You are on page 1of 119

Mafalda Jorge dos Santos

Licenciada em Biologia Celular e Molecular

KOMBUCHA: CARACTERIZAO DA MICROBIOTA E


DESENVOLVIMENTO DE NOVOS PRODUTOS ALIMENTARES PARA
USO EM RESTAURAO

Dissertao para obteno do Grau de Mestre


em Cincias Gastronmicas

Orientador: Prof. Doutora Catarina Prista,


Professora Auxiliar, ISA/UL

Jri:

Presidente: Prof. Doutora Paulina Mata, Professora Auxiliar, FCT/UNL


Arguente: Prof. Doutor Manuel Malfeito Ferreira, Professor Auxiliar, ISA/UL
Vogal: Prof. Doutora Catarina Prista, Professora Auxiliar, ISA/UL

Maro 2016
Mafalda Jorge dos Santos
Licenciada em Biologia Celular e Molecular

KOMBUCHA: CARACTERIZAO DA MICROBIOTA E


DESENVOLVIMENTO DE NOVOS PRODUTOS ALIMENTARES PARA
USO EM RESTAURAO

Dissertao para obteno do Grau de Mestre


em Cincias Gastronmicas

Orientador: Prof. Doutora Catarina Prista,


Professora Auxiliar, ISA/UL

Maro 2016
KOMBUCHA: CARACTERIZAO DA MICROBIOTA E DESENVOLVIMENTO DE NOVOS PRODUTOS
ALIMENTARES PARA USO EM RESTAURAO

Copyright Mafalda Jorge dos Santos, FCT/UNL e UNL

A Faculdade de Cincias e Tecnologia e a Universidade Nova de Lisboa tm o direito,


perptuo e sem limites geogrficos, de arquivar e publicar esta dissertao atravs de
exemplares impressos reproduzidos em papel ou de forma digital, ou por qualquer outro
meio conhecido ou que venha a ser inventado, e de a divulgar atravs de repositrios
cientficos e de admitir a sua cpia e distribuio com objetivos educacionais ou de
investigao, no comerciais, desde que seja dado crdito ao autor e editor.
RESUMO
A kombucha uma bebida fermentada refrescante e agridoce preparada geralmente com
ch preto aucarado ao qual adicionada a chamada me da kombucha, uma pelcula de
celulose bacteriana contendo um consrcio simbitico de bactrias acticas e leveduras. A
crescente popularidade da kombucha deve-se essencialmente aos seus alegados efeitos
benficos na sade humana que, apesar de no terem sido ainda comprovados
cientificamente, vrios estudos demonstraram o potencial desta bebida em clulas e
organismos-modelo.

Neste trabalho pretendeu-se estudar a microbiota de culturas de kombucha atravs do


isolamento, seleo e identificao dos microrganismos presentes no lquido fermentado.
Foram identificadas as espcies de leveduras Candida californica, Zygosaccharomyces
rouxii, Metschnikowia pulcherrima e uma bactria Acetobacter sp.. A partir dos
microrganismos isolados e de coleo (Gluconobacter oxydans CBISA 4270,
Gluconacetobacter hansenii CBISA 4276 e CBISA 4277, e Acetobacter aceti CBISA 4417)
tentou-se produzir uma kombucha semelhante obtida atravs das culturas iniciais.

Realizou-se tambm uma prova de anlise sensorial com a kombucha produzida com uma
das culturas do Laboratrio de Bioenergtica Microbiana (LBM) do ISA-UL versus uma
kombucha existente no mercado, com um grupo de 34 provadores no treinados
consistido por 16 homens e 18 mulheres com idades compreendidas entre os 18 e 76
anos. Os resultados demonstraram uma forte preferncia pela kombucha do LBM, que foi
considerada mais doce e mais equilibrada, contudo menos rica em termos aromticos
relativamente kombucha do mercado, que foi considerada mais cida.

Com o objetivo de explorar outras aplicaes para esta bebida que se est a tornar cada
vez mais popular, foram tambm produzidos outros produtos derivados de kombucha,
nomeadamente uma nata de kombucha (uma alterao de um produto filipino muito
popular) e gis de kombucha.

Palavras-chave: Kombucha, Microbiota, Anlise Sensorial, Nata de Kombucha,


Hidrocolides, Gastronomia Molecular

i
ABSTRACT
Kombucha is a refreshing, sweet and acidic fermented beverage usually prepared with
sugared black tea to which a tea fungus is added. This tea fungus is composed of a
bacterial cellulosic pellicle containing a symbiotic consortia of acetic bacteria and yeasts.
The growing popularity of this fermented beverage is owed to its reported beneficial
effects on human health, although these claims havent been proved scientifically.
Nevertheless, a good number of studies have already demonstrated the potential of this
product on cells and model organisms.

In the present study, the microbiota of kombucha cultures was evaluated through the
isolation, selection and identification of microorganisms present in the fermented liquid.
The yeast species Candida californica, Zygosaccharomyces rouxii and Metschnikowia
pulcherrima were identified as well as one bacteria belonging to the Acetobacter genus.
The isolated microorganisms were used along with Gluconobacter oxydans CBISA 4270,
Gluconacetobacter hansenii CBISA 4276 and CBISA 4277, and Acetobacter aceti CBISA
4417 (ordered from a culture collection) in an attempt to produce a kombucha similar to
the one produced with the original cultures.

A sensory evaluation test was performed to assess the acceptability of a kombucha


produced with a culture from the Laboratory of Microbial Bioenergetics (LMB) from ISA-
UL versus a store-bought kombucha, among a group of 34 untrained testers, comprised of
16 men and 18 women aged between 18 and 76 years. The results showed a strong
preference for the LMB kombucha, which was considered sweeter and more balanced,
although less rich in aroma compared with the store-bought kombucha, which was
considered more acidic.

Alternative applications for this popular beverage were explored and new food products
based on kombucha were produced, namely nata de kombucha (a modification of a
popular Philippine product) and kombucha gels.

Keywords: Kombucha, Microbiota, Sensory Analysis, Nata de Kombucha, Hydrocolloids,


Molecular Gastronomy

iii
NDICE
RESUMO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . i

ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iii

NDICE DE FIGURAS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

NDICE DE TABELAS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi

1 INTRODUO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1

2 REVISO BIBLIOGRFICA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
2.1 O Ch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
2.1.1 Histria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
2.1.2 Composio Qumica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4
2.1.3 Propriedades e Consumo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
2.1.4 Preparao . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
2.2 A Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
2.2.1 Histria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
2.2.2 Preparao . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
2.2.3 Microrganismos Presentes na Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
2.2.3.1 Leveduras . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
2.2.3.2 Bactrias . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2.2.4 Processos Metablicos Envolvidos na Produo de Kombucha . . . . 13
2.2.5 Composio Qumica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2.2.6 Propriedades . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
2.2.6.1 Propriedades Antimicrobianas . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15
2.2.6.2 Propriedades Antioxidantes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.2.6.3 Propriedades Anticancergenas . . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.2.6.4 Outras Propriedades . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.2.7 Aplicaes Alternativas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.2.8 Consumo A Kombucha como um Novo Produto . . . . . . . . . . . . . . . . . . . . 21
2.3 Mtodos de Identificao de Microrganismos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

v
NDICE

2.4 Gastronomia Molecular como Metodologia para Inovao . . . . . . . . . . . . . . . . . . . . 27


2.4.1 Desenvolvimento de Novos Produtos Alimentares . . . . . . . . . . . . . . . . . . 28
2.4.2 Hidrocolides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.4.2.1 Agar (E406) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
2.4.2.2 Carrageninas (E407 e E407a) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
2.4.2.3 Goma de Alfarroba (E410) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34
2.5 Tcnicas de Anlise Sensorial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36

3 MATERIAIS E MTODOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.1 Obteno das Culturas de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.2 Preparao da Base de Ch . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.3 Seleo e Preparao do Inculo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
3.4 Preparao de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
3.5 Meios de Cultura . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
3.6 Isolamento de Microrganismos de Kombucha de Ch Preto . . . . . . . . . . . . . . . . . . . 39
3.7 Produo de Kombucha a partir de Isolados . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39
3.8 Tcnicas Moleculares de Identificao de Microrganismos . . . . . . . . . . . . . . . . . . . . 40
3.8.1 Extrao de DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
3.8.1.1 Leveduras . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
3.8.1.2 Bactrias Acticas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
3.8.2 Amplificao de DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
3.8.2.1 Leveduras . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
3.8.2.2 Bactrias Acticas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
3.8.3 Quantificao do Produto de PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
3.8.4 Sequenciao de DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
3.9 Anlise Sensorial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
3.10 Desenvolvimento de Novos Produtos Alimentares base de Kombucha . . . . 44
3.10.1 Nata de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
3.10.2 Filtrao de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
3.10.3 Gis de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

4 RESULTADOS E DISCUSSO . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
4.1 Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
4.1.1 Seleo e Misturas de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47
4.1.2 Isolamento de Microrganismos de Kombucha de Ch Preto . . . . . . . . 48
4.1.3 Kombucha Produzida a partir de Isolados . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

vi
NDICE

4.1.4 Identificao dos Microrganismos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49


4.1.4.1 Leveduras . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
4.1.4.2 Bactrias Acticas . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54
4.1.5 Anlise Sensorial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
4.2 Novos Produtos Alimentares Obtidos a partir de Kombucha . . . . . . . . . . . . . . . . . . 60
4.2.1 Nata de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60
4.2.2 Gis de Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
4.2.2.1 Gis com Agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62
4.2.2.2 Gis com Elastic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

5 CONSIDERAES FINAIS E PERSPETIVAS FUTURAS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

REFERNCIAS BIBLIOGRFICAS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67

ANEXOS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
Anexo I Propriedades e Modo de Utilizao dos Hidrocolides Apresentados 82
Anexo II Ficha de Prova da Anlise Sensorial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
Anexo III Observaes Macro e Microscpicas dos Microrganismos Isolados 88
Anexo IV Resultados das Sequenciaes de DNA Genmico dos Microrganismos
Isolados . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
Anexo V Resultados da Prova de Anlise Sensorial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Anexo VI Poster das Apresentaes do Mestrado de Cincias Gastronmicas,
Junho 2015 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100

vii
NDICE DE FIGURAS
Figura 2.1 Produo de nata de coco . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20

Figura 2.2 Casacos produzidos com me de kombucha, por Suzanne Lee . . . . . . . . . . . . . 21

Figura 2.3 Tendncias de pesquisa globais pelo termo kombucha, de 2004 ao presente
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22

Figura 2.4 Health-Ade Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22

Figura 2.5 GTs Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Figura 2.6 Live Kombucha Soda . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Figura 2.7 Reeds Culture Club Kombucha . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23

Figura 2.8 Wild Kombucha by Ballsy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Figura 2.9 Kombucha da Xat . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Figura 2.10 Esquema da regio dos genes de rDNA de fungos . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

Figura 2.11 Amplificao de DNA por PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26

Figura 2.12 Sequenciao de DNA automatizada . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27

Figura 2.13 Estrutura da molcula de agarose . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31

Figura 2.14 Estruturas das carrageninas principais . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33

Figura 2.15 Estrutura geral de um segmento de galactomanana . . . . . . . . . . . . . . . . . . . . . . . . . 35

Figura 4.1 Perfil eletrofortico da amplificao de DNA das leveduras isoladas . . . . . . . . 50

Figura 4.2 Alinhamento entre as duas sequncias das bandas de 400 pb da amostra da
levedura 2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

Figura 4.3 Alinhamento entre sequncias dos genes de 18S rDNA de M. pulcherrima e M.
bicuspidata var. bicuspidata . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53

ix
NDICE DE FIGURAS

Figura 4.4 Perfil eletrofortico da amplificao de DNA da bactria 1 . . . . . . . . . . . . . . . . . . . 55

Figura 4.5 Avaliao hednica das caractersticas organolticas das kombuchas . . . . . . 56

Figura 4.6 Intensidades dos diferentes atributos referentes ao aroma . . . . . . . . . . . . . . . . . . 57

Figura 4.7 Intensidades dos diferentes atributos referentes ao sabor . . . . . . . . . . . . . . . . . . . 58

Figura 4.8 Resultado da prova pareada de preferncia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

Figura 4.9 Inteno de compra das kombuchas apresentadas . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60

Figura 4.10 Pelcula de kombucha cortada aos cubos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61

Figura 4.11 Alguns exemplos de aplicaes de nata de coco . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61

Figura 4.12 Aspeto dos gis de agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62

Figura 4.13 Gomas de kombucha com agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

Figura 4.14 Aspeto dos gis de Elastic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

Figura 4.15 Vus de kombucha com Elastic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

x
NDICE DE TABELAS
Tabela 2.1 Composio em %(p/p) de peso seco de folhas de ch frescas, de folhas de ch
preto e de uma infuso de ch preto (tempo de infuso, 3 min) . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

Tabela 2.2 Comparao entre os principais componentes de kombucha preparada com


ch preto, com diferentes condies de fermentao . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14

Tabela 2.3 Tipos de novos produtos alimentares . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28

Tabela 3.1 Sequncias dos primers ITS4 e ITS5 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Tabela 3.2 Mistura reacional para PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Tabela 3.3 Programa de PCR utilizado para as leveduras (primers ITS4 e ITS5) . . . . . . . 42

Tabela 3.4 Sequncias dos primers Ac1 e Ac3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42

Tabela 3.5 Programa de PCR utilizado para as bactrias acticas (primers Ac1 e Ac3) 43

Tabela 3.6 Composio dos gis de agar preparados . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

Tabela 4.1 Observaes relativas s kombuchas selecionadas . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47

Tabela 4.2 Resultados possveis da identificao das leveduras isoladas . . . . . . . . . . . . . . . 51

xi
1

CAPTULO
INTRODUO

Nos ltimos anos tem-se observado uma crescente preocupao da sociedade em relao
alimentao. No s relativamente aos aspetos nutricionais dos alimentos, como tambm
da sua provenincia (ex.: se provm de agricultura biolgica ou no) e dos seus efeitos na
sade. Comea-se a observar uma crescente procura por alimentos ditos saudveis e
funcionais, e assim tambm surgem novas oportunidades de negcios que se baseiam na
venda de bebidas funcionais (referidas como desintoxicantes ou promotoras do sistema
imunolgico, entre outras propriedades) e produtos alimentares com baixo valor calrico.

A kombucha uma bebida ancestral, refrescante e agridoce, que consiste em ch


fermentado. Desde o seu descobrimento que conhecida pelas suas propriedades
curativas, mas s nesta ltima dcada que se observou uma exploso na sua
popularidade, especialmente nos Estados Unidos, onde atualmente existe um mercado
bem estabelecido deste produto. Para alm da enorme panplia de marcas de kombucha
presentes nas lojas, esta bebida est tambm presente em estabelecimentos de
restaurao como um dos vrios itens na carta de bebidas, existindo at a possibilidade de
pedir kombucha presso em alguns desses estabelecimentos.

Em Portugal esta bebida est lentamente a ganhar ateno, nomeadamente em grupos nas
redes sociais, onde indivduos que produzem kombucha em casa, partilham as suas
culturas com outros membros do grupo. No mercado, este produto ainda no est muito
presente, existindo apenas em lojas especializadas.

Apesar de toda a ateno que a kombucha tem recebido devido s suas propriedades
benficas para a sade humana, no h provas cientficas conclusivas em relao a este
aspeto. Contudo foram j feitos vrios estudos em organismos-modelo e clulas, e esta
bebida apresenta de facto grande potencial.

1
CAPTULO 1 INTRODUO

Como a kombucha ainda um produto pouco conhecido em Portugal, importante a


divulgao de informao fundamentada para o pblico. No mbito desta dissertao,
foram realizadas duas exposies orais para o pblico geral, uma na Noite Europeia dos
Investigadores no contexto da atividade Diversidade na vinha, no vinho, e nos micrbios
dos nossos petiscos, desenvolvido pelo Centro de Botnica Aplicada Agricultura (CBAA)
do ISA, em Setembro de 2014; e outra no mbito das apresentaes finais da disciplina de
Seminrios do Mestrado de Cincias Gastronmicas, em Junho de 2015.

Neste trabalho pretendeu-se:

i. Caracterizar a microbiota da kombucha;

ii. Criao de um inculo a partir dos microrganismos isolados para a produo desta
bebida fermentada;

iii. Avaliar a aceitao do pblico relativamente kombucha produzida e a existente


no mercado, atravs de testes de anlise sensorial;

iv. Explorar aplicaes alternativas para a kombucha, com recurso a alguns


hidrocolides.

2
2

CAPTULO
REVISO BIBLIOGRFICA

2.1 O Ch

Tanto o ch verde, o oolong e o preto provm da mesma espcie de planta, Camelia


sinensis, uma rvore de folha perene da famlia botnica Theaceae, nativa do Sudeste
Asitico [1, 2, 3]. A diferena entre os vrios tipos de ch reside no processamento das
folhas colhidas. Assim que as folhas so cortadas, a enzima polifenoloxidase, presente no
seu interior, ativada levando oxidao dos polifenis. Esta enzima inativada pelo
calor, portanto se as folhas forem submetidas ao calor pouco depois de serem colhidas, h
pouca ou nenhuma oxidao e obtm-se o ch verde. Por outro lado, o ch oolong sofre
alguma oxidao, enquanto o ch preto aquele cujo processo de oxidao enzimtica
deixado ocorrer durante mais tempo [2, 4].

Existem quatro variedades de C. sinensis, mas o ch disponvel comercialmente


produzido essencialmente a partir de duas delas, C. sinensis var. assamica que apresenta
folhas largas (utilizada mais frequentemente para ch preto) e C. sinensis var. sinensis de
folhas pequenas (mais utilizada para ch verde) [1].

2.1.1 Histria

Apesar de a mitologia chinesa apontar para o surgimento do ch como bebida no ano de


2737 a.C. com a lenda de que o ch foi descoberto pelo imperador Shen Nung, as primeiras
referncias escritas ao ch encontram-se num dicionrio chins de cerca de 400 a.C. [2].

O ch um produto ancestral que inicialmente era utilizado como erva medicinal e s mais
tarde que se tornou popular como bebida. Esta transio de remdio para bebida

3
CAPTULO 2 REVISO BIBLIOGRFICA

ocorreu no final da Dinastia Zhou (1124 222 a.C.) e depois, a partir da Dinastia Qin (221
206 a.C.), observou-se um aumento gradual da popularidade do ch. A arte da
preparao do ch foi sendo melhorada empiricamente ao longo do tempo de modo a
transformar as folhas amargas numa bebida agradvel e revigorante. Foi na Dinastia Tang
(618 907 d.C.) que o ch passou a ter um papel muito relevante no dia-a-dia da
sociedade, sendo visto como uma bebida refinada e sofisticada. Tornou-se uma bebida
social, presente em todos os eventos importantes das classes sociais mais elevadas.
Contudo, continuava a ser consumido pelas classes mais baixas tambm. A cultura e a
popularidade do ch continuaram a evoluir depois da Dinastia Tang. Durante a Dinastia
Song (960 1279) apareceram as primeiras casas de ch, e na Dinastia Ming (1368
1644) foi desenvolvido o ch preto, pois descobriu-se que este tipo de processamento das
folhas de ch permitia que este mantivesse a qualidade em viagens longas [5, 6].

Apesar de os portugueses terem sido os primeiros a trazer ch, especiarias e porcelanas


do Oriente para o Ocidente, foram os holandeses que trouxeram a cultura do consumo de
ch para a Europa, no incio do sculo XVII. Trouxeram tambm o hbito que o imperador
chins da altura tinha de adicionar quantidades generosas de leite ao seu ch, da o
costume de se adicionar leite ao ch em vrios pases do Ocidente [6].

O aumento da popularidade do ch no Ocidente (mais especificamente na Inglaterra)


deveu-se s influncias da princesa portuguesa, Catarina de Bragana, que gostava muito
de ch, e quando se casou com Carlos II de Inglaterra, em 1662, trouxe a sua bebida
preferida para a corte e da o ch passou a ser muito popular na sociedade inglesa. Era
bebido com leite, como os holandeses tinham ensinado e adicionava-se tambm acar
[6].

A crescente popularidade do ch levou a que esta bebida fosse incorporada em vrios


rituais sociais em diferentes pases. Atualmente o ch a bebida mais consumida no
mundo a seguir gua [2].

2.1.2 Composio Qumica

O sabor de uma folha de ch fresca pouco mais do que amargo e adstringente. Isto deve-
se ao facto de os seus principais constituintes (presentes em maior proporo do que os
prprios componentes estruturais) serem um conjunto de compostos fenlicos que so
amargos e adstringentes, e cujo propsito natural de tornarem as folhas da rvore do ch
desagradveis para os animais [1, 3].

4
CAPTULO 2 REVISO BIBLIOGRFICA

Aquando do processamento das folhas do ch, ocorrem, de forma geral, dois tipos
principais de transformaes enzimticas. Uma delas a libertao de compostos
aromticos que, na folha do ch intacta, se encontram associados a outras molculas.
Quando as folhas so cortadas ou esmagadas, so libertadas enzimas que quebram estes
complexos, havendo ento a libertao de aromas [2, 3]. Como as enzimas das folhas no
ch verde so inativadas muito cedo, o seu aroma no to rico e complexo como os do
ch oolong e preto. O segundo tipo de transformao enzimtica a oxidao dos
polifenis pela polifenoloxidase. Esta enzima utiliza o oxignio do ar para ligar os
compostos fenlicos de pequenas dimenses presentes nas folhas do ch, em complexos
maiores. As molculas pequenas que ocorrem naturalmente nas folhas no apresentam
cor, mas medida que so oxidadas em molculas mais complexas vo apresentando cores
cada vez mais escuras [3].

A composio qumica exata das folhas de ch depende da sua origem, idade e tipo de
processamento a que foram submetidas [7]. Por outro lado, a composio das infuses
produzidas a partir das folhas de ch vai depender, no s das folhas utilizadas como do
tipo de gua e do modo de preparao do ch (temperatura da gua e tempo de infuso).

A tabela 2.1 apresenta uma comparao entre os compostos presentes em folhas de ch


frescas, de ch preto, e numa infuso de ch preto.

Tabela 2.1 Composio em %(p/p) de peso seco de folhas de ch frescas, de folhas de ch preto e de
uma infuso de ch preto (tempo de infuso, 3 min) (adaptada da referncia 7).
Folhas de ch Folhas de ch Infuso de ch
Constituintes
frescas preto preto

Compostos fenlicos
30 5 4.5
(maioritariamente flavanis)

Compostos fenlicos oxidados


0 25 15
(maioritariamente tearubiginas)

Protenas 15 15 (vestgios)

Aminocidos 4 4 3.5

Cafena 4 4 3.2

Fibra 26 26 0

Outros carboidratos 7 7 4

Lpidos 7 7 (vestgios)

Pigmentos
2 2 (vestgios)
(clorofila e carotenides)

Compostos volteis 0.1 0.1 0.1

5
CAPTULO 2 REVISO BIBLIOGRFICA

Minerais 5 5 4.5

Os compostos que tm maior importncia nas caractersticas organolticas do ch so os


polifenis que conferem um sabor mais ou menos amargo e a sensao de adstringncia.
As catequinas, que so compostos fenlicos simples presentes em abundncia nas folhas
frescas de ch, so amargas e incolores mas no adstringentes. Quando estes compostos
sofrem a ao da polifenoloxidase, do origem a teaflavinas, que apresentam uma cor
amarelada ou acobreada e que so muito amargas e adstringentes. Se sofrerem uma ao
enzimtica mais extensa, formam-se as tearubiginas, mais escuras mas menos amargas e
adstringentes [3].

Para alm de amargo, o ch ligeiramente cido devido presena de cidos orgnicos na


sua composio [2, 3]. As folhas de ch so tambm muito ricas em teanina, um
aminocido que exclusivo do ch. A teanina apresenta um sabor doce e saboroso
(savory). Existem muitos compostos que conferem sabor ao ch, mas so mais
numerosos os compostos que conferem aroma, tendo sido identificados mais de 630
volteis no ch [8].

A presena de cafena no ch tambm relevante para o seu consumo, devido aos seus
efeitos estimulantes no organismo humano.

2.1.3 Propriedades e Consumo

Na China antiga, o ch era tomado pelas suas propriedades estimulantes, desintoxicantes e


medicinais. Acreditavam ser um remdio que auxiliava a eliminao do lcool e toxinas,
melhorava a circulao sangunea e do trato urinrio, aliviava dores nas articulaes e
aumentava a resistncia a doenas [9]. Atualmente o ch ainda consumido como um
remdio, sendo muito recomendado pela medicina alternativa.

Devido a estas crenas de que o ch benfico para a sade, tm sido realizados variados
estudos cientficos com o objetivo de comprovar as propriedades medicinais do ch.
Contudo, apesar de no existirem ainda estudos conclusivos acerca dos efeitos no
organismo humano, a compreenso da atividade biolgica dos componentes do ch
importante para perceber o potencial medicinal desta bebida. As catequinas e os flavonis
(outro grupo de compostos fenlicos) presentes no ch apresentam boa atividade
antioxidante, sendo que as catequinas so os antioxidantes mais potentes de todos os
compostos fenlicos de origem vegetal [9]. Estes polifenis apresentam potencial na

6
CAPTULO 2 REVISO BIBLIOGRFICA

preveno de doenas cardiovasculares [10], cancro [11, 12], diabetes e insuficincia


renal [9]. O ch tambm apresenta atividade antimicrobiana, sendo os polifenis os
principais responsveis por esta propriedade [5, 13]. A teanina, o aminocido do ch,
demonstrou capacidade de reduzir a presso arterial, reduzindo a hipertenso em ratos.
Este aminocido tem um efeito relaxante que suprime o efeito estimulante da cafena
tambm presente no ch [9]. Contudo, ambos os compostos atuam em sinergia
promovendo a concentrao mental [1]. As propriedades desintoxicantes do ch em
relao metabolizao do lcool foram tambm comprovadas em ratos [9].

interessante verificar que os antigos conseguiam j perceber as potencialidades do ch


como remdio. Apesar de os estudos atuais no comprovarem totalmente os efeitos desta
bebida no organismo humano, ela apresenta grande potencial, um produto rico em
termos nutricionais e deve ser consumido como parte de uma dieta saudvel.

O ch consumido por centenas de milhes de pessoas por todo o mundo. O seu consumo
est associado no s aos seus potenciais benefcios medicinais, como tambm ao seu
efeito estimulante, cultura de determinados pases ou simplesmente por recreao.
Tradicionalmente, no Oriente prefere-se ch verde ou oolong, no Norte de frica tambm
se consome ch verde. Na maioria dos restantes pases h uma maior preferncia por ch
preto. Em pases de influncia inglesa (maioritariamente), ao ch preto costuma-se
acrescentar leite e muitas vezes acar tambm. Em muitos outros pases bebe-se o ch
preto adoado e acrescenta-se ainda limo. O ch gelado foi introduzido pela primeira vez
em 1904 nos Estados Unidos durante um dia muito quente e atualmente uma maneira de
beber ch muito popular em todo o mundo [4].

2.1.4 Preparao

Para se preparar um bom ch no basta ter em ateno a qualidade das folhas de ch, a
gua com que se prepara a infuso igualmente importante. No se devem utilizar guas
duras, pois apresentam altos teores de carbonatos de clcio e magnsio que vo levar
formao de uma pelcula superfcie do ch, constituda por agregados de compostos
fenlicos e carbonatos precipitados. guas ditas macias levam a uma extrao excessiva
dos componentes das folhas de ch e conferem um sabor salgado infuso. A gua
destilada tambm no ideal pois os minerais so essenciais para conferir alguma
dimenso ao sabor do produto final. Deve-se, portanto, utilizar uma gua com contedo

7
CAPTULO 2 REVISO BIBLIOGRFICA

mineral equilibrado e com um pH prximo da neutralidade, de modo a que a infuso tenha


um pH final moderadamente cido (por volta de pH 5) [3].

Caso se utilize gua da torneira, os odores e o cloro a presentes sero maioritariamente


eliminados no passo de aquecimento [3]. Para a preparao de ch preto ou oolong, a gua
dever estar perto da fervura, enquanto no caso do ch verde a temperatura da gua
dever ser mais baixa, por volta dos 77-82 C [6], de modo a limitar a extrao dos
compostos amargos e adstringentes muito abundantes neste tipo de ch e minimizar a
degradao da clorofila das folhas.

O tempo de infuso , normalmente, 3 a 5 minutos para o ch preto, fazendo-se apenas


uma infuso; para o oolong o tempo mais curto (90 segundos a 2 minutos) e possvel
realizar vrias infuses com as mesmas folhas; isto tambm se aplica ao ch verde, mas o
tempo de infuso de 2 a 3 minutos [6]. Quanto quantidade de folhas de ch utilizadas,
McGee (2004) refere que no Ocidente utiliza-se cerca de 1 a 3 % (p/v) para uma infuso
apenas, enquanto no Oriente so utilizadas quantidades maiores de folhas que so
deixadas em infuso durante muito pouco tempo e vrias vezes seguidas [3].

2.2 A Kombucha

A kombucha uma bebida doce fermentada base de ch, de origem asitica. Para a
produo de kombucha usado tradicionalmente o ch preto, mas o ch verde tambm
pode ser utilizado como base. Ao ch aucarado adicionada a chamada me da
kombucha que vai ser responsvel pelo processo fermentativo. Esta consiste numa
associao simbitica de bactrias e leveduras, acomodadas numa matriz de celulose
sintetizada por bactrias acticas.

O resultado uma bebida refrescante, agridoce e ligeiramente carbonatada, que lembra


sidra. O tempo de fermentao geralmente 7 a 10 dias e, se este for muito prolongado, a
kombucha desenvolve um sabor avinagrado mais intenso. As caractersticas da kombucha
variam muito pois esto dependentes de diversos fatores, tais como o tipo de ch utilizado
como base, os microrganismos presentes na me da kombucha e o tempo de
fermentao.

importante referir que o termo fermentao tem dois significados. No contexto


bioqumico, refere-se a todos os processos metablicos que envolvam a converso de

8
CAPTULO 2 REVISO BIBLIOGRFICA

compostos orgnicos em energia, na ausncia de oxignio; enquanto no sentido lato,


envolve todo o tipo de transformaes levadas a cabo por microrganismos e pelas suas
enzimas [14].

2.2.1 Histria

A origem da kombucha incerta, mas acredita-se que tenha surgido na Manchria, no


nordeste da China [15], sendo que os primeiros registos desta bebida datam de cerca de
221 a.C., onde era conhecida como o ch da imortalidade [16]. Em 414 d.C., um mdico
de nome Kombu teria levado a kombucha da Coreia para o Japo para curar os problemas
digestivos do Imperador Inkyo [9, 15] e surgiria da o nome Kombu cha ou ch do
Kombu [17, 18].

No incio do sc. XX, com a expanso das rotas comerciais, a kombucha veio para o
Ocidente pela Monglia e foi introduzida na Rssia, onde depois seguiu para a Polnia
durante a Primeira Guerra Mundial. Depois da guerra, a kombucha j estava presente na
Alemanha e Dinamarca [16]. Na altura da Segunda Guerra Mundial, esta bebida j era
conhecida em Itlia, Frana e Espanha, mas devido ao racionamento de provises,
nomeadamente de ch e acar, neste perodo de guerra, a kombucha deixou de ser
consumida, pois no era possvel a sua preparao [15, 16].

Mais tarde, em 1960, investigadores suos relataram que o consumo de kombucha era to
benfico como o de iogurte e a partir da a popularidade desta bebida aumentou [15].

2.2.2 Preparao

Para a produo de kombucha usado tradicionalmente o ch preto [15], mas tambm


podem ser utilizados outros chs como base. O modo de preparao e as propores de
ch, acar e inculo variam muito de produtor para produtor mas, em traos largos, o
procedimento base o seguinte: prepara-se uma base de ch (0.5 % [p/v], de acordo com
Jayabalan et al., 2014 [15]) com 5 a 15 % (p/v) de acar [17]. A base de ch preparada
quente, deixada arrefecer e depois distribuda em recipientes limpos de bocal largo.
ento adicionado o inculo composto pela me da kombucha e 10 a 20 % de kombucha
j fermentada [15, 17]. Isto vai provocar uma diminuio do pH do meio, que vai inibir o
desenvolvimento de microrganismos indesejados no ch aucarado. O recipiente onde se
pretende produzir a kombucha no deve ser fechado. Deve ser apenas coberto com gaze

9
CAPTULO 2 REVISO BIBLIOGRFICA

limpa para evitar contaminaes (moscas, esporos), mas ao mesmo tempo permitir a
entrada de ar. importante que haja algum espao de cabea no recipiente para que haja
bastante oxignio disponvel.

O preparado incubado sem agitao, temperatura ambiente (20 a 22 C) [15] durante 7


a 10 dias, ou at mais, dependendo do estado do inculo ou do resultado pretendido.
importante monitorizar frequentemente o ch durante o processo fermentativo at que se
atinjam as caractersticas desejadas em relao ao aroma e sabor. Quanto mais tempo se
deixar o ch a incubar, mais avinagrado ficar o produto final.

Ao fim de alguns dias, uma nova pelcula de celulose (me da kombucha) ter-se-
formado superfcie do lquido e, caso no seja utilizada para uma nova fermentao,
dever ser guardada no frio, juntamente com algum volume de kombucha j fermentada.

A bebida resultante dever ser filtrada para remover os restos de celulose e massas de
microrganismos em suspenso. Deve ser conservada no frigorfico em recipientes
fechados e geralmente servida fria.

Pode ainda ser realizada uma segunda fermentao para carbonatar a kombucha,
adicionando-se uma fonte de acar (sumo, fruta, ou acar mesmo) bebida j
fermentada. Esta mistura dever ser guardada numa garrafa de plstico fechada e deixada
temperatura ambiente. A kombucha estar carbonatada assim que a garrafa ficar firme
[18].

Quando se prepara kombucha num ambiente caseiro, necessrio ter ateno ao aspeto
da kombucha e da respetiva pelcula. Caso a bebida apresente um odor ou colorao
anormal, ou se a pelcula apresentar bolor, dever ser descartada. Devido acidez do
produto final, a kombucha no deve ser preparada nem armazenada em recipientes de
cermica ou chumbo para que no ocorra lixiviao de compostos txicos para a bebida
[19, 9].

2.2.3 Microrganismos Presentes na Kombucha

A microbiota da kombucha encontra-se dispersa no lquido e acomodada na me da


kombucha. A me da kombucha o nome comum que se d pelcula gelatinosa
celulsica que se forma superfcie do lquido e que responsvel pela fermentao do
ch. Recebe este nome porque ela que vai dar origem bebida e a uma nova pelcula, a
filha. As pelculas formam-se por camadas, de baixo para cima, sendo que a do topo

10
CAPTULO 2 REVISO BIBLIOGRFICA

sempre a mais recente [15]. Esta matriz de celulose bacteriana acomoda as bactrias e
leveduras responsveis pela fermentao da kombucha. Estes microrganismos formam
uma poderosa associao simbitica cuja atividade capaz de inibir o crescimento de
potenciais bactrias contaminantes [9].

A composio exata dos microrganismos presentes na kombucha varivel, estando


dependente da sua origem [15].

2.2.3.1 Leveduras

As leveduras que j foram isoladas de kombucha pertencem a vrias espcies e


maioritariamente aos seguintes gneros: Saccharomyces, Saccharomycodes,
Schizosaccharomyces, Zygosaccharomyces, Brettanomyces/Dekkera, Candida, Torulospora,
Kloeckera/ Hanseniaspora, Pichia, Torula, Torulopsis, Mycotorula e Mycoderma [15].

Mayser et al. (1995) analisaram 34 pelculas de kombucha de diferentes origens


(maioritariamente da Alemanha) e isolaram leveduras do gnero Brettanomyces,
nomeadamente B. lambicus em 56% das amostras, e dos gneros Zygosaccharomyces e
Saccharomyces em 29% e 26%, respetivamente. Tambm foram isoladas as espcies
Saccharomycodes ludwigii e Candida kefyr, mas apenas em uma amostra, cada. Algumas
amostras apresentavam leveduras apiculadas dos gneros Kloeckera e Hanseniaspora e
leveduras formadoras de pelcula como Candida krusei e Issatchenkia
occidentalis/orientalis [20].

Outros investigadores estudaram culturas de kombucha de origem australiana, de onde


isolaram leveduras das espcies Zygosaccharomyces bailii, Schizosaccharomyces pombe,
Torulospora delbrueckii, Rhodotorula mucilaginosa, Brettanomyces bruxellensis e Candida
stellata. Estas espcies foram as mais predominantes entre todos os isolados obtidos das
culturas analisadas [21].

Marsh e colaboradores (2014) analisaram culturas de kombucha do Canad, Reino Unido,


Irlanda e Estados Unidos e verificaram que o gnero Zygosaccharomyces era
predominante, tendo sido identificadas duas espcies desta populao: Z. lentus e Z.
bisporus. Do gnero Dekkera foram identificadas D. bruxellensis e D. anomala; e do gnero
Pichia e similares, P. kudriavzevii, P. fermentans, P. membranaefaciens e Hyphopichia
burtonii. Foi tambm detetada a presena de Kazachstania unispora, Davidiella tassiana,
Lachancea fermentati, Kluyveromyces marxianus, Naumovozyma castelli, Wallemia sebi e

11
CAPTULO 2 REVISO BIBLIOGRFICA

Leucosporidiella fragaria, espcies que at ento no tinham sido ainda associadas


kombucha [22]. J em culturas provenientes da Arbia Saudita, isolaram-se e
identificaram-se Candida guilliermondii, C. colleculosa, C. kefyr, C. krusei e, possivelmente,
Saccharomycodes ludwigii [23].

Kurtzman et al. (2001) descrevem no seu trabalho uma nova espcie de levedura,
Zygosaccharomyces kombuchaensis, que foi isolada de kombucha [24].

Foram identificadas vrias espcies dos gneros Saccharomyces e Candida, tais como S.
cerevisiae, S. bisporus, C. famata e C. obtusa. Zygosaccharomyces rouxii, Brettanomyces
intermedius, B. claussenii, B. custersii, Kloeckera apiculata e Kuyveromyces africanus
tambm foram referidas como presentes em kombucha [9, 15].

Apesar de no existir um conjunto universal de leveduras presentes na kombucha, as


leveduras osmotolerantes, fermentativas e produtoras de cido encontram-se entre os
isolados mais comuns [21].

2.2.3.2 Bactrias

As bactrias predominantes na kombucha so as acticas. Pertencem essencialmente aos


gneros Acetobacter, Gluconobacter e Gluconacetobacter [9, 15, 22], sendo a bactria mais
relevante a Gluconacetobacter xylinus/Komagataeibacter xylinus (anteriormente conhecida
como Acetobacter xylinum) [22, 25], pois a responsvel pela produo da pelcula de
celulose que forma a chamada me da kombucha. A. xylinoides, A. pasteurianus, A. aceti,
Bacterium gluconicum e Gluconobacter oxydans tambm ocorrem com frequncia nas
culturas de kombucha [9, 15]. Para alm destas, foram isoladas outras bactrias, tais como
A. intermedius [26] e bactrias fixadoras de azoto como A. nitrogenifigens e
Gluconacetobacter kombucha, sendo esta ltima capaz de produzir celulose [27, 28].

Marsh et al. (2014) investigaram a populao bacteriana de vrias culturas de kombucha


de diferentes origens e verificaram que os gneros de bactrias dominantes nas amostras
analisadas eram Acetobacter e Gluconacetobacter, sendo que este ltimo era
predominante. Tambm foram detetadas bactrias lcticas Lactobacillus e Lactococcus,
sendo os lactobacilli mais comuns possivelmente Lactobacillus kefiranofaciens subsp.
kefirgranum. Outros gneros de bactrias observados neste estudo (mas com menor
ocorrncia que os anteriores) foram, Leuconostoc, Allobaculum, Ruminococcaceae Incertae
Sedis, Enterococcus, Propionibacterium, Bifidobacterium e Thermus. possvel que algumas

12
CAPTULO 2 REVISO BIBLIOGRFICA

destas bactrias tenham sido introduzidas por condies de saneamento deficientes na


origem das culturas [22].

2.2.4 Processos Metablicos Envolvidos na Produo de Kombucha

As leveduras e as bactrias da kombucha utilizam os substratos das suas atividades


metablicas de forma complementar. As leveduras hidrolisam a sacarose (acar) da base
de ch em frutose e glucose pela ao da enzima invertase, e produzem etanol e dixido de
carbono [15], sendo que algumas delas, como as do gnero Saccharomyces tem
preferncia por glucose, ao passo que determinadas leveduras do gnero
Zygosaccharomyces tm preferncia por frutose como substrato [29]. As bactrias acticas
convertem a glucose em cido glucnico e a frutose em cido actico [30]. A presena
deste cido estimula as leveduras a produzir etanol que depois utilizado pelas bactrias
acticas para o seu crescimento e para a produo de mais cido actico [30, 31]. Tanto o
etanol como o cido actico apresentam atividade antimicrobiana contra bactrias
patognicas, o que significa que o ambiente fermentativo da kombucha tem a capacidade
de inibir o desenvolvimento de microrganismos contaminantes [9].

A bactria Gluconacetobacter xylinus a principal responsvel pela sntese da matriz de


celulose que acomoda a microbiota da kombucha, promovendo assim a associao entre as
bactrias e leveduras. A cafena e outras substncias estimulantes similares presentes no
ch estimulam a sntese de celulose bacteriana [9].

Leveduras dos gneros Zygosaccharomyces e Saccharomyces produzem compostos


aromticos frutados, apresentando uma grande importncia no desenvolvimento do
aroma da kombucha. As leveduras apiculadas (Kloeckera e Hanseniaspora) sintetizam
steres volteis e cidos que conferem ao substrato um aroma semelhante a sidra [20].

O pH da kombucha vai decrescendo ao longo do processo fermentativo devido produo


de cidos orgnicos. A cor do lquido vai ficando mais clara, em relao cor original do
ch, devido s alteraes que ocorrem na conformao dos complexos fenlicos perante o
aumento da concentrao de protes [3], e tambm devido ao de enzimas microbianas
sobre os polifenis [15, 32].

13
CAPTULO 2 REVISO BIBLIOGRFICA

2.2.5 Composio Qumica

A composio qumica da kombucha muito varivel, estando dependente de vrios


fatores como a durao da fermentao, o tipo de microrganismos presentes no inculo e
as caractersticas da base de ch (gua utilizada, tipo e concentrao de ch e de acar).

A kombucha contm vrios tipos de cidos orgnicos tais como, actico, glucnico,
glucurnico, ctrico, lctico, mlico, tartrico, malnico, oxlico, succnico, pirvico, snico.
Tambm contm acares, nomeadamente sacarose, glucose e frutose; vitaminas B1, B2, B6,
B12 e C; glicerol, aminocidos, aminas biognicas, purinas, pigmentos, lpidos, protenas,
algumas enzimas hidrolticas, etanol, compostos com propriedades antibiticas, dixido de
carbono, compostos fenlicos, minerais, DSL (D-saccharic acid-1,4-lactone) e outros
metabolitos microbianos [9, 15].

A tabela 2.2 lista os principais componentes da kombucha e respetivas concentraes


observadas em vrios trabalhos realizados com esta bebida, com diferentes condies de
fermentao.

Tabela 2.2 Comparao entre os principais componentes de kombucha preparada com ch preto, com
diferentes condies de fermentao (adaptada da referncia 15). Valores aproximados.
Temperatura Tempo de
Concentrao Sacarose Quantidade
Componente de fermentao fermentao Referncia
(%[p/v]) inicial (%) de ch preto
(C) (dias)

0.8 10 2 saquetas 24 3 60 [30]

cido actico 0.5 10 1.2% (p/v) 24 3 18 [32]

0.2 5
0.3 7 0.5% (p/v) 20 25 [33]
0.1 10

3.9 10 2 saquetas 24 3 60 [30]


cido
glucnico 1.3 5
3.1 7 0.5% (p/v) 20 25 [33]
3.6 10
cido
0.2 10 1.2% (p/v) 24 3 18 [32]
glucurnico

5.5 10 2 saquetas 24 3 60 [30]


Frutose
0.5 7 0.15% (p/v) 28 21 [34]

Glucose 1.2 10 2 saquetas 24 3 60 [30]

14
CAPTULO 2 REVISO BIBLIOGRFICA

1.3 7 0.15% (p/v) 28 21 [34]

1.1 10 2 saquetas 24 3 60 [30]

Sacarose
1.3 7 0.15% (p/v) 28 21 [34]
remanescente
0.1 5
0.2 7 0.5% (p/v) 20 25 [33]
0.3 10

O sabor agridoce da kombucha advm da presena destes cidos orgnicos e acares na


sua composio.

Nutricionalmente, a me da kombucha constituda maioritariamente por protena e


fibra. rica em aminocidos essenciais e no essenciais, sendo a lisina o que ocorre em
concentraes mais altas, segundo a anlise realizada por Jayabalan e colaboradores
(2010) [35].

2.2.6 Propriedades

A kombucha j era conhecida na antiguidade pelas suas propriedades curativas. Apesar de


no existirem ainda provas cientficas slidas sobre os efeitos da kombucha na sade
humana, os consumidores desta bebida tm referido que esta alivia dores de cabea, tem
propriedades desintoxicantes, reduz o nvel de colesterol, promove o bom funcionamento
do fgado, previne problemas digestivos e circulatrios, aumenta a resistncia ao cancro,
retarda o envelhecimento, melhora o metabolismo e a viso, diminui a incidncia de
inflamaes, entre outros efeitos [9, 15].

2.2.6.1 Propriedades Antimicrobianas

Atualmente foram j realizados vrios estudos acerca das propriedades da kombucha em


modelos experimentais. Quanto s suas propriedades antimicrobianas, Steinkraus e
colaboradores (1996) verificaram que a bebida fermentada inibia o crescimento das
bactrias patognicas Helicobacter pylori (principal causa de gastrite relacionada com
lceras ppticas e cancro do estmago), Escherichia coli, Staphylococcus aureus e
Agrobacterium tumefaciens. Contudo os resultados foram semelhantes inibio por
vinagre, o que significa que a atividade inibitria da kombucha sobre estas bactrias deve-
se essencialmente ao cido actico presente na sua composio [36]. O estudo realizado

15
CAPTULO 2 REVISO BIBLIOGRFICA

por Sreeramulu et al. (2000) testou o efeito da kombucha em culturas dos microrganismos
patognicos Enterobacter cloaceae, Pseudomonas aeruginosa, Bacillus cereus, E. coli,
Aeromonas hydrophila, Salmonella typhimurium, Salmonella enteritidis, Staphylococcus
epidermis, Listeria monocytogenes, Yersinia enterolytica, S. aureus, Shigella sonnei,
Campylobacter jejuni, H. pylori e Candida albicans, e verificou-se que, na maior parte dos
casos, havia maior inibio do crescimento destes microrganismos com amostras de
kombucha fermentadas durante mais tempo. Apesar do poder antimicrobiano ser
comparvel ao do cido actico (com excepo em C. albicans), a kombucha tambm
apresentou ao inibitria no crescimento de E. coli, Sl. typhimurium, Sl. enteritidis, L.
monocytogenes, Sh. sonnei, Cm. jejuni e C. albicans mesmo com pH neutro, e com
tratamento trmico, o que quer dizer que o cido no o nico responsvel pelo poder
antimicrobiano da kombucha. Isto implica a existncia de outros compostos com ao
antimicrobiana na composio da bebida fermentada que no sejam protenas (pois no
resistiriam ao tratamento trmico), nem catequinas (compostos fenlicos presentes em
abundncia no ch), dado que as amostras de ch no fermentado no apresentaram ao
inibitria para nenhum dos microrganismos com excepo de Cm. Jejuni [37]. Battikh e
colaboradores (2013) estudaram a atividade antimicrobiana de kombucha preparada com
ch preto e com ch verde, e verificaram que, apesar de ambas inibirem o crescimento da
maior parte dos microrganismos estudados, a kombucha de ch verde apresentou maior
potencial antimicrobiano [38].

2.2.6.2 Propriedades Antioxidantes

A atividade antioxidante est relacionada com a preveno de cancros, aumento da


imunidade e alvio de inflamaes e artrite. A kombucha apresenta maior atividade que
ch no fermentado. Isto est associado ao contedo de polifenis, cido ascrbico e DSL
da bebida fermentada. As propriedades antioxidantes da kombucha dependem do tempo
de fermentao, tipo de ch utilizado e dos microrganismos presentes [15].

Chu e Chen (2006) verificaram que as kombuchas estudadas apresentavam atividade


sequestradora de DPPH (,-difenil--picrilhidrazil) e do radical ABTS (cido 2,2'-azino-
bis-[3-etilbenzotiazolina-6-sulfnico]) cerca de 1.7 e 1.4 vezes superior ao do ch no
fermentado, respetivamente. Tambm foi avaliada a taxa de inibio da peroxidao do
cido linoleico, em que as kombuchas apresentaram, em mdia, valores cerca de 1.4 vezes
superiores ao do controlo. Estas propriedades antioxidantes observadas nas amostras de
kombucha aumentaram com o tempo de fermentao, contudo no se recomenda a

16
CAPTULO 2 REVISO BIBLIOGRFICA

fermentao prolongada do ch devido formao excessiva de cidos orgnicos fracos.


No entanto, os perfis de atividade antioxidante apresentaram algumas variaes entre
amostras, o que poder estar relacionado com as diferentes origens das culturas de
kombucha [39]. Jayabalan et al. (2008) estudaram as propriedades de kombucha
preparada com ch preto, verde, e com resduos provenientes do processamento de ch
(tea waste material), verificando igualmente que todas as amostras apresentaram um
aumento da capacidade sequestradora de DPPH, mas kombucha de ch verde demonstrou
maior atividade. O mesmo foi observado em relao inibio da peroxidao do cido
linoleico. Verificou-se tambm que todos os tipos de kombucha apresentaram um
aumento da atividade sequestradora de anies superxido com o tempo de fermentao,
contudo o inverso foi observado para radicais hidroxilo [40]. No trabalho de Malbaa e
colaboradores (2011), foi avaliada a influncia de trs culturas diferentes (mistura de
bactrias acticas e Zygosaccharomyces sp., mistura de bactrias acticas e Saccharomyces
cerevisiae, e uma cultura de kombucha local) nas propriedades antioxidantes de kombucha
de ch preto e verde contra radicais hidroxilo e DPPH. Os autores verificaram que a
kombucha de ch preto produzida com a mistura contendo Zygosaccharomyces sp., e a de
ch verde produzida com a cultura local demonstraram maior atividade antioxidante [41].

Existem estudos que comprovam a atividade da kombucha como agente hepatoprotetor,


atuando contra a hepatotoxicidade do tetracloreto de carbono em ratos (tanto como um
agente preventivo, como curativo) [42]; contra a citotoxicidade e morte celular induzida
por TBHP (ter-butil hidroperxido) em hepatcitos de ratos [43]. Estas propriedades
desintoxicantes da kombucha devem-se, possivelmente, aos compostos com atividade
antioxidante presentes na sua composio. Wang et al. (2013) reportaram que o DSL
(composto que produzido essencialmente por Gluconacetobacter sp. A4 presente na
kombucha) o principal responsvel pelos efeitos hepatoprotetores da bebida
fermentada. Neste estudo testou-se o efeito de DSL, de kombucha tradicional e de
kombucha fermentada apenas com Gluconacetobacter sp. A4, contra hepatotoxicidade
induzida por paracetamol em ratos e verificou-se que os efeitos de ambas as bebidas
foram semelhantes ao do DSL em termos de atividade hepatoprotetora [44].

2.2.6.3 Propriedades Anticancergenas

As propriedades anticancergenas da kombucha tambm foram investigadas. Jayabalan e


colaboradores (2011) estudaram as propriedades citotxicas e anti-invasivas de fraes
de kombucha extradas por diferentes solventes, contra clulas cancergenas A549

17
CAPTULO 2 REVISO BIBLIOGRFICA

(carcinoma pulmonar humano), U2OS (osteossarcoma humano) e 786-O (carcinoma renal


humano). A frao extrada por acetato de etilo foi a mais eficaz e foi determinado que esta
continha malonato de dimetil 2-(2-hidroxi-2-metoxipropilideno) e vitexina, que
possivelmente sero os compostos responsveis pelas propriedades anticancergenas da
kombucha [45]. Srihari et al. (2013) testaram o efeito de extrato de kombucha liofilizado
contra clulas PC-3 (cancro da prstata). O extrato foi conseguido atravs de acetato de
etilo. Verificou-se que a kombucha diminui significativamente a sobrevivncia das clulas
cancerosas atravs da inibio da expresso de molculas que estimulam a angiognese.
Tambm se observou uma inibio na migrao das clulas do cancro da prstata [46].

2.2.6.4 Outras Propriedades

Para alm das propriedades anteriormente referidas, outros autores tm reportado outros
efeitos benficos da kombucha. Shenoy (2000) observou atividade hipoglicmica de
kombucha em ratos normais e em indivduos com diabetes induzido por aloxana [47]. Por
outro lado, Hartmann et al. (2000) forneceram uma soluo de kombucha a um grupo de
ratos (vs. um grupo controlo ao qual foi fornecida gua) durante o seu desenvolvimento
at sua morte natural. Os autores verificaram que a ingesto crnica de kombucha
provocou uma inibio no aumento de peso, aumentou a resposta e perceo de estmulos
ambientais, e contribuiu para um aumento da longevidade nos indivduos estudados.
Contudo observou-se um aumento do tamanho dos fgados e baos nos ratos tratados com
kombucha [48]. Yang e colaboradores (2008) verificaram os efeitos antioxidantes e
hipocolesterolmicos da kombucha em ratos, e tambm observaram uma diminuio do
peso dos indivduos tratados com a bebida fermentada [49]. Num estudo realizado por
Kallel et al. (2012), observou-se uma inibio da -amilase pancretica suna por
kombucha, em testes in vitro. Um copo de 200 mL da bebida poder ter algum efeito
inibidor da -amilase no intestino delgado, afetando a digesto de amido e glucose
absorvida. Estes resultados podero dar indicaes acerca da ao da kombucha na perda
de peso e tratamento da diabetes tipo 2 [50].

A kombucha considerada um potencial produto probitico desde que no sofra nenhum


processamento que remova ou inviabilize os microrganismos presentes. Um produto
probitico aquele que contm microrganismos vivos que, quando administrados em
quantidades adequadas, conferem benefcios na sade do indivduo. Exemplos deste tipo
de produtos so iogurtes, leite fermentado e no fermentado, miso, tempeh e alguns
sumos ou outras bebidas fermentadas [51].

18
CAPTULO 2 REVISO BIBLIOGRFICA

Apesar destes potenciais benefcios da kombucha, foram tambm reportados casos de


indivduos que se sentiram indispostos aps o consumo desta bebida. Os Centros de
Controlo e Preveno de Doenas (EUA) registam dois casos de indivduos que ficaram
inexplicavelmente doentes aps consumo regular de kombucha, tendo um dos indivduos
falecido [52]. Srinivasan et al. (1997) reportam quatro casos de doenas associadas ao
consumo de kombucha. Dois dos pacientes demonstraram sintomas de reao alrgica,
outro ictercia e o restante nuseas, vmitos, e dores de cabea e pescoo [19].
Adicionalmente, Kole e colaboradores (2009) relatam um caso de um indivduo com HIV
que foi admitido com hipertermia severa, acidose lctica e falha renal aguda 15 horas
depois do consumo de uma garrafa de kombucha [53]. importante referir que estes
relatos envolvem casos singulares e separados, e no possvel definir com certeza de que
o consumo de kombucha foi o principal responsvel pelos efeitos secundrios descritos.

2.2.7 Aplicaes Alternativas

A kombucha consumida quer como refresco, quer como tnico, devido aos seus supostos
efeitos benficos. Para alm da aplicao da cultura de kombucha para a fermentao de
ch, foram testados outros substratos para a produo de bebidas diferentes. Cvetkovi e
Markov (2002) utilizaram uma soluo de extrato de malte (10% [p/v]) e ch preto (0.2%
[p/v]) como base, produzindo uma bebida sensorialmente satisfatria [54]. Outros
autores testaram leite magro e meio gordo com diferentes concentraes de inculo e
verificaram que as combinaes com leite meio gordo eram mais agradveis. Dentro
destas, a mistura com 15 % (v/v) de inculo foi a que se destacou [55]. Malbaa e
colaboradores (2009) produziram vrias bebidas base de leite meio gordo e kombucha
de vrias origens (de ch preto, verde e de extrato de tupinambo), que foram comparadas
com iogurte, tendo na maioria dos casos conseguido bebidas agradveis e com melhor
estabilidade no armazenamento [56].

A pelcula de celulose bacteriana que constitui a me da kombucha tambm poder ser


aproveitada para outras aplicaes. Czaja et al. (2006) reportam a potencialidade da
utilizao da pelcula de celulose produzida por Acetobacter xylinum no tratamento de
leses drmicas [57]. Nas Filipinas, a pelcula de celulose bacteriana resultante da
fermentao de gua de coco ou sumo de anans (ou outras frutas) cortada em cubos e
denominada nata (figura 2.1). Este um produto bastante popular, sendo utilizado em
sobremesas e refrescos. No presente trabalho, a me da kombucha foi utilizada para a
produo de nata de kombucha (ver seco 3.9.1).

19
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.1 Produo nata de coco (imagem retirada da referncia 58). Camadas espessas de celulose
bacteriana resultante da fermentao de gua de coco por A. xylinum so cortadas em cubos uniformes para a
produo da chamada nata de coco.

Murugesan et al. (2006), Mamisahebei et al. (2007) e iban et al. (2012) testaram a
pelcula de celulose da kombucha na remoo de poluentes metlicos de solues aquosas
e verificaram que esta um bioabsorvente bastante eficaz, apresentando a potencialidade
de ser utilizada em projetos de tratamento de guas contaminadas [59, 60, 61]. Zhu e
colaboradores (2014) estudaram a biocompatibilidade desta estrutura e verificaram que
esta um biomaterial promissor para a engenharia de tecido nervoso [62].

Murugesan et al. (2005) estudaram a utilizao da me da kombucha como suplemento


na alimentao de pintos broiler e verificaram que uma concentrao de 15 % (p/p) de
pelcula em rao, provocou um aumento do consumo de rao e gua, do peso e do fator
de produo das aves, sem ter sido observado qualquer efeito secundrio negativo [63].

Suzanne Lee [64], uma designer de moda nova-iorquina e fundadora da Biocouture


(http://www.biocouture.co.uk/), um projeto cujo objetivo o da criao de peas de
roupa a partir de biomateriais, produziu peas de vesturio a partir de pelculas de
kombucha desidratadas de grandes dimenses, que foram lavadas, secas, cortadas e
cosidas como se fossem pedaos de tecido (figura 2.2). Este projeto foi apresentado numa
TED Talk [65], onde Lee usou um colete feito com me de kombucha. O nico grande
inconveniente destas roupas o facto de as pelculas absorverem gua, pelo que estas
peas de vesturio inchariam com a chuva e, eventualmente, comeariam a desfazer-se nas
costuras.

20
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.2 Casacos produzidos com me de kombucha, por Suzanne Lee (imagem retirada da referncia
66). possvel tingir as peas de vesturio produzidas com as pelculas desidratadas com corantes vegetais,
criando padres orgnicos (esquerda) ou com ndigo (direita) que tem propriedades antimicrobianas.

2.2.8 Consumo A Kombucha como um Novo Produto

A kombucha tornou-se uma bebida muito popular nestes ltimos anos devido aos seus
potenciais efeitos benficos. Numa sociedade cada vez mais preocupada com a sua
alimentao e com os benefcios dos alimentos que consome, natural que esta bebida
tenha sido to bem recebida.

De acordo com o Google Trends (https://www.google.com/trends/), a seco do Google


que avalia as tendncias de pesquisa dos utilizadores deste motor de busca, o interesse
pelo termo kombucha tem aumentado desde 2010 (figura 2.3), sendo que o pas onde
este termo mais pesquisado os EUA, seguido pela Nova Zelndia e o Canad. Em termos
de pesquisas relacionadas, os tpicos mais procurados (sem incluir a bebida em si) so os
benefcios, receitas, o modo de preparao e a cultura de kombucha [67].

21
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.3 Tendncias de pesquisa globais pelo termo kombucha, de 2004 ao presente [67]. Os
pontos marcados no grfico so relativos ao ponto mais alto, que representa 100% das pesquisas por este
termo.

A kombucha um produto extremamente popular nos EUA, sendo que existem inmeras
marcas desta bebida disponveis no mercado (exemplos nas figuras 2.4 a 2.7), algumas
delas representando um volume de negcios considervel [68]. De acordo com a Quartz
(http://qz.com/), um jornal de negcios digital, s no ano 2014 foram consumidos o
equivalente a quase 400 milhes de dlares em kombucha [68]. Devido ao grande nmero
de marcas existentes no mercado, os produtores procuram inovar o seu produto
introduzindo kombuchas com sabores ou combinaes pouco usuais e uma imagem
atrativa que permita a diferenciao do seu produto em relao ao da concorrncia [69].

Figura 2.4 Health-Ade Kombucha, de Los Angeles, Califrnia (imagem retirada da referncia 70).
Disponvel nos sabores (da esquerda para a direita): uvas da Califrnia, ma Pink Lady, ameixa, rom,
original, gengibre e limo, lima + gengibre + pimenta cayenne, beterraba e cenoura. O nome da marca e a
embalagem que lembra um frasco de remdio, apelam aos potenciais benefcios da kombucha para a sade. O
objetivo da embalagem escura na realidade para proteger o produto da luz, mas acaba por se aliar tambm
imagem de bebida saudvel que a marca pretende transmitir.

22
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.5 GTs Kombucha, da Califrnia (imagem retirada da referncia 71). Esta marca dispe de duas
linhas, a Classic com teor alcolico superior a 0.5 %, e a Enlightened com teor alcolico inferior a 0.5 %. Esta
marca possui um total de 32 sabores diferentes de kombucha, contando com sabores de fruta, herbais e
alguns com sementes de chia. A imagem do produto, com imagens que lembram mandalas, os nomes msticos
e a constante utilizao da palavra elixir na descrio no site (http://synergydrinks.com/) apela origem
asitica, anci e esotrica desta bebida.

Figura 2.6 Live Kombucha Soda, de Austin, Texas (imagem retirada da refernca 72). Esta marca, ao
contrrio das anteriores, apresenta a kombucha como um refrigerante, portanto dispe de sabores que
tentam imitar os de refrigerantes populares. Da esquerda para a direita: mirtilos e rom; cream soda e
laranja; rootbeer e baunilha; lima e limo; especiarias; gengibre; Cola; morango e ruibarbo.

Figura 2.7 Reeds Culture Club Kombucha (imagem retirada da referncia 73). Disponvel nos sabores (da
esquerda para a direita): goji e gengibre; hibiscos, gengibre e toranja; limo, gengibre e framboesa; oxicoco e
gengibre; rom e gengibre; gua de cco e lima; maracuj, manga e gengibre; uva Cabernet Sauvignon.

23
CAPTULO 2 REVISO BIBLIOGRFICA

Em alguns pases existem bares de kombucha, onde servida kombucha presso.


Alguns exemplos so o Red Star Kombucha, nos EUA; e o Wild Kombucha by Ballsy
(http://wildkombucha.com/), na Austrlia (figura 2.8).

Figura 2.8 Wild Kombucha by Ballsy, em Sidney, Austrlia (imagem retirada da referncia 74).

Em Portugal esta bebida no to popular e ainda no muito conhecida, exceto em


grupos especficos, mas j existem pginas de partilha de kombucha espalhadas pelas
redes sociais, como o caso do grupo Kefir e
Kombucha Portugal - GRUPO DE PARTILHA, no
Facebook (https://www.facebook.com/groups/21
2887238773306/), onde os participantes trocam
culturas entre si, discutem o progresso dos
alimentos fermentados que produzem e partilham
receitas.

A kombucha est presente no mercado em vrios


pases e em Portugal pode-se encontrar em lojas
de produtos biolgicos/naturais, como as do
Celeiro, na Miostis e nos supermercados do El
Corte Ingls. Uma das marcas existentes chama-se
Figura 2.9 Kombucha da Xat (imagem
Xat (Cantanhede, Portugal) e existe nos sabores:
retirada da referncia 75).
original, rom e limo (figura 2.9).

24
CAPTULO 2 REVISO BIBLIOGRFICA

2.3 Mtodos de Identificao de Microrganismos

Existem vrios mtodos que podem ser usados para determinar os principais grupos de
microrganismos que compem a microbiota interveniente na produo de kombucha.
Para alm dos mtodos mais clssicos baseados no crescimento dos microrganismos em
meios seletivos e que dependem da capacidade de multiplicao destes nas condies
selecionadas, atualmente os mtodos mais fiveis so os moleculares, que tm por base
reaes de amplificao de regies especficas do DNA por PCR utilizando sequncias
iniciadoras (primers) desenhadas de acordo com as regies que se pretende amplificar.
Para a identificao de espcies de leveduras so geralmente amplificadas regies do DNA
ribossomal (rDNA), que apresentam vrias regies conservadas separadas por domnios
com sequncias especficas das respetivas espcies. O rDNA constitudo pelos genes que
codificam as subunidades 18S, 5.8S e 25/28S, separados pelos espaadores transcritos
internos (internal transcribed spacers ou ITS) ITS1 e ITS2 [76], tal como mostra a figura
2.10.

5 ITS1 ITS2 3
18S rDNA 5.8S rDNA 25/28S rDNA

Figura 2.10 Esquema da regio dos genes de rDNA de fungos (adaptado das referncias 76 e 77). As
caixas representam os genes ribossomais e as setas coloridas indicam as posies dos primers utilizados
neste trabalho para a identificao de espcies de leveduras (ITS4 e ITS5).

Para a identificao de espcies de bactrias acticas so utilizados os primers Ac1 e Ac3.


Estes correspondem a regies conservadas do rDNA bacteriano e so utilizados para
amplificar parte do gene de 16S rDNA [78].

A tcnica de PCR compreende trs passos fundamentais (representados na figura 2.11), a


desnaturao do DNA, onde as cadeias que compem o dsDNA so separadas pela rutura
das pontes de hidrognio que as unem pela ao da temperatura (94 a 95 C); o passo de
annealing, em que ocorre a ligao dos primers aos moldes de ssDNA, a uma temperatura
mais baixa; e finalmente, o passo de extenso, que se d temperatura tima da DNA
polimerase utilizada, e onde ocorre a sntese de DNA catalisada por essa enzima [79].

Os resultados da amplificao das regies especficas por PCR so geralmente analisados


por eletroforese em gel de agarose e posteriormente sequencia-se o produto de PCR por
sequenciao automtica de DNA (automated DNA sequencing), uma tcnica baseada no
mtodo de sequenciao de Sanger (figura 2.12 A) [80].

25
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.11 Amplificao de DNA por PCR (adaptado da referncia 80). (A) Os trs passos fundamentais
de um PCR. (B) Estes passos so repetidos durante vrios ciclos para que se consigam vrias cpias do
segmento de DNA desejado. Os fragmentos assinalados a amarelo so aqueles cujo tamanho corresponde ao
da regio que se pretende amplificar, os outros fragmentos apresentam ainda DNA extra a jusante da
sequncia original. Este fenmeno acontece apenas nos primeiros ciclos. Aps vrios ciclos, todos os
fragmentos apresentaro o tamanho desejado.

26
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.12 Sequenciao de DNA automatizada (adaptado da referncia


81). (A) Cada ddNTP (nuclesidos modificados que provocam a terminao
da sntese da cadeia de DNA) est associado a um marcador fluorescente
diferente, apresentando uma cor diferente dependendo do ddNTP que tiver
sido incorporado. medida que as bandas vo passando pelo detetor de
fluorescncia, este envia a informao a um sistema de imagem que ir
process-la e produzir um grfico semelhante ao ilustrado em (B), onde
cada pico representa a incorporao do ddNTP respetivo em determinada
posio.

2.4 Gastronomia Molecular como Metodologia para Inovao

O termo gastronomia molecular surgiu em 1988 como uma disciplina que criaria a ponte
entre as cincias dos alimentos (mais ligada a processos tecnolgicos em larga escala) e as
cozinhas de pequena escala [82]. Os seus fundadores, Herv This e Nicholas Kurti,
escolheram este nome pois gastronomia, segundo Brillat-Savarin, designa todo o
conhecimento inteligente relativo a tudo o que sirva de alimento ao Homem. A

27
CAPTULO 2 REVISO BIBLIOGRFICA

gastronomia integra conhecimento na rea da histria natural, fsica, qumica, culinria,


negcios e economia poltica [83]. This e Kurti definiram inicialmente a sua nova
disciplina como Gastronomia Fsica e Molecular [82], pois procurava estudar os aspetos
fsicos e moleculares dos processos culinrios e dos alimentos em si, mas mais tarde
acabou por ser abreviado para Gastronomia Molecular.

As atividades culinrias basearam-se sempre em conhecimento emprico e nunca se


procurou compreender os fenmenos por detrs dos processos culinrios. Este um dos
objetivos da Gastronomia Molecular, sendo que os outros incluem o melhoramento de
receitas j existentes, o desenvolvimento de novas receitas atravs do conhecimento
terico cientfico, e a introduo de novas tcnicas, instrumentos e ingredientes na cozinha
[84], resultando numa ligao entre a Cincia e a Arte, aliando cientistas a cozinheiros.

2.4.1 Desenvolvimento de Novos Produtos Alimentares

A inovao est na base do sucesso e da sobrevivncia de qualquer empresa. No domnio


dos produtos alimentares, a inovao pode surgir na forma de uma extenso de linha, de
um reposicionamento ou reformulao de um produto j existente, numa nova forma ou
tamanho de um dado produto, de uma nova embalagem para um produto existente, ou na
forma de um produto inovador ou criativo (tabela 2.3) [85].

Tabela 2.3 Tipos de novos produtos alimentares (adaptada da referncia 85).

Tipo de Novo Produto Exemplos Caractersticas Gerais

Extenso de linha Um novo sabor numa linha de Desenvolvimento e investigao


guas aromatizadas. requerem pouco tempo.

Uma nova variedade numa linha de No so necessrias grandes alteraes


sopas prontas a servir. no fornecimento de matrias-primas,
processo de produo e armazenagem
ou estratgia de marketing.

Reposicionamento de um Produtos contendo aveia Desenvolvimento e investigao


produto existente reposicionados como produtos que requerem pouco tempo.
reduzem o colesterol.
No so necessrias grandes alteraes
Produtos contendo soja no fornecimento de matrias-primas,
reposicionados como produtos que processo de produo e armazenagem.
combatem o cancro.
Requer desenvolvimento de novas
estratgias de marketing e tcnicas de
vendas para o posicionar em novos
nichos de mercado ou novos mercados.

Nova forma ou tamanho Fruta j descascada e/ou em Impacto varivel na investigao e


de um produto existente gomos. desenvolvimento.

28
CAPTULO 2 REVISO BIBLIOGRFICA

Chs e cafs instantneos. Impacto varivel no processo de


produo e nas instalaes fabris.

Requer desenvolvimento de novas


estratgias de marketing e tcnicas de
vendas.

Reformulao de um Produtos de baixo teor calrico. Investimento em investigao e


produto existente desenvolvimento moderado, consistente
Produtos lcteos sem lactose. com o objetivo da reformulao.

Pouco impacto nas instalaes fabris,


processo de produo, estratgia de
marketing e vendas, a no ser que a
reformulao leve a um
reposicionamento do produto.

Nova embalagem para um Embalagens individuais de iogurte, A novidade da embalagem determinar


produto existente leite, etc. o investimento em investigao e
desenvolvimento.
Molhos (ketchup, mostarda) em
embalagens de espremer. Algum impacto na produo.
necessria a aquisio de novo
equipamento de embalagem.

Pequeno impacto na estratgia de


marketing, vendas e distribuio.

Produto inovador Kits para refeies. Investimento na investigao e


desenvolvimento dependente da
Refeies congeladas. natureza da inovao.

Impacto muito varivel no processo de


produo e instalaes fabris.

Requer desenvolvimento de novas


estratgias de marketing e tcnicas de
vendas.

Produto criativo Falso caviar. Grande investimento em investigao e


desenvolvimento.
Surimi (delcias do mar).
Processo de investigao e
desenvolvimento longo.

Pode requerer uma nova instalao


fabril ou equipamento (inclusivamente
desenvolvimento de novo equipamento).

Requer desenvolvimento de novas


estratgias de marketing e tcnicas de
vendas. Pode mesmo requerer a criao
de uma nova marca ou empresa.

Alto risco de insucesso.

Os avanos tecnolgicos trouxeram novos ingredientes e novos processos que permitiram


o desenvolvimento de produtos que anteriormente seriam impossveis de produzir.

29
CAPTULO 2 REVISO BIBLIOGRFICA

Tambm trouxeram novos materiais que permitiram uma evoluo nos mtodos de
embalamento e acondicionamento dos produtos alimentares [85].

2.4.2 Hidrocolides

Um hidrocolide uma substncia com caractersticas hidroflicas, devidas presena de


vrios grupos hidroxilo (-OH) que formam ligaes com molculas de gua, capazes de
formar disperses coloidais numa fase contnua aquosa [86]. As misturas coloidais
caracterizam-se pela dimenso microscpica das partculas na fase dispersa, produzindo
sistemas que, a olho nu, aparentam ter apenas uma fase.

Os hidrocolides so um grupo de polmeros de cadeias longas (polissacridos ou


protenas) caracterizados pela sua capacidade de formar disperses viscosas e/ou gis
quando misturados em gua. Estas propriedades conferem a estes compostos um enorme
interesse em aplicaes na indstria alimentar, sendo utilizados como espessantes,
gelificantes, emulsionantes, estabilizantes e servem ainda para controlar a formao de
cristais de gelo ou acar nos alimentos [86].

Estes compostos encontram-se classificados como emulsionantes, estabilizadores,


espessantes e gelificantes na lista de aditivos alimentares aprovados pela Unio Europeia
[87]. Existem vrias substncias hidrocolides diferentes, mas apenas sero abordadas
aquelas que foram utilizadas no presente trabalho: agar, carrageninas e goma de alfarroba.

2.4.2.1 Agar (E406)

O agar (ou agar-agar) um polissacrido produzido por algumas espcies de algas


vermelhas (Rhodophyceae) [88, 89]. Constitui as reservas de polissacridos destas algas,
pelo que o seu contedo e composio variam de acordo com as condies fisiolgicas dos
organismos e do meio em que se encontram [90]. As algas produtoras de agar mais
utilizadas na indstria so dos gneros Gelidium (produzem gis mais fortes) e Gracilaria
(gis mais fracos) [89].

O agar uma mistura constituda maioritariamente por agarose e agaropectina em menor


proporo [88]. A agarose um polmero linear composto por unidades de D-
galactopiranose ligadas por ligaes (14) a 3,6-anidro-L-galactopiranose que, por sua
vez, se encontra ligada na forma (13) ao prximo resduo de D-galactopiranose (figura
2.13).

30
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.13 Estrutura da molcula de agarose (imagem retirada da referncia 91). O primeiro
resduo representado a contar da esquerda a D-galactopiranose que se encontra ligada 3,6-anidro-L-
galactopiranose por uma ligao (14). Esse resduo, por sua vez, est ligado D-galactopiranose
seguinte por uma ligao (13).

A estrutura da agaropectina semelhante da agarose, mas bastante heterognea,


apresentando grupos laterais diferentes tais como grupos sulfato, metilo e cido pirvico.
Os substituintes presentes nesta molcula diferem de acordo com a espcie de alga e com
fatores fisiolgicos e ecolgicos [89].

Em termos do processo de gelificao, a agarose o componente mais relevante para a


formao de um gel de agar [90]. A gelificao do agar um fenmeno fsico resultante da
formao de pontes de hidrognio entre as cadeias lineares, que se associam
aleatoriamente em hlices, que depois se vo ligar entre si (novamente por pontes de
hidrognio), formando estruturas mais complexas. Estas hlices so estabilizadas pelas
molculas de gua contidas no seu interior. A estrutura tridimensional resultante desta
complexa associao de molculas o que vai dar origem matriz do gel [88, 89].

As propriedades e modo de utilizao do agar esto listados no Anexo I, a. Quanto s suas


aplicaes, o agar j era utilizado na sia h 350 anos em receitas tradicionais, antes de ter
sido introduzido no Ocidente e de ter aparecido na cozinha moderna. Atualmente o agar
utilizado na indstria alimentar em sobremesas, gomas, doces, aspics, carnes enlatadas,
caviares de imitao, coberturas de bolos, molhos e sopas, tirando partido das suas
capacidades enquanto espessante e gelificante [89].

O agar permite a elaborao de gelatinas e sobremesas com frutas como o anans e kiwi,
pois resistente s proteases que estes frutos possuem (ao contrrio da gelatina). Nas
carnes enlatadas o agar em p adicionado carne, resultando num produto mais
suculento que mais fcil de cortar [89]. Nas coberturas de bolos, o agar atua como um
estabilizante. Este composto permite uma melhor adeso do produto ao bolo e retm a
humidade, pelo que evita que a superfcie da cobertura seque e quebre [89].

31
CAPTULO 2 REVISO BIBLIOGRFICA

Nos molhos e sopas, o agar atua como espessante, melhorando a textura do produto. Na
cozinha moderna, o agar utilizado para fazer gis quentes, esparguetes e esferificaes
em leo frio, por exemplo.

2.4.2.2 Carrageninas (E407 e E407a)

A carragenina um polissacrido que ocorre naturalmente em algumas espcies de algas


vermelhas da famlia Rhodophyceae [92]. As espcies principais utilizadas na produo
das carrageninas disponveis comercialmente incluem Kappaphycus alvarezii (ou
Eucheuma cottonii), Eucheuma denticulatum (ou E. spinosum), Chondrus crispus e Gigartina
stellata [92, 93].

Existem duas classes de produtos com carrageninas: extrato de carragenina e carragenina


semi-refinada (ou algas Eucheuma transformadas, AET) [87, 93]. No primeiro caso as
carrageninas encontram-se numa forma solvel, isoladas da matria algal; enquanto no
segundo caso, estes hidrocolides apresentam-se ainda dentro da matriz celulsica
estrutural das algas [93]. Na lista de aditivos alimentares aprovados pela Unio Europeia,
disponvel na pgina da ASAE [87], estes produtos encontram-se classificados como:

E 407 Carragenina; mistura complexa de polissacridos portadores de grupos sulfato na forma de sais
de clcio e magnsio, produzida por algas vermelhas (p. ex., Chondrus crispus e Gigartina stellata),
utilizada como emulsionante, espessante e gelificante.

E 407a Algas Eucheuma transformadas; com propriedades hidrocoloidais obtida a partir de algas
vermelhas da classe Rhodophyceae, Eucheuma cottonii ou E. spinosum, que para alm de carragenina,
pode conter at 15% de celulose insolvel; usado como espessante, gelificante e emulsionante.

A concentrao e a composio de carrageninas presentes nas algas varia entre espcies e


at mesmo entre as vrias partes da prpria planta. A estrutura geral das carrageninas
consiste numa cadeia linear de molculas de galactose e 3,6-anidrogalactose sulfatadas ou
no, associadas por ligaes glicosdicas -(1,3) e -(1,4). Os diferentes tipos deste
polissacrido diferem na proporo e posio dos grupos ster sulfato e na proporo de
3,6-anidrogalactose [93]. Os trs tipos utilizados na indstria alimentar so as kappa (),
iota () e lamba () carrageninas [94] (figura 2.14).

32
CAPTULO 2 REVISO BIBLIOGRFICA

Figura 2.14 Estruturas das carrageninas principais (adaptada da referncia 93). Mu e nu carrageninas
so precursores das kappa e iota, respetivamente, que so convertidas por modificao alcalina. As
lambda carrageninas ocorrem naturalmente e, na presena de uma base, so modificadas a theta
carrageninas. Estes tipos de carrageninas podem ser preparados na sua forma pura por mtodos de
extrao seletivos a partir de algas especficas.

Quantos mais grupos ster sulfato estiverem presentes, menor ser a temperatura de
solubilizao das carrageninas e mais fracos sero os gis formados, ou no haver sequer
a formao de um gel, como o caso da -carragenina, que apenas utilizada como
espessante [94].

No geral, as carrageninas so utilizadas para espessar, estabilizar e gelificar preparados.


Tm a particularidade de interagir com protenas, sendo muito utilizadas em produtos
lcteos. Nestes sistemas, existem micelas de casena que apresentam concentraes de
cargas positivas na sua periferia, isto atrai os grupos sulfato das carrageninas que
apresentam carga negativa. Formam-se ento complexos entre este hidrocolide e as
protenas do leite, levando estabilizao, espessamento ou gelificao do produto lcteo,
dependendo da concentrao de carrageninas utilizada [94].

As - e -carrageninas gelificam com o abaixamento da temperatura e na presena de


caties apropriados, ocorrendo um alinhamento dos polmeros em hlices que se podero
ligar entre si. As -carrageninas reagem com ies de clcio ou potssio, sendo que no
primeiro caso formam gis firmes e quebradios, contudo na presena de potssio
formam-se gis muito firmes mas elsticos. As -carrageninas gelificam na presena de
clcio, dando origem a gis fracos [94].

33
CAPTULO 2 REVISO BIBLIOGRFICA

As propriedades e modo de utilizao das carrageninas encontram-se apresentados no


Anexo I, b. As -carrageninas so geralmente utilizadas para sobremesas gelificadas
(como um substituinte da gelatina) e coberturas de bolos. Podero ser conjugadas com
outros hidrocolides como iota carrageninas, goma de alfarroba ou konjac, para se obter a
textura desejada. Este tipo de carragenina tambm utilizado em produtos crneos
enlatados para aumentar a suculncia do produto, facilitar o corte e proporcionar um
mouthfeel agradvel [93].

As propriedades reversveis dos gis de -carragenina so utilizadas para estabilizar


molhos com elementos em suspenso (ervas, por exemplo), bebidas de soja e de leite
esterilizado. Concentraes mais elevadas deste hidrocolide formam gis suaves,
adequados para molhos para carnes enlatadas [93].

Concentraes baixas de carragenina so usadas para estabilizar batidos, gelados, leite


com chocolate, e cremes pasteurizados e esterilizados, inibindo a separao dos
componentes (soro, gordura, chocolate), e controlando a textura e formao de cristais de
gelo, no caso dos gelados [92, 93]. As carrageninas so tambm utilizadas para a produo
de queijos processados, um tipo de queijo que apresenta uma boa estrutura, mas que
fcil de cortar e derrete facilmente [93].

As carrageninas do tipo kappa formam sinergia com goma de alfarroba, produzindo gis
muito firmes, coesos, extremamente elsticos e com excelente controlo de sinrese [93].
Esta mistura de hidrocolides foi utilizada neste trabalho sob a forma de um produto
denominado Elastic da marca Sosa (Espanha).

2.4.2.3 Goma de Alfarroba (E410)

A goma de alfarroba consiste essencialmente em galactomananas obtidas do endosperma


da semente de alfarroba, o fruto da alfarrobeira (Ceratonia siliqua). As galactomananas
que compem a goma de alfarroba so polissacridos de elevado peso molecular
compostos por duas unidades fundamentais: galactose e manose. A cadeia principal
composta por unidades de -D-manopiranose (manose) associadas por ligaes (14),
com cadeias laterais compostas por resduos de -D-galactopiranose (galactose) com
ligaes (16) [95] (figura 2.15).

34
CAPTULO 2 REVISO BIBLIOGRFICA

(16)-D-galactopiranose
(D-galactose)

(14)-D-manopiranose
(D-manose)

Figura 2.15 Estrutura geral de um segmento de galactomanana (adaptada da referncia 95). A


distribuio dos resduos de D-galactose podem ser aleatrios, em blocos e/ou ordenados.

A estrutura das galactomananas afeta as suas propriedades. Quanto menos resduos de


galactose estiverem presentes na cadeia principal, maior ser a sua flexibilidade, mas a
distribuio desigual das cadeias laterais vai comprometer a solubilidade, e as misturas
resultantes sero menos viscosas e os gis mais fracos [96].

As propriedades e modo de utilizao da goma de alfarroba encontram-se apresentados


no Anexo I, c. A goma de alfarroba muito utilizada em produtos congelados, como o
caso dos gelados, pela sua capacidade de reduzir o tamanho dos cristais de gelo formados,
conferindo uma textura agradvel ao produto final. Para alm disso, a matriz formada por
este hidrocolide fornece resistncia ao descongelamento sem deixar um mouthfeel muito
viscoso [96].

tambm usada como espessante e estabilizante em vrias bebidas, devido sua


estabilidade a uma gama alargada de pH. Em produtos de pastelaria melhora a textura
final e aumenta a viscosidade da massa, o que ajuda na reteno dos gases em massas
fermentadas, levando a um aumento do rendimento do produto. A goma de alfarroba
usada como agente ligante em massas sem glten, conferindo ao produto final uma
estrutura semelhante aos equivalentes com glten [95].

Em recheios de pastelaria, a presena de goma de alfarroba confere-lhes maior


estabilidade e evita que vertam para fora dos produtos durante o cozimento ou que
ensopem a massa que os rodeia [96].

35
CAPTULO 2 REVISO BIBLIOGRFICA

2.5 Tcnicas de Anlise Sensorial

A anlise sensorial uma disciplina cientfica cujo objetivo a caracterizao de um


produto atravs dos sentidos (viso, olfato, gosto, tato, e audio) de acordo com
metodologias que a tornem o mais objetiva possvel. As provas de anlise sensorial tm
uma grande importncia em estudos de aceitao do consumidor e no controlo de
qualidade de produtos alimentares, sendo uma ferramenta muito relevante na rea da
indstria alimentar [97].

As provas so realizadas por painis de provadores, podendo estes serem treinados ou


no, dependendo do objetivo pretendido [97]. Por exemplo, caso se pretenda testar a
reao do consumidor perante um dado produto alimentar, a prova ser feita com um
painel no treinado constitudo por potenciais consumidores do produto; por outro lado,
numa prova cujo objetivo o de avaliar e/ou enumerar as caractersticas de um dado
produto, conta-se com a participao de um painel treinado nesse mesmo produto.

Existem, ento, vrios tipos de mtodos de anlise sensorial: afetivos, de diferena ou


discriminativos, analticos ou descritivos, e de sensibilidade [97]. No presente trabalho
realizaram-se apenas testes afetivos.

Nas provas afetivas avalia-se a opinio subjetiva dos provadores em relao a um dado
produto, e so realizados entre consumidores habituais ou potenciais do produto testado
[97]. Dentro deste gnero de provas, existem vrios tipos de testes, os de preferncia, em
que o indivduo tem de identificar a sua amostra preferida ou orden-las por ordem de
preferncia; os de aceitao por escala hednica, em que o indivduo pontua o quo gosta
ou no de um dado produto; os de aceitao por escala do ideal (ou intensidade), em que
se avalia se o grau de intensidade de um dado atributo ou no aceitvel; e finalmente, os
testes de escala de atitude ou de inteno, em que o consumidor expressa a sua vontade
em consumir, adquirir ou comprar o produto em estudo [98].

Os restantes mtodos de anlise sensorial acima enunciados so mais objetivos que os


afetivos. Os testes discriminativos avaliam a existncia ou no de diferenas entre as
amostras analisadas e podem ser aplicados em controlo de qualidade, desenvolvimento de
novos produtos, e para testar a preciso e a confiabilidade dos provadores. Por outro lado,
os testes descritivos pretendem descrever e quantificar os atributos presentes no produto
avaliado; e os testes de sensibilidade servem para treinar um painel de provadores em
relao a estmulos olfativos ou gustativos [97].

36
3

CAPTULO
MATERIAIS E MTODOS

3.1 Obteno das Culturas de Kombucha

As culturas de kombucha foram fornecidas pelo Laboratrio de Bioenergtica Microbiana


(LBM) do Instituto Superior de Agronomia, da Universidade de Lisboa (ISA-UL), e por uma
produtora de kombucha caseira, de Braga. As culturas apresentavam-se na forma de
pelculas frescas imersas em kombucha j fermentada. As mes de kombucha do LBM
foram cultivadas em ch preto e encontravam-se armazenadas a 4C enquanto as de Braga
foram cultivadas em ch verde e foram transportadas e armazenadas temperatura
ambiente.

Foi obtido um total de sete conjuntos de culturas do LBM, que foram rotulados como K1,
K2, K3, K4, K5, K6 e K[vinagre]. A cultura originria de Braga foi denominada de KB.

3.2 Preparao da Base de Ch

A base de ch para a kombucha foi preparada com gua da torneira levada fervura,
qual foram adicionadas 2 saquetas de ch por cada litro de gua. O ch foi deixado em
infuso durante 10 minutos, tendo-se adicionado depois acar branco granulado numa
concentrao de 10% (p/v), enquanto o ch ainda estava quente. Aps a dissoluo do
acar, o ch adoado foi deixado a arrefecer, tapado, at atingir a temperatura ambiente
(entre 20 a 25 C).

37
CAPTULO 3 MATERIAIS E MTODOS

3.3 Seleo e Preparao do Inculo

Preparou-se ch preto (Yellow Label, Lipton) e ch verde (Dia) segundo o mtodo


descrito em 3.2. Dividiu-se em pores de 500 mL em recipientes de vidro estreis e
procedeu-se inoculao do ch com a respetiva cultura de kombucha e uma poro de
kombucha j fermentada (cerca de 15 mL).

Os recipientes foram tapados com gaze segura por elsticos. A fermentao decorreu
numa estufa a cerca de 28C durante 5 dias.

As bebidas resultantes desta fermentao foram selecionadas de acordo com as suas


caractersticas organolticas (aroma e sabor), tendo-se escolhido as que apresentavam
aroma e sabor mais agradveis.

3.4 Preparao de Kombucha

Prepararam-se ch preto e ch verde, e dividiram-se em vrios recipientes de vidro, uns


contendo uma nica cultura de kombucha e outros contendo uma mistura de duas
culturas.

Os chs foram inoculados com uma cultura de kombucha (pelcula), com cerca de 7 cm de
dimetro, e 10% (v/v) de kombucha j fermentada. No caso das misturas, usou-se metade
de cada pelcula, triturada, e 5% (v/v) de lquido fermentado de cada kombucha envolvida
na mistura.

Os recipientes foram tapados com gaze segura por elsticos. As preparaes foram
incubadas numa estufa a cerca de 28C durante 5 a 7 dias.

3.5 Meios de Cultura

Os meios de cultura usados no presente trabalho foram: meio de ch, consistindo na base
de ch preto (descrita acima) com 2% (p/v) de agar; meio Hestrin-Schramm (HS)
contendo 2% (p/v) de glucose, 0.5% (p/v) de peptona, 0.5% (p/v) de extrato de levedura,
0.27% (p/v) de Na2HPO4, 0.115% (p/v) de cido ctrico.H2O, a pH 5 [25], e com 1.5% (p/v)
de agar; meio GYC contendo 5% (p/v) de glucose, 1% (p/v) de extrato de levedura, 3%

38
CAPTULO 3 MATERIAIS E MTODOS

(p/v) de CaCO3, a pH 4.5, e com 2,5% (p/v) agar; meio MEA 2.5% (p/v) com 2% (p/v) de
agar; e meio YPD contendo 2% (p/v) de glucose, 2% (p/v) de peptona, 1% (p/v) de
extrato de levedura e 2% (p/v) de agar.

3.6 Isolamento de Microrganismos de Kombucha de Ch Preto

Foram retiradas amostras de kombucha e feitas vrias diluies, que foram depois
plaqueadas (em duplicado) em meio de ch, HS com 0.015% de cicloheximida, GYC, YPD
com 0.01% de tetraciclina e MEA. As placas foram incubadas em condies aerbias, a
temperaturas entre 25 a 28 C at se observar crescimento.

Observaram-se as placas preparadas e realizou-se a descrio macromorfolgica das


colnias obtidas. Selecionaram-se as colnias macromorfologicamente mais distintas e
procedeu-se sua observao microscpica.

As culturas foram mantidas regularmente em placas com meio YPD ou GYC consoante
correspondiam a leveduras ou bactrias, respetivamente.

3.7 Produo de Kombucha a partir de Isolados

Os microrganismos selecionados e isolados foram inoculados em 50 mL de meio YPD


lquido (glucose 2% [p/v], peptona 2% [p/v], extrato de levedura 1% [p/v]) e incubados
numa estufa com agitao (no caso das leveduras) ou sem agitao (no caso das bactrias),
a 28C durante 3 dias.

Aps esse tempo, mediu-se a absorvncia (ou densidade tica) das amostras a 600 nm e, a
partir desta informao, calculou-se o volume de suspenso a retirar. A quantidade de
suspenso microbiana utilizada para a inoculao dos chs foi calculada tendo como base
as seguintes razes:

= / (para as leveduras) [99]

= / (para as bactrias) [100]

Pretendeu-se obter uma concentrao final de 1105 clulas/mL tanto para as bactrias
[41] como para as leveduras [21].

39
CAPTULO 3 MATERIAIS E MTODOS

Os respetivos volumes de amostra foram colocados em eppendorfs que foram


centrifugados velocidade mxima (14 000 rpm) durante 1 minuto. Descartou-se o
sobrenadante e ressuspendeu-se o pellet em 1 mL de gua desmineralizada estril.

Foi preparada uma base de ch preto que foi dividida em recipientes de vidro contendo
200 mL de ch. Cada frasco foi inoculado com um microrganismo diferente ou com uma
mistura de microrganismos.

Os chs foram incubados numa estufa a 28C e foram acompanhados ao longo da sua
fermentao, durante 28 dias.

3.8 Tcnicas Moleculares de Identificao de Microrganismos

3.8.1 Extrao de DNA

3.8.1.1 Leveduras

Para a extrao de DNA, seguiu-se o mtodo descrito por Akada et al., 2000 [101].
Transferiu-se biomassa das culturas puras cultivadas em YPD, com o auxlio de um palito
estril, para eppendorfs contendo 20 L de uma soluo de SDS a 0.25% (p/v). Agitou-se
no vrtex durante 10 segundos, aqueceu-se num banho a 90C durante 3 minutos,
centrifugou-se a 14 800 rpm durante 30 segundos e recolheu-se o sobrenadante.

3.8.1.2 Bactrias Acticas

Para a extrao de DNA seguiu-se o mtodo de boiling adaptado de Millar et al., 2000
[102]. Transferiu-se biomassa das culturas puras cultivadas em GYC, com o auxlio de um
palito estril, para eppendorfs contendo 50 L de tampo TE (10 mM Tris-HC pH 8.0 com
1 mM EDTA). Incubaram-se as amostras num banho a 95C durante 15 minutos,
centrifugaram-se a 13 000 g durante outros 15 minutos e recolheu-se o sobrenadante.

40
CAPTULO 3 MATERIAIS E MTODOS

3.8.2 Amplificao de DNA

3.8.2.1 Leveduras

A amplificao do DNA extrado foi realizada por PCR, utilizando os primers ITS4 e ITS5
(ambos da STAB VIDA, Portugal) (tabela 3.1).

Tabela 3.1 Sequncias dos primers ITS4 e ITS5 (informao retirada dos documentos fornecidos pela
STAB VIDA, Portugal).

Primer Sentido Sequncia (5-3)

ITS4 Reverse TCCTCCGCTTATTGATATGC

ITS5 Forward GGAAGTAAAAGTCGTAACAAGG

A mistura utilizada para a reao foi a seguinte (tabela 3.2):

Tabela 3.2 Mistura reacional para PCR. 5 Phusion HF Buffer e Phusion


DNA Polymerase da Thermo Scientific (EUA); dNTPs NZYMix da NZYTech
(Portugal).

Volume (L)

5 Phusion HF Buffer 10

H2O mili-Q estril 35.8

Primer ITS4 10 M 1

Primer ITS5 10 M 1

dNTPs NZYMix 10 mM 1

Phusion DNA Polymerase (2 U/L) 0.2

DNA 1

Volume total 50

Utilizaram-se solues do DNA extrado em 3.8.1.1 puro e aps diluies de 10-1 e 10-2.

O PCR foi realizado num termociclador Mastercycler Personal (Eppendorf, Alemanha),


segundo o programa abaixo descrito (tabela 3.3):

41
CAPTULO 3 MATERIAIS E MTODOS

Tabela 3.3 Programa de PCR utilizado para as leveduras (primers ITS4 e ITS5).

Etapa Temperatura (C) Tempo (min) N de ciclos

Desnaturao inicial 95 7 1

Desnaturao 95 1

Annealing 52 1 40

Extenso 72 1

Extenso final 72 7 1

3.8.2.2 Bactrias Acticas

O protocolo de amplificao de DNA de bactrias acticas foi adaptado de Camilo, 2014


[103]. A amplificao do DNA extrado foi realizada com o auxlio de um PCR, utilizando os
primers Ac1 e Ac3 (ambos da STAB VIDA, Portugal) (tabela 3.4).

Tabela 3.4 Sequncias dos primers Ac1 e Ac3 (informao retirada dos documentos fornecidos pela STAB
VIDA, Portugal).

Primer Sentido Sequncia (5-3)

Ac1 Forward GCTGGCGGCATGCTTAACACAT

Ac3 Reverse AACCACATGCTCCACCGCTTG

A mistura utilizada para a reao foi a mesma descrita para as leveduras (tabela 3.2), mas
utilizando os primers acima mencionados.

Utilizaram-se solues do DNA extrado em 3.8.1.2 nas diluies 10-1 a 10-3. Optou-se no
utilizar a soluo 100 para prevenir eventual inibio da reao por produtos
contaminantes resultantes do protocolo de extrao de DNA.

A reao de amplificao PCR foi realizada num termociclador Mastercycler Personal


(Eppendorf, Alemanha), segundo o programa abaixo descrito (tabela 3.5):

42
CAPTULO 3 MATERIAIS E MTODOS

Tabela 3.5 Programa de PCR utilizado para as bactrias acticas (primers Ac1 e Ac3).

Etapa Temperatura (C) Tempo (min) N de ciclos

Desnaturao inicial 95 7 1

Desnaturao 95 1

Annealing 64 2 40

Extenso 72 2

Extenso final 72 10 1

3.8.3 Quantificao do Produto de PCR

O DNA amplificado por PCR foi quantificado atravs de eletroforese em gel de agarose
(2.5% [p/v] em TAE 1), ao qual foi adicionado 1 L de GreenSafe Premium (NZYTech,
Portugal) para cada 25 mL de tampo. Prepararam-se amostras com 1 L de loading buffer
com RNase para cada 5 L de produto de PCR. Utilizou-se como marcador de peso
molecular o NZYDNA Ladder I (NZYTech, Portugal).

Correu-se o gel a 80 V durante 60 minutos para os ensaios com leveduras, e 45 minutos


para os ensaios com bactrias acticas.

3.8.4 Sequenciao de DNA

O DNA amplificado foi sequenciado pela empresa STAB VIDA (Portugal), utilizando o
mtodo de Sanger. As sequncias foram analisadas com o auxlio da ferramenta BLAST
(NCBI, EUA) com as definies Search database Nucleotide collection (nr/nt) using Blastn
(Optimize for somewhat similar sequences).

3.9 Anlise Sensorial

As provas foram realizadas entre 34 indivduos escolhidos aleatoriamente, de ambos os


sexos (16 homens e 18 mulheres), entre os 18 e 76 anos (a maioria abaixo dos 35 anos),
aos quais no foi feito qualquer tipo de treino em relao avaliao sensorial de
kombucha. Foram analisadas duas amostras de kombucha, uma produzida no mbito
deste trabalho a partir da cultura K3, e outra pertencente a uma marca presente no

43
CAPTULO 3 MATERIAIS E MTODOS

mercado. As amostras foram servidas em copos de plstico transparentes (30 mL), a uma
temperatura de cerca de 6 a 10C [98], e com um volume de 20 mL.

As provas decorreram em ambientes informais (ex.: salas de aula) onde cada provador foi
sentado separadamente dos restantes e foi-lhes distribuda uma ficha de prova e as duas
amostras de kombucha codificadas com trs algarismos aleatrios (722 para a kombucha
produzida no mbito deste trabalho e 530 para a de compra). Os provadores tinham
tambm disponvel um copo com gua para limpar o paladar.

A ficha de prova foi composta por duas partes, uma em que foi pedido ao provador para
escolher a sua amostra preferida (ver Anexo II, a), e outra onde o objetivo foi a avaliao
hednica das caractersticas organolticas, da intensidade de atributos de aroma e sabor, e
da inteno de compra de cada uma das amostras (ver Anexo II, b).

Os atributos includos na ficha relativos ao aroma e ao sabor da kombucha foram


escolhidos tendo em conta as observaes feitas por provadores experientes que tinham j
participado em vrias provas informais realizadas ao longo deste trabalho.

3.10 Desenvolvimento de Novos Produtos Alimentares base de


Kombucha

3.10.1 Nata de Kombucha

A metodologia para a produo da nata de kombucha baseou-se em duas receitas, uma


para nata de coco [104] e outra para nata de kombucha [105]. Partiu-se de uma pelcula
de kombucha com cerca de 1 cm de grossura, cortou-se aos cubos de dimenses de cerca
de 1 cm, passou-se por gua fria para retirar o excesso de acidez, adicionou-se acar
branco granulado (em propores de do peso dos cubos, ou igual peso) e cozinhou-se
numa panela em lume brando durante cerca de 15 minutos. Os cubos (a nata de
kombucha) foram depois guardados em recipientes fechados, juntamente com a calda de
acar formada.

3.10.2 Filtrao de Kombucha

A kombucha utilizada nas preparaes seguintes foi filtrada a vcuo de modo a remover
todos os componentes em suspenso. Foram realizadas duas filtraes sucessivas, em que

44
CAPTULO 3 MATERIAIS E MTODOS

na primeira recorreu-se a papel de filtro qualitativo, da marca Whatman (GE Healthcare


Life Sciences, Reino Unido) de grau 1 (poros de 11 m); e na segunda foram utilizadas
membranas de nitrocelulose da Micron-Sep (GVS Life Sciences, EUA) com poros de 0.45
m.

3.10.3 Gis de Kombucha

Os gis de kombucha foram preparados com agar (Agar-Agar, Sosa, Espanha) e com uma
mistura de goma de alfarroba e carragenina (Elastic, Sosa, Espanha). Foram produzidos
gis com 50 mL de volume, com 0.25%, 0.5%, 0.75%, 1%, 1.5%, 2% e 3% de agar, e com
2.5%, 3%, 3.5%, 4%, 4.5%, 5% de Elastic (concentraes em %[p/v]). No caso dos gis de
agar, o p foi hidratado e aquecido at dissolver completamente numa poro de gua (ver
tabela 3.6), e depois perfez-se o volume de 50 mL com kombucha ligeiramente aquecida.
Para a preparao dos gis de Elastic, o p foi hidratado no volume total de kombucha e
aquecido at dissolver. Os gis foram colocados em placas de Petri e deixados arrefecer
temperatura ambiente at solidificarem.

Tabela 3.6 Composio dos gis de agar preparados.

% (p/v) de agar % (v/v) de gua adicionada


0.25 20
0.50 20
0.75 40
1 40
1.5 40
2 50
3 60

45
4

CAPTULO
RESULTADOS E DISCUSSO

4.1 Kombucha

4.1.1 Seleo e Misturas de Kombucha

As kombuchas que apresentaram aroma e sabor mais agradveis em ch verde (v) foram
as K2 e KB, e em ch preto (p) as K3 e KB. As bebidas foram avaliadas por um conjunto de
provadores treinados, sendo que as observaes gerais feitas em relao a cada kombucha
se encontram resumidas na seguinte tabela (tabela 4.1):

Tabela 4.1 Observaes relativas s kombuchas selecionadas.

Base de ch Cultura Observaes

K2 Aroma a mel; bom equilbrio cido/doce.


Ch verde
KB Aroma a ma; intensidade de aroma menor que K2.

K3 Aroma a mel e flores; nvel de acidez agradvel.


Ch preto
KB Nvel de acidez agradvel, mas o sabor muito doce.

K2(v) e K3(p) foram consideradas as melhores kombuchas, pelo que foram levadas para a
Noite Europeia dos Investigadores 2014 para o painel Diversidade na vinha, no vinho, e
nos micrbios dos nossos petiscos, desenvolvido pelo CBAA do ISA. No geral, a aceitao
do pblico foi muito positiva em relao a ambas as bebidas.

As kombuchas selecionadas (K2v, K3p, KBp e KBv) apresentaram um perfil de flavour


bastante distinto e, em vez de se proceder mistura dos lquidos para produzir uma
bebida com sabor e aroma mais complexos, decidiu-se misturar as culturas. Ambas as

47
CAPTULO 4 RESULTADOS E DISCUSSO

pelculas de kombucha de ch preto foram misturadas e inoculadas em ch preto e o


mesmo se procedeu com as pelculas de ch verde que foram inoculadas no ch
equivalente.

Esperava-se obter uma bebida com a soma das caractersticas de cada kombucha original,
contudo no foi o que se observou. A mistura em ch verde ficou menos agradvel em
termos de aroma e sabor, relativamente s kombuchas originais. Quanto mistura em ch
preto, apesar de no ter ficado como se esperava, apresentou sabor e aroma agradveis.

4.1.2 Isolamento de Microrganismos de Kombucha de Ch Preto

Foram retiradas amostras da kombucha de ch preto produzida a partir da mistura das


culturas K3p e KBp, que foram inoculadas nos vrios meios descritos em 3.5. HS e GYC so
utilizados para cultivar bactrias acticas [25, 106], enquanto YPD e MEA so utilizados
para leveduras, da ter-se optado por estes meios. De modo a inibir o crescimento dos
tipos de microrganismos no desejados e favorecer os microrganismos pretendidos, em
particular os de crescimento mais lento, ao meio HS foi ainda adicionado um antifngico
(cicloheximida) [107, 108] e ao meio YPD um antibacteriano (tetraciclina) [31].

Foram conseguidos um total de 44 isolados, dos quais foram selecionados 6 (4 leveduras e


2 bactrias) que aparentaram ser mais distintos macro e micromorfologicamente entre si
(ver Anexo III).

4.1.3 Kombucha Produzida a partir de Isolados

Aps o isolamento das leveduras e bactria actica nos meios seletivos, procedeu-se
inoculao das estirpes isoladas com vista a verificar se estas eram capazes de fermentar
ch, quer em associao quer isoladamente, produzindo uma bebida final similar
kombucha de onde tinham sido isoladas.

O primeiro ensaio realizado teve como objetivo principal verificar se a bactria actica
isolada formava pelcula celulsica no ch. Para tal inoculou-se um frasco de ch com os
quatro isolados de levedura e a bactria 1, e incubou-se nas mesmas condies usadas na
produo de kombucha. Como controlo, de forma a garantir que todos os isolados
apresentavam capacidade de se multiplicar no ch e verificar se a bactria 1 conseguia
produzir pelcula isoladamente, foram inoculados 5 frascos com cada isolado
individualmente e incubados nas mesmas condies.

48
CAPTULO 4 RESULTADOS E DISCUSSO

Todos os microrganismos apresentaram crescimento nos respetivos chs, evidenciado


pelo depsito formado no fundo dos recipientes. Ao fim de 7 dias j era possvel verificar
uma alterao no aroma do ch. Ao fim de 28 dias, a bactria 1 no formou pelcula nem no
meio YPD lquido, nem em nenhum dos chs em que estava presente. Conclui-se que esta
bactria no forma pelcula celulsica, pelo menos nestas condies.

Como a principal caracterstica das culturas de kombucha a pelcula de celulose


bacteriana, foi realizado um segundo ensaio desta vez com bactrias acticas
encomendadas da Coleo de Bactrias do Instituto Superior de Agronomia (CBISA). Estas
vieram cultivadas em meio GYC e foram as seguintes: Gluconobacter oxydans (CBISA
4270), Gluconacetobacter hansenii (CBISA 4276 e CBISA 4277) e Acetobacter aceti (CBISA
4417).

De acordo com estudos j realizados, algumas estirpes destas espcies de bactrias


produzem celulose [109, 110, 111]. Das estirpes encomendadas, apenas CBISA 4277
formou uma pelcula celulsica superfcie do meio YPD lquido.

No segundo ensaio, foi preparado um frasco de ch para cada microrganismo, outro com
todas as leveduras e CBISA 4277 inoculados em simultneo, e um ltimo frasco com todos
os microrganismos (tambm inoculados em simultneo). Todos os frascos apresentaram
crescimento, evidenciado pelo depsito formado no fundo dos recipientes. Ao fim de 5 dias
j era possvel verificar uma alterao no aroma do ch, mas ao fim de 28 dias nenhum dos
frascos contendo CBISA 4277 apresentava formao de pelcula celulsica superfcie.
possvel que esta estirpe no forme pelcula nestas condies. Desconhece-se a origem da
bactria, mas provvel que no esteja adaptada a este tipo de meio.

Sugere-se, num futuro ensaio, a inoculao do ch com a pelcula formada em YPD por
CBISA 4277, em adio suspenso celular; ou a utilizao de outras bactrias acticas
produtoras de celulose.

4.1.4 Identificao dos Microrganismos

4.1.4.1 Leveduras

A amplificao do DNA extrado das quatro leveduras isoladas produziu bandas no gel de
eletroforese com vrios tamanhos diferentes. O primeiro gel preparado apresentava
bandas muito tnues (fotografia no apresentada), portanto o produto de PCR das
amostras que produziram bandas (levedura 1 [10-1]; levedura 2 [100 e 10-1]; levedura 3

49
CAPTULO 4 RESULTADOS E DISCUSSO

[10-1]; e levedura 4 [100]) foi novamente amplificado e preparou-se um novo gel de


eletroforese (figura 4.1).

1 2 2.1 M C- 3 4

Figura 4.1 Perfil eletrofortico da


amplificao de DNA das leveduras isoladas.

1800
M NZYDNA Ladder I, com os respetivos
tamanhos assinalados (em pb);
1000
800
C- Controlo negativo;

600
1 Levedura 1 (10-1);
400
2 Levedura 2 (100);

200 2.1 Levedura 2 (10-1);

3 Levedura 3 (10-1);

4 Levedura 4 (100).

A amplificao obtida a partir de DNA genmico da levedura 2 apresentou um total de


quatro bandas de tamanhos diferentes nas duas diluies: duas bandas na diluio 100
(uma entre 400 e 600 pb, assinalada com a seta preta, e outra com cerca de 400 pb) e
outras duas na diluio 10-1 (uma banda com aproximadamente 800 pb e outra com cerca
de 400 pb), o que no era esperado. Procedeu-se separao das bandas destas amostras
atravs do seu corte do gel de eletroforese e o DNA nelas contido foi purificado atravs do
kit Wizard SV Gel and PCR Clean-Up System (Promega, EUA). As quatro amostras
resultantes, juntamente com as das restantes leveduras foram sequenciadas (STAB Vida,
Portugal) e os resultados possveis da identificao de cada uma encontram-se
apresentados na tabela 4.2. As sequncias resultantes encontram-
-se apresentadas em anexo (Anexo IV, a, b, c, d).

50
CAPTULO 4 RESULTADOS E DISCUSSO

Tabela 4.2 Resultados possveis da identificao das leveduras isoladas. Na linha


correspondente levedura 2, o primeiro conjunto de espcies corresponde diluio
100 e o segundo 10-1. Foram selecionados os resultados com menor valor esperado (E
value) valores no apresentados e com maior percentagem de identidade.

Levedura Espcie Identidade (%)

1 Candida californica 100

Candida californica (400-600 pb) 99


Metschnikowia sp. (400 pb) 98
2
Zygosaccharomyces rouxii (800 pb) 83
Metschnikowia pulcherrima (400 pb) 99

3 Candida californica 99
Metschnikowia bicuspidata var.
4 98
bicuspidata

Trs conjuntos de sequncias foram identificadas como Candida californica: as da levedura


1 e 3, e as da banda de maiores dimenses da diluio 100 da levedura 2. Como o poo no
gel de eletroforese desta amostra era adjacente ao da levedura 1, esta banda pode ter
surgido por passagem acidental de parte da amostra da levedura 1 para o poo contguo.

As sequncias correspondentes s bandas de 400 pb da amostra de levedura 2 foram


alinhadas (com o auxlio da ferramenta BLAST) e apresentaram uma identidade de 97%
(figura 4.2). Apesar de no ser possvel distinguir dois tipos de colnias diferentes,
macroscopicamente (ver Anexo III, b), a nvel microscpico possvel observar clulas
com diferentes morfologias, o que inicialmente se julgou dever a diferentes estdios de
desenvolvimento da levedura. Portanto possvel que na amostra da levedura 2
estivessem presentes duas leveduras diferentes: Zygosaccharomyces rouxii e
Metschnikowia pulcherrima.

51
CAPTULO 4 RESULTADOS E DISCUSSO

Score Expect Identities Gaps Strand


590 bits(654) 2e-173 343/352(97%) 1/352(0%) Plus/Plus

10^0 23 ATTAATATTGAAATTACACCCTTTTAGGCACAAACTCTAAATCTTAACCGTCAATAACAC 82
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
10^-1 23 ATTAATATTGAA-TTACACCCTTTTAGGCACAAACTCTAAATCTTAACCGTCAATAACTT 81

10^0 83 AATTAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAA 142


|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10^-1 82 TATCAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAA 141

10^0 143 TTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGC 202


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10^-1 142 TTGCGATACGTAATATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGC 201

10^0 203 CCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTT 262


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10^-1 202 CCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATATTTACTCTCAAACCTCCGGTTT 261

10^0 263 GGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCAGCCTTTTTCC 322


|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||
10^-1 262 GGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCATTCTTCTTCC 321

10^0 323 TCACCCTCGTAAGACTACCCGCTGAACTTAAGCATATCAAAAAGCGGAGGAA 374


|||||||||||||||||||||||||||||||||||||||| |||||||||||
10^-1 322 TCACCCTCGTAAGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA 373

Figura 4.2 Alinhamento entre as duas sequncias das bandas de 400 pb da amostra da levedura 2.
Foram alinhadas as sequncias produzidas a partir do primer ITS5 pois apresentavam menor nmero de
nucletidos no identificados (N). 10^0 e 10^-1 correspondem s respetivas diluies da amostra.

Quanto ao resultado da identificao da levedura 4, Metschnikowia bicuspidata var.


bicuspidata um parasita de artmias (Artemia salina) e encontra-se geralmente em
ambientes aquticos hipersalinos [112]. Como estas condies no se encontram em
kombucha, a sequncia correspondente ao gene de 18S rDNA desta levedura foi alinhada
com a sequncia desse mesmo gene de M. pulcherrima (mais plausvel de ocorrer em
kombucha) e obteve-se um resultado de 99% de identidade (figura 4.3), pelo que muito
provvel que a levedura 4 corresponda na realidade a esta ltima levedura.

52
CAPTULO 4 RESULTADOS E DISCUSSO

Score Expect Identities Gaps Strand


666 bits(738) 0.0 374/377(99%) 0/377(0%) Plus/Plus

Mpulc 1 TCCGTAGGTGAACCTGCGGAAGGATCATTAATATTGAAATTACACCCTTTTAGGCACAAA 60
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Mbicp 152 TCCGTAGGTGAACCTGCGGAAGGATCATTAATATTGAAATTACACACTTTTAGGCACAAA 211

Mpulc 61 CTCTAAATCTTAACCGTCAATAACTTTATCAAAAAACTTTCAACAACGGATCTCTTGGTT 120


||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Mbicp 212 CTCTAAATCTTAACCCTCAATAACTTTATCAAAAAACTTTCAACAACGGATCTCTTGGTT 271

Mpulc 121 CTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATATGACTTGCAGACGTGAATC 180


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mbicp 272 CTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATATGACTTGCAGACGTGAATC 331

Mpulc 181 ATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGC 240


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mbicp 332 ATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGC 391

Mpulc 241 GATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGA 300


||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mbicp 392 GATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGA 451

Mpulc 301 ATAAGTTTTAGCCCCATTCTTCTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAAGCA 360


||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Mbicp 452 ATAAGTTTTAGCCCCATTCTTTTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAAGCA 511

Mpulc 361 TATCAATAAGCGGAGGA 377


|||||||||||||||||
Mbicp 512 TATCAATAAGCGGAGGA 528

Figura 4.3 Alinhamento entre sequncias dos genes de 18S rDNA de M. pulcherrima (Mpulc) e M.
bicuspidata var. bicuspidata (Mbicp). Foram utilizados os seguintes nmeros de acesso do GenBank:
EU137672.1 e KP132407.1, respetivamente.

Das espcies isoladas, apenas Z. rouxii foi j descrita como presente em kombucha [15].
Apesar de a presena de C. californica e M. pulcherrima (forma anamrfica: Candida
pulcherrima) [113] ainda no ter sido reportada nesta bebida fermentada, estas leveduras
foram isoladas em vinhas [114], sendo que M. pulcherrima (presente tambm noutros
tipos de frutos) um agente de controlo biolgico natural, atuando contra alguns
microrganismos patognicos ou indesejveis, tais como Proteus vulgaris, Escherichia coli,
Candida albicans, C. parapsilosis, C. krusei, Trichosporon mucoides, Aspergillus flavus, A.
fumigatus, A. niger, Trichoderma spp., Paecilomyces spp, Bipolaris spp. [115], e leveduras
pertencentes aos gneros Brettanomyces/Dekkera, Hanseniaspora e Pichia, sendo que no
tem efeito no crescimento de Saccharomyces cerevisiae [116].

Jolly e colaboradores (2003a) produziram vinhos a partir de uvas Chenin blanc com uma
estirpe de S. cerevisiae industrial e combinaes desta levedura com duas estirpes
diferentes de C. pulcherrima. Os autores verificaram que estas estirpes tiveram uma

53
CAPTULO 4 RESULTADOS E DISCUSSO

influncia positiva na qualidade dos vinhos resultantes (em relao ao controlo), tendo
tambm recebido uma pontuao mais alta para o atributo goiaba na avaliao sensorial
do aroma dos vinhos e, em alguns dos casos, para o atributo frutado [117]. O papel das
leveduras no-Saccharomyces na produo de vinho tem sido estudado, de modo a avaliar
a sua influncia na evoluo da fermentao e no perfil do vinho resultante [118, 119].

Por outro lado, na produo de vinho de cereja, Sun e colaboradores (2014), verificaram
que a utilizao de S. cerevisiae em combinao com M. pulcherrima produzia uma bebida
com notas mais acentuadas de doce, verde e gorduroso, contribuindo positivamente
para a intensidade e complexidade do perfil aromtico do produto final [120]. Na
produo de vinho de manga, Sadineni et al. (2012), verificaram tambm que a utilizao
destas duas leveduras dava origem a uma bebida organolepticamente mais agradvel do
que aquela produzida apenas por S. cerevisiae, de acordo com a prova de anlise sensorial
realizada [121].

Estes estudos indicam que M. pulcherrima/C. pulcherrima, conjuntamente com S.


cerevisiae, produzem um conjunto de compostos aromticos que favorecem o flavour das
bebidas fermentadas em que esto presentes. Apesar de, neste trabalho, no ter sido
isolada S. cerevisiae, esta espcie descrita como presente na kombucha, portanto
provvel que estas duas leveduras sejam responsveis pela produo de alguns dos
compostos aromticos presentes nesta bebida.

4.1.4.2 Bactrias Acticas

Das duas bactrias isoladas, s se conseguiu extrair DNA da bactria 1, dado que a bactria
2 deixou de apresentar crescimento. A amplificao do DNA desta bactria produziu uma
banda com tamanho entre 800 e 1000 pb, no gel de eletroforese, tal como era esperado
[78] (figura 4.4):

54
CAPTULO 4 RESULTADOS E DISCUSSO

10-1 10-2 M C- 10-3

Figura 4.4 Perfil eletrofortico da amplificao de DNA


1800 da bactria 1.

1000
M NZYDNA Ladder I, com os respetivos tamanhos
800
assinalados (em pb);
600
400 C- Controlo negativo;

200 10-1, 10-2, 10-3 amostras nas respetivas diluies.

Os resultados da sequenciao do DNA da bactria 1 (Anexo IV, e) apontam para a


possibilidade de esta pertencer a uma das seguintes espcies com igual percentagem de
identidade (95%): Acetobacter papayae, A. peroxidans ou A. pasteurianus. Seria necessria
a realizao de mais ensaios de modo a confirmar a identidade desta bactria. Apesar de o
gene de 16S rDNA ser o mais utilizado para identificar bactrias, este no permite uma
distino precisa entre espcies de bactrias acticas, pelo que se sugere a amplificao e
sequenciao do gene da subunidade B da DNA girase (gyrB) com os primers descritos por
Huang e colaboradores (2014), pois este gene permite diferenciar estas trs espcies
referidas com maior resoluo [122].

Estas espcies de bactrias so muito prximas, sendo normalmente categorizadas no


grupo de Acetobacter pasteurianus, quando no possvel uma identificao mais precisa
[122, 123]. Bactrias deste grupo foram j isoladas de vinagres [123, 124], kombucha
[125] e frutos [126, 127].

4.1.5 Anlise Sensorial

Como a prova foi realizada entre um nmero reduzido de pessoas (o ideal seria entre 50 a
100 provadores [98]), s foram analisadas tendncias. As respostas obtidas esto
apresentadas no Anexo V.

Foi pedido aos provadores para realizarem uma avaliao hednica do aspeto, aroma e
sabor das kombuchas apresentadas. Para a anlise dos resultados obtidos, atribuiu-se uma

55
CAPTULO 4 RESULTADOS E DISCUSSO

pontuao a cada nvel da escala utilizada (1 Muito desagradvel; 2 Desagradvel; 3


Indiferente; 4 Agradvel; 5 Muito agradvel), em que o nmero de respostas de cada
nvel foi multiplicado pelo respetivo valor e foi feita a mdia de pontuao para cada
atributo. Os resultados encontram-se representados graficamente na figura 4.5.

Apesar de a literatura [98] referir que as escalas mais utilizadas para uma avaliao
hednica so as de 7 ou 9 termos, foram apenas utilizados 5 para tornar a prova mais
simples e a resposta mais rpida.

Aspeto
5

Sabor Aroma

722 530

Figura 4.5 Avaliao hednica das caractersticas organolticas das


kombuchas.

A partir da anlise do grfico, percebe-se que a kombucha 722 foi considerada mais
agradvel em relao aos atributos avaliados, comparativamente com a 530, que obteve
uma pontuao intermdia. Contudo, esta pontuao no se deve a um maior nmero de
respostas do nvel 3 (Indiferente), mas sim de um grande nmero de respostas nos
nveis 2 e 4 (Desagradvel e Agradvel, respetivamente), indiciando a separao do
painel de provadores em dois grupos.

Estes resultados esto de acordo com as respostas recolhidas em relao apreciao


global das bebidas. A kombucha 722 foi considerada Agradvel por 56% dos provadores,
enquanto a amostra 530 teve igual quantidade de respostas (35%) tanto no nvel
Desagradvel como no Agradvel.

A kombucha 722 teve uma pontuao mais baixa no aroma, em comparao com os
restantes atributos. Alguns provadores comentaram que o aroma desta bebida era

56
CAPTULO 4 RESULTADOS E DISCUSSO

desinteressante ou at desagradvel comparativamente ao da 530, que foi considerada


mais aromtica.

Na ficha de prova era tambm pedido aos provadores para avaliarem o aroma e o sabor de
ambas as kombuchas, tendo em conta a intensidade dos seguintes atributos:

Doce, frutado, floral, avinagrado e fermentado (para o aroma);


Doce, cido e presena de gs (para o sabor).

Para a anlise dos resultados obtidos, atribuiu-se uma pontuao a cada nvel da escala
utilizada (1 - No percetvel; 2 - Muito pouco [intenso]; 3 - Pouco; 4 Suficiente; 5 Muito;
6 Demasiado) e os dados foram tratados da mesma forma que os anteriores. Os
resultados encontram-se representados graficamente nas figuras 4.6 e 4.7.

Escolheu-se acrescentar o nvel No percetvel a esta escala de 5 pontos, pois havia a


possibilidade de um dos atributos no estar presente ou de os provadores no terem
capacidade para o detetar.

Doce
5
4
3
2
Fermentado Frutado
1
0

Avinagrado Floral

722 530

Figura 4.6 Intensidades dos diferentes atributos referentes ao aroma. Nota: a linha de
grelha referente ao nvel 6 (Demasiado) no se encontra representada pois os valores
mdios de cada atributo no chegaram a atingir esse nvel.

No geral, o aroma de ambas as amostras foi considerado pouco intenso, com a exceo do
atributo Avinagrado que foi considerado equilibrado, apesar de ter sido recolhido igual
nmero de respostas para os nveis Suficiente e Muito [intenso]. Os atributos Doce,
Frutado e Floral foram considerados menos intensos em 530 relativamente a 722,
apesar de esta primeira amostra ter sido apreciada como mais aromtica por alguns

57
CAPTULO 4 RESULTADOS E DISCUSSO

provadores (em observaes escritas). O atributo Fermentado foi considerado mais


intenso em 530 comparativamente a 722, o que era expectvel, dado que a primeira
bebida sofreu uma fermentao mais prolongada e, ao contrrio da 722, no foi clarificada
por centrifugao, pelo que provavelmente conteria maior nmero de microrganismos em
suspenso, que continuaram a fermentar a bebida mesmo depois de engarrafada.
importante referir que houve um nmero significativo (2 resposta mais pontuada) de
provadores que consideraram este atributo como no percetvel o que se pensa dever a
uma incompreenso do termo relativamente a esta prova, ou a uma incapacidade de
avaliar este atributo.

Doce
5

Gs cido

722 530

Figura 4.7 Intensidades dos diferentes atributos referentes ao sabor.

Relativamente ao sabor, a kombucha 722 foi considerada equilibrada em termos de


doura (com 68% de respostas do nvel 4 Suficiente), sendo que houve um nmero
igual de pessoas (15%) que acharam a amostra Muito e Pouco doce. A kombucha 530
foi considerada pouco doce pela maioria, apesar de 21% dos provadores achar a doura
desta amostra suficiente. Esta kombucha foi considerada mais cida e com mais gs que a
722, o que era esperado, devido s diferenas anteriormente referidas relativas no s ao
tempo de fermentao, como ao processo que sofreram (centrifugao) que poder levar
perda de gs.

Como a kombucha 722 no sofreu nenhuma fermentao depois de engarrafada e dado


que o gs perdido facilmente durante a preparao das amostras servidas, este era
praticamente inexistente nesta kombucha, ao contrrio da 530 que apresentava algum gs.
Ainda assim 24% dos provadores consideraram o gs nesta ltima amostra como no

58
CAPTULO 4 RESULTADOS E DISCUSSO

perceptvel, o que pode ser explicado pelas diferenas no tempo de realizao da prova
por parte de alguns provadores que, em alguns casos, foi muito longo o que pode ter
levado perda parcial do gs ou, como no caso anterior, possvel que algum gs se tenha
perdido durante a preparao das amostras para a realizao da prova.

A kombucha 722 foi avaliada como equilibrada tanto em acidez como doura, o que
explica a aceitabilidade desta amostra na avaliao hednica. Por outro lado, a kombucha
530 foi considerada pouco doce e muito cida o que, de acordo com os resultados
anteriores, demonstra que dentro dos provadores escolhidos existem pessoas que
apreciam bebidas com este perfil e outras que no.

Na prova pareada de preferncia, a amostra 722 foi a preferida pela maioria dos
provadores (85%), enquanto a 530 obteve 12% dos votos. A restante percentagem
corresponde a uma ficha que no foi devidamente preenchida (figura 4.8).

3%
12%

85%

722 530 Nulo

Figura 4.8 Resultado da prova pareada de


preferncia.

A preferncia da 722 contra a 530 est de acordo com os resultados apresentados


anteriormente. Alguns provadores comentaram que preferiram a primeira amostra por
ser mais doce que a restante, tendo havido algumas observaes a referir a kombucha 530
como sendo muito avinagrada. Comparando os resultados com o perfil dos provadores,
verificou-se que estes foram independentes da idade ou do sexo dos indivduos.

De acordo com o que foi at aqui apresentado, era esperada uma maior inteno de
compra da kombucha 722 do que da 530, o que foi efetivamente verificado (figura 4.9).

59
CAPTULO 4 RESULTADOS E DISCUSSO

18
16
14

N de respostas 12
10
8
6
4
2
0
De certeza que Provavelmente No sei se Provavelmente De certeza que
no compraria no compraria compraria compraria compraria

722 530

Figura 4.9 Inteno de compra das kombuchas apresentadas.

De acordo com as respostas recolhidas, a kombucha produzida no mbito deste trabalho


seria preferencialmente escolhida face kombucha existente no mercado apresentada
durante a prova, desde que os consumidores j tivessem tido uma experincia prvia de
ambos os produtos. Alguns provadores comentaram que gostariam de consumir a
kombucha 722 com gelo, o que uma boa sugesto de apresentao do produto.

Caso a kombucha 722 venha a ser comercializada, sugeria-se a sua colocao na zona dos
frios dos supermercados, no s para reduzir a fermentao dentro do recipiente, como
tambm para dispor aos consumidores uma bebida mais agradvel sensorialmente. Esta
de facto a zona onde se encontrava exposta a kombucha adquirida no mercado. Uma outra
alternativa que permitiria evitar os custos acrescidos que implica a colocao num
expositor refrigerado, seria a pasteurizao em garrafa (para evitar perdas de gs) e a
colocao da sugesto Deve consumir-se preferencialmente frio no rtulo da garrafa.

4.2 Novos Produtos Alimentares Obtidos a partir de Kombucha

4.2.1 Nata de Kombucha

A pelcula de kombucha foi conseguida a partir da cultura K1, que se desenvolveu em ch


preto aucarado at atingir a grossura pretendida. Depois de ter sido cortada em cubos
(figura 4.10), foi provada e entendeu-se que apresentava um sabor muito cido, pelo que
foi lavada at esse sabor se tornar menos intenso. A quantidade de acar adicionada
tambm foi ajustada at se considerar o produto final satisfatrio. Foi primeiro testada

60
CAPTULO 4 RESULTADOS E DISCUSSO

uma proporo de acar equivalente ao peso dos


cubos e achou-se o resultado final demasiado
doce, pelo que na segunda tentativa se utilizou
do peso dos cubos, o que resultou num produto
mais aceitvel. A nata produzida apresentava
uma cor acastanhada clara (dado que foi
produzida em ch preto), um sabor agridoce
forte, mas agradvel, e uma textura muito firme e
gelatinosa (caracterstica de um gel de celulose).

Figura 4.10 Pelcula de kombucha cortada A nata de kombucha foi apresentada no Pavilho
aos cubos.
do Conhecimento no mbito das apresentaes
finais da disciplina de Seminrios do Mestrado de Cincias Gastronmicas, em Junho de
2015 (poster no Anexo VI). Foi servida juntamente com a kombucha (bebida) e, no geral,
teve uma boa aceitao pela parte do pblico presente, apesar de apresentar uma textura
que geralmente no muito apreciada pelos ocidentais.

Pretendeu-se criar este produto como um paralelo nata de coco ou nata de pia dos
Filipinos, sendo as suas aplicaes semelhantes a estes produtos (figura 4.11). Poder ser
utilizada em bebidas e sobremesas, podendo aparecer em cadeias de gelados (ou outro
tipo de sobremesas) e/ou bebidas como um dos toppings possveis.

Esta tambm uma boa soluo (especialmente para produtores caseiros) para aproveitar
pelculas de kombucha excedentes que no seriam de outra forma utilizadas.

Figura 4.11 Alguns exemplos de aplicaes de nata de coco. ( esquerda) Milk tea com nata de coco
da Saints Alp Teahouse, em Nova Iorque (imagem retirada da referncia 128). ( direita) Gelado de
leite condensado com nata de coco do Spot Dessert Bar, em Nova Iorque (imagem retirada da
referncia 129).

61
CAPTULO 4 RESULTADOS E DISCUSSO

4.2.2 Gis de Kombucha

4.2.2.1 Gis com Agar

As concentraes de agar testadas correspondem quelas utilizadas nas aulas prticas de


Hidrocolides na Alimentao do Mestrado de Cincias Gastronmicas. Como estava
previsto, o gel produzido com a menor concentrao (0.25% [p/v] de agar) era muito
frgil e o com a maior concentrao era demasiado firme (3% [p/v] de agar). Na
preparao dos gis, hidratou-se o agar em gua e no diretamente em kombucha, pois o
pH da bebida era de cerca de 3, e este hidrocolide no forma gis com alimentos muito
cidos pois sofre hidrlise cida. Tentou-se usar o mnimo possvel de gua (apenas o
suficiente para dissolver completamente o agar) de modo a no diluir o sabor da
kombucha.

Quanto ao aspeto, este era mais agradvel nos gis mais fracos (nomeadamente nos de
0.25 e 0.50% [p/v] de agar), pois eram mais transparentes que os gis mais fortes que,
devido elevada concentrao de agar na mistura, apresentavam maior opacidade e no
eram to apelativos (figura 4.12).

Figura 4.12 Aspeto dos gis de agar. A fotografia foi tirada com um fundo escuro para se perceber a
transparncia dos gis.

62
CAPTULO 4 RESULTADOS E DISCUSSO

Os gis s foram provados at ao de 1.5%


(p/v) de agar, porque achou-se j a textura
deste gel demasiado firme e desagradvel,
pelo que no se sentiu necessidade de
provar os restantes. O gel de 0.25% (p/v)
de agar, apesar de ser o mais apelativo
visualmente e de ser o melhor em termos
de sabor, era demasiado frgil e
apresentava muita sinrese. O de 0.5%
(p/v) foi considerado o melhor do
conjunto, pois apresentava uma textura Figura 4.13 Gomas de kombucha com agar.

agradvel que se desfazia bem na boca, boa libertao de sabor e um aspeto visualmente
apelativo, apesar de apresentar alguma sinrese (mas em menor grau que o gel mais
fraco). O gel de 0.75% (p/v) apresentava um sabor mais fraco a kombucha, era mais frivel
e no apresentava sinrese. Esta concentrao poderia ser adequada para a aplicao em
gomas (figura 4.13), por exemplo, mas ter-se-ia de utilizar um preparado com um sabor
mais intenso e com acar adicionado, pois os gis resultantes ficaram muito pouco doces.
O gel de 1% (p/v) no apresentava praticamente qualquer sabor e era muito firme.

4.2.2.2 Gis com Elastic

A gama de concentraes testadas para o Elastic foram baseadas nas recomendaes do


rtulo do produto. Todos os gis apresentaram um aroma pouco intenso, possivelmente
devido ao facto de os preparados terem sido fervidos para dissolver o gelificante. Quanto
ao aspeto, todos apresentaram uma cor apelativa e transparente (figura 4.14), a textura
era tambm muito elstica e agradvel, e no apresentaram sinrese (a gua superfcie
do gel de 5% de Elastic na figura 4.14 deve-se a condensao). Quanto ao sabor, este
tornava-se mais fraco quanto maior fosse a concentrao de Elastic, e no geral era menos
doce do que a bebida original, pelo que se aconselha a acrescentar acar ao preparado
para se obter gis mais doces.

63
CAPTULO 4 RESULTADOS E DISCUSSO

Figura 4.14 Aspeto dos gis de Elastic. A fotografia foi tirada com um fundo claro
para se perceber a cor dos gis.

Quanto a aplicaes, determinou-se que a concentrao de 2.5% de Elastic muito boa


para gis de sobremesa (gelatinas), a de 3% indicada para vus (figura 4.15) e a de 5%
poder ser utilizada para a produo de gomas.

Figura 4.15 Vus de kombucha com Elastic.

64
5

CAPTULO
CONSIDERAES FINAIS E PERSPETIVAS FUTURAS
Apesar da antiguidade da kombucha, este produto no se encontra ainda to bem
caracterizado relativamente a outros produtos alimentares mais comuns. Contudo
esperado que, com a crescente popularidade desta bebida, se note um aumento nos
trabalhos de investigao em torno da kombucha. Este produto geralmente consumido
pelos seus alegados efeitos benficos e, de facto, esta bebida apresenta bastante potencial
de acordo com os estudos j realizados. Porm, os compostos ativos nela presentes e os
seus mecanismos de ao precisam ainda de ser caracterizados em modelos humanos.

Apesar de j terem sido realizados vrios estudos acerca deste produto fermentado, a
microbiota essencial da kombucha quase uma incgnita, sendo que necessrio ainda
compreender como os microrganismos interagem entre si, qual a sua proporo, o seu
papel e quais so fundamentais para o perfil de flavour desta bebida.

Neste trabalho foram identificados quatro microrganismos diferentes da kombucha


analisada, trs leveduras (Candida californica, Zygosaccharomyces rouxii e Metschnikowia
pulcherrima) e uma bactria actica do gnero Acetobacter. Esta bactria no formou
pelcula celulsica superfcie do ch e as bactrias acticas subsequentemente
encomendadas tambm no foram bem sucedidas nesta tarefa. Assim sendo, no foi
possvel a criao de um inculo que fosse capaz de produzir uma kombucha semelhante
quela resultante da mistura das culturas K3 (LBM, ISA-UL) e KB (Braga) em ch preto.

Embora no tenha sido realizada uma anlise detalhada do aroma da kombucha


produzida, quer por mtodos instrumentais, quer por mtodos sensoriais (com um painel
treinado), este seria um estudo interessante a realizar no seguimento do presente
trabalho. A anlise sensorial aqui realizada teve como alvo potenciais consumidores, pelo
que se estudou apenas a aceitao e preferncia dos produtos apresentados. Os resultados

65
CAPTULO 5 CONCLUSES FINAIS E PERSPETIVAS FUTURAS

demonstraram que o consumidor prefere uma bebida com um bom equilbrio em termos
de doura e acidez.

Esta bebida comercializada em alguns pases de diferentes formas. No s como uma


bebida funcional, mas tambm como um refrigerante. Em Portugal, a kombucha vendida
em estabelecimentos comerciais ditos biolgicos, e a bebida comercializada como um
alimento funcional. No existem muitas marcas disponveis no mercado, portanto um
campo a ser explorado. Contudo, existem j muitas pessoas em Portugal a produzir
kombucha a nvel caseiro e devido falta de informao disponvel na lngua portuguesa,
muitas vezes os indivduos recorrem s redes sociais para pedir informaes. ento
importante criar iniciativas em eventos abertos ao pblico geral onde haja a divulgao de
informao acerca deste produto de modo a, no s criar uma comunidade informada,
como tambm para dar a conhecer esta bebida que ainda to desconhecida no pas.

Para alm do consumo da kombucha como bebida, possvel a sua utilizao em outros
tipos de preparaes culinrias. A pelcula celulsica pode ser preparada e utilizada como
topping de bebidas e sobremesas na forma de nata de kombucha; o lquido fermentado
pode ser transformado em gel para ser consumido como uma sobremesa, e eventualmente
poder tambm ser utilizado para a elaborao de um sorbet de kombucha, entre outras
aplicaes. uma questo de tempo at este produto fermentado comear a ser usado de
forma corrente na rea da restaurao.

66
REFERNCIAS BIBLIOGRFICAS
[1] Ahmed S., Stepp J.R. 2013. Chapter 2 Green Tea: Plants, Processing, Manufacturing and
Production em V. Preedy (ed.), Tea in Health and Disease Prevention, pgs. 19-31. Academic
Press. ISBN: 9780123849373.

[2] Harbowy M.E., Balentine D.A. 1997. Tea Chemistry. Critical Reviews in Plant Sciences,
16(5): 415-80.

[3] McGee H. 2004. On Food and Cooking: The Science and Lore of the Kitchen, pgs. 435-41.
Scribner, Nova Iorque, EUA. ISBN: 1416556370.

[4] Weisburger J.H. 1997. Tea and health: a historical perspective. Cancer Letters, 114(1-2):
315-7.

[5] Chen M.-L. 2002. 1. Tea and Health An Overview em Y.-S. Zhen (ed.), Tea: Bioactivity and
Therapeutic Potential, pgs. 1-16, Taylor & Francis. ISBN: 0203301277 [ebook].

[6] Heiss M.L., Heiss R.J. 2007. The Story of Tea: A Cultural History and Drinking Guide. Ten
Speed Press, Nova Iorque, EUA. ISBN: 9781607741725 [ebook].

[7] Belitz H.-D., Grosch W., Schieberle P. 2009. Food Chemistry, 4 edio, pgs. 951-8.
Springer-Verlag, Berlin/Heidelberg, Alemanha. ISBN: 9783540699330.

[8] Wang H.-F., You X.-Q., Chen Z.-M. 2002. 5. The Chemistry of Tea Volatiles em Y.-S. Zhen
(ed.), Tea: Bioactivity and Therapeutic Potential, pgs. 89-120, Taylor & Francis. ISBN:
0203301277 [ebook].

[9] Dufresne C., Farnworth E. 2000. Tea, Kombucha, and health: a review. Food Research
International, 33(6): 409-21.

[10] Chen Z.-M. 2002. 8. The Effects of Tea on the Cardiovascular System em Y.-S. Zhen (ed.),
Tea: Bioactivity and Therapeutic Potential, pgs. 151-67, Taylor & Francis. ISBN:
0203301277 [ebook].

[11] Cheng S.-J. 2002. 10. Anticarcinogenic Activity of Tea em Y.-S. Zhen (ed.), Tea: Bioactivity
and Therapeutic Potential, pgs. 193-210, Taylor & Francis. ISBN: 0203301277 [ebook].

67
REFERNCIAS BIBLIOGRFICAS

[12] Zhen Y.-S. 2002. 11. Antitumor Activity of Tea Products em Y.-S. Zhen (ed.), Tea:
Bioactivity and Therapeutic Potential, pgs. 211-29, Taylor & Francis. ISBN: 0203301277
[ebook].

[13] Tao P.-Z. 2002. 9. Antimicrobial Activity of Tea Products em Y.-S. Zhen (ed.), Tea:
Bioactivity and Therapeutic Potential, pgs. 169-92, Taylor & Francis. ISBN: 0203301277
[ebook].

[14] Lacasse, D. 1995. Introduo Microbiologia Alimentar, traduzido por P. Seixas, pgs. 560-
1, Instituto Piaget, Lisboa, Portugal. ISBN: 9727711022.

[15] Jayabalan R., Malbaa R.V., Lonar E.S., Vitas J.S., Sathishkumar M. 2014. A Review on
Kombucha Tea Microbiology, Composition, Fermentation, Beneficial Effects, Toxicity, and
Tea Fungus. Comprehensive Reviews in Food Science and Food Safety, 13(4): 538-50.

[16] Kaufmann K. 2013. Kombucha Rediscovered: The Medicinal Benefits of an Ancient Healing
Tea. Books Alive, Tennessee, EUA. ISBN: 9780920470763 [ebook].

[17] Pedersen J.A. 2013. Kombucha: a tasty Symbiotic Culture of Bacteria and Yeasts em Nordic
Food Lab, http://nordicfoodlab.org/blog/2013/2/komboooucha [ltima consulta em
08/02/2016].

[18] Broome T. 2015. Kombucha: The Tea of Immortality em Fift Season Gardening,
http://fifthseasongardening.com/kombucha-the-tea-of-immortality [ltima consulta em
08/02/2016].

[19] Srinivasan R., Smolinske S., Greenbaum D. 1997. Probable Gastrointestinal Toxicity of
Kombucha Tea. Is This Beverage Healthy or Harmful? Journal of General Internal Medicine,
12(10): 643-4.

[20] Mayser P., Fromme S., Leitzmann C., Grnder K. 1995. The yeast spectrum of the tea
fungus Kombucha. Mycoses, 38(7-8): 289-95.

[21] Teoh A.L., Heard G., Cox J. 2004. Yeast ecology of Kombucha fermentation. International
Journal of Food Microbiology, 95(2): 119-26.

[22] Marsh A.J., OSullivan O., Hill C., Ross R.P., Cotter P.D. 2014. Sequence-based analysis of
the bacterial and fungal compositions of multiple kombucha (tea fungus) samples. Food

68
REFERNCIAS BIBLIOGRFICAS

Microbiology, 38: 171-8.

[23] Ramadani A.S., Abulreesh H.H. 2010. Isolation and Identification of Yeast Flora in Local
Kombucha Sample: Al Nabtah. Umm Al-Qura University Journal of Applied Sciences, 2(1):
42-51.

[24] Kurtzman C.P., Robnett C.J., Basehoar-Powers E. 2001. Zygosaccharomyces


kombuchaensis, a new ascosporogenous yeast from Kombucha tea. FEMS Yeast Research,
1(2): 133-8.

[25] Nguyen V.T., Flanagan B., Gidley M.J., Dykes G.A. 2008. Characterization of Cellulose
Production by a Gluconacetobacter xylinus Strain from Kombucha. Current Microbiology,
57(5): 449-53.

[26] Boesch C., Trek J., Sievers M., Teuber M. 1998. Acetobacter intermedius, sp. nov.
Systematic and Applied Microbiology, 21(2): 220-9.

[27] Dutta D., Gachhui R. 2006. Novel nitrogen-fixing Acetobacter nitrogenifigens sp. nov.,
isolated from Kombucha tea. International Journal of Systematic and Evolutionary
Microbiology, 56(8): 1899-903.

[28] Dutta D., Gachhui R. 2007. Nitrogen-fixing and celulose-producing Gluconacetobacter


kombuchae sp. nov., isolated from Kombucha tea. International Journal of Systematic and
Evolutionary Microbiology, 57(2): 353-7.

[29] Cabral S., Prista C., Loureiro-Dias M.C., Leandro M.J. 2015. Occurrence of FFZ genes in
yeasts and correlation with fructophilic behaviour. Microbiology, 161(10): 2008-18.

[30] Chen C., Liu B.Y. 2000. Changes in major components of tea fungus metabolites during
prolonged fermentation. Journal of Applied Microbiology, 89(5): 834-9.

[31] Sievers M., Lanini C., Weber A., Schuler-Schmid U., Teuber M. 1995. Microbiology and
Fermentation Balance in a Kombucha Beverage Obtained from a Tea Fungus Fermentation.
Systematic and Applied Microbiology, 18(4): 590-4.

[32] Jayabalan R., Marimuthu S., Swaminathan K. 2007. Changes in content of organic acids
and tea polyphenols during kombucha tea fermentation. Food Chemistry, 102(1): 392-8.

69
REFERNCIAS BIBLIOGRFICAS

[33] Blanc P.J. 1996. Characterization of the tea fungus metabolites. Biotechnology Letters,
18(2): 139-42.

[34] Malbaa R.V., Lonar E.S., Kolarov LJ. A. 2001. Sucrose and Inulin Balance During Tea
Fungus Fermentation. Romanian Biotechnological Letters, 7(1): 573-6.

[35] Jayabalan R., Malini K., Sathishkumar M., Swaminathan K., Yun S.-E. 2010. Biochemical
Characteristics of Tea Fungus Produced During Kombucha Fermentation. Food Science and
Biotechnology, 19(3): 843-7.

[36] Steinkraus K.H., Shapiro K.B., Hotchkiss J.H., Mortlock R.P. 1996. Investigations into the
Antibiotic Activity of Tea Fungus/Kombucha Beverage. Acta Biotechnologica, 16(2-3): 199-
205.

[37] Sreeramulu G., Zhu Y., Knol W. 2000. Kombucha Fermentation and Its Antimicrobial
Activity. Journal of Agricultural and Food Chemistry, 48(6): 2586-94.

[38] Battikh H., Chaieb K., Bakhrouf A., Ammar E. 2013. Antibacterial and Antifungal
Activities of Black and Green Kombucha Teas. Journal of Food Biochemistry, 37(2): 231-6.

[39] Chu S.-C., Chen C. 2006. Effects of origins and fermentation time on the antioxidant
activities of kombucha. Food Chemistry, 98(3): 502-7.

[40] Jayabalan R., Subathradevi P., Marimuthu S., Sathishkumar M., Swaminathan K. 2008.
Changes in free-radical scavenging ability of kombucha tea during fermentation. Food
Chemistry, 109(1): 227-34.

[41] Malbaa R.V., Lonar E.S., Vitas J.S., anadanovi-Brunet J.M. 2011. Influence of starter
cultures on the antioxidant activity of kombucha beverage. Food Chemistry, 127(4): 1727-
31.

[42] Murugesan G.S., Sathishkumar M., Jayabalan R., Binupriya A.R., Swaminathan K., Yun
S.E. 2009. Hepatoprotective and Curative Properties of Kombucha Tea Against Carbon
Tetrachloride-Induced Toxicity. Journal of Microbiology and Biotechnology, 19(4): 397-402.

[43] Bhattacharya S., Gachhui R., Sil P.C. 2011. Hepatoprotective properties of kombucha tea
against TBHP-induced oxidative stress via suppression of mitochondria dependent apoptosis.
Patophysiology, 18(3): 221-34.

70
REFERNCIAS BIBLIOGRFICAS

[44] Wang Y., Ji B., Wu W., Wang R., Yang Z., Zhang D., Tian W. 2013. Hepatoprotective effects
of kombucha tea: identification of functional strains and quantification of functional
components. Journal of the Science of Food and Agriculture, 94(2): 265-72.

[45] Jayabalan R., Chen P.-N., Hsieh Y.-S., Prabhakaran K., Pitchai P., Marimuthu S.,
Thangaraj P., Swaminathan K., Yun S.E. 2011. Effect of solvent fractions of kombucha tea
on viability and invasiveness of cancer cells Characterization of dimethyl 2-(2-hydroxy-2-
methoxypropylidine) malonate and vitexin. Indian Journal of Biotechnology, 10(1): 75-82.

[46] Srihari T., Arunkumar R., Arunakaran J., Satyanarayana U. 2013. Downregulation of
signaling molecules involved in angiogenesis of prostate cancer cell line (PC-3) by kombucha
(lyophilized). Biomedicine & Preventive Nutrition, 3(1): 53-8.

[47] Shenoy C. 2000. Hypoglycemic activity of bio-tea in mice. Indian Journal of Experimental
Biology, 38(3): 278-9.

[48] Hartmann A.M., Burleson L.E., Holmes A.K., Geist C.R. 2000. Effects of Chronic
Kombucha Ingestion on Open-field Behaviors, Longevity, Appetite Behaviors, and Organs ins
C57-BL/6 Mice: A Pilot Study. Nutrition, 16(9): 755-61.

[49] Yang Z.-W., Ji B.-P., Zhou F., Li B., Luo Y., Yang L., Li T. 2008. Hypocholesterolaemic and
antioxidant effects of kombucha tea in high-cholesterol fed mice. Journal of the Science of
Food and Agriculture, 89(1): 150-6.

[50] Kallel L., Desseaux V., Hamdi M., Stocker P., Ajandouz E.H. 2012. Insights into the
fermentation biochemistry of Kombucha teas and potential impacts of Kombucha drinking on
starch digestion. Food Research International, 49(1): 226-32.

[51] Kozyrovska N.O., Reva O.M., Goginyan V.B., de Vera J.-P. 2012. Kombucha microbiome as
a probiotic: a view from the perspective of post-genomics and synthetic ecology. Biopolymers
and Cell, 28(2): 103-13.

[52] Centers for Disease Control and Prevention. 1995. Unexplained Severe Illness Possibly
Associated with Consumption of Kombucha Tea -- Iowa, 1995. Morbidity and Mortality
Weekly Report, 44(48): 892-3, 899-900. Disponvel online em: http://www.cdc.gov/
mmwr/preview/mmwrhtml/00039742.htm [ltima consulta em 11/01/2016].

[53] Kole A.S.H., Jones H.D., Christensen R., Gladstein J. 2009. A Case of Kombucha Tea

71
REFERNCIAS BIBLIOGRFICAS

Toxicity. Journal of Intensive Care Medicine, 24(3): 205-7.

[54] Cvetkovi D.D., Markov S.L. 2002. Cultivation of Tea Fungus on Malt Extract Medium. Acta
Periodica Technologica, 2002(33): 117-26.

[55] Milanovi S.D., Lonar E.S., uri M.S., Malbaa R.V., Teki M.N., Ilii M.D., Durakovi
K.G. 2008. Low Energy Kombucha Fermented Milk-Based Beverages. Acta Periodica
Technologica, 2008(39): 37-46.

[56] Malbaa R.V., Milanovi S.D., Lonar E.S., Djuri M.S., Cari M.., Ilii M.D., Kolarov L.
2009. Milk-based beverages obtained by Kombucha application. Food Chemistry, 112(1):
178-84.

[57] Czaja W., Krystynowicz A., Bielecki S., Brown R.M. Jr. 2006. Microbial cellulose the
natural power to heal wounds. Biomaterials, 27(2): 145-51.

[58] STBX Studios. Nata De Coco Fondant Factory (Photography),


http://www.stbxstudios.com/nata-de-coco-fondant-factory/ [ltima consulta em
08/02/2016].

[59] Murugesan G.S., Sathishkumar M., Swaminathan K. 2006. Arsenic removal from
groundwater by pretreated waste tea fungal biomass. Bioresource Technology, 97(3): 483-
7.

[60] Mamisahebei S., Khaniki G.R.J., Torabian A., Nasseri S., Naddafi K. 2007. Removal of
Arsenic from an Aqueous Solution by Pretreated Waste Tea Fungal Biomass. Iranian Journal
of Environmental Health, Science and Engineering, 4(2): 85-92.

[61] iban M.B., Prodanovi J.M., Razmovski R.N. 2012. Biosorption of Copper(II) and
Chromium(VI) by Modified Tea Fungus. Acta Periodica Technologica, 2012(43): 335-42.

[62] Zhu C., Li F., Zhou X., Lin L., Zhang T. 2014. Kombucha-synthesized bacterial cellulose:
Preparation, characterization, and biocompatibility evaluation. Journal of Biomedical
Materials Research Part A, 102(5): 1548-57.

[63] Murugesan G.S., Sathishkumar M., Swaminathan K. 2005. Supplementation of waste tea
fungal biomass as a dietary ingredient for broiler chicks. Bioresource Technology, 96(16):
1743-8.

72
REFERNCIAS BIBLIOGRFICAS

[64] About Suzanne Lee em TED, http://www.ted.com/profiles/732127 [ltima consulta em


08/02/2016].

[65] Lee S. 2011. Grow your own clothes em TED, http://www.ted.com/talks/suzanne_lee_


grow_your_own_clothes [ltima consulta em 08/02/2016].

[66] British Science Association. 2012. Secret Scientist: Suzanne Lee em I, Science,
http://www.isciencemag.co.uk/features/suzanne-lee/ [ltima consulta em 08/02/2016].

[67] Kombucha em Google Trends, http://www.google.com/trends/explore#cmpt=q&geo&q=


kombucha [ltima consulta em 04/02/2016].

[68] Narula S.K. 2015. The American kombucha craze, in one home-brewed chart em Quartz,
http://qz.com/368513/the-american-kombucha-craze-in-one-home-brewed-chart/
[ltima consulta em 04/02/2016].

[69] Carr C. 2014. Kombucha cha-ching: A probiotic tea fizzes up strong growth em CNBC,
http://www.cnbc.com/2014/08/08/kombucha-cha-ching-a-probiotic-tea-fizzes-up-
strong- growth.html [ltima consulta em 04/02/2016].

[70] Health-Ade Kombucha. http://health-ade.com/ [ltima consulta em 04/02/2016].

[71] McLaughlin A. 2010. really.important. em Edible Perspective [blog],


http://www.edibleperspective.com/home/2010/5/13/reallyimportant.html [ltima
consulta em 04/02/2016].

[72] Live Soda Kombucha. http://livesodakombucha.com/ [ltima consulta em 04/02/2016].

[73] Reeds Inc. Reeds Culture Club Kombucha, http://reedsinc.com/product/reeds-culture-


club-kombucha-goji-ginger/ [ltima consulta em 04/02/2016].

[74] Sharp E. 2015. Australias first kombucha bar comes to Sydney! em Sporteluxe,
http://www.sporteluxe.com/australias-first-kombucha-bar-comes-to-sydney/ [ltima
consulta em 04/02/2016].

[75] Xat Kombucha. http://www.xatedrinks.com/kombucha/ [ltima consulta em

73
REFERNCIAS BIBLIOGRFICAS

04/02/2016].

[76] Pincus D.H., Orenga S., Chatellier S. 2007. Yeast identification past, present, and future
methods. Medical Mycology, 45(2): 97-121.

[77] Larena I., Salazar O., Gonzlez V., Julin M.C., Rubio V. 1999. Design of a primer for
ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. Journal
of Biotechnology, 75(2-3): 187-94.

[78] Poblet M., Rozs N., Guillamn J.M., Mas A. 2000. Identification of acetic acid bacteria by
restriction fragment length polymorphism analysis of a PCR-amplified fragment of the gene
coding for 16S rRNA. Letters in Applied Microbiology, 31(1): 63-7.

[79] Sambrook J., Russel W.D. 2001. Molecular Cloning: A Laboratory Manual Volume 2, 3
edio, pgs. 8.4-8.17, Cold Spring Harbor Laboratory Press, Nova Iorque, EUA. ISBN:
0879695765.

[80] Alberts B., Johnson A., Lewis J., Raff M., Roberts K., Walter P. 2008. Molecular Biology of
the Cell, 5 edio, pgs. 545, 548-550, Garland Science, Nova Iorque, EUA. ISBN:
9780815341055.

[81] Brown T.A. 2007. Genomes 3, 3 edio, pgs. 105-107, Garland Science Publishing, Nova
Iorque, EUA. ISBN: 0815341385.

[82] This H. 2009. Molecular Gastronomy, a Scientific Look at Cooking. Accounts of Chemical
Research, 42(5): 575-83.

[83] This H. 2006. Molecular Gastronomy: Exploring the Science of Flavor, traduzido por M.
DeBevoise, pgs. 1-2, Columbia University Press, Nova Iorque, EUA. ISBN: 023113312X.

[84] This H. 2002. Molecular Gastronomy. Angewandte Chemie International Edition, 41(1): 83-
8.

[85] Fuller G.W. 2011. New Food Product Development. From Concept to Marketplace, 3 edio,
pgs. 1-33, CRC Press, EUA. ISBN: 9781439818657 [ebook].

[86] Saha D., Bhattacharya S. 2010. Hydrocolloids as thickening and gelling agents in food: a

74
REFERNCIAS BIBLIOGRFICAS

critical review. Journal of Food Science and Technology, 47(6): 587-97.

[87] Autoridade de Segurana Alimentar e Econmica (ASAE). 2009. Lista de Aditivos


Alimentares, disponvel online em: http://www.asae.pt/ [ltima consulta em 16/02/2016].

[88] Agar Agar (Japanese isinglass, ceylon moss, kanten) em Molecular Recipes,
http://www.molecularrecipes.com/hydrocolloid-guide/agar-agar/ [ltima consulta em
16/02/2016].

[89] Imeson A. 2010. Captulo 3 Agar em A. Imeson (ed.), Food Stabilisers, Thickeners, and
Gelling Agents, 1 edio, pgs. 31-49, Blackwell Publishing. ISBN: 9781405132671.

[90] Armisn R., Galatas F. 2009. Captulo 4 Agar em G.O. Phillips e P.A. Williams (eds.),
Handbook of Hydrocolloids, 2 edio, pgs. 83-107, Woodhead Publishing Limited. ISBN:
9781845694142.

[91] Chaplin M. 2016. Agar em Water Structure and Science. Artigo disponvel online em:
http://www1.lsbu.ac.uk/water/agar.html [ltima consulta em 16/02/2016].

[92] Prajapati V.D., Maheriya P.M., Jani G.K., Solanki H.K. 2014. Carrageenan: A natural
seaweed polysaccharide and its applications. Carbohydrate Polymers, 105: 97-112.

[93] Blakemore W.R., Harpell A.R. 2010. Captulo 5 Carrageenan em A. Imeson (ed.), Food
Stabilisers, Thickeners, and Gelling Agents, 1 edio, pgs. 73-94, Blackwell Publishing.
ISBN: 9781405132671.

[94] Iota Carrageenan, Kappa Carrageenan and Lambda Carrageenan em Molecular Recipes,
http://www.molecularrecipes.com/hydrocolloid-guide/carrageenan/ [ltima consulta em
16/02/2016].

[95] Barak S., Mudgil D. 2014. Locust bean gum: Processing, properties and food applications
A review. International Journal of Biological Macromolecules, 66, 74-80.

[96] Locust Bean Gum (LBG, carob gum) em Molecular Recipes,


http://www.molecularrecipes.com/ hydrocolloid-guide/locust-bean-gum-lbg/ [ltima
consulta em 21/02/2016].

[97] Teixeira L.V. 2009. Anlise Sensorial na Indstria de Alimentos. Revista do Instituto de

75
REFERNCIAS BIBLIOGRFICAS

Laticnios Cndido Tostes, 366(64): 12-21.

[98] Instituto Adolfo Lutz. 2008. Mtodos fsico-qumicos para anlise de alimentos. O.
Zenebon, N.S. Pascuet, P. Tiglea (coordenadores), 4 edio / 1 edio digital, pgs. 281-
320, IAL, So Paulo, Brasil.

[99] Elbing K., Brent R. 2003. UNIT 1.2 Growth in Liquid Media em F.M. Ausubel, R. Brent, R.E.
Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhl (eds.), Current Protocols in
Molecular Biology, pg. 1.2.2, John Wiley & Sons Inc., Nova Jersey, EUA. ISBN: 047150338X.

[100] Treco D.A., Winston F. 2003. UNIT 13.2 Growth and Manipulation of Yeast em F.M.
Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, K. Struhl (eds.),
Current Protocols in Molecular Biology, pg. 13.2.1, John Wiley & Sons Inc., Nova Jersey,
EUA. ISBN: 047150338X.

[101] Akada R., Murakane T., Nishizawa Y. 2000. DNA extraction method for screening yeast
clones by PCR. BioTechniques, 28(4):668-70, 672, 674.

[102] Millar B.C., Jiru X., Moore J.E., Earle J.A.P. 2000. A simple and sensitive method to extract
bacterial, yeast and fungal DNA from blood culture material. Journal of Microbiological
Methods, 42(2):139-47.

[103] Camilo S.F. 2014. Origem e Disseminao dos Microrganismos do Vinho. Lisboa, ISA-UL
[Dissertao de Mestrado].

[104] Castro F., Sumague J., Villa D. How to Produce Nata de Coco. Technology and Livelihood
Resource Center. Documento disponvel online em: http://www.southpacificbiz.net/
library/docs/howto/How%20to%20Produce%20Nata%20de%20Coco.pdf [ltima
consulta em 22/02/2016].

[105] Katz S.E. 2012. The Art of Fermentation: An In-Depth Exploration of Essential Concepts and
Processes from Around the World, pgs. 962-6. Chelsea Green Publishing Co., Vermont, EUA.
ISBN: 9781603583640 [ebook].

[106] El-Salam S.S.A. 2012. 16S rRNA Gene Sequence Detection of Acetic Acid Bacteria Isolated
from Tea Kombucha. New York Science Journal, 5(3): 55-61.

[107] Raspor P., Goranovi D. 2008. Biotechnological Applications of Acetic Acid Bacteria.

76
REFERNCIAS BIBLIOGRFICAS

Critical Reviews in Biotechnology, 28(2): 101-24.

[108] Cycloheximide em Sigma-Aldrich, http://www.sigmaaldrich.com/catalog/product/


sigma/c7698 [ltima consulta em 26/02/2016].

[109] Jia S., Ou H., Chen G., Choi D.-B., Cho K.-A., Okabe M., Cha W.S. 2004. Cellulose
Production from Gluconobacter oxydans TQ-B2. Biotechnology and Bioprocess Engineering,
9 (3):166-170.

[110] Iyer P.R., Catchmark J., Brown N.R., Tien M. 2011. Biochemical localization of a protein
involved in synthesis of Gluconacetobacter hansenii cellulose. Cellulose, 18(3): 739-47.

[111] Dayal M.S., Goswami N., Sahai A., Jain V., Mathur G., Mathur A. 2013. Effect of media
components on cell growth and bacterial cellulose production from Acetobacter aceti MTCC
2623. Carbohydrate Polymers, 94(1): 12-6.

[112] Butinar L., Santos S., Spencer-Martins I., Oren A., Gunde-Cimerman N. 2005. Yeast
diversity in hypersaline habitats. FEMS Microbiology Letters, 244(2): 229-34.

[113] Jolly N.P., Augustyn O.P.H., Pretorius I.S. 2006. The Role and Use of Non-Saccharomyces
Yeasts in Wine Production. South African Journal of Enology and Viticulture, 27(1): 15-39.

[114] Zuehlke J.M., Glawe D.A., Edwards C.G. 2014. Efficacy of Dimethyl Dicarbonate Against
Yeasts Associated with Washington State Grapes and Wines. Journal of Food Processing and
Preservation, 39(6): 1016-26.

[115] Trkel S., Ener B. 2009. Isolation and Characterization of New Metschnikowia
pulcherrima Strains as Producers of the Antimicrobial Pigment Pulcherrimin. Zeitschrift fu r
Naturforschung C. Journal of Biosciences, 64(5-6): 405-10.

[116] Oro L., Ciani M., Comitini F. 2014. Antimicrobial activity of Metschnikowia pulcherrima on
wine yeasts. Journal of Applied Microbiology, 116(5): 1209-17.

[117] Jolly N.P., Augustyn O.P.H., Pretorius I.S. 2003a. The Use of Candida pulcherrima in
Combination with Saccharomyces cerevisiae for the Production of Chenin blanc Wine. South
African Journal of Enology and Viticulture, 24(2): 63-9.

[118] Jolly N.P., Augustyn O.P.H., Pretorius I.S. 2003b. The Effect of Non-Saccharomyces Yeasts

77
REFERNCIAS BIBLIOGRFICAS

on Fermentation and Wine Quality. South African Journal of Enology and Viticulture, 24(2):
55-62.

[119] Zott K., Thibon C., Bely M., Lonvaud-Funel A., Dubourdieu D., Masneuf-Pomarede I.
2011. The grape must non-Saccharomyces microbial community: Impact on volatile thiol
release. International Journal of Food Microbiology, 151(2): 210-5.

[120] Sun S.Y., Gong H.S., Jiang X.M., Zhao Y.P. 2014. Selected non-Saccharomyces wine yeasts in
controlled multistarter fermentations with Saccharomyces cerevisiae on alcoholic
fermentation behaviour and wine aroma of cherry wines. Food Microbiology, 44: 15-23.

[121] Sadieni V., Kondapalli N., Obulam V.S.R. 2012. Effect of co-fermentation with
Saccharomyces cerevisiae and Torulaspora delbrueckii or Metschnikowia pulcherrima on
the aroma and sensory properties of mango wine. Annals of Microbiology, 62(4): 1353-60.

[122] Huang C.-H., Chang M.-T., Huang L., Chu W.-S. 2014. The gyrase B gene as a molecular
marker to resolve interspecific relationships within the Acetobacter pasteurianus group and
a novel target for species-specific PCR. European Food Research and Technology, 238(1):
27-33.

[123] Gullo M., Caggia C., de Vero L., Giudici P. 2006. Characterization of acetic acid bacteria in
traditional balsamic vinegar. International Journal of Food Microbiology, 106(2): 209-12.

[124] Wu J.J., Gullo M., Chen F.S., Giudici P. 2010. Diversity of Acetobacter pasteurianus Strains
Isolated From Solid-State Fermentation of Cereal Vinegars. Current Microbiology, 60(4):
280-6.

[125] Liu C.-H., Hsu W.-H., Lee F.-L., Liao C.-C. 1996. The isolation and identification of microbes
from a fermented tea beverage, Haipao, an their interactions during Haipao fermentation.
Food Microbiology, 13(6): 407-15.

[126] Iino T., Suzuki R., Kosako Y., Ohkuma M., Komagata K., Uchimura T. 2012. Acetobacter
okinawensis sp. nov., Acetobacter papaya sp. nov., and Acetobacter persicus sp. nov.; novel
acetic acid bacteria isolated from stems of sugarcane, fruits, and a flower in Japan. The
Journal of General and Applied Microbiology, 58(3): 235-43.

[127] Pitiwittayakul N., Yukphan P., Sintuprapa W., Yamada Y., Theeragool G. 2014.

78
REFERNCIAS BIBLIOGRFICAS

Identification of acetic acid bacteria isolated in Thailand and assigned to the genus
Acetobacter by groEL gene sequence analysis. Annals of Microbiology, 65(3): 1557-64.

[128] Chan K.Y. 2011. Slurping Nata de Coco at Saint's Alp Teahouse, NYC em Serious Eats,
http://drinks.seriouseats.com/2011/06/nata-de-coco-saints-alp-teahouse-nyc.html
[ltima consulta em 26/02/2016].

[129] DiGregorio S. 2010. Spot's Condensed Milk Ice Cream with Nata de Coco em The Village
Voice, http://www.villagevoice.com/restaurants/spots-condensed-milk-ice-cream-with-
nata-de-coco-6578125 [ltima consulta em 26/02/2016].

[130] Moura J. 2011. Cozinha com Cincia e Arte. Bertrand Editora. ISBN: 9789722523622.

[131] Lersch M. (editor) 2014. Texture. A hydrocolloid recipe collection. Verso 3.0. Disponvel
online em: http://blog.khymos.org/recipe-collection/.

79
ANEXOS
ANEXOS

Anexo I Propriedades e Modo de Utilizao dos Hidrocolides


Apresentados

a) Agar (E406)

Propriedades

Forma gis com textura firme e quebradia [130].

Apresenta grande poder gelificante (muito superior ao da gelatina), portanto capaz de


formar gis a concentraes baixas [130].

insolvel em gua fria. So necessrias temperaturas superiores a 85C para se proceder


sua dissoluo [130].

Solidifica a temperaturas relativamente altas (35-45C) [130].

Os gis de agar so termorreversveis e s se liquefazem a temperaturas superiores a 85C,


pelo que possvel elaborar gis quentes [130].

Os gis podem ser fundidos e gelificados vrias vezes sem grandes alteraes nas suas
propriedades [89].

Como os gis no derretem temperatura corporal, a libertao de sabor fraca, pois os


compostos de sabor ficam aprisionados na matriz do gel [130].

A diferena entre a temperatura de gelificao e a de fuso dos gis muito grande. Este
aspeto designa-se por histerese [131].

No forma gis com alimentos muito cidos (pH < 4). O pH timo entre 4 e 10 [130]. A
valores de pH baixos, os polissacridos sofrem hidrlise cida e caso se conjugue a ao de
temperaturas altas, o processo acelerado [90].

No gelifica se for dissolvido directamente em meios alcolicos. O agar deve ser hidratado em
gua primeiro e s depois que pode adicionar a componente alcolica [130].

Os gis de agar no so to transparentes como os de gelatina. So ligeiramente opacos [88,


131].

Tambm pode ser utilizado como espessante [88].

geralmente vendido sob a forma de um p branco que pode ou no apresentar odor a algas.
Os gis formados so transparentes e inodoros, mas podero apresentar algum sabor.

82
ANEXOS

Modo de Utilizao [130]

Aquecer at ebulio, mexendo sempre, para garantir a boa dissoluo do agar.

Deixar o preparado arrefecer at solidificar.

No descartar as solues quentes de agar para o esgoto, elas podem solidificar nos canos e,
como s derretem a temperaturas muito elevadas, podem obstru-los. Para deitar solues de
agar fora, deix-las gelificar primeiro e depois coloc-las no lixo.

Concentraes (p/v) habituais de utilizao:


0.25 % propriedades espessantes;
0.5 % gis suaves;
1 % gis mdios;
2 % gis duros;
3 % gis muito duros.

b) Carrageninas (E407 e E407a)

Propriedades

Formam gis termorreversveis [94].

Solidificam a temperaturas altas, a cerca de 45C [94].

Gis formados com kappa carragenina so ligeiramente turvos, enquanto os gis formados
com iota so transparentes [94].

Apesar de formar gis muito firmes (exceto lambda), a libertao de sabores bastante boa
[94].

Preparados com lambda e iota aguentam ciclos de congelao-descongelao, enquanto


preparaes com kappa carragenina sofrem sinrese com a congelao [93, 94].

Gis formados com iota carragenina no sofrem sinrese [94].

As kappa carrageninas formam gis com propriedades pseudoplsticas, o que quer dizer que a
viscosidade diminui com o aumento da fora aplicada (ex.: aumento da agitao). Isto significa
que os gis slidos podem ser desfeitos numa misturadora, dando origem a gis fluidos [94].

Se uma mistura com iota carragenina for agitada, impede-se a formao do gel, mas se o
preparado for deixado em repouso, formar-se- um gel novamente [94].

Valores de pH timos entre 4 e 10. pouco estvel em misturas muito cidas e recomenda-se a
adio da componente cida depois da disperso e hidratao das carrageninas [94].

Iota insolvel em preparaes com elevadas concentraes de acar (50% [p/v]) e kappa
insolvel a concentraes elevadas de sais (10% [p/v]) [93].

83
ANEXOS

Iota e kappa podem ser usadas em esferificaes diretas e inversas com sais de clcio e
potssio, respetivamente [131].

Modo de Utilizao

Kappa e iota: Dispersar em gua fria com o auxlio de uma varinha mgica. Aquecer at
dissolver completamente [94, 130]. Deixar arrefecer para que o gel se forme. Se a
concentrao de ies clcio ou potssio for aumentada, formam-se gis mais fortes a
temperaturas mais elevadas e a concentraes mais baixas de carrageninas.

Lambda: Dissolve facilmente em lquidos frios, portanto basta ser adicionada soluo que se
pretende espessar [94].

Concentraes (p/v) habituais de utilizao das carrageninas [94]:


Kappa: 0.02 1.5 % para espessar; > 1.5 % para formar gis.
Iota: 0.02 1 % para espessar; 1 1.5 % para formar gis.

c) Goma de Alfarroba (E410)

Propriedades

Sabor neutro [130].

Espessante que forma solues viscosas e pseudoplsticas [96].

Estvel aps congelao-descongelao [96].

pH timo entre 4 e 7, mas apresenta boa estabilidade fora deste intervalo [96, 131].

Forma sinergias com outros hidrocolides como xantano e kappa carragenina, produzindo
gis elsticos que no sofrem sinrese [96].

84
ANEXOS

Modo de Utilizao

Dispersar em gua fria e aquecer at dissolver completamente [130].

A viscosidade das misturas aumenta medida que vo arrefecendo [96].

Concentraes (p/v) habituais de utilizao da goma de alfarroba: 0.1 a 1 % para a maior parte
das aplicaes [96].

85
ANEXOS

Anexo II Ficha de Prova da Anlise Sensorial

a) Parte I

Idade: _______ Sexo: M | F Data: ________________

Objetivo: Avaliao da preferncia entre duas amostras de kombucha (ch fermentado).

Cdigos das amostras apresentadas: ___________ ___________

Qual das amostras prefere? ___________

Observaes: _________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

86
ANEXOS

b) Parte II

Idade: _______ Sexo: M | F Data: ________________

Objetivo: Avaliao hednica e das caractersticas de cada uma das amostras de kombucha
(ch fermentado).

Amostra: ___________

Classifique cada um dos seguintes parmetros:


Muito Muito
Desagradvel Indiferente Agradvel
desagradvel agradvel
Aspeto

Aroma

Sabor

Apreciao
global

Classifique a intensidade de cada um dos atributos relacionados com o aroma:


No
Muito pouco Pouco Suficiente Muito Demasiado
percetvel
Doce
Frutado
Floral

Avinagrado

Fermentado

Classifique a intensidade de cada um dos atributos relacionados com o sabor:


No
Muito pouco Pouco Suficiente Muito Demasiado
percetvel
Doce
cido

Gs

Inteno de compra:
De certeza que Provavelmente No sei se Provavelmente De certeza que
no compraria no compraria compraria compraria compraria

Observaes: _________________________________________________________________
_____________________________________________________________________________
_____________________________________________________________________________

87
ANEXOS

Anexo III Observaes Macro e Microscpicas dos


Microrganismos Isolados

a) Levedura 1

Colnias com colorao creme, baas e opacas, com superfcie lisa, forma circular
irregular e elevao umbilicada, margem inteira e consistncia muito cremosa.

Fotografia captada de um microscpio tico, a uma ampliao de 1000.

88
ANEXOS

b) Levedura 2

Colnias com colorao branca, baas e opacas, com superfcie lisa, forma
circular e elevao umbilicada, margem inteira e consistncia cremosa.

Fotografia captada de um microscpio tico, a uma ampliao de 1000.

89
ANEXOS

c) Levedura 3

Colnias com colorao creme, baas e opacas, com superfcie lisa, forma
circular e margem inteira.

Fotografia captada de um microscpio tico, a uma ampliao de 1000.

90
ANEXOS

d) Levedura 4

Colnias com colorao branca, baas e opacas, com superfcie lisa, forma
circular e elevao convexa, margem inteira e consistncia muito viscosa.

Fotografia captada de um microscpio tico, a uma ampliao de 400.

91
ANEXOS

e) Bactria 1

Colnias com colorao esbranquiada, brilhantes e translcidas, com forma


circular, planas e com margem dentada.

Fotografia captada de um microscpio tico, a uma ampliao de 1000.

92
ANEXOS

f) Bactria 2

Colnias com colorao esbranquiada, brilhantes, ligeiramente opacas no


centro e mais translcidas nas bordas, com forma circular, planas e com
margem inteira.

Fotografia captada de um microscpio tico, a uma ampliao de 1000.

93
ANEXOS

Anexo IV Resultados das Sequenciaes de DNA Genmico dos


Microrganismos Isolados

a) Levedura 1

Com o primer ITS4


GGTTCTACCTGATCTGAGGTCGAGCTTGTTAATGTTCTCGGCGGCCAAGCGTCCTGTTTCTAGTTCGCTCAGCCCGCA
ACGTTTCTTTTCGGCGGGGCCAGCGGCCGGGCCATGTCTAACACTACGTGTTAAGAAGGAAACGACGCTCAGACAGGC
ATGCCCGCCGGAATACCGACGGGCGCAATGTGCGTTCAAGAACTCGATGATTCACGATGGCTGCAATTCACACTAGGT
ATCGCATTTCGCTGCGCTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTTTAAACTTTGTATGT
TTGAAGCTGGTATTATGGTTGATGTGTTTGTTGCGCCCACGTGTGTGGATGTTTATATCACAGTAATGATCCTTCCGC
AGGTTCACCTACGGAAACCTTGTTACGACTTTTACTTCCAAAATAAA

Com o primer ITS5


CTAAGGGGACTGCGGAGGACATTACTGTGATATAAACATCCACACACGTGGGCGCAACAAACACATCAACCATAATAC
CAGCTTCAAACATACAAAGTTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCG
AAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCC
GGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTAACACGTAGTGTTAGACATGGCCCGGCCGCTGGCCCCGCCGAA
AAGAAACGTTGCGGGCTGAGCGAACTAGAAACAGGACGCTTGGCCGCCGAGAACATTAACAAGCTCGACCTCAGATCA
GGTAGGAATACCCGCTGAACTTAAGCATATCATAAAGAGGGAGGAAAACCC

b) Levedura 2

Amostra 100, banda de 400-600 pb, com o primer ITS4


TTCTACCTGATCTGAGGTCGAGCTTGTTAATGTTCTCGGCGGCCAAGCGTCCTGTTTCTAGTTCGCTCAGCCCGCAAC
GTTTCTTTTCGGCGGGGCCAGCGGCCGGGCCATGTCTAACACTACGTGTTAAGAAGGAAACGACGCTCAGACAGGCAT
GCCCGCCGGAATACCGACGGGCGCAATGTGCGTTCAAGAACTCGATGATTCACGATGGCTGCAATTCACACTAGGTAT
CGCATTTCGCTGCGCTCTTCAACGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTTTAAACTTTGTATGTTT
GAAGCTGGTATTATGGTTGATGTGTTTGTTGCGCCCACGTGTGTGGATGTTTATATCACAGTAATGATCCTTCCGCAG
GTTCACCTACGGAAACCTTGTTACGATTTTTACTTCCACACTTGT

Amostra 100, banda de 400-600 pb, com o primer ITS5


NNNNNNNNNNNTNNNNNGCGNNANNNTCATTACTGTGATATAAACATCCACACACGTGGGCGCAACAAACACATCAAC
CATAATACCAGCTTCAAACATACAAAGTTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGA
GCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTC
GGTATTCCGGCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTAACACGTAGTGTTAGACATGGCCCGGCCGCTGGCC
CCGCCGAAAAGAAACGTTGCGGGCTGAGCGAACTAGAAACAGGACGCTTGGCCGCCGAGAACATTAACAAGCTCGACC
TCAGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Amostra 100, banda de 400 pb, com o primer ITS4


GGAATCTTACGAGGGTGAGGAAAGGCTGGGGCTAAAACTTATTCTAGCGCCGTTGATATTAGGCCGAAGCAGGACCAA
ACCGGAGGTTTGAGAGTAAATATCGCTCACCCACGCATGCCCTGGGGAATACCCCGGGGCGCAATGTGCGTTCAAAGA
TTCAATGATTCACGTCTGCAAGTCATATTACGTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATC
CGTTGTTGAAAGTTTTTTAATTGTGTTATTGACGGTTAAGATTTAGAGTTTGTGCCTAAAAGGGTGTAATTTCAATAT
TAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTACTTCCAAAACACGG

Amostra 100, banda de 400 pb, com o primer ITS5


NNNNNNNNNACTGCGGNNGATCATTAATATTGAAATTACACCCTTTTAGGCACAAACTCTAAATCTTAACCGTCAATA
ACACAATTAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAAT
ATGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGA
GCGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCA
GCCTTTTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAAGCATATCAAAAAGCGGAGGAAAA

94
ANEXOS

Amostra 10-1, banda de 800 pb, com o primer ITS4


NNNNNNNNGNNNNNTNNACGNGNNTGAGNNAGAATGGNGANTNNNCTTATGCTAGCGCTGCGAGATTCGGTTGAAGAA
GGAACCTCCGGCTTTCGCCGANAAGTATCAACCTCCTACGACTGTCGTGGGGAGGACCCTGGGGCGCTCCCCGGCCTC
AACCCTTCAGGGGTACTCGTCAGAGGGCCGCATGACTGGAAAGCATTGCCTCCCCTCTGGCCTCCCGTTTTCACGCAA
ACTCCCGAGTAGAGTAGTTTTTTGACCAAACGTAAAGTTTGAGAGGGAAATGACGCTCAAACAGGCATGCGCCCCGGA
ATACTTAGGGGCCCTTTGGGCGGTCCAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCAGTTCG
CTGCGTTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGAATATTTTGTTTTTAAAATTCATTTGA
CTGTGTTAATAGTATAATAAAAGATTGTTTGTGTTTACCTCTGGGAGAGCAGAACCCTCCCAAAGAGAACAAAAAAGT
AGAAACTCCAATGTGTGTATCAAAGGCGGAGGAGATTAAAAACAGCCGCGCAATTAAGCGCAGGCCTTCCCCTCCAAC
ACTTTGAGAGAACTCCGTTAAGAGTTCACGTCATTTTCTATAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGT
TACGACTTTTACTTCCNNAN

Amostra 10-1, banda de 800 pb, com o primer ITS5


NNNNNNNGNANNGCGGANACATTATTATNNNGNCGNNNCTCTTAGNNGAAACTCTAAATCTGNTGGAGGGTAACGTNA
GCGAAAAATTGCCCGGACGTTTTTCTCGCCTCCGCCTTTGATACACACCTTGGAGTTTTGACTTTTTTGTTCTCATTT
GNAGACGTCAATCATTGAATCTTTGAACGCACACTGCCCTTTAGGATACTCCCCACGCCATGCAAGGAATTTCGATAT
TTANTCTCAAACCTTTTCAATGGCGGAGCTCTTGGTTCACATCNCGGCGCTAACGCAAGTTTCTGCCCCATTCTTTGT
CCTTTGCCTCNTTCCGTGCATCGTCGAATCTTTGAACGCACATTGCGCCAGGAAGGTATTCCGGGGGGCATGCCTGTT
TGAGCGTCATTTCCCTCTCAAACTTTACGTTTGGTAGTGAGCGATACTCTACTCTGGAGTTTGCTTGAAAATGGGAGG
CCATAGGCGAAGCATTGCTTTCCAATCCTGCGGCCCTCTGCTTACTTCCCCTTGTGGGTTGTGGCAGGGGAAAGCGGG
AGGCGCCTTGCCACGATAGTCGTATTAGGTTTTACCGACTCGGCGAAAGTGAAGAGGTTTGCTTTTTAAAAAGAAGCA
GGCAGCGTCTGGCTTGACAAAATTCTCAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCA
ATAAGCGGAGGAA

Amostra 10-1, banda de 400 pb, com o primer ITS4


CNNNNNNNNNGCGNTANGANCATTAATATTGAATTACACCCTTTTAGGCACTAGCTCTAAATCTTAACCGTCAATAAC
TTTATCAAAAAACTTTCAACAACGGATCTCTTGGTTCTNCNNATCGATCAAGAACGCAGCGAATTGCGATACGTGATA
TGACTTGCAGACGTGAATCATTGAATCTTTGAACGNACATTGCGCCCCGGGGGGGTTCCCCCGGGNGGGGGGGGCAGA
AAAACCTTTCTCTAAAATTTTGTGGTGGGTTTTTNGGNNNNAAANNNNNNNNNNNCNANANNNNNNNAAATTNTTTTT
TTCCCCCCCNNNGGGCCCCCCNNNNCATTTTTAANNNGNGNGNNNNNNNNNNN

Amostra 10-1, banda de 400 pb, com o primer ITS5


CCNNNNNNNNNCNGCGGNGGANATTAATATTGAATTACACCCTTTTAGGCACAAACTCTAAATCTTAACCGTCAATAA
CTTTATCAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATA
TGACTTGCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAG
CGATATTTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCAT
TCTTCTTCCTCACCCTCGTAAGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

c) Levedura 3

Com o primer ITS4


NNNNNNNNNNNNCNNCCTGATCTGAGGTCGAGCTTGTTAATGTTCTCGGCGGCCAAGCGTCCTGTTTCTAGTTCGCTC
AGCCCGCAACGTTTCTTTTCGGCGGGGCCAGCGGCCGGGCCATGTCTAACACTACGTGTTAAGAAGGAAACGACGCTC
AGACAGGCATGCCCGCCGGAATACCGACGGGCGCAATGTGCGTTCAAGAACTCGATGATTCACGATGGCTGCAATTCA
CACTAGGTATCGCATTTCGCTGCGCTCTTCATCGATGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTTGTTTAAACT
TTGTATGTTTGAAGCTGGTATTATGGTTGATGTGTTTGTTGCGCCCACGTGTGTGGATGTTTATATCACAGTAATGAT
CCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATNTTTACTTNNNN

Com o primer ITS5


CTTAGGGACTGCGGAGGACATTACTGTGATATAAACATCCACACACGTGGGCGCAACAAACACATCAACCATAATACC
AGCTTCAAACATACAAAGTTTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGA
AATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCGTCGGTATTCCG
GCGGGCATGCCTGTCTGAGCGTCGTTTCCTTCTTAACACGTAGTGTTAGACATGGCCCGGCCGCTGGCCCCGCCGAAA
AGAAACGTTGCGGGCTGAGCGAACTAGAAACAGGACGCTTGGCCGCCGAGAACATTAACAAGCTCGACCTCAGATCAG
GTAGGAATACCCGCTGAACTTAAGCATATCAAAAGGCGGGAGGAAAACTCC

95
ANEXOS

d) Levedura 4

Com o primer ITS4


GGAGCCTTACGAGGGTGAGGAAAGATGGGGCTAAAACTTATTCTAGCGCCGTTGATATTAGGCCGAAGCAGGACCAAA
CCGGAGGTTTGAGAGTAAATATCGCTCACCCACGCATGCCCTGGGGAATACCCCGGGGCGCAATGTGCGTTCAAAGAT
TCAATGATTCACGTCTGCAAGTCATATTACGTATCGCAATTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATCC
GTTGTTGAAAGTTTTTTGATAGAGTTATTGACGGTTAAGATTTAGAGTTTGTGCCTAAAAGGGTGTAATTTCAATATT
AATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGATTTTTACTTCCAAACCCC

Com o primer ITS5


GGACTGCGGAGACATTAATATTGAAATTACACACCTTTTAGGCACAAACTCTAAATCTTAACCCTCAATAACTCATAT
TAAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAATATGACTT
GCAGACGTGAATCATTGAATCTTTGAACGCACATTGCGCCCCGGGGTATTCCCCAGGGCATGCGTGGGTGAGCGATAT
TTACTCTCAAACCTCCGGTTTGGTCCTGCTTCGGCCTAATATCAACGGCGCTAGAATAAGTTTTAGCCCCATTCTTCT
TCCTCACCCTCGTAAGACTACCCGCTGAACTTAAGCATATCATAAAGCGGAGGAAAAAAAAAATGGGG

e) Bactria 1

Com o primer AC1


TAGCCGGGGGGCGCGGGCGCAGTGACGGACGGGTGAGTAACGCGTAGGAATCTATCCATGGGTGGGGGATACATCCGG
AAACTGGTGCTAATACCGCATGATACCTGAGGGTCAAAGGCGCAAGTCGCCTGTGGAGGAGCCTGCGTTTCGATTACC
TACTTGGTGGGGTAAAGGCCTACCAGGCGATGATCGACAGCTGGTTTGAGAGGATTATCTGCCACACTGGACACTTAT
ACACGGCCCACACTCCTACCGGAGGCAGCCGTGGGGAATATTGTACAATGGTGGCAACCCTGATCCCGCAGTGCCGCG
TGTGTGAATAACGTCTTCCGATTGTAACGCACTTTCCACCGGTACCATCATGACAGTACCCGTAGAACAAGCCCCCGC
TAACTTCCTGCCACCAGCCGCGGTAATACTAAGGGGGCTAGCGTTGCTCGGACTGACTGGGCCTACCCGGCGTGTAGG
CCGTTTTGACCCTCAGACGTTAAATCCCCAGGCTTAACCTGCTGAGCTGCGGTTGCCACCTTTAGACTATATTGTGAG
ATACGGTTGTGCAATTCACTCTGTACAGGTGTAAATTTCTAGATGTGGCGAATAACACCCGTGGCGAAGGCGGCGATC
TTCCTCATTACTGACGCTTACGCGCGAAAGCATGGGGAGCAAACCAGGCTACATCCCCTGATACTCCCCTCTATAAAC
GATGTGTGATATATGTTCTGTAAATTATTTACTCCATCTTATAATTAACGCGTTGAGCGCCGCGGCCGGGGTAGTCCC
GCAGACAGGATTAAGACGCCCATACCATAGAAAAAGGCTCGAAAAATAATGGAAAAAAAATAAATAAAAAAACATTAA
CAGACAGACGAGCAGAGAATTTAGCGGTCTG

Com o primer AC3


GGGGGGGGGGGAAAGCCAAAGAAAAAACCTTGCGGCCGTACTCCCCAGGCGGTGTGCTTAACGCGTTAACTGCGACAC
TGAGTAACTAAGTTACCCAACATCTAGCACACATCGTTTACAGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCC
CCACGCTTTCGCGCCTCAGCGTCAGTAATGAGCCAGGTTGCCGCCTTCGCCACCGGTGTTCTTCCCAATATCTACAAA
TTTCACCTCTACACAGGGAATTCCACAACCCTCTCTCACACTCTAGTCTTAACGTCTCAAATGCAGCTCCCAGGTTAA
GCCCGGGGATTTCACATCTGACTGTCAAAACCGCCTACACGCCCTTTACGCCCAGTCATTCCGAGCAACGCAAGCCCC
CTTCGTATTACCGCGGCTGCTGGCACGAAGTTAGCCGGGGCTTCTTCTACGGGTACCGTCATCATCGTCCCCGTCGAA
AGTGCTTTACAATCCGAAGACCTTCTTCACACACGCGGCATTGCTGGATCAGGGTTGCCCCCATTGTACAATATTCCC
CACTGCGGCCTCCCAAATGAGTCTGGGCCGGGTCTCAGTCTCAGTGTGGCGGAAAATCCTCGCGGAGAAGGTAGCTAT
CTGCCCCTTTGTAGGCCTTTAGCCAAGCAACGAGGGGAACAAAACGGGCTCCTCCCGCGGGTGACTTCCCGCTTAGAA
CGGGGAGAGAGAGATTGTACACACACTATTTTATCACATTTACTATCCCACGGGACGCACCGCGGCGGAAACTTCAGT
CGAACAGCAGAAGTGAAGACGCCGCATACGCAGGCGAAAGTTGTAGTAGTTAACGAACATAGAAAAAAACCCTAAAAA
AAGACGGAAACCCCCCGG

96
ANEXOS

Anexo V Resultados da Prova de Anlise Sensorial

a) Amostra

Sexo Categorias N de indivduos


M F de idades M F Total
16 18 <21 4 0 4
Total 34 21-24 3 5 8
25-34 4 4 8
35-44 2 3 5
45-54 3 2 5
55-64 0 1 1
>=65 0 3 3

b) Resultados da Parte I Prova Pareada de Preferncia

Cdigo da N de
%
Amostra respostas
722 29 85,3
530 4 11,8
(nulo) 1 2,9
Total 34 100

c) Resultados da Parte II

Avaliao hednica das caractersticas organolticas das kombuchas


N de respostas
Muito Muito
Amostra 722 Desagradvel Indiferente Agradvel
desagradvel Agradvel
Aspeto 0 0 5 22 7
Aroma 0 9 13 7 5
Sabor 1 5 1 16 11
Global 1 3 4 19 7

N de respostas
Muito Muito
Amostra 530 Desagradvel Indiferente Agradvel
desagradvel Agradvel
Aspeto 0 1 8 23 2
Aroma 1 12 8 10 3
Sabor 2 18 4 9 1
Global 3 12 7 12 0

97
ANEXOS

Intensidades dos diferentes atributos referentes ao aroma

N de respostas
No Muito
Amostra 722 Pouco Suficiente Muito Demasiado (nulo)
perceptvel pouco
Doce 7 3 7 12 4 0 1
Frutado 4 6 7 13 3 0 1
Floral 6 9 10 4 3 1 1
Avinagrado 1 1 7 10 11 4 0
Fermentado 9 2 7 10 5 0 1

N de respostas
No Muito
Amostra 530 Pouco Suficiente Muito Demasiado (nulo)
perceptvel pouco
Doce 8 7 11 8 0 0 0
Frutado 7 5 14 5 2 0 1
Floral 9 6 9 8 1 0 1
Avinagrado 2 2 4 11 11 4 0
Fermentado 6 3 3 15 5 1 1

Intensidades dos diferentes atributos referentes ao sabor

N de respostas
No Muito
Amostra 722 Pouco Suficiente Muito Demasiado (nulo)
perceptvel pouco
Doce 0 1 5 23 5 0 0
cido 2 2 5 18 6 1 0
Gs 13 8 8 5 0 0 0

N de respostas
No Muito
Amostra 530 Pouco Suficiente Muito Demasiado (nulo)
perceptvel pouco
Doce 7 8 12 7 0 0 0
cido 0 0 0 16 13 5 0
Gs 8 3 7 13 2 0 1

98
ANEXOS

Inteno de compra das kombuchas apresentadas

N de respostas
Amostra De certeza que Provavelmente No sei se Provavelmente De certeza que
no compraria no compraria compraria compraria compraria
722 4 4 6 16 4
530 9 9 10 6 0

99
ANEXOS

Anexo VI Poster das Apresentaes do Mestrado de Cincias


Gastronmicas, Junho 2015

100
KOMBUCHA: CARACTERIZAO DA MICROBIOTA E DESENVOLVIMENTO DE NOVOS Mafalda Santos

2016
PRODUTOS ALIMENTARES PARA USO EM RESTAURAO