299: 49–75. Part III.)77:23-150 11 Morón. México. 2007. Hispinae). 9 Márquez.). Acta Zoológica Mexicana (n. Aphodiinae described or ­recorded by Bates in Biología Centrali–Americana (Coleoptera S­ carabaeoidea: Aphodiidae). B. Insecta ­Mundi. (1999) Monografia de las especies Mexicanas de Canthon del subgenero Glaphyrocanthon: Acta Zoologica Mexicana (N. Fauna de escarabajos melolóntidos (Coleoptera: ­Scarabaeoidea) en el municipio de Villaflores.s. 2008. M. Folia Entomológica Mexicana. A. ­Zootaxa. The Canadian ­Entomologist. Castro-Ramírez. 17 Gómez y Gómez. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote 6 Burke A.International Journal of Invertebrate Taxonomy - ­ enus.

VI. 24 Aalbu. Elateridae. In: Entomología Mexicana vol. Coleoptera: Lamellicornia. Deloya. Atlas de los escarabajos de México. B. Revisión taxonómica del género Psyrassa Pascoe (­Coleoptera: Cerambycidae). México 20 Morón. D. European ­Journal of Entomology 102:737-776 23 Toledo. México 21 Casari. J. The Coleopterists Society Monograph 4:1-40. 21. 25 Villegas-Guzmán. 46(3): 263-428. Parra-Olea. Acta Zoológica Mexicana (n.. 49B(1-2): 89-114. Review of the genus Chalcolepidius Eshscholtz. Rosales-Esquinca. L. 4. M. Carmen Pozo. Vörös & G. 2005... M. S. J. complicatus-group (Coleoptera: Aphodiinae: Eupariini). ­Gutiérrez-Hernández. G. 1959. Revista Brasilera de Entomologia. Chiapas. H. 60: 599-609. 242 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . R. J. M. Ponce-Díaz.A. Chemsak. Vol. C. Ruiz. Acta zoologica cracoviensia. Benigno Gómez. (2005).s. 22 Corona. 2005. Z. Bulletin. 1867. Edivaldo Rodríguez y Lorena Ruíz-Montoya 18 Thomas. 47(4): 363-408. F. 28 Stebnicka. I Familia Melolonthidae. Revision of the A. Revista de Biología Tropical. C. Revision of western hemisphere Dacoderinae with a phylogenetic analysis of world taxa (­Coleoptera: Salpingidae). F. Zuart-Macías. The cerambycid fauna of the tropical dry forest of “El Aguacero. Ratcliffe & C. Quiroga-Madrigal & J. A. & ReyesCastillo. 2006. 2012. Pollock. V. 19 Morales-Morales.A. P. 1–64. G. The Coleopterists Bulletin 56: 515–532. A. The New World species of Ataenius Harold. 2005. O. P. ­ oadaptación entre los ácaros (Arachnida: Klinckowstroemiidae) y coleópteros C Passalidae (Insecta: Coleoptera). L. Revision of the subgenus Lampetis (Spinthoptera) (­Coleoptera: Buprestidae) of North and Central American. and the West Indies. 1993. F. A. Noguera. México. León Felipe de la Mora-Estrada. L. Domínguez. P. 2002. H. A. The Coleopterists. y CONABIO. Ocozocuautla. Mexico.. A. 26 García-París. Ma. M. Agrypninae). Graellsia. V. Hovore & E. J..” ­Chiapas. F. Sociedad Mexicana de En- tomología A. 27 Toledo. T. C.). R. M. 1997. Francke. Martín R. Sociedad Mexicana de Entomología. Sinopsis de los Meloidae (Coleoptera) de Chiapas (México) y comentarios sobre el género Denierota Kaszab. B. 2009.. & D. 1829 (­Coleoptera. Giesbert. Andrews. ­Melolóntidos (Coleoptera: Scarabaeoidea) de la zona de conservación ecológica Laguna Bélgica. 65:47-58. T... R. C. Pérez. A. F. 2002. Pp. R.144-148. Scarabaeidae (Coleoptera) of the Chiapanecan forest: A ­faunal ­survey and chorographic analysis.

39 Ortega-León. Contributions in Science. 1997. Two new Calleida species from Mexico (Coleoptera. de la Cruz Pérez. Morales y E. 0093: 1-11 31 Sánchez-Hernández. Chiapas. 38 Cervantes. 52: 174. 2001. B. A. 56 p 32 Blas. Diversidad de escarabajos copronecrófagos (­Coleoptera: Scarabaeidae: Scarabaeinae) asociados a tres ambientes en Emilio ­Rabasa. A review of the New World Genus ­Pterogramma Spuler and a revision of the Pterogramma sublugubrinum group.. Distribución de la subfamilia Asopinae (Hemiptera: ­Heteroptera: Pentatomidae) para México. Gómez. Insecta Mundi. Serie Zoología. 33 Cano E. Tuxtla Gutiérrez. UNICACH. A. Briceño. Seed beetles (­Coleoptera: Bruchidae) associated with Acacia cornigera (L. En: Riechers. M.. 75-87). A. 2010b. Hernández (Comp. Marshall. Lebiini). 26(3): 685. Florida ­Entomologist. & B. Chiapas. L. The Coleopterists Bulletin. 2008. Coreidae. J. & S. Denisia (nueva serie) 50: 249-268. Coreinae. E. Tesis de Licencia- tura en Biología. Folia Entomológica Mexicana. M.45: 1-104 35 Smith. 2006. 2006. 77: 25–29 30 Romero N. & Kingsolver.). 37 Brailovsky. Instituto de Historia Natural. México. Acta Zoologica Mexicana. A ­ canthocephalini). 2004. J. 2013. Six new species of Mozena from ­Mexico (­Heteroptera: Coreidae: Coreinae: Nematopodini). J. 1998. I. P.178. Revisión de las especies de Phyllophaga (Phytalus) grupos ­obsoleta y pallida (Coleoptera: Melolonthidae: Melolonthinae). 243 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2009.703. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote 29 Casale. Descripción de los estadios ­ninfales de ­Froeschneria piligera (Stal) (Hemiptera: Heteroptera: Lygaeoidea: ­Rhyparochromidae: ­Myodochini) su distribución en México y notas sobre su ­biología. Laguna Bélgica: Patrimonio natural e interpretación ambiental. H. with description of a new species of Acanthoscelides Schilsky. M. Barrera. H.. 499: 1-163. Anales Instituto Biología Universidad Nacional Autónoma México. Annals of Carnegie Museum. Deltochilum valgum acropyge Bates (Coleoptera: ­Scarabaeidae): Habits and Distribution. 34 Morón. Reserva de la Biosfera Selva ElOcote. 2009.) Willd. 84(1):99-111.A. G. & M. A review of the Mexican species of Acanthocephala ­Laporte. G. & E. C ­ arabidae. 36 Brailovsky. with description of one new species (Heteroptera. Escarabajos (Coleoptera: Scarabaeidae) (pp. 68: 53-89. A.

P. Mexico. León Felipe de la Mora-Estrada. 89-100). Benigno Gómez. 244 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Tuxtla Gutiérrez. Jones & A. 53(4): 153-158 48 Jiménez.L. O. Louton. Ed. E. The Sphingidae (Hetero­cera) of the “El Ocote” Reserve . Mariposas(pp. Chiapas. 2009. E. J. Journal of teh Lepidopterists Society. 2951: 1–97 47 Gómez-Nucamendi. International Journal Speleology. 368 pp. The species of  Eupelmus  (Eupelmus) Dalman and E ­ upelmus (Episolindelia) Girault (Hymenoptera: Eupelmidae) in North America north of Mexico. University of Kentucky Doctoral Dissertations. 1999. 2006.. R. von Ellenrieder & J. R. Laguna Bélgica: Patrimonio natural e interpretación ambiental. ­Luzarinae). 2007: Taxonomic study of Mexican Phalangopsinae (­Orthoptera: Gryllidae). A. Morón. Marcelo Cutrim. N.N. A.V. M.A. Chiapas. 16(2): 177–200. Hernández (Comp. Edivaldo Rodríguez y Lorena Ruíz-Montoya 40 Desutter-Grandcolas & Hubbell. Carmen Pozo. Morales y E. W. Taxonomic revision of Zelomorpha ­ASHMEAD. In Desutter-Grandcolas. 1920 (Braonidae: ­Agathidinae) with a ­phylogenetic analysis of color patterns. Grylloidea: Phalangopsidae. 43 García-Aldrete A. En: Riechers. Revisao taxonómica e filogenia do g­ énero neotropical Loneura Navás. Estados Unidos. The Johns ­Hopkins University Press.. ­Instituto Nacional de Pesquisas de Amazonia. México. phylogeny and the ­evolution of ­troglobiotic life (Orthoptera.. programa de Pósgraduaçao em Biologia Tropical e Recursos Naturais 45 Sarmiento-Monroy.). Journal New York Entomological ­Society. Martín R. Dragonfly Genera of the New World: an illustrated and annotated key to the Anisoptera. Zoosystematica rossica. (1997): A new species of Loneura (Psocoptera: ­Ptiloneuridae) from Chiapas. 105 (3-4): 186-189. 2011. 2006. 42 Garrison. Domínguez. 44 Moreira de Castro. 1993. C. 1927 (Psocoptera: Ptiloneuridae). 1900 and Hemichoma Enderlein. A. A. G. Instituto de Historia Natural. The cricket ­fauna of Chiapanecan caves (Mexico): systematics. Zootaxa. 351pp 46 Gibson. 22(1-4):44  41 Gorochov.

1869) *Eurema arbela boisduvaliana Eurema (C. 1865) Parides eurimedes mylotes Papilionidae Papilioninae Parides (H. Phoebis Phoebis philea philea (Linnaeus. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 2. 1887) Lycaenidae Polyommatinae Hemiargus Hemiargus hanno antibubastus Hübner [1818] 245 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Felder. 1777) Pieridae *Pyrisitia nise nelphe (R. 1836) Pierinae Pieriballia Pieriballia viardi (Boisduval. 1775) *Eurema albula celata (R. 1844) Anteos *Anteos clorinde (Godart. 1860) Glutophrissa Glutophrissa drusilla tenuis (Lamas 1981) Leptophobia Leptophobia aripa elodia (Boisduval. 1861) Parides photinus (Doubleday. 1844) Heraclides thoas autocles Heraclides (Rothschild & Jordan. 1836) *Phoebis argante ssp n. [1824]) *Phoebis agarithe agarithe (Boisduval. 1836) Ascia Ascia monuste monuste (Linnaeus. 1777) Coliadinae Aphrissa Aphrissa statira statira (Cramer.W. Rhopalocera Familia Subfamilia Género Especie Protographium agesilaus neosilaus Protographium (Hopffer. 1865) Eurema daira eugenia (Wallengren. Felder & R. Felder. 1764) Theclinae Strymon Strymon serapio (Godman & Salvin. 1763) *Phoebis sennae marcellina (Cramer. Felder. 1906) Dismporphia amphione praxinoe Dismorphiinae Dismporphia (Doubleday. Lista taxonómica de mariposas (Lepidoptera) registradas en cuatro localidades de la Reserva de la Biosfera Selva El Ocote (REBISO) *Especies registradas con anterioridad por López-Gutierrez (2015). 1869) Pyrisitia Pyrisitia proterpia (Fabricius. Bates.

[1855]) *Morpho helenor montezuma Morpho Morphinae Guenée. [1855]) Greta andromica lyra (Salvin. 1852 Nymphalidae Dircenna *Dircenna klugii klugii (Geyer. 1869 Caligo Caligo uranus Herrich-Schäffer. León Felipe de la Mora-Estrada. M. 1869) Greta *Greta morgane oto (Hewitson. 1857 Riodininae Detritivora Detritivora zama H. 1863) Danainae Danaus *Danaus plexippus plexippus (Linnaeus. 1868 *Danaus gilippus thersippus (H. 1881 Manataria hercyna maculata Manataria (Hopffer. 1907 Opsiphanes quiteria quirinus Nymphalidae Godman & Salvin. 1864) Chloreuptychia sericeella Chloreuptychia (H. Domínguez. 1874) Satyrinae *Cepheuptychia glaucina Cepheuptychia (H. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 2. Bates. Bates. Benigno Gómez. Bates. [1844]) Godyris Godyris nero nero (Hewitson. 1837) Ithomiinae *Pteronymia cotytto cotytto Pteronymia (Guérin-Méneville. 1859 Morpho Morpho polyphemus luna Butler. 1878) Riodinidae Mesosemia Mesosemia lamachus Hewitson. Bates.W. 1758) Mechanitis Mechanitis lysimnia utemaia Reakirt.W. 1864) 246 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .W. Carmen Pozo. 1870) Morphinae Opsiphanes invirae relucens Opsiphanes Fruhstorfer.W. 1866 Napeogenes tolosa tolosa Napeogenes (Hewitson. (continuación) Familia Subfamilia Género Especie Euselasia inconspicua Euselasiinae Euselasia (Godman & Salvin. Martín R. 1850 Opsiphanes cassina fabrici (Boisduval. 1855) Ithomia Ithomia patilla Hewitson.

1887) Cissia pompilia (C. 1767) *Pareuptychia metaleuca metaleuca Pareuptychia (Boisduval. 1869 Hermeuptychia hermes (Fabricius. 1775) Hermeuptychia Satyrinae Hermeuptychia sp. 1905) Archaeoprepona demophoon gulina (Fruhstorfer. Magneuptychia Magneuptychia libye (Linnaeus. 1931 Taygetis Nymphalidae Taygetis kerea Butler. 1983 Cissia similis (Butler. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 2. Pseudodebis *Pseudodebis zimri (Butler. Felder.W. Bates. (continuación) Familia Subfamilia Género Especie *Cissia confusa (Staudinger. 1884) Memphis philumena xenica Memphis (H. 1869) *Archaeoprepona amphimachus amphiktion Fruhstorfer. 1916 Archaeoprepona demophon centralis Archaeoprepona (Fruhstorfer. 1904) *Mestra dorcas amymone Biblidinae Mestra (Ménétriés. 1869) Taygetis inconspicua Draudt. 1867) Cissia Cissia pseudoconfusa Singer. 1869 Yphthimoides *Yphthimoides renata (Stoll. DeVries & Ehrlich. 1780) Consul Consul electra electra (Westwood. [1849]) *Memphis forreri (Godman & Salvin. Felder & R. 1864) Memphis pithyusa pithyusa Charaxinae (R. 1850) Consul Consul fabius cecrops (Doubleday. Felder. 1870) Pareuptychia ocirrhoe ssp. n. 1857) 247 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1867) Cyllopsis hedemanni hedemanni Cyllopsis R. Felder.

1938 Dione Dione juno huascuma (Reakirt. Maza.W. 1866) Dryas *Dryas iulia moderata (Riley. Benigno Gómez. 1908 Smyrna *Smyrna karwinskii Geyer. [1833] Nymphalidae Anartia *Anartia fatima fatima (Fabricius. 1758) *Smyrna blomfildia datis Fruhstofer. 1916 *Siproeta epaphus epaphus Siproeta (Latreille. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 2. [1848]) *Hamadryas februa ferentina (Godart. 1950 Heliconius *Heliconius erato petiverana Doubleday. [1813]) *Chlosyne janais janais (Drury.M. Felder. 1864) *Euptoieta hegesia meridiania Euptoieta Stichel. M. 1926) Heliconiinae Eueides Eueides isabella eva (Fabricius. 1793) Junonia evarete nigrosuffusa Junonia Nymphalinae Barnes & McDunnough. 1847 248 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1952 Adelpha paraena massilia Adelpha (C. 1867) Colobura Colobura dirce dirce (Linnaeus. Carmen Pozo. [1824]) Hamadryas *Hamadryas feronia farinulenta Biblidinae (Fruhstorfer. 1907 *Dynamine postverta mexicana Dynamine d’Almeida. (continuación) Familia Subfamilia Género Especie Catonephele mexicana Catonephele Jenkins & R. León Felipe de la Mora-Estrada. 1855) Anthanassa Anthanassa frisia tulcis (H. 1985 *Nessaea aglaura aglaura Nessaea (Doubleday. Bates. Brown. Felder & R. 1782) Chlosyne Chlosyne theona theona (Ménétriés. 1916) Temenis laothoe hondurensis F Temenis ruhstorfer. 1793) *Heliconius charitonia vazquezae W.G. Martín R. Domínguez. Comstock & F.P.

1955 249 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Felder. 1847 Pyrginae Chioides Chioides albofasciatus (Hewitson. 1907) Urbanus Urbanus teleus (Hübner. 1882) Nisoniades Nisoniades godma Evans. 1767) Heliopetes Heliopetes arsalte (Linnaeus. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 2. 1758) Remella Remella rita Evans. 1867) Urbanus viterboana (Ehrmann. (continuación) Familia Subfamilia Género Especie Heliconius ismenius telchinia Heliconiinae Heliconius Nymphalidae Doubleday. 1821) Urbanus tanna Evans. 1953 Pellicia dimidiata dimiditata Pellicia Hesperiidae Hesperiinae Herrich-Schäffer. 1869) Antigonus Antigonus corrosus Mabille. 1870 Carrhenes canescens canescens Carrhenes (R. 1952 Autochton Autochton longipennis (Plötz. 1878 Pyrgus Pyrgus oileus (Linnaeus.

2006) Eurysternus Eurysternus angustulus (Harold. Carmen Pozo. 1887) Dichotomius amicitiae (Kohlmann & Solís. 1928) Canthidium moroni (Kohlmann & Solis. Domínguez. 1964) Canthon vazquezae (Martínez. 1869) 250 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . M. 2000) Ateuchus rodriguezi (Preudhome de Borre. León Felipe de la Mora-Estrada. 1886) Canthidium Canthidium centrale (Boucomont. 1887) Deltochilum sublaeve (Bates. 1863) Deltochilum mexicanum (Burmeister. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 3. Lista taxonómica de escarabajos (Coleoptera: Scarabaeinae) de cuatro localidades de la Reserva de la Biosfera Selva El Ocote (REBISO) Familia Subfamilia Género Especie Scarabaeidae Scarabaeinae Ateuchus Ateuchus perezvelai (Kohlmann. 1869) Dichotomius carolinus (Martínez. 2006) Canthidium pseudoperceptibile (Kohlmann & Solis. 1859) Canthon meridionalis (Martínez & Halffter. 1951) Dichotomius colonicus (Say. 1869) Copris lugubris (Boheman. Dichotomius 1997) Dichotomius amplicollis (Harold. 1981) Canthon Canthon cyanellus (LeConte. 1964) Copris Copris laeviceps (Harold. 1858) Coprophanaeus Coprophanaeus corythus (Harold. 1835) Dichotomius maya (Peraza y Deloya. Benigno Gómez. 1938) Deltochilum scabriusculum (Bates. 2006) Canthidium pseudopunticolle (Howden & Young. Martín R. Halffter & Halffter. Deltochilum 1848) Deltochilum pseudoparile (Paulian.

1868) Onthophagus Onthophagus anthracinus (Harold. Uroxys 1981) 251 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1873) Onthophagus batesi (Howden & Cart- Onthophagus wright. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 3. 1835) Onthophagus Onthophagus landolti (Harold. 1880) Onthophagus Onthophagus maya (Zunino. 1863) Scatimus Scatimus ovatus (Harold. 1789) Ontherus Ontherus mexicanus (Harold. 2006) Phanaeus Phanaeus endymion (Harold. 1981) Onthophagus Onthophagus rhinolophus (Harold. (continuación) Familia Subfamilia Género Especie Eurysternus Eurysternus caribaeus (Herbst. Peraza y Onthophagus Deloya. 1862) Uroxys microcularis (Howden & Young. 1963) Onthophagus Onthophagus incensus (Say. 1969) Onthophagus yucatanus (Delgado.

1862 x x Panchlora Panchlora nivea Saussure. 1862 x Blaberidae Panchlora sp 1 Burmeister. Carmen Pozo. Méx. M. Benigno Gómez. León Felipe de la Mora-Estrada. 1920 x x x Anaplecta Anaplecta mexicana Saussure. Blaberus Blaberus craniifer x 1838 Anaplecta Anaplecta fallax Saussure. Pseudomops interceptus x x Pseudomops 1838) Pseudomops sp 1 Ectobiidae Xestoblatta aff castanea Xestoblatta Xestoblatta sp 1 Xestoblatta sp 3 252 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 1773) x x Ischnoptera sp 1 Ischnoptera sp 2 Ischnoptera sp 3 Ischnoptera sp 4 Ischnoptera sp 5 (Burmeister. Lista taxonómica de las cucarachas de la Reserva de la Biosfera Selva el Ocote (REBISO) Nuevo Registro Familia Género Especie Autoridad REBISO Chis. 1903 x x Panclora azteca Saussure. 1868 x Epilampra Epilampra maya Rehn. 1862 x x occidentalis Ischnoptera Ischnoptera rufa rufa (De Geer. 1868 x x Anaplecta aff moxa Chromatonotus Chromatonotus sp 1 x x x Ischnoptera aff deropteliformis Ischnoptera aff panamae Ectobiidae Ischnoptera rufa Saussare. 1862 x x Anaplecta hemiscotia Hebard. Epilampra azteca Saussare. Domínguez. Martín R. Edivaldo Rodríguez y Lorena Ruíz-Montoya Apéndice 4.

1916) x x Latiblattella Latiblattella sp 1 x x Plectoptera Plectoptera sp 1 x x Anisopygia Anisopygia sp 1 (Fabricius. (continuación) Nuevo Registro Familia Género Especie Autoridad REBISO Chis. Xestoblatta sp 4 Xestoblatta Xestoblatta sp 5 Megaloblatta Megaloblatta sp 1 Cariblatta Cariblatta aff imitans Chorisoneura Chorisoneura gemmicula Hebard. Diversidad de insectos colectados en cuatro localidades de la Reserva de la Biosfera Selva El Ocote Apéndice 4. 1811) Imblattella Imblattella fratercula (Hebard. 1920 x x Ectobiidae Euphyllodromia Euphyllodromia angustata (Latreille. Periplaneta australiasiae x 1775) Blattinae Periplaneta- Burmeister. Méx. Periplaneta brunnea x 1838 Corydiidae Compsodes Compsodes sp 1 x x 253 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

.

debido a una alta tasa de recambio entre las parcelas. Chiapas. Barrio María Auxiliadora. Veinte Casas (555 m). Emilio Rabasa (728 m).1 hectáreas se registraron 191 especies.mx Resumen Se presenta un análisis de la riqueza y diversidad de árboles presente en cinco loca- lidades de la Reserva de la Biosfera Selva El Ocote: El Encajonado (190 m). E-mail: nramirezm@ecosur.1 Miguel Martínez-Icó.1 Alfonso Luna-Gómez. San Joaquín (936 m) y Nuevo San Juan Chamula (1066 m). Chiapas. Carretera Panamericana s/n. Chiapas Neptalí Ramírez-Marcial. México) 2 Escuela Nacional Superior de Ciencias Agronómicas de Burdeos-Aquitaine. México. 126 géneros y 57 familias. Unidad San Cristóbal (San Cristóbal de Las Casas. De un total de 2116 árboles (diámetro a la altura del pecho mayor a 10 cm) censados en 42 parcelas circulares de 0.032) entre las localidades (21-35 m2 × hectárea). La composición. (Gradignan. por lo que este parámetro varió significativamente (P = 0.P. Francia) Correspondencia: Neptalí Ramírez-Marcial. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. C. El Colegio de la Frontera Sur. Departamento de Conservación de la Biodiversidad. estructura y diversidad de árboles mostró alta diversidad local y regional. El área basal se incrementó conforme a la altitud de las parcelas. El Colegio de la Frontera Sur.1 Chlöe Buet2 y Nathaline Elena Taylor-Aquino1 1 Departamento de Conservación de la Biodiversidad. 29290 San Cristóbal de las Casas. Estos patrones 255 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . El tipo de vegetación predominante tanto en la zona núcleo y parte de la zona de amortiguamiento de la REBISO correspon- de a diversas asociaciones florísticas de la selva mediana subperennifolia.

FAO 2015). derivadas de la constante presión de las actividades humanas (Sax y Gaines 2003. Aunque se encontraron varias especies de distribución amplia. 2016). de tal suerte que prácticamente todos los bienes y servi­cios ecosistémicos que son necesarios para la supervivencia humana. Asimismo. área basal. conjuntamente con cambios climáticos globales afectan a la diversidad biológica a distintas escalas. se identificaron 47 especies presentes con un solo individuo. La pérdida de la cobertura forestal y consecuente pérdida de la riqueza de especies vegetales es considerada como una forma de evaluar la vulnerabilidad de un sistema natural. en estrecha relación con 256 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . desde lo local a lo planetario (FAO 2015. rique- za. Chlöe Buet y Nathaline Elena Taylor-Aquino sugieren que la vegetación actual es la resultante del efecto de procesos regionales y locales que promueven una alta diversidad de árboles. sucesionales intermedias y tardías varió entre las localidades. La vegetación tiene un papel fundamental para la regulación de los ciclos biogeoquímicos del planeta. inventarios forestales. Neptalí Ramírez-Marcial. Los datos más recientes de la condición de los bosques y selvas indican que las tasas de deforestación a nivel mundial. La mayor proporción de especies secundarias se registró en El Encajonado y las tardías en Emilio Rabasa y Veinte Casas. Se concluye que la vegetación actual está en condiciones óptimas de desarrollo y no se detectaron amenazas directas a su mantenimiento dentro de las áreas núcleo. Alfonso Luna-Gómez. la distribución de especies pioneras. depen­ den de la dinámica de la vegetación (FAO 2015). Palabras clave: Áreas Naturales Protegidas. Miguel Martínez-Icó. Sin embargo. se requiere de un muestreo y análisis más detallado dentro de las principales áreas de uso forestal en cada localidad para conocer el efecto de los aprovechamientos sobre la estructura y diversidad del bosque. Introducción La situación de los bosques tropicales a nivel mundial es preocupante por la conti- nua deforestación y degradación de su estructura y funcionalidad. Franklin et al. estructura de la vegetación. Hoy en día nadie niega que la condición de los ecosistemas naturales esté alterada por los cambios globales derivados de los patrones de uso de la tierra promovidos por la continua acción humana.

Aún persiste un activo debate sobre la relación entre los procesos locales y regionales que determinan la diversidad. Newton 2007). además de otros factores de heterogeneidad ambiental (González-Espinosa et al. 2014). la evaluación de S se ha abordado frecuentemente a partir de la información obte- nida de inventarios forestales de tamaño variable (Gotelli y Colwell 2001. estructura. se consideran 257 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Mittelbach 2012. plenamente reconocibles y dife- renciados entre sí. Por ejemplo. cobertura. es posible identificar cambios temporales en la estructura y composición de las especies dentro de las comunidades (Mao y Colwell 2005). Chiapas la vulnerabilidad de una sociedad humana que depende de dicho sistema natural para mantener sus modos de vida (González-Espinosa et al. Por medio de estas estimaciones se puede inferir varias propiedades de las comunidades biológicas como su diversidad. entre otras (Newton 2007). uniformidad en la distribución de la abundancia o dominancia. 2016). Para el caso de la vegetación arbórea. Con las evaluaciones de S. Mittelbach 2012). 2014).4% de las casi 16.000 especies de árboles) corresponden a la mitad de la densidad de todos los árboles estimados (3. El cálculo y expresión de S normalmente se representa mediante el número de especies encontradas por unidad de área (densidad de especies) o también con base en el esfuerzo de muestreo. Particularmente se reconoce que la diversidad de especies puede variar en función de distintas escalas espaciales o temporales (Ricklefs y Schluter 1993. sino que es útil para valorar la “calidad ecológica” de un sistema socio-ambiental (González-Espinosa et al. en tanto se repitan en el espacio y tiempo. La diversidad de especies puede variar en función de diversos factores cli- máticos. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. la evaluación de la riqueza de especies y su diversidad no es sólo un método convencional para comparar números entre situaciones ecológicas determinadas. Ramírez-Marcial et al. evaluado a través del número de indi- viduos muestreados (Gotelli y Colwell 2001). 2014. biomasa). En cambio. Convencionalmente se usa el concepto de riqueza de especies (S) como una variable biológica para evaluar la importancia de un área determinada para albergar diversos números de taxones (especies). los recientes análi- sis de la diversidad de árboles en los bosques amazónicos revelaron que existe un grupo de especies hiper-dominantes (1. dominancia (área basal. 2005. Blundo et al. se encontró que cerca de 11. geográficos o de disturbio. 2008.000 especies. cober- tura. De esta manera.9 × 1011 individuos).

Finalmente también se ha invocado el efecto de las perturbaciones (tanto naturales como aquellas derivadas de la acción humana) que afectan la diversidad de especies (Connell 1978. los procesos más importantes que regulan la diversidad son la especiación. mientras que a escala regional. 2013). 2012). Chlöe Buet y Nathaline Elena Taylor-Aquino poco abundantes. se reconoce que los procesos locales determinan la estructura de una comunidad definida (Broker et al. 2015). Miguel Martínez-Icó. Neptalí Ramírez-Marcial. Alfonso Luna-Gómez. También se reconoce que la heterogeneidad ambiental y la limitación a la dispersión son procesos que afectan la distribución de la especies a diferentes escalas (e. 2004. aunque también se ha retomado el papel de los procesos regionales. Ramírez-Marcial et al. escasas o raras. los autores proponen que existen factores regionales históricos que han configurado acervos florísticos distintivos (Slik et al.g. Asimismo en el estudio más reciente de la diversidad de árboles a escala mundial (Slik et al. Por ejemplo. los cuales influyen en la estructuración de las comunidades locales de árboles (Ricklefs 2009. aunque solo sean localmente dominantes (ter Steege et al. Blundo et al. 2001. Tilman et al. Ricklefs y He 2016). Bajo esta perspectiva.12% de toda la densidad de árboles. Debido a que muy pocas especies son compartidas entre las tres regiones tropicales antes indicadas. existen entre 40. Varias de las especies hiper-dominantes se caracterizan por ocupar una gama amplia de hábitats. se espera que una comunidad puede estar “saturada” de especies y que la aparición de una o más especies nuevas ocurre solo en caso de que se extingan localmente otras.000 especies de árboles tropicales a nivel mundial. 2016). Huston 1979.000 y 53. migración y extinción (Stroop et al. Otro tema de debate actual es el relativo a la existencia o no de los límites eco- lógicos que determinan la diversidad a escalas continentales o más grandes (Har- mon y Harrison 2015. Rabosky y Hurlbert 2015). 2015) se re- portó que con base en la información procedente de inventarios forestales. Blun- do et al. se acepta que la diversidad a escala local está regulada por procesos de extinción aleatoria local y por el efecto de diferentes interacciones competitivas y de depredación. 2012). González-Espinosa et al. hay algunos consensos en el reconocimiento de ciertos procesos locales y regionales que determinan la diversidad biológica (Ricklefs y Schluter 1993. lo cual les permite tener amplias distribuciones. 2005. 2009). En complemento a es- tas interpretaciones. 2009). Por otro lado. 258 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . además se documentó que la región Indo-Pacífica es significativamente más rica en especies que la región Neotropical y la región africana la más pobre en especies. al representar solo el 0.

Wet.013 km2 que se localiza en la porción noroccidental del estado de Chiapas (16°45’42” y 17°09’00” de latitud Norte y 93°54’19” y 93°21’20” de longitud Oeste). o sus equivalentes en la clasificación de los tipos de ve- getación de Chiapas (Breedlove 1981. Con dicho análisis. Ochoa-Gaona 1996). Plascencia-Vargas et al. se presenta una descripción de la riqueza y diversi- dad de árboles registrada en cinco localidades de la reserva de la biosfera Selva El Ocote y se discuten algunas explicaciones de los procesos ecológicos que ayuden a interpretar la relación entre la diversidad local y regional de árboles dentro de la reserva. Esta área natural protegida está considerada de alta importancia biológica y cultural debido a su cercanía con las selvas de los Chimalapas. Prácticamente todo el sustrato geológico corresponde a calizas del Cretácico inferior y Terciario. or Rain Forest (Holdridge 1967). 2014). manejo y conservación de árboles en la REBISO. 1963. la topografía es accidentada y abrupta. la vegetación dominante corresponde a la Selva Mediana Subperennifolia (Wendt 1993. Oaxaca y las de Uxpanapa. las que en su conjunto conforman un corredor biológico que caracteriza a la selva zoque (CONANP 2011). parcialmente (Miranda y Hernández-X. Gómez-Pompa 1965. El clima se clasifica como cálido húmedo (tipo Am) a cálido subhúmedo (Am(f)) con lluvias en casi todo el año y temperatura del mes más frío mayor a 18°C (García 2004). Veracruz. La REBISO comprende una superficie de 1. Chiapas En el presente capítulo. Selva Mediana o Baja Perennifolia. 259 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Pennington y Sarukhán 2005). parcialmente (Miranda 2015). parcialmente (Rzedowski 1978) o Tropical Montane Moist. lo que ha dado lugar a suelos someros y pedregosos. Bosque Tropical Perennifolio. pretendemos ofrecer información relevante de la condición de la vegetación y sus posibles implicaciones para el uso. Se eli- gieron cinco localidades ubicadas en los márgenes de la zona núcleo de la Reserva de la Biosfera Selva El Ocote (REBISO). con pendientes pronunciadas y numerosos acantilados (Flamenco-Sandoval 2007. Materiales y métodos Descripción del área de estudio El trabajo de campo se desarrolló durante noviembre de 2014 a junio de 2015. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. González-Espinosa y Ramírez-Marcial 2013): Selva Mediana y Baja Siempre Verde.

cultivo maíz y frijol maíz y café chile de maíz y frijol.478854 -93.2000 1300 1200 – 1500 anual (mm) Temperatura media 24. Origen étnico Español  Tsotsil Español Español  Tsotsil Las columnas están arregladas de la localidad a menor altitud a la más alta. chile.988479 16.616394 -93. Miguel Martínez-Icó. 260 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .822119 -93.9 20.057162 16. Neptalí Ramírez-Marcial.7 21.515608 (grados decimales) Altitud media 190 555 728 936 1066 (msnm) Precipitación media 2000 .8 20.2 anual (° C) Clima Am Am Am(f) Am(f) Am(f) (García 2004) Vegetación Vegetación Selva Selva Selva secundaria secundaria Tipo de vegetación mediana mediana mediana de Selva de Selva circundante sub­ sub­­.2500 1500 . cultivo de miel.533867 -93. Alfonso Luna-Gómez. Ubicación geográfica y principales características ecológicas y sociales de las cinco comunidades estudiadas dentro de la REBISO. sub­ mediana mediana perennifolia perennifolia perennifolia sub­ sub­ perennifolia perennifolia Tiempo de fundación del 15 30 34 50 poblado (años) Número 76 259 91 506 de habitantes Número 35 23 27 45 de ejidatarios Producción Pesca. Cultivo de Cultivo de Actividades realizadas de maíz y frijol. Chlöe Buet y Nathaline Elena Taylor-Aquino Tabla 1.915261 16.899995 (grados decimales) Longitud -93. Nuevo San Carrizal Veinte Emilio San Juan Características (El Encajonado) Casas Rabasa Joaquín Chamula Latitud 17.6 22.2000 1500 .917693 16.

Chiapas Muestreo de la vegetación El trabajo de campo se realizó en cinco localidades dentro de la REBISO. luego fueron trasladados y procesados hasta su identificación por medio del cotejo con otros ejemplares en el herbario de ECOSUR en San Cristóbal de Las Casas. 261 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se obtuvo una muestra bo- tánica de los ejemplares conforme se fueron incorporando en el muestreo y con ellos se elaboró un catálogo de campo itinerante que se utilizó para propósitos comparati- vos durante todo el muestreo.5 m y entre 5-10 cm de diámetro a la altura del pecho (DAP). se obtuvo el permiso previo informado y todos los ejidos determinaron su acuerdo en el planteamiento y desarrollo de la presente investigación. y socioeconómicas (Tabla 1). 2012) y aplicada desde el programa R (R Core Team 2015). se contaron y midieron a todos los individuos cuyas alturas fueran mayores de 1. Adicionalmente. las cuales difieren en algunas características biofísicas. En la parcela más grande. De este modo. Dentro de cada localidad. en la que solo fue posible establecer tres parce- las). El tamaño y forma de las parcelas fue con base en una modificación del esquema sugerido por Ramírez-Marcial et al. se realizó una estandarización de la nomenclatura botánica con ayuda de la rutina Taxonstand (Cayuela et al. Para poder llevar a cabo el estudio. Para identificar a cada especie. en cada localidad se establecieron entre 9 y 11 parcelas circulares de 1000 m2 (excepto en San Joaquín. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Todas se ubican en la periferia del área núcleo de la REBISO. se realizaron diversos recorridos de campo para identificar aquellas áreas de vegetación continua que permitiera establecer un patrón de muestreo de vegetación lo suficientemente representativo de la heterogeneidad local. El muestreo de árboles se estratificó con base en el tamaño de los árboles utilizando dos tamaños de parcela circular (100 m2 y 1000 m2). Una vez conformada la lista general de las especies en todos los inventarios. dichos ejemplares se herborizaron y prensaron directamente en campo. En el primer caso. se completó el muestreo para todos los individuos mayores a 10 cm de DAP. (2010). se realizaron colectas botánicas para aquellos ejemplares en los que fue posible observar alguna estructura reproductiva (flores y/o frutos). Esta estandarización permite identificar errores ortográficos y de sinoni- mias de los distintos taxa al establecer una conexión automática con las bases taxo- nómicas mundiales (The Plant List) mismas que son revisadas continuamente por especialistas del Royal Botanical Garden (Reino Unido) y del Missouri Botanical Garden (EEUU).

las cuales presentan tasas de crecimiento lento. dentro de estos extremos contrastantes. densidad (número de individuos por especie en cada área muestreada) y área basal (m2·ha-1). Miguel Martínez-Icó. se obtuvo directamente con el modelo de diferencia de Lande (1996). así como el índice de uniformidad de Pielou (H/log(S)). los parámetros obtenidos por parcela en cada localidad fueron: la riqueza de especies (S). Adicionalmente a los índices de diversidad. 2005). Chlöe Buet y Nathaline Elena Taylor-Aquino Con base en la información de la literatura disponible y de inventarios flo- rísticos previos. La diversidad beta o tasa de recambio entre pares de unidades de muestreo local. Alfonso Luna-Gómez. intermedia o tardía. Para la mayoría de los análisis se utilizó la rutina“vegan” (vegetation analysis. Neptalí Ramírez-Marcial. las cuales se establecen bajo condiciones de sombra. se obtuvieron distintos parámetros ecológicos para evaluar la condición de la comunidad local de árboles y a nivel de toda la REBISO. pero después de que las especies pioneras comienzan a disminuir en su dominancia (González- Espinosa et al. como pionera. que aparecen en las etapas incipientes de la sucesión secundaria y se consideran intolerantes a la sombra (pioneras) en contraposición a las especies sucesionales tardías. el cual resta la diversidad local de la regional (Gardener 2014). Análisis Para cada localidad. se obtuvieron los índices de diversidad de Shannon (H) y su expresión en términos del número efectivo de especies (exp(H)). Finalmente y para explorar el nivel de completitud 262 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se cons- truyeron por localidad: curvas de acumulación de especies. Específicamente.Oksanen 2015) aplicada dentro del programa R (R Core Team 2015). Este esquema de clasificación sucesional permite discriminar categóricamente a las especies de rápido crecimiento. se ubicaron a las especies sucesionales intermedias. Con los valores de S y su densidad. fue posible asignar a cada especie una categoría sucesional. y curvas de rango y abundancia. por lo que dependen de la preexistencia de una cobertura cerrada propia de bosques madu- ros. el índice de dominancia de Simpson (SI) y el inverso del índice de Simpson (1/SI). son tolerantes a la sombra. Estos análisis permitieron obtener una comparación de la diversidad local (cada parcela por localidad) y diversidad regional (todas las parcelas). en las que se arreglaron en orden descendente de las especies más abundantes a las más escasas.

3% de las 451 especies de árboles tropicales reportadas por Wendt (1993) para los bosques de la región de los Chimalapas y de Uxpanapa (Apéndice 1). en el cual cada parámetro ecológico se comparó entre las localidades y se usaron pruebas de comparación de medias entre pares de localidades con el método de Tukey.8-86% de la riqueza esperada (Tabla 2). con los valores relativos de estos parámetros.1 hectáreas.37. Al incluir éste y otros estudios florísticos más recientes. Chao et al.17).701. F4.28. ambos basados en la densidad de individuos por especie (Chao y Jost 2012. esta riqueza de especies registrada para la REBISO corresponde al 42. 2014). 126 géneros y 57 familias botánicas. Se realizaron análisis de varianza (ANOVA) con un solo criterio de clasificación. Estos valores indican que el esfuerzo realizado es equivalente al 84. Por ejemplo. el índice de diversidad de Shannon (F4. se utilizaron dos estimadores de la riqueza de especies (Chao y ACE). permitió reconocer a 191 de las 222 o 225 es- pecies esperadas según los estimadores de riqueza ACE y Chao. se obtuvo una riqueza total de 191 especies de árboles.37 = 1. la riqueza (ANOVA. frecuencia y área basal de cada especie. Para los datos estructurales. representadas por el conteo de 2116 árboles individuales. respectivamente.37 = 2. P= 0. Varios de los parámetros analizados no resultaron significativamente di- ferentes entre las localidades estudiadas. Todos estos análisis gráficos y estadísticos se realizaron a través del programa R (R Core Team 2015).37 = 2. Chiapas del muestreo realizado a nivel de toda la REBISO. Resultados Riqueza y diversidad de especies Un resumen de los principales parámetros ecológicos analizados se presenta con- centrado en la Tabla 2. la riqueza de toda esta región tropical asciende a 565 especies de árboles (Apéndice 1).07). P= 0. se construyó un índice de valor de importan- cia ecológica para cada especie. El esfuerzo de muestreo realizado. el inver- so del índice de Simpson (F4. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote.07) y el número efectivo de especies 263 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . se ob- tuvo para cada parcela la densidad. Al considerar la totalidad del muestreo de campo (n = 42 parcelas de 0. excluyendo la información para árboles menores a 10 cm de DAP). P= 0. Asimismo.

56 17.91 10.927 12.91 46.96 0.5 0.94 16.39 70 164 199 200 27 ER 22 15 35 50 2.94 16.93 13.9 0.569 23.8 0.96 7.93 23.92 14. Resumen de los principales parámetros ecológicos evaluados en cinco localidades de la REBISO Estimadores Parámetros ecológicos de riqueza Localidad Chao Hexp alfaF InvIS MSS Plot ACE ESS LSS Sobs DA UP Sest AB IS H 1 VC 17 13 56 31 2.47 1.2 46 50 2.85 6.51 12.51 0.69 35.49 12.94 25.01 62 131 170 173 16 EE 28 31 42 27 3.7814 8.92 12.94 16.93 37.87 7.9 0.2 0.32 27 80 118 120 7 VC 28 16 40 44 2.61 0.38 43 159 196 197 25 ER 16 0 36 64 1.48 61 145 184 186 20 ER 27 17 48 35 2.32 80 151 189 191 22 ER 16 29 43 29 2.92 12.86 19.48 11.96 19.26 28 36 62 64 3 VC 22 0 61 39 2.7 62 31 2.89 9.3 0.27 9.90 21.84 17.9 41 53 2.88 17.14 47 138 177 179 18 EE 13 55 45 0 2.4 0.9 10.05 0.36 0.32 68 148 186 188 21 ER 31 15 52 33 3.01 2.64 0.10 45 128 167 170 15 EE 18 27 67 6.82 6.2808 12.5 0.4156 7.78 41.7099 7.16 8. Miguel Martínez-Icó.99 0.5 12.388 11.75 8.17 0.91 26.64 0.71 3.50 36 114 154 157 12 EE 21 38 44 19 2.36 0.6 0. Chlöe Buet y Nathaline Elena Taylor-Aquino Tabla 2.84 39.7 14.724 0.4 0.6 0.44 0.54 0.953 43.4 0.92 19.88 8.91 54 88 128 130 8 VC 20 5 50 45 2.64 0.9 0.49 12.75 15.43 0.67 30.92 12.90 38.54 55 166 202 202 264 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .95 19.92 12.91 10.0765 2.60 42 142 180 182 19 ER 17 20 53 27 1.81 0.87 7.01 0.55 34 62 100 100 5 VC 24 4.6 0.051 13. Neptalí Ramírez-Marcial.2 0.14 0.99 19.51 44 108 148 151 11 EE 21 11 50 39 2.8973 1.84 6.12 22.84 18.98 0.845 19.4297 7.08 41 101 142 145 10 EE 23 32 42 26 2.524 14.99 17.88 37.3858 10.81 0.708 0.75 15.83 27.89 8.179 0.89 53.84 15.017 0.08 0.27 59 119 160 162 13 EE 19 25 63 13 2.892 26.69 0. Alfonso Luna-Gómez.1 0.733 0.6 16.7 2.89 28.08 7.94 60 161 198 199 26 ER 19 5.88 43 71 108 110 6 VC 21 11 50 39 2.11 22.39 4.41 18.82 5.73 50 135 174 176 17 EE 23 20 55 20 2.16 0.09 0.91 0.4 0.94 43 21 37 40 2 VC 15 7.8 4.16 8.6316 6.9747 11.01 62 157 194 195 24 ER 8 0 25 75 1.65 34.85 41 50 85 85 4 VC 11 20 30 50 2.571 19.5 0.2151 5.9 0.99 19.3 0.77 15.07 52 154 191 192 23 ER 6 40 40 20 1.67 3.336 13.97 41.6 0.4 11.363 22.91 11.61 47 123 163 166 14 EE 18 25 44 31 2.1 0.73 3.462 21.93 14.7 0.08 44 95 136 138 9 VC 18 18 35 47 2.81 16.86 17.58 0.86 27.77 19.113 0.87 34.94 16.

4 0.19 0.94 57 174 208 208 32 NSJ 24 25 42 33 2.28 33 168 203 203 29 NSJ 17 5.93 14.9 0.86 0.86 0.91 10.3 0.223 8.52 38 188 222 219 41 SJ 30 17 33 50 3.7882 3. 265 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .364 12.18 68 172 206 206 31 NSJ 21 30 40 30 2.78 17.24 9.1 ha-1).44 50 191 225 222 VC = Veinte Casas InvIS = inverso del índice de Simpson EE = El Carrizal (El Encajonado) alfaF = diversidad alfa de Fisher ER = Emilio Rabasa UP = índice de uniformidad de Pielou NSJ = Nuevo San Juan Chamula AB = área basal (m2·ha-1) SJ = San Joaquín.93 15.9 65 29 2.235 0.57 0. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote.69 61 190 224 221 42 SJ 29 14 55 31 3.42 0.91 32.40 63 177 211 210 34 NSJ 25 19 43 38 2.24 0.11 8.42 0.667 15.939 10.2 0.00 75 175 210 209 33 NSJ 20 22 50 28 2.43 0. Resumen de los principales parámetros ecológicos evaluados en cinco localidades de la REBISO (continuación) Estimadores Parámetros ecológicos de riqueza Localidad Chao Hexp alfaF InvIS MSS Plot ACE ESS LSS Sobs DA UP Sest AB IS 28 ER 13 23 38 38 H 2.77 37 181 215 214 36 NSJ 17 27 60 13 2.91 0.64 15.91 11.75 0.1 0.95 19.86 7.6 14.91 55 182 216 215 37 NSJ 21 5.154 12 0. Los estimadores de riqueza ESS = Porcentaje de especies representan los valores sucesionales tempranas acumulativos para Sest = Riqueza MSS = Porcentaje de especies esperada de especies sucesionales intermedias Chao = Riqueza de especies con el mode- LSS = Porcentaje de especies tardías lo de Chao basado en las abun- H = índice de Shannon dancias.93 13.37 0.54 0.91 10.3 0.90 31.91 11. Chiapas Tabla 2.364 10.375 0.447 28.81 5.313 23.55 13.63 13.735 19.85 16.1709 8.91 29.0.852 0.92 13.41 11. Los parámetros fueron: DA = densidad absoluta Sobs = Riqueza observada de especies (núm.86 17.94 16.14 22.78 12.618 11.53 0.14 0.87 30.87 7.12 0.99 0.8 0.4 0.44 38 187 221 218 40 SJ 21 24 43 33 2.93 14.07 21.57 74 179 213 212 35 NSJ 8 38 38 25 1.85 31.77 38 185 219 217 39 NSJ 17 20 40 40 2. de ind.89 47 170 205 205 30 NSJ 19 12 47 41 2. Hexp = Número efectivo de especies ACE = Riqueza de especies estimada a IS = índice de Simpson partir de las abundancias.4377 9.89 33.76 13.74 20.2119 7.92 33.91 20.35 3.93 56.736 13.8 0.64 2.78 44 184 217 215 38 NSJ 16 14 57 29 2.92 34.1 0.94 15.9 47 47 2.91 45.87 29.93 29.

Solamente el área basal mostró un cambio positivo y significativo con la altitud (Figura 1). éstas no difirieron en la riqueza de árboles de las demás localidades.08).27 y P> 0.2% del total de los individuos contabilizados (Figura 2).503.37 = 4. cuyos valores promedio de área basal variaron entre 30.05). Por ejemplo. Sin em- bargo. lo cual representa 24. Heliocarpus appendiculatus en Nuevo San Juan Chamula. Asimismo.37 = 2.2 y 34. Chlöe Buet y Nathaline Elena Taylor-Aquino (F4.021). Efecto de la altitud y la diversidad de árboles Debido a que los inventarios forestales incluyeron una diferencia altitudinal mayor a 1 km entre la parcela más baja (241 m) y la más alta (1328 m). la proporción de las especies 266 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . un hecho notable es que se registraron 47 especies con solo un indivi- duo (singletons). los cuales resultaron significativamente diferentes respecto a las otras lo- calidades.235. el índice de diversidad alfa de Fisher (F4.37 = 2. Las curvas de rango-abundancia mostraron que en cada localidad la domi- nancia estuvo compuesta por especies diferentes (Figura 2). En Veinte Casas. Miguel Martínez-Icó. el índice de dominancia de Simpson (F4. F4. P= 0. P= 0. Estas cinco especies más abundantes representan 11. P= 0.37 = 3. Por otro lado.0063) y el índice de uniformidad de Pielou (F4. F4. y Euge- nia acapulcensis en San Joaquín (Figura 2).016).37 = 3. la mayoría de las variables no se correlacionaron con la altitud (todas las r’s <0. Los parámetros que resultaron significativamente diferen- tes entre localidades fueron: la densidad de árboles promedio por parcela (ANO- VA.3% de la densidad total de árboles registrados en el muestreo.37 = 2. P= 0. Alfonso Luna-Gómez. Figura 3). una especie de distribu- ción muy restringida.9 ± 4. pero solo el 2. P= 0. los parámetros ecológicos se analizaron también en relación con esta variable explicativa.96.02 m2·ha-1).6% de la riqueza regional registrada en la REBISO.58. a pesar de que las parcelas de El Encajonado se localizan a menor altitud (241-480 m). pero localmente abundante.28. P= 0.36. Pseudolmedia spuria en Emilio Rabasa. Neptalí Ramírez-Marcial. ubicadas por encima de los 700 m y en todo caso.032. El área basal promedio evaluada entre las parcelas fue variable entre las localidades y los valores más bajos se registraron en El Encajonado (20.071). la especie más abundante fue Louteridium donnell-smithii. Las otras especies más abun- dantes fueron Heliocarpus americanus en El Encajonado. se ob- servó una alta variación dentro de las localidades.3 m2·ha-1 (ANOVA.

Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. 20C = Veinte Casas EE = El Encajonado ER = Emilio Rabasa NSJ = Nuevo San Juan Chamula SJ = San Joaquín 267 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Chiapas Figura 1. Curvas de rango y abundancia para las especies registradas en los inventarios de la REBISO. Relación entre el área basal (m2·ha-1) y la altitud (msnm) de las 42 parcelas de inventario realizadas en cinco localidades de la REBISO 20C = Veinte Casas EE = El Encajonado ER = Emilio Rabasa NSJ = Nuevo San Juan Chamula SJ = San Joaquín Figura 2.

los valores de las espe- cies sucesionales intermedias varió entre 41 al 50% y no fueron significativamente distintas entre localidades (F4. Miguel Martínez-Icó. lo cual se explica por la tasa de recambio de especies (diversidad beta) la cual fue igualmente más alta en Emilio Rabasa que en el resto de las localidades. Chlöe Buet y Nathaline Elena Taylor-Aquino clasificadas por su categoría sucesional varió entre las localidades (Figura 4). Sin embargo.318.357. la diversidad regional más alta se registró en Emilio Rabasa y más baja en San Joaquín. Neptalí Ramírez-Marcial. indican que sería posible en- contrar hasta 222-225 especies en todo el polígono de la REBISO. es evidente su importancia para la conservación de numerosas especies de árboles. con valores intermedios para El Encajonado y Veinte Casas (Tabla 3).281).2 hectáreas fue posible identificar a 191 especies de árboles que definena las principales comunidades forestales de la zona. Figura 4). P= 0.0018. Para el caso de la reserva de la biosfera Selva El Ocote. las estimaciones de la riqueza a partir de las abundancias registradas. Las especies pioneras constituyeron entre 16 y 29% de la riqueza total por localidad y la mayor proporción detectada en el El Encajonado resultó significativamente diferente de las demás localidades (F4.0193). Discusión Patrones de riqueza local y regional La información de la riqueza y diversidad de la vegetación arbórea es una medida rápida y efectiva para analizar y comparar dos o más condiciones y permite identificar algunas de las posibles variables que promueven dichos patrones de riqueza y diver- sidad (Brewer et al.37 = 5.285. Alfonso Luna-Gómez. 2003). P= 0. Estas estimaciones 268 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Aún más. P= 0. Diversidad local vs regional Al tomar en cuenta los valores de riqueza de especies por localidad.37 = 1. Finalmente. se observó que la diversidad local fue más alta en la comunidad de San Joaquín y la más baja en Emilio Rabasa y Nuevo San Juan. el porcentaje de especies sucesionales tardías osciló entre 21-43% y la mayor proporción de es- pecies tardías registrada en Emilio Rabasa y Veinte Casas fue distinta de la de El Encajonado (F4.37 = 3. En una superficie de 4.

Gráfica de caja para el área basal promedio (m2·ha-1) registrado en las localidades por localidad 20C = Veinte Casas EE = El Encajonado ER = Emilio Rabasa NSJ = Nuevo San Juan Chamula SJ = San Joaquín Figura 4. Porcentaje del número de especies pioneras. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. intermedias y tardías dentro de las cinco localidades de muestreo en la REBISO. 269 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Chiapas Figura 3.

Esquivel et al. 2007. Por ejemplo.6 Regional 74 71 97 61 60 Beta = regional/local 3.4 20.g. Chlöe Buet y Nathaline Elena Taylor-Aquino Tabla 3. 2010) pero no incluidas en los inventarios actuales.g. Miguel Martínez-Icó. los valores de diversidad local (promedio de especies por parcela) son relativamente altos (19-27 especies) cuya tasa de diferenciación me- dida como diversidad beta. Tabla 3). el cual correspondería aproximadamente al 51% de la riqueza reportada por Wendt (1993) para las selvas de Los Chimalapas y Uxpanapa. se ubicaron en las áreas más conservadas de vegetación y excluimos otras de vegetación secundaria. con esta lista.54 3.4 17. con lo cual se completaría el registro de árboles de la REBISO haciendo un total de 230 especies. casi todas las 42 parcelas empleadas en el presente estudio.47 5.8 3. arroja también un valor importante de 2-6 especies diferentes presentes de una parcela a otra. se podrían incluir al menos unas 40 especies más. Por otro lado. NSJ = Nuevo San Juan Chamula SJ = San Joaquín para completar el inventario de árboles de la REBISO son bastante realistas y podrían completarse con más inventarios similares y ubicados en otras condiciones ecológi- cas contrastantes.6 26. que han moldeado la diversidad regio- nal. pero que las pequeñas variaciones ambientales y nivel de intervención humana influyen en la estructura de diversidad local de árboles en El Ocote. en el entendido de que ya se han explorado con anterioridad para propósitos de evaluar su capacidad de captura de carbono mediante el manejo de sistemas agroforestales (e. Resumen de la diversidad local (promedio por parcela). Neptalí Ramírez-Marcial.25 VC = Veinte Casas EE = El Encajonado ER = Emilio Rabasa. A partir de la relación de especies presentada en el Apéndice 1 es posible reconocer a especies observadas en otros estudios (e. Igualmente 270 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . regional (acumulada por localidad) y diversidad beta (regional/local) para las cinco localidades de la REBISO Diversidad VC EE ER NSJ SJ Local 19.5 18. Orihuela-Belmonte 2014). Alfonso Luna-Gómez. La condición florística estructural y de diversidad de árboles tiene una alta relación entre procesos histórico-geológicos. Este patrón contribuye a conformar los altos valores de diversidad regional observados para las cinco localidades (60-97 especies. Rocha-Loredo et al.27 2.

Aunque la estacionalidad de la precipitación anual explica 19% de la variación en la diversidad regional. (2003) al documentar la vegetación de Belize sobre sustratos calizos. además de otros procesos ecosistémicos de largo plazo. 2009). Fine 2015). en el que 47 de las 191 especies estuvieron presentes únicamente con un registro. no es posible afirmar si varios de estos registros únicos son simplemente errores de muestreo o falta de una mayor intensidad de muestreo para detectar un patrón de abundancia real de las especies. ter Steege et al. 2009. 2009). encontraron que la densidad de tallos se incrementó con la altitud. 2009. Esta tendencia de encontrar sistemáticamente registros únicos de especies en una gran cantidad de inventarios florísticos (Hubbell 2015) también se observó en los inventarios de El Ocote. migración. Para ello. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. en los que se aprecian conjuntos de especies que son muy abundantes en cada localidad y otras especies cuyas densidades son más bien escasas o con registros únicos. Nuestros resultados son consistentes con los patrones globales descritos para la diversidad de árboles tropicales (Stroop et al. 2013). se considera que dicho patrón es resultado de la historia paleoclimática de la región. lo cual representa el 2. los cuales han definido la edad de las formaciones geológicas y que explican un 14% adicional de la diversidad regional (Stroop et al. para el caso del bosque amazónico explicó el 17% de la variación observada (Stroop et al. Estas diferencias las atribuyen al mayor efecto de la sequía a altitudes mayores. en cambio el factor que tiene un efecto más importante a escala local es el disturbio antropogénico. lo cual impide el desarrollo de árboles grandes. Algunos datos globales de la diversidad de árboles tropicales de la región amazónica indican que la estabilidad paleoclimática puede explicar hasta un 31% de la correlación con la diversidad regional. Por otro lado. extinción) que ayudan a explicar dichos patrones a distintas escalas (Ricklefs y Schluter 1993. Más recientemente Harmon y Harrison (2015) han indicado que no hay una clara separación entre los procesos locales y regionales (continentales) que 271 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Otros estudios que describen los patrones de diversidad de árboles tropi- cales reconocen la participación de procesos locales (interacciones ecológicas) y regionales (procesos evolutivos como especiación. el cual.2% de la representación numérica de todos los árboles individuales contabilizados. Chiapas Brewer et al. Stroop et al. pero el porcentaje de árboles grandes disminuyó. es necesario continuar con nuevos inventarios forestales que incluyan una mayor cobertura geográfica de la actualmente considerada.

se ha propuesto que los depredadores su- periores. Miguel Martínez-Icó. Esta diversidad no está uniformemente distribuida en toda la reserva. sino que refleja la alta heterogeneidad de condiciones físico- geográficas. las poblaciones evaluadas en el presente estudio mantienen una alta diver- sidad de árboles que contribuye a conservar poco más de la mitad de la riqueza de especies de árboles registrados para lo último que queda de la selva zoque. Asimismo. la REBISO tiene una gran importancia para la conservación de la alta diversidad biológica que posee en sus poco más de 1012 km2 de superficie protegida. Alfonso Luna-Gómez. climáticos y ecológicos que han permitido la expresión de estos patrones de riqueza y diversidad taxonómica. Chlöe Buet y Nathaline Elena Taylor-Aquino promueven la diversidad biológica. geográficos. hay cierta evidencia de que los factores ecológicos relacionados con la disponibilidad de recursos regulan la riqueza de especies a escalas continentales (Rabosky y Hurlbert 2015). Como región geográfica. El resultado de que cada sitio contribuye con 2-6 especies diferentes dentro del muestreo realizado. incluido 272 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . sino que se trata de un proceso continuo en espacio y tiempo. Por ejemplo. es un indicador inequívoco de la necesidad de conservar la mayor cantidad de área dis- ponible por su alto valor de conservación. La diversidad de árboles de la REBISO debe verse así como un acervo único que representa una larga historia de procesos geológicos. de tal manera que la complementariedad de cada sitio para definir la diversidad regional es igualmente alta (Tabla 3). mantienen la integridad de numerosas cadenas tróficas las cuales al final mantienen la diversidad biológica (Terborgh 2016). dentro de las cuales se expresa una diversidad local particular (sensu Blundo et al. Para Ricklefs y He (2016) los patrones de diversidad son los resultantes de ambos procesos locales y regionales y la coexistencia entre especies está más explicada por las diversas interacciones que operan a escala local. A pesar de que la vegetación de las selvas circundantes a la REBISO se hallan altamente deforestadas (CONANP 2011). 2016). los resultados presentados aquí indican que la condición de la comunidad de árboles de la REBISO está en buen estado de conservación dentro de los límites de sus áreas núcleo. Vulnerabilidad de la vegetación ante el efecto del cambio climático Aunque este estudio forma parte de un proyecto acerca de la vulnerabilidad bio- lógica y social ante el cambio climático. Neptalí Ramírez-Marcial.

al transformar a la selva en otros usos. reconocemos que una limitante de nuestro estudio es que por ahora no incluimos información de la regeneración avanzada dentro de cada sitio. por lo que sugiere intervenir mediante alguna estrategia de rehabilitación como el enriquecimiento de especies. 2011). Chiapas la parte de Oaxaca. la cual podría darnos algunos indicios acerca de la dinámica demográfica que la comunidad de árboles tiene en el presente. Chiapas y Veracruz. En las cinco localidades incluidas en el estudio. la cual había sido una de las más severamente afectadas por los incendios de 1998. Maldonado-Méndez et al. presentaron los valores más bajos de riqueza de árboles. En nuestro estudio pu- dimos constatar que en dos parcelas de muestreo ubicadas en una zona de Emilio Rabasa que fue afectada por los incendios de 1998. El efecto del daño puede perdurar varios años previo a su recuperación natural. 2016). irremediablemente se modifica la estructura y función de la vegetación. se afirmó que se utilizan las áreas de producción familiares para la provisión de leña y otros bienes directos. lo cual provoca a su vez una serie de cambios en las propiedades del microclima. exceden los 273 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2016). Estos autores reconocen una evidente reducción de especies en relación con la frecuencia y magnitud de los incendios. Asimismo. El supuesto detrás de estas consideraciones. y que reconocen las restricciones de uso y acceso a las áreas núcleo dentro de la REBISO (Márquez-Reynoso 2016). Esta condición le confiere un alto valor al área y son una prueba de que las áreas naturales protegidas (ANP) cumplen un papel fundamental para preservar gran parte de la diversidad biológica contendida en una región (Beaudrot et al. y en la disponibilidad de algunos recursos de uso directo por la población humana. es que cuando los factores climáticos. (2009) ana- lizaron el efecto de los incendios forestales sobre la riqueza de especies en la locali- dad de Emilio Rabasa. razón por la cual dichas áreas mantienen ciertamente una alta integridad biológica y estructural. Aunque se ha señalado que el efecto del calentamiento global puede afectar el balance hídrico más intensamente que el de la temperatura (Franklin et al. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. reportando solamente 54 especies de árboles en las zonas siniestradas por fuego. Chen et al. específicamente la temperatura y la precipitación. Se espera que el estudio de la dinámica de reclutamiento de plántulas nos pueda aportar nueva información acerca del posible efecto de cambios ambientales sobre el establecimiento de árboles (e.g. lo cierto es que el cambio de uso de la tierra.

Alfonso Luna-Gómez. Conclusiones La riqueza de árboles de la REBISO comprende 57 familias. 2005). No se encontró una relación directa entre algún parámetro ecológico. 2011). inexistentes en la REBISO. Particular- mente. sería factible esperar que ocurra un proceso de desplazamiento vertical hacia las partes más elevadas. se espera que las especies de árboles muestren algún tipo de ajustes ecofisiológicos. observamos en las partes más altas de Veinte Casas. De esta manera. donde se encontrarían las condiciones ambientales óptimas. en respuesta a estos cambios ambientales (Golicher et al. se anticipa que el efecto del cambio climático sobre la vegetación se verá reflejado en la distribución y abundancia de las especies (Peterson et al. estas no pueden desarrollarse de manera óptima y su dominancia tendería a disminuir (Mittelbach 2012). la ausencia de individuos juveniles o plántulas. Miguel Martínez-Icó. Chen et al. El ejemplo anterior también nos sugiere que para las especies cuya distribución óptima se ubicaba hacia altitudes más bajas. una especie de encino relativamente común en bosques mesófilos de montaña. 2008.5°C en Chiapas. y se estima que podría haber unas 40 especies más con un esfuerzo más intenso de muestreo. Sin duda estos planteamientos son aún especulativos y deben abordarse cuidadosa y experimentalmente para poder responderlos objetivamente. Neptalí Ramírez-Marcial. morfológicos o ecológicos. Se sabe con certeza que la temperatura media anual del aire se ha incrementado en los últimos 50 años alrededor de 1. este efecto será más severo para las especies que se encuentren en ecosis- temas geográficamente confinados. asociado a la riqueza y diversidad de árboles respecto a la altitud en el 274 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . nos sugiere que es una especie que probablemente desapare- cerá del área en los próximos años ante la imposibilidad de desplazarse a terrenos más altos. 126 géneros y 191 especies. Sin embargo. 2006). a dos individuos grandes de Quercus corrugata. aunque el patrón de precipitación no es tan claro (Golicher et al. como las partes más altas de las montañas. Aplicado a las condiciones de la REBISO. Chlöe Buet y Nathaline Elena Taylor-Aquino umbrales de tolerancia de las especies. La diversidad local es alta y la contribución de cada loca- lidad al total de la diversidad regional es igualmente elevada por la alta tasa de recambio entre sitios. En el caso de El Ocote.

C. 2016. Asimismo agradecemos a Karla Leal y Roberto Escalante (CONANP) por todas las facilidades para el contac- to y el acceso a los sitios remotos de la REBISO. J. J. Alvarez-Loayza. Moreira Lima. por lo que se recomienda continuar con los esfuerzos actuales para evitar el cambio de uso del suelo dentro de la zona núcleo. B.1371/journal. Agradecimientos Expresamos nuestro amplio agradecimiento a las autoridades locales y personal que nos acompañó durante las incursiones de campo. 275 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Zvoleff y S. K. A. la cual se incrementó con el aumento de la altitud. Spironello. Winarni. Kumar.G. Fegraus.A.C. D. M. M. F. auspiciado por el Consejo Nacional de Ciencia y Tecnología. Chiapas área. K. A. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Boekee.L. E. J. N. Razafimahaimodison. M. Larney..doi:10. Martin.R. O’Brien. Campos-­ Arceiz. Espinosa. P. Mahony. A. Standardized assessment of biodiversity trends in tropical forest protected areas: The end is not in sight. Hallam. Santos. W. C. Rovero. Ahumada. Estos patrones de diversidad le confieren a la REBISO un valor importante para la conservación de árboles tropicales. E. Eichberg. Hurtado. Fletcher. E. Salvador. McWilliam.1002357. Andelman. F. H.R. D. Romero-Saltos. C. Mugerwa. Jansen. J. a excepción del área basal. P. PLoS Biology 14: e1002357. asimismo es necesario realizar más estudios dentro de las zonas de amor- tiguamiento y de influencia de la REBISO para vincular acciones de manejo de la vegetación secundaria que permita el aprovechamiento y conservación de la vegetación natural. Willig. pbio. A. Sheil. S.H. Gajapersad. T. Ndoundou-Hockemba. Este trabajo fue posible a través del apoyo económico proporcionado por el proyecto PDCPN2013-012/14659 “Vul- nerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote”.J.A. Referencias Beaudrot. L. dentro de la convocatoria de Proyectos de desarrollo científico para atender problemas nacionales 2013.

2016. N. Cavieres. R. 2012. 2011. C. 2012. Relationships of phytogeography and diversity of tropical tree species with limestone ­topography in Southern Belize. Malizia. L. I.W. M.H. Journal of Tropical Ecology 28:83–95. Introduction to the Flora of Chiapas. F.R.M. Rarefaction and extrapolation with Hill numbers: a ­framework for sampling and estimation in species diversity studies. González-Espinosa y L.C.G.. Blake y A. A. T. Albuquerque y J. Fine. R.D.. Kikvidze. Hsieh. Chao.E. Methods in Ecology and Evolution 3:1078–1083. D. Comisión Nacional de Áreas Naturales Protegidas-Fondo Mexicano para la Conservación de la Naturaleza A.U.M. K.W. Chlöe Buet y Nathaline Elena Taylor-Aquino Blundo. 2014. Micha- let. Alfonso Luna-Gómez. Callaway. G. R. E. Miguel Martínez-Icó.A. R. Neptalí Ramírez-Marcial. 2012. E­ llison. Lortie.-The Nature ­Conservancy. Colwell y A. California Academy of Sciences. C. Breedlove. Webb y P. The American Naturalist 174:919–927.I. Granzow-de la Cerda. Rejmánek.. Comisión Nacional de Áreas Naturales Protegidas- Fondo Mexicano para la Conservación de la Naturaleza A. Ecological Monographs 84:45–67. 2009.-The Nature Conservancy.J. A. Ecology 93:2533– 2547.. A. Don’t diss ­integration: A comment on Ricklefs’s disintegrating communities. Relative contribution of niche and neutral processes on tree species turnover across scales in ­seasonal forests of NW Argentina. Pugnaire. F. S. Plant Ecology 217:359–368.. Pro- grama de adaptación al cambio climático en áreas naturales protegidas del complejo Selva Zoque. Brooker. Malizia.C. San Francisco. 276 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . ­Taxonstand: An R package for species names standardisation in vegetation databases. A.S. Sander. A. D. 1981..L. Tree species distribution in Andean forests: influence of regional and local factors. E.J. H. R. y L.K. 2003. V. Valiente-Banuet y T. L. Coverage-based rarefaction and extrapolation: ­standardizing samples by completeness rather than size.A. Journal of Biogeography 30:1669–1688. J. Z. L. Ma. Golicher. Chao. Ciudad de México. Blundo. Brewer. M. Brown. C. Cayuela. Gotelli. Jost. Whitham. M.C.

Connell. Thomas.D. Science 199: 1302–1310. Flamenco Sandoval. Esquivel Bazán. P. Inédito. Fine. Evolution and Systematics 46:369–92.. V. Gardener.K.M. J. E. 2004.-C. Community ecology. Hill. E. Instituto de Geografía. J. D. Applying climatically associated species pools to the ­modeling of compositional change in tropical montane forests.J. Roy y C. México. Reporte Técnico. 2015. Ramírez- Marcial. How are the World’s forests changing?.F. J. 2014. Serra-Diaz. A. A. 2011. Quechulpa Montalvo. Analytical methods using R and Excel. Diversity in tropical rain forests and coral reefs.B. Proceedings of National ­Academy of Sciences 113: 3725–3734. Formulación de un proyecto REDD (Reducción de Emisiones por Deforestación y Degradación) usando el sistema Plan Vivo en la Reserva de la biosfera El Ocote. R. Annual Review of Ecology. Olguín Álvarez. Golicher. Pelagic Publishing. D. D. Global forest resources assessment.. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Global change and terrestrial plant community dynamics.. Exeter. Reino Unido. M. Cayuela. Ohlemuller. J. Regand. D. Science 333:1024–1026. De La Cruz Arias y M. UNAM. M. Orihuela Belmonte.J de Jong. I. B. L.A. Instituto de Geografía. M. M. 277 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Rapid range shifts of species associated with high levels of climate warming. AMBIO-ECOSUR. 2016. E. FAO. García.. México. 2008. Franklin J. Tesis de Doctorado.A.R. Syphard y H. 1978. Roma. UNAM.H.V. S. Chiapas Chen. Global Ecology and Biogeography 17:262–273. Chiapas. Food and Agriculture Organization of the United Nations. Dinámica y escenarios sobre los procesos de cambio de cobertura y uso del terreno en el sureste de México: el caso de la Selva El Ocote. M. González-Espinosa y N. 2007. Alkemade. 2015. Modificaciones al sistema de clasificación climática de Köppen. Ecological and evolutionary drivers of geographic variation in species diversity. 2007. San Cristóbal de Las Casas.­ 5ª edición. Hernández Vásquez.

en La biodiversidad en Chiapas: Estudio de Es- tado. Perspectivas para la restauración de bosques en la Sierra Madre de Chiapas. Investigación Ambiental Ciencia y Política Pública 6:89–108. Mexico. Heidelberg. México. N. Riqueza de árboles en Chiapas: variación espacial y di- mensiones -ambientales asociadas al nivel regional. M. A. M. México González-Espinosa..R. Galindo-Jaimes y D. Páginas 81–125. Ramírez-Marcial. M. M. 278 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Ecography 27:741–756. Huston y D. Ecological Studies 185. Páginas 209–221. Ruiz-Montoya (editores). M. E. Ramírez-Marcial. Ramírez-Marcial.M. González-Espinosa. Chlöe Buet y Nathaline Elena Taylor-Aquino Golicher. Diver- sidad Biológica en Chiapas. N. N. Galindo-González y F. González-Espinosa. Correlations between precipitation patterns in southern Mexico and the El Niño sea surface t­ emperature index.. Sánchez-Velásquez. México. M. González-Espinosa. Ecology and Conservation of Neotropical ­Montane Oak Forest. J. N. Ramírez-Marcial y S. Comunidades vegetales terrestres. COCYTECH y Plaza y Valdés. 1965. Levy-Tacher. Neptalí Ramírez-Marcial. Musálem-Castillejos.. Ramírez-Marcialy J. N. S­ econdary succession in Montane Pine-Oak Forests of Chiapas. ECOSUR. Rey-Benayas. N. Díaz-Fleischer (editores). Gómez-Pompa. Golicher.J. González-Espinosa. Páginas 21-42. M. en L.. Mundi Prensa. Vulnera- bilidad ambiental y social. J. Ramírez-Marcial. González-Espinosa. Méndez-Dewar. Galindo-Jaimes. Variación espacial de la diversidad arbórea de Chiapas: patrones regionales y jerarquía de factores determinantes. Distrito federal. A. Gómez-Pineda. México. Springer. en M. 2014. 2006. Boletín de la Sociedad Botánica de México 29:76–120. Miguel Martínez-Icó. M. 2013. 2008. La vegetación de México. Páginas 147–166. Kappelle (editor). Golicher. M. México. 2006. G. y N. N. L. manejo y con- servación de los ecosistemas de montaña en México.. Interciencia 31:80–86. Rey-Benayas. Ecología. Alfonso Luna-Gómez. Parra- Vázquez. Díaz-Hernández y K. Ramírez-Marcial y L. 2004.I. Comisión Nacional para el Conocimiento y Uso de la Biodiversidad (CONABIO) y Gobierno del Estado de Chiapas. Ramírez-Marcial y L. González-Espinosa.M. Tree diversity in the northern Neotropics: regional ­patterns in highly diverse Chiapas. 2005. en M.. D.R. B.

en C. Suiza.A. Maldonado. Reducción en riqueza de especies arbóreas por incendios en la reserva selva el ocote. Hall y S. Chiapas Gotelli.. México.. The American N ­ aturalist 113:81–101. Lande. 2001. Chiapas. K. Colwell. San José. Propiedades dendroenergeticas de las especies ar- bóreas utilizadas para leña en comunidades de la Reserva de la Biosfera Selva El Ocote. Ecological restoration for protected areas: Principles.P. M. R.C. Harrison. Oxford. Tesis de M. Mao. Hubbell. 2005.L.Gland. J. Estimation of species richness: mixture models. and ­ isher’s paradox. Rodríguez T. Marquez-Reynoso. D. Life zone ecology.J. guidelines and best practices. Oxford University Press. Chiapas. 1979. Náñez J. C. Community ecology. 2016. Sinauer. El Colegio de la Frontera Sur. y R. La vegetación de Chiapas. Costa Rica. 1963. Estimating the global number of tropical treespecies. San Cristóbal de Las Casas. Forest ecology and conservation.R. Revista Mexicana de Ciencias Forestales 34:127–148. N. S. Sunderland. Miranda. y S. Oikos 76:5–13. A. Chiapas. 2009. A general hypothesis of species diversity. Harmon. Colwell. L. 2007. 2015. Tropical Science Center.M.. F. Cuarta edición.K.J. Miranda. México. Hernández-X. S. F. Proceedings of the National Academy of Sciences 112:7343– F 7344. G. Newton. L. X. Statistics and partitioning of species diversity. Stolton. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. 1967. Quantifying biodiversity: procedures and pitfalls in the measurement and comparison of species richness.A. Guízar N. the role of rare species. Tuxtla Gutiérrez. Ecology Letters 4:379–391. Keenleyside.G. Cairns.M. Dudley. M. The American Naturalist 185:584–593. 2015.. Tomo I. N. y R. Species diversity is dynamic and unbounded at local and continental scales. Reino Unido. Velázquez M. 1996. and similarity among multiple communities. 2012. 279 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Boletín de la Sociedad Botánica de México 28:29–179. C.I. Huston. E. y E. Ecology 86:1143–1153. Universidad de Ciencias y Artes de Chiapas.U.A. K. Holdridge. Los tipos de vegetación de México y su cla- sificación. A handbook of techniques. M. and inferential challenges. 2012. 2015. Massachusetts. y S. Unión Internacional para la Conservación dela Naturaleza. E. Mittelbach.

San Cristóbal de Las Casas. México. Características físico-bióticas de la cuenca del río Grijalva. Rabosky. González-Espinosa. Pennington.L. Multivariate analysis of ecological communities in R: vegan ­tutorial. en M. A. México. D. Forest Ecology & Management 154:311–326. 2001. González-Espinosa y G. Williams-Linera. Species richness at continental scales is ­dominated by ecological limits.H. Páginas 9-27. Martínez-Meyer. Sánchez-Cordero. Yale University Press. Mexico. R: A language and environment for statistical computing. User’s guide and application published at http://cc. 280 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Miguel Martínez-Icó. San Cristóbal de las Casas. User’s guide and application published at URL http:www. 2014. Neptalí Ramírez-Marcial. Dinámica de carbono en la selva de la Reserva de la Biosfera “Selva El Ocote” en el Estado de Chiapas. Tian. R Foundation for Statistical Computing. Lovejoy y L.R-project.. ­Anthropogenic disturbance and tree diversity in montane rain forest in Chiapas. Chiapas. 2015. D. G. Montañas. Vásquez e I. Plascencia-Vargas. M.org. Hannah (editores). Modeling ecosystems shifts and individual species distribution shifts. R Development Core Team. 2014. H. N. 2005.F.A. D. Evaluación y moni- toreo de la vegetación. Ramírez-Marcial. Pá- ginas 211-228.E. Sarukhán.H. T. en T. J.L. El Colegio de la Frontera Sur. Páginas 29–79. Universidad Nacional Autónoma de México/Fondo de Cultura Económica. M. El Colegio de la Frontera Sur. E. pueblos y agua. y J. March (editores) Con- servación y desarrollo sustentable en la Selva El Ocote. Ramírez-Marcial. Peterson. The American Naturalist 185:572–583. N.T. Austria. 2015.. Ishiki-Ishihara.D. M. Soberón y V. 2010.fi/~jarioksa/ opetus/metodi/vegantutor. México. 2005. Martínez-Icó y M. Chiapas. Ramírez-Marcial..pdf Orihuela-Belmonte. León Cortés y E.. La vegetación de la Reserva El Ocote a lo largo del cañón del río La Venta. ­Brunel Manse (editores). Viena. J. Tercera edición. D. Tesis de doctorado. Musálem-Castillejos. Chiapas. González-Espinosa y C. 1996. Hurlbert. en M. Naranjo (editores). Oksanen. Ediciones Juan Pablos.A. Álvarez- Solís y K. Connecticut. 2015. en J. Climate change and biodiversity. Chlöe Buet y Nathaline Elena Taylor-Aquino Ochoa-Gaona S. Alfonso Luna-Gómez. Árboles tropicales de México: manual para la identificación de las principales especies. Páginas 45–86.oulo. y A. N. E. Dimensiones y reali- dades de la cuenca Grijalva.U.

Species diversity: from global decreases to local i­ ncreases. Böhning-Gaese. L. Clark. Davidar.J.A. E. Bongers.M.C. R.A. Ricklefs. J. R.C. Fletcher. Colwell. Schluter. Y. S. P. N.U. Limusa. Slik. C. M. E. Leal Matos. Alvarez-Loayza. Imai. Eler. Chiapas Manual para el reconocimiento. en: M. Ewango. R. G. 2016.E. G.-F. J. S. Culmsee. N. D. Species diversity in ecological ­communities. y F. Schluter (editores). Sax. Arroyo-Rodríguez.W. van den Berg. N. Durigan. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Feeley. Ricklefs. J. Chicago. H. K. M. Ricklefs. Grogan. México. Cambridge. F.. D. Massachusetts. Breuer-Ndoundou Hockemba. Gillet. G. J. K.L.G. A. R. P. Damas.-L. Harrison. Bellingham.. F. Butlin. González-Espinosa. Eichhorn.L. Bastian. J. E.B.M. ­Eisenlohr. Ediciones Juan Pablos. 2009. N. Blanc.L. 281 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . A. México. Montañas. editores. D.A. E. C.U. Chazdon. 1993.S. V. E. Ramírez-Marcial y M.E. He. Fredriksson. Dauby. Cambridge University Press. Trends in Ecology and Evolution 18:561–566. D. J. González-Espinosa y C.A. González-Espinosa. Aiba. Amarnath. Gaines. Ashton y P. Speciation. Chai. L. P. Balvanera. S. S. en R. D ­ eWalt. Gillespie. 2014. A. Griffith. K. Castillo-Santiago. Boeckx. Bridle y D. 1978. Catharino. México. Brearley. C. G. E. Region effects influence local tree species diversity.-L. Dimensiones y realidades de la cuenca Grijalva. Ramírez-Marcial. El Colegio de la Frontera Sur. Proceedings of National Academy of Sciences 113:674–679. San Cristóbal de Las Casas. Historical and geographical perspectives. B. Noguera- Savelli y E.F. A. Riqueza y diversidad de árboles del bosque tropical caducifolio en la Depresión Cen- tral de Chiapas. Homeier. Duque. 2010. M. N. Páginas 518-554. Forshed. y D. 2003. A. B ­ unyavejchewin. and diversity. O. Musálem-Castillejos. K. extinction.-I. Brunel-Manse (editores).D. K.J. Hector.K. R.F. Bernacci. Alves. P.V. A.J. R. P. P. Doucet. Gómez-Pineda. Farwig. P. Chiapas. D. Páginas 257–277. M. Vegetación de México. R. Rocha-Loredo. H. Itoh. Harris. Speciation and patterns of diversity. Bradford.E. D. Field.O. D. Dattaraja.Q. Boletín de la Sociedad Botánica de México 87:89–103. Franco. M.. Boyle.F. Rzedowski. Estrategias para una construcción social de la restauración forestal en comunidades de la cuenca media y alta del río Grijalva. G. L.T. de Oliveira Filho. y S. evaluación y monitoreo de la diversidad biológi- ca. Ferreira. J. ­Gunatilleke. pueblos y agua. Chen. Clark. Clark. L. The University of Chicago Press. Bispo. T.

Yap. M. Ochoa-Gaona. R. K ­ enfack. J. Santos. floristic affinities. M. Saner. Salomão.A.L. Kelly. F. R. D. F. Reich y F. Mansor. Stropp. Zahawi. K. M. E. L. Pitman. 2009. Nagamasu.Y. Valencia. M. Permana. Chlöe Buet y Nathaline Elena Taylor-Aquino P.J. H. 2013.H. T. T.D. Sist. S. An estimate of the number of tropical tree species.A. Schulze. Poulsen. E. Puyravaud. C. J.L. Reitsma.L. Page. Neptalí Ramírez-Marcial.L. T.C. ­Jansen. X. de Assis. S. D.W. Parthasarathy. ATDN y RAINFOR. Metzger.. en T. Baraloto. Vieira. E. J. Melo. Malhi.A. Ruokolainen.U.P. J. R. P. disturbance. Laurance. R. Adou Yao. A. A. Hurtado. Zakaria. F.W. F. I.M.A. Williams. Sukumar. R. et al. Toward a trophic theory of species diversity.. Lot y J. E. Proceedings of the National Academy of Sciences 109:10394–10397.K. dos S­ antos. J. B. Science 342:1243092 Terborgh. Saiter. Yan. do Amaral.C. Meilb. K. J. J. R.L. Parolin. Paudel. Webb. P. E. Suzuki.A. R. N.H. Fa (editores). Whitfeld. Van Do.R. R.P. Montero. J. Composition.P.J. Santos. J. V. W. H. Sarker. Yoneda.R. C. Joly. Laumonier. Tchouto. C. Disentangling re- gional and local tree diversity in the Amazon. J. Larney. Vasquez. Garcia Luize y E. H. N.C. N. J. H. Letcher. Ecography 32:46–54.H. Pitman.M. Miguel Martínez-Icó. Alfonso Luna-Gómez. Rovero. Stevart. S. E.Wich. Adekunle. S. K.H. D. Verbeeck.-F. 2015. D. Proceedings of the National Academy of Sciences 112:11415–11422. J.L. T. T. T. X. R. O. M ­ etcalfe. V ­ aleriano. H. D.L.P. S. Poorter. R. J. F. Wittmann. N. Millet. Zang.-C. Marjokorpi. van Valkenburg. Biodiversity impacts ecosystem p ­ roductivity as much asresources. 282 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . P. Y.C.B.O. Laurance. Proceedings of the National Academy of Sciences 112:7472–7477. Kessler. Powers. Schmitt. Venticinque. Guevara. S. Romero- Saltos. Suganuma. M. Y. J. Sheil. Tabarelli.F.F.J. Biological diversity of Mexico: Origins and distribution. A. J. B. Ramamoorthy. 1993.B. da Silva Pinheiro. I. A. Sun. B. or herbivory.A. 2012. E. V. M. Theilade. Poulsen. P. Sabatier. Tang. I. H. Kitayama. Hyperdominance in the Amazonian tree flora. M.T. Mugerwa. R. C. Piedade. Medjibe. 2015. Kartawinata. Sunderand. Prasad. M. Isbella. Lu. R. J.S. Parre. ter Steege.P. Tilman. Targhetta. M. Wendt. Oxford University Press. Phillips. Kearsley. de Jong. Suresh. Wöll. Páginas 595-680. J. Lindsell. Schöngart. Lawes. P. and origins of the canopy tree flora of the Mexican Atlantic slope rain forests. H. Spironello. D. J.P. E.E. ter Steege. Thomas.W. C. Kooyman.G. ­Satdichanh. Rutishauser. A. D. H. Bye. Nilus.. B. Rozak. N.S. D. Martin. A.A. Mohandas.C.A. New York. S. Razafimahaimodison.

y/o Chis.. Smith G × Tapirira macrophylla Lundell G × Tapirira mexicana Marchand G × × 283 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .. T × Metopium brownei Urban G. Chiapas Apéndice 1 Lista modificada de especies leñosas inicialmente consignadas en el estudio florístico de Wendt (1993) para la región de Uxpanapa. Bray G × Astronium graveolens Jacq... (2009) y el presente estudio. Wendt & J. Ocurre en al menos uno de estos estados (Ver. no Ver. T: Registrada solo de Tabasco y/o Chiapas.. SLP y algunas veces Tab.Y: Combinación de las dos distribuciones anteriores.D.) Standl.. Veracruz y Los Chimalapas. a menudo también en Tab. Oax. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Chis y/o extremo SW de Campeche. Watson Y × Louteridium mexicanum (Baill. QRoo y Camp. Pue. 2009 Región de 1996 Familia Nombre científico Bravaisia integerrima (Sprengel) Standley G × × × ACANTHACEAE Louteridium donnell-smithii S. Wendt G × × ACTINIDIACEAE Saurauia yasicae Loes. *: Especie observada. Ocurre en al menos uno de los estados de (Yuc. no inventariada.. D.. Oaxaca Para propósitos comparativos se anota la información de los registros para la REBISO realizados por Ochoa- Gaona (1996). Oax. Como en el documento original de Wendt (1993). G. Hgo. Y × * Mosquitoxylon jamaicense Krug & Urban G × × * ANACARDIACEAE Spondias mombin L. Y: Yucatán. G × × AGAVACEAE Beaucarnea pliabilis (Baker) Rose Y × AMARANTHACEAE Iresine arbuscula Uline & W. Smith G × Tapirira chimalapana T. o QRoo). G × ACHARIACEAE Chiangiodendron mexicanum T. G. o más al NW). G. Maldonado et al. Y × × × Spondias radlkoferi J.. Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.. Y × × × × Comocladia engleriana Loes. no en el resto de Camp. Yuc. la información de distribución se refiere a la distribución generalizada del bosque tropical lluvioso en la vertiente del Golfo de México: G=Golfo.

G.) R.) Miers. Y × Aspidosperma megalocarpon Muell. Y × × * Plumeria rubra L.) Saff. Neptalí Ramírez-Marcial. G × Xylopia frutescens Aublet G. 2009 Región de 1996 Familia Nombre científico Annona globiflora Schltdl. Fries G × × × * Cymbopetalum mayanum Lundell T × Desmopsis galeottiana (Baill. Y × * Aspidosperma cruentum Woodson G. Y × × × Woodson Stemmadenia grandiflora (Jacq. Miguel Martínez-Icó. Fr. G × AQUIFOLIACEAE Ilex guianensis (Aublet) Kuntze T × Ilex tectonica Hahn G × 284 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Sm. Y × Tabernaemontana arborea Rose G × Ilex costaricensis Donn. Arg.E. Y × Cymbopetalum baillonii R. Alfonso Luna-Gómez. T × Guatteria anomala R. Fries G × × Malmea depressa (Baill. G × ANNONACEAE Oxandra maya Miranda T × Rollinia membranacea Triana & Planchon G × Rollinia mucosa (Jacq. G. G. Y × * APOCYNACEAE Stemmadenia donnell-smithii (Rose) G. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.) Baillon G × Sapranthus humilis Miranda T × Sapranthus sp. Y × ANNONACEAE Annona liebmanniana Baillon G × Annona scleroderma Saff.E.098 T × Sapranthus violaceus (Dunal) Saff.E.

G. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. ex Mart. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.A. Y × * Astrocaryum mexicanum Liebm. G. G × × ARALIACEAE Orepanax geminatus Marchal G × × Schefflera morototoni (Aublet) Decne. G × × Atelea cohune (C. ex Mart.) Decne. Y × Sabal mauritiformis (Karsten) Griseb. Y × * & H. G. G × × × & Planchon Acrocomia aculeata (Jacq. 2009 Región de 1996 Familia Nombre científico AQUIFOLIACEAE Ilex belizensis Lundel G × Dendropanax arboreus (L.) Lodd. Y × Koanophyllon pittieri (Klatt) R. Y × Thrinax radiata Schultes & Schultes f.M. Y × × × & Planchon ARALIACEAE Oreopanax sp. 285 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Martius) Standley Y × Atelea liebmannii Becc. T × Gaussia maya (Cook) Quero & Read Y × Gaussia gomez-pompae (Quero) Quero G × ARECACEAE Roystonea dunlapiana P. King T × & H. G × Orepanax capitatus Planch. Sabal mexicana C. Allen G. Y × Sabal yapa Becc. Rob. T × Oreopanax peltatus Regel G × × Oreopanax sanderianus Hemsl. G × Attelea rostrata Oerst. Martius G. Wendl.

Y × × Bourreria oxyphylla Standley Y BORAGINACEAE Cordia alliodora (Ruiz & Pav. & Cham. Y × × × Aphananthe monoica (Hemsley) J. Y × × * Tabebuia donnell-smithii Rose G × BIGNONIACEAE Tabebuia guayavan (Seemann) Hemsley G × × Tabebuia rosea (Bertol.F.) Nicholson G. ARECACEAE T × & Brettell Tabebuia chrysantha (Jacq. Miguel Martínez-Icó. G × × × × BIXACEAE Cochlospermum vitifolium Willd ex Spreng. Y × Trema micrantha (L. Sm. G. Leroy G × × × × CANNABACEAE Celtis trinervia Lam. Neptalí Ramírez-Marcial. G. 2009 Región de 1996 Familia Nombre científico Telanthophora grandifolia (Less.) H. Johnston G × Cordia stellifera I. Y × 286 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . DC. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. Y × Cordia gerascanthus L. Y × × × * Capparis discolor J. Rob. G × * Cordia dodecandra A. G. Y × Ehretia tinifolia L. Johnston G × Cordia subestena L. T × * BURSERACEAE Bursera simaruba (L.D.) Oken G.M. Alfonso Luna-Gómez. G. DC.M. G. Y × Bursera bipinnata Sessé & Mociño) Engl.) DC. Y × × × × Protium copal (Schltdl.) Blume G. Y × × × × Cordia bicolor A. G. Y × Cordia megalantha S. Blake G × BORAGINACEAE Cordia prunifolia I. Smith G × CAPPARACEAE Capparis heydeana Donn.) Sarg.) Engl.

G × Wimmeria bartlettii Lundell G × × * Zinowiewia integerrima (Turcz. var. Y × Elaeodendron xylocarpum (Vent.) A. media G × CHRYSOBALANACEAE (Standley) Prance Licania hypoleuca Benth.) DC. subsp. hypoleuca G × Licania platypus (Hemsley) Fritsch G × × Licania sparsipilis S.) Lundell G. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. G. Y × Hirtella triandra Sw.C. Sm. G. Smith Y × × Coussapoa purpusii Standley G × Pourouma guianensis Aubl. 2009 Región de 1996 Familia Nombre científico Capparis mollicella Standley G × Capparis quiriguensis Standley G × CAPPARACEAE Crateva tapia L. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G. Y × × × Cecropia obtusifolia Bertol.F. Y × CARICACEAE Jacaratia dolichaula (Donn. G × × × Couepia polyandra (Kunth) Rose G × Hirtella americana L. Y × CELASTRACEAE Maytenus sp. T × Cheiloclinum belizense (Standl.D.) Woodson G. Y × × × × Cecropia peltata L. G × Maytenus purpusii Lundell G × × Maytenus schippii Lundel G. Y × Quadrella incana (Kunth) Iltis & Cornejo G.) Turcz. Blake G × 287 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Y × × × CECROPIACEAE Coussapoa oligocephala J. G × CELASTRACEAE Crossopetalum parviflorum (Hemsl. Sm.

Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G × Diospyros acapulcensis var. García & A. I. ex Willd. G × × * EBENACEAE Diospyros salicifolia Humb. Sanders Diospyros campechiana Lundel G. 2009 Región de 1996 Familia Nombre científico CLETHRACEAE Clethra sp. Y × × Bucida macrostachya Standl. G × Callophyllum brasiliense Cambess.) Steud. Y × * COMBRETACEAE Terminalia amazonia (J. Y × & Bonpl.C. Miguel Martínez-Icó. Diospyros vera-crucis (Standley) Standley G. Y × × (Standley) Standley Clusia belizensis Standley T × Clusia flava Jacq.) Provance. Alfonso Luna-Gómez. G × Bucida buceras L.119 G × Garcinia intermedia (Pittier) Hammel G × × Garcinia macrophylla C. Martius G.M. G × Clusia sp. Y × Diospyros yatesiana Standley Y × ELAEOCARPACEAE Sloaena ampla I. G. vera-crucis G × (Standl.) Steud. Y × Diospyros digyna Jacq. G × COMBRETACEAE Terminalia obovata (Ruiz & Pav. G. Johnson G × * 288 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .f. G × CLUSIACEAE Clusia salvinii Donn. Y × Clusia rosea Jacq. Neptalí Ramírez-Marcial. Sm. rekoi G. var.) Exell G × × × × Terminalia oblonga (Ruiz & Pav. Gmel. Y × Symphonia globulifera L.

& Steyerm. Y × Hyeronima oblonga (Tul. Y × Drypetes browneii Standley T × Drypetes lateriflora (Sw. 2009 Región de 1996 Familia Nombre científico Sloanea medusula Schumann & Pittier G × Sloanea meianthera J.D. G × Erythroxylum mexicanum Kunth G × Alchornea latifolia Sw. Y × EUPHORBIACEAE Omphalea oleifera Hemsley G × Pera barbellata Standley G × Sapium burgeaui Croizat G × ELAEOCARPACEAE Sapium lateriflorum Hemsley G × × 289 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Y × × × Croton draco Schltdl.) Krug & Urban G. G × Sloanea terniflora (DC. G. Y × × ERYTHROXYLACEAE Erythroxylum macrophyllum Cav.) Standley G × Sloanea tuerckeimii J. Smith G × ELAEOCARPACEAE Sloanea petenensis Standley & Steyerm.) Muell. Smith G × Erythroxylum campechianum L. G × Mabea excelsa Standl.f. Arg. G × × Margaritalia nobilis L. G. & Cham. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Y × Garcia nutans Vahl G × Hura polyandra Baillon G. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G. G. Y × * Croton guatemalense Lotzy G × Croton reflexifolius Kunth G × Croton schiedeanus Schltdl.D. G × EUPHORBIACEAE Croton sp.

G × * Hymenaea courbaril L. Alfonso Luna-Gómez.) Lundel G × × Sapium oligoneurum Schumann & Pittier Y × ELAEOCARPACEAE Sapium pedicellatum Huber T × Sebastiana tuerckeimiana (Pax & K. var. courbaril G. G. nov. Miguel Martínez-Icó. G × × Caesalpinioideae Gliricidia sepium (Jacq. Y × × Senna multijuga (Rich. G × Caesalpinia yucatanensis Greenman Y × Cassia grandis L. Y × × Pelthophorum dubium (Sprengel) Taubert G × Schizolobium parahyba (Vellozo) S.f. Irwin G × & Barneby Senna spectabilis (DC. Irwin G. Y × × & Barneby var. [Wendt] G × Caesalpinia gaumeri Greenman Y × Caesalpinia mollis (Kunth) Sprengel Y × Caesalpinia sp. spectabilis 290 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . doylei (Britton & Rose) H. 2009 Región de 1996 Familia Nombre científico Sapium macrocarpum Müll. G × Sapium nitidum (Monach.F. Hoffm) T × Lundell Tetrorchidium rotundatum Standley G × × Bauhinia sp.) H.Arg. Irwin & Barneby subs. Y × Cassia moschata Kunth G × Cynometra oaxacana Brandegee G × Cynometra retusa (Britton & Rose) G × FABACEAE/ Dialium guianense (Aublet) Sandw. Neptalí Ramírez-Marcial. Blake G.) H. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.) Kunth ex Walp.

& Cham. Y Acacia cornigera (L. G × 291 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . G × Acacia centralis (Britton & Rose) Lundell G. Y × × * Enterolobium schomburgkii Benth. G. Y × × Acacia pennatula (Schltdl. Y × × Acacia dolichostachya S. Y × FABACEAE Albizia purpusii Britton & Rose G × /Mimosoideae Albizia sp.) Willd.) Willd. Y Abarema sp. Smith) Rec. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote.) Benth.) Bukart G. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. T × * Acacia usumacintensis Lundell G.175 × Inga alba (Sw. G × Especie. G. Wilson) FABACEAE/ Y × Standley var. 2009 Región de 1996 Familia Nombre científico Swartzia cubensis (Britton & P. cubensis Caesalpinioideae Sweetia panamensis Benth. nov. T × × Cojoba arborea (L.) Griseb. Blake Y × × Acacia gentlei Lundell Y × Acacia glomerosa Benth. Y × Albizia adinocephala (J. T × Albizia guachapele (Kunth) Dugand T × Albizia niopoides (Benth. G. G × Enterolobium cyclocarpum (Jacq. G × Inga belizensis Standely T × Inga brevipedicellata Harms G × × Inga fagifolia (L. G.D.) Benth. Y × Cojoba sp.F.) Britton & Rose G × × × × Cojoba donnell-smithii Britton & Rose G.

G × × Inga quaternata Poeppig G × Inga sapindoides Willd. Y × × Papilionoideae Inga xalapensis Benth. Y × × * Andira galeottiana Standley G × × * Andira inermis (Wright) DC. 4 G × Inga tenuipedunculata León G × Inga thibaudiana DC. Y × Lysiloma acapulcensis (Kunth) Benth. nov. G × Inga sp. G × Dalbergia glomerata Hemsley G × Dalbergia tucurensis J.) Benth. G × Lysiloma latisiliquum (L. 1 G × Inga sp. Neptalí Ramírez-Marcial. spuria (Willd. Y × Zygia conzattii (Standley) Britton & Rose G × Acosmium panamense (Benth. nov. nov. 2009 Región de 1996 Familia Nombre científico Inga laurina (Sw. Smith G × 292 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .D. G × Dalbergia glabra (Miller) Standl. nov.) Yakovlev G. G × Leucaena glauca Benth.) León G. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G × Inga oerstediana Benth ex Seem. 3 G × Inga sp. Miguel Martínez-Icó. Dietr. G. G. G × Inga paterno Harms G × Inga punctata Willd. 2 G × Inga sp. G × Ateleia pterocarpa D. subs. Y × × * Lysiloma auritum (Schltdl. T × × FABACEAE/ Inga vera Willd.) Willd.) Benth. Alfonso Luna-Gómez.

Sousa G × Myroxylon balsamum (L. G. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.J. G. 2 G × Lonchocarpus sp. G × 293 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Sm. Y × Dussia mexicana (Standley) Harms G × Erythina chiapasana Krukoff G × Erythina tuxtlana Krukoff & Barneby G × Erythrina folkersii Krukoff & Mold. Y × × × FABACEAE/ Lonchocarpus hondurensis Benth. nov.) G × Standley & Steyerm. G × Lennea modesta (Standley & Steyerm. T × * Lonchocarpus robustus Pittier G × Lonchocarpus sp. nov. & var. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Sousa G × * Diphysa carthagenensis Jacq. nov. 1 G × Lonchocarpus sp. Y × × Papilionoideae Lonchocarpus lasiotropis F. G. 2009 Región de 1996 Familia Nombre científico Diphysa americana (Miller) M. G × Lonchocarpus castilloi Standley Y × × Lonchocarpus cruentus Lundell G × Lonchocarpus guatemalensis Benth. Herm. 3 G × Lonchocarpus sp.109 Y × Lonchocarpus verrucosus M. Y × pereirae (Royle) Harms Ormosia isthmensis Standley G × Ormosia macrocalyx Ducke G × Ormosia panamensis Benth.) Harms var. G × Lonchocarpus minimiflorus Donn. Lonchocarpus atropurpureus Benth.

nov. G LAURACEAE Beilschmiedia hondurensis Kosterm. 2 G × Vatairea lundellii (Standley) Killip G. G × Hernandia stenura Standley G × HIPPOCRATEACEAE Hemiangium excelsum (Kunth) A. G × ICACINACEAE Oecopetalum mexicanum Greenman G × & C. Miguel Martínez-Icó. Y × Papilionoideae Piscidia piscipula (L. 1 G × Styphnolobium sp.F.) F. Smith Y × ICACINACEAE Calatola laevigata Standl. Alfonso Luna-Gómez.) Dugand G × × Platymiscium yucatanum Standley Y × × FABACEAE/ Pterocarpus rohrii Vahl G. Thompson LACISTEMATACEAE Lacistema aggregatum (Bergius) Rusby G × LAMIACEAE Aegiphila monstrosa Moldenke G × × Aiouea inconspicua van der Werff G × Beilschmedia anay (S. Y × × Standley Platymiscium pinnatum (Jacq. Blake) Kosterm. T × 294 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Y × × × Willardia schiedeana (Schltdl.J. G × × Mappia racemosa Jacq. G.) Sarg. G × HERNANDIACEAE Hernandia sp. Y × × × Platymiscium dimorphandum Donn. 2009 Región de 1996 Familia Nombre científico FABACEAE/ Ormosia schippii Standley & Steyerm. Sm. Y × × × Papilionoideae Styphnolobium sp. T × Hernandia sonora L. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. nov.C. G. Herms. Neptalí Ramírez-Marcial. G × × Cinnamomum grisebachii Lorea-Hern. G × FAGACEAE Quercus corrugata Hook. nov.

) Mez G × LAURACEAE Nectandra loesnerii Mez G × Nectandra lundellii Allen G × Nectandra membranacea (Sw. G × Licaria pecki (I. G × not [Aublet] Mez] Nectandra sp.) Griseb.) G × Kosterm. globosa auth. [N. G × Nectandra perdubia Lundell G × Nectandra reticulata (R. 2009 Región de 1996 Familia Nombre científico Cinnamomum triplinerve (Ruiz & Pav. Johnston) Kosterm. Y × × × Nectandra sinuata Mez G × Nectandra sp. Y × × Licaria triandra (Sw. Licaria campechiana (Standley) Kosterm.) Kosterm. G × × Licaria velutina van der Werff G × Nectandra ambigens (S. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote.) Mez G × Nectandra salicifolia (Kunth) Nees G. & P.) Kosterm. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. & Schltdl. Y × Licaria capitata (Cham. nov. G × × Licaria misantlae (Brandegee) Kosterm. in part. G.F. T × Nectandra tubacensis (Kunth) Nees G × Ocotea cernua (Nees) Mez G × Ocotea dendrodaphne Mez G × × 295 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .M. Blake) Allen G × × Nectandra cissiflora Nees G × Nectandra colorata Lundell G × Nectandra cuspidata Nees G × Nectandra globosa (Aubl.

) Gaertner G.A. G × Ocotea rubriflora Mez G × Ocotea sp. G × LAURACEAE Ocotea sp. Y × × × Malpighia glabra L. S.) G. G × MALVACEAE Ceiba aesculifolia (Kunth) Britten & Baker F.) Meissner G × Persea schiedeana Nees G × Eschweilera mexicana Wendt. Y × * Ceiba penthandra (L.) Laness. Anderson G × Apeiba tiboubou Aublet G × Bernoullia flamea Oliver G × × × Berrya cubensis (Griseb.Mori LECYTHIDACEAE G × & Prance LYTHRACEAE Ginoria nudiflora (Hemsley) Koehne G × MAGNOLIACEAE Talauma mexicana (DC. Wendt & G × van der Werff Persea longipes (Schltdl. Alfonso Luna-Gómez. G × Ocotea sp. G. G × Malpighia wendtii W. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. T × Bunchosia lindeniana Adr. nov. Don G × × Bunchosia biocellata Schltdl. G × Byrsonima cotinifolia Kunth G × × MALPIGHIACEAE Byrsonima crassifolia (L. Y × × * Guazuma ulmifolia Lam.) Kunth G. Miguel Martínez-Icó.R. G × Ocotea uxpanapana T.) M. Neptalí Ramírez-Marcial. Y × × × 296 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2009 Región de 1996 Familia Nombre científico Ocotea effusa (Meissner) Hemsley G × Ocotea leucoxylon (Sw. Juss.

) Urban G × * Pachira aquatica Aublet G. G. Mortoniodendron ocotense Ishiki T × & T. Watson G × × × Heliocarpus americanus L. G × Heliocarpus appendiculatus Turcz. Y × × × Pseudobombax ellipticum (Kunth) Dugand G. prob. T × lacandonensis Quararibea yunckeri Standley G × Robinsonella brevituba Fryxell G × Robinsonella mirandae Gómez Pompa G × × × 297 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .) Spregue G * Luehea candida (DC. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. 2009 Región de 1996 Familia Nombre científico Hampea stipitata S. Y × Mortoniodendron guatemalense (Sw. Wendt Mortoniodendron palaciosii Miranda G × × MALVACEAE Mortoniodendron ruizii Miranda G × × Mortoniodendron vestitum Lundell G × × Ochroma pyramidale (Lam. Y × × × × Quararibea asterolepis Pittier G × Quararibea funebris (LLave) Vischer G. G × × × Heliocarpus donnell-smithii Rose G. nov. Y × × Quararibea gentlei Lundell T × Quararibea sp. Y × × × * Heliocarpus mexicanus (Turcz. [Alverson].) Mart. G × × Luehea seemannii Triana & Planchon T × Luehea speciosa Willd. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote.) G × Laness.

G × × Trichospermum grewifolium (A.) G. Neptalí Ramírez-Marcial.) DC. G × MALVACEAE Sterculia sp. Y × × × × Trichilia havanensis Jacq. [Wendt & E.) Loudon G × Mouriri gleasoniana Standley var. Y × × × Kosterm. G × × × Trichilia minutiflora Standley Y × 298 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . G × gleasoniana MELASTOMATACEAE Mouriri myrtilloides (Sw. DC. G. Rich. G × Trichilia hirta L. Vahl G × × × Guarea grandifolia DC. G × Miconia trinervia (Sw.) DC. Miguel Martínez-Icó.) Morley Cedrela odorata L. Y × × × × Guarea glabra M. Taylor] G × Trichospermum galeottii (Turcz.) Karsten G × Sterculia mexicana R. G × × Guarea guidonia (L.) Sleumer G × Guarea sp. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. nov.) Triana G × Miconia argentea (Sw.) Kosterm. G × parviflora (Benth. G × MELIACEAE Swietenia macrophylla King G. G. 2009 Región de 1996 Familia Nombre científico Robinsonella samaricarpa Fryxell G × Sterculia apetala (Jacq. G × MELASTOMATACEAE Miconia elata (Sw.) Poiret subsp. Bellucia grossularioides (L. Br. Alfonso Luna-Gómez. Y × × Trichilia martiana C.

) Miq. Y × × × × Brosimum guianense (Aublet) Huber G × Brosimum lactescens (S. Y × Ficus petenensis Lundell G × Ficus tecolutensis (Liebm. G × Ficus colubrinae Standley G × × × Ficus cookii Standley G × × Ficus cotinifolia Kunth G. Y × × Trichilia pallida Sw. G × Brosimum alicastrum Sw.C. 2009 Región de 1996 Familia Nombre científico Trichilia moschata Sw. Y × Ficus obtusifolia Kunth G. Y × 299 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Burger G. elastica G. G × Ficus pertusa L.) Miq.f. Berg G × Castilla elastica Sessé var. alicastrum G. subsp. G × Ficus maxima Miller G.) Miq. Moore) C. G × Ficus perforata L. moschata G. Y × * Clarisia biflora Ruiz & Pav. G. G. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. MELIACEAE Trichilia moschata Sw. G. G × Ficus aurea Nutt. Y × × × Ficus insipida Willd. G × × × MORACEAE Ficus isophlebia Standley G × Ficus jimenezii Standley G × * Ficus lapathifolia (Liebm. var. subsp.) Gaudich. Y × Chlorophora tinctoria (L. Y × * Ficus morazaniana W. Y × Ficus paraensis (Miq. matudae G × × (Lundell) Penn.

Berg G × Eugenia acapulcensis Steudel G. Y × Eugenia bumelioides Standl.) D. Smith G. Y × Poulsenia armata (Miq. G.) Willd.M. Y × Eugenia capuli (Schltdl.& Cham. Alfonso Luna-Gómez. 2009 Región de 1996 Familia Nombre científico Ficus trigonata L.) Standley G × × × MORACEAE Pseudolmedia oxyphyllaria J. G × Eugenia mexicana Steudel G × × Eugenia tikalana Lundell Y × Eugenia uxpanapensis P. Burger G × Ficus yoponensis Desv. G × × 300 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Burger Compsoneura sprucei (A. ramon G. Y × × MYRTACEAE Eugenia choapamensis Standley G × × Eugenia colipensis O. Berg G. Berg.) DC. Sánchez G × & L. Y × Calyptranthes schiedeana O.) Bureau G × × × Trophis racemosa (L. G × MYRISTICACEAE Virola guatemalensis (Hemsley) Warb. Miguel Martínez-Icó.) Griseb. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G × Maclura tinctoria (L.D.) Urban subsp. pallens G. G. Y × × × (Schltdl. Y × × × Eugenia aeruginea DC.) W. G × Eugenia axilaris (Sw. G.) O. G × × Trophis mexicana (Liebm. & Cham. Y × × × * Pseudolmedia spuria (Sw. DC. Don ex Steud. Ortega Myrcia splendens (Sw. G × Calyptranthes pallens Griseb. var.) Warb. Y × Ficus turrialbana W. Neptalí Ramírez-Marcial.

Green 301 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Berg) Niedenzu G.F.202 × Especie. T × × & Steyerm. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Y × Pimenta dioica (L.064 × Especie. G.161 × Especie.209 × Especie.219 × Guapira linearibracteata (Heimer) Lundell G × Guapira petenensis Standl. 2009 Región de 1996 Familia Nombre científico Myrcianthes fragrans (Sw. G × × × OLEACEAE Fraxinus purpusii var.) P. Blake G × Chionanthus domingensis Lam. Y × * Especie.129 × Especie.007 × Especie.024 × Especie. G × OLACACEAE Heisteria media S. Berg) G × Niedenzu Psidium sartorianum (O. Sm. vellerea (Standl.217 × Especie.S. G × Neea stenophylla Standl. G × NYCTAGINACEAE Neea psychotrioides Donn.) Merr. Y × × × × MYRTACEAE Psidium friedricksthalianum (O.034 × Especie.) McVaugh G.037 × Especie.189 × Especie. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.089 × No determinadas Especie.

Neptalí Ramírez-Marcial.D. Y × × Coccoloba floresii Ortiz-Díaz & Arnelas T * Coccoloba hondurensis Lundell G × Coccoloba matudae Lundell G × POLYGONACEAE Coccoloba montana Standley G × Coccoloba sp. T × Coccoloba spicata Lundell Y × Coccoloba tenuis Lundell T × Coccoloba tuerckheimii J. & Urban G × PROTEACEAE Roupala montana Aublet G × Colubrina arborescens (Miller) Sarg. Y × PIPERACEAE Piper yucatanense C. 2009 Región de 1996 Familia Nombre científico ONAGRACEAE Hauya elegans DC. odorata G × × PENTAPHYLACACEAE Ternstroemia tepezapote Schltdl. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G. Miguel Martínez-Icó.) Standl. G. Smith G × × Gymnopodium floribundum Rolfe. Y × PODOCARPACEAE Podocarpus guatemalensis Standley G × Coccoloba acapulcensis Standley Y × Coccoloba barbadensis Jacq. Y × 302 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . DC. Y × * Ruprechtia pallida Standley G × Ardisia compressa Kunth G × PRIMULACEAE Ardisia densiflora Krug. & Cham. Vahl) Urban G. Alfonso Luna-Gómez. G × × PHYLLANTHACEAE Phyllanthus sp. G. G × OPILIACEAE Agonandra racemosa (DC. Y × × × Coccoloba belizensis Standley G × Coccoloba cozumelensis Hemsl. Y × × RHAMNACEAE Krugiodendron ferreum (M. G × PASSIFLORACEAE Erblichia odorata Seemann var.

G × Psychotria chiapensis Standley G × × 303 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .D. Y × Blepharidium guatemalensis Standley Y × × * Calycophyllum candidissimum (M. Y × × × × Guettarda macrosperma J. G × Alseis yucatanensis Standley Y × Antirhea lucida (Sw.D. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. Y × × Genipa americana L. & J. Hook. Gray G. G. Smith G. Vahl) DC. Smith G × Morinda panamensis Steemann G × Posoqueria latifolia (Rudge) Roemer G × & Schultes Psychotria carthagensis Jacq. Y × Prunus barbata Koehne G × ROSACEAE Prunus brachybotrya Zucc. Y × * Chione chiapasensis Standley G × × Chione guatemalensis Standley T × Chione mexicana Standley G × Chomelia breedlovei Borhidi G × Courtaportia guatemalensis (Standley) G × Lorence RUBIACEAE Coussarea mexicana Standley G × Elaeagia uxpanapensis Lorence G × Exostema mexicanum A.D. G × * Guettarda combsii Urban G.) Bent. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.) Planch. Y × Arachnothryx buddleioides (Benth. 2009 Región de 1996 Familia Nombre científico RHIZOPHORACEAE Cassipourea guianensis Aublet G. Y × × Hamelia calycosa J.

G × RUTACEAE Zanthoxylum acuminatum (Sw. G × RUBIACEAE Randia matudae Lorence & Dwyer G × Rondeletia galleottii Standley G × Simira salvadorensis (Standley) Steyerm. Y × Citrus × aurantium × Decazyx macrophyllus Pittier & Blake G.) Urban G × SALICACEAE Casearia arguta Kunth G × 304 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . G. belizensis (Lundell) Kaastra Stauranthus perforatus Liebm. G. G.) Griseb. Neptalí Ramírez-Marcial.059 × Psychotria sp. Alfonso Luna-Gómez.Wilson G × Zanthoxylum procerum J.D.) Sw. G × Zanthoxylum panamense P. Y × Casearia arborea (Rich. Miguel Martínez-Icó. Wilson G × × Zanthoxylum mayanum Standley T × Zanthoxylum microcarpum Griseb. G × subsp. Y × × Zanthoxylum riedelianum Engl. G × Zanthoxylum belizense Lundell G × Zanthoxylum caribaeum Lam. Y × Esembeckia pentaphylla (Macfad. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. G. 2009 Región de 1996 Familia Nombre científico Psychotria simiarum Standley G × Psychotria sp. Y × × Zanthoxylum kellermanii P. G × Amyris elemifera L.085 × Randia aculeata L. Smith G. Y × × × Sickingia lancifolia Lundell T × Amyris attenuata Standl.

2009 Región de 1996 Familia Nombre científico Casearia bartlettii Lundell T × Casearia commersoniana Cambess. G. G. Y × SAPINDACEAE Cupania mayana (Lundell) Lundell T × Cupania rufescens Triana & Planch. Y × × × Blomia prisca (Standley) Lundell G.) Sleumer G × × Populus mexicana Wesm. Y × × * Cupania glabra Sw. G × SALICACEAE Laetia thamnia L.L Juss. G.) Britton G. G × * 305 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .subsp.) Radlk. Y × × × Matayba apetala (Rich. var. G × × Pleuranthodendron lindenii (Turcz. Y × × × × Allophyllus psilospermus Radlk. sylvestris G × × × Casearia tacanensis Lundell G × × Hasseltia guatemalensis Warb. G. Y × × Matayba oppositifolia (Macfad) Radlk. G × Casearia corymbosa Kunth G. G. Y × Exothea paniculata (A. G × Exothea diphylla (Standley) Lundell G. Smith G × × × Zuelania guidonia (Sw.D. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. G × Homalium racemosum Jacq. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.) Britton & Millsp. mexicana G × Salix humboldtiana Willd. Gómez & Mollinet G × Cupania dentata DC. G. Y × * Xylosma chloranthum J. G. Y × Lunania mexicana Brandeg. Y × × × Cupania belizensis Standley Y × Cupania cubensis M. Y × × × Casearia sylvestris Sw.

1 G × Pouteria sp. G × × × durlandii SAPOTACEAE Pouteria glomerata (Miq. Y × × × × Chrysophyllum venezuelanense (Pierre) G × Penn. T × 306 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Miguel Martínez-Icó. T × Pouteria campechiana (Kunth) Baehni G.) Baehni G × Pouteria viridis (Pittier) Cronq. G × tuberculata (Sleumer) Penn. G. Sm. 2009 Región de 1996 Familia Nombre científico Sapindus saponaria L.) H. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols.) Radlk.E. Y × glomerata Pouteria reticulata (Engl. Neptalí Ramírez-Marcial. Y × × × Talisia floresii Standley Y × SAPINDACEAE Talisia oliviformis (Kunth) Radlk. Y × Thounia canescens Radlk. 2 G × Pouteria torta (C. Y × Chrysophyllum mexicanum Brandegee G. Moore & Stearn G × × × Pouteria sp.) Cronq. Y × × × × Micropholis melinoniana Pierre G × Pouteria belizensis (Standl. Alfonso Luna-Gómez. G. subsp. Y × × Pouteria durlandii (Standley) Baehni subsp. Martius) Radlk. Pouteria unilocularis (Donn. G. subsp.) P. Y × reticulata Pouteria sapota (Jacq. Royen G. Manilkara chicle (Pittier) Gilly G × × Manilkara zapota (L.) Eyma subsp.

Penn. G. G × STAPHYLEACEAE Turpinia occidentalis (Sw. G × × tempisque (Pittier) Penn. DC. G × × breviflora Croat STYRACACEAE Styrax argenteus Presl. Diversidad local y regional de árboles en la Reserva de la Biosfera Selva El Ocote. subsp. G × × Huertea sp. G × Sideroxylon foetidissimum Jacq. T × Sideroxylon tepicense (Standl. G × Sideroxylon eucoriaceum (Lundell) Penn. G × Alvaradoa amorphoides Liebm. 2009 Región de 1996 Familia Nombre científico Sideroxylon capiri (A.) Lam. Y × gaumeri (Pittier) Penn.) G. Don subsp. Y × * SIMAROUBACEAE Recchia simplicifolia T. G × minutiflorum (Pittier) Penn.) Pittier subsp.) T. Y × Solanum erianthum D. G × SOLANACEAE Solanum nudum Dunal G × Cestrum racemosum Ruiz & Pav. Y × × Sideroxylon stevensonii (Standley) Penn. G × × × subsp. Donn. Chiapas Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. Wendt & Lott G × Simarouba glauca DC. Sideroxylon salicifolium (L. persimile Sideroxylon portoricense Urban subsp. G. SAPOTACEAE Sideroxylon persimile (Hemsley) Penn. T × × Freziera grisebachii Krug & Urban G × THEACEAE Laplacea grandis Brandegee G × 307 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Sideroxylon contrerasii (Lundell) Penn.D.

Sm. Y × × Rehdera penninervia Standley & Mold. Smith G × ×   *  Totales 597 451 148 54 191 308 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Alfonso Luna-Gómez. VIOLACEAE Orthion subsessile (Standley) Steyerm.D. Neptalí Ramírez-Marcial. G Citharexylum affine D. G × VERBENACEAE Lippia myriocephala Schltdl. G × Citharexylum donnell-smithii Greenm. T × & Standley Rinorea hummelii Sprague G × × VOCHYSIACEAE Vochysia guatemalensis J.) Blume G × × URTICACEAE Myriocarpa heterospicata Donn. 2009 Región de 1996 Familia Nombre científico Ampelocera hotlei (Standley) Standley G. Y × ULMACEAE Ulmus mexicana (L. & Cham. Don G × × Citharexylum caudatum L. T × Vitex gaumeri Greenman Y × Orthion malpighiifolium (Standley) G × Standley & Steyerm. Chlöe Buet y Nathaline Elena Taylor-Aquino Apéndice 1 (continuación) Ochoa-Gaona Wendt 1993 Este estudio distribución Maldonado cols. Miguel Martínez-Icó. G.

Se identificó a Acacia centralis como 309 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . El Colegio de la Frontera Sur. así como los riesgos que enfrentan las especies ante cambios ambientales. las relaciones genéticas de 17 especies arbóreas.P. México) Correspondencia: Bárbara Cruz-Salazar. Unidad San Cristóbal (San Cristóbal de Las Casas. y su asociación con la riqueza de especies de árboles en cinco localidades de la Reserva de la Biosfera Selva El Ocote (REBISO). Se obtuvo una estimación de la variación genética (π) de la región del ADN nuclear ribosomal ITS 1-2 e ITS 3-4 y se determinó su correlación con índices de diversidad del ­sitio. Departamento de Conservación de la Biodiversidad.mx.2 María Zenaida López-­ López. Chiapas.40) la de mayor. Chiapas. Carretera Panamericana y Periférico Sur s/n.025) y Guarea glabra (π = 0. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. El Colegio de la Frontera Sur. E-mail: bcruz@ecosur. Resumen La distribución de la diversidad genética y su relación con la diversidad de espe- cies puede ayudar a conocer el potencial evolutivo de un ecosistema. 29290 San Cristóbal de Las Casas. México) 2 Laboratorio de Genética.1 Maricela García-Bautista. México. En este estudio se exploró la distribución de la diversidad genética. C. Barrio María Auxiliadora. México Bárbara Cruz-Salazar. Unidad San Cristóbal.1 Trinidad Alejandro Guillén-Díaz1 y Lorena Ruíz-Montoya1 1 Departamento de Conservación de la Biodiversidad. El ADN se extrajo de hojas o de cambium de corteza de cinco a 26 individuos por especie. Unidad San Cristóbal (San Cristóbal de Las casas. Chiapas. Chiapas. El Colegio de la Frontera Sur.edu. Maytenus purpusii fue la especie con menor diversidad genética (π = 0.

María Zenaida López-­López. Estas interpretaciones significan en conjunto que las especies de árboles de la REBISO tienen potencial adaptativo al cambio climático. Palabras clave: cambio climático. de manera tal que la diversidad genética de una población se relacio- na con la diversidad de la comunidad a la que pertenece (Verdú 2009. La diversidad genética y la diversidad de especies pueden estar estrecha- mente ligadas. La diversidad genética encontrada fue de baja a moderada y distri- buida heterogéneamente entre las localidades. genética de comunidades. 2015. Silvestrini et al. La diversidad genética se entiende como la variación de genotipos y alelos que se presenta en una o más poblaciones. Bárbara Cruz-Salazar. Uno de los estimadores más simples de esta diversidad es el número de especies o la generación de índices que pondera la frecuencia de especies raras y abundantes (Jost 2016). junto con Bursera simaruba y Protium copal. 2006). y se considera un indicador del potencial evolutivo de las especies. 2006). selvas tropicales. La interacción de los organismos de distintas especies puede ser también a través de sus genotipos. ITS. y en conjunto crean ecosistemas dinámicos (Wei y Jiang 2012). 2015). Wehenkel et al. A mayor diversidad genética. 2009). La diversidad de especies se refiere a la presencia de especies y su abundancia en un lugar determinado. si este es gradual y en ausencia de procesos de deforestación por actividades humanas. Maricela García-Bautista. Se detectó una relación positiva entre la diversidad genética y la diversidad de espe- cies arbóreas. Introducción La diversidad genética y la diversidad de especies son dos componentes importan- tes de la diversidad biológica (Wehenkel et al. El estudio de la diversidad genética de comunidades se ha abordado con especies de plantas y herbívoros asociados (Barbour et al. mayor es la ­capacidad de respuesta de la especie a cambios ambientales (De Almeida et al. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya el linaje con menor número de sustituciones nucleotídicas (especie secundaria y adaptada a disturbio humano). La distribución de la diversidad genética entre poblaciones y entre especies es un reflejo de su historia 310 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . REBISO.

México evolutiva en interacción. El conocimiento de los patrones de diversidad genética puede ser útil para tomar decisiones sobre el establecimiento de áreas prioritarias de conservación y para el diseño del manejo sustentable de especies con importancia económica (Vázquez-Domínguez 2007). cloroplastos. ecológicos y ambientales. y los resultados sugieren que los patrones de diversidad son producto de procesos evolutivos. por lo que una puede predecir a la otra. Chiapas. 2007. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. 53 de reptiles. y Uxpanapa. Montiel-Oscura et al. 2015. posiblemente de forma lineal (Vellend y Geber 2005). La Reserva de la Biosfera Selva El Ocote (REBISO) es un ANP que se caracteriza por su alta biodiversidad y endemismo. 97 de mamíferos y 334 de aves (Flamenco et al. tales como frag- mentación del paisaje. 2012). 2017). 2013. (2013) reportaron 4. generalmente se tienen restriccio- nes logísticas y financieras para realizar estudios de este tipo. Villaseñor et al. Hay poco conocimiento de estudios genéticos con especies arbóreas dentro de las Áreas Naturales Protegidas (ANP) de México. Delgado y Piñero 2002. Veracruz. dependiente del marcador utilizado. 2011). La REBISO forma parte del corredor biológico mesoamericano por su proximidad con los Chimalapas. AFLP (Amplified Fragment Length Polymorphism). ITS (Internal Transcribe Spacer). microsatélites y aloenzimas (Tabla 1). Rivera-Rivera et al. y es considerada uno de los principales remanentes de bosque tropical en el mundo (Flamenco-Sandoval et al. Orihuela 2014. asimismo se carece de elementos para valorar la eficiencia de los programas de conservación de bosques. aislamiento por distancia y tamaño poblacional (Alcalá et al. García-Gómez et al. 311 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . RAPD (por sus siglas en inglés. contiene más de 2000 especies de plantas vasculares. 30 de anfibios. Oaxaca.331 especies de árboles para México. Random amplification Polymorphic DNA). de las cuales sólo se han estudiado genéticamente a 45 (Tabla 1). Esta situación limita el cono- cimiento de los efectos de los cambios ambientales en las especies y comunidades. Ruiz-Montoya et al. 2014. A pesar de la importancia que tiene la variación genética de especies para su manejo y conservación (Thompson 1992). Los marcadores utilizados son isoenzimas. Estos estudios muestran que las especies de árboles con- centran una diversidad genética importante con intervalos variables. Los estudios de la diversidad genética de especies arbóreas de México son relativamente pocos con respecto al total de las especies de plantas árboreas des- critas (Wehenkel et al.

2009 RAPD Polimorfismo isoenzimas 29. guatemalensis. pseudostrobus π = 0. Abies Isoenzimas Ho = 0.220 Delgado et al. eduardii.318 Quijada et al. Abies religiosa. y Abies hickeli He = 0. 2006 Ht = 0 (ADNm) He= 0.8237 Escalante 2001 de cloroplasto Pinus pinceana y Pinus Isoenzimas He= 0. He= 0. potosina Quercus affinis y Q. muricata He = 0.1 en A. 2009 spp. María Zenaida López-­López. 1999 Abies guatemalensis. 1997 Pinus rzedowskii ITS y RFLP Ho = 0.0031. 2007 Pinus pseudostrobus de cloroplasto He= 0. 2004 laurina Malus domestica RAPD Polimorfismo 80% González-Horta et al.174 Ledig et al.33 Q. Maricela García-Bautista. pseudostrobus Microsatélites Pinus nelsonii He= 0. Estudios de diversidad genética realizados con especies arbóreas de México Marcador Especie Niveles de diversidad Autor molecular Picea chihuahuana Isoenzimas He= 0. 1998 Pinus rzedowskii Isoenzimas He= 0. flinckii Aguirre-Planter et al. Microsatélites Pinus pinceana He= 0. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya Tabla 1.299. 2004 potosina He = 0. 2003 de cloroplasto Quercus eduardii y Q.069 en A. Cloroplasto Delgado y Piñeiro 2002 Pinus pseudostrobus He = 0.346 en P.12 Viveros-Viveros et al.409 para Pinus monte- Pinus montezumae y Microsatélites zumae. Ho = 0. 2001 muricata He = 0. 2005 Quercus affinis y Q.386 en P.093 Ledig et al. Cloroplasto h = 0. monte- Pinus montezumae y zumae. 2005 laurina Ht = 0.597 González-Rodríguez et al. Isoenzimas Molina-Freaner et al.4571 – 0. 2001 maximartinezii Picea mexicana Isoenzimas He= 0. 2002 Pinus laguanae y Pinus He= 0. Isoenzimas y Pinus chiiapensis Polimorfismo RAPD 24. Bárbara Cruz-Salazar. ht = 0. hickeli.125 Ledig et al.6% Persea americana Mill.5% Del Castillo et al. 2000 flinckii. RAPD Polimorfismo 18.4 % González-Rodríguez et al. lagunae.4752 – 0.113 en A. drymifolia Pinus hartwegii Isoenzimas He= 0.448 P.4130 en P.264 Cuenca et al. Picea chihuahuana ADNcp y ADNm Jaramillo-Correa et al.415 (ADNcp). AFLP Sin información Gutiérrez-Díez et al. 2010 312 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .416 en P. RAPD Alfonso-Corrado et al.35 en Q. Delgado et al.

discolor. & Cham He = 0.253. Pinus pseudostrobus y pseudostrobus.154 González-Hernández et al. He = heterocigocidad esperada promedio. ht = diversidad haplotípica total.073 en P.055 en A. 2013 Pinus patula Schiede ex Microsatélites Nt = 59. ADNm = ADN mitocondrial.379 Ruiz–Montoya et al. durangensis. breedlovi Pinus johannis Isoenzimas Ho = 0. Montezumae Byrsonima crassifolia (L. He = 0. Ht = heterocigocidad total. magnus. 2011 Manilkara zapota Microsatélites Na = 11. flincjii Microsatélites Mújica 2013 Ho = 0.373 ± 0. Na = número de alelos promedio.202 Montiel-Oscura et al. 303.246. 2012 Ho = 0. Pinus durangen.555-0. h = diversidad haplotípica. 2010 sideroxyla Ho = 0. Hs = heterocigocidad por subpoblación. He = 0. He = 0. 2010 Oreopanax xalapensis Isoenzimas Ho = 0.802 Alfonso-Corrado et al. Nt = número de alelos totales.818 – 0.059 en O. rhamnoides. Ho = 0. He = 0. Estudios de diversidad genética realizados con especies arbóreas de México (continuación) Marcador Especie Niveles de diversidad Autor molecular Quercus hypoleucoides. Oreopanax xalapensis. 2013 H. 270. xalapensis. He = 0. 2015 268. Prunus rham- He = 0. religiosa Litsea glaucescens Kunth RAPD Sin información Valle et al. sine juergensinii. Styrax magnus y = 0. 2013 Ho = 0.039 Symplocos breedlovi en S. teocote.03.290. Arbutus xalapensis. He = 0.K Fagus grandifolia Aloenzimas Ho = 0. ADNcp = ADN de cloroplasto. García-Bautista et al.470 Annona squamosa Isoenzimas Salazar et al. flincjii.277 en P. Abies religiosa y A.362. 2016 P. Chiapas. AFLP Herández-Velasco et al.112 en P.120 en M. π = diversidad nucleotídi- ca. respectivamente. 2010  ± 0. 2014 barbata. Prunus RFLP He = 0.12 Martínez et al. 323 bandas Pinus cembroides. He = 0. He = 0. He noides.895 en A.716 Alcalá et al.883 en A. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. Q.023 Dendropanax arboreus Microsatélites Ho = 0. He = 0. scytophylla y Q. 2014 Swietenia macrophylla Microsatélites He = 0. barbata.253 Figueroa-Esquivel et al. xalapensis.231.) RAPD Ho = 0. juergensinii. México Tabla 1. cem- sis y Pinus teocote broides.85.841 Peñaloza-Ramírez et al. Ho = heterocigocidad observada promedio. Myr- He = 0. 313 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .B. 2013 Pinus montezumae Ho = 0. Pinus polimórficas en P. P. Microsatélites Delgado et al. 2014 Schltdl.245 García-Gómez et al.274 en P. discolor y P. Microsatélites He = 0.183 en S.

2012. (2) estudiar las relaciones genéticas entre las especies arbóreas estudiadas. Orihuela et al. 2013). Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya 2007. 2012). Antecedentes Los estudios realizados en la REBISO versan la tasa de cambio de uso de suelo con herramientas de sistemas remotos de información geográfica (Flamenco-Sandoval et al. los objetivos del presente estudio fueron: (1) identificar los niveles de di- versidad genética de árboles de la Selva El Ocote. puesto que han causado el deterioro del hábitat y la pérdida de especies en esta región (Flamenco et al. Orihuela-Belmonte et al. Rivera et al. María Zenaida López-­López. y al registro de la diversidad genética que se conserva en sus ANP’s. Orantes et al. Hasta el momento no se conocen estudios genéticos de ninguna de las especies presentes en la Reserva. con base en la variación de se- cuencias de nucleótidos de la región de ADN nuclear ribosomal ITS1-2 e ITS3-4. 2013) y el aprovechamiento de los recursos maderables tropicales na- tivos de la Reserva (Velasco et al. 2007). Bárbara Cruz-Salazar. y la evaluación de la profundidad del sue- lo para estimaciones de almacenamiento de carbono (Orihuela-Belmonte et al. Por tal motivo. evaluación del combustible forestal (Ve- lasco et al. Maricela García-Bautista. la disminución de especies arbóreas debido a los incendios forestales de 1998 y 2003 (Maldonado et al. 2013. 2012). No obstante. 314 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . el efecto de las actividades hu- manas y la deforestación amenazan fuertemente a la biodiversidad de la REBISO. busca aportar información de un área altamente amenazada. por lo tanto esta investigación es la primera en su tipo. 2009). 2007). estimación de la producción de hojarasca en selvas y acahuales (Orihuela-Belmonte y de Jong 2012). Otros estudios han sido sobre el abastecimiento y acumulación de carbono del bosque tropical secundario y del suelo (Orihuela 2014. 2012). poco investigada y de gran importancia biológica como lo es la REBISO. Asimismo. y (3) explorar la relación entre la diversidad genética observada y la diversidad de es- pecies arbóreas de la Reserva para conocer la interacción entre los dos niveles de diversidad. Nuestro trabajo contribuye al estudio de la genética de comunidades de árboles en México.

La vegetación original es selva tropical perennifolia y subperennifolia. 315 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Rivera-Rivera et al. 5.288 ha. 2012) (Figura 2). 2012). no obstante mucha de su extensión se ha transformado a bosques secundarios y tierras de cultivo (CONANP 2006. entre las coordenadas 16°45’42’’ y 17°09’00’’ N. y 93°54’19’’ y 93°21’20’’ W (Orihuela 2014. al noreste del estado de Chiapas. (2000) Materiales y métodos Área de estudio La Reserva de la Biosfera Selva El Ocote tiene una superficie aproximada de 101. IGS = secuencia i­ntergénica. 25S = regiones codificantes del ADN ribosomal. México. Estructura de ADN nuclear ribosomal en eucariontes y ubicación de la región ITS ETS = espaciador transcrito externo.8S. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. se encuentra ubicada entre dos provincias biogeográficas neotropicales: la Provincia del Pacífico y la Provincia de Tehuantepec. El intervalo de altitud de la reserva va de 180 msnm hasta 1500 msnm (Coutiño 2010). ITS2 = espaciador transcrito interno 2. con una temperatura media anual superior a los 22°C y una precipitación media anual de 1200-2000 mm (Coutiño 2010. El clima predominante es cálido húmedo con abundantes lluvias en verano. NTS = espaciador no transcrito. Chiapas. México Figura 1. 18S. Figura modificada de Booy et al. ITS1 = espaciador transcrito interno 1. Rivera- Rivera et al. Orihuela 2014).

Localidades de muestreo de especies arbóreas de la Reserva de la Biosfera Selva El Ocote en Chiapas. El Encajonado. (2017) para analizar la diversidad de comunidades de árboles. María Zenaida López-­López. Mientras un grupo de trabajo tomó datos sobre la identidad de los individuos con un DAP > 1.5 ml (Eppendorf). Maricela García-Bautista. Bárbara Cruz-Salazar. Las hojas fueron aquellas que se observaron de reciente formación y sin daño aparente. En cada localidad se establecieron nueve parcelas circulares de 1000 m2 para el registro de la presencia de especies de árboles y para la obtención de muestras de hojas o cabium de corteza de los mismos en las mismas parcelas que utilizaron Ramírez-Marcial et al. otro grupo se encargó de tomar las muestras de hojas o cabium de corteza. Veinte Casas. San Joaquín y Emilio Rabasa (Figura 2). de cada hoja se tomó una porción para conservarla en un vial de 1. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya Figura 2. con buffer CTAB hasta 316 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . México Obtención de muestras El muestreo se realizó en áreas de la zona nucleo y de amortiguamiento en cinco localidades de la REBISO: Nuevo San Juan Chamula.5 cm.

subsp. matudae (Lundell) 0 26 0 1 0 27 Penn. 2017).) Engl. NS = Nue- vo San Juan Chamula. Chiapas. Tabla 2. El hisopo y su contenido se conservó en viales de 1.) P. México su procesamiento en el laboratorio. & Cham. 0 14 0 1 0 15 Mortoniodendron ocotense Ishiki & T. alicastrum 0 0 11 0 0 11 Pseudolmedia spuria J. se frotó un hisopo de algodón esterilizado para extraer tejido celular vivo. Nsp = número de muestra por especie. var.) Sw. Mimosoideae Acacia centralis (Britton & Rose) Lundell 10 0 0 0 0 10 Moraceae Brosimum alicastrum Sw. ER = Emilio Rabasa. 12 0 0 0 0 12 Sapindaceae Allophylus psilospermus Radlk 0 5 0 0 0 5 Sapotaceae Manilkara zapota (L. Del total de las especies muestreadas (191). El cambium se obtuvo realizando cuatro cortes perpendiculares para retirar aproximadamente 10 cm2 de corteza. se eligieron 17 con base a un tamaño de muestra > 5 individuos (Tabla 2). EE= El Encajonado. Smith 0 0 0 1 7 8 Rubiaceae Psychotria chiapensis Standley 0 0 13 3 0 16 Rutaceae Zanthoxylum acuminatum (Sw. 0 0 0 0 5 5 Zanthoxylum caribaeum Lam. 10 0 0 0 3 13 Protium copal (Schltdl. y sobre ésta o la parte descubierta del árbol.D. El análisis de composición y diver- sidad se presenta en el Capítulo 7 de este mismo libro (Ramírez-Marcial et al. 317 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .5 ml con buffer CTAB. VC = Veinte Casas. 0 0 0 0 5 5 Celastraceae Maytenus purpusii Lundell 0 0 0 0 5 5 Euphorbia- Garcia nutans Vahl 0 0 0 0 8 8 ceae Malvaceae Heliocarpus appendiculatus Turcz. Royen 0 0 0 0 19 19 Nloc 46 45 48 11 52 202 Número de especies 4 3 4 5 7 17 Nloc = número de muestra por localidad. Tamaño de muestra por especie y por localidad para el análisis de la diversidad genética con el ITS 1-2 e ITS 3-4 en la Reserva de la Biosfera Selva el Ocote Localidad Familia Especie EE NS VC SJ ER Nsp Boraginaceae Cordia alliodora (Ruiz & Pav) Oken 14 0 0 0 0 14 Burseraceae Bursera simaruba (L. Wendt 0 0 9 5 0 14 Meliaceae Guarea glabra Vahl 0 0 15 0 0 15 Trichilia moschata Sw.) Sarg. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. SJ= San Joaquín.

5. 1995) (Figura 1). Liston et al. seguida por 35 ciclos con una desnaturalización de 95ºC por 30 s. Baldwin et al. Análisis de laboratorio El procedimiento de extracción de ADN genómico se realizó con el método para plantas CTAB (Doyle 1990). El programa utilizado constó de una desnaturalización inicial de 95ºC por 3 min. y 2 µl de dilución de ADN (3: 100-500). Las amplificaciones fueron realizadas con el termociclador C1000 TouchTM Thermal Cycler (BIORAD). Los productos de PCR fueron secuenciados en Macrogen Inc 318 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Todas estas características y la necesidad de elegir un marcador universal. El ADN extraído se visualizó mediante electroforesis en geles de agarosa al 1%. 1990). Las condiciones de la PCR se establecieron para un volumen total de 50 µl: 24 µ de PCR master mix (PROMEGA). la extensión final se dio a 72ºC por 10 min (White et al. (para el ITS 1-2) y 52ºC (para el ITS 3-4) por 30 s y una extensión de 72ºC por 2 min. 2 µl de cada primer. 1990). Bulcker y Holtsford 1996. 1995. PROMEGA) de 100 pares de bases (pb). Estos marcadores han sido utilizados para estudios filogenéticos y para esclarecer relaciones entre taxa a distintos niveles taxonómicos debido a que son marcadores universales para eu- cariontes. María Zenaida López-­López. Internal Transcibed Spacer): ITS 1 (TCCGTAGGTGA- ACCTGCGG) -2 (GCTGCGTTCTTCATCGATGC). El producto de las reacciones fue visualizado en electroforesis en geles de agarosa al 2% con un marcador control (Ladder. 1996). la visualización de una banda definida sirvió para de- terminar su viabilidad para la amplificación por PCR (por sus siglas en inglés (Po- limerasa Chain Reaction). e ITS 3 (GCATCGATGA- AGAACGCAGC) -4 (TCCTCCGCTTATTGATATGC) (White et al.8S y 28S del ADN ribosómico el cual se encuentra en los cromosomas del nu- cleólo (Hillis y Dixon 1991. Bárbara Cruz-Salazar. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya Marcadores moleculares Los ITS son espaciadores internos transcritos que separan las subunidades 18S. Maricela García-Bautista. una temperatura de alineamiento de 57ºC. Posteriornente. 20 µl de agua libre de nucleasas (PROMEGA). hicieron a los ITS marcadores idóneos para el análisis de la diversidad genética intra e interespecífica de árboles en la REBISO. altamente reproducibles y con altas tasas de sustitución (Baldwin et al. debido al número de especies evalua- das. se amplificaron dos regiones de ADN ribosomal nuclear (ITS.

Castillo-Cobián 2007. se editaron con el programa Chromas Pro v. que considera el número total de posisiones segregantes en un grupo de secuencias (Arboleda 2008. (4) variación nucleotídica por sitio (θ). Análisis de datos Diversidad genética. mediante el protocolo de secuenciación desarrollado por Applied Biosystems con el kit de secuenciación ABI PRISM ® Big DyeTM Terminator Cycle Sequencing y el secuenciador ABI 3730xl Analyzer. Cuando el valor de π es superior que θ se obtiene un valor positivo el cual sugiere selección positiva que ha beneficiado a 319 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 2014). que es la probabilidad de que dos muestras tomadas al azar difieran en una posición particular del genoma y es calculada a partir de la expresión θ = 4Neμ (Ne = tamaño efectivo poblacional. 1992). con el modelo de sustitución Kimura 2-parámetros. 5 (Librado y Rozas 2009).1 (Thompson et al. Todos los análisis fueron realizados en el laboratorio de gené- tica de ECOSUR-Unidad San Cristóbal mediante la agrupación de las secuencias por especie con el propósito de evitar los gaps (regiones sin información en las secuencias) que se obtuvieron debido a la alta variación de composición de nucleó- tidos entre especies (Graudal et al. Nei y Gojobori 1986). Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. que es el número de nucleótidos diferentes por sitio entre dos secuencias tomadas al azar. 1. (3) diversidad de haplotipos (h). Adicionalmente se realizó una prueba de bondad de ajuste para evaluar la distribución de la diversidad genética con relación a las cinco localidades (Sokal y Rohlf 2003). Kimura 1980. (2) diversidad nucleotídica (π). 2. Para reconocer algunos de los procesos evolutivos determinantes de la diversidad genética observada. Corea. que son los sitios en donde las secuencias difieren.5 (McCarthy 1996) y se alinearon con el programa Clustal X v. que indica el polimorfismo dado por cambios nucleotídicos en la región analizada. Las secuencias enviadas por Macrogen Inc en formato ab1. Chiapas. Estos paráme- tros fueron: (1) número de posiciones segregantes o sitios polimórficos (s). Se obtuvieron los parámetros de diversidad mediante el software DnaSP v. México en Seúl. μ = tasa de mutación). se obtuvieron los valores de Tajima (1989) (D) a partir de la relación entre la diversidad nucleotídica (π) y la variación nucleotídica por sitio (θ). y (5) promedio de diferencias nucleotídicas (K). D = (π – θ) / V (π – θ) .

4 (Swofford 2002). (2017). para obtener las relaciones filogenéticas entre especies se construyó el árbol de consenso estricto con regla de mayoría para el soporte de las ramas (> 50%). o bien reducción poblacional posiblemente causada por un cuello de botella (Wat- terson 1975. Las secuencias elegidas como no idénticas e informativas se analizaron con el método de Máxima Parsimonia con 1000 repeticiones al azar y algoritmo TBR (Tree Bisection Reconection). también puede indicar selección purificadora que beneficia atributos promedios y elimina mutaciones.21 (Cle- ment et al. Diversidad genética y ecología de comunidades Para evaluar la relación entre la diversidad genética y la diversidad de especies se correlacionó el promedio de los índices de diversidad obtenidos del trabajo de Ramírez-Marcial et al. Se establecieron las relaciones genéticas entre especies me- diante un análisis de similitud entre secuencias con el software TCS v. Bárbara Cruz-Salazar. 2000). Los parámetros de diversidad genética que se consideraron fueron: sitos segregativos (s). Posteriormente. inverso de índice de Simpson (InvIS). diversidad alfa de Fisher (alfaF). Además se realizó el árbol de distancias genéticas con 1000 réplicas con el método Kimura 2-parámetros (Kimura 1980). En tanto que. mediante el programa PAUP v. Perfectii et al. 2009. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya algunos alelos y por lo tanto incrementa su frecuencia. diversidad nucleotídica (π) y diversidad de haplotipos (h). Martinez-Castilla 2007). contrariamente si θ > π la relación es negativa e indica mutaciones deletéreas y crecimiento poblacional o selección de barrido (Kaplan et al. Para este análisis se obtuvo el promedio aritmético para cada estimador de diversidad genética por localidad. Maricela García-Bautista. índice de Simpson (IS). Relaciones genéticas. 1. el cual expresa la distancias evolutivas a partir del número de sustituciones por sitio de cada grupo de secuencias homólogas (Demarchi 2009. María Zenaida López-­López. los índices de diversidad de especies fueron: riqueza de especies observada (Sobs). así como los de diversidad que se presentan en Ramírez-Marcial et al. Tajima 1989). 1989). de los 500 árboles más parsimoniosos (Vázquez- Domínguez 2007). índi- ce de Shannon (H). (2017) y el promedio de los parámetros genéticos de las 17 especies de árboles analizados genéticamente. riqueza de especies con el modelo de Chao basado 320 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .

el valor más bajo se presentó en Pseudolmedia spuria y el mayor en Heliocarpus appendiculatus (Tabla 3). para cada ITS se describen los resultados para la especies y al final en función de la localidad. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. La relación entre los estimadores se valoró con base en un análisis de correlación por pares de Pearson. Todas las especies presentaron 290 pb en sus secuencias.41) y Brosimum 321 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Chiapas. México en las abundancias (Chao) y riqueza de especies estimada a partir de las abundan- cias (ACE). Los análisis de correlación y los CCA se hicieron con el programa R v. 3.01) y Maytenus purpusii (π = 0. Seis secuencias fueron excluidas del análisis de Máxima Parsimonia y distancias genéticas a causa de su relativa baja composi- ción en pares de bases (< 200): un individuo de Bursera simaruba.5 (CCA-package) (González y Déjean 2009. R Core Team 2013). La diversidad de nucleótidos fue extremadamente baja en Cordia alliodora (π = 0. mientras que la ma- yor diversidad de nucleótidos se observó en Guarea glabra (π = 0. de cada ITS (170 para el ITS 1-2 y 145 para el ITS 3-4). y dos individuos de Heliocarpus appendiculatus. Cordia alliodora y Guarea glabra. Diversidad genética Los resultados se presentan por marcador ITS con el propósito de reportar la va- riación genética encontrada en cada región de ADN. Región ITS 1-2. localidades y niveles de altitud. Las posi- ciones segregantes se encontraron en un amplio intervalo de variación (s = 4-186). Distribución de la diversidad genética entre especies y localidades Para explorar la distribución de los haplotipos entre especies.2. Asimismo. Resultados Se procesaron un total de 202 árboles. se realizaron Análisis de Correspondencia Canónica (CCA).04). Mortonioden- dron ocotense.

3 1.72 -2.87 -0.47 0.13 35.32 76.01* Cordia alliodora 3-4 122 0.23 22 0.23 11 0.19 13 1 -1.23 8 1 -1.95 -1.67 NS 1-2 147 0.66 NS 1-2 74 0.02 5 0.3 15 1 -1.07 22.29 50.23 51.24 0.68 0.16 5 0.13 41.23 10 0. Diversidad genética de especies de árboles de la Reserva de la Biosfera Selva el Ocote con base en la región nuclear de ADN ribosomal ITS 1-2 e ITS 3-4 Especie ITS s π K θ Nh h D 1-2 138 0.14 5 1 -1.90* Allophylus psilospermus 3-4 76 0.21 0.89NS 1-2 130 0.16 4 0.6 1.21 NS 1-2 87 0.34 0.1 0.1 0.94 0.57 0.05* Trichilia moschata 3-4 165 0. Bárbara Cruz-Salazar.27 51.32 0.23NS 1-2 163 0.23 14 0.96 -1.27NS Guarea glabra 3-4 170 0.19 8 0.48 0.4 0.53*** Mortoniodendron 1-2 146 0.2 36.01 2.7 0.41 NS 1-2 88 0.13 0.9 1.4 0.49 0.2 47.92 -1.4 68.54NS ocotense 3-4 143 0.15NS 1-2 4 0.91 0.19 8 0.98 -1.02 4 0.12 40.97 0.12 4 0.64 -1.97 NS 1-2 144 0.16 2 0.56 NS 1-2 151 0.55 NS 1-2 155 0.99 -0.61 -2.21 7 0.17NS Protium copal 3-4 98 0.39 113.29 -2.18 5 1 -1.22 9 0.52 NS Heliocarpus 1-2 186 0.3 8 1 -0.51 -2.27 67.04NS Psychotria chiapensis 3-4 192 0.31 60.21 61.11 8 0.94 0.12 11 0.26 14 1 -1.56 0.99 -1. María Zenaida López-­López.43NS 322 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote .73 -1.24 44.21 49. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya Tabla 3. Maricela García-Bautista.9 -1.07 0.34NS Acacia centralis 3-4 120 0.76 -1.32*** 1-2 18 0.75 0.98 -1.67* Pseudolmedia spuria 3-4 222 0.06NS Maytenus purpusii 3-4 12 0.2 10 0.75 0.8 -1.21 9 0.2 47.23 14 0.01 5.2 61 0.41 65.45*** Manikara zapota 3-4 167 0.9 -1.2 49.12 NS 1-2 18 0.89 -0.88 0.3 7 0.03 5 1 -0.17 39 0.92 0.53NS Garcia nutans 3-4 167 0.15 8 0.91 0.90NS Brosimum alicastrum 3-4 103 0.04 10 0.14 44 0.35NS appendiculatus 3-4 145 0.05 10.39 4 0.77 -1.08 28.2 44.49NS Bursera simaruba 3-4 173 0.

spuria (D = -1.22 63.00) (Tabla 3).91). K = media de diferencias nucleotídicas. π = diversidad de nucleótidos. México Tabla 3.91) (Tabla 4).21 6 0.05) (Tabla 3). π = 0. La diversidad de haplotipos fue de media (h = 0.7 -0. K = 31.64NS Zanthoxylum caribaeum 1-2 53 0. la prueba de Tajima fue negativa en casi todas las especies con excepción de A. promedio de diferencias nucleotídicas (K = 25.01). Emilio Rabasa y El Enca- jonado presentaron los valores menores que se describen en seguida y ordenados por localidad: posiciones segregantes (s = 76.51 en C.43. spuria) y 15 (G. En cuanto a la diversidad genética por localidad.08 5 1 -1.23) y número de haplotipos (h = 6.05. caribaeum (D = 0.01.16NS Zanthoxylum acuminatum 3-4 16 0.07 19. *** = P< 0.21) y C. P.90). alicastrum (π = 0. θ = variabili- dad nucleotídica por sitio. alliodora (K = 2.02 3 0. psilos- permus (D = 1. El número de haplotipos encontrados osciló entre cuatro (P.96 0.34. alliodora) a alta en Maytenus purpusii.5 haplotipos. glabra). alliodora (D = -2. no obstante únicamente para cinco especies se detectó diferencias significativas entre los valores de π y θ: Allophylus psilospermus (D = 1.5). Chiapas.90) y Z.56) y Guarea glabra (K = 65.001.81 -1. 11. La diversidad de haplotipos fue menor en Nuevo San Juan Chamula (h = 0.97) (Tabla 3).08 23. K = 59.29. Mortoniodendron ocotense.40).02 7 0. s = 89). diversidad de nucleótidos (π = 0. ** = P< 0.67) y Trichilia moschata (D = -2. Diversidad genética de especies de árboles de la Reserva de la Biosfera Selva el Ocote con base en la región nuclear de ADN ribosomal ITS 1-2 e ITS 3-4 (continuación) Especie ITS s π K θ Nh h D 1-2 46 0. mientras que la mayor diversidad genética ob- tenida con todos los parámetros analizados se observó en Veinte Casas (s  = 145. en tanto que los valores mayores se encontraron en Brosimum alicastrum (K = 68.5 0.09. La prueba de bondad de ajuste para determinar si la diversidad genética está distribuida uniformemente 323 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . Garcia nutans.50. D = prueba de Tajima. spuria (K = 1. Protium copal y Zanthoxylum acuminatum (h = 1.82).82NS   3-4 181 0. C.03 0. NS = no significativo.73). h = diversidad de haplotipos.27NS s = sitios segregativos.33 0. glabra. G.45). Manilkara zapota (D = -2. * = P< 0. El promedio de las diferencias nucleotídicas fue menor en P. 8.28. π =13). Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. Nh = número de haplotipos. h = 0.15.06 10 0. Por último.

90 ER 3-4 122.91 VC 3-4 152 0.28 11.08 8.26 59. María Zenaida López-­López.87 1-2 145.92.87 1-2 125. Esta región se constituyó de 330 bp para todas las muestras en el análisis.50. K = media de diferencias nucleotídicas. en M. El número de haplotipos se encontró en un intervalo de cuatro a 22.84 EE 3-4 149 0.89 1-2 141 0.15 25. En Zanthoxylum acuminatum se registraron valores de π = 0.20 43. Maricela García-Bautista.16 47. en las localidades fue significativa para las posiciones segregantes (χ2 = 33.26 66. Bárbara Cruz-Salazar.23 8.99). K = 113. π = diversidad de nucleótidos.29) y mayor en B.00. con base en la región nuclear de ADN ribosomal ITS 1-2 e ITS 3-4 Localidad ITS s π K Nh h 1-2 89 0. NS = Nuevo San Juan Chamula. Diversidad genética promedio de 17 especies arbóreas para cinco localidades de la Reserva de la Biosfera Selva el Ocote. La diversidad de nucleótidos (π) y el promedio de diferencias nucleotídicas (K) en Ma- ytenus purpusii fue de 0.28 0. Por último la prueba de Tajima fue negativa para 16 de las 17 especies analizadas.02 y K = 7.5 0. spuria (h = 1.14 0. moschata.29 0. Las posiciones segregantes (s) oscilaron entre 12 y 222. Región ITS 3-4. s = sitios segregativos.34 59.49 6.20 0. VC = Veinte Casas. respecti- vamente. Nh = número de haplotipos.43 0.75 0.4 0. copal y P. zapota y T. P = 0.40 0.33 0. respectivamente.13 31.14 44.25 37.81 11. SJ = San Joaquín.44 × 10-07) y no significativa para la diversidad nucleotídica (χ2  = 0. h = diversidad de haplotipos. simaruba. únicamente A.1. spuria tuvo los valores más altos para ambos parámetros: π = 0.09 6.13.67 11.39.01 y 5. 324 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . la menor variación se observó en Maytenus purpusii y la mayor en Pseudolmedia spuria (Tabla 3).80 SJ 3-4 173.19 48. P. Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya Tabla 4. En cuanto a la diversidad de haplotipos se detectó el nivel menor en M.73 NS 3-4 128.83 EE = El Encajonado.67 0. zapota (h = 0.5 10 0.00). P = 9.88 1-2 76.28 9 0. mientras que P.50 0. ER = Emilio Rabasa.50 0.80 0.85 10.

en orden).33) y en El Encajonado se presentó la mayor diversidad de haplotipos (h = 0. uno con dos individuos (03 VC. zapota (D = -2. Asimismo. P = 0. El resultado de la prueba de bondad de ajuste a la distribución uniforme de la diversidad genética fue significativo para las posiciones segregantes (χ2 = 11. respectivamente) y de diversidad de nucleótidos (π = 0. no obstante.26.83). 23 VC. moschata (18 NS). por lo tanto los análisis de parsimonia y distancias genéticas se realizaron con 170 secuencias para el ITS 1-2 y 145 para el ITS 3-4.14. G.022). Relaciones genéticas El análisis de similitud de secuencias mostró 32 de ellas altamente similares para el ITS 1-2 y 57 secuencias para el ITS 3-4. caribaeum (12 EE). México psilospermus presentó una relación positiva (D = 1.41. En el análisis por localidad se observó que todos los parámetros fueron bajos en Emilio Rabasa (s = 122. no así para la diversidad nucleotídica (χ2 = 0. 43 ER. Diversidad y relaciones genéticas de especies arbóreas en la Reserva de la Biosfera Selva El Ocote. Región ITS 1-2. San Joaquín y Veinte Casas mostraron el mayor número de sitios polimórficos (s = 173.49. 12 VC) y otro con cinco (24 VC. P. alicastrum se agrupó en dos clados se- parados. A. sin embargo algunos individuos no se agruparon en el clado correspondiente. centralis se separó del resto de las especies (Figura 3).4. π = 0. psilospermus (07 NS.25.062. simaruba se estructuró en dos clados separados y el resto de 325 Vulnerabilidad social y biológica ante el cambio climático en la Reserva de la Biosfera Selva El Ocote . 15 VC. 01 VC. mostró una topología con agrupamiento por especie casi en su totalidad. h = 0. Chiapas. glabra (01 VC). P = 0.67).99). 16 VC.14. spuria (07 ER). B. 6. Asimismo. 34 NS). por ejemplo los de A. 51 ER) y Z. K = 44. Acacia centralis presentó un individuo (con clave 11 EE) fuera del clado de este especie. M. en su mayoría.53) (Tabla 3). por los ­individuos de cada especie. T. ­de ellos se obtuvo el árbol de consenso estricto en el que se observó un buen soporte de ramas (82%-100%) y una constitución de grupos. Nuevo San Juan Chamula (11.89) (Tabla 4). La agrupación con base a las distancias genéticas.32) y M. 152. B. 0.28 haplotipos. 34 VC) G. El análisis de parsimonia para esta región construyó 500 árboles.56). en tanto que el promedio de diferencias nucleotídicas fue mayor en San Joaquín (K = 66. nutans (01 ER. 18 VC). ocotense (49 SJ. se detectó sig- nificancia solo en Maytenus purpusii (D = -1.

Trinidad Alejandro Guillén-Díaz y Lorena Ruíz-Montoya Figura 3. ER = Emilio Rabasa. SJ = San Joaquín. Zac = Zanthoxylum acumina- tum. Msp = Maytenus purpusii. Aps = Allophylus psilospermus. Mza = Manilkara zapota. Ggl = Guarea glabra. Hap = Heliocar- pus appendiculatus. Árbol de consenso de Máxima Parsimonia de 17 especies de árboles de la Reserva de la Biosfera Selva El Ocote obtenido con el ITS 1-2 Ace = Acacia centralis. Cal = Cordia alliodora. Maricela García-Bautista. Gnu = Garcia nutans. VC = Veinte Casas. NS = Nuevo San Juan. Bal = Brosimum alicastrum. Moc = Mortoniodendron ocotense. Psp = Pseudolmedia spuria. EE = El Encajonado. Pco = Protium copal. Tmo = Trichilia moscha