You are on page 1of 45

Practice Test 1 (1-50 questions

)
Question 1
James, a 3-week-old infant with ectrodactyly (a rare malformation of the hands and feet) is brought to you by his
parents, Steve and Sonya. James has one older sibling who has normal hands and feet. Although neither parent
has hand or foot abnormalities, members of Steve’s family are affected with ectrodactyly. A family history reveals
the following pedigree, where symbols representing individuals affected with ectrodactyly are shaded and
symbols representing individuals with no clinical symptoms are not shaded.
What mode of inheritance is most suggested by this pedigree?
A. Autosomal recessive with variable expressivity
B. X-linked dominant with reduced penetrance
C. Y-linked with evidence of allelic heterogeneity
D. Autosomal dominant with reduced penetrance
E. X-linked recessive with a high degree of pleiotropy
Question 2
The figure shown here displays the results of a DNA fragment analysis experiment involving marker D21S369.
Genotypes were obtained for four individuals. The size (in base pairs) of each identified fragment is found in the
box under each allele peak.
Which statement best describes the DNA sequence of D21S369?
A. D21S369 is a minisatellite
B. D21S369 is a monoallelic marker
C. D21S369 is a single nucleotide polymorphism (SNP)
D. D21S369 is a dinucleotide microsatellite repeat
This is an example of a dinucleotide repeat, with multiple alleles, each different from the other by a factor of two
nucleotides. It is amplified using the polymerase chain reaction (PCR) with DNA primers that flank the repeat unit
and the alleles are separated from one another by separation by capillary or gel electrophoresis (see Chapter 4).
Question 3
Which karyotype represents an individual with a balanced chromosome complement?
A. 69, XYY
B. 45, XX, der(14;21)(q10;q10)
C. 46, XX, del(4p)
D. 46, XY, +der(1)t(1;3)(p31;p21) –3
E. 46, XY, dup(12)(q11.2;q21.2)
This is the karyotype of an individual with a balanced Robertsonian translocation between the long arms of
chromosomes 14 and 21. This individual lacks one normal 14 and one normal 21 and has instead a long
chromosome composed of the q arms of both chromosomes (note that there are only 45 centromeres –
translocation of two acrocentric chromosomes results in the loss of one centromere). As the short arms of
acrocentric chromosomes are very small and contain no essential genetic material, their loss does not result in a
clinical phenotype. However, the offspring of these balanced individuals are at risk of inheriting missing or extra
parts of the involved chromosomes (see Chapter 18).
Question 4
Robin is affected by an autosomal dominant disorder inherited from her mother. She is married to Chad, who is
unaffected and has no history of the disorder in his family. Robin and Chad have two unaffected children. Studies
suggest that for every 100 individuals who inherit mutations in the gene of interest, only 50 actually show clinical
symptoms. The new mutation rate for this disorder is essentially zero. Based on this, what is the probability that

their next child will present with the clinical signs of the disease?
A. 3/4
B. 1/2
C. 1/4
D. 1/8
E. Virtually 0
We can assume that Robin carries one copy of the mutation. The probability that she passes the mutation to the
next pregnancy is 1/2 and the probability that a fetus with the mutation will express clinical symptoms is also 1/2.
Since these are independent events, they can be multiplied to obtain the answer of 1/4.
Question 5
An adoption study was initiated in an attempt to determine whether depression has a genetic basis or is due
strictly to environmental factors. Adults with depression who were adopted as infants were recruited into the
study as cases. The frequency of depression was compared between the biological and non-biological adoptive
relatives of the cases. If depression has a strong genetic component, what is the most likely finding of this study?
A. Depression rates are similar between the biological and non-biological relatives.
B. Depression rates are higher for the biological relatives.
C. Depression rates are higher for the non-biological relatives.
This addresses the question of whether a disease ‘runs in families’ because of shared genetic or environmental
factors. Adopted individuals share the genetic factors of their biological family, but the environmental factors of
their non-biological family. If depression is strongly influenced by genetic factors, there should be a higher
incidence of depression among the biological family (see Chapter 15).
Question 6
What is the inheritance pattern that best fits the disease shown in the pedigree shown here?
A. Autosomal recessive
B. Autosomal dominant
C. Sex-linked recessive
D. Sex-linked dominant
Notice individuals are affected in each generation – a hallmark of dominant disorders. In addition, there is no
male-to-male transmission, there are approximately twice as many affected females as males, and affected fathers
transmit the disease to all of their daughters – all of which suggest a sex-linked dominant disorder (see Chapter 7).
Question 7
Type 1 albinism is an autosomal recessive disorder that results from a mutation in tyrosinase, resulting in the lack
of pigmentation. John and Susan, who are married, are both healthy and not affected with type 1 albinism,
although John’s father was affected as was Susan’s maternal grandmother. Susan is pregnant. What is the
probability that this fetus will be affected with type 1 albinism?
A. 1/4
B. 1/8
C. 1/16
D. 1/24
E. 1/64
Individuals with autosomal recessive disorders have mutations in each copy of the causative gene. For a child of
John and Susan to have type 1 albinism, each parent must inherit one copy of the mutation and then pass it to the
child. John’s father had type 1 albinism so John inherited one copy of the tyrosinase mutation from him. There is a
1/2 chance he will pass this along to a child. We know Susan’s mother is an obligate carrier for type 1 albinism (she

had to inherit one of the two mutant copies from Susan’s grandmother, who was affected.) Subsequently, there is
a 1/4 chance Susan will pass along a tyrosinase mutation to a child – a 1/2 chance she received the mutation her
mother inherited from Susan’s grandmother multiplied by a 1/2 chance that she would pass along that mutation
to a child. So there is a 1/8 total chance the fetus will inherit two copies of the tryrosinase mutation (see Chapter
7).
Question 8
Suppose a research study shows that people who suffer from test anxiety are homozygous for a mutation in the
EXAM gene. Individuals without test anxiety have the following sequence at the very beginning of the translated
region of their EXAM genes:
5′-ATG ACG TTT GAA ATT CAG TCT AGA-3′
Met Thr Phe Glu Ile Gln Ser Arg
Affected individuals have the following sequence:
5′-ATG ACG TTT GAA ATT TAG TCT AGA-3′
Met Thr Phe Glu Ile STOP
The mutation identified among affected individuals is most likely an example of which of the following types?
A. Missense
B. Gain of function
C. Nonsense
D. Frameshif
E. Dominant negative
A nonsense mutation is a substitution that leads to the generation of one of the stop codons, resulting in
premature termination of the translation machinery (see Chapter 2).
Question 9
Ned and Stacey are the parents of Mark, a child affected with a fully penetrant, autosomal recessive disorder that
is easily diagnosed at birth, and occurs in the population with an incidence of 1/3600. Neither Ned nor Stacey has
this disorder themselves. Their next child, Tony, is born without any apparent signs of the disease. Tony grows up
and marries Maria, a woman with no known family history of the disorder. The chance that Tony and Maria’s first
child will be affected with the same disorder that affects Mark is closest to which of the following numbers?
A. 1/45
B. 1/120
C. 1/180
D. 1/240
E. 1/360
Three things must occur for Tony and Maria to have an affected child.
1. Tony must be a carrier for the disorder. As Tony doesn’t show any symptoms of the disorder (which is fully
penetrant), he does not carry both copies of the mutation. Subsequently, there are three equally likely remaining
genotype options for Tony – homozygous normal, heterozygous with the mutation received from his mother, or
heterozygous with the mutation received from his father. The overall probability that Tony is a carrier is therefore
2/3 (see Chapter 7).
2. Maria must also be a carrier. Because Maria has no family history of disorder, we assume her risk of being a
carrier is equivalent to the carrier frequency in the population. This can be deduced using Hardy-Weinberg
equilibrium (see Chapter 8). The incidence of this disorder in the population is 1/3600. As mentioned in the text
(p. 126), a rough estimate of the carrier frequency can be obtained by doubling the square root of the population
frequency – ≈ 2 × 1/60 = 1/30. This is the chance that Maria is a carrier.

3. Both Tony and Maria must pass their mutation on to a child. If both Tony and Maria are carriers, the chance
they would have an affected child is 1/4 (see Chapter 7).
To obtain the final probability for this problem, multiply the probabilities from all three events – 2/3 × 1/30 × 1/4 =
2/360 = 1/180.
Question 10
Anne is 16 weeks pregnant and undergoes maternal serum screening to test her maternal serum alpha fetoprotein
levels (MSAFP). Her MSAFP level is 4.5 multiples of the median (MoM). Assuming Anne is carrying a single fetus
and her pregnancy is correctly dated for gestational age, for which of the following disorders should Anne be
offered additional testing?
A. Trisomy 13
B. Pulmonary hypoplasia
C. Open spina bifida
D. Cystic fibrosis
E. Trisomy 21
Increased levels of MSAFP are associated with the presence of open neural tube defects, such as anencephaly. The
generally accepted cut-off level above which further investigation is offered is 2.5 MoM. This value detects
approximately 75% of screened open neural tube defects.
Question 11
Karen is a 39-year-old woman who gives birth to an infant girl with flexed and overlapping fingers, rocker-bottom
feet, low-set ears and a recessed jaw. Prenatal ultrasound had revealed the presence of large choroid plexus cysts
in the cerebral ventricles of the fetus, which did not spontaneously disappear. The infant dies afer 3 weeks.
Chromosome analysis of the infant is most likely to reveal which of the following karyotypes?
A. 45, XX, der(13;21)(q10:q10)
B. 47, XX, +18
C. 45, XO
D. 47, XX, +13
E. 46, XX, –4p
The above physical description is consistent with a diagnosis of trisomy 18. In addition, the presence of choroid
plexus cysts on ultrasound is a so-called ‘sof marker’ sometimes observed among trisomy 18 fetuses (see Chapter
18).
Question 12
For what purpose are prenatal screening tests best used?
A. To diagnose a suspected disease in a fetus
B. To diagnose a suspected disease in a parent
C. To obtain fetal cells for chromosome karyotyping
D. To identify individuals who should undergo diagnostic testing
E. To examine the DNA of a fetus for suspected mutations in a specific gene
Screening tests are not, in and of themselves, diagnostic. They are designed to separate most of the individuals
who are at an increased risk of being affected with a disease from those who are less likely to have the disease.
Confirmation of disease status requires a follow-up diagnostic test.
Question 13
Which of the following prenatal diagnostic techniques routinely allows fetal chromosomes to be analyzed during
the first trimester of pregnancy?
A. Cordocentesis

Chorionic villus sampling D. however. Locus heterogeneity E. Question 17 Elizabeth is a 25-year-old woman with color blindness. Length of DMD-encoded protein A premature stop codon will ofen lead to the expression of a truncated protein. Maternal triple testing Chorionic villus sampling is a first trimester diagnostic method for obtaining DNA for direct testing or chromosome analysis. It is routinely performed at 11–12 weeks’ gestation. Her father is also color blind. particularly if the mutation occurs near the 5′ end of the gene. Skewed X inactivation . an X-linked disorder. Note that in some cases. Question 14 Mark is affected with Duchenne muscular dystrophy. introducing a premature stop codon. Reduced penetrance B. Radiography E. Generally. while others have life-threatening tumors surrounding the spinal cord. preventing the formation of protein altogether (see Chapter 2). What is the likely cause of Elizabeth’s color blindness? A. The most likely consequence of this mutation is a reduction in which of the following? A. Mutation analysis in his family identifies a single base pair substitution in exon 1 of the DMD gene. mRNA transcripts containing premature stop codons are actually degraded by a process known as nonsense-mediated decay. Length of DMD DNA C. may present with café au lait spots and Lisch nodules. Homologous chromosomes segregate to opposite poles B. XY sex reversal B.B. DNA pairing is initiated. Sex-influenced expression Variable expressivity refers to the variation observed in clinical symptoms among individuals with an identical genetic disorder (see Chapter 7). Question 16 Which of the following processes occurs during meiosis II? A. align on the metaphase spindle and are separated (see Chapter 3). Amniocentesis C. Variable expressivity C. Some. Sister chromatids of the homologous chromosomes separate D. her medical history is unremarkable. allowing independent movement of homologous chromosomes During the second meiotic stage. leading to the formation of the synaptonemal complex E. sister chromatids. Digenic inheritance D. the shortened amino acid chain is unable to retain normal function. Aside from being color blind. Question 15 Nearly every individual affected with neurofibromatosis type 1 (NF1) exhibits clinical symptoms. There is no history of color blindness on her mother’s side of the family. Submetacentric and acrocentric chromosomes undergo recombination C. joined by cohesion proteins at their centromere. These represent an example of which of the following? A. Chiasmata are resolved. Amount of DMD DNA B. Length of DMD mRNA D. an X-linked recessive disorder.

15q11-12 D. 7q11 B. The incidence in the Ashkenasic Jewish population is 1/6400. 1/400 C. 4p C. FISH analysis of Steve’s chromosomes would likely identify an abnormality in which of the following chromosomal regions? A. which is the most likely diagnosis for John? A. Cellular analysis reveals the presence of a Barr body. Congenital adrenal hyperplasia E. Turner syndrome Klinefelter syndrome is due to the presence of an additional X chromosome in males. 1/6400 This answer can. At times however. Question 19 If an autosomal recessive disorder occurs in the US Ashkenasic Jewish population with an incidence of approximately 1/6400. Marfan syndrome B. In Elizabeth’s case. the chance that two people.C. 1/3200 E. Question 18 Steve is a 16-year-old male with clef palate. a rough estimate of the carrier frequency can be obtained by doubling the square root of the population frequency – ≈ 2 × 1/80 = 1/40. the inactivation pattern is highly unbalanced in favor of one chromosome. leaving the mutated copy active in most of her cells and resulting in the clinical phenotype (see Chapter 6). Question 20 John is a 32-year-old man. X inactivation occurs when the female embryo consists of around 5000 cells.2 E. Adults with Klinefelter . 17p11. part of the 22q11 syndrome (DiGeorge/Sedlackova/velocardiofacial syndrome) caused by a three megabase microdeletion at chromosome 22q11 (see Chapter 18). microcephaly. A testicular biopsy reveals an absence of germ cells in the seminiferous tubules. 1/80 B.2 The symptoms described are consistent with velocardiofacial syndrome. in part be determined by the use of the Hardy-Weinberg equilibrium equation. As mentioned in the text (p. small gonads and slight gynecomastia. 126). who presents with primary infertility. he is a tall and lanky individual with sparse body hair. Steve’s mother shows a similar constellation of features. Androgen insensitivity D. At this point. either of the two X chromosomes can be inactivated in any particular cell and the choice is generally random. conotruncal defects. randomly drawn from this population will both be carriers for the mutation is closest to which of the following? A. it is likely that the X chromosome carrying the normal gene for color vision is inactivated at a higher frequency. Turner syndrome Elizabeth is likely a manifesting heterozygote with skewed X inactivation. 1/1600 D. At 6′4″. Based upon this description. Klinefelter syndrome C. The likelihood that two individuals drawn from the population will both be carriers is then 1/40 × 1/40 = 1/1600 (see Chapter 8). 22q11. midface hypoplasia and moderate developmental delay.

Which of the following is the most likely diagnosis? . reflecting the presence of the additional X chromosome (see Chapter 18). she had three fractures. Sonic hedgehog (SHH) This patient likely has a mild form of osteogenesis imperfecta. During puberty D. Which of the following conditions best explains this constellation of characteristics? A. Question 24 A 9-month-old infant presents with poor feeding and lethargy. leading to a truncated or absent procollagen protein. Blue sclerae are ofen a hallmark of this syndrome (see Chapter 19). In early adulthood E.) are absent. at which time the infant began to miss milestones. leading to the absence of all female internal structures as well. Mutations in 5-alpha reductase C. Galactose-1-phosphate uridyl transferase (GALT) D. From birth to early childhood C. blocking the virilizing effects of testosterone. Fibrillin 1 (FBN1) E. epididymis. There are several subtypes of this disorder. Testes are present. an autosomal dominant collagen I disorder. fallopian tubes. Question 22 As a general rule. External genitalia appear as female. caused by the absence of functioning androgen receptors. uterus etc. ranging in severity. During uterine development B. On examination. Question 23 A 52-year-old woman comes into the clinic with her second broken bone in 15 months. but the vagina ends in a blind pouch (see Chapter 18). Blood analysis reveals normal circulating levels of testosterone and dihydrotestosterone. Mutation of the SRYgene This is a case of androgen insensitivity. During childhood. Cystathione beta synthase (CBS) C. Which of the following genes is likely to be mutated in this woman? A. Development was normal until 6 months of age. Collagen I pro-alpha1 (proα1(I)) B. Maternal androgen ingestion during pregnancy B.syndrome are slightly taller than average and all are infertile with small testes. all in different bones. male internal structures do not form. Afer the age of 40 Most metabolic disorders are identified during infancy or early childhood when the child’s body is first responsible for metabolizing the proteins obtained from formula or food (see Chapter 11). Magnetic resonance imaging reveals that testes are present. however. Mullerian inhibiting substance is produced. Individuals with these mutations ofen experience a small number of fractures in childhood and in later life (due to postmenopausal bone loss). the woman is noted to have blue-gray sclerae. Question 21 Karyotype analysis of an apparent female infant reveals that the baby is chromosomally male (46. Barr body analysis shows the presence of one Barr body. XY). Mild forms are usually due to nonsense mutations in the pro-alpha1 gene. Biochemical analysis of serum from the infant shows reduced levels of hexosaminidase A. but that male and female genital ducts (vas deferens. Lack of estrogen receptors E. but without the action of testosterone. Disabled androgen receptors D. when do patients with metabolic disorders first present with clinical abnormalities? A.

Collagen III pro-alpha2 D. There is a 50% chance Susan will pass the normal X chromosome to her son and a 50% chance she will pass the X chromosome that carries the mutation in . Wilson’s disease B. High gene transfer rates. Glucosylceramide beta glucosidase C.9 kb) neurotrophic gene is packaged into a vehicle and inserted directly into the nondividing cells of the hippocampus. A modified retrovirus A modified adeno-associated virus can accommodate inserts of up to 5 kb in size. 2/3 D. so his hemophilia status is actually irrelevant. The probability that Fred and Susan’s new son will have hemophilia A is closest to which of the following? A. DNA packaged in a liposome E. A small (4. who also has hemophilia A. Tay-Sachs disease Reduced or absent levels of hexosaminidase A is a hallmark of Tay-Sachs disease. Lesch-Nyhan syndrome E. caused by mutations in the gene for clotting factor VIII. and is able to infect nondividing cells without stimulating host immune responses.A. leading to progressive mental impairment and ultimately death (see Chapter 11). 1/2 E. Fred passes his Y chromosome to the fetus. characterized by rhizomelia. which is a disorder of lipid storage. Hurler syndrome D. is married to Fred. John carries this mutation on his X chromosome and passes it to Susan. Susan. Susan and Fred are expecting their first child. Question 27 John is a 42-year-old man with hemophilia A. Which of the following delivery vehicles would be the most likely candidate? A. and ultrasound demonstrates the fetus is a boy. megalencephaly and spinal cord compression (see Chapter 6). Sandhoff disease C. John’s daughter. 3/4 C. long-term integration and lasting stable gene expression are the goals of the protocol and the investigators wish to avoid eliciting any immune response. 1/4 Hemophilia A is an X-linked recessive disorder. Question 25 Mutations in which of the following genes inhibit chondrocyte proliferation within the long bones leading to rhizomelia and achondroplasia? A. Question 26 A patient undergoes gene therapy as part of a clinical trial for Alzheimer’s disease. 1 B. who is a carrier for hemophilia. A modified adeno-associated virus B. liver and spleen. Fibroblast growth factor receptor 3 (FGFR3) E. integrates stably at a specific site on chromosome 19. Paired box gene 3 (PAX3) Mutations in the FGFR3 gene is responsible for achondroplasia. The failure to degrade sphingolipid results in its gradual accumulation in the brain. 21-hydroxylase B. A modified herpes virus C. A modified adenovirus D.

If this occurs through two somatic mutations in the same cell. leading to the tumor. Many genes in this region are imprinted. leading to a fixed maternal imprint pattern This girl has Prader-Willi syndrome. A CTG expansion in the 3′ untranslated region of the dystrophia myotonica protein kinase (DMPK) gene C. Both copies of the gene must be mutated for tumor development to occur. In families in whom this form of retinoblastoma occurs. first noted at age 4 years in the lower limbs has progressed with increasing age. The second copy of the gene is somatically mutated. poor suck reflex and a failure to thrive. A mutation in the imprinting center of 15q11-q13. Which of the following best describes the most likely etiology of this case? A. Disomy of chromosome 15 in the sperm. Examination reveals calf pseudohypertrophy. At birth. The second mutation may occur in several of the retinoblasts. Question 30 What change(s) in the retinoblastoma (Rb) gene are required for the formation of bilateral retinoblastomas in a young child? A. Question 29 A girl is identified with short stature. she developed extreme hyperphagia and food seeking behavior. sporadic retinoblastoma (a single tumor in one eye) develops. leading to hemophilia (see Chapter 19). Loss of function of both copies of the Rb gene due to inherited and somatic mutations Retinoblastoma is the classic example of a tumor suppressor. the . meaning there is differential expression depending on whether the region is inherited from the father or the mother. small hands and feet. Question 28 A 13-year-old boy is brought for examination. and a learning disability. resulting in multiple tumors in both eyes. an X-linked recessive disorder. Somatic occurrence of a single mutation in one Rb allele in an otherwise genetically normal cell B. Loss of function of one copy of the Rb gene due to an inherited mutation E. A deletion of the maternal copy of 15q11-q13 C. Bilateral retinoblastoma generally occurs as an inherited disorder. Somatic occurrence of mutations in both Rb alleles in an otherwise genetically normal cell C. An out-of-frame deletion in the dystrophin gene D. in which one mutated copy. she exhibited hypotonia. Which of the following options represents the most likely genetic cause of these physical features? A. Amplification of both copies of Rb in an otherwise genetically normal cell D.the factor VIII gene. A deletion of the 15q11-q13 region on the paternally-inherited chromosome E. Absence of the paternal copy of these genes leads to Prader-Willi syndrome. leaving him wheelchair bound. obesity. Two-thirds of individuals affected with DMD have a deletion in the dystrophin gene. An in-frame deletion in the neuronal apoptosis inhibitory protein (NAIP) gene This boy likely has Duchenne muscular dystrophy (DMD). is present in all retinoblasts of the individual. Paternal uniparental disomy for chromosome 15 D. A duplication of the peripheral myelin protein-22 gene (PMP22) B. Slight muscle weakness. The most common cause of Prader-Willi syndrome is a deletion of 15q11-q13 on the chromosome inherited from the father (see Chapter 7). At the age of 3. which alters the translational reading frame (see Chapter 19). leading to the marked obesity. a developmental disorder caused by loss of gene expression from the paternally-derived copy of chromosome 15q11-q13. followed by loss of the maternal copy of chromosome 15 in the early embryo B. passed from generation to generation. while absence of a gene in this region from the maternal copy leads to Angelman syndrome. A missense mutation in the neurofibromin gene E.

A splice-site mutation near the 5′ end of the DMPK gene B. which is an autosomal dominant myopathy. Hereditary non-polyposis colorectal cancer (HNPCC) HNPCC is an autosomal dominant form of colorectal cancer. although at the cellular level. Cowden disease D. leading to an increased risk of malignancy due to unrepaired errors in oncogenes or tumor suppressors. The recurrence risk for disease X is highest for a couple with an affected daughter C.disorder seems to segregate in an autosomal dominant manner. two mutations are required for tumor formation (see Chapter 14). Familial adenomatous polyposis (FAP) C. A hallmark of HNPCC mutations is the presence of microsatellite instability in tumor DNA (see Chapter 14). These cases are almost without exception inherited maternally (see Chapter 19). When individuals inherit a mutated copy of one of these mismatch repair genes. A deletion that encompasses the entire DMPK coding region Myotonic dystrophy is caused by the expansion of a CTG sequence found in the 3′UTR of the corresponding DMPK gene. The insertion of additional polyglutamine residues in the DMPK coding region D. Analysis of several polymorphic markers from the DNA of the tumors revealed microsatellite instability. In the congenital form of myotonic dystrophy. An expansion of a CTG triplet repeat in the 3′ region of the DMPK gene E. expansion of this repeat region can exceed 2000 repeats. MYH polyposis B. Because the disorder described above is more common in males. Question 34 An allele of the a2c-adrenergic receptor (del322-325) has been found to decrease receptor function. What is the most likely molecular mechanism for congenital myotonic dystrophy? A. 160 . then the risk will be higher for relatives of an individual of the less frequently affected sex. HNPCC is associated with mutations in a set of mismatch repair genes. All affected individuals were identified with cancer in their middle forties. Which of the following syndromes best describes this family? A. The recurrence risk for disease X is independent of gender According to the threshold liability model of disease. Question 32 A 44-year-old woman is found to have a small number of cancerous polyps along the proximal (right side) of the colon. The recurrence risk for disease X is highest for a couple with an affected son B. a loss of function of the second copy leads to the inability to repair DNA mismatches. Unlike FAP. if the condition is more common among individuals of one specific gender. the recurrence risk will be higher for the couple with an affected daughter (see Chapter 9). A point mutation in the promoter region of the DMPK gene C. Alex’s mother is mildly affected with moderate facial weakness and myotonia. Li-Fraumeni syndrome E. Question 33 Assume a multifactorial disorder (disease X) is found around the world at a higher frequency among males than females. only a small number of polyps are present in the colon. Which of the following is true? A. Question 31 Alexander has congenital myotonic dystrophy. Her mother and one of her five siblings have also been diagnosed with these types of tumors and another sibling has developed gastric cancer. the presence of numerous additional alleles not present in noncancerous cells.

The males in this family who inherit the BRCA1 mutation have an increased risk of breast cancer. The adjusted odds ratio for heart failure among persons who were homozygous for the del322-325 allele was 0. Increased B. leading to an overexpression of the MYC gene (see Chapter 14). leading to a deletion event in the ABL gene region B.unrelated African-American patients with heart failure and 200 unrelated African-Americans without heart failure were genotyped at this locus. Proto-oncogenes serve as a signal for cellular apoptosis B. C. generally involved in relaying a ‘pro-growth’ message to the cell and responding by stimulating the transcription of growth factors (see Chapter 14).38 compared with those who had other alleles. Translocation of the MYC proto-oncogene to a position downstream of the IgH locus D. somatic mutation at this locus E. Proto-oncogenes repair DNA damage across the genome Proto-oncogenes are components of cell growth pathways. Question 38 Examine the following pedigree. Question 35 Janice was diagnosed with breast cancer at the age of 42. Amplification of the BCR locus on homogeneously staining regions C. Improper gene conversion. Promoter hypomethylation of both copies of the TP53 gene Burkitt lymphoma is generally the result of a translocation of the MYC oncogene from chromosome 8 to the heavy chain immunoglobulin locus on chromosome 14. This cancer is usually caused by which mechanism listed below? A. As the mutation likely passed to Janice from her father. Assume these results can be replicated and validated. Male’s with a BRCA1 mutation have an increased risk of developing prostate cancer. Which statement best describes the risk of developing cancer for Janice’s family members? A. Question 36 A 6-year-old Kenyan child develops Burkitt lymphoma. he probably carries the BRCA1 mutation himself (see Chapter 14). the risk for an African-American who is homozygous for the del322-325 allele will be which of the following? A. Which of the following disorders most likely affects this family? A. Proto-oncogenes are cell checkpoint regulators D. Compared to the risk for heart failure among an African-American with other alleles. Identical D. Proto-oncogenes scan the genome for DNA damage E. Inheritance of a mutation in the KIT locus. B. Janice’s father likely has an increased risk of prostate cancer. MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) . a B-cell tumor of the jaw. Individuals in this family who inherit the BRCA1 mutation have an increased risk of colorectal cancer. Proto-oncogenes are components of cell growth pathways C. D. Decreased C. Premenopausal breast cancer was a common occurrence in her father’s family and genetic testing showed that Janice possesses a mutated version of BRCA1. Question 37 Which of the following statements is true concerning the function of proto-oncogenes: A. No risk assessment can be made The finding of an odds ratio significantly less than 1 suggests that individuals homozygous for the specific variant (the del322-325 allele) have a lower risk of heart failure. followed by the acquisition of a second. Janice’s daughters have a 1 in 4 risk of developing breast cancer.

Premutation females ofen undergo premature ovarian failure. To calculate the amount of recombination that occurs between a specific candidate gene and the disease of interest C. To determine the most appropriate mendelian inheritance patterns for a disease of interest B. due to population stratification between the case and control groups gathered in each study B. a range of symptoms becomes apparent. This variant has been identified in multiple studies from around the world. Li-Fraumeni syndrome E. Full-mutation individuals are mentally impaired and have a characteristic facial appearance. Mutations in the genes responsible for maintaining mitochondrial replication Mutations in MELAS and MERRF are generally due to mutations that impair the functioning of the mitochondrial- specific tRNAs. Neither the normal nor the variant allele shows an appreciable difference in structure or function of the transporter. nor is a difference observed in regulation of the gene’s transcription or translation. Question 39 The mitochondrial disorders MELAS (mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes) and MERRF (myoclonic epilepsy with ragged red fibers) are generally both caused by what type of mutation? A. Mutations in nuclear-encoding genes required for function of the OXPHOS pathway D. To compare the frequency of specific alleles among populations with and without the disease of interest Affected sib pair analysis is a model-free method that attempts to identify alleles or chromosomal regions shared by affected relatives more ofen than expected by chance (see Chapter 9). Question 41 A positive association has been identified between the dopamine transporter and individuals with attention deficit hyperactivity disorder (ADHD). Recently. Question 40 Affected sib pair studies are primarily used for what purpose? A. this is ofen observed as a tremor/ataxia phenotype. Fragile X syndrome C. clinical symptoms have also been described for individuals with a repeat size in the premutation range. To identify alleles or chromosomal regions shared between affected relatives more ofen than expected by chance D. Parkinson’s disease D. the number of repeats is unstable from generation to generation and as the number of repeats expands. What is the most likely explanation for the positive association between the variant allele and ADHD? A. For a small fraction of the population. This is a false positive. each composed of closely matched groups of cases and controls. The variant is in linkage disequilibrium with a nearby gene or other sequence variation involved in the . Single base mutations in mitochondrial tRNA genes B. The variant identified in this receptor is an A/C nucleotide change in the 3′UTR of the gene. The identified variant is the functional cause of the disorder C. For males. This ultimately impacts the translation of all mitochondrially-encoded genes (see Chapter 11). a CGG trinucleotide repeat disorder. Leigh’s syndrome This is the pedigree of a typical family affected with fragile X syndrome. Large nonspecific deletions in the mitochondrial genome C.B. resulting in a very early menopause (see Chapter 18).

Concordance rates of 80% were observed for NIDDM. Retinoblastoma B. However. Genetic influences exert a larger role in NIDDM than in IDDM. The maternal inheritance pattern is the first clue that this patient is likely affected with a mitochondrial disease (see Chapter 11). NIDDM appears to due to mutations in a single. Concordance rates of 30–50% have been found for IDDM. Leber’s hereditary neuropathy D. gene Twin studies are ofen used in an attempt to identify the degree of genetic influence exerted on a disorder. Genetic factors have little or no role in the etiology of IDDM C. dizygotic (DZ) concordance rates were 15%. The following pedigree shows the blood groups from a three-generation family. AA E. OO B. What does this information suggest concerning the relative effect of genetic and environmental factors for each type of diabetes? A. The numerous studies identifying a positive association with this allele suggest the finding is not a false positive. suggesting that genetic factors play a potentially larger role in the etiology of this disorder (see Chapter 15). AB C. The most likely explanation is that the variant is in linkage disequilibrium with a nearby functional change that increases the risk of ADHD (see Chapter 9). For both types of diabetes. there is a substantial concordance for NIDDM among MZ twins. You develop a differential diagnosis of likely disorders that includes which of the following? A. O) at the blood group locus. Question 42 A 19-year-old male patient complains of a loss of central vision in both eyes. and the proband’s maternal grandmother. The A and B alleles function in a codominant manner. NIDDM is primarily determined by non-genetic factors D. If a disease were due solely to genes. and both are dominant to the O allele. indicating that there is also a role for non- genetic (environmental) factors in the etiology of NIDDM and IDDM. all her five siblings. etiology of the disorder The variant in the dopamine transporter does not appear likely to be a functional cause of the disorder because neither allele appears to influence the transporter activity. researchers calculated concordance rates for monozygotic (MZ) twins. B. The pedigree you construct of the proband’s family reveals vision loss in the patient’s mother. Question 44 The ABO blood group is coordinated by three alleles (A. Kearns-Sayre syndrome E. E. Question 43 In an effort to identify the influence of genetic factors on both insulin-dependent (IDDM) and non-insulin- dependent (NIDDM) diabetes mellitus. as yet unidentified. The concordance rates are lower than those values for this study. AO D. what is the genotype of Michael at the ABO blood group locus? A. Leigh’s syndrome Leber’s hereditary neuropathy is a mitochondrial disorder that leads to a rapid onset of vision loss. concordance rates would approach 100% for MZ twins and 50% for DZ twins. BO . No conclusions can be drawn from this study B. Based on this information. MELAS syndrome C. The onset was less than 6 months ago and has progressed rapidly.

RNA substitutes adenine nucleotides C. That means Michael is AO at the blood group locus and has type A blood. leading to incorporation of incorrect amino acids E.g. Mutation analysis of her polycystin 2 gene identifies a DNA change that prevents the addition of a methylated guanine cap at the 5′ end of the polycystin transcript. more than one codon represents the same amino acid (e. DNA replicates in a conservative manner. The code is universal D. resulting in improper or failed splicing of the transcript C. it cannot be added to the polycystin transcript B. RNA replication is semi-conservative DNA contains several sequences that are not present in processed RNA. Some of these sequences (such as promoter regions) are not transcribed. The code is degenerate B. Question 45 Which molecular property best distinguishes DNA from RNA? A. RNA resides mainly in the nucleus D. which can only occur when an OO genotype is present. The introns of the polycystin mRNA will not be excised. DNA contains a hydroxyl group at the 2′ position of the ribose sugar. This change is classified as a silent mutation (i. DNA contains uracil. The polycystin mRNA will undergo premature degradation in the cytoplasm.Michael’s parents have type A blood. The ‘capless’ transcript is ubiquitinated by the repair machinery of the cell. In order to have type A blood. an autosomal dominant disorder. Because of this principle. So Michael must also have an O allele. the third position of the codon can differ without altering the corresponding amino acid. This scenario illustrates which principle of the genetic code? A. . Their genotypes are either AA or AO. DNA contains non-coding sequences. The code is overlapping C. Absence of the cap leads to early degradation and a subsequent reduction in protein (see Chapter 2). Question 47 Anthony has a DNA change in the dystrophin gene at nucleotide position 486. the child must have inherited an O from his mother and an A allele from Michael. The third child has type O blood. these are removed during RNA processing E. DNA is present in the cytoplasm and nucleolus. Ofen. Depending on their specific genotypes. What is the likely effect of this change on the polycystin mRNA? A. Michael could either be AA. Because the poly(A) tail is normally attached at the end of the 5′ cap. Based on her mother’s type A blood. The first child has type A blood. the genetic code is said to be degenerate (see Chapter 2). CCC and CCG both code for proline). Question 46 Cheryl has polycystic kidney disease (PKD). it does not alter the identity of amino acid 162). AO or OO. RNA does not B. The code is non-overlapping In many cases. but later removed during the processing steps (see Chapter 2). The ribosome will be unable to establish the correct reading frame. Michael’s wife can pass on an O or B allele to her child. Michael’s wife has type B blood and is either BB or BO at the blood group locus. reducing protein levels in the cell D. preventing its transport out of the nucleus The 5′ cap is believed to protect the transcript from degradation by cellular exonucleases.e. Michael and his wife have three children. Other sequences (like introns) are transcribed. which corresponds to the third position of the codon for amino acid 162. we can infer that Michael’s wife is BO at the ABO locus – she inherits a B from her father and an O from her mother.

Given that no abnormality was seen by G-band analysis. Microdeletion of the elastin gene E. Maternal nondisjunction at meiosis II C. Monosomy for chromosome 7 C. In all the examined cells of this girl. Michael is found to be 47. confirming the diagnosis of Williams syndrome. Question 50 Which of the following chromosomal conditions would result only in the production of gametes that were either nullisomic or disomic for chromosome 21? A. The additional Y chromosome likely arose as a result of which of the following events? A. the nondisjunction must have occurred in the father. supravalvular aortic stenosis.Question 48 A 2-year-old girl with hypercalcemia. only one signal is obtained for the locus-specific elastin probe. Question 49 Upon karyotype analysis. A standard G-banded karyotype reveals no visible abnormalities. Paternal nondisjunction at meiosis I D. Nondisjunction at the second stage of meiosis results in the gamete receiving both copies of one homolog (in this case YY). A 10q21q reciprocal translation C. What is the most likely genetic cause of Williams syndrome in this girl? A. Frameshif mutation in the elastin gene D. In contrast. two signals are obtained showing hybridization of the chromosome 7 centromeric probes. A paracentric inversion for chromosome 21 D. Fluorescence in situ hybridization (FISH) analysis is performed. Monosomy for chromosome 21 B. Maternal nondisjunction at meiosis I B. nondisjunction at meiosis I produces a gamete with one homolog of each chromosome pair (XY) (see Chapter 3). Because there are two copies of the Y chromosome. Paternal nondisjunction at meiosis II XYY males likely arise from a nondisjunction event during the second round of meiosis in spermatogenesis. too small to be seen on the standard karyotype (see Chapter 3). short stature and mental impairment is suspected of having Williams syndrome. A 21q21q Robertsonian translocation Individuals in whom the q arms of the two chromosomes 21 have fused are only capable of producing gametes that are nullisomic (lacking the translocation) or disomic (containing the translocation) for chromosome 21 (see Chapter 3).XYY. . In contrast. the most likely cause of the syndrome is a microdeletion. Nonsense mutation in the elastin gene B. using two chromosome 7 probes: one corresponds to the centromeric region of the chromosome and the second is for the elastin gene located at 7q11. Mutation in the elastin promoter region The FISH results confirm a deletion in the 7q11 region.

Which method is most likely to be used for this purpose? A. centrally located eye (see Chapter 6). There is ofen an absence of midline facial formation. which in severe cases may result in the formation of a single. Oligonucleotide ligation assay B. DNA microarray analysis This is an example of a Southern blot (see Chapter 4). Ulnar-mammary syndrome B. These moles. Southern blotting C. transferring them to a nitrocellulose filter and hybridizing the filter with a radioactively labeled nucleic acid probe for the region of interest. but no fetus is present. denaturing the fragments. Renal-coloboma syndrome C. 46 of paternal origin and 23 of maternal origin D. 46 chromosomes. 46 chromosomes. the incomplete separation of the developing brain into distinct hemispheres and ventricles. Question 3 The Sonic hedgehog gene (SHH) induces cell proliferation during embryonic development in a highly regulated manner. DNA sequencing D. 23 of paternal origin and 23 of maternal origin E. are thought to arise by fertilization of an empty egg (lacking any chromosomes) by either two sperm or by a sperm that undergoes replication of its chromosomes before fertilization (see Chapter 6). which have a high malignant potential. fractionating the fragments by size using gel electrophoresis. all of paternal origin Complete hydatidiform moles have 46 chromosomes. 69 chromosomes. Single-stranded conformational polymorphism (SSCP) E. Question 2 Cytological mapping techniques allow a gene to be physically assigned to a chromosome or chromosome region. Fluorescence in-situ hybridization (FISH) C. Mutations or deletions in this gene result in which of the following clinical features? A. 69 chromosomes. G-banding of metaphase chromosomes B. What finding would you expect from chromosome analysis and subsequent DNA testing of tissue from the complete mole? A. 46 chromosomes. A complete hydatidiform mole is diagnosed. Exon trapping FISH allows high resolution mapping of fragments that are separated by 2–3 kb and up to 700 kb (see Chapter 5). Holoprosencephaly E. Hirschsprung disease SHH mutations lead to holoprosencephaly. An ultrasound of her uterus identifies an enlarged and poorly organized placenta.Practice Test 2 (1-50 questions) Question 1 Diagnostic testing of patients with fragile X syndrome is performed by digesting the sample DNA with restriction enzymes. Question 4 A 34-year-old woman is 10 weeks pregnant. 23 of paternal origin and 46 of maternal origin B. Sizing of polymerase chain reaction (PCR) fragments D. all of which are paternal in origin. all of maternal origin C. This is a description of which of the following techniques? A. Synpolydactyly D. Question 5 .

In this case. This same mutation was transmitted to Sarah. Marker D18S452 does not appear to be located anywhere near the disease causing gene. Homozygosity for an inactivating mutation in the factor XIII gene D. C. an X-linked recessive disorder. causing a gain of function that leads to hemophilia. As a result. They both have achondroplasia. is an example of which of the following? A. but far enough away that recombination occurs between the gene and marker some proportion of the time. D. No mutations are found in the factor XIII genes from Sarah’s father. Sarah has Turner syndrome E. Karyotype analysis of Sarah is unremarkable.Sarah has hemophilia A. the majority of her cells can only transcribe the factor XIII nonsense allele. Mutation analysis of the family’s factor XIII genes identifies a nonsense mutation in one of the two copies of the gene in Sarah’s mother. Based on this result. Each always knew they would only marry someone who also had achondroplasia. with no aneuploidy or structural abnormalities identified. the characteristic extends to a single gene trait (see Chapter 8). but is otherwise clinically normal. Based upon these findings. Skewed X inactivation in Sarah C. Consanguinity D. This type of choice. Neither her mother nor her father has hemophilia.85. Assortative mating is the tendency for humans to choose partners who share specific characteristics. Question 8 A. what is the most likely cause of Sarah’s hemophilia? A. but additional families need to be recruited into the study before linkage can be firmly established. leading to a very low level of factor XIII being produced and the clinical features of hemophilia A (see Chapter 7). Marker D18S452 is likely located very close to the disease-causing gene and in these families does not experience any intervening recombination. the LOD score for these families was +4. Sarah likely has a skewed X inactivation profile. Assortative mating E. Marker D18S452 shows some evidence of being near the disease-causing gene. Multiple studies of a given disorder among siblings have estimated the heritability of the disorder as equal to . Gene pooling B. A LOD score of +3 or greater is sufficient for evidence of linkage between a marker and disease gene. Question 6 Steven and Sarah are married. Question 7 Several families with what appears to be an autosomal dominant disorder are recruited into a genetic linkage study in an attempt to identify the location of the causative gene. given a recombination fraction of 0. with most cells inactivating the chromosome with the normal copy of the factor XIII gene. what can you conclude about the location of marker D18S452 relative to the causative gene under study? A. Positive selection C. The mutation on the maternal X chromosome is a dominant negative. The researchers coordinating the study report that for the polymorphic marker D18S452. B. Marker D18S452 is on the same chromosome as the disease causing gene. A de novo mutation on the paternal copy of the factor XIII gene B. The copy of the gene transmitted to Sarah from her father also appears to harbor no mutations or DNA variants. Selective dominance One of the assumptions underlying Hardy-Weinberg equilibrium is that random mating occurs across the population. which at the population level can disturb Hardy-Weinberg equilibrium.

leading to toxicity . Impair the ability of cells to degrade lipids. Two C. Does the frequency of ins555-560 differ between populations with and without hypertension? Association studies compare the frequency of a particular allele in populations with and without the disease of interest. Environmental factors exert a greater influence over disease likelihood than genetic factors Heritability is a measure of the total variance in a trait phenotype that is caused by additive genetic factors. with no environmental influences D. The majority of the variance in the phenotype of this disease is caused by genetic influences C. This is likely caused by the deletion of how many of the alpha globin genes? A. What is the effect of PKU causing mutations? A. Delta beta thalassemia D. Hydrops fetalis B. How much recombination occurs around the ACE gene among individuals with hypertension and the ins555- 560 allele? C. Five Hb H disease results from the deletion of three of the four alpha globin genes. an autosomal recessive disorder. What is the corresponding disorder? A. The presence of this tetramer leads to the clinical symptoms of Hb H disease (see Chapter 10). the greater the role of genetic factors (see Chapter 9). Melissa is diagnosed with phenylketonuria (PKU). Does hypertension occur more ofen than expected in extended family members when one member has the ins555-560 ACE allele? B. Question 9 An association study is undertaken to investigate the possible link between hypertension and a specific allele variant (ins555-560) of the ACE gene. leading to the presence of a small level of normal Hb A. 0. What does this finding reveal about the cause of this disorder? B. it would be expected to occur with greater frequency among the affected population. Heritability is measured on a scale from 0 to 1 and the higher the variance. Sickle cell disease Sickle cell disease is caused by the valine to glutamic acid change in beta globin (see Chapter 10). Is the ins555-560 allele shared between affected relatives more ofen than expected by chance? D. There is an overwhelming majority of beta globin. Question 11 Ryan is diagnosed with Hb H disease. Hereditary persistence of fetal hemoglobin C. One B. resulting in the production of the beta globin tetramer. A small amount of alpha globin is produced by the remaining gene. Three D. Question 12 Shortly afer birth. This disorder is likely caused by a single gene. Four E. This change affects the solubility of the resulting protein under certain conditions. Cooley’s anemia E. If the allele is involved in the etiology of the disorder. What question will this study attempt to answer? A. Hb H.85. Question 10 A single nucleotide change in the gene for beta globin substitutes the amino acid valine for glutamic acid at the sixth position.

Connexin 43 Increased levels of homocystine is the hallmark of homocystinuria. Enzymes that cleave sphingolipids E. leading to hypopigmentation C. dislocation of the lenses. most ofen caused by a deficiency of cystathionine beta synthetase. Result in an increase in melanin formation. Disrupt the function of the enzyme tyrosinase D. which damages the development of the CNS and interferes with brain function (see Chapter 11). Liver enzymes necessary to degrade glycogen to release glucose D. Increased levels of homocystine are identified in his urine. The metabolic process is polygenic C. Question 14 Which enzyme is most likely deficient in individuals with a mucopolysaccharidosis disorder? A. Question 16 In cancer. pectus excavatum and arachnodactyly. Three genes metabolize the drug D. Blockage of this pathway leads to a buildup of phenylalanine. Which of the following genes is most likely to contain the causative mutation for this child? A. Cystathionine beta synthetase E. Collagen type I C. which is responsible for converting phenylalanine to tyrosine. It is ofen confused with Marfan syndrome due to an overlap in some symptoms. Such a finding suggests what about the metabolism of the drug in question? A. which damages the brain and CNS E. A single gene metabolizes the drug E. An enzyme in the urea cycle leading to hyperammonemia B. curvature of the spine. Genetic involvement in the metabolism process is minimal B. The concentrations of the drug among the individuals are shown here. Lysosomal enzymes involved in macromolecule degradation C. A tumor suppressor B. Lead to hyperphenylalaninemia. Question 13 A 5-year-old is identified with mental impairment. Branched chain ketoacid decarboxylase (BCKD) D. heterozygous. Question 15 A pharmaceutical company carries out a dose–response test for a new drug – 300 individuals are given a standard dose of the drug and are tested 1 h later to determine the amount of the drug circulating in the bloodstream.B. but elevated homocystine is not a feature of Marfan syndrome (see Chapter 11). An enzyme necessary for the metabolism of monosaccharides such as fructose Mucopolysaccharidosis disorders are lysosomal storage diseases (see Chapter 11). homozygous recessive (see Chapter 12). loss of heterozygosity among tumor cells suggests that the region ‘lost’ may contain which gene type? A. Prevent the transport of sodium and chloride ions across the membrane of cells The mutation for PKU is in the gene for phenylalanine hydroxylase (PAH). A receptor for a growth factor . Fibrillin B. Metabolism occurs in a codominant manner by the enzymes from two genes A trimodal discontinuous response suggests metabolism is under the control of a single gene with the three responses corresponding to the three genotypes at this gene: homozygous dominant.

loss of heterozygosity indicates the location of a putative tumor suppressor.C. Martin does not have pancreatic insufficiency. in fact. RAS Tp53 is a tumor suppressor gene. Tp53 C. A deletion of the long arm of the X chromosome afer fertilization C. An oncogene D. Mutations in which genes are responsible for this disorder? A. 10% D. leading to mosaicism B. Question 17 Individuals with Li-Fraumeni syndrome have an increased risk of developing a large number of cancers at relatively early ages. Question 19 Martin has congenital bilateral absence of the vas deferens (CBAVD). leading to the cancer. Post-zygotic loss of a sex chromosome. It is the most frequently mutated gene identified to date. gene conversion following DNA repair. CBAVD (see Chapter 19). leading to sterility. The second mutation occurs through a mechanism that removes a parental allele—ofen mitotic nondisjunction. The first copy of the mutation is usually inherited. 25% E. 50% Levels of CFTR activity between 8% and 12% are associated with the mildest cystic fibrosis phenotype. etc. The other mutation is acquired somatically in a specific tissue. 6% C. Question 18 What mechanism causes most cases of Turner syndrome (45. The screen correctly identifies one hundred and ninety (190) individuals with cystic fibrosis. Isochromosome formation for the X chromosome during maternal meiosis Turner syndrome arises in 80% of all cases through a paternal nondisjunction event.X)? A. c-MYC D. Loss of a sex chromosome through paternal meiosis E. 5000 individuals receive a positive screening result. gene deletion. The formation of a ring chromosome during maternal meiosis D. nor does he have a history of recurrent lung infections or pulmonary involvement. KIT E. The extent to which CFTR activity is reduced by mutation correlates well with the clinical phenotype of the disorder. A cytoplasmic tyrosine kinase Ofen. Individuals with Li- Fraumeni syndrome inherit a mutation in one of the two copies of the gene. but diagnostic studies show that they do not. 1% B. 10 individuals . A cell cycle kinase E. RB1 B. Question 20 A screening test for cystic fibrosis has been established and data gathered on the first year’s findings. (see Chapter 14). Which of the following levels of CFTR activity would most likely be found among Martin’s cells? A. have cystic fibrosis. which results in a sperm that lacks a sex chromosome. DNA analysis carried out as part of a fertility study identifies mutations in both copies of Martin’s cystic fibrosis transmembrane conductance regulator (CFTR) gene.

Specificity is calculated as the percentage of screen-negative. but actually do have cystic fibrosis. 1/2 C. what is the probability that Carol’s first child will exhibit the clinical symptoms of the disease? A.000 individuals received a negative screening result and are not affected with PKU.000) = 99% (see Chapter 20). 98% C. Taken together. costs. She asks you ‘should I get the test?’ You tell her that it is entirely her decision to make. there is a 1/2 chance he or she will actually show clinical symptoms.000 individuals receive a negative screening result and do not have cystic fibrosis. 5000 individuals are ‘false positive’ – they receive a positive screen test. In the example above. What is the sensitivity of this screening method? A. It is a measure of how well the test detects individuals who are truly affected. Assuming that neither Anita’s husband nor Carol’s husband carries the mutation. 95% C. compared with those individuals who test screen positive. What is the ethical principle relevant in this case? . Anita has a daughter. 1/8 E. 97% D. disease-negative individuals divided by the total number of disease-negative individuals = 495.000/(5000 + 495. 48% Sensitivity is determined by identifying the proportion of truly affected individuals identified by the screen. Question 22 Anita is affected by a rare autosomal dominant disorder that occurs among males and females with an equal frequency. Two additional individuals with PKU received ‘screen-negative’ scores. 99% B. 99% B. 1% Specificity describes the proportion of unaffected individuals who are identified by a screen as unaffected.receive a negative screening result. 1/16 There is a 1/2 chance that Anita will pass along the mutation to Carol and a 1/2 chance that Carol will pass along the mutation to her child. An additional 495. 194. Question 21 A screening test for phenylketonuria (PKU) identifies 48 individuals as ‘screen positive’ who are diagnostically confirmed to have PKU. If Carol’s child receives the mutation. Carol. 5% E. In this example. You provide her with information related to options. 1/4 D. 10% D. What is the specificity of this screening test? A. For every 100 individuals who inherit a mutation in the disease gene. 48 of out 50 affected individuals received a positive screening result = 48/50 = 96% (see Chapter 20). but are also unaffected. only 50 present with clinical symptoms of this disorder. limits of interpretation. but do not have cystic fibrosis. etc. 96% E. this gives a 1/8 total probability. Question 23 A patient with a family history of breast cancer comes to you seeking advice about genetic testing. 3/4 B. An additional 6000 ‘screen-positive’ individuals are found to be unaffected by further diagnostic testing.

at least to the extent that is possible given the circumstances. Although Ron does not want to know if he has inherited the mutation. the chance that the fetus has inherited the mutated (expanded) copy of the huntingtin gene is closest to which of the following? A. Justice E. who has no family history of Huntington’s disease. which is of normal size. he is concerned about the potential risks for his children. which statement best describes recurrence risk in this population? A. Prenatal testing is performed.A. The recurrence risk for children of an affected male is less than the recurrence risk for children of an affected female According to the concepts outlined in the liability/threshold model. The specific location of the emission is used to track the relative amount of RNA present for specific genes in the cells of interest. Ron’s mother has no family history of Huntington’s disease. is pregnant. Question 25 Ron’s father has Huntington’s disease. Question 24 Clef lip and palate is a multifactorial trait with a frequency in Caucasians of 1/1000. About 60–80% of affected individuals are males. 1 Although Huntington’s disease can be tested for directly. Note that we do not know if this is the expanded or normal copy. The recurrence risk for a sibling of an affected sister is smaller than the recurrence risk for a sibling of an affected brother C. Nonmaleficence Autonomy refers to the right of the patient to be in charge and make his or her own decisions. Unhybridized RNA is washed away. Upon exposure to laser light. This puts the chance of Huntington’s disease closest to zero for this fetus (see Chapter 9). 3/4 E. Ron’s wife. the hybridized samples emit light. RNA is obtained from the cells of interest. if the condition is more common among individuals of one gender. Array-based comparative genome hybridization (aCGH) . Beneficence B. using the alleles of an STR marker completely linked (θ = 0. Given this information. Question 26 Miniaturized spots of cDNA or oligonucleotides from a set of predetermined genes are robotically placed on a glass surface.0) to the huntingtin gene. the relatives of an affected individual of the more frequently affected sex will be at lower risk than the relatives of an affected individual of the less frequently affected sex (see Chapter 9). Ron does not want to know if he has inherited the mutation. Autonomy C. labeled with fluorochromes and allowed to hybridize with the cDNA or oligonucleotides present on the glass. 0 B. 1/4 C. this can be avoided. In the example given above. The allele results are shown below on the pedigree of Ron’s family. The goal of this type of approach is to determine whether the fetus has inherited the copy of huntingtin gene that originated in Ron’s father. Confidentiality D. the fetus inherits the copy of huntingtin gene that originated in Ron’s mother. By testing the fetus for a linked marker. Using this information. 1/2 D. What technique is described above? A. The recurrence risk for the sons of an affected male is equal to the recurrence risk for his daughters B.

you need to assess the risk for mosaicism in the fetus. Question 29 Martha is a 38-year-old woman in her 16th week of pregnancy. The risks are determined empirically. it is usually necessary to employ empiric risks to provide recurrence information. 20% C. 100% This is an example of a level 2 mosaicism for trisomy 21 in a male fetus. Question 27 Aaron. The amniotic sample received by the cytogenetics lab is split into three separate aliquots and cell cultures are established from each aliquot. hepatomegaly and splenomegaly. 50% D. She is referred for amniocentesis on the basis of advanced maternal age. These are based on the observed recurrence among families studied to date. Single gene inheritance risks are multiplied by a multifactorial fraction. Question 28 Many disorders are not caused by single gene inheritance. As the lab director. presents with anemia. A: Karyotype found in eight cells from culture 3. Recurrence risks cannot be determined for non-Mendelian disorders In the situation described above. a lipid storage disorder that results from the accumulation of glycosylceramide.B. The resulting karyotypes are shown below. bone and joint pain. What is the best option to manage Aaron’s disorder? A. Bayes’ theorem is applied. What will you report? A. B: Karyotype found in the remaining cells of culture 3 and among all cells examined from cultures 1 and 2. Gene therapy B. Palliative care Although initial attempts at enzyme replacement therapy showed little success. leading to dramatic alleviation of symptoms in affected individuals (see Chapter 11). Enzyme replacement therapy D. two or more cells in . Northern blotting E. an 8-year-old of Ashkenazi Jewish ancestry. He is diagnosed with Gaucher disease. based on previous observations of disease recurrence among actual families D. Liver transplant C. In counseling situations involving these disorders. Virtually 0% B. chosen to represent the contribution from other genetic factors plus the environmental influence B. but are multifactorial. Microarray gene expression analysis C. slight modification to the enzyme targets it to macrophage lysosomes. Reverse-transcriptase polymerase chain reaction (RT-PCR) D. how are recurrence risks identified? A. 80% E. In a level 2 mosaicism. using modifications of the ‘prior’ risk calculation utilized among single-gene defects C. Serial analysis of gene expression (SAGE) Microarray gene expression analysis utilizes multiplex hybridization assays to measure the relative abundance of thousands of gene transcripts simultaneously.

The presence of single-base changes in the coding region of the huntingtin gene Nearly all individuals with Huntington’s disease have an expansion of a CAG polyglutamine repeat in the 5′ region of the huntingtin gene. If the woman is found to carry a mutation in CFTR. Genetic testing identified a deletion at chromosome 5q13. What is the most likely explanation for the presence of NF1 in the children? A. leading to death at 18 months. Diagnostic tests measure the size of the CAG repeat tract: allele sizes of 40 or more CAG repeats are invariably associated with the disease (see Chapter 19). The number of CAG repeats in the 5′ region of the huntingtin gene E. she is invited to bring in her partner for testing. completely penetrant disorder. What is the most likely diagnosis for this disorder? . Cascade screening B. Couple screening C. Targeted screening E. Independent de-novo mutations in affected children C. testing is offered to the father (see Chapter 20). multiple affected children from unaffected healthy parents are more likely due to parental gonadal mosaicism. Follow-up fetal blood sampling is sometimes used in an attempt to resolve these types of findings. Question 30 Michael is the grandson of a woman affected with Huntington’s disease.only one culture have an alternate karyotype. If the partner is also a carrier. Although about 1/2 of all cases are due to new mutations. This is most likely a culture artifact. Two-step screening This is a description of two-step screening: first the mother is tested and if positive. He’d like more information about this genetic test. You tell him that the diagnostic test for Huntington’s disease specifically measures what? A. There is no family history of NF1 and neither Elizabeth nor Robert has any of the clinical findings associated with NF1. Family screening D. Incomplete penetration D. The presence of deletions spanning one or more exons of the huntingtin gene C. Question 32 Population screening for carriers of cystic fibrosis is now commonly offered to all pregnant women. but empiric studies have shown that there is up to a 20% chance the mosaicism is real and will be identified in the fetus. two of whom are affected with type 1 neurofibromatosis (NF1). The presence and amount of the huntingtin protein B. Question 33 An infant girl was born with severe hypotonia and lack of spontaneous movement. 25% recurrence risk for each child NF1 is an autosomal dominant. Parental gonadal mosaicism B. He has asked to undergo genetic testing to determine whether he is likely to develop Huntington’s. The number of polyglutamine residues in the 3′ UTR of the huntingtin gene D. What is this screening approach called? A. Question 31 Elizabeth and Robert have five children. prenatal diagnosis is then offered. Continued progression of muscle weakness affected both swallowing and respiratory function. encompassing both the survival motor neurone gene and the neuronal apoptosis inhibitory protein gene. Environmental exposure limited to affected children E. The girl’s mother remembered fetal movements were both faint and sporadic during pregnancy. where a proportion of the gametes from one parent carry the NF1 mutation (see Chapter 19).

Malformation E. a 26-year-old woman.A. Duchenne muscular dystrophy B. Heterokaryon C. Question 34 David and Sarah have four children. Angie becomes pregnant. In this example. What is the term describing the mechanism that led to this single congenital abnormality? A. Xeroderma pigmentosa E. Question 36 Angie. Fanconi anemia B. At birth. Question 35 During prenatal ultrasound. leading to reduced levels of all blood cell types. Myotonic dystrophy This is a description of SMA type I. Dysplasia C. Spinal muscular atrophy (SMA) E. Chimera B. Bloom’s syndrome C. This child was born without thumbs and later developed bone marrow failure. These malformations can be traced to the effect of the retinoic acid. clef palate and low-set deformed ears. retinoic acid is a(n): A. due to the constriction of the amniotic band. Ataxia telangiectasia D. an amniotic band is discovered to encircle the lef hand of the fetus. Sequence B. The active ingredient in this medication is retinoic acid. She gives birth to a son who is affected with hydrocephaly. While taking the medication. has been taking a medicine prescribed by her doctor to treat severe acne. One has short stature. The association with upper limb abnormalities is unique among the chromosomal breakage syndromes (see Chapter 18). Teratogen E. Which chromosomal breakage syndrome is most consistent with this clinical description? A. Morphogen This is a classic example of a teratogen – an agent that causes birth defects by affecting embryonic or fetal . Juvenile Parkinson’s disease C. ICF syndrome This is a description of Fanconi anemia. Amyotrophic lateral sclerosis D. developmental delay and bilateral radial aplasia (an upper limb abnormality that involves the radius). Disruption A disruption occurs when some outside factor (usually not genetic) disrupts the normal developmental pathway (see Chapter 16). Enhancer D. Deformation D. An examination of cultured cells from this child revealed multiple chromosomal breaks. The disease is characterized by degeneration of the anterior horn cells of the spinal cord leading to progressive muscle weakness (see Chapter 19). several of the fingers on the infant’s lef hand are missing and the remainder are poorly formed. an autosomal recessive disorder characterized at the cytogenetic level by chromosome breakage and gaps.

C. Recurrence risk increases with increased number of affected first-degree relatives E. the concentration of the drug circulating in the blood was measured. Question 37 Which finding would suggest that environmental factors play a major role in the etiology of essential hypertension? A. Multiple genes . t(8. cancer diagnosed before age 50 in at least one relative) is used to select high-risk individuals for what form of inherited cancer? A. The correlation for blood pressure between adoptive children and their biological parents is lower than the correlation for children who remain with their biological parents. Li-Fraumeni syndrome The Amsterdam criteria are used to identify individuals at highest risk of colorectal cancer (see Chapter 14). Ovarian cancer C. A single dominant gene B. t(9. What action is the metabolism of this drug most likely controlled by? A. observed in 90% of individuals with this form of leukemia. at least two successive generations affected. Double minute for MYCN E. the overall concentrations formed the following distribution. Migrant populations show no change in disease prevalence B. adopted children would show lower correlations with their biological parents (who do not share their environment) than would children who stay with (and thus share the environment of) biological parents (see Chapter 15). Breast cancer B. del(17p13.development (see Chapter 16).22)(q34. Incidence of hypertension is increased in identical twins compared to non-identical twins If a disorder is driven in large part by environmental factors. one with normal and one with elevated systolic pressures D. Thyroid cancer E. Two hypertensive groups exist. Chromosome analysis of her white blood cells would reveal which abnormality? A. A single recessive gene C. All individuals were given a standard dose and afer 30 minutes.14)(q24. Question 39 The ‘Amsterdam criteria’ (at least three affected relatives. When plotted. Question 38 Emily is an 18-year-old who has recently been diagnosed with chronic myeloid leukemia.q11) B.q32) D.1) C. is the product of a reciprocal translocation between the long arms of chromosomes 22 and 9 (see Chapter 14). Colorectal cancer D. Question 40 The metabolism of a certain drug is measured using a dose–response test in 1000 individuals. del(13q) The ‘Philadelphia chromosome’.

Question 41 Andrew.D. the metabolism is polygenic. When screening individuals in this family. what early clinical sign will you look for? A. fully translucent irises. Analysis of Evelyn’s blood will most likely show an elevation of which metabolic product? A. 21-hydroxylase Andrew presents with the symptoms of type I oculocutaneous albinism (OCA). Question 44 Miguel’s family has familial hypercholesterolemia (FH) and is at increased risk of early coronary artery disease. Phenylalanine Ornithine transcarbamylase deficiency is an inborn error of the urea cycle. and blue. Tyrosinase E. Question 43 Marcus and Carmen have a child with ambiguous external genitalia. a 4-year-old male. Ammonia C. Urea E. Hexosaminidase-A C. High cholesterol levels in persons with FH are due to defective or deficient low-density lipoprotein receptors. It leads to an accumulation of ammonia which is toxic to the nervous system (see Chapter 11). Individuals with OCA type 1 have deficiencies in tyrosinase. Hurler’s syndrome E. What is the most likely diagnosis? A. see Chapter 12). leading to the absence of melanin pigmentation (see Chapter 11). Evelyn has a low core temperature. Congenital adrenal hyperplasia B. She is diagnosed with ornithine transcarbamylase deficiency. has white hair. has become difficult to rouse and is now having seizures. These symptoms are likely to be caused by a deficiency in which one of the following enzymes? A. Appearance of a ‘cherry-red’ retinal spot B. Cannot be determined with the available data A unimodal distribution suggests that the metabolism is under the control of multiple genes (i. her parents report she has not been feeding well. The internal genitalia are female and chromosome analysis is 46. He also presents with poor visual acuity and nystagmus. Ferrochelatase B.e. Although she appeared normal at birth. Biochemical studies reveal a deficiency of 21-hydroxylase.XX. cerebral edema and has slipped into a coma. Androgen insensitivity D. Uric acid B. Folate D. Hirsutism . Camptomelic dysplasia Congenital adrenal hyperplasia is the result of mutations in 21-hydroxylase. Arginase D. white skin that does not tan. Pompe’s disease C. It is the most common cause of ambiguous genitalia in females (see Chapter 11). Question 42 Evelyn is a 6-day-old newborn brought to the emergency room by her parents.

Question 46 Rehan has sickle cell anemia. weakness and lassitude. these features do not appear until a few months afer birth because gamma globin is the major non-alpha globin chain during fetal development and early postnatal life. Sickle cell disease C. which increases the risk of thrombophilia. An elevation of serum creatine E. Question 45 Maria is a 23-year-old woman who has recently noticed loss of coordination.C. Which disorder is most consistent with this clinical profile? A. caused by a single nucleotide change in the beta-globin chain of hemoglobin. growth retardation and hepatosplenomegaly. splenomegaly. The effect of this single nucleotide change on multiple organ systems is an example of: A. what is the chance that the firstborn child of Jin (Peng’s son) will also be homozygous for the factor V Leiden mutation? . Penetrance D. limb pain. Because the gamma and delta globin chains are intact. Formation of Heinz bodies in the red blood cells D. Maria is noted to have a Kayser-Fleischer ring at the corneal margin of her eyes. In general. Question 47 Mikklos is a 9-month-old boy of Greek origin who presents with severe anemia. Hydrops fetalis D. Maple syrup urine disease B. Propionic acidemia C. Pleiotropy C. Given the information shown in this pedigree. leading to the symptoms described above. It ofen appears during childhood or adolescence in individuals with FH (see Chapter 11). Peng is homozygous for the mutation. Beta thalassemia B.4) gives the following results. and difficulty in speaking and swallowing. Formation of multiple xanthomas A xanthoma is a subcutaneous deposit of lipid. Question 48 The pedigree shown here follows the inheritance of the factor V Leiden mutation. HbA2 and HbF production continues (see Chapter 10). Upon clinical examination. Wilson’s disease D. what disorder should be strongly considered? A. McArdle’s disease E. early renal failure. Hemoglobin electrophoresis on cellulose acetate (pH 8. It ofen causes both neurological and behavioral changes in affected individuals and is recognized by the presence of a Kayser-Fleischer ring in the eye (see Chapter 11). Methemoglobinemia E. He has splenic infarctions. Allelic heterogeneity B. Her parents have also noticed sharp personality changes in Maria. Based upon Maria’s symptoms. Anticipation A mutation that affects numerous organ or tissue types is said to exhibit pleiotropy (see Chapter 7). Locus heterogeneity E. HbH disease Beta thalassemia results from the absence of functional beta globin (and the consequent absence of HbA). Galactosemia Wilson’s disease is a disorder of copper metabolism.

There was a marked deceleration in the growth of her head during this same period. Kirsten would be most likely to be affected with which disorder? A. APC D. TP53 E. Miller-Dieker syndrome D. By 24 months. Given this set of clinical findings. Benjamin also has congenital hypertrophy of the retinal pigment epithelium. Question 50 Benjamin is a 38-year-old man who has just undergone a total colectomy with ileoanal pull-through. Benjamin’s mother and a maternal uncle died of cancer before the age of 55. Question 49 Kirsten is a 5-year-old girl with ataxia and seizures. It is caused by mutations in the MECP2 gene. Based upon these findings. but had lost the use of her hands for other purposes and had severe impairment in expressive and receptive language. as is his wife. 50% D. Edward syndrome C. MLH1 C. The probability that they both pass the mutation on to a child is therefore 25%. Rett syndrome E. . The result of an apparently normal pregnancy and birth. RET Mutations in both copies of the APC gene are a hallmark of familial adenomatous polyposis (FAP). in which gene is Benjamin most likely to have a mutation? A.A. Congenital hypertrophy of the retinal pigment epithelium (pigmented areas of the retina) is a finding ofen associated with FAP (see Chapter 14). BRCA2 B. an autosomal dominant disorder accounting for approximately 1% of colorectal cancer. Virtually 0% B. 75% E. It is characterized by hundreds to thousands of adenomatous polyps throughout the colon. DiGeorge syndrome B. His colon contained more than 2400 polyps. 25% C. a mediator of gene expression and transcriptional silencing. 100% Jin is heterozygous for the mutation. Patau syndrome Rett syndrome is a neurodevelopmental X-linked dominant disorder that occurs almost exclusively among females. Kirsten progressed normally until the middle of her second year. she had developed a pattern of hand wringing. when she began losing speech and motor skills.

Inflammatory peripheral neuropathy B. Reduced fitness observed for Amish affected with this disease D. The test was positive. When carriers’ red blood cells are invaded by the malaria parasite. compared with individuals who have two normal copies of the beta globin gene. He also notes frequent leg cramping and difficulty climbing stairs and stepping over objects. Charcot-Marie-Tooth disease C. An environmental risk factor present at increased frequency among the Amish The most likely explanation for this observation is that one or two of the original founders of the Old Order Amish were carriers for the Ellis-van Creveld mutation. Genetic drif Heterozygote advantage is an example of positive selection. an autosomal recessive disorder. resulting in an increase in the number of marriages between two carriers and a subsequent increase in disease frequency (see Chapter 8). There are no other family members with similar problems and no family history of neuromuscular disorders. In these populations. carriers of sickle cell anemia have greater resistance to infection. most likely accounts for this elevated frequency? A. Becker muscular dystrophy E. . Leigh disease Charcot-Marie Tooth disease. Upon examination. Which of the following factors. Consequently. Assortative mating D. Due to the restricted number of marriage partners available to members of this group. is present at a much higher frequency than that observed among other groups of European descent. but segmental demyelination was observed. the frequency of the mutation increased to a relatively high frequency. atrophy of his distal leg muscles and reduced ankle and patellar reflexes are noted. is most ofen caused by increased dosage of PMP22 as a result of a duplication of the chromosome 17 gene (see Chapter 19). A subsequent nerve biopsy showed no evidence of inflammation. Heterozygote advantage E. the cells sickle and are destroyed. A founder effect among the Amish population B. coupled with the social and religious isolation of this population. Question 3 Roger is a 26-year-old man who complains of a decrease in strength and endurance and a reduced ability to walk and run. Negative selection C. characterized by chronic motor and sensory polyneuropathy. What is the most likely diagnosis? A. This disturbance of genetic inheritance in populations is referred to as what? A.Question 1 In areas where Plasmodium falciparum malaria occurs. Ellis-van Creveld syndrome. indicating increased dosage of this gene. Neurofibromatosis D. A neurological evaluation identifies a reduction in nerve conduction velocity. the neurologist requested molecular testing for a duplication of the peripheral myelin protein 22 gene (PMP22). Question 2 Among the Old Order Amish in the US. Allelic diffusion B. Increased reproductive fitness of the affected males among the Amish E. A reduced mutation rate among the Amish C. Hardy- Weinberg equilibrium is disturbed for the beta globin mutation. where the presence of one copy of the sickle cell mutation increases the fitness of the individual (see Chapter 8).

who is affected with a single-gene. both coding for photoreceptor membrane proteins. only patients heterozygous for mutations in both genes develop the disease. There is a 50% that Marsha passed along the mutation to Marcus. . ROM1 and peripherin. Co-dominant inheritance C. Digenic inheritance D. 40% C. XX individuals who are phenotypically male. 100% Marsha’s dizygotic twins arose from the fertilization of two oocytes by two sperm. However. many of the genes that control sperm development and fertility reside on the Y chromosome. and XX males who lack these genes are therefore infertile (see Chapter 6). Translocation of SRY onto the X chromosome results in XX males. XX individuals who are phenotypically female. there is an 80% chance that he will develop the clinical symptoms of the disorder. and her two children. XX individuals with ambiguous genitalia B. As a result.Question 4 Anne-Elizabeth is affected with a rare form of retinitis pigmentosa (a progressive retinal degeneration). Michael and Marcus. which combination of karyotype and phenotype is most likely to be observed? A. Michael is also clinically affected with the disorder. most meiotic recombination between the X and Y chromosomes occurs in the pseudoautosomal region. If such a translocation event takes place and the resulting sperm fertilizes a normally developed oocyte. Pleiotropy B. autosomal dominant disorder that shows 80% penetrance. leading to symptoms (see Chapter 7). sharing 50% of the genes in common on average. there is a 40% overall chance that Marcus will show signs of the disease (see Chapter 5). 50% D. Marsha. Question 5 In sperm. translocating the SRY gene from the Y chromosome onto the X. This form of the disease only occurs when individuals are heterozygous for mutations in two different unlinked genes. leading to the formation of masculine internal and external genitalia. but infertile The SRY gene is the primary factor that determines maleness. It is theorized that the individual effect of each mutation is not sufficient by itself to cause the disorder. The affection status of Michael and Marcus are independent. Triallelic inheritance E. 80% E. If Marcus received the mutation. 20% B. XY individuals who are phenotypically male. Genetic heterogeneity Digenic inheritance describes a situation where the additive effects of heterozygous mutations at two different genes leads to the occurrence of a disorder. This is an example of what type of complex inheritance pattern? A. The probability that Marcus will have the clinical signs associated with the disorder is closest to which of the following choices? A. Rarely. They are genetically equivalent to siblings. but the joint presence crosses some threshold of cell damage or injury. Question 6 The following pedigree shows your patient. but infertile D. but infertile E. XY individuals who are phenotypically female and are fertile C. aberrant recombinations take place outside this region. Individuals who carry a mutation in only one of these genes are not affected. SRY expression triggers a series of downstream gene activation.

Question 10 Your patient. Ordering which cytogenetic analysis results in the fastest clinical report? A. Question 8 The polymerase chain reaction (PCR) is a powerful tool and is commonly used for diagnostic studies. The resulting double-stranded products are denatured and one of the strands is subjected to gel electrophoresis. You seek molecular confirmation of this diagnosis. is 16 weeks’ pregnant. However. in part. Real-time PCR E. GCTGG C. High-resolution Giemsa banding B. Single strand conformational polymorphism (SSCP) B. D. on their specific DNA sequence (see Chapter 4). Large amounts of starting DNA are needed C. PCR is carried out under strict guidelines in areas free of contaminating sequence (see Chapter 4). Of the choices provided. Fluorescent in-situ hybridization (FISH) C. Denaturing high-performance liquid chromatography (DHPLC) D. Ephraim. 24–48 hours is required to complete the assay B. You order an amniocentesis.Question 7 The following sequence is found in the promoter region of the insulin gene: 5′- CACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAAC-3′ Which of the subsets of this sequence shown below represent the most likely target region for recognition and cleavage by a restriction endonuclease? A. which is ofen associated with trisomy 21. DNA microarray for resequencing purposes C. The process is prone to amplify contaminating DNA. ATCTCAG E. Flow cytometry . use of the PCR is limited by which of the following experimental conditions? A. Which of the following laboratory tests will you order? A. Contaminating DNA can readily be coamplified The PCR is a very robust process that will amplify any DNA fragment present in a sample that is homologous to the forward and reverse primers used in the reaction. The test you want performed involves segmental amplification of the promoter and exonic regions of both collagen type I genes. only option C contains a palindrome (see Chapter 4). GCCGACA Restriction endonucleases cleave double-stranded DNA around palindromic nucleotide sequences (where the same sequence of nucleotides occurs on each of the two DNA strands when read in the same direction of polarity). Single stranded DNA fragments assume a specific three-dimensional structure based. Nirupama. and both you and your patient are anxious for a rapid diagnosis. Question 9 Your patient. Multiple regions of DNA cannot be coamplified in the same reaction D. Reverse banding (R-banding). for this reason. Oligonucleotide ligation assay (OLA) SSCP. Ultrasound of the fetus showed an increase in the nuchal thickness. CTACAC B. looking for variations from the normal electrophoretic mobility of a fragment. is suspected of having osteogenesis imperfecta. GGATCC D.

markers D16S753. A genome-wide linkage study was conducted using a large African-American kindred segregating the PKD phenotype in an attempt to identify the most likely location of the PKD gene (Bennett LB.0 or greater. Virtually 0% B. Molecular diagnosis of her beta-globin genes identifies a mutation that removes the 100 nucleotides immediately preceding the start site for transcription. Sperm mitochondria are generally destroyed so that all mitochondria are derived from the mother. Question 11 Paroxysmal kinesigenic dyskinesia (PKD) is a rare autosomal dominant disorder characterized by episodic choreiform or dystonic movements that are brought on or exacerbated by voluntary movement. Subsequent molecular studies reveal the causative mutation is a single base substitution in NADH dehydrogenase subunit four. 3′ intron/exon boundary for intron 2 . Approximately 50% E. D16S419 is contained within the gene boundaries of the putative PKD locus B. Approximately 75% A defining characteristic of mitochondrial DNA is inheritance through only the maternal lineage. Question 13 Anna-Marie is affected with beta-thalassemia. It is likely the location of the PKD gene will be found somewhere in this interval. D16S3396 and D16S419 achieve this level. Approximately 38% D. The strongest evidence for linkage to the PKD locus is found at marker D16S769 C. Approximately 25% C. characterized by rapid optic nerve death. What is the probability that both daughters have inherited this mutation? A. Consequently.E. 54(1):125–130). What beta-globin regulatory element is removed by this deletion? A. What conclusions can reasonably be drawn from these data? Table 1: Two point LOD scores for chromosome 16 loci and PKD. The two-point LOD scores from a portion of markers along chromosome 16 are shown here. The allele of marker D16S419 that was co-inherited with the clinical phenotype is the PKD-causing mutation D. A locus for paroxysmal kinesigenic dyskinesia maps to human chromosome 16. TATA box C. Bowcock AM. A. coded by a mitochondrial gene. The physical location of the PKD gene is likely found between markers D16S753 and D16S419 LOD scores of 3. with correspondingly small recombination fractions. The descending order in the table corresponds to their physical order (from centromere to telomere) on the q arm of the chromosome. In this example. are accepted as significant evidence for linkage with a specific marker. Question 12 Ryan is affected with Leber’s hereditary optic neuropathy (LHON). Polyadenylation signal B. Ryan has two daughters. Roach ES. none of the offspring of a male carrying a mitochondrial mutation will inherit the mutation (see Chapter 2). Neurology 2000. FISH can be used to examine interphase cells (as well as metaphase cells) with a turnaround time as rapid as 24 hours (see Chapter 3). leading to bilateral blindness.

Shown below is her DNA sequence for a portion of exon 6 for the collagen type 1 gene. HbA/HbA 60%. Question 14 May-lin has type 1 osteogenesis imperfecta (OI). there are 200 chromosomes. 3′ UTR (untranslated region) E. Substitution D.32 B. Frameshif This is an example of a frameshif mutation. Question 16 Hemoglobin protein electrophoresis was used to determine whether 100 individuals carried genes for normal hemoglobin (HbA) or the Lepore variant (HbL). 0.D. HbL/HbL 10%. Although Evann’s OI is caused by a loss of function mutation in the pro alpha I gene. only one mutation is needed to produce the clinical effects of OI. These include the TATA box (approximately 25 base pairs upstream of the transcription start site) and the GC and CAAT boxes (usually within the 80 base pairs upstream of the start site) (see Chapter 2). What is the allele frequency of HbA in this sample? A. an autosomal dominant disorder resulting from defective type I collagen. 0. which contains the mutation responsible for type 1 OI. Homoplasmy D.68 E. Quantitative analysis of the electrophoresis results is shown below. 0. Termination codon Sequences immediately upstream of the transcription start site generally contain conserved sequences important for the initiation of transcription. Of those 200. 0. Question 15 Evann is affected by osteogenesis imperfecta (OI). Missense C.75 Among this sample of 100 individuals. Hypermorph E. May-lin: 5′ AAACTCCACTTCTTCACGTAC – 3′ Normal: 5′ –AAACTCACTTCTTCACGTAC – 3′ May-lin has what type of mutation? A. A single base deletion has disrupted the reading frame for translation (see Chapter 2). Question 17 . Haploinsufficiency C. The frequency of HbA is therefore 150/200 = 0. Heteroplasmy Haploinsufficiency describes the situation where 1/2 of the normal levels of the gene product leads to phenotypic effects (see Chapter 2).56 C. 150 are HbA (120 from the HbA homozygotes plus 30 contributed by the HbA/HbL heterozygotes). HbA/HbL 30%. Heterogeneity B.60 D. Insertion E. This case illustrates which of the following genetic concepts? A.75. Nonsense B. 0. The corresponding normal sequence is also shown.

1/4 of their offspring will inherit two normal copies of the corresponding gene.Evan is a 28-year-old man with a younger brother who died from type 2 Gaucher disease. At birth.67 E. an autosomal recessive disorder that results in the inability to metabolize branched chain amino acids. What is the probability that Evan is a heterozygous carrier for the Gaucher mutation? A. However. 0. Two of these three would result in a heterozygous carrier for the mutation. 1/128 D.33 C. giving Evan a 2/3 probability. 1/16 C. She has two daughters who each have one child.50 D. 1/2 will inherit one copy of the normal gene and one copy of the mutation. 2) he inherited a mutation from his mother and a normal copy from his father. 1/2 There is a 1/2 chance that Sarah passes along the mutation to one of her daughters. 1/512 B. and 3) he inherited a normal copy from his mother and a mutation from his father. 0. the probability that Roxanne and Richard will give birth to a child with hemochromatosis (an autosomal recessive disorder) is closest to which of the following options? A. 1/64 E. followed by a 1/2 chance that the daughter in turn passes the mutation along to her child. In the same way. The chance that both grandchildren will carry the mutation is 1/4 × 1/4 = 1/16. 1/32 As hemochromatosis is an autosomal recessive disorder.75 Evan’s parents were each carriers of the Gaucher mutation. Through a family history you establish the pedigree shown here. 1/256 C. Question 19 Roxanne and Richard are married. as Evan is 28 years old. he cannot possibly be affected with Gaucher disease. What are the chances that both Sarah’s grandchildren have inherited a copy of the MSUD mutation? A. 0. 3/8 E. and 1/4 will inherit both copies of the mutation (and have Gaucher disease).25 B. the great grandfather of Roxanne and the great grandmother of Richard are obligate . The frequency of this mutation in the population is negligible. 1/32 B. That leaves three equally likely possibilities: 1) he inherited both normal copies from his parents. there is a 1/4 chance that the other grandchild will carry the MSUD mutation. Question 18 Sarah is a known heterozygous carrier of a mutation that causes maple syrup urine disease (MSUD). If all individuals who married into this family are not carriers for the mutation. an autosomal recessive lysosomal storage disorder that is fatal by the age of 2 years. So there is a 1/4 chance that one grandchild will be a carrier for the MSUD mutation. 0. 0. because these individuals die before the age of 2 years. 1/4 D.

Taken together. The matching allele frequencies for both alleles of the third microsatellite are 0. What is the probability that this child will be affected with Becker muscular dystrophy? A. she must inherit a mutation from both her father and her mother. who also has Becker muscular dystrophy. it is likely that one of her parents carried the mutation.carriers. . there is a 1/4 chance the newborn daughter of Helene and Gary will inherit two mutations and be affected.10.0010 D. Helene has just given birth to a daughter. 0. 3/4 E. Richard has a 1/8 chance of being a carrier. 0. There is a 1/2 chance that Roxanne’s great grandfather passed the mutation to his son (Roxanne’s grandfather). So there is a 1/2 × 1/2 = 1/4 chance that a child will inherit a maternal copy of the mutation.0004. 1/4 C. Helene has a 1/2 chance of being a carrier. He is a Caucasian of European descent.20 for the second microsatellite. If Helene carries the mutation. Gary will pass the mutation for Becker to all his daughters. For a female to be affected with Becker muscular dystrophy. the probability of this occurring is 1/64 × 1/4 = 1/256. Question 21 Helene has two brothers with Becker muscular dystrophy. so the genotype frequency for the first microsatellite is 0.10 = 0. In the same way.20² = 0.0004 C. In order for Richard and Roxanne to have a child with hemochromatosis they must both be carriers (1/8 × 1/8 = 1/64) and then each pass the mutation to that child (which would occur on average 1/4 of the time). a 1/2 chance he then passed it to his daughter (Roxanne’s mother) and a 1/2 chance she passed it to Roxanne.04 = 0. What is the probability that a random individual drawn from the Caucasian population would match the alleles present on the male fraction obtained from the rape kit? A. or 2 × 0.20 × 0. 1 As both Helene’s brothers have Becker muscular dystrophy (an X-linked recessive disorder).50² = 0.04. She marries Gary. The genotype frequencies are determined using the Hardy-Weinberg equation.50 for the first microsatellite and 0. Multiplying the three genotype frequencies together gives us the probability that a randomly chosen individual in the Caucasian population would have the same genotypes as those identified on the rape kit.25. In the situation described above. The suspect is homozygous for the first two microsatellites examined and heterozygous for the third. His alleles at these three markers match the alleles recovered from the male fraction of the rape kit collected from the victim shortly afer the attack. 0. This gives Roxanne a 1/2 × 1/2 × 1/2 = 1/8 chance of carrying the hemochromatosis mutation. 0. The genotype frequency of each homozygous microsatellite is p². 0. Similarly.0020 The probability is determined by multiplying together the frequencies of the three genotypes present on the rape kit.0002 B.20 and 0.0016 E. The matching allele frequencies among the general Caucasian population are 0. Virtually 0 B. Question 20 A suspect in a rape and assault case has been genotyped at three independent microsatellite repeat markers. 1/2 D. there is a 1/2 chance she will pass it to a child. 0.04. the genotype frequency for the homozygote at the second microsatellite is 0.04 × 0. The frequency for the heterozygous genotype at the third microsatellite is 2pq.25 × 0.

Under the hypothesis of linkage between the disease and the genotyped marker. This individual would be termed a recombinant. 3/8 E. a loss of genetic material produces more severe consequences than a gain of genetic material. Based on this information alone. where an autosomal dominant disorder is being transmitted. There is a 1/2 chance that the mutation was passed to her sister as well.XX. This is the case for all but one of the offspring (III-7). you would expect the deletion patient (Anita) to be more severely affected than a .Question 22 Chris and his brother Todd both have Duchenne muscular dystrophy. Virtually 0 B. About the same severity as Margaret D. Based on these haplotypes. from his mother (individual I-2). while those that inherit the ‘5’ allele would not. and those of his unaffected mate (individual II-2). Question 23 Consider the pedigree shown here. More severe than Margaret B. Thus. Based only on this information.dup(5)p15 for Margaret. carried on the same chromosome as allele 3. 1/2 E. how severe would you expect Anita’s clinical phenotype to be compared to Margaret’s clinical phenotype? A. A four allele marker has been genotyped and the corresponding alleles are shown below the symbol for each individual. 0 B. 1/8 C.XX. He would inherit the normal copy of the gene. from his father (individual I-1). Question 24 A cytogenetics laboratory reports a karyotype of 46. the boy’s maternal aunt. this man would inherit the disease causing mutation. What is the probability that she is a heterozygous carrier of the disease gene? A. 1/4 D. carried on the same chromosome as allele 5. One recombinant in eight meiotic events yields a recombinant fraction of 1/8. which means that one of her parents most likely carried the mutation responsible for Duchenne muscular dystrophy. is interested in beginning a family. there are seven nonrecombinants and one recombinant among the offspring. What is the recombination frequency for the marker and disease locus? A. we would predict that the children who inherit the ‘3’ allele from their father would also be affected. 5/8 The genotypes of the individuals in generation I establish the linkage phase for individual II-1. Impossible to tell from the information available In general. 3/8 D. 1/8 C. Jean. 1/2 The mother of Chris and Todd is an obligate carrier. Less severe than Margaret C. There is a maternal family history of this disorder.del(5)p15 for Anita and a karyotype of 46.

Individual 7. has been typed for all members of the family. The accompanying genotypes are shown in the electrophoresis image below the pedigree. What type of green vision will the sons born to this couple have? A. All sons . A and B During the first meiotic division. Chromosome 2 homologs are labeled at the centromeres as B. 90% E. At the second meiotic division.b. All will have green blindness For X-linked disorders. where reds. a mature oocyte contained the centromeres labeled A and B. Chromosome 1 homologs are labeled at the centromeres as A. The g1 mutation is dominant to the g2 mutation.a. A man with normal vision marries a woman with green blindness. This allele was inherited by individuals 3 and 6.00. an autosomal dominant disorder. there is no contribution from the father (who provides the Y chromosome instead). At this point. greens and yellows cannot be distinguished. 1/2 will have green shif. sister chromatids are separated. 10% C. 100% Because there is no recombination between the OI locus and the typed microsatellite. A four allele microsatellite. The second polar body would contain sister chromatids that are identical to those that remain in the mature oocyte (see Chapter 3).duplication patient (Margaret). Mutations at this locus have a penetrance of 90%. a and b B. both of which are mutations. Based on these genotypes what is the approximate risk that individual 7 will have the clinical symptoms of OI? A. The normal allele ‘G’ is dominant to the other two alleles. If at the time of fertilization. Virtually 0% B. which combination would be found in the second polar body? A. A and b C. The OI causing mutation is on the same chromosome as allele 2 in the affected father. will be unaffected. linked to the OI locus at a recombination fraction of 0. who are both affected with OI. Question 27 A three-allele locus on the X chromosome controls the green-sensitive pigment for color vision. Shaded individuals are affected with osteogenesis imperfecta (OI). The g1 mutation leads to a condition called ‘green shif’ – the presence of a weakened green-sensitive pigment where only certain shades of green are indistinguishable from browns. which results in ‘green blindness’. Question 26 Consider chromosomes 1 and 2 at the beginning of meiosis. 1/2 will have green blindness E. 1/2 with have normal vision. All will have green shif D. who inherited allele 4 from his father. All will have normal green vision B. we can use the alleles of the microsatellite to predict the affection status of the family members. a and b would be found in the first polar body and A and B would remain in the oocyte. 50% D. 1/2 will have green shif C. homologous chromosomes are separated. Question 25 The pedigree of the Patel family is shown here. a and B D.

47. is the primary hemoglobin present during development. 24.XX Mature human gametes have 23 chromosomes. These insoluble tetramers are harmful to red blood cells and lead to their premature destruction.will receive one of the mother’s two X chromosomes. a 25-year-old woman. The infant’s hands and feet appear normal. In utero. but not both (see Chapter 3). low-set ears and a ventricular septal defect.XO D. 45. gamma expression is diminished as beta globin expression is increased. Alpha globin D. which is ofen identifiable in utero. 45. This combination will result in green blindness. alpha-globin tetramers are capable of supplying oxygen to the fetus E. 22. Question 29 Which of the following karyotypes would most likely be present among mature. der(13.X C. 23. Sperm will have either an X or Y sex chromosome. present until just afer birth.XX. composed of alpha and gamma subunits. Fetal Hb B. normal. Chromosome studies of this infant would likely reveal which of the following karyotypes? A. microphthalmia with bilateral colobomas. This is because: A. Delta hemoglobin tetramers transport oxygen during fetal development D. Prenatally.Y B. +18 C. both of the mother’s X chromosome carry the g2 mutation. 46.XX. Question 31 Unlike alpha thalassemia.2 –q13 The above physical description is consistent with a diagnosis of trisomy 13 (see Chapter 18). Fetal hemoglobin is sufficient to meet oxygen needs prenatally B. 46. Question 28 Decreasing production of which form of hemoglobin would theoretically benefit a patient with beta thalassemia major? A. Beta globin C.XY E. Embryonic hemoglobin.Y D. 47.XX. all oxygen requirements are provided by maternal red blood cells C.XX. beta thalassemia usually presents only afer birth. . In this case. Gamma globin Individuals affected with beta thalassemia major produce little to no beta globin.21)(q10:q10) B. This results in an overabundance of alpha globin subunits. –15q11. human sperm? A. leading to the formation of alpha subunit tetramers. has just given birth to a daughter with severe developmental abnormalities. 46. bilateral clef lip and palate. meets fetal oxygen requirements Fetal hemoglobin. +13 E. The infant has microcephaly. Around the time of birth. Question 30 Monique. The infant dies 10 days afer birth. Decreasing the levels of alpha globin would theoretically reduce the formation of alpha tetramers (see Chapter 10). so all sons will have one g2 allele and a Y chromosome.

she is herself a carrier for a mutation that causes cystic fibrosis. As Anne has an affected child. a 27-year-old woman is screened for a fully penetrant autosomal dominant disorder. Rebekah’s mother had the disease and died in her early 40s. Studies have shown that the frequency of cystic fibrosis among individuals of Northern European descent is 1/2500. She divorces her husband and marries Alex. Approximately 2% B. There is a 1/2 chance Anne will pass along her mutated allele to her next child. has a child with cystic fibrosis. the frequency of the normal allele (p) is 49/50. Bayesian analysis can be used to incorporate the findings from the screening test to determine a new risk. if the disease frequency is 1/2500 (q²). Approximately 4% C. which is 1/50. What now is the best estimate of her risk of developing the disease? A. Question 35 Leevi. there was an a priori risk of 50% that Rebekah would inherit the mutation from her mother and develop the disease. beta) hemoglobin (see Chapter 10). Leevi. Approximately 96% E. Question 33 Anne. 97.Individuals with mutations that impair beta globin production begin to show symptoms as the proportion of fetal hemoglobin drops without a concomitant rise in adult (alpha. a genetically unrelated man from France.5% D. 1/4 Cystic fibrosis is an autosomal recessive disorder. Question 32 An autosomal recessive disorder has a frequency of 1 per 2500 in the Caucasian population. Rebekah tests positive. the chance he would pass it along to his child is 1/2. 1/250 C. a young woman from the UK. According to Hardy-Weinberg equilibrium. 90% B. 1/2500 B. The frequency of the homozygous normal genotype is (p)x(p) = p² (49/50)² = 2401/2500 ≈ 96%. 1/25 E. the frequency of the disease allele (q) is the square root of the frequency of the disease (1/2500). 1/100 D. 95% C. What is the risk that Anne and Alex will have a child with cystic fibrosis? A. the frequency of the disease allele is q = 1/50. Since the frequency of the disease allele plus the frequency of the normal allele must equal 1. Approximately 98% According to Hardy-Weinberg equilibria. Approximately what percentage of this population has two copies of the normal allele for this gene? A. All known cases of this disorder result from an identical mutation in the causative gene. If Alex has the mutation. Question 34 Rebekah. Putting this all together gives a risk of 1/25 × 1/2 × 1/2 = 1/100. Approximately 90% D. 98% E. The screening test detects affected individuals with a 98% sensitivity and a 5% false positive rate. 99% Before the screening test. The chance that Alex is a carrier for cystic fibrosis is 2pq ≈ 2q = 1/25. . a 32-year-old man of Finnish descent had a sibling who died at the age of 10 from cystic fibrosis (CF). Clinical symptoms for this disease do not generally appear until the fourth decade of life.

Uniparental disomy C. What test should be ordered . DNA samples are not available from his brother or from his parents. He undergoes DNA testing for the 70 most common CFTR mutations – a panel that detects 90% of the mutations found among individuals of northern European descent. given that he tested negative for the CF panel. his new risk of being a carrier for CF is 1/6. 1/6 D. however. 1/15 E. Nucleotide substitution E. located at 17p13. has recently married and would like to start a family. infant who is hypotonic. 2/3 B. Fluorescent in-situ hybridization (FISH) D. The mutation is too large to be detected using standard DNA sequencing or DHPLC methods — the normal copy of the LIS1 gene would be amplified and screened. Given this finding. rapid breathing. The difference in gene dosage at the LIS1 gene could. characterized by short stature. 1/4 C.3. Question 36 Robert is diagnosed with Prader-Willi syndrome (PWS). Chromosome duplication D. Given this information. Because he is not affected with the disorder. also be identified using a quantitative approach such as quantitative PCR. Question 37 Many cases of Miller-Dieker syndrome are caused by microdeletions within the region of the LIS1 gene. what is the probability that he is a heterozygous carrier for CF? A. Standard G-banding C. FISH examination of the PWS 15q locus shows no evidence of an interstitial deletion in this area. hypogonadism and learning disabilities. Chromosome translocation B. but is concerned about the risk of passing CF to his children. which molecular mechanism listed below is the most likely cause of Prader-Willi syndrome for Robert? A. Question 38 Steven is a 24-hour-old. the risk he is a carrier is 2/3. full-term. masking the presence of the deletion. who are both deceased. obesity. DNA sequencing B. his new risk of being a carrier for CF is 1/6. lethargic and has shallow. Which diagnostic technique would most likely detect a 75 kilobase deletion in this gene region? A. He tests negative for all 70 mutations. His mother gave birth 2 years ago to a son with similar symptoms who died 72 hours afer birth. The two chromosomes 15 are inherited maternally. Autosomal monosomy Uniparental disomy (the inheritance of two chromosomes from one parent) occurs in approximately 30% of Prader-Willi cases. 1/25 Begin with the prior risk that Leevi is a carrier for CF. So.who does not himself have CF. Then use Bayesian analysis to calculate the risk given his negative testing results. The microdeletion is too small to be identified by standard G- banding. Denaturing high performance liquid chromatography (DHPLC) FISH is the best technique for the case described.

At the end of meiosis what would the proportions be of normal. Ann B. Schizophrenia is a psychotic illness characterized by disorganized thought. which is equal to the concordance rate for dizygotic twins D. who gives birth to a son with the disorder. which leads to a build-up of ammonia. Question 40 The following pedigree shows the transmission of a very rare disorder. Plasma ammonia level C. Which individual in the pedigree is an obligate carrier for the mutant allele of the disease-causing gene? A. which renders the factor V resistant to cleavage. Question 42 Andrew is heterozygous for both the factor V Leiden mutation. disomic and nullisomic gametes E. Chromosome analysis B.on Steven first? A. Sweat chloride level D. Mike E. which reaches the brain and can cause irreversible damage and death. disomic. Jim D. Hemoglobin electrophoresis Steven has the symptoms of a urea cycle disorder. Equal number of disomic and nullisomic gametes D. is an obligate carrier. and a daughter who is a carrier. The incidence of schizophrenia is increased among biological relatives of schizophrenic adoptees compared to the biological relatives of control adoptees C. altered behavior and a decline in social functioning. Sallie This represents a disorder with an X-linked recessive inheritance pattern. genetically influenced? A. More disomic than nullisomic gametes C. Sallie. Elevated ammonia levels are a hallmark of urea cycle disorders. The lifetime risk to develop schizophrenia is 1% for an individual in the general population and rises to 4% if the associated schizoid personality disorder is also considered B. What finding suggests the development of schizophrenia is. Nondisjunction at this stage results in two gametes with extra chromosomes and two gametes with missing chromosomes (see Chapter 3). at least in part. The concordance rate for monozygotic twins with schizophrenia is 15%. The concordance rate for schizophrenia for identical twins born to a schizophrenic parent is higher if the twins are reared together rather than reared separately Increased incidence among biological relatives provides support for genetic factors in the etiology of schizophrenia (see Chapter 15). All disomic gametes B. 1:1:2 ratio of normal. Plasma phenylalanine level E. disomic and nullisomic gametes The first meiotic division separates homologous chromosomes. The comparison of birth month to incidence of schizophrenia reveals an excess of winter births among individuals with schizophrenia E. 2:1:1 ratio of normal. Question 39 A nondisjunction event for chromosome 2 occurs during the first meiotic division of a primary spermatocyte. . Beth C. and nullisomic gametes? A.

the patient becomes unresponsive and develops a life-threatening morphine intoxication. Hypertension E. Thalassemia Individually. Other alleles inactivate CYP2D6 activity (‘poor metabolizer’ alleles). Question 44 Many cases of androgen insensitivity syndrome are caused by deletions within the androgen receptor gene located on the X chromosome. Normal/ultrarapid Individuals with ultrarapid CYP2D6 activity can produce greater amounts of morphine from codeine and as a result. This is especially likely when the other CYP2D6 allele is either normal or also ultrarapid. What diagnostic technique would most likely detect a 700 base pair deletion that completely removes exon 8 in this gene? A. There are over 80 distinct alleles identified for this gene. Coronary artery disease C.and the prothrombin variant G20210A. and very likely too small for FISH detection as well. DNA sequencing C. On the other hand. The deletion is certainly too small to detect by karyotype. Normal/normal B. Poor metabolizer/ultrarapid D. Southern blotting B. a deletion of this size is too large for detection by standard sequencing techniques. Inherited together. A few days into treatment. Mismatch repair . Question 43 One of the genes involved in codeine metabolism is CYP2D6. Question 45 Individuals with hereditary non-polyposis colorectal cancer (HNPCC) ofen have mutations in what class of genes? A. which increases prothrombin levels. Many alleles (classified as ‘normal’ alleles) do not alter enzyme activity levels. fully functional extra copy of the CYP2D6 gene (‘ultrarapid’ alleles). A 62-year-old man with bilateral pneumonia has a cough that does not respond to over-the-counter medication. This patient most likely possesses which of the following CYP2D6 allele combinations? A. An 800 band karyotype Southern blots are most likely to detect this relatively small deletion. Fluorescent in-situ hybridization (FISH) E. This enzyme mediates O-demethylation of codeine to produce morphine. Apoptosis pathway B. A 500 band karyotype D. A small number of individuals have CYP2D6 genes where a gene duplication event has created an adjacent. Normal/poor metabolizer C. the overall metabolic effect will appear as if there are two normal alleles present (see Chapter 12). may experience exaggerated clinical consequences in response to standard doses. they confer a twentyfold increase in risk (see Chapter 15). Venous thrombosis D. If the other allele is a poor metabolizer.or fivefold. He is given standard dosage of oral codeine to relieve the cough. Hemophilia B. What disease is he is at an increased risk of developing? A. a component of the cytochrome P-450 family. the factor V Leiden mutation and prothrombin variant both increase the risk of deep vein thrombosis four.

autosomal dominant. premature aging syndrome. resulting in the loss of the final 150 nucleotides. G-banding and MECP2-specific fluorescent in-situ hybridization (FISH) B. how does the gender of the carrier affect recurrence risks for additional children with Down syndrome? A. Quantitative PCR and Southern blotting DNA sequencing or DHPLC-based screening will identify the point mutations. Question 47 Classic Rett syndrome is an X-linked. Cell adhesion HNPCC is due to mutations in a series of proofreading genes involved in the repair of DNA mismatches that arise due to errors in DNA replication (see Chapter 14). the chromosomes of the parents are also examined to determine whether either parent is a balanced carrier of the translocation. which are too small to be detected by a standard G-banded karyotype. Recurrence risks are higher if the father is the carrier C. Recurrence risks are higher if the mother is the carrier . The entire last exon is spliced out of the transcript during processing D. When a translocation Down syndrome case is identified. Denaturing high-performance liquid chromatography (DHPLC) screening and DNA sequencing C. DNA sequencing and Southern blotting E. If one of the parents is identified as carrying the translocation. which activates a cryptic splice-site donor in the last exon of the gene that is 150 nucleotides 5′ of the traditional GT donor site. What combination of tests should be ordered to maximize the likelihood of identifying a causative mutation in a patient with the clinical symptoms of Rett syndrome? A. 99. Signal transduction D. the additional chromosomal material is the result of a Robertsonian translocation between chromosome 21 and usually either chromosome 13 or 14. an extremely rare. A different amino acid is inserted in the protein at the site of the mutation C. but then experience loss of language. the last exon is spliced at this location. Most cases are caused by a silent base substitution. Southern blotting. G-banding and quantitative PCR D. the protein will be 50 amino acids shorter. What is the most likely effect of this mutation? A. Approximately 80% of classic Rett syndrome mutations are point mutations and 15% are microdeletions encompassing the Rett gene. Recurrence risks are not influenced by the gender of the carrier B. A single point mutation in this gene is responsible for the majority of cases of Hutchinson-Gilford progeria. Rett syndrome is caused by mutations in the MECP2 gene and mutations that cause classic Rett syndrome are male lethal. When the transcript undergoes processing. Of the identified mutations. The final 50 amino acids are deleted from the end of the protein B. Question 48 In approximately 4% of all cases of Down syndrome. FISH or quantitative PCR will identify the microdeletions. motor skills and eventually purposeful hand movements. progressive neurological disorder observed in girls who appear normal for the first few months of life. but cannot detect the microdeletions (the non-deleted copy of the gene will amplify and provide normal sequence). a key component of the nuclear membrane. The lamin gene is transcribed at a reduced rate.5% occur de novo. decreasing protein levels Activation of a cryptic splice-site donor creates a new location for the exon/intron boundary. Consequently. Question 46 The LMNA gene on chromosome 1 encodes lamin protein.C.

Clinical variability Locus heterogeneity occurs when a disorder can be caused by a mutation in more than one gene. These cysts impair kidney function. Her children could either be unaffected or have PWS C. fertility among PWS individuals has been documented. they will only have their father’s PWS and AS gene regions. have AS or have PWS D. The PWS genes are active on the paternal copy. Question 50 A woman is affected with Prader-Willi syndrome (PWS) due to a deletion that includes both the Angelman syndrome (AS) and PWS genes. Which genetic term best describes the inheritance of this disorder? A. Germline mosaicism B. For male carriers. Her children could either be unaffected or have AS B. the AS gene is inactive on the paternal copy and as this gene is missing from the maternal copy. If they receive the deleted copy. . Question 49 Individuals with the autosomal dominant form of polycystic kidney disease (ADPKD) have numerous fluid-filled cysts within each kidney. There are two causative genes. If her children receive the normal copy. Although rare. but not both. All her children would be unaffected If this woman were to become pregnant. Co-dominant inheritance D. they will be unaffected. so the child will not have PWS. Individuals with ADPKD inherit a mutation in one of the genes.The recurrence risks for Down syndrome are approximately 10% if the mother carries the Robertsonian translocation involving chromosome 21. Digenic inheritance E. She could have children who are unaffected. this child would have Angelman syndrome. the risk is only 1 –3% (see Chapter 18). ultimately leading to kidney failure. PKD1 and PKD2. Locus heterogeneity C. she would either pass to her children her normal copy of 15q or the copy with the deletion. Which of the following options describe the potential outcomes if this woman were to become pregnant? A. However.