You are on page 1of 272

THIS WEEK DENIM Chemistry offers WORLD VIEW Research COLOURS Secrets of spider

EDITORIALS a greener route to blue


jeans p.128
funders should push for
open citations p.129
rainbow display revealed
p.131

Under new management


The mysterious benefactors who are about to take over the Arecibo radio telescope have an early
success to celebrate — whoever they are.

W
hen the US National Science Foundation (NSF) drew up a thing the big dish did was to return its gaze to Auriga.
plan to demolish its radio telescope near Arecibo, Puerto Like many veteran science experiments, Arecibo has an impres-
Rico, it did conclude that something positive would result sive back catalogue. In cinema history, it’s where Jodie Foster listened
— although it was only a minor and short-term benefit. Five specialists for aliens in 1997’s Contact, and where Pierce Brosnan’s James Bond
in explosives would need to spend a month on the Caribbean island, dispatched villain Sean Bean in GoldenEye (1995). In scientific his-
and, the NSF said in an environmental-impact statement last year, the tory, the telescope beamed a message meant for extraterrestrials to
local community could profit from what the visitors would spend on the globular star cluster M13 in 1974, and has probed dangerous near-
meals and lodging. Earth asteroids to help protect the planet
Hoteliers and restaurant owners aside, most of the local workers and “The discovery from cosmic impacts.
researchers who help to keep the giant dish functioning breathed a sigh comes after Now the NSF wants to free up money for
of relief last November, when the NSF announced that the telescope a tumultuous newer astronomical facilities by offloading
would remain standing. At least one partner organization had pledged couple of years some of its older ones, including Arecibo.
to help fund it, solving a cash crunch at the decades-old facility. for the Arecibo With the demolition plan nixed, the current
The identity of the saviours is still a closely guarded secret (although telescope.” funding arrangement will end in April and
everyone in the astronomy community has their own idea of the the NSF will officially hand the controls to
funders’ identity, ranging from overseas agencies to universities). the mystery newcomers, who have agreed to step in as the agency
Whoever they are, they are sure to be smiling to themselves this week. scales down its annual contributions from US$8 million to $2 million
Their new toy has shown what it can still do. over the next 5 years. (NASA will continue to pay one-third of the
In a paper in Nature this week, astronomer Daniele Michilli of the observatory’s costs.)
University of Amsterdam and his colleagues describe how they used The dish that the benefactors get for their money is no longer the
the Arecibo dish to track a mysterious signal from deep space called a world’s biggest telescope of its type. China switched on its larger Five-
fast radio burst (D. Michilli et al. Nature 553, 182–185; 2018). These hundred-meter Aperture Spherical radio Telescope (FAST) in 2016,
powerful but short-lived flashes of radio noise were first discovered and the facility is already making headlines by chalking up discoveries
a decade ago, but their source remains unknown. They are one of the — three new pulsars last month alone. But the sky is a big place, and
biggest outstanding astrophysical mysteries today. there is plenty of science to go around. Arecibo is rightly safe from the
Most of these sources blaze into life just once and then vanish. But a dynamite for now. ■
fast radio burst in the constellation Auriga, first spotted in November
2012, has shown itself many times since. Indeed, Michilli and his team

Science at sea
recorded at least 16 separate flashes of its activity. Each time, they
gleaned a little more information about its probable origin.
The trick, it turns out, lies in looking at the polarization of radiation
coming from the burst. The plane of polarization rotates when the
light travels through a magnetic field, an effect first seen by physicist Debate on a United Nations treaty to protect the
Michael Faraday in 1845. For the Auriga burst, the Faraday rotation
is large and variable — suggesting that the light must be travelling
open ocean offers an opportunity for scientists.
through a highly magnetized environment.

I
Until now, this type of Faraday rotation has been seen only close n a rare diplomatic breakthrough — and good news for marine
to black holes. So one possible explanation for this fast radio burst is scientists and conservationists around the world — nations agreed
that something is producing radio emissions very near to a black hole. in 2016 to protect a huge area of ocean off the coast of Antarctica
Imagine, perhaps, a dense neutron star burping out radiation that from commercial fishing and other harmful activities. That success
twists and rotates as it travels through its highly magnetized surround- came only after years of failed discussions. It was followed by another
ings. The work is the most precise look yet at what could be powering positive step: in December, Arctic Council countries decided not to
fast radio bursts (or at least one of them). fish industrially in the Arctic Sea.
The announcement of the discovery comes after a tumultuous These are good signs. Still missing, though, is a more significant
couple of years for the Arecibo telescope. Alongside the uncertainty agreement — a mechanism that would allow governments to create
over its funding, the facility — like much of Puerto Rico — was marine reserves in ecologically crucial ocean regions beyond any
battered and put temporarily out of action by Hurricane Maria last national jurisdiction.
year. On restarting its science observations last November, the first Could the United Nations Convention on the Law of the Sea

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 2 7
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
THIS WEEK EDITORIALS

fill the gap? The UN thinks so. On 24 December, it convened an patterns of critical species. They will also want to take a closer look at
intergovernmental conference to produce a legally binding treaty on how biological processes in the deep ocean control key chemical cycles,
the conservation and sustainable use of biological diversity in the high such as carbon uptake and release, that govern Earth’s climate.
seas outside national maritime boundaries. It’s a crucial first step, and Research can benefit from, as well as inform, protection. Recent stud-
is encouraging because it suggests that political will is building to draft ies show that marine reserves can help species adapt to ocean acidifica-
international rules that protect the ocean wilderness. tion and other impacts of climate change (see, for example, C. M. Roberts
The vote, after almost a decade of preparatory work, reflects scien- et al. Proc. Natl Acad. Sci. USA 114, 6167–6175; 2017). Such areas can
tists’ growing concern about the alarming state of the global oceans. serve as a control by which to evaluate the
And public awareness about issues such as overfishing, plastic pollution
“Implementation impact of fishing and environmental change
and species extinction is sharply on the rise in many countries. on marine ecosystems. Researchers can also
The planned treaty, due by 2020, is much needed. A global commons,
of any rules will help to set priorities, by working to identify
the high seas cover half of Earth’s surface and provide eco-services of have to rely on key ecosystems that need protection from
immeasurable value. Still, any new pact cannot address all the ills of the effective satellite overfishing and other human interference.
seven seas. The surge in plastic waste, for example, has to be tackled at surveillance.” A meaningful high-seas pact must also
its terrestrial source, mainly with the producers. But a well-crafted and encourage effective fisheries management
properly enforced rulebook can do much to protect ocean ecosystems outside protected areas, to support sustainable catch. And implemen-
from man-made harm. tation of any rules will have to rely on effective satellite surveillance
Any future network of high-seas reserves will need to cover a large of fisheries activities on the open ocean. The International Mari-
variety of species in representative ecosystems in all climate zones. To time Organization (and Interpol) is already using vessel-monitoring
do this, researchers with the UN Convention on Biological Diversity technology to track ship movements and suspicious activity.
suggest that marine protected areas should cover at least 10% of the The next step will be the first session of the intergovernmental
global ocean by 2020. At present, the figure is closer to 6% — almost all conference, on 4–17 September. It is unclear whether key fishing
in coastal waters. The higher target will be impossible to reach without nations — including the United States, Russia and China — will ratify
setting aside reserves in high-seas regions that are as yet legally out of any agreement. Encouragingly, these countries have not blocked the
reach. Hence the need for a new treaty. work of the preparatory committee. Other nations, including Norway,
The treaty’s range and scope are yet to be defined, and science has Iceland, Japan and South Korea, have signalled full support for a legally
the chance to help frame its demands, and to ensure that the goals binding instrument. The number of signatures required for the treaty
of protection and conservation are effectively met. Our understand- to be enforced is yet to be negotiated.
ing of marine ecosystems is best for coastal and inshore regions. An Whatever arrangements emerge, the UN’s move should provide
evidence-based approach to protecting the wilderness of the high seas ample research opportunities. Funders should take note. A treaty involv-
will require massive amounts of research. For example, to get a better ing an international research mandate  —  including a regime to regulate
sense of the scale of the looming ocean crisis, scientists need to map controversial geoengineering experiments such as ocean iron fertiliza-
ecosystem structures and deep-seabed habitats, and to track migratory tion ­— would be a boon for ocean health and responsible science. ■

In the jeans
http://dx.doi.org/10.1038/nchembio.2552; 2018).
The process borrows a chemical switch from nature. Inside plant
leaves, the unstable indigo precursor indoxyl is combined with glucose
and stored as a colourless molecule called indican. The researchers
An environmentally friendly way to dye denim mimicked this by adding genes to Escherichia coli bacteria to make
them secrete indican. To dye material with this biosynthetic indican,
could usher in a long-overdue new fashion. the scientists dissolved it in water and applied the solution alongside an
enzyme that stripped away the glucose to re-form indoxyl. This indoxyl

I
n his Latin description of the Gallic Wars, Julius Caesar wrote: “se then spontaneously oxidized to leuco­indigo. When removed from the
Britanni vitro inficiunt” — widely translated as meaning that the Brit- liquid, the leucoindigo reacted with the air and turned to indigo.
ons dyed themselves with woad. Hence, many sources will tell you, The clever mechanism goes further than previous attempts to clean
the Romans named the ancient people of northern Britain the Picts, or the process, because it kills two polluting birds with one stone. First, it
‘painted ones’. Among the objections to this claim is that woad is not a does away with the wasteful chemical synthesis of indigo.
very good dye for people — it’s caustic and irritates the skin and eyes. Second, unlike previous indigo biosyntheses, this project removes
It’s not a great dye for textiles, either. The indigo colour squeezed from the damaging bleaching stage that converts indigo to leuco­indigo.
plants including woad (Isatis tinctoria) doesn’t dissolve in water and Industry churns out some 50,000 tonnes of synthetic indigo a year,
so can’t penetrate and bind cloth fibres. Instead, it must be chemically and the bacterial system will need to be optimized and scaled up to
converted into a water-soluble compound called leucoindigo, or white make it commercially viable. The glucose molecules must be separated
indigo, which then adsorbs to the textile surface. It is most commonly and removed, for one, and the enzyme used to liberate the indoxyl is
used on denim. Over 4 billion denim garments are produced each year. expensive.
These days, most are dyed blue with synthetic indigo, but the artificial The scientists are optimistic that these challenges can be overcome.
colour must still be fixed using a potent bleaching agent. This is one rea- Are they right to be? One reason that biofuel production is cheap enough
son why indigo dyeing is so polluting, as shown vividly by the numerous to be possible commercially is that it uses enzymes farmed from fungi. A
rivers in China and elsewhere that have been turned blue by untreated useful step to prove the credentials of the greener denim dye would be to
waste from jeans factories. According to environmental groups, textile develop a similar low-cost way to make the required enzyme.
dyeing is one of the most polluting industries in the world. Still, indigo production has not always welcomed novelty. Until well
Indigo dyeing is so widespread that it is hard to replace with a into the eighteenth century, France protected its woad industry by
cleaner process. But scientists are trying. Writing online in Nature threatening users of indigo imported from India and other foreign
Chemical Biology, researchers describe a more environmentally sources with the death penalty. But given that the popularity of blue
friendly method of making and applying indigo dye that relies on denim shows no signs of slowing, the process that produces it sorely
genetically engineered bacteria (T. M. Hsu et al. Nature Chem. Biol. needs a new trend. ■

1 2 8 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
WORLD VIEW A personal take on events

Funders should mandate


KAY ADKINS, PHOTOGRAPHIC ARTIST

open citations
All publishers must make bibliographic references free to access, analyse and
reuse, argues David Shotton.

O
ver the past two decades, open access to journal articles, the OpenCitations Corpus, the repository I run with computer scientist
software and research data has changed from aspirational to Silvio Peroni, has already published 12.8 million citation links from
commonplace. However, truly open scholarship also requires PubMed Central under a Creative Commons waiver that puts them in
that bibliographic references be freely available for analysis and reuse. the public domain. These are fully curated and semantically enhanced
Citations — the links created when a published work acknowledges in Linked Open Data format to assist automated analysis.
other works in its bibliographic references — knit together independent Two significant barriers prevent comprehensive reference availability
works of scholarship into a global endeavour, and they are important for through Crossref. First, although it is easy to do so, two-thirds of
assigning credit to other researchers. Crossref ’s publisher-members, in particular the smaller ones, do not
Analyses of citations can reveal how scientific knowledge develops submit references along with the other details of their publications.
over time and illuminate patterns of authorship. Such information is The second obstacle is created by publishers that submit references to
essential for assessing scholars’ influence and making wise decisions Crossref, but do not make them open. Elsevier is by far the largest mem-
about research investment. Bibliographic databases and citation indices ber of this group, which also includes the American Chemical Society,
are also crucial to individual researchers: they enable automated tools IEEE and Wolters Kluwer Health. Elsevier deposits about one-third of
to hunt for relevant papers throughout the literature. all journal-article references stored by Crossref, these constitute nearly
Making reference lists from articles free to view two-thirds of those that are not presently open.
is insufficient for these purposes; to be useful, The rationale for Elsevier not opening up
open references must be stored in a machine-
readable format in a centralized repository. WHERE POLITE its references is financial: free availability of its
numerous bibliographic references would under-
Crossref, the DOI-registration agency used by ENCOURAGEMENT mine Elsevier’s ability to sell access to such data.
most academic publications, has provided such a
repository since 2000, but its references are freely FALLS ON Companies such as Elsevier have invested
considerable resources over many years into
available only if publishers explicitly specify that
they be made open. Funders and the scientific DEAF EARS, creating databases that can be used for bibliomet-
ric analyses. Elsevier argues that it is reasonable
community must push harder for this.
Last year was eventful for open references. In
STERNER MEASURES to charge for high-quality citation analysis, that
curating citation data entails costs, including
April, more than 60 publishers (including Springer ARE licensing fees, and that it cannot make reference
Nature) responded to a call from the Initiative
for Open Citations (I4OC) — an effort that I co-
founded — to unlock the reference lists of their
REQUIRED. lists from its journals freely available because it
could not then afford to add value to these data.
However, I believe that Elsevier’s decision not
scientific articles. By September, more than half to open up its raw reference data is misguided.
of the nearly one billion journal-article references deposited at Crossref Because it is bad for scholarship, it cannot be good in the long term for
had been made open, up from 1% before I4OC launched. Bibliometric a business that seeks to serve scholars. In an increasingly open world,
visualizations using this open data set have already appeared. They Elsevier’s reputation will suffer, and its publications will become less
reveal, for instance, how co-authorship maps within particular disci- visible. Instead, Elsevier executives should have more confidence in the
plines and, at a larger scale, links between disciplines. In December, advantage their analytical services give them in the citations market.
an open letter signed by more than 250 scientometricians called for I call on all parties who could potentially benefit — including
publishers to open up their references (see go.nature.com/2crblo9). researchers, librarians, bibliometricians, funders, academic and
For reasons of both international equity and methodological integrity, research administrators, governmental agencies, members of the gen-
scholars need access to comprehensive open reference data, and they eral public, and other stakeholders committed to open scholarship — to
need to be able to show the raw data behind their analyses. campaign for comprehensive open access to bibliographic references,
That is presently not the case. The two most authoritative sources and to actively develop, support and use services providing such access.
of citation data are Clarivate Analytics’ Web of Science, which grew However, where polite encouragement falls on deaf ears, sterner
from the Science Citation Index created by Eugene Garfield in 1964, and measures are required. Specifically, major funders should extend their
Elsevier’s Scopus, launched in 2004. Neither is open or comprehensive. open-access mandates and require grant recipients to publish only in
Most research universities pay tens of thousands of dollars annually journals whose publishers ensure their references are open. ■
to access one or both of them, whereas institutions and independent
scholars that cannot afford such a cost have no access. David Shotton is co-director of OpenCitations, and a senior
However, the idea that references are proprietary data is fading. In researcher at the Oxford e-Research Centre, University of Oxford, UK.
addition to the half-billion references already made open by Crossref, e-mail: david.shotton@opencitations.net

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 2 9
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
SEVEN DAYS The news in brief

RESEARCH

Views of science

CNRI/SPL
Most people in the United
States are in favour of science,
but few are knowledgeable
about how research is
conducted, according to a
survey by the advocacy group
Research!America, based
in Arlington, Virginia. The
survey, released on 2 January,
asked 1,005 people about their
views of science and scientists.
Although 82% of respondents
thought that scientists were
trustworthy, 81% could not
name a living scientist and
67% could not name a research
institution. About half of the
respondents said they believed
that great science will continue
under US President Donald
Trump’s administration,
and 67% agreed that public
Improved typhoid jab gets go-ahead
policies should be rooted in A new vaccine against typhoid fever will be procured by United Nations agencies. Gavi, an
the best available science. rolled out to millions of children in low-income organization based in Geneva, Switzerland, that
Research!America’s surveys countries, after the World Health Organization funds vaccines for low-income countries, said
have found similar results over (WHO) announced its endorsement on it would spend US$85 million on deploying the
the past decade. 3 January. The product — developed by Bharat vaccine, with child immunizations likely to begin
Biotech in Hyderabad, India — is a typhoid in 2019. Typhoid bacteria (Salmonella Typhi;
HEALTH conjugate vaccine, which means that it provides pictured), which spread through contaminated
longer-lasting protection and requires fewer food and water, cause an estimated 11 million
A costly treatment doses than do other typhoid immunizations. The to 20 million infections and 128,000–161,000
A gene therapy to treat WHO’s endorsement allows the vaccine to be deaths each year.
hereditary blindness will
cost US$425,000 per eye,
pharmaceutical company has still raised eyebrows, given the university was no longer in Andover and Cambridge,
Spark Therapeutics widespread concern over high in a position to host the event both in Massachusetts, and
announced on 3 January. drug prices. “due to certain issues [on] the in Groton, Connecticut. In
The US Food and Drug campus”. No further details 2012, Pfizer stopped a clinical
Administration approved the EVEN TS were given. The congress trial of an antibody therapy for
treatment, called Luxturna will now be held at Manipur Alzheimer’s disease because
(voretigene neparvovec), in Congress postponed University in northeast India it demonstrated no clinical
December; it was the first Organizers of the 105th Indian on 16–20 March. benefit. No therapies for
US approval for a gene therapy Science Congress have delayed Alzheimer’s are yet available.
that targets disease-causing the country’s largest gathering Dementia pull-out
mutations. Observers were of scientists until March amid The multinational drug firm FACI L I T I ES
keen to see what Spark, concerns over the venue. At Pfizer will abandon research
based in Philadelphia, an emergency meeting on on dementia treatments, AI industry hub
Pennsylvania, would charge 27 December, the Indian joining a stream of major China will invest 13.8 billion
for the treatment, which Science Congress Association pharmaceutical companies that yuan (US$2.1 billion) in
is administered only once in Kolkata postponed the have fled the high-risk research an industrial park devoted
in each eye and could set a conference, which was field in the past decade. On to artificial intelligence
precedent for future gene scheduled for 3–7 January 6 January, the company said (AI). The park in western
therapies. At $850,000 for a at Osmania University in that it expects to shed 300 US Beijing is expected to
full, two-eye treatment, the Hyderabad. The association jobs from its neuroscience host 400 companies and a
cost is below the predicted said in a statement that the discovery and early stage drug- national laboratory to house
price tag of $1 million — but event was postponed because development programmes collaborations between

1 3 2 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
SEVEN DAYS THIS WEEK

industry and domestic and PEO PL E basic-research agency. Petit


NASA

foreign universities and would succeed Alain Fuchs,


research institutions. Last UK science minister who left the job last October
July, the central Chinese Sam Gyimah was appointed — four months before the end
government released plans UK minister for universities of his four-year term.
for the country to become the and science on 9 January,
world leader in AI by 2030. as part of a reshuffle of the CL I M AT E CHA NG E
In November, it announced Cabinet, the government’s
that information-technology most senior decision-making Extreme weather
giants Baidu, Alibaba and body. Gyimah, who became Hurricanes, wildfires and
Tencent would be partners in a Member of Parliament other natural disasters
a national AI strategy. Google in 2010, moves from the caused a record US$306
has also set up an AI research Ministry of Justice, where billion in damages in the
centre in Beijing. he was a junior minister. He United States in 2017, the
campaigned for Britain to US National Oceanic and
ENERGY remain in the European Union Atmospheric Administration
in the 2016 referendum. The said on 8 January. Sixteen
Offshore drilling role of science minister will events each caused at least
The US Department of the remain split between the Spacelab mission, focusing on $1 billion worth of damage,
Interior has reversed course on Department for Education and scientific experiments. Young with Hurricane Harvey —
offshore drilling, proposing to the Department for Business, was the first person to have which hit Texas in August —
open up most coastal waters for Energy and Industrial flown into space six times. topping the list at $125 billion.
oil and gas development. The Strategy. Gyimah replaces Jo Other notable events included
draft leasing programme for Johnson, who moves sideways French-agency head hurricanes Irma and Maria,
2019–24, released on 4 January, to become a junior minister at France’s Prime Minister wildfires in California and
would overturn extensive the Department for Transport. Edouard Philippe has two tornado outbreaks in the
drilling restrictions put in place proposed Antoine Petit as central and midwestern United
under former US president Astronaut dies the next president of the States. The previous record
Barack Obama and allow for John Young, one of NASA’s nation’s main basic-science for damages — $215 billion,
energy development on more most experienced astronauts, funder, the CNRS. Petit is adjusted for inflation — was set
than 90% of the US outer died on 5 January from currently chief of Inria, the in 2005, the year that Hurricane
continental shelf. Under the complications of pneumonia. country’s research agency Katrina devastated Louisiana,
proposed plan, the interior He was 87. Trained as a test for computer science and Mississippi and other parts of
department would auction off pilot, Young (pictured) first applied mathematics. French the US Gulf Coast.
47 oil and gas leases over five flew in space in 1965 aboard President Emmanuel Macron
years, including 16 leases along Gemini 3. He orbited the endorsed the nomination Climate panel back
the east and west coasts — areas Moon in 1969 on Apollo 10, on 3 January, but Petit will A federal climate advisory
that have been off limits for and landed on the lunar near- still need to be interviewed committee disbanded in
federal leasing for more than side in the Descartes highlands and approved by both August by US President
three decades. The proposal in 1972 with Apollo 16. In houses of parliament before Donald Trump is being
opened to public comment on 1981, he commanded the being formally appointed. revived. Columbia University
8 January and faces opposition space shuttle Columbia on its With an annual budget of and the state of New York are
from environmentalists and maiden flight; two years later, €3.3 billion (US$3.9 billion), re-establishing the committee
many coastal states. he was commander of the first the CNRS is Europe’s largest to help businesses and state
and local governments make
better use of the US National
Climate Assessment, which
TREND WATCH
SOURCE: PEW RESEARCH CENTER (WWW.PEWRESEARCH.ORG)

DISCRIMINATION IN STEM JOBS is scheduled for completion


In the United States, 50% of women in science, technology, engineering this year. New York governor
and mathematics (STEM) jobs report experiencing discrimination at work.
Half of women in science, Andrew Cuomo, co-chair
technology, engineering and Women in STEM Men in STEM of an alliance of US states
mathematics (STEM) jobs in the In computer jobs that is committed to
In mostly male workplaces
United States say that they have action on climate change,
been discriminated against at Say they have announced the state’s support
work, according to a survey of experienced gender on 2 January. Columbia
nearly 5,000 people published discrimination University’s Earth Institute in
at work
on 9 January. That compares New York City is hosting the
with 41% of women in other Say gender has effort, and 10 of the original
made it harder
sectors. The survey also finds to succeed
15 committee members have
that more black people in STEM agreed to serve, including
jobs (62%) than in other jobs Say sexual climate scientist and former
harassment is a
(50%) report experiencing racial problem in their co-chair Richard Moss.
discrimination. Both groups say workplace
that negative stereotypes affect 0 20 40 60 80% NATURE.COM
recruitment and promotion. For daily news updates see:
www.nature.com/news
1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 3 3
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS IN FOCUS
COMPUTING Groups race to PALAEONTOLOGY Scratches on CLIMATE SCIENCE Carbon storage NEUROSCIENCE The tools to
develop silicon as a platform pterosaur teeth provide clues in wetlands shows surprising observe and manipulate
for quantum computers p.136 about the animals’ diet p.138 consistency p.139 memory get an upgrade p.146
WORLD VIEW

A Stratollite balloon made by World View is inflated in Page, Arizona.

S PACE SCIENCE

Scientific ballooning aims


for the stratosphere
Commercial providers open the market for new types of research flight.
BY ALEXANDRA WITZE as World View of Tucson, Arizona, are lofting “We’re turning what was rare scientific
BROOMFIELD, COLORADO payloads quickly and cheaply into the strato- ballooning into something routine,” Stern says.
sphere, between 16 and 30 kilometres up. The Balloons occupy a sweet spot between

P
rivate companies want to take scientific commercial balloon flights have new capabili- planes, which can survey small areas of land in
experiments sky-high in 2018 — aboard ties that open up fresh types of science — such great detail, and satellites, which span the globe
specialized balloons. as low-cost monitoring of natural disasters, but provide images at much lower resolutions.
For decades, agencies including NASA and or testing how to explore Venus by studying “We need observations from balloons, because
France’s National Centre for Space Studies have Earth’s geology, says Alan Stern, a planetary they’re just so powerful,” said Karl Hibbitts, a
flown balloon-borne experiments to realms scientist at the Southwest Research Institute planetary scientist at the Johns Hopkins Uni-
higher than aeroplanes can reach but lower in Boulder, Colorado, and a co-founder of versity Applied Physics Laboratory in Laurel,
than satellites’ orbits. Now, companies such World View. Maryland. He spoke at a meeting of the

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 3 5
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS IN FOCUS

Next-Generation Suborbital Research- After taking off in Idaho, the balloon soared View flights are actually there”, says Thomas
ers Conference in Broomfield, Colorado, on for 500 kilometres before touching down in Zurbuchen, NASA’s associate administrator
18–20 December. Montana. Like a high-flying metal detec- for science in Washington DC. “We’re really
Among the ballooning companies that tor, Grimm’s on-board equipment measured interested in doing some science on these
accept scientific payloads are Raven Aerostar of changes in electrical properties within a gran- new platforms.” (The agency funded Grimm’s
Sioux Falls, South Dakota, and Near Space Cor- ite-rich mountain range below. Collecting such World View flight.)
poration of Tillamook, Oregon. World View data over Venus could illuminate the geology To Adrienne Dove, a planetary scientist at
has made a splash in the past year by developing at or beneath the planet’s surface, says Grimm, the University of Central Florida in Orlando,
a standardized ‘Stratollite’ platform that dan- who hopes to fly further experiments in May. stratospheric balloons offer a new opportu-
gles beneath its balloons. A payload that might World View has also developed ways to hold nity to explore the physics behind spaceflight.
cost more than US$1 million to fly on a NASA its balloons nearly stationary over a point of She studies how dust clumps together in low-
balloon could fly for tens of thousands of dol- interest. The company directs the balloon up gravity conditions — important for lunar and
lars on World View if it shares a Stratollite with and down to catch planetary exploration — and has worked with
other experiments, Stern says. “We need the wind and keep sounding rockets and the ‘vomit comet’ aero-
In 2018, World View aims to fly up to four observations the craft in approxi- planes that create low gravity for short periods
times a month, says Jane Poynter, the com- from balloons, mately the same loca- during their parabolic flights. “My interest is
pany’s chief executive. Each balloon would lift because tion. Google’s parent, in developing microgravity capability on bal-
one Stratollite carrying one or more experi- they’re just so Alphabet, uses a loons, which currently doesn’t exist,” she says.
ments into the stratosphere. The longest flight powerful.” similar approach to Looking even further into the future is
so far lasted just over five days, but Poynter keep its Project Loon Siddharth Krishnamoorthy, an aerospace
says the company hopes to conduct weeks- balloons in one spot. The company has been engineer at the Jet Propulsion Laboratory
long flights in the near future. testing whether the balloons, built by Raven in Pasadena, California. His team wants
Robert Grimm, a planetary scientist at the Aerostar, can provide Internet connectivity to use stratospheric balloons to listen for
Southwest Research Institute, flew an experi- in places such as Puerto Rico, following last low-frequency infrasound signals com-
ment on a World View balloon in October to September’s devastating Hurricane Maria. ing from earthquakes, as a test for possible
test designs for a possible mission to Venus. NASA is developing advanced balloon future missions to probe for seismic activity
The planet’s surface is too hot for equipment technology for scientists, including its ‘super- on Venus.
to survive for long, but conditions high in pressure’ balloons that can fly for up to 100 That would mean floating in the strato-
Venus’s atmosphere are much more temperate days — a period suitable for long-term studies sphere above earthquake-prone places such
— meaning that scientists could use balloons such as certain astronomical observations. But as Oklahoma or California, listening for
as a way to study the planet for months, rather the work is expensive and technologically chal- infrasound signals and pretending they are on
than minutes or hours. lenging. For many experiments, “the World Venus. “Yes, it’s cool,” says Krishnamoorthy. ■

COMP U TING

Silicon gains ground in


quantum-computing race
Slow-starter seeks to catch up with rival techniques.
B Y D AV I D E C A S T E LV E C C H I curiosities, says James Clarke, who heads Intel’s information as 0s and 1s. In the quantum world,
quantum-hardware development. “I think you’ll units of information are called qubits, and each

I
n the next few weeks, a research group at hear a lot about silicon quantum computing this qubit can exist simultaneously in a ‘super­
the Delft University of Technology in the year,” Clarke says. position’ of both 0 and 1. Two bits can also be
Netherlands expects to receive an impor- The relatively modest device represents the entangled, so that the state of one qubit deter-
tant package. Its contents promise to increase latest move in the push to give silicon a boost mines the state of its partner. This enables quan-
competition in the race to produce useful over other approaches. Some scientists also see tum devices to conduct calculations in parallel.
quantum computers. promise in the silicon route. Physicists such as Physicists in many labs have developed
Shipped from the research-and-development Michelle Simmons at the University of New prototype quantum computers, which often
facilities of semiconductor giant Intel in Hills- South Wales (UNSW) in Sydney, Australia, are operate at temperatures close to absolute zero.
boro, Oregon, the parcel holds the first quantum developing their own ways of building quan- The frontrunners in the race use one of two
computer manufactured with the techniques tum computers using silicon. In May 2017, she methods to encode the qubits: single ions held
used to fabricate silicon chips in conventional founded an Aus$83 million (US$65 million) in traps, or oscillating currents in supercon-
computers. Although the silicon method cur- start-up called Silicon Quantum Computing, ducting loops. Both systems require exquisite
rently lags behind other approaches to building backed in part by the Australian government. control: the ion technique uses complex laser
quantum computers, the company hopes that Quantum computers aim to exploit two systems to read and write each qubit, and super-
the technique could accelerate the development small-scale phenomena to outperform their conducting qubits must each have a device to
of devices that go beyond proof-of-concept classical counterparts, which encode bits of control them using radio waves.

1 3 6 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
IN FOCUS NEWS

P U B L I S H I NG

Elsevier grants
a reprieve
It allows German institutions
continued journal access.

BY QUIRIN SCHIERMEIER

T
he Dutch publishing giant Elsevier has
granted uninterrupted access to its
paywalled journals for researchers at
around 200 German universities and research
institutes that had refused to renew their
individual subscriptions at the end of 2017.
The institutions had formed a consortium
to negotiate a nationwide licence with the pub-
lisher. They sought a collective deal that would
give most scientists in Germany full online
access to about 2,500 journals at roughly half
the price that individual libraries have paid
Techniques for fabricating conventional silicon chips could be used to make quantum devices. in the past. But talks broke down and, by the
end of 2017, no deal had been agreed. Elsevier
Proponents of the silicon technique see devices scale up, she says. “I want to engineer now says that it will allow the country’s scien-
YOSHIKAZU TSUNO/AFP/GETTY

major advantages in using a semiconduc- everything out that isn’t essential and make tists to access its paywalled journals without
tor to code qubits. They can be manipulated things as simple as possible.” a contract until either a national agreement
much more simply using microscopic electric In 2017, two groups reached a milestone is reached or 200 individual contracts are
leads etched right onto the chip. And if the when they designed the first fully controlla- hammered out.
same large-scale manufacturing techniques ble two-qubit devices in silicon. Petta and his The two sides had “constructive conver-
for making chips could be transferred to the collaborators achieved sations well into December”, says Harald
quantum realm, it could become easier to turn “I want to that feat 3 , as did a Boersma, a spokesman for Elsevier. “We will
the technology into commercial products. engineer separate team4 led by continue our conversations in the first quarter
everything Lieven Vandersypen of 2018 to find an access solution for German
A LONG ROAD out that isn’t at Delft. researchers in 2018 and a longer-term national
The idea of building quantum computers out essential and Inte l, w h i ch i s agreement,” he says. “Where access agreements
of silicon is not new. Bruce Kane, an experi- make things investing US$50 mil- ended, we have informed these institutions
mental physicist now at the University of as simple as lion over 10 years at that we would maintain access to our content
Maryland in College Park, first suggested possible.” Delft, is now manufac- while we continue to work with the German
encoding qubits in the magnetic orientation, turing multiple-qubit Rectors’ Conference [which leads negotiations
or ‘spin’, of phosphorus nuclei embedded electron-spin devices for Vandersypen, in the for the consortium] on a solution and specifi-
in silicon 20 years ago1. At about the same same type of factory where it develops micro- cally a one-year extension to existing contracts,
time, David DiVincenzo, a theoretical physi- processor-fabrication techniques. Indus- covering 2018.”
cist then at IBM in Yorktown Heights, New trial partners can help by providing reliably Günter Ziegler, a mathematician at the
York, and his collaborator Daniel Loss at the identical devices, he says. Free University of Berlin and a member of the
University of Basel in Switzerland proposed “We hope that we can accelerate spin consortium’s negotiating team, says that Ger-
a way of storing information in the spins of qubits to compete” with the more mature man researchers have the upper hand in the
mobile electrons inside semiconductors2. approaches, Clarke says. Simmons’ start-up talks. “Most papers are now freely available
Both proposals led to a number of experi- aims to build a ten-qubit machine within somewhere on the Internet, or else you might
mental demonstrations but, for a long time, five years. Google, IBM and a number of choose to work with preprint versions,” he says.
the quality of the materials limited progress. other companies and academic labs are all “Clearly our negotiating position is strong.”
Building a quantum computer using silicon using different techniques to build quantum Academic-publishing experts around the
took years of “not very flashy” developments computers with around 50 superconduct- world are keenly observing the situation in
in materials science and engineering, says ing qubits — and so is Intel itself, which is Germany. The nationwide deal sought by
physicist Jason Petta of Princeton University hedging its bets by supporting more than one scientists includes a open-access option, under
in New Jersey. Physicists at the UNSW Centre technical approach. ■ which all corresponding authors affiliated with
for Quantum Computation and Communica- 1. Kane, B. E. Nature 393, 133–137 (1998).
German institutions would be allowed to make
tion Technology, which Simmons directs, have 2. Loss, D. & DiVincenzo, D. P. Phys. Rev. A 57, their papers free to read and share for anyone in
done much of that groundwork. And Sim- 120–126 (1998). the world. This would be a milestone for global
mons developed a manufacturing technique 3. Zajac, D. M. et al. Science http://dx.doi. efforts to make the results of publicly funded
org/10.1126/science.aao5965 (2017).
that requires fewer control leads, preventing 4. Watson, T. F. et al. Preprint at https://arxiv.org/ research immediately and freely available to
inevitable issues of crowding once quantum abs/1708.04214 (2017). scientists and the wider public, they say. ■

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 3 7
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS IN FOCUS

Although pterosaurs existed for 150 million

MARK P. WITTON/CC BY 4.0


years, complete fossils are relatively rare, and
gut contents have been recovered from just
four species. That means that most hypoth-
eses about species’ diets have been “little more
than speculation based on scant evidence”, says
Bestwick.
He and his colleagues have so far examined
11  pterosaur species, looking at tooth
specimens held at institutions such as the
Natural History Museum in London and the
Museum for Natural History in Berlin. They
used infinite-focus microscopes to create 3D
images of tooth wear. They then used statistical
methods to look at wear patterns on pterosaur
teeth, alongside the teeth of living species of
bats, lizards and crocodilians that are known to
eat insects or fish and other vertebrates.
Analysis of the pterosaur Rhamphorhynchus
reveals wear patterns that are statistically similar
to those seen in modern relatives of crocodiles.
This suggests that Rhamphorhynchus ate fish,
Fossil teeth of Dimorphodon macronyx suggest that it ate insects and small land vertebrates. backing up a long-standing hypothesis about
the pterosaur’s diet, Bestwick says. Wear
PAL AEO NTO LO GY patterns on the teeth of Pterodactylus, the first

Pterosaur teeth
pterosaur ever described, in 1784, suggests that
it was an omnivore, as some experts had also
hypothesized, he adds.
Stephen Brusatte, a palaeontologist at the

reveal ancient diet


University of Edinburgh, UK, says the study is
one of the first attempts to use a rigorous sta-
tistical method to determine what these flying
reptiles ate. “This is a great example of how a
combination of cutting-edge techniques and
careful comparisons to modern species can
Feeding habits of flying reptiles have been much debated. help us understand how long-extinct animals
behaved,” says Brusatte.
BY JOHN PICKRELL pterosaur teeth for tiny abrasions caused by Steven Vidovic, a vertebrate palaeontolo-
food. Microscopic scratches and chips cre- gist at the University of Portsmouth, UK,

M
icroscopic scratches on fossil teeth ate characteristic surface textures that vary says that complete fossils of pterosaurs are so
are forcing palaeontologists to according to an animal’s diet, says Bestwick. rare because their light, hollow bones were
rethink some cherished ideas about The preliminary findings offer new details relatively fragile and unlikely to fossilize. The
the diets of pterosaurs — flying reptiles that about the feeding habits of some species, and lack of direct evidence of their diets has often
ruled the skies while terrestrial dinosaurs confirm theories about the diets of others. led to researchers making assumptions on the
flourished on the lands beneath them. Bestwick presented the results, which will form basis of the reptiles’ environment, he says. For
Since pterosaur fossils were first uncovered part of his PhD thesis, at the Palaeontological instance, pterosaur remains are often found in
in the eighteenth century, researchers have Association’s annual meeting in London on coastal environ­ments, which led researchers
made assumptions about their eating habits, 18 December. to assume that many species ate fish, he says.
mostly from indirect clues such as the shapes One surprise finding in the analysis raised Vidovic says the latest analysis will enable
of their teeth and the environments they lived questions about the pterosaur Dimorphodon palaeontologists to test theories about ptero-
in. But Jordan Bestwick, a palaeontologist at macronyx, which researchers assumed had saurs’ diets. “This new method presents a real
the University of Leicester, UK, and his col- hunted fish. The wear and tear on the reptile’s opportunity to observe the hardness and abra-
leagues sought more-direct evidence: they teeth suggests that it actually feasted on insects siveness of the food pterosaurs were consum-
performed the first examination of fossilized and land vertebrates. ing, and test hypotheses of ecology,” he says. ■

TO P N EW S M OR E NE W S N AT U R E P ODCAST

Rhinoceros ● Long-awaited US report Tabletop


MORE
MARTIN HARVEY/GALLO/GETTY

poachers charts course for studies physics; what a


of Earth from space go.nature.
ONLINE
prosecuted memory looks like;
using DNA com/2cht2rg and conflict’s toll
database ● How the immune system on wildlife
go.nature. could stymie some CRISPR nature.com/nature/
com/2akgkny gene therapies go.nature.com/2d9zezy podcast

1 3 8 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
IN FOCUS NEWS

P UBLISHING

Indonesian preprint server takes off


Website’s creators aim to open up the country’s science to a wider audience.
BY IVY SHIH Bandung Institute of Technology in Indonesia. seem to be using INA-Rxiv to boost the chance
The server hosts papers in multiple of having their papers included in the govern-

A
preprint server that focuses exclusively disciplines — most in the natural sciences, ment’s new research-evaluation system, called
on Indonesian research passed a mile- followed by engineering, the social and behav- the Science and Technology Index (SINTA).
stone on 5 December when the number ioural sciences and arts and humanities — and Launched in January 2017, SINTA ranks
of papers posted on it reached 1,500. INA-Rxiv accepts material written in Bahasa Indonesian researchers and institutions by various metrics,
is one of the first preprint repositories to focus and English. It operates including the number of publications listed in
on the work of a single country. in partnership with the “In Indonesia, major citation databases and Google Scholar.
“I didn’t think it would be this huge in such Open Science Frame- we can produce But Irawan says that SINTA does not index
a short period of time,” says hydro­geologist work, a service run by original many open-access Bahasa-language jour-
Dasapta Irawan, who helped to create the Center for Open research and nals. Some researchers, he says, seem to use
INA-Rxiv, which launched in August. Science in Charlotte­ papers.” INA-Rxiv to get around SINTA’s limitation.
Most preprint servers specialize in par- sville, Virginia. That’s because articles on the preprint server
ticular academic disciplines — including Computer scientist Robbi Rahim at Indo- are automatically indexed on Google Scholar.
the original arXiv, which covers physics and nesia’s Medan Institute of Technology has Although Indonesian scientists have
mathematics. The four researchers who devel- uploaded 26 papers. One of those articles, embraced INA-Rxiv, some question whether
oped INA-Rxiv built it to draw attention to about multimedia learning in mathematics and it will improve the country’s research. Psychol-
Indonesian research, which they felt was going written in Bahasa, has been downloaded some ogy researcher Dicky Pelupessy of the Univer-
unnoticed by the international science com- 330 times. Rahim says that the site helps him sity of Indonesia in Depok says that research
munity. “I want people to understand that in to reach a big audience, because he can upload quality is one of the reasons Indonesian sci-
Indonesia, we can produce original research articles in both languages. entists struggle to get their research read and
and papers,” says Irawan, who is based at the Irawan says that some Indonesian scientists cited internationally. ■

C LIM ATE SCIENCE Over the past decade, scientists and policy­

‘Blue carbon’ defies


makers have pushed to protect the carbon
stored in coastal wetlands, known as blue
carbon. The goal is to address climate change
while protecting ecosystems that sustain

expectations
fisheries, improve water quality and protect
coastlines against storms. But raising money to
support such efforts often requires determin-
ing precisely how much carbon these ecosys-
tems hold, and how it accumulates over time.
Results of soil survey could bolster efforts to monitor and Windham-Myers’s team reanalysed raw
protect wetlands around the globe. data from some 1,500 sediment cores collected
over the past several decades, and 400 newer
samples. The data showed a clear relationship:
BY JEFF TOLLEFSON carbon funded by NASA. “The variability that the density of soils decreased as the fraction
everybody expected just doesn’t exist.” of carbon in those soils increased, and vice

T
idal wetlands come in many forms, Her team presented its findings last month versa. As a result, the amount of carbon in any
but they could be more alike below the in New Orleans, Louisiana, at a meeting of the given cubic metre of soil remained roughly the
surface than anyone realized. Whether American Geophysical Union; the researchers same, regardless of differences in vegetation,
it’s a mangrove forest in Florida, a freshwater plan to publish data from 1,500 soil cores climate, topography or water chemistry across
swamp in Virginia or a saltwater marsh in online as early as this month, and hope to blue-carbon ecosystems.
Oregon, the amount of carbon locked in a soil release information on the remaining 400 later “It’s almost like a universal constant,”
sample from each of these coastal ecosystems this year. says Stephen Crooks, an independent geo­
is roughly the same. The discovery could bolster efforts to assess morphologist in San Francisco, California,
That’s the surprising message from a new and protect the world’s coastal wetlands. These who analysed blue-carbon stocks in the latest
analysis of some 1,900 soil cores collected ecosystems accumulate vast stocks of carbon US inventory of greenhouse-gas emissions and
around the United States during the past that escape into the atmosphere when wet- sinks. That report, which the US Environmental
few decades. “In terms of carbon stocks, all lands are destroyed. Development alters some Protection Agency released in April last year,
tidal wetlands are very, very similar,” says 800,000 hectares of coastal wetlands around found that the United States’ 3.8 million hec-
Lisamarie Windham-Myers, an ecologist the world each year, sending roughly 500 mil- tares of coastal wetlands soak up 8.1 million
with the US Geological Survey (USGS) in lion tonnes of carbon dioxide into the atmos- tonnes of CO2 each year.
Menlo Park, California, who is leading a phere — double the carbon emissions of Spain Estimates from a century’s worth of
3-year, US$1.5-million assessment of coastal in 2016. soil surveys by the US Department of

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 3 9
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS IN FOCUS

But understanding how much carbon is in


WESTWINDGRAPHICS/GETTY

the ground is just a prelude to determining the


rate at which wetlands sequester carbon. That
figure depends in part on local topography and
on the rate at which seas rise and create more
space for carbon-rich sediments to accumulate.
And methane emissions vary widely depending
on whether water in a wetland is salty, fresh or
brackish. Similarly, understanding how much
carbon enters the atmosphere when a wetland
is drained for agriculture or other purposes
requires a more detailed understanding of the
soil make-up. All of this information must be
plugged into models to project how wetlands
will evolve in the coming decades.
Crooks hopes that providing better data on
the carbon stored by wetlands will encourage
governments to halt the destruction of these
ecosystems. “It’s important that we find every
mechanism that we can to offset our carbon
Tidal wetlands such as this marsh in Oregon can store large amounts of carbon. emissions,” Crooks says. “This is one piece of
the puzzle.” ■
Agriculture (USDA) showed more variation, overestimated carbon stocks in the region.
but those figures were based on data collected Crooks says that if soil measurements from
by people who were often thinking more wetlands elsewhere agree with the US findings, CORRECTION
about agriculture on land. In the Mississippi global estimates of carbon stocks could The image of the eclipse in ‘Images of
delta, for instance, many early measurements improve. Windham-Myers and her colleagues the year’ (Nature 552, 308–313; 2017)
were limited to surface sediments that are rich recently examined data from coastal wetlands was an artistic representation that did not
in carbon, and estimates of the soil density across Africa, and the results were consistent accurately depict the event. It has been
below the surface may have been too high. with the team’s analysis of cores from US tidal replaced with a new image online.
As a result, Windham-Myers says, the USDA wetlands.
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
TABLETOP PHYSICS
PUSHED TO THE EDGE
BY GABRIEL POPKIN
Researchers adapt atomic-
physics tricks to look for
evidence of new particles.

I
t’s possible that no one knows the electron in the shadow of high-energy facilities such as them to solve some of the thorniest remain­
ALYSSA SCHUKAR FOR NATURE

as well as physicist Gerald Gabrielse. He the Large Hadron Collider (LHC), the 27-kilo­ ing problems in physics. But six years’ worth
once held one in a trap for ten months to metre-circumference, US$5-billion particle of LHC data have failed to produce a definitive
measure the size of its internal magnet. accelerator near Geneva, Switzerland. “There detection of anything unexpected.
When it disappeared, he searched for two days was a time in my career when there weren’t More physicists are moving in Gabrielse’s
before accepting that it was gone. “You get kind very many people doing this kind of thing, and direction, with modest set-ups that can fit in
of fond of your particles after a while,” he says. I wondered if it was the right choice,” he says. standard university laboratories. Instead of
And Gabrielse has had ample time to become Now, he’s suddenly moving from the fringes brute-force methods such as smashing particles,
fond of the electron. For more than 30 years, of physics to the limelight. Northwestern these low-energy experimentalists use precision
he has been putting sophisticated electro­ University in Evanston, Illinois, is about to open techniques to look for extraordinarily subtle
magnetic traps and lasers to work to reveal the a first-of-its-kind research institute dedicated to deviations in some of nature’s most fundamen­
particle’s secrets, hoping to find the first hints just his sort of small-scale particle physics, and tal parameters. The slightest discrepancy could
of what’s beyond the standard model of par­ Gabrielse will be its founding director. point the way to the field’s future.
ticle physics — the field’s long-standing, but The move signals a shift in the search for Even researchers long associated with high-
incomplete, foundational theory. Yet for many new physics. Researchers have dreamed of energy physics are starting to look to low-
of those years, it seemed as if he was working finding subatomic particles that could help energy experiments for glimpses beyond the

1 4 2 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
FEATURE NEWS

Gerald Gabrielse in his standard model. If decade has been pinning down the shape of the experiments was conducted at Yale University
low-energy-physics such hints emerge, electron. Although it is usually seen as a simple in New Haven, Connecticut, by physicist David
lab at Northwestern they could point the point with negative charge, the electron could DeMille and his colleagues, using thallium
University in Evanston, way to explaining the have hidden complexity. If certain symmetries ions2. But DeMille was running out of ideas
Illinois, with postdoc mysteries of dark mat­ of nature — rules that say the Universe behaves for teasing more accuracy from his experi­
Wayne Huang. ter and dark energy, the same under various reversals — are vio­ ment, which was demanding an increasingly
which collectively lated, the electron’s charge won’t have a perfectly byzantine arrangement of highly calibrated
constitute some 95% of the Universe. “This is spherical distribution. Instead, virtual particles lasers, vacuum chambers and cryogenics.
sort of a tectonic shift in the way we think of that constantly wink in and out of existence will A breakthrough came in 2008, when two
doing physics,” says Savas Dimopoulos, a theo­ skew the overall distribution of charge, squash­ theorists at JILA, a research institute in Boulder,
rist at Stanford University in California. ing it slightly out of shape and giving it what Colorado, reported3 that the molecule thorium
physicists call an electric dipole moment, or oxide had an internal electric field roughly 1,000
SQUASHED SPHERE EDM (see ‘Searching the particle sea’). times the strength of thallium’s, which would
In some ways, these small-scale experiments The standard model predicts a tiny squashing make a precession effect in its electrons much
are a return to how particle physics was once — so small, Gabrielse says, that “there’s essen­ easier to see. Around the same time, Gabrielse
done. Gabrielse drew particular inspiration tially no hope to measure it in my lifetime”. But — who was then at Harvard University in
from a 1956 experiment by physicist Chien- Cambridge, Massachusetts — had wrapped
Shiung Wu. In a laboratory at what is now the up a long-running study and decided that he
US National Institute of Standards and Technol­ wanted to get into the electric-dipole game. He
ogy in Gaithersburg, Maryland, Wu found an
asymmetrical spatial pattern in how radioac­
tive cobalt-60 atoms emit electrons. The find­
“THIS IS SORT OF A talked to John Doyle, also a physicist at Harvard,
who had invented a new way to make focused
beams of cold, slow-moving molecules. DeMille
ing, along with theoretical work, confirmed that
two particles discovered almost a decade before TECTONIC SHIFT IN also contacted Doyle, and the three decided to
join forces. In 2009, the trio’s experiment, called

THE WAY WE THINK OF


were actually one and the same. It also helped Advanced Cold Molecule Electron EDM, or
to solidify faith in the burgeoning theoretical ACME, received a 5-year, $6.2-million grant
framework for the Universe’s fundamental par­ from the US National Science Foundation.

DOING PHYSICS.”
ticles and most of its fundamental forces, which
would soon evolve into the standard model. PRECESSION PROCESSION
But physics was already moving towards big­ The group set up shop at Harvard. Gabrielse
ger and more-expensive experimental machin­ worked on making the team’s lasers — eight in
ery. Buoyed by a flush of post-Second World total — more stable and accurate. Doyle focused
War cash and prestige, and by predictions that some theories posit as-yet-undetected particles on producing high-quality beams of thousands
new particles would emerge in high-energy that could make the electron’s EDM roughly one of thorium oxide molecules. And DeMille
collisions, physicists proposed increasingly billion times larger. Many of those theories fall designed a system to align the molecules and
powerful and expensive particle accelerators. into a class called supersymmetry, an extension shield them from outside interference.
And they got them: facilities sprung up at Stan­ of the standard model that could explain why In the experiment, a lab-made electric field
ford; at Fermilab near Batavia, Illinois; at CERN the Higgs boson’s mass is smaller than expected, orients the thorium oxide molecules. A pair of
near Geneva; and elsewhere. Quarks, muons, and that could unify the electromagnetic, weak lasers then sets the spin direction of an electron
neutrinos and, finally, the Higgs boson were and strong forces in the early Universe. It might inside each molecule to be perpendicular to the
discovered. The standard model was complete. also reveal the nature of dark matter. molecule’s internal electric field, and a magnetic
And yet, as a description of the Universe, Attempts to measure the electron’s EDM go field is used to make the particle’s spin precess.
it is incomplete. The standard model doesn’t back more than four decades. Physicists have If the electron has an EDM, it will slightly add
explain, for example, why antimatter and mat­ taken advantage of the fact that an electron to or subtract from that rotation. After about
ter were not created in equal parts at the start with an EDM can rotate, or precess, around an one milli­second, polarized laser light bouncing
of the Universe. If they had been, they would electric field, tracing out a loop. The stronger off the molecules reveals how far their electrons
have annihilated each other, leaving behind a the electric field, the faster — and more easily have precessed. The experiment is then repeated
featureless void. The standard model also says detectable — the precession. with the molecules’ orientations reversed, which
nothing about dark matter, which seems to bind But complications abound. Experimental­ should reverse the direction of precession due to
galaxies together, or about the dark energy that ists can’t work with solitary electrons, because an EDM. The larger the difference in precession
is pushing the Universe apart at an accelerating a strong electric field would cause them to angle, the larger the EDM.
rate. “I like to call the standard model the great skitter away. Luckily, atoms and molecules In early 2014, the researchers reported4 that
triumph and the great frustration of modern effectively lock electrons in place — and can they had not seen evidence for an EDM in their
physics,” says Gabrielse. On the one hand, he produce internal electric fields stronger than set-up, which was sensitive to an angular differ­
says, it lets physicists predict some quantities the strongest laboratory-made field. Because ence of about 100-millionths of a degree. That
“to ridiculous accuracy. On the other hand, we atoms and molecules absorb light at specific drove the upper limit of the electron EDM down
have a hole we can drive the Universe through.” frequencies, researchers can use lasers to trap by more than a factor of 10, to 8.7 × 10−29 in units
Gabrielse’s work trapping and probing and cool them — and nudge their internal of centimetres multiplied by electron charge. If
particles at very low energies has taken him to a electrons into different configurations. an electron were the size of Earth — and Earth
smaller facility at CERN, home of the LHC, to By the mid 2000s, several generations of a perfect sphere — the limit would correspond
hunt for differences between matter and anti­ experiments building on these techniques had to moving a patch of material roughly 20 nano­
matter (see Nature 548, 20–23; 2017). He and ratcheted down the upper limit on the size of metres thick from one pole to the other.
his colleagues have produced the most precise the electron’s EDM, but not quite to the level The ACME team argued that the result
measurement yet of a physical quantity — the that would reveal the influence of particles has big implications for theories beyond the
size of the electron’s internal magnet, or spin1. predicted by supersymmetry or other exten­ standard model, nixing many hypothetical
But one of his biggest focuses in the past sions of the standard model. One of those supersymmetric particles that would exist in an

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 4 3
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS FEATURE

energy range probed by the LHC. But one second over the age of the Uni­

NIK SPENCER/NATURE
some theorists counter that plenty of
remaining theories — supersym­
SEARCHING THE PARTICLE SEA verse. Researchers have since used
data from such clocks to search for
Physicists are hunting for evidence that the electron’s charge cloud
metric and otherwise — predict an might be not be perfectly round, which could indicate the presence changes in the ratio between the
electron EDM smaller than those of new particles. electron’s and proton’s masses and in
ruled out by the ACME team. Gabri­ the fine-structure constant — a fun­
The electron moves through a sea of virtual particles that are constantly
else finds the surviving theories more popping into and out of existence. According to many theories, these
damental parameter that governs
and more contrived. “Theorists are should distort the electron’s charge cloud, creating a corresponding the strength of the electro­magnetic
wily,” he says. “Every time we exclude property called an electric dipole moment (EDM). force. Others, following a proposal7
something, they try to wiggle out.” by Asimina Arvanitaki, a theorist at
ACME is not alone in this effort. An EDM would arise
the Perimeter Institute for Theoreti­
After earning a Nobel prize in 2001 along the same axis as cal Physics in Waterloo, Canada, are
for creating a new phase of matter the electron’s spin. using clocks to look for subtle oscil­
called a Bose–Einstein condensate, Virtual particles lations that might be created by a
JILA physicist Eric Cornell teamed up hypothesized dark-matter candidate
with Jun Ye, also at JILA, to look for an called the axion, or a related particle.
EDM Electron
EDM. Rather than manipulate mol­ charge cloud
So far, these investigations have
ecules as they pass by in a beam, as yielded no new physics. But they
The charge cloud would
ACME does, Cornell and Ye decided be distorted, making
show how a younger generation of
to use a rotating electric field to trap one side slightly more physicists is infusing the field with
molecular ions with large internal negative than the other. new ideas, says Dimopoulos, who was
fields, giving electron precessions Arvanitaki’s PhD adviser. “There’s a
longer to reveal themselves. DeMille lot of theoretical ideas that have been,
calls the idea “brilliant and far from To measure the size of in a sense, overlooked because every­
obvious”. the EDM, physicists The electron’s intrinsic body was focusing on the LHC and
expose electrons to Spin spin (and EDM, if any) can
Cornell faced a setback when he strong electric fields. be aligned perpendicular
the previous colliders,” he says.
lost an arm to necrotizing fasciitis to the electric field. No one expects such tabletop
in 2004. But it led to a joke he likes experiments to replace particle col­
to tell when he gives talks: “His left liders. Rather, they could guide
sleeve is empty, and he’ll say, ‘If any­ physicists to the right energy range
body should know about asymmetry, for more detailed study. Right now,
it’s me’,” says former lab mate Chris Electric field the collider community suspects that
Monroe, now a physicist at the Uni­ it needs more energy than the LHC
versity of Maryland in College Park. is designed to reach, but it’s unclear
After a decade building and refining how much will be sufficient. Find­
If the electron has an EDM, the Other theories predict a much
what Cornell calls a “two-tabletop particle will rotate, or precess, larger EDM, with a faster ings from low-energy experiments
experiment” (because it occupies around the direction of the precession. Measuring such a might influence a multibillion-dollar
two tables in his lab), he and his co- electric field. The standard model precession could indicate that decision about the next big collider,
of particle physics predicts an the EDM is influenced by
authors finally published their first immeasurably small EDM effect. as-yet-undiscovered particles. and that has put added pressure on
results last year5, coming within a researchers working in this tabletop
factor of 1.5 of ACME’s 2014 limit. “I realm. “We have to do almost every­
might not have started if I had realized thing with more care than is typical in
how hard it would be,” says Cornell. the standard atomic-physics experi­
Now, researchers are closing in on Small Large ment,” says DeMille.
EDM EDM
new EDM results. The ACME physi­ Gabrielse has high hopes for the
cists have increased the number of team’s next experiment — and for the
molecules they can send into their work at his centre at Northwestern,
experimental apparatus by a factor which is set to open this year. But he
of 400. They expect this and other can make no promises. “We’re fishing
improvements to sharpen the experi­ for a fish whose shape and colour and
ment’s precision by a factor of ten — allowing technology in service of fundamental physics: speed and equipment for biting are completely
them to hunt for effects beyond the energy atomic clocks. The frequencies of radiation unknown.” ■
range of the LHC. The JILA team is also gear­ absorbed and emitted by the atoms that make
ing up for experiments set to push beyond the up these clocks depend only on certain funda­ Gabriel Popkin is a freelance journalist based
LHC’s reach. And researchers at Imperial Col­ mental constants of nature. A slight deviation in in Mount Rainier, Maryland.
lege London who held a former electron-EDM those frequencies could lend support to theories
measurement record6 have plans for experi­ that attempt to explain why gravity is so much 1. Hanneke, D., Fogwell, S. & Gabrielse, G. Phys. Rev.
Lett. 100, 120801 (2008).
ments with laser-cooled ytterbium mono­ weaker than the Universe’s other forces. 2. Regan, B. C., Commins, E. D., Schmidt, C. J. &
fluoride molecules; they hope their test will be The ability to test this idea was out of reach DeMille, D. Phys. Rev. Lett. 88, 071805 (2002).
1,000 times more precise than ACME’s first run. until the early 2000s, when researchers devel­ 3. Meyer, E. R. & Bohn, J. L. Phys. Rev. A 78,
010502(R) (2008).
The electron isn’t the only low-energy peep­ oped atomic clocks that operate in the optical 4. The ACME Collaboration. Science 343, 269–272
hole into the world beyond the standard model. range of the electromagnetic spectrum instead (2014).
Some physicists are searching for EDMs in neu­ of in the microwave. Their higher frequencies 5. Cairncross, W. B. et al. Phys. Rev. Lett. 119, 153001
trons or atoms, which, like the electron, could meant that time could be sampled at a much 6. (2017). Hudson, J. J. et al. Nature 473, 493–496 (2011).
reveal a violation of one of nature’s symme­ higher rate, enabling the creation of clocks so 7. Arvanitaki, A., Huang, J. & Van Tilburg, K. Phys.
tries. Others are adapting an entirely different precise that they would lose or gain less than Rev. D 91, 015015 (2015).

1 4 4 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
PORTRAIT OF A MEMORY
Researchers are painting intricate pictures of individual memories and
learning how the brain works in the process.
BY HELEN SHEN

F
or someone who’s not a Sherlock superfan, cognitive neuroscience in the past decade are enabling researchers to uncover
ILLUSTRATION BY ANDY POTTS; PHOTOS FROM GETTY

neuroscientist Janice Chen knows the BBC’s hit detective fundamental rules about how individual memories form, organize and
drama better than most. With the help of a brain scanner, interact with each other. Using techniques for labelling active neurons,
she spies on what happens inside viewers’ heads when they for example, teams have located circuits associated with the memory of
watch the first episode of the series and then describe the plot. a painful stimulus in rodents and successfully reactivated those path-
Chen, a researcher at Johns Hopkins University in Baltimore, ways to trigger the memory. And in humans, studies have identified
Maryland, has heard all sorts of variations on an early scene, when a the signatures of particular recollections, which reveal some of the ways
woman flirts with the famously aloof detective in a morgue. Some peo- that the brain organizes and links memories to aid recollection. Such
ple find Sherlock Holmes rude while others think he is oblivious to the findings could one day help to reveal why memories fail in old age or
woman’s nervous advances. But Chen and her colleagues found some- disease, or how false memories creep into eyewitness testimony. These
thing odd when they scanned viewers’ brains: as different people retold insights might also lead to strategies for improved learning and memory.
their own versions of the same scene, their brains produced remarkably The work represents a dramatic departure from previous memory
similar patterns of activity1. research, which identified more general locations and mechanisms. “The
Chen is among a growing number of researchers using brain imaging results from the rodents and humans are now really coming together,”
to identify the activity patterns involved in creating and recalling a spe- says neuroscientist Sheena Josselyn at the Hospital for Sick Children
cific memory. Powerful technological innovations in human and animal in Toronto, Canada. “I can’t imagine wanting to look at anything else.”

1 4 6 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
FEATURE NEWS

The physical trace of a single memory — also called an engram — has cage and delivered foot shocks, while at the same time re-activating
long evaded capture. US psychologist Karl Lashley was one of the first to neurons that formed the engram of a ‘safe’ cage. When the mice were
pursue it and devoted much of his career to the quest. Beginning around returned to the safe cage, they froze in fear, showing that the fearful
1916, he trained rats to run through a simple maze, and then destroyed a memory was incorrectly associated with a safe place6. Work from other
chunk of cortex, the brain’s outer surface. Then he put them in the maze groups has shown that a similar technique can be used to tag and then
again. Often the damaged brain tissue made little difference. Year after block a given memory7,8.
year, the physical location of the rats’ memories remained elusive. Sum- This collection of work from multiple groups has built a strong case
ming up his ambitious mission in 1950, Lashley wrote2: “I sometimes that the physiological trace of a memory — or at least key components
feel, in reviewing the evidence on the localization of the memory trace, of this trace — can be pinned down to specific neurons, says Silva. Still,
that the necessary conclusion is that learning is just not possible.” neurons in one part of the hippocampus or the amygdala are only a
Memory, it turns out, is a highly distributed process, not relegated tiny part of a fearful foot-shock engram, which involves sights, smells,
to any one region of the brain. And different types of memory involve sounds and countless other sensations. “It’s probably in 10–30 different
different sets of areas. Many structures that are important for memory brain regions — that’s just a wild guess,” says Silva.
encoding and retrieval, such as the hippocampus, lie outside the cor-
tex — and Lashley largely missed them. Most neuroscientists now believe A BROADER BRUSH
that a given experience causes a subset of cells across these regions to Advances in brain-imaging technology in humans are giving
fire, change their gene expression, form new connections, and alter the researchers the ability to zoom out and look at the brain-wide activity
strength of existing ones — changes that collectively store a memory. that makes up an engram. The most widely used technique, functional
Recollection, according to current theories, occurs when these neurons magnetic resonance imaging (fMRI), cannot resolve single neurons,
fire again and replay the activity patterns associated with past experience. but instead shows blobs of activity across different brain areas. Con-
Scientists have worked out some basic principles of this broad ventionally, fMRI has been used to pick out regions that respond most
framework. But testing higher-level theories about how groups of neu- strongly to various tasks. But in recent years, powerful analyses have
rons store and retrieve specific bits of informa- revealed the distinctive patterns, or signatures,
tion is still challenging. Only in the past decade of brain-wide activity that appear when peo-
have new techniques for labelling, activating ple recall particular experiences. “It’s one of
and silencing specific neurons in animals
allowed researchers to pinpoint which neurons “I CAN’T IMAGINE the most important revolutions in cognitive
neuroscience,” says Michael Kahana, a neuro-
make up a single memory (see ‘Manipulating
memory’). WANTING TO LOOK AT scientist at the University of Pennsylvania in
Philadelphia.

IN SEARCH OF THE ENGRAM


Josselyn helped lead this wave of research with
ANYTHING ELSE.” The development of a technique called
multi-voxel pattern analysis (MVPA) has cata-
lysed this revolution. Sometimes called brain
some of the earliest studies to capture engram decoding, the statistical method typically feeds
neurons in mice3. In 2009, she and her team fMRI data into a computer algorithm that auto-
boosted the level of a key memory protein called CREB in some cells matically learns the neural patterns associated with specific thoughts or
in the amygdala (an area involved in processing fear), and showed experiences. As a graduate student in 2005, Sean Polyn — now a neu-
that those neurons were especially likely to fire when mice learnt, roscientist at Vanderbilt University in Nashville, Tennessee — helped
and later recalled, a fearful association between an auditory tone and lead a seminal study applying MVPA to human memory for the first
foot shocks. The researchers reasoned that if these CREB-boosted time9. In his experiment, volunteers studied pictures of famous people,
cells were an essential part of the fear engram, then eliminating them locations and common objects. Using fMRI data collected during this
would erase the memory associated with the tone and remove the period, the researchers trained a computer program to identify activity
animals’ fear of it. So the team used a toxin to kill the neurons with patterns associated with studying each of these categories.
increased CREB levels, and the animals permanently forgot their fear. Later, as subjects lay in the scanner and listed all the items that they
A few months later, Alcino Silva’s group at the University of could remember, the category-specific neural signatures re-appeared
California, Los Angeles, achieved similar results, suppressing fear a few seconds before each response. Before naming a celebrity, for
memories in mice by biochemically inhibiting CREB-overproduc- instance, the ‘celebrity-like’ activity pattern emerged, including activa-
ing neurons4. In the process, they also discovered that at any given tion of an area of the cortex that processes faces. It was some of the first
moment, cells with more CREB are more electrically excitable than direct evidence that when people retrieve a specific memory, their brain
their neighbours, which could explain their readiness to record revisits the state it was in when it encoded that information. “It was a
incoming experiences. “In parallel, our labs discovered something very important paper,” says Chen. “I definitely consider my own work
completely new — that there are specific rules by which cells become a direct descendant.”
part of the engram,” says Silva. Chen and others have since refined their techniques to decode
But these types of memory-suppression study sketch out only half memories with increasing precision. In the case of Chen’s Sherlock stud-
of the engram. To prove beyond a doubt that scientists were in fact ies, her group found that patterns of brain activity across 50 scenes of the
looking at engrams, they had to produce memories on demand, too. In opening episode could be clearly distinguished from one another. These
2012, Susumu Tonegawa’s group at the Massachusetts Institute of Tech- patterns were remarkably specific, at times telling apart scenes that did
nology in Cambridge reported creating a system that could do just that. or didn’t include Sherlock, and those that occurred indoors or outdoors.
By genetically manipulating brain cells in mice, the researchers Near the hippocampus and in several high-level processing cen-
could tag firing neurons with a light-sensitive protein. They targeted tres such as the posterior medial cortex, the researchers saw the same
neurons in the hippocampus, an essential region for memory pro- scene-viewing patterns unfold as each person later recounted the epi-
cessing. With the tagging system switched on, the scientists gave the sode — even if people described specific scenes differently1. They even
animals a series of foot shocks. Neurons that responded to the shocks observed similar brain activity in people who had never seen the show
churned out the light-responsive protein, allowing researchers to sin- but had heard others’ accounts of it10.
gle out cells that constitute the memory. They could then trigger these “It was a surprise that we see that same fingerprint when different
neurons to fire using laser light, reviving the unpleasant memory for people are remembering the same scene, describing it in their own
the mice5. In a follow-up study, Tonegawa’s team placed mice in a new words, remembering it in whatever way they want to remember,” says

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 4 7
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS FEATURE

Preston’s group found that when some people view one pair of images

JASIEK KRZYSZTOFIAK/NATURE
MANIPULATING MEMORY
To identify neurons that form part of a memory engram, researchers have
(such as a basketball and a horse), and later see another pair (such as
a horse and a lake) that shares a common item, their brains reactivate
developed systems for tagging, reactivating and silencing them. the pattern associated with the first pair12. This reactivation appears to
bind together those related image pairs; people that showed this effect
during learning were better at recognizing a connection later — implied,
NEURON TAGGING but never seen — between the two pictures that did not appear together
Neuron
tagging
Cells in the hippocampus (in this case, the basketball and the lake). “The brain is making connec-
are altered so that when
they fire, they produce a
tions, representing information and knowledge that is beyond our direct
light-sensitive protein. observation,” explains Preston. This process could help with a number
The mouse forms a of everyday activities, such as navigating an unfamiliar environment by
memory of a shock to
the foot, and the inferring spatial relationships between a few known landmarks. Being
neurons that are able to connect related bits of information to form new ideas could also
activated are tagged. be important for creativity, or imagining future scenarios.
Foot shock
In a follow-up study, Preston has started to probe the mechanism
Blue light behind memory linking, and has found that related memories can
pulses
merge into a single representation, especially if the memories are
acquired in close succession13. In a remarkable convergence, Silva’s
work has also found that mice tend to link two memories formed
MEMORY RECALLED closely in time. In 2016, his group observed that when mice learnt
Researchers can induce to fear foot shocks in one cage, they also began expressing fear
the tagged neurons to towards a harmless cage they had visited a few hours earlier14. The
fire using a blue laser.
Even in a different cage, researchers showed that neurons encoding one memory remained
the mouse recalls the more excitable for at least five hours after learning, creating a win-
foot shock.
dow in which a partially overlapping engram might form. Indeed,
when they labelled active neurons, Silva’s team found that many cells
participated in both cage memories.
These findings suggest some of the neurobiological mechanisms that
link individual memories into more general ideas about the world.
MEMORY “Our memory is not just pockets and islands of information,” says
SUPPRESSED Josselyn. “We actually build concepts, and we link things together
To block a memory, that have common threads between them.” The cost of this flexibility,
some studies use a
? protein that silences however, could be the formation of false or faulty memories: Silva’s
cells when exposed to mice became scared of a harmless cage because their memory of it
light of a certain colour.
Even in the cage where
was formed so close in time to a fearful memory of a different cage.
it formed the foot-shock Extrapolating single experiences into abstract concepts and new ideas
memory, the mouse risks losing some detail of the individual memories. And as people
cannot retrieve it.
retrieve individual memories, these might become linked or muddled.
“Memory is not a stable phenomenon,” says Preston.
Researchers now want to explore how specific recollections evolve
with time, and how they might be remodelled, distorted or even rec-
Chen. The results suggest that brains — even in higher-order regions reated when they are retrieved. And with the ability to identify and
that process memory, concepts and complex cognition — may be manipulate individual engram neurons in animals, scientists hope
organized more similarly across people than expected. to bolster their theories about how cells store and serve up informa-
tion — theories that have been difficult to test. “These theories are old
MELDING MEMORIES and really intuitive, but we really didn’t know the mechanisms behind
As new techniques provide a glimpse of the engram, researchers can them,” says Preston. In particular, by pinpointing individual neurons
begin studying not only how individual memories form, but how that are essential for given memories, scientists can study in greater
memories interact with each other and change over time. detail the cellular processes by which key neurons acquire, retrieve and
At New York University, neuroscientist Lila Davachi is using MVPA lose information. “We’re sort of in a golden age right now,” says Josselyn.
to study how the brain sorts memories that share overlapping content. “We have all this technology to ask some very old questions.”■
In a 2017 study with Alexa Tompary, then a graduate student in her lab,
Davachi showed volunteers pictures of 128 objects, each paired with one Helen Shen is a science journalist based in Sunnyvale, California.
of four scenes — a beach scene appeared with a mug, for example, and
1. Chen, J. et al. Nature Neurosci. 20, 115–125 (2016).
then a keyboard; a cityscape was paired with an umbrella, and so on. 2. Lashley, K. S. Soc. Exp. Biol. Symp. 4, 454–482 (1950).
Each object appeared with only one scene, but many different objects 3. Han, J. H. et al. Science 323, 1492–1496 (2009).
appeared with the same scene11. At first, when the volunteers matched 4. Zhou, Y. et al. Nature Neurosci. 12, 1438–1443 (2009).
5. Liu, X. et al. Nature 484, 381–385 (2012).
the objects to their corresponding scenes, each object elicited a different 6. Ramirez S. et al. Science 341, 387–391 (2013).
brain-activation pattern. But one week later, neural patterns during this 7. Denny, C. A. et al. Neuron 83, 189–201 (2014).
recall task had become more similar for objects paired with the same 8. Tanaka, K. Z. et al. Neuron 84, 347–354 (2014).
9. Polyn, S. M., Natu, V. S., Cohen, J. D. & Norman, K. A. Science 310,
scene. The brain had reorganized memories according to their shared 1963–1966 (2005).
scene information. “That clustering could represent the beginnings of 10. Zadbood, A., Chen, J., Leong, Y. C., Norman, K. A. & Hasson, U. Cereb. Cortex
learning the ‘gist’ of information,” says Davachi. 27, 4988–5000 (2017).
Clustering related memories could also help people use prior 11. Tompary, A. & Davachi, L. Neuron 96, 228–241 (2017).
12. Zeithamova, D., Dominick, A. L. & Preston, A. R. Neuron 75, 168–179 (2012).
knowledge to learn new things, according to research by neuroscien- 13. Zeithamova, D. & Preston, A. R. J. Cogn. Neurosci. 29, 1311–1323 (2017).
tist Alison Preston at the University of Texas at Austin. In a 2012 study, 14. Cai, D. J. et al. Nature 534, 115–118 (2016).

1 4 8 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
SUSTAINABILITY Two very
COMMENT HISTORY Did science help PUBLISHING Hold an annual CLIMATE CHANGE Study fragile
different visions of how to women to get the test to highlight hoax ecosystems’ response to
secure the future p.152 vote? p.154 journals p.155 warming p.155
NASA/JPL/UNIV. ARIZONA

Impact craters and atmospheric history on Mars provide information on how terrestrial planets form and evolve.

Exoplanet science 2.0


The study of life on and off Earth needs unified funding and a coherent plan,
say Caleb Scharf, Debra Fischer and Victoria Meadows.

I
t is more than two decades since we Neptune. One in six of these stars has an life may have thrived on a warmer Mars.
learnt that the Universe is awash with Earth-sized planet in an orbit that is tighter Within a decade or two, we might find
other worlds. Since 1992, more than than Mercury’s around the Sun1. traces of extraterrestrial life in our Solar
3,500 exoplanets have been discovered This plethora of rocky planets raises a System. The Mars 2020 and ExoMars 2020
orbiting stars other than our Sun. big question: is life common in the Uni- rovers are set to probe the Martian surface
The range of systems is dazzling. There verse? Even in our Solar System, there are in that year. NASA’s Europa Clipper and the
is at least one planet around any star that, plenty of places where organisms could European Space Agency’s Jupiter Icy Moons
like the Sun, is powered by fusing hydrogen potentially survive, such as in the oceans Explorer (JUICE) ventures will get close to
into helium. Sixty per cent of such stars har- of liquid water beneath the frozen surfaces Jupiter’s satellites by about 2030. The James
bour ‘super-Earths’ — rocky worlds that are of Jupiter’s satellite Europa and Saturn’s Webb Space Telescope will look farther
more massive than ours but smaller than moon Enceladus. Four billion years ago, afield, scrutinizing the atmospheres of

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 4 9
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
COMMENT

distant exoplanets in deep space2.


Insights from many disciplines are needed
to discover which ingredients, mechanisms
and environmental pathways create and sus-
tain life. Molecular biologists need to explain
how proto-life might operate. Evolutionary
biologists and ecologists need to probe life’s
interplay with alien environments. Geophys-
icists, geochemists and planetary scientists
need to describe how planets evolve over
billions of years. And astronomers have to
detect more remote biospheres, while astro-
biologists help to tie the pieces together.
Exoplanetary exploration should be
central to this quest. Although exoplanets
pique public attention, some astronomers
see this field as niche and immature — they
prefer to leave the review and funding of
interdisciplinary projects in exoplanetary
science to other fields. But if astronomers
aren’t included in such efforts, scientific
quality suffers. Exoplanet science requires Studying organisms from Yellowstone National Park’s hot springs can uncover conditions needed for life.
large and expensive teams, telescopes, sat-
ellites and computing facilities. But allied illustrate how exoplanet systems science can and chemical zones in nascent planetary

SMITH COLLECTION/GADO/GETTY​
fields such as planetary and Earth science draw disciplines together. systems unlike ours.
are established, vibrant and have their own Wider insights from astronomy are also
wish lists of discipline-specific projects What dictates planets’ variety and needed. A major question is how stars influ-
that are more ready for action than those properties? For example, why are the ence the planets around them. Stars spin
in exoplanet research. atmospheres and climates of Venus, Earth, and oscillate according to their age, internal
Competition over resources and intellec- Mars and Titan so different? To find out, we structure and activity. Young and low-mass
tual turf is fierce among all these fields. For must bridge the gaps between Solar-System, stars can emit intense X-rays and γ-rays or
example, astronomers may favour building exoplanet and astrophysical science. Obser- eject charged particles. These may erode the
space-based observatories to gather more vational data must be tied to models that atmospheres of planets and modify their
statistical data on exoplanets3. Meanwhile, simulate the evolution of the atmospheres, composition, affecting their surface tem-
planetary scientists might argue for detailed interiors and surfaces of planets over bil- perature and ability to hold water6. A planet’s
studies of a few planets. Both approaches lions of years5. Tools from data science must magnetosphere can mitigate this, but needs
are ultimately compatible, but that tension be adapted to tackle increasingly large and to be better understood.
erodes the clarity of goals and can make complex data sets. The elements in stars influence planet
funders nervous. The Solar System should serve as one formation, but it is unclear how. Elements
Crucial opportunities for scientists to calibration point while its statistical signifi- can accumulate in different areas of the disks
learn from one another are falling between cance is assessed. For example, structures that ring young stars. The build-up of mate-
the cracks. For example, most Solar-System in Jupiter’s atmosphere and magnetic field rial might be affected by the rates at which
research is barely influenced by exoplanetary revealed by NASA’s Juno spacecraft are stars and disks spin. The bulk properties of
studies, and vice versa. Yet exoplanet data changing views of the planet’s core and of stars and their births across the Milky Way
must be calibrated with knowledge about how gas giants form. Studies of vortices need to be investigated in more depth to
the Solar System, from the nature of runaway and reflective particles in Neptune’s atmos- establish how planets have formed from the
greenhouse-gas effects on Venus-like planets phere have shown how chemistry affects the Big Bang to today.
to how the orbits of young planetary systems spectra of ice giants. And the New Horizons
are reconfigured. mission to the dwarf planet Pluto and the How can we identify worlds that are
Dawn mission to the minor planets Vesta capable of harbouring life? The study of
INTERACTION, NOT ISOLATION and Ceres helped to trace how condensed exoplanets opens up a wider range of plan-
There has to be a radical shift. Now that volatile compounds are distributed in the etary characteristics than we can observe
answers about life’s universality are finally Solar System. in the Solar System alone, such as mass,
within reach, funding agencies and sci- Exoplanetary data challenge established composition and orbital configuration.
entists must step up. In our view, the ideas and put our understanding of the Knowledge of Earth’s deep environmental
field needs a systems-science approach4 Solar System into a wider context. For history, climate and chemical state is essen-
focused on interactions — between example, we now know that planets can tial for calibrating models that explore the
galactic environments, planet formation, form around binary stars, extremely close likelihood of life forming on other worlds,
orbital dynamics, heliophysics, atmos- to stars and in dense packs. Gas giants have perhaps under different conditions. But
pheres, hydrospheres, cryospheres, geo- a wider range of chemical compositions a broader approach to planets would also
spheres, biospheres and magnetospheres than was previously thought. Planetary help to interpret Earth: from the puzzles of
— rather than on components in isolation. orbits can be highly elongated or inclined. ancient atmospheric oxygenation and chem-
This would extend Earth-systems science Astronomy facilities such as the Atacama ical and climatic change, to the influence of
to encompass other types of planet and Large Millimeter/submillimeter Array human activity.
ecosystem. (ALMA) in Chile are revealing details Geoscientists and astronomers need
Here we highlight three key questions that of the agglomeration of dust and solids, to develop better criteria for categorizing

1 5 0 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
COMMENT

planets, including those capable of hosting and land–ocean fractions are very different. centres and graduate programmes that
life. Concepts such as the ‘habitable zone’ Fundamental questions about cell function bridge astronomy, planetary science, Earth
around stars can guide our initial search, by and adaptation can be tackled theoretically science and biological sciences.
simplistically identifying rocky planets that and experimentally using virtual and labo- Networks are being created, such as the
might have liquid water on the surface. But ratory environments. Ecologists, planetary European Astrobiology Campus and the
the real challenge lies in modelling and meas- scientists and geoscientists must also exam- European Astrobiology Network Associa-
uring actual details of surface conditions and ine the nature of geospheres for planets of tion, to foster interdisciplinary training and
imagining evolutionary strategies in these widely different ages, as well as primitive communication. Efforts are under way to
places7. The presence of temperate surfaces atmospheres where molecular species such accelerate astrobiology research in China,
depends on many things, including the com- as hydrogen may be abundant. initiated by a team formed at the Inter-
position and photochemistry of the atmos- Uncertainties about the chemical and national Space Science Institute in Bern,
phere, the tilt and rate at which a planet spins thermal conditions of young planets must Switzerland. Since 2015, NASA’s Nexus
and the topography of a planet’s surface5. A be reduced. Where do the first biomolecules for Exoplanetary System Science (NExSS)
systems approach would be much more effi- come from, and what chemistry is involved in coalition has forged a community that
cient at formally identifying the most impor- life’s origins? Data from exoplanetary systems, supports the exchange of ideas and active
tant factors than current methods are. as well as from laboratory astrochemistry and collaboration. It comprises more than a
Existing efforts that bring climate models of planet assembly, can provide sce- dozen teams with diverse approaches to
scientists together with astronomers to narios for chemists and biologists to evaluate modelling and observing exoplanets.
build generalized climate models for rocky and study these processes experimentally. Building more coherence into efforts such
exoplanets could be the kernel for growing as these would be the next step towards exo-
this systems approach. These models, in NEW FRONTIERS planetary systems science. It must be the
turn, test the sensitivity of Earth’s proper- Exoplanetary systems science will be subject of a bigger conversation before the
ties to atmospheric conditions and extreme kick-started through the reorientation of next US decadal surveys, in 2020 for astron-
forcings of climate. research and the restructuring of funding pro- omy and in 2022 for planetary science. We
Basic geological research is needed to grammes. Funding agencies should replace encourage professional societies to address
understand the cores of planets, the weath- current grant silos with broader themes. the idea. These include the American Astro-
ering and transport of material on their For example, elements of the US National nomical Society, the AGU and the American
surfaces, their magnetic fields and the Science Foundation’s (NSF’s) Astronomy & Association for the Advancement of Science
probability that water is present. Exoplan- Astrophysics, Geophysics and Ecosystem (AAAS) and global organizations such as the
etary science is stimulating advances in Studies programmes could be replaced by one International Astronomical Union (IAU).
deep-Earth sensing, experimentation and exoplanetary systems science programme. A good start would be for the AAAS
modelling8. For example, the 2017 American The NSF’s solar and planetary research or the IAU to convene researchers from
Geophysical Union (AGU) autumn meeting programme, NASA’s Cosmic Origins pro- areas that are already embracing systems
hosted sessions on how heat and volcanism gramme and the European Research Coun- approaches to share their insights with exo-
influence the geochemistry, mineralogy cil’s Synergy Grant scheme still largely assign planetary researchers. We have a lot to learn
and petrology of Mercury, Venus, Earth, the funding in traditional ways. Fields such as from genomics, systems biology, complex
Moon, Mars and asteroids. Solar-System science systems, public health, data science and
and exoplanetary sci- “Funding machine learning. ■
How can we decode life’s relationship with ence should not have agencies
its environment? Life’s possible behaviour to compete. It is essen- should replace Caleb Scharf is director of astrobiology
on planets around other stars with different tial that agencies and current at Columbia University, New York City,
orbits, ages and histories is central to under- institutions support grant silos New York, USA. Debra Fischer is a
standing Earth systems and the origins and systems-inspired con- with broader professor of astronomy at Yale University,
early evolution of life on our planet. Micro- sortia. themes.” New Haven, Connecticut, USA. Victoria
biologists and astrobiologists need to inform The next-genera- Meadows is a professor of astronomy and
speculations about life elsewhere by provid- tion of space-based observatories that are principal investigator at the Virtual Planet
ing limits to its molecular capabilities. It is being discussed for selection in 2020 and Laboratory, University of Washington,
helpful to study terrestrial organisms that launch in the 2030s should be viewed as Seattle, Washington, USA.
live in extreme conditions, such as around systems-science missions. These include e-mail: caleb@astro.columbia.edu
deep-sea hydrothermal vents or hot springs, NASA’s Large UV/Optical/IR Surveyor
1. Dressing, C. D. & Charbonneau, D. Astrophys. J.
but astronomers and planet modellers must (LUVOIR) or Habitable Exoplanet Imaging 807, 45 (2015).
know the options for life’s possible effects Mission (HabEx). Their priorities should be 2. Deming, D. et al. Publ. Astron. Soc. Pac. 121,
on planetary chemistry and its interplay evaluated in an interdisciplinary light and 952–967 (2009).
3. Bean, J. L., Abbot, D. S. & Kempton, E. M.-R.
with abiotic processes if they are to find it. plans should be made accordingly for how Astrophys. J. Lett. 841, L24 (2017).
Work on metabolic pathways and on abiotic their time will be allocated10. 4. Mobus, G. E. & Kalton, M. C. Principles of Systems
photo­chemistry and geochemistry is chang- Some institutions have already moved in Science (Springer, 2015).
ing perspectives on chemical biomarkers this direction. Since 1998, the NASA Astro- 5. Mackwell, S. J. et al. (eds) Comparative Climatology
of Terrestrial Planets (Univ. Arizona Press, 2013).
and global chemical equilibria9. biology Institute, directed from NASA’s 6. Zahnle, K. J. & Catling, D. C. Astrophys. J. 843,
We need to know what fraction of a planet Ames Research Center in Mountain View, 122 (2017).
is capable of sustaining organisms, as well California, has funded astrophysics, exo- 7. Kasting, J. F. & Catling, D. Annu. Rev. Astron.
Astrophys. 41, 429–463 (2003).
as which chemical and climatic proper- planets, biology, chemistry and planetary 8. Duffy, T. S., Madhusudhan, N. & Lee, K. K. M. in
ties that can be observed astronomically exploration through a single programme. Mineralogy of Super-Earth Planets. Treatise on
may reveal a biosphere. Ecological mod- Some universities, such as the University of Geophysics 149–178 (Elsevier, 2015).
els in Earth-climate simulations need to Arizona in Tucson, the University of Wash- 9. Meadows, V. S. Astrobiology 17, 1022–1052
(2017).
be examined in the context of exoplanets, ington in Seattle and McMaster University 10. Fujii, Y. et al. Preprint at https://arxiv.org/
where radiation, rotation, planet orientation in Hamilton, Canada, have established abs/1705.07098 (2017).

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 5 1
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
Although few today

DENVER POST VIA GETTY


would self-identify as
followers of Borlaug
or Vogt, the heart of
Mann’s book asks how
people he considers
their intellectual heirs
propose to deal with
climate change and to
provide food, water
The Wizard and and energy for a pro-
the Prophet:
Two Remarkable
jected global popula-
Scientists and tion of 10 billion (or
Their Dueling more) by 2050. His
Visions to Shape Wizard camp ranges
Tomorrow’s World from biotech boost-
CHARLES C. MANN
ers to advocates of
Knopf: 2018.
geo­engineering. His
Prophets include the
authors of The Limits to Growth (Universe,
1972), along with the small-is-beautiful advo-
cates of organic agriculture and solar power.
The structure of The Wizard and the
Prophet reminded me of John McPhee’s bril-
liant Encounters with the Archdruid (Farrar,
Straus and Giroux, 1971). That book explored
the implications of the environmental move-
ment by arranging confrontations between
David Brower — long-time leader of the
conservationist Sierra Club and founder of
Friends of the Earth — and three presumed
foes. Brower debates a mining engineer, a
resort developer and a dam builder (the latter,
on a raft trip on a wild stretch of the Colorado
River). McPhee respected all four, and was
masterful at challenging stereotypes. Readers
were free to decide who had won the debates.
Ecologist William Vogt warned of the dangers of dwindling resources. Unfortunately, Mann’s study doesn’t meas-
ure up to McPhee’s classic. It is flawed in many
S USTAI NAB ILIT Y ways, most notably in its lack of even-hand-

Duel for the future


edness. Mann writes that he was a Vogtian
when young, later became a Borlaugian and
is now torn — but I don’t see that ambivalence
in the text. Mann indicts Vogt as a failure who
wasted precious time by leading people down
Adam Rome assesses a study of two scientists who have a dead end. He considers Borlaug a saviour,
even though the Green Revolution had
polarized attitudes to sustainability since the 1960s. unfortunate social and environmental con-
sequences, such as a growing concentration
of land ownership and pollution of waterways

O
ur species has had an amazingly contrasts the work of agronomist Norman through overuse of pesticides. Mann also
successful run. Billions of people Borlaug (the Wizard of his title) with that stacks the deck by ignoring problems with the
now live in environments radically of ecologist William Vogt (the Prophet). In Borlaugian approach and neglecting compel-
transformed to suit human needs and wants. 1970, Borlaug won the Nobel Peace Prize ling elements of the Prophetic tradition.
But humanity’s future is far from guaranteed. for developing high-yield varieties of wheat At root, the differences between Borlaug
How will we meet the looming challenges of that launched the Green Revolution. Along and Vogt were ideological, not scientific.
the twenty-first century? We can work even with agricultural chemicals and irrigation Borlaug accepted the mainstream values of
harder to master the planet with technological systems, Borlaug’s seeds led to a sharp rise his time and place — the American dream of
ingenuity. Or we might need to accept that our in productivity in Mexico, India and other material progress. Vogt didn’t; like all proph-
desires can’t be unlimited, and see ourselves as developing countries, particularly in the ets, he was a critic. He called for people to
citizens of a larger-than-human community, 1960s. Vogt’s 1948 best-seller Road to Sur- reappraise their place in the world: to think
rather than as world conquerors. We can’t do vival warned that rising population and ecologically about everything from what
both, science writer Charles Mann argues in declining resources spelt global catastrophe. we consume to how we understand history.
The Wizard and the Prophet, an effort to assess Whereas Borlaug hoped to free humanity He questioned whether “that sacred cow
which path holds the more promise. from the constraints of nature, Vogt called Free Enterprise” could be environmentally
To dramatize the two options, Mann for a new environmental consciousness. sustainable. And he advocated population

1 5 2 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
BOOKS & ARTS COMMENT

Books in brief
control, which went against many people’s
religious views and humanist ideals. Aside
from decrying the latter notion, Mann
engages with none of these ideas.
Instead, Mann turns the ideological divide Heavens on Earth
into a dispute about technological visions, the Michael Shermer Henry Holt (2018)
hard and soft paths (a dichotomy he appropri- An astonishing 75% of US citizens — including some avowed atheists
ates from physicist Amory Lovins). Wizards — believe in an afterlife. So potent is the idea of immortality, reminds
favour ‘hard’, sophisticated, capital-intensive, Skeptic magazine publisher Michael Shermer in this intriguing study,
top-down methods of ensuring adequate that it pervades human culture. After exploring the notion’s place in
food, water and energy, Mann argues. Proph- religious belief, Shermer examines its scientific manifestations, from
ets believe in simpler, decentralized, ‘soft’ transhumanism and longevity research to cryonics. He looks, too, at
solutions. But that definition is Borlaugian. It utopianism as the desire to create an earthly paradise. He concludes
assumes that the goal is to meet ever-greater that balanced rationality — along with an honest, positive acceptance
demand for natural resources — a premise of mortality — constitutes the real “soul” of life.
that most Vogtians reject, because they argue
that we need to moderate our desires, not
just find less destructive ways to slake them. Frankenstein and the Birth of Science
Even if Mann considers that argument naive, Joel Levy Andre Deutsch (2018)
fairness demands giving it a hearing. The bicentennial of Mary Shelley’s masterwork Frankenstein is
Mann also caricatures proponents of the upon us. And one of the first homages of the year is this episodic,
soft path — particularly Lovins. Lovins is entertaining analysis by science writer Joel Levy. He presents the
as can-do as any techhead; he’s not a coun- novel as a portrayal of high-Romantic “gonzo science”, as well
ter-cultural guru. Yet he does warn in Soft as science fiction. Levy contextualizes Shelley’s narrative with
Energy Paths (Friends of the Earth Interna- contemporary research into areas such as galvanic revivification,
tional, 1977) that hard technologies lead to psychoactive substances and polar discovery (as Victor
undemocratic concentrations of power, as Frankenstein and his monster travel to the North Pole). A celebration
major oil companies have proved. He is also of an enduring classic’s “extraordinarily rich confluence of sources”.
a leader in making the market greener, as a
consultant to corporations and as co-author
of Natural Capitalism (Little, Brown, 1999). The Story of the Earth in 25 Rocks
Although Mann dismisses him as a retro Donald R. Prothero Columbia University Press (2018)
activist, Lovins would be a worthy antagonist Geologist Donald Prothero has crafted a rock-solid premise for this
for any Borlaugian. delightful book: a tour of 25 geological discoveries that changed
And it’s to the Borlaugians that Mann is our understanding of Earth and the cosmos. He begins explosively,
most generous. He considers the evidence with Pliny the Younger’s eyewitness account of the eruption of
for the safety of genetically engineered crops Vesuvius in southern Italy in ad 79 — the first scientifically accurate
as compelling as the scientific consensus on description of such an event. He then reveals how deep time,
climate change. He holds out hope for nuclear the Moon’s origins and other ‘stories in stones’ were cracked by
power. And he barely acknowledges that luminaries from Enlightenment geologist James Hutton to Marie
history provides countless reasons for anxi- Tharp, who mapped the Atlantic Ocean’s floor in the 1950s.
ety about unintended consequences of tech-
nology. From plastics to chemical pesticides,
many twentieth-century miracles have done Our Senses
harm as well as good. Even some technology Rob DeSalle Yale University Press (2018)
boosters admit that surprises are inevitable, Sight, hearing, touch, smell, taste: the senses are our portal to the
although they remain undaunted. As the world. But this erudite, zesty study by Rob DeSalle, curator at the
automotive pioneer Charles Kettering liked American Museum of Natural History in New York City, ranges far
to say: “The price of progress is trouble, and I beyond these “big five” into arenas such as balance, pain, heat
don’t think the price is too high”. and cold. DeSalle examines sense in an array of fauna, including
Mann asserts that those who lean towards comb jellies, lampreys and bats. He digs deepest, however, into how
Vogt’s world view can’t prove that we’ll hit perception is formed in the human brain, how phenomena such as
planetary limits. But the heirs of Borlaug can’t synaesthesia arise, how people with brain damage experience the
prove that they’ll avoid making a mistake world, and how our sensory armoury feeds creativity.
that undermines the ecological or planetary
foundations of civilization. Where does that
leave us? The Wizards have had most of the The End of Epidemics
momentum since the Enlightenment. The Jonathan D. Quick and Bronwyn Fryer St Martin’s Press (2018)
Prophets keep the Wizards from overreach- Physician Jonathan Quick’s long experience at the front lines of global
ing, and challenge us to probe what we really public health gives his call to action on pandemics a searing urgency.
value. We need to listen carefully to both. ■ With writer Bronwyn Fryer, Quick examines how fear and complacency
impede responses to emergencies such as the 2014 Ebola epidemic
Adam Rome is a professor of history at the in West Africa. He then sets out a seven-part solution centred on
University at Buffalo, New York. His latest actions such as establishing resilient health systems and mobilizing
book is Green Capitalism?. on-the-ground activism. Pragmatic, insightful and research-rich, this is
e-mail: adamrome@buffalo.edu a key volume for the policymaker’s shelf. Barbara Kiser

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 5 3
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
admitted to the London Chemical Society.

GERRY CRANHAM/FOX PHOTOS/GETTY


Among the non-Newnhamites, Caroline
Haslett rose from the post of clerk at the
Cochran Boiler Company (which made parts
for ships) to train as an engineer during the
war. Later, she became the first female mem-
ber of the British Electricity Authority. For-
midable Scottish geologist Maria Gordon was
the first woman to be awarded a doctor of sci-
ence from the University of London, in 1893.
This group is completed by the “scientists
in khaki” and leaders of the Women’s Army
Auxiliary Corps, physician Mona Geddes and
botanist Helen Gwynne-Vaughan.
Fara also highlights achievements of
lesser-known women. We meet aeronautical
researcher Beatrice Mabel Cave-Browne-
Cave; spycatcher Mabel Elliott; and the dip-
lomatic-mail readers of the Admiralty’s Room
40 who, with their codebreaking counter-
parts, saw their covert wartime work persist
into peacetime. Fara discusses, too, medical
Botanist Helen Gwynne-Vaughan was controller of the British Women’s Army Auxiliary Corps. luminaries such as Helena Gleichen and Nina
Hollings, who worked in new fields including
H ISTORY radiography and physiotherapy. Interwoven

Science and suffrage


are fascinating glimpses of women about
whom “only snippets of information” survive.
Fara’s retrieval of them makes this narrative
more than the sum of its parts.
Elizabeth Bruton lauds a book tracing how women in But winning the war, and the vote, did not
result in equality: it would be another dec-
wartime research blazed a path to the vote and beyond. ade before the Equal Franchise Act of 1928
granted voting parity. And the interwar years
saw a return to prewar mores. Male veterans

A
century ago, women over 30 were higher degrees. Fara reclaimed jobs, and women’s opportuni-
granted the vote in Britain. (US shows how they cre- ties dried up, among expectations that they
women gained the vote two years ated opportunities in would return to the kitchen.
later, although African Americans and Native research, medicine, If there is a weakness in Fara’s approach, it is
Americans were still effectively disenfran- intelligence and code- that the focus on Cambridge graduates veers
chised for some years.) The UK watershed breaking. They opened close to a ‘Great Women’ echo of the ‘Great
coincided with the end of the First World doors in factories, aca- Men’ history that Fara criticizes. She does
War. Historian of science Patricia Fara com- demia, hospitals and acknowledge, if sparsely, difficulties experi-
memorates the moment with A Lab of One’s the battlefield. enced by working-class women, for example
Own, using archival research to draw together They also fought the in gas production and munitions. Neverthe-
A Lab of One’s
narratives of science, war and suffrage (as she Own: Science and
belief that women were less, she shows how women and their wartime
trailed in an essay: Nature 511, 25–27; 2014). Suffrage in the inherently lesser than work changed perceptions of female roles and
The standard take on this period is that First World War men, shaped by bio- competency, and influenced professional and
British women gained opportunities through PATRICIA FARA logical justifications, educated women earning their own living.
labour shortages, the result of 6 million men Oxford University including eugenics. In 1919, the Women’s Engineering Society
going to war. Thus, women were able to enter Press: 2018. Charles Darwin and was founded. A year later, the University of
fields such as science, technology, engineer- founder of taxonomy Oxford granted women the right to graduate.
ing, mathematics and medicine (STEMM). Carl Linnaeus, Fara claims, used their theo- The wartime changes were neither long-
Fara’s story differs. She shows how wom- ries to argue for the impossibility of sexual standing nor wide-ranging. But they were
en’s entry into these areas was shaped by the equality. In 1904, chemist Henry Armstrong — Fara argues — catalysts for many positive
prewar efforts and example of exceptional argued that, because women were thought to shifts in the workplace. The discrimination
women including archaeologist Agnes Con- be lower down the evolutionary scale, “educa- experienced by many of the women in A Lab
way; biochemist Ida Smedley; and political tion can do little” to modify their nature. of One’s Own is now illegal. Fara concludes
campaigner Ray Strachey, related to Virginia Fara’s nuanced narrative centres on a with an open-ended question: how can what
Woolf. (The title of Fara’s book, suggested by group of scientific and medical women, we learn from this history challenge other
historian Marsha Richmond, was inspired by many of them graduates of Newnham historical interpretations, and so inform the
Woolf ’s classic 1929 ‘A Room of One’s Own’.) College, Cambridge. Strachey studied math- future narratives of women in STEMM? ■
Along with agitating for the vote, these ematics before turning to politics, fighting
women called for more than the traditional for women’s economic, professional and Elizabeth Bruton is curator of technology
roles of domesticity, clerical work, nursing political power before, during and after the and engineering at London’s Science Museum.
and teaching. They lobbied for professional war. Conway studied history and chronicled e-mail: elizabeth.bruton@sciencemuseum.
opportunities, financial independence and women’s work. Smedley was the first woman ac.uk

1 5 4 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
Correspondence
Gene-drive e-mails accountable to the public — of Clinical Oncology guidelines for Climate Change, Leioa, Spain.
legally requested not to private public-relations now recommend that women ignacio.palomo@bc3research.org
firms or big-money agendas. with oestrogen-receptor-positive
Gene-drive technology does Accountability is exactly why we breast cancer should consider
indeed need proper scrutiny, have freedom-of-information 10 years of AET with tamoxifen. A serious nonsense
but it also needs transparent laws. Undermining those laws Balkees Abderrahman, V. Craig publishing proposal
and accountable governance undermines a free press. Jordan University of Texas
(see Nature 552, 6; 2017). In my Jim Thomas ETC Group, MD Anderson Cancer Center, The surge in open-access
view, your Editorial seems to be Montreal, Canada. Houston, Texas, USA. predatory journals is making
trying to excuse the influence jim@etcgroup.org bhabderrahman@mdanderson.org it harder for contributors and
of big-money manipulations on J.T. declares competing financial readers to distinguish these
scientific decision-making when interests; see go.nature.com/2ctjftu from legitimate publications — a
it comes to this risky technology. Fragile ecosystems to confusion that is fostered by
In so doing, I feel that Nature test climate targets the predatory-journal industry.
has crossed a line in conflating Arm against return One solution could be to deploy
a cornerstone of investigative of breast cancer At the 2015 climate summit a variant of a well-established
journalism — requests under in Paris, negotiators adopted quality-control test.
freedom-of-information laws — Your summary of the latest 2 °C as the upper limit for The scientific community
with outright theft. study by the Early Breast Cancer global warming, with a view to could submit replicate test articles
Specifically, you write that Trialists’ Collaborative Group, limiting it to 1.5 °C. I suggest several times a year to a wide
the release of 1,200 e-mails states that “Even after treatment, that more research is needed array of open-access journals,
from gene-drive researchers odds of recurrence are worse into ecosystems that are highly suspect and non-suspect. These
(obtained by Edward Hammond for the next 20 years” (Nature sensitive to temperature shifts manuscripts would use the
under US open-records laws) http://go.nature.com/2eob74j; and that deliver multiple organization and language of
“echoes the way in which hackers 2017). We find this statement ecosystem services, such legitimate science but would be
released documents stolen from unnecessarily alarming. as mountains and corals. readily identifiable as nonsense
climate scientists before a major The same group showed in Such work could help in the to someone in the field. The
UN meeting in 2009”. The two previous work that, at 15 years assessment of these targets process should be undertaken by
incidents are very different. of follow-up, women with and of the risks associated an independent group, perhaps
Those ‘Climategate’ e-mails were oestrogen-receptor-positive with climate-mitigation under the auspices and oversight
taken illegally. These e-mails, breast cancer who received options such as bioenergy and of the Directory of Open Access
dubbed the Gene Drive Files, adjuvant endocrine therapy geoengineering. Journals or the US National
were released by the institutions (AET) with the drug tamoxifen The Intergovernmental Panel Library of Medicine.
involved in accordance with legal for 5 years had a reduced risk of on Climate Change is moving The results could then be
requirements. There is nothing recurrence (risk reduction, 47%) forward with its special report made public to form the basis of
criminal about this. and of related mortality (risk on the 1.5 °C warming and a ‘journal integrity index’. This
Furthermore, climate deniers reduction, 29%). The yearly rate its Sixth Assessment Report. would avoid labelling journals as
used the Climategate e-mails to of death related to breast cancer Each document will need to predatory and reduce the risk of
claim that data had been falsified. also dropped by about one-third consider the future impacts of legal retribution.
Scientists robustly and correctly throughout the first 15 years (see the two targets on biodiversity, Such an objective assessment
responded through independent Early Breast Cancer Trialists’ ecosystems and humans — and of legitimate editorial practice,
inquiries that this was incorrect. Collaborative Group Lancet what it would take to achieve the which is currently almost
By contrast, the Gene Drive 378, 771–784; 2011). Women 1.5 °C target. impossible to verify, could help
Files concern issues of process: with this cancer type who did In the Himalayas, for to eliminate the scourge of fake
they corroborate how the Bill not receive this treatment had a example, projected mean journals that is threatening the
& Melinda Gates Foundation 46.2% probability of recurrence increases of 1.8 °C, 2.2 °C and scientific enterprise.
in Seattle, Washington, paid of breast cancer at 15 years. 3.7 °C in global mean surface Steven N. Goodman Stanford
US$1.6 million to a private The ATLAS randomized trial temperatures for 2081–2100 University, California, USA.
public-relations firm, apparently showed that extending AET (relative to 1986–2005) would steve.goodman@stanford.edu
with the intention of influencing with tamoxifen treatment from lead to significantly greater
the United Nations discussion 5 to 10 years reduced the risk loss of glaciers than if the
on gene drives by coordinating of relapse (risk reduction, 30%) projected increase is 1.5 °C or CORRECTION
what an ‘advocacy coalition’ of and of related mortality (risk less (P. D. A. Kraaijenbrink et al. The Outlook article
public researchers should say in reduction, 48%) after completion Nature 549, 257–260; 2017). ‘Combinations on trial’
an expert process. Nature failed to of therapy. The benefits of the These glacier changes would (Nature 552, S67–S69; 2017)
provide the details but readers can treatment were reaffirmed by affect biodiversity and human overstated the number of
make up their own minds. the aTTom randomized trial populations by altering species immunotherapeutic agents
Employment as a researcher (G. Schiavon and I. E. Smith distributions, water regimes, in development at more
at a publicly funded institution Breast Cancer Res. 16, 206; 2014). farming and the risks of outburst than 2,400. In fact, there are
is an immense privilege. These findings changed clinical floods from glacier lakes. roughly 2,000.
Such researchers are rightly practice. The American Society Ignacio Palomo Basque Centre

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 5 5
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS & VIEWS For News & Views online, go to
nature.com/newsandviews

P L ANE TARY SCIENCE

Cometary spin-down
The rotation rate of a comet more than halved in two months — a much greater change than has previously been observed.
This suggests that the comet is in a distinct evolutionary state and might soon reorient itself. See Letter p.186

J E S S I C A A G A R WA L During previous passes by the Sun,


known as perihelion passages, the

K
Rotation
ilometre-sized chunks of ice axis
comet had a high level of outgassing
and dust known as cometary activity, given its small size9. It passed
nuclei were left over from the by Earth at only one-seventh of the
Rotation
formation of the Solar System1. The Earth–Sun distance (an astronomical
vast majority of these objects orbit Comet unit, au) on 1 April 2017, and had its
the Sun in one of two cometary res- closest approach to the Sun at a dis-
ervoirs beyond the orbit of Neptune: tance of about 1 au on 12 April.
Recoil
the Kuiper belt and the Oort cloud. force
Bodewits et al. observed comet
When an object from one of these 41P in March 2017 using the Discov-
reservoirs enters the inner Solar ery Channel Telescope at the Lowell
System, it becomes an active comet Observatory in Arizona, and then in
— its ice is transformed into gas and May using the UltraViolet–Optical
carries along embedded dust to form Active Telescope on board the Swift space
area
a diffuse envelope (coma) and tail. observatory. Over the two-month
On page 186, Bodewits et al.2 report interval between their observations,
a dramatic decrease in the rotation the authors found that the comet’s
rate of comet 41P/Tuttle–Giacobini– rotation period increased from
Kresák (comet 41P) indicating that an already long 20 hours to more
this object could soon enter a phase Outgassing than 46 hours. Such a high rate of
of rotational instability and reorienta- change has not been seen in a comet
tion that has never before been seen before.
in a comet. The authors conclude that comet
A rotating celestial body that orbits Figure 1 | Asymmetric outgassing from a comet.  Bodewits et al.2 41P must be subject to an extremely
the Sun without being perturbed has report that the rotation rate of comet 41P/Tuttle–Giacobini–Kresák effective torque. They suggest that
a constant spin state — its rotation decreased rapidly between March and May 2017. They suggest that this this feature could be caused by out-
rate and the orientation of its axis slowdown was caused by the release of gas from a particularly active gassing from a particularly active
of rotation relative to inertial space area far from the comet’s rotation axis. Such asymmetric outgassing area far from the body’s rotation
would have generated a strong recoil force, accelerating the active area
(represented approximately by the in the opposite direction to the comet’s rotation and thereby reducing axis, oriented such that the gas flows
positions of stars) are fixed. But, in the comet’s rotation rate. in approximately the same direction
practice, many factors can change a as the rotation. The efficiency of the
body’s spin state. These include the torque is enhanced by the comet’s
gravitational pull of other objects, collisions, comet 67P/Churyumov–Gerasimenko, the comparatively small size, high outgassing rate
asymmetric emission of thermal radiation target of the European Space Agency’s Rosetta and slow overall rotation.
from the body3 and, particularly in the case of mission, a clear connection has been estab- Bodewits and colleagues extrapolated the
comets, the recoil force from the asymmetric lished between outgassing-induced torques comet’s rotation period in time to explore the
release of gas. and changes in rotation rate5. body’s past and future spin states (see Fig. 4 of
Gas that streams from a comet’s surface If a comet is spun up to a rotation rate at the paper2). Assuming comparable torques
accelerates the region of origin in the opposite which the centrifugal force near the equator during past perihelion passages, the authors
direction, like a rocket engine (Fig. 1). If surpasses gravitational and cohesive forces, found that the comet could have been rotating
the direction of this acceleration does not landslides and partial or even catastrophic with a period of about 5 hours, which is near
cross the body’s centre of mass, it will produce fragmentation can occur6–8. Such events would the fragmentation limit, before 2006. They
a turning effect called a torque. And if the be accompanied by strong sublimation (trans- hypothesize that this rapid rotation might
time-averaged torques on all surface elements formation of ice into gas) and dust production be linked to a bright outburst that occurred
do not cancel each other out, they will alter the from newly exposed areas, which is one pos- during the comet’s 2001 perihelion passage9.
comet’s spin state. Outgassing forces will also sible cause of sudden increases in brightness For instance, the rotation could have
affect the body’s orbit around the Sun4. called outbursts. induced a landslide or partial fragmenta-
Moderate changes in rotation rate have Comet 41P is a small (1.4–2.0 km in diam- tion in the comet, which would have been
been observed in several comets — in par- eter) body that originated from the Kuiper visible as an outburst. Alternatively, or in
ticular, those visited by spacecraft, for belt and was pulled into its current orbit in the addition, the event behind the outburst
which high-quality data are available. For inner Solar System by the gravity of Jupiter. might have uncovered an active area that

1 5 8 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS & VIEWS RESEARCH

is now causing the strong torque. A similar A change in comet 41P’s rotation axis would 37077 Göttingen, Germany.
sequence of events could have occurred in affect the seasonal distribution of heating e-mail: agarwal@mps.mpg.de
comet 103P/Hartley 2, which was visited across the body’s surface, the associated levels
1. Whipple, F. L. Astrophys. J. 111, 375–394 (1950).
by the Deep Impact Extended Investigation of activity and the pattern of mass transport 2. Bodewits, D., Farnham, T. L., Kelley, M. S. P. &
(DIXI) space mission8,10 in 2010. between different regions11. The global pro- Knight, M. M. Nature 553, 186–188 (2018).
Extrapolating comet 41P’s rotation rate cess of cometary erosion might therefore be 3. Rubincam, D. P. Icarus 148, 2–11 (2000).
4. Marsden, B. G. Astron. J. 74, 720–734 (1969).
forward in time, Bodewits et al. predict that redirected. Observations from the end of the 5. Keller, H. U., Mottola, S., Skorov, Y. & Jorda, L. Astron.
the period would have exceeded 100 hours in 2017 activity period and from the next perihe- Astrophys. 579, L5 (2015).
mid-2017. Such an extremely slow rotation lion passage in 2022 could document this yet- 6. Hirabayashi, M. et al. Nature 534, 352–355 (2016).
7. Jewitt, D. et al. Astrophys. J. 829, L8 (2016).
would no longer stabilize the comet’s spatial to-be-seen phase of cometary evolution, and 8. Steckloff, J. K., Graves, K., Hirabayashi, M., Melosh, H. J.
orientation, so that even small torques could reveal valuable information about the nature & Richardson, J. E. Icarus 272, 60–69 (2016).
make it wobble like a spinning top. If the cur- of comets and other planetary bodies. ■ 9. Combi, M. SOHO SWAN Derived Cometary Water
rent strong torque persists, it might eventu- Production Rates Collection (NASA, 2017).
10. A’Hearn, M. F. et al. Science 332, 1396–1400 (2011).
ally drive the comet to spin up again, possibly Jessica Agarwal is at the Max Planck 11. Keller, H. U. et al. Mon. Not. R. Astron. Soc. 469,
about a different axis. Institute for Solar System Research, S357–S371 (2017).

NE URO SCIENCE and constant structure. Intuition suggests that


this cannot be the case — the worm’s nervous

Neuronal plasticity in system is so complex that it must be based on


dynamic mechanisms. But few examples of
variability in C. elegans neurons have been

nematode worms
described until now.
The C. elegans inhibitory neuron DVB
makes different connections in the worm’s
two sexes: males and hermaphrodites4,6. A
Neuronal activity induces changes in the connectivity of a neuron called DVB in single process extends towards the head of
adult male nematode worms. This discovery provides an opportunity to study a the worm in both sexes, and a male-specific
fundamental process in this powerful model organism. See Article p.165 outgrowth towards the tail leads to the for-
mation of synaptic connections to a neuron
and muscles that control the movement of the
S C O T T W. E M M O N S between individuals. These properties, male’s spicules — a pair of hardened structures
together with the fact that connectivity data that insert into the vulva of the hermaphrodite

C
entral to the function of the nervous were obtained from only a few individuals, during mating6 (Fig. 1). The formation of these
system is its dynamic ability to undergo have created the impression that the C. elegans new synapses, and the loss of some old ones,
changes, for instance in the physiologi- nervous system is exceptional in having a rigid mean that spicule movement comes under the
cal properties of its constituent neurons, the
synaptic connections between them, and
the characteristics of individual synapses. Day 1 Neurexin Neuroligin
SPC
The hypothesis that neuronal activity can
DVB
lead to such plasticity, first proposed by the Promotes Inhibits
outgrowth outgrowth
neurophysiologist Donald Hebb in 1949, is Spicule protractor
fundamental to brain science, and has been muscle
confirmed in many studies1. On page 165,
Spicule
Hart and Hobert2 describe an example of
experience-dependent neural plasticity in
the nematode worm Caenorhabditis elegans,
a species in which this phenomenon has been
little studied3. Day 5
It is important to demonstrate this already
well-described and widely studied neural
Circuit
phenomenon in a nematode because C. elegans activity
is not just any worm, but a powerful experi-
mental model. Genetic studies in C. elegans
have led to the discovery of several molecular
components common to all nervous systems.
Furthermore, a complete map of neural con-
nectivity in the nematode nervous system has
been available for more than 30 years4,5 — such Figure 1 | Activity-dependent neuronal outgrowth in nematodes.  Hart and Hobert2 examined the
a connectome is not yet available for any other neuron DVB in nematode worms (Caenorhabditis elegans). They report that, between days one and five of
adulthood in male worms, DVB grows towards, and makes synaptic connections onto, spicule protractor
animal.
muscles and the spicule neuron SPC, which control a male-specific mating behaviour involving
Assembly of the C. elegans connectome was movement of a structure called the spicule. This outgrowth is regulated, at least in part, by two cell-
made possible not only by the worm’s tiny size adhesion proteins: neurexin is expressed by DVB and promotes outgrowth; and neuroligin is expressed
(1 millimetre long), but also because its cells by the spicule protractor muscles and SPC, and inhibits outgrowth. The authors show that the expression
are constant in number and identity, and its of neuroligin is repressed when the male undergoes copulatory behaviours, activating these muscles and
synaptic connections are largely conserved SPC — DVB outgrowth is therefore activity dependent.

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 5 9
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
RESEARCH NEWS & VIEWS

inhibitory control of DVB. This refinement to send processes, how its axonal extensions for understanding not only learning and
improves the male’s mating efficiency7. Hart recognize appropriate synaptic targets, memory, but also mental disorders and their
and Hobert now show that this male-specific and precisely how circuit activity controls sex-specific expression. ■
outgrowth of DVB occurs between days 1 neuroligin expression.
and 5 of adult life. The outgrowth produces a Finally, Hart and Hobert found that these Scott W. Emmons is in the Department
branching neuronal architecture that, unlike events occur only in males. The authors of Genetics and the Dominick P. Purpura
many neuronal circuits in C. elegans, varies attempted to stimulate DVB outgrowth in Department of Neuroscience, Albert Einstein
between individuals. hermaphrodites, but their results suggest College of Medicine, New York,
Hart and Hobert used fluorescent ‘reporter’ that neither circuit activity nor the neurexin– New York 10461, USA.
proteins to visualize DVB outgrowth and syn- neuroligin pathway are by themselves suffi- e-mail: scott.emmons@einstein.yu.edu
apse formation. Their analysis reveals that cient to do this. Other work10 in C. elegans
1. Holtmaat, A. & Svoboda, K. Nature Rev. Neurosci.
outgrowth does not occur if the male does not suggests that it is the complement of sex 10, 647–658 (2009).
experience copulatory activity. The authors chromosomes (two X chromosomes in the 2. Hart, M. P. & Hobert, O. Nature 553, 165–170
then mimicked natural behaviours by using hermaphrodite and only one in the male) in (2018).
sophisticated genetic techniques to activate or the cells of the circuit that ultimately makes 3. Jin, Y. & Qi, Y. B. Curr. Opin. Neurobiol. 48, 97–105
(2017).
inhibit the signalling or movement of DVB’s them respond to sex-neutral pathways in 4. White, J. G., Southgate, E., Thomson, J. N. &
target neuron and muscles, respectively. This sex-appropriate ways. Brenner, S. Phil. Trans. R. Soc. B 314, 1–340 (1986).
shows that activity in DVB’s targets stimulates Genetic studies9 have implicated muta- 5. Emmons, S. W. Phil. Trans. R. Soc. B 370, 20140309
the neuron’s outgrowth. tions in neural cell-adhesion genes, including (2015).
6. Jarrell, T. A. et al. Science 337, 437–444 (2012).
What molecular pathways might mediate neurexin and neuroligin, as the bases of 7. LeBoeuf, B. & Garcia, L. R. G3 Genes Genomes
DVB outgrowth? Neural cell-adhesion psychiatric disorders, partly because of Genet. 7, 647–662 (2017).
proteins are expressed on cell surfaces in the roles of these genes in neural plastic- 8. Williams, M. E., de Wit, J. & Ghosh, A. Neuron 68,
9–18 (2010).
the nervous system. They have extracellular ity. Progress in unravelling details of the 9. Südhof, T. C. Cell 171, 745–769 (2017).
protein–protein interaction domains that can molecular pathways underlying their activity 10. Portman, D. S. J. Neurosci. Res. 95, 527–538
mediate communication between cells, and are could therefore have profound implications (2017).
thought to have a role in encoding and build-
ing the nervous system’s synaptic structure8.
Two of the best-studied proteins in this class O R GA N O M ETA L L I C CH E M I ST RY
are neurexin and neuroligin, which can inter-
act with one another and are involved in syn-
apse formation and regulation9. As such, they
were natural candidates for Hart and Hobert
Dogma-breaking
catalysis
to test.
The authors examined the roles of these
proteins by combining genetic deletion or
overexpression of the proteins with stimula-
tion or suppression of activity in the circuit. The catalysts conventionally used for industrially important hydrogenation
These analyses led to several findings. First, reactions are expensive and generate toxic residues. Catalysts have now been
neurexin is expressed in DVB and is required reported that might lead to cheaper, less toxic alternatives.
for DVB outgrowth. Second, the activity of
neurexin is inhibited by neuroligin, which is
expressed in male sex circuits and muscles. D O U G L A S W. S T E P H A N chemistry led to the development of a wide
Third, neuroligin expression is suppressed by variety of transition-metal complexes that are

R
activity in the circuit, which explains why DVB eactions of hydrogen gas with organic highly effective catalysts for these reactions4.
outgrowth is activity dependent. Precisely compounds are performed on a large Soluble transition-metal catalysts have under-
how neuroligin inhibits DVB outgrowth, and scale worldwide by the chemicals gone continual development to offer higher
whether the two proteins physically interact in industry1. Such hydrogenation reactions are and higher reactivities. In addition, judi-
this setting, remain to be determined. essential to the production of numerous com- cious changes to the ligand molecules bound
Hart and Hobert’s work brings together mercial goods, including many polymers, to the metal atom were found to control the
three areas of study in neuroscience: out- foodstuffs and pharmaceuticals. However, a reactivity and selectivity of the catalytic com-
growth, branching and target selection in catalyst is needed to provide a thermodynami- plexes — not only the substrate selectivity, but
plastic neurons; control of these processes cally accessible reaction pathway that allows also the stereo­selectivity (the 3D geometric
through neuronal activity; and the function of hydrogenations to occur. Until the past decade arrangement of atoms generated in the prod-
neural cell-adhesion proteins. The value of the or so, it was thought that these catalysts must uct). Despite these advances, most catalysts
study therefore lies not only in the discovery of derive from transition metals, but there is now used in industrial processes are derived from
a new phenomenon, but also in the framework a growing list of alternatives. Writing in Nature the metals platinum, palladium, rhodium
it provides for making more discoveries. Catalysis, Bauer et al.2 add to that list by report- and ruthenium, which are expensive, toxic
Analysis of C. elegans mutants will make it ing effective hydrogenation catalysts derived and rare.
possible to identify additional molecules that from alkaline-earth elements — the group of The cost of the precious metals in such
affect DVB outgrowth, such as the binding metals that includes calcium. catalysts is not the only expense associated
partner of neurexin that stimulates outgrowth. About 100 years ago, the chemist Paul with their use — the removal of toxic cata-
The intracellular mechanisms that drive DVB Sabatier was the first to recognize that amor- lyst residues from the products is also costly.
outgrowth, and how they are controlled by phous metals could act as catalysts to mediate This, together with increasing environmental
interactions between neurexin and its bind- the hydrogenation of organic substrates3. By concerns, has prompted efforts to find alter-
ing partner, can then be analysed. Other ques- the middle of the twentieth century, the emer- natives to conventional hydrogenation cata-
tions for study include how DVB knows where gence of the subdiscipline of organometallic lysts. One strategy that uses the principles of

1 6 0 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS & VIEWS RESEARCH

organo­metallic chemistry has been to develop


catalysts derived from earth-abundant, less-
toxic transition metals such as iron, cobalt b R′
and nickel5. N Aldimine
In the past decade or so, startling strategies a R
for hydrogenation reactions have also been H2 R′
discovered. In 2006, certain molecules con- (Me3Si)2N M N(SiMe3)2 (Me3Si)2N M H (Me3Si)2N M N
–H2
taining boron and phosphorus were shown Initial complex Hydride H2 Diamido R
to react reversibly with hydrogen 6. It was c intermediate
subsequently found7 that reactions between R′
boron-containing molecules known as N Amine
boranes and phosphorus-containing mol- R H
ecules called phosphines can be frustrated
electronically or through steric effects (which
occur when bulky chemical groups block Figure 1 | Simplified hydrogenation mechanism for catalysts that contain alkaline-earth metals. 
access to certain parts of a molecule). This Bauer et al.2 report that complexes containing alkaline-earth metals catalyse the reaction of aldimine
allows certain combinations of boranes and compounds with hydrogen gas (H2), and propose the following mechanism. a, The initial complex
phosphines to chemically activate hydrogen reacts with H2 — probably reversibly — to generate a transient hydride intermediate. b, The aldimine
molecules, and, in some cases, mediate the inserts into the M–H bond of the hydride to form a diamido intermediate. c, This intermediate reacts
with more H2 to liberate the hydrogenation product (an amine), regenerating the hydride for further
hydrogenation of many different types of catalytic cycles. Me, methyl; Si, silicon; M, magnesium, calcium, strontium or barium; R is typically
compound8,9. Then, in 2008, a remarkable an aromatic group, such as phenyl; Rʹ is t-butyl, isopropyl, phenyl or a mesityl (a bulky analogue of
calcium-based catalyst was reported10 for the phenyl group).
the hydrogenation of alkenes (hydrocarbons
that contain carbon–carbon double bonds).
Collectively, these findings provided evi- had a phenyl group (a benzene ring) attached a currently undefined, catalytically active
dence that hydrogenation can be catalysed to the carbon atom in the imine. Bauer et al. complex involving an aggregated hydride. The
by systems based on elements other than the found that the catalysts still worked when simulations also supported the proposed step-
transition metals, overturning 100 years of electron-withdrawing or electron-donating wise mechanism for the catalytic cycle. Finally,
chemical dogma. groups were attached to the phenyl group Bauer et al. used a previously reported calcium
Bauer et al. have now broadened the range — something that isn’t always guaranteed in hydride complex11 as a model of the proposed
of alkaline-earth-metal derivatives that can chemical reactions. However, the catalysts catalytic hydride intermediate, and found that
form the basis of hydrogenation catalysts. The could not hydrogenate compounds known as it reacts with an aldimine and hydrogen gas
new catalysts are complexes with the general ketimines, which are similar to aldimines but in a way that is consistent with the proposed
formula M[N(SiMe3)2]2 (where M can be mag- have two groups attached to the imine carbon catalytic cycle.
nesium, calcium, strontium or barium; Si is atom, rather than just one. Compared with industrial reactions
silicon; and Me represents a methyl group), Bauer and co-workers propose a mechanism catalysed by transition-metal complexes,
and can be readily prepared. The authors used for the catalytic cycle in which the catalyst first Bauer and colleagues’ reactions use higher
them to hydrogenate substrates known as reacts with hydrogen amounts of catalyst and are relatively slow.
aldimines (Fig. 1). gas to generate a tran- Nonetheless, the findings expand the sub-
The researchers performed 30 reactions “The authors sient hydride inter- strate scope for hydrogenation catalysts
using different reaction conditions and report effective mediate — a process derived from abundant alkaline-earth met-
several aldimines. They varied the amount hydrogenation that is likely to be als, raising the possibility that low-cost and
of catalyst used (between 2.5% and 10% catalysts reversible (Fig. 1a). low-toxicity catalysts could one day be used
molar equivalents of the reaction substrate), derived from The aldimine inserts for industrial applications. Work is now
the pressure of hydrogen (1–12 bar) and the alkaline-earth into the M–H bond needed to improve the activity of such cata-
temperature (80–120 °C). Most of the reactions elements.” of the hydride to gen- lysts, and to find catalysts that tolerate the
were 99% complete in times ranging from erate a diamido inter- presence of the impurities found in indus-
15 minutes to 24 hours, depending on the mediate (Fig.  1b), trial-grade reagents. Perhaps most crucially,
specific substrate, catalyst and conditions. which then reacts with more hydrogen gas to the authors’ work provides further evidence
The authors show that the hydrogenations liberate the hydrogenation product (an amine; that the dogma that transition metals are
are slower for bulkier aldimine molecules and Fig. 1c). This last step also regenerates the required for hydrogenation catalysis should
when the carbon atom in the aldimine’s imine hydride for further catalytic cycles. be firmly relegated to the false beliefs of
(C = N) group is less electrophilic (attractive The proposed mechanism might seem the past. ■
to negative charges). Conversely, the catalytic straightforward, but the authors note that
activity increases with the atomic size of the the active form of the catalyst has not been Douglas W. Stephan is in the Department
metal used: the magnesium catalyst is least un­ambiguously identified. When Bauer et al. of Chemistry, University of Toronto, Toronto,
reactive, and the calcium, strontium and reacted the calcium catalyst with hydrogen Ontario, M5S 3H6 Canada.
barium catalysts are increasingly reactive. gas alone, the proposed hydride intermediate e-mail: douglas.stephan@utoronto.ca
That said, the calcium catalyst10 previously did form, but so, too, did aggregated forms of
1. de Vries, J. G. & Elsevier, C. J. (eds) Handbook of
reported by researchers from the same group hydrides. Homogeneous Hydrogenation (Wiley, 2006).
was a highly effective catalyst for aldimine The researchers performed computational 2. Bauer, H. et al. Nature Catal. http://dx.doi.
hydrogenation, which suggests that the simulations of their reactions to cast further org/10.1038/s41929-017-0006-0 (2018).
activity of the current calcium catalyst could light on the reaction mechanism. The simu- 3. Sabatier, P. Ind. Eng. Chem. 18, 1005–1008
(1926).
be optimized by modifying the ligands bound lations revealed that the aggregation process 4. Hudlický, M. Reductions in Organic Chemistry
to the metal atom. probably releases energy, suggesting that a 2nd edn (Am. Chem. Soc., 1996).
Most of the aldimines tested with the catalysts thermodynamic driving force could generate 5. Bullock, R. M. (ed.) Catalysis without Precious Metals

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 6 1
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
RESEARCH NEWS & VIEWS

(Wiley, 2010). 8. Chase, P. A., Welch, G. C., Jurca, T. & Stephan, D. W. Int. Edn 47, 9434–9438 (2008).
6. Welch, G. C., San Juan, R. R., Masuda, J. D. & Angew. Chem. Int. Edn 46, 8050–8053 (2007). 11. Causero, A. et al. Organometallics 35, 3350–3360
Stephan, D. W. Science 314, 1124–1126 (2006). 9. Stephan, D. W. & Erker, G. Angew. Chem. Int. Edn 54, (2016).
7. Welch, G. C. & Stephan, D. W. J. Am. Chem. Soc. 6400–6441 (2015).
129, 1880–1881 (2007). 10. Spielmann, J., Buch, F. & Harder, S. Angew. Chem. This article was published online on 8 January 2018.

BIOT ECHNO LO GY
versions of the TMC1 gene from each other

An ode to gene edits (Fig. 1). One way to understand this is to imag-


ine a duet between two people trying to sing in
unison. If one person is off-key, this offender

that prevent deafness


must be selectively silenced to allow the correct
tune to be heard, because if both singers are
stopped, the music will cease.
Gene editing is the technique of choice to
Gene editing can prevent inherited deafness in mice by disabling a mutant rid a hair cell of the mutant version of a gene8.
version of a gene that causes hearing loss. Is this a turning point on the path This involves using a nuclease enzyme to cut
towards treating some types of human deafness? See Letter p.217 a targeted DNA sequence in the specific gene
inside the living cell. The cut causes a double-
strand DNA break and the repair process
FYODOR URNOV has a wild-type copy of the gene7. often results in mistakes in which nucleotides
The repair of dominant-mutation- are added or lost. Such a change can alter the

W
hen the 32-year-old composer associated deafness is a delicate matter — the sequence in a way that might cause translation
Ludwig van Beethoven realized that mutated gene must be disabled while preserv- to prematurely arrest and thereby prevent gene
his hearing was failing, he wrote ing the wild-type gene within the same cell. expression.
to his brothers that “as the leaves of autumn This is no trivial undertaking, because only The authors used the nuclease Cas9, which
wither and fall, so has my own life become one nucleotide of DNA distinguishes the two cuts DNA at a specific site by using a snippet
barren”. Although the cause of Beethoven’s
deafness is unknown, there are many exam-
ples of hearing loss in later life that are linked
Lipid
to inherited DNA changes. Two centuries later,
techniques to prevent inherited forms of deaf- Guide
ness are finally getting closer to implemen- RNA
Cilia
tation in the clinic. On page 217, Gao et al.1
report progress in using gene-editing technol- Cas9
ogy to treat a mouse model of inherited deaf-
ness. Given the growing momentum in using
genetic engineering for human therapy, the
path needed to take this approach to the clinic
is clear.
The remarkable process of sensing sound Hair cell

occurs in the inner ear 2. Tiny, hair-like


structures called cilia on the surface of hair Gene editing
cells in the cochlea respond to sound waves. Mutant Wild-type
Ciliary motion evokes an electrical signal Tmc1 Tmc1
because the properties of a protein assembly
Nucleus
at the base of each cilium change when such Mutant
motion occurs. The TMC1 protein is thought3 GAAGTT GAGTT
to be part of this assembly in humans, and Tmc1 gene Deleted nucleotide
some TMC1 mutations cause people to lose
Wild type
their hearing over time. The symptoms start in
childhood, and deafness, along with associated GATGTT GATGTT

degeneration and death of hair cells, ensues


within 10 to 15 years4.
Gao and colleagues analysed the Beethoven
mouse strain, in which the animals have a
Tmc1 mutation that causes them to grow deaf Figure 1 | Gene editing in mice can prevent inherited hearing loss.  Gao et al.1 investigated a mouse
over time5. The mouse mutation they studied model of later-life deafness that is caused by a mutant version of the Tmc1 gene. This mutation is identical
matches a mutation in human TMC1 that is to one in the human version of the gene that is linked to deafness. Hearing loss is accompanied by the
also linked to progressive hearing loss6. The death of inner-ear hair cells that sense sound using their ciliary projections. The authors injected the ears
of newborn mice with gene-editing components: the nuclease enzyme Cas9 that can cut DNA, and a
mutation is dominant, which means that guide RNA that targets Cas9 to the mutant version of Tmc1 in hair-cell nuclei. These were packaged in a
even if only one of a person’s two copies of lipid droplet that fuses with cells to enable the gene-editing components to enter. The mutant version of
the gene has the mutation, they will become Tmc1 has an adenine nucleotide (A, highlighted in red in the mutant nucleotide sequence) at a position
deaf. The mutant copy of the gene produces that is a thymidine nucleotide (T) in the wild-type version. Gene editing selectively inactivated the
a defective protein that somehow impairs mutant version of the gene through mechanisms such as nucleotide deletion. Edited cells express only the
cell function, even though the cell also wild-type Tmc1 protein (white) and don’t express the mutant version (red).

1 6 2 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
NEWS & VIEWS RESEARCH

of RNA that binds to both the enzyme and the HIV13. Immune cells have also been edited to progress being made with genome editing is
target DNA9. This approach is also known generate cancer-targeting cells14. However, changing this. Although Beethoven never
as CRISPR–Cas gene editing. The guide RNA these techniques required cells to be removed heard his famous Ode to Joy, it could be that —
matches the mutant but not the wild-type from the patient’s body for gene editing and thanks in no small part to his murine name-
gene, enabling Gao and colleagues to solve the then replaced. Ear cells cannot be removed, so sake’s fateful encounter with Cas9 — we are
problem of ensuring that the mutant form of a direct in vivo approach is needed, which is getting closer to the day when individuals with
the gene is cut whereas the wild-type version even more challenging to achieve than ex vivo deafness-causing mutations can be treated by
is left untouched. gene editing. gene editing to prevent hearing loss. ■
Another challenge was to get Cas9 into the Encouragingly, such in vivo gene editing
inner ear. In vivo gene-editing approaches (for a different condition) has been per- Fyodor Urnov is at the Altius Institute for
often rely on viruses to introduce nuclease- formed in a clinical trial using zinc-finger Biomedical Sciences, Seattle, Washington
encoding sequences into the organism being nucleases15, and the work leading up to that16 98121, USA.
edited 10,11. However, Gao and colleagues makes clear the next steps for Gao and col- e-mail: urnov@altius.org
reasoned that, when the nuclease has done its leagues’ approach. A nuclease must be found
1. Gao, X. et al. Nature 553, 217–221 (2018).
job in the cell, it will no longer be required, so that has clinical-grade potency and specificity 2. Fettiplace, R. & Kim, K. X. Physiol. Rev. 94, 951–986
introducing the protein itself should suffice. in human cells. Lipids must be identified that (2014).
They turned to a technique they had used can be safely injected along with the nuclease 3. Kawashima, Y. et al. J. Clin. Invest. 121, 4796–4809
(2011).
previously12, in which they packaged Cas9 into the human inner ear. Next, this nuclease
4. Kurima, K. et al. Nature Genet. 30, 277–284
protein bound to its guide RNA in a type of must be tested for safety in larger animals, (2002).
lipid droplet that can fuse with cells, enabling such as primates. An in vivo virus-based gene 5. Zhao, Y. et al. PLoS ONE 9, e97064 (2014).
the editing machinery to enter. The authors therapy for direct injection into the eye17 has 6. Vreugde, S. et al. Nature Genet. 30, 257–258
(2002).
injected these droplets into the inner ear of been recommended for approval in the United 7. Pan, B. et al. Neuron 79, 504–515 (2013).
newborn Beethoven mice. States, and that work provides a road map for 8. Carroll, D. Annu. Rev. Biochem. 83, 409–439 (2014).
The inner ears of unedited adult Beethoven the scientific, medical and commercial con- 9. Jiang, F. & Doudna, J. A. Annu. Rev. Biophys. 46,
505–529 (2017).
mice were barren of hair cells; however, their siderations that need to be taken into account 10. Li, H. et al. Nature 475, 217–221 (2011).
gene-edited adult siblings had inner-ear hair when moving to the clinic. 11. Ran, F. A. et al. Nature 520, 186–191 (2015).
cells that were almost indistinguishable in In 1902, the physician Archibald Garrod 12. Zuris, J. A. et al. Nature Biotechnol. 33, 73–80
shape and number from those in wild-type initiated the first study that demonstrated a (2014).
13. Tebas, P. et al. N. Engl. J. Med. 370, 901–910
mice. The edited animals could be startled by link between a gene and a disease. Since then, (2014).
a sudden loud noise, whereas their unedited more than 5,000 diseases have been linked to 14. Qasim, W. et al. Sci. Transl. Med. 9, eaaj2013 (2017).
siblings could not. More-sophisticated single-gene changes. However, without the 15. https://clinicaltrials.gov/ct2/show/NCT03041324
16. Sharma, R. et al. Blood 126, 1777–1784 (2015).
measurements also confirmed that hearing tools to modify disease-causing forms of genes, 17. Russell, S. et al. Lancet 390, 849–860 (2017).
improved as a result of gene editing. geneticists have often been unable to see their
Encouragingly, the engineered nuclease seems knowledge put to use for clinical benefit. The This article was published online on 20 December 2017.
to have stayed true to its design and did not
create undesired genetic changes of concern
in the DNA of the hair cells. M ATER I A L S S CI E NCE
A modest fraction of cells were edited. The
authors propose that this low proportion of
edited cells resulted in a beneficial ‘halo’-like
effect on neighbouring unedited cells that
Rule-breaking
perovskites
still contained the mutant form of the gene,
preventing the death and degeneration of these
neighbouring cells. Although the mechanism
underlying this proposed halo effect is
unclear, the finding offers encouragement A material from the perovskite family of semiconductors emits light much more
for the clinical adoption of this approach, efficiently than expected. The explanation for this anomalous behaviour could
because it suggests that the genetic repair lead to improvements in light-emitting technology. See Letter p.189
of all hair cells is perhaps not needed to
achieve a beneficial effect on hearing.
Gao and colleagues’ work provides an MICHELE SABA Conventional wisdom holds that triplet
essential first step towards moving this type states are dark because of the spin selection

W
of approach nearer to the clinic by providing hen a semiconductor absorbs light, rule4, which forbids electrons from chang-
evidence that it is safe and effective in an a particle-like entity called an exci- ing their intrinsic angular momentum (spin)
animal that has a similar genetic mutation and ton can be produced. Excitons during an optical transition — the process
comparable hearing loss to those in humans. comprise an electron and a hole (the absence in which an atom or molecule switches from
How long could it be before individuals with of an electron), and have two possible states: one energy state to another by emitting or
this TMC1 mutation might be treated using singlet and triplet. Triplet states were thought absorbing light. The rule is taught in quan-
gene editing? One reason for optimism comes to be poor emitters of light, but, on page 189, tum-mechanics classes when atomic transi-
from the pace at which other gene-editing Becker et al.1 report that semiconductors tions are first introduced, and is so general
approaches have reached the clinic. known as lead halide perovskites have bright that one might think that it is written in stone.
To give just a few examples from clinical triplet excitons. The results could signify a Fortunately, there are loopholes that can be
trials, the gene CCR5 has been inactivated breakthrough in optoelectronics because exploited.
in immune-system cells using a type of triplet states are three times more abundant The search for emissive triplet states has
enzyme called a zinc-finger nuclease to try to than singlet states2 and currently limit the focused on a certain principle of quantum
reduce the viral load in people infected with efficiency of organic light-emitting diodes3. mechanics: if an electron’s spin is coupled

1 1 JA N UA RY 2 0 1 8 | VO L 5 5 3 | N AT U R E | 1 6 3
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
RESEARCH NEWS & VIEWS

best light emitters — an idea reinforced by


Becker and colleagues’ work.
Perovskite solar cells are now leaving
Electron Hole academic labs and entering the market, thanks
to substantial industrial efforts. The competi-
Light tion is mainly silicon solar cells, which have
a b become so cheap that they negate some of the
advantages of perovskite fabrication. For this
reason, tandem solar cells (consisting of two
sub-cells) and innovative architectures involv-
Spin ing perovskites are being developed that can
outperform commercial silicon devices in
terms of efficiency, if not cost9.
Singlet exciton Bright triplet exciton Light emission is an application in which
organic semiconductors and nanocrystals
have already found commercial success,
Figure 1 | Exciton emission.  Semiconductors contain electrons and holes (absences of electrons) that because of their ability to produce vivid
can combine to form bound states called excitons. a, In singlet excitons, the intrinsic angular momenta colours and to be incorporated into thin
(spins) of the electron and the hole point in opposite directions, which facilitates the emission of light. panels. And yet the electric-current densities
b, Conversely, in triplet excitons, the spins point in the same direction. Conventional wisdom holds that in organic light-emitting diodes are much
such states are dark, but Becker et al.1 report that semiconductors known as lead halide perovskites emit lower than in their inorganic counterparts
light through bright triplet excitons.
as a result of poor electrical conductivity.
Perovskites could allow high current densities
to another form of angular momentum transitions between triplet and singlet states. and efficiencies to be realized on large-area,
(namely, orbital momentum), the sum of the It is unclear to what extent bright triplet thin panels10.
two momenta needs to be conserved, rather states affect the material’s emission efficiency Becker and colleagues’ study highlights the
than the spin alone. The effect is known as at room temperature — when thermal energy potential of perovskite materials as efficient
spin–orbit coupling in atomic physics and as greatly exceeds the singlet–triplet splitting light emitters. Although the findings might
intersystem crossing in the study of organic energy and all states are equally populated. seem surprising at first sight, they should be
semiconductors. It is responsible for weak Nevertheless, the authors’ findings are of seen as a natural consequence of quantum-
emission from triplet states in atoms and fundamental relevance. mechanical reciprocity — that the class of
organic molecules, especially when heavy Future work will certainly investigate material brought to the forefront by solar-cell
elements are involved. However, until now, whether bright triplet states exist in other technology could find applications in light
the strength of triplet emission was thought types of perovskite, such as hybrid perovskites emission. ■
always to be inferior to that of singlet that have organic, positively charged ions
emission. (cations). Such materials include the archetypal Michele Saba is in the Department of Physics,
Lead halide perovskites seem to dispose of methylammonium lead iodide (CH3NH3PbI3), University of Cagliari, I-09042 Monserrato,
all conventional wisdom in materials science. and are typically prepared not as nanocrys- Italy.
Like organic semiconductors, they are rela- tals, but as solid- e-mail: saba@unica.it
tively easy to fabricate, and their bandgap (a state films6. Unlike
property that determines their conductiv- “The authors’ CsPbX3 nanocrystals, 1. Becker, M. A. et al. Nature 553, 189–193
(2018).
ity and optical properties) can be tuned by study highlights these films com- 2. Pope, M. & Swenberg, C. E. Electronic Processes in
varying their composition. Yet, like thin-layer the potential prise micrometre- Organic Crystals (Oxford Univ. Press, 1999).
(epitaxial) inorganic semiconductors, they are of perovskite or millimetre-sized 3. Reineke, S., Thomschke, M., Lüssem, B. & Leo, K.
Rev. Mod. Phys. 85, 1245–1293 (2013).
highly crystalline and exhibit efficient charge materials as crystalline domains,
4. Demtröder, W. Atoms, Molecules and Photons
transport. It is as if their properties were efficient light in which excitons (Springer, 2010).
selected from a materials scientist’s wish list, emitters.” dissociate into pairs 5. Rainò, G. et al. ACS Nano 10, 2485–2490
combining the best aspects of organic mol- of free electrons (2016).
ecules, nanocrystals and epitaxial inorganic and holes at room 6. Stoumpos, C. C. & Kanatzidis, M. G. Acc. Chem. Res.
48, 2791–2802 (2015).
semiconductors. temperature. More generally, Becker and 7. Correa-Baena, J.-P. et al. Science 358, 739–744
Becker and colleagues’ study suggests colleagues’ theoretical analysis might help (2017).
that there is another feature of lead halide scientists to identify other semiconducting 8. Rau, U. Phys. Rev. B 76, 085303 (2007).
9. Eperon, G. E., Hörantner, M. T. & Snaith, H. J. Nature
perovskites to be added to this list. The materials (either organic or inorganic) that Rev. Chem. 1, 0095 (2017).
authors used a combination of theoretical and have bright triplet excitons. 10. Colella, S., Mazzeo, M., Rizzo, A., Gigli, G. & Listorti, A.
experimental work to show that nanocrystals Research into hybrid perovskites has been J. Phys. Chem. Lett. 7, 4322–4334 (2016).
of caesium lead halide perovskites (CsPbX3, fuelled in the past few years by the successful
where X is chlorine, bromine or iodine) have incorporation of these materials into solar
bright triplet excitons (Fig. 1). This property cells. Such devices can now convert more than CORRECTION
results in an emission rate surpassing that of 22% of the energy received from sunlight into The News & Views article ‘Cancer: Tumour
other known nanocrystals5. electricity7, which is a record for perovskite lymph vessels boost immunotherapy’ by
The energy difference between the solar cells. However, because of a concept Christine Moussion and Shannon J. Turley
triplet and singlet states in CsPbX 3 known as quantum-mechanical reciprocity, (Nature 552, 340–342; 2017) cited
nanocrystals is relatively small (of the order there is an unavoidable energy loss in solar reference 2 incorrectly. The correct reference
of 1 millielectronvolt). Becker et al. there- cells: that due to photoluminescence, which is: S. L. Topalian, C. G. Drake & D. M. Pardoll
fore explored the material’s emission at cryo- is the reverse of the absorption process8. As a Cancer Cell 27, 450–461 (2015).
genic temperatures (a few kelvin), to prevent consequence, the best solar cells are also the

1 6 4 | N AT U R E | VO L 5 5 3 | 1 1 JA N UA RY 2 0 1 8
©
2
0
1
8
M
a
c
m
i
l
l
a
n
P
u
b
l
i
s
h
e
r
s
L
i
m
i
t
e
d
,
p
a
r
t
o
f
S
p
r
i
n
g
e
r
N
a
t
u
r
e
.
A
l
l
r
i
g
h
t
s
r
e
s
e
r
v
e
d
.
Article doi:10.1038/nature25192

Neurexin controls plasticity of a mature,


sexually dimorphic neuron
Michael P. Hart1 & Oliver Hobert1

During development and adulthood, brain plasticity is evident at several levels, from synaptic structure and function to
the outgrowth of dendrites and axons. Whether and how sex impinges on neuronal plasticity is poorly understood. Here
we show that the sex-shared GABA (γ-aminobutyric acid)-releasing DVB neuron in Caenorhabditis elegans displays
experience-dependent and sexually dimorphic morphological plasticity, characterized by the stochastic and dynamic
addition of multiple neurites in adult males. These added neurites enable synaptic rewiring of the DVB neuron and instruct
a functional switch of the neuron that directly modifies a step of male mating behaviour. Both DVB neuron function and
male mating behaviour can be altered by experience and by manipulation of postsynaptic activity. The outgrowth of DVB
neurites is promoted by presynaptic neurexin and antagonized by postsynaptic neuroligin, revealing a non-conventional
activity and mode of interaction of these conserved, human-disease-relevant factors.

Experience modifies the structure and function of neurons and circuits Day 1 males have been shown to protract their spicules briefly follow-
in the brain through multiple mechanisms of neuronal plasticity1,2. ing the expulsion step of defecation, owing to ­connections between
Plasticity in adult brains refines circuits in response to experience defecation and spicule circuits11. This seemingly pointless p ­ rotraction
in order to mediate adaptation and homeostasis, and as a cellular can result in chronic protraction of spicules, which is ­detrimental to
correlate of learning and memory1,3,4; this type of plasticity includes male mating ability. We found that day 1 males, but not day 3 males,
extension and retraction of dendrites and axons5–7. The molecular frequently protracted spicules during expulsion12 (Extended Data
mechanisms that underlie morphological plasticity in adult neurons Fig. 3b). To determine whether DVB was involved in this change, we
are not well understood. Similarly, though the sexual identity of an silenced DVB using expression of a histamine-gated chloride channel
organism ­influences the function and plasticity of its nervous system, (lim-6int4::HisCl1 with histamine), which resulted in increased pro-
the molecular and cellular bases of such sexual dimorphism are also traction of spicules with expulsion at day 3 (Extended Data Fig. 3b).
not fully ­understood. The time between consecutive expulsions was unchanged between
day 1 and day 3 in controls, but slightly increased in DVB-silenced
Morphological plasticity in adult male DVB neuron day 3 males (Extended Data Fig. 3c). These results suggest that DVB
The GABAergic motor neuron/interneuron DVB is located in the tail of plays a role in reducing expulsion-associated spicule protraction dur-
C. elegans and projects anteriorly in the ventral nerve cord in both sexes ing the period of neurite outgrowth, probably through inhibition of
(Fig. 1a). We used fluorescent reporter gene technology to visualize spicule circuit components that connect with the defecation circuit.
DVB and found that it displays extensive post-developmental morpho- Moreover, laser ablation of DVB in day 1 males (Extended Data Fig. 3d)
logic plasticity exclusively in males, characterized by the progressive resulted in a reduction in the number of males with chronically
extension of new neurites posteriorly into the tail (Fig. 1b; Extended ­protracted spicules compared to controls, whereas ablation of DVB
Data Fig. 1). The total neurite length and the number of neurite junc- on each day after day 2 resulted in a progressive increase in worms
tions increase significantly (P <​ 0.001) from day 1 to day 5 of adult life with chronically protracted spicules (Fig. 2a). Thus, DVB contributes to
(Fig. 1c, d). The branching pattern of male DVB neurites lacks any spicule protraction at day 1 and inhibits spicule protraction after day 2,
overt stereotypy (Extended Data Fig. 2a, b). The generation of new with a functional consequence of suppressing spicule protraction
DVB neurites in males is accompanied by the addition of presynaptic ­during expulsion.
boutons containing the synaptic marker RAB-3, suggesting that these We validated these findings using expression of channelrhodopsin
neurites are axon-like (Fig. 1b, Extended Data Fig. 1); electron micros- in DVB (Extended Data Fig. 3e). Light-induced activation of DVB
copy analysis supports this conclusion8,9. We have not identified other in day 1 adult males resulted in observable movement of spicules,
neurons that undergo comparable neurite outgrowth in adulthood whereas ­activation of DVB at day 5 resulted in only rare m
­ ovement of
(Fig. 1b, Extended Data Fig. 2c–h). spicules (Fig. 2b, Supplementary Video 1). Expression and ­activation
of ­channelrhodopsin in the spicule protraction neurons and m ­ uscles
Dimorphic DVB connectivity influences behaviour always resulted in spicule protraction at days 1 and 5 (Fig. 2b,
In hermaphrodite worms, DVB controls defecation behaviour10; in Supplementary Video 2, Extended Data Fig. 3f). The fraction of male
males it also contributes to protraction of the male-specific spicule worms exhibiting spicule movement after channelrhodopsin-­mediated
structures, which are inserted into the hermaphrodite vulva during DVB activation at day 1 was unchanged in males lacking GABA signal-
copulation11 (Fig. 1e–g). Consistent with a sexually dimorphic ­function, ling components (unc-25/GAD or unc-49/GABAA receptor mutants;
the synaptic wiring pattern of DVB is also notably ­sexually ­dimorphic8,9 Fig. 2c), indicating that DVB may signal through electrical connec-
(Fig. 1g). To test for functional roles of DVB neurite o ­ utgrowth, we tions and/or neuropeptides11. Although DVB neurite outgrowth was
examined DVB function over the period of DVB ­neurite outgrowth. not affected in unc-49 mutants, these worms did show a reduction in

1
Department of Biological Sciences, Howard Hughes Medical Institute, Columbia University, New York, New York, USA.

1 1 j a n u a r y 2 0 1 8 | V O L 5 5 3 | NA T UR E | 1 6 5
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a Figure 1 | Progressive neurite outgrowth of


the GABAergic DVB neuron in adult males.
a, DVB neuron schematic. b, DVB visualized
DVB DVB with lim-6int4::wCherry in adult males and
hermaphrodites (asterisk, PVT neuron;
arrowheads, DVB neurites, n as indicated in c).
b Day 1 Day 3 Day 5 c <0.001 Presynaptic boutons visualized with presynaptic
lim-6int4::wCherry <0.001 <0.001 marker lim-6int4::gfp::rab-3. DIC, differential
lim-6int4::wCherry interference contrast. c, d, DVB neurite
150

Total neurite length (µm)


outgrowth in males quantified by total neurite
* length (c) and number of neurite junctions (d).
100
Dot represents one worm; magenta bar, median;
*
boxes, quartiles. Comparison using one-way
lim-6int4::gfp::rab-3
50 ANOVA and post-hoc Tukey HSD, P values
shown above plots, bold shows significance
0 n = 45 43 37 (P <​  0.05). e, Schematic of DVB and postsynaptic
Day 1 Day 3 Day 5 spicule-associated neurons and muscles in
d 0.040 male tail. f, Sample images of males with non-
<0.001 <0.001
14
lim-6int4::wCherry
protracted or protracted spicules (red triangles
12 indicate base and tip of spicules; tail and male
Merge and DIC fan are outlined, demonstrating protracted
Neurite junctions
10

8
spicules extending underneath male fan; n >​  10).
g, Connectivity of DVB at adult stage inferred
6
* from electron micrographs (sections indicate
4
number of EM sections over which
* 2
en passant synapses were observed)8,11.
n = 44 43 37
0
Behavioural output indicated for each sex.
Day 1 Day 3 Day 5
lim-6int4::wCherry
e Scale bars, 10 μ​m.
Retractors
DVB

SPC
Anal depressor
*
*
Protractors Spicules
Merge and DIC
f

*
* Non-protracted Protracted

g 5 sections Sensory neuron Hermaphrodite-specific chemical synapse


10 sections Interneuron Male-specific chemical synapse
20 sections Motor neuron Sex-shared
30 sections Muscle Male-specific

PVP PVP
EF2
DVB DVB
DVB

SPC
DVE

AVL
AVL

DD6 DA8 DD6 DA8 Spicule protractor


Intestinal muscle
Intestinal muscle
Anal depressor Anal depressor

Defecation Spicule movement

spicule protraction at day 5 (aldicarb assay described below, Extended control and mock-ablated males, demonstrating a functional switch for
Data Fig. 4a–d), suggesting that GABA contributes to restriction of DVB from an excitatory to an inhibitory input on spicule protraction
spicule protraction in later adulthood. (Fig. 2f). These results were confirmed using genetic ‘ablation’ of DVB
To further characterize the role of DVB in active spicule protraction, (lim-6 transcription factor mutant14; Fig. 2f). Together, our results
we used the acetylcholine esterase inhibitor aldicarb, which induces ­confirm that DVB switches function in adulthood, and implicate DVB
spicule protraction through the accumulation of acetylcholine at as the main contributor to the temporal change observed in spicule
neuromuscular synapses onto spicule protractor muscles13 (Fig. 2d). protraction and defecation behaviour.
Aldicarb-induced spicule protraction took longer as males aged To investigate how the switch of DVB function during DVB
from day 1 to day 5 (Fig. 2e), during the same period as DVB neurite ­neurite outgrowth relates to changes in synaptic connectivity, we used
outgrowth. To directly test whether DVB is involved in this behavioural trans-synaptic labelling (GRASP15) to visualize synapses between
change, we combined laser ablation of DVB with aldicarb-induced DVB and the spicule protraction neurons and muscles (Fig. 2g). The
spicule protraction. DVB ablation at day 1 resulted in slower spicule number of these specific synaptic connections increased from day 1
protraction in response to aldicarb than in control and mock-ablated to 5 (Fig. 2h, i). We also visualized synapses between DVB and the
males, again demonstrating that DVB input at day 1 has an excit- spicule retractor muscles (Fig. 2j; Extended Data Fig. 4h); the number
atory effect on spicule protraction (Fig. 2f). DVB ablation at day 5 of these synapses decreased from day 1 to 5 (Fig. 2k, l). These results
resulted in faster spicule protraction in response to aldicarb than in provide evidence that structural remodelling of axons and dendrites in

1 6 6 | NA T UR E | V O L 5 5 3 | 1 1 j a n u a r y 2 0 1 8
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

lim-6int4::wCherry Figure 2 | DVB neuron undergoes a functional


a b Ex[lim-6int4::ChR2::yfp] c
Ex[gar-3b::ChR2::yfp] switch in adulthood resulting in dynamic
60 Mock ablated 120 <0.001 120 Day 1 behavioural output. a, Per cent of mock-ablated
1.000
or DVB-ablated males with chronically protracted
Per cent spicules protracted

DVB ablated

Per cent males with spicule


0.008

Per cent males with spicule


<0.001 <0.001
50 100 100 lim-6int4::wCherry
spicules 20 h after ablation at day indicated

muscle contraction
Ex[lim-6int4::ChR2::yfp]

muscle contraction
0.005
40
0.019
80 80 (mean ±​ s.e.m., two-tailed Student’s t-test).
30 60 60 b, Per cent of worms responding to 488-nm
<0.001 1.000 0.999 light with movement of spicules for control,
20 40 40
Ex[lim-6int4::ChR2::yfp], and Ex[gar-3b::ChR2::yfp]
0.023
10
0.134
20 0.479 20 worms (mean ±​ s.e.m., one-way ANOVA and
0 0
post-hoc Tukey HSD). c, Per cent of worms with
0
n = 56 47 35 26 46 31 46 34 52 36 n = 69 77 25 41 39 24 n = 22 29 27 39 25 27 or without Ex[lim-6int4::ChR2::yfp] responding
Day 1 Day 2 Day 3 Day 4 Day 5 Day 1 Day 5 Control unc-49(e407) unc-25(e156)
to blue light with spicule movement at day 1
d e 0.004 f 0.985 0.006 in control, unc-49(e407), and unc-25(e156)
0.010 0.171 <0.001<0.001
GABA 0.469 <0.001 males (mean ±​ s.e.m., one-way ANOVA and

<0.001
<0.001
0.756

0.003

1.000
<0.001
DVB
SPC
0.026 <0.001 <0.001
0.499 0.412 0.015 <0.001
post-hoc Tukey HSD). d, Diagram of GABA
ACh 500
and acetylcholine input onto spicule muscles
Time to protraction (s)

Time to protraction (s)


600
GABA
ALDICARB 500
showing site of aldicarb action. e, Males on 5 mM
400
400
aldicarb medium timed for spicule protraction
Spicule protractor 300
300
for more than 5 s. Dot represents one worm;
Anal depressor 200
200 magenta bar, median; boxes, quartiles; one-way
100 100 ANOVA and post-hoc Tukey HSD. f, Control,
Spicule
protraction 0 0 Day 1 Day 5 mock-ablated, DVB-ablated, or lim-6(nr2073)
n= 42 20 43 27 31 n=
Day 1 Day 3 Day 5
22 25 16 16 17 33 27 15
mutant males timed for aldicarb-induced spicule
(n ed
3)

(n ed
3)
M l
lim ab ck

DV M l
lim ab ck
protraction 12 h after ablation. g, Diagram of
tro

tro
2.5 mM aldicarb

07

07
-6 lat

-6 lat
o

B o
on

on
r2

r2
C

C
synaptic connections labelled with lim-6/gar-3
B
DV

g lim6int4:::nlg-1::gfp1-10 h 0.010 j k 0.059 GRASP. h, i, Quantification (h) and confocal


gar-3b::nlg-1::gfp11 <0.001 <0.001 0.005 <0.001
lim6int4:::nlg-1::gfp1-10
25
images (i) of lim-6/gar-3 GRASP puncta.
20 flp-13::nlg-1::gfp11
j, Diagram of synaptic connections labelled with
GRASP puncta
GRASP puncta

DVB
No. of flp-13p
No. of gar-3b

20
SPC
15 DVB 15 lim-6/flp-13 GRASP. k, l, Quantification (k) and
10
Spicule retractor 10 confocal images (l) of lim-6/flp-13 GRASP puncta.
Spicule protractor 5 5 For i, l, arrowheads, location of GRASP puncta on
Anal depressor 0
CP6 0 DVB neurites; scale bars, 10 μ​m. P values shown
n= 14 17 14 n= 27 23 18
Day 1 Day 3 Day 5 Day 1 Day 3 Day 5 above plots, bold shows significance (P <​  0.05).
i Day 1 Day 3 Day 5 l Day 1 Day 3 Day 5
gar-3b GRASP lim-6int4::wCherry

flp-13p GRASP lim-6int4::wCherry


Merge

Merge

adulthood can rewire specific synaptic targets, supporting the notion DVB neurites are experience- and activity-dependent
that this remodelling can markedly alter connectivity within circuits To determine whether DVB plasticity occurs in response to experi-
and alter downstream behaviour. ence, we tested whether the act of mating itself altered DVB neuron
Male spicule protraction into the hermaphrodite vulva is the most morphology by exposing males to hermaphrodites for the first 48 h of
complex step of the male mating behaviour, involving coordina- adulthood. Single males housed with hermaphrodites showed signifi-
tion of cholinergic and GABAergic signalling16–18. The balance of cant increases in DVB neurite length and junctions compared to males
excitatory and inhibitory signalling is crucial for successful spicule housed alone (P <​  0.001; Fig. 3a–c). C. elegans males housed with other
insertion, which must be further coordinated with changes in sex males or in isolation can engage in mating-like behaviours, which may
muscle excitability in early adulthood13,19–21. Day 1 and day 3 males include spicule protraction. To minimize mating sensory input and
are proficient at most steps of mating20; however, in five-minute self-mating behaviour, we analysed DVB neurite outgrowth in pkd-2
timed mating assays, day 3 males were significantly more likely than (cation channel) mutant males22 and in genetically paralysed mutant
day 1 males to successfully complete mating with sperm transfer males (unc-97)23. pkd-2 mutant males have reduced DVB neurite
(P =​  0.003; Extended Data Fig. 5a). We scored the spicule-related outgrowth at day 3, whereas unc-97 mutant males have almost no DVB
steps of mating (spicule prodding and spicule protraction) and found neurites at day 3 (Extended Data Fig. 4e–g); however, they can protract
that day 1 males showed more spicule prodding attempts overall spicules in response to aldicarb (data not shown) and their neurites can
and a lower ratio of protraction to prodding attempts compared be ectopically induced (Extended Data Fig. 5d–f). Paralysed males also
with day 3 males (Extended Data Fig. 5b, c), indicating that day 1 show no change in neurite outgrowth when housed with hermaphro-
males are less capable than day 3 males of transitioning from spicule dites for 48 h (Fig. 3a–c). These results demonstrate that DVB neurite
­prodding to spicule protraction. This suggests that the morphologi­ outgrowth is experience-dependent and is potentially driven by spicule
cal and functional plasticity of DVB in males may fine-tune and protraction and activity of the postsynaptic spicule protraction circuit.
coordinate the defecation and spicule protraction circuits to increase We next investigated whether activity of the p ­ ostsynaptic targets
mating success. of DVB contributes to DVB neurite outgrowth. Channelrhodopsin-

1 1 j a n u a r y 2 0 1 8 | V O L 5 5 3 | NA T UR E | 1 6 7
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a Single Mated unc-97(su110), single unc-97(su110), ‘mated’ Figure 3 | DVB neurite outgrowth is
lim-6int4::wCherry experience-dependent, can be driven
by circuit activity, and affects behaviour.
a–c, Confocal images of lim-6int4::wCherry (a),
total neurite length (b), and number or
Day 2

neurite junctions (c) of males housed by


themselves (single), with hermaphrodites
(mated), unc-97 mutant males housed by
themselves (single), or with hermaphrodites
0.996
(‘mated’) after 48 h. Controls and
1.000
b <0.001 <0.001 c <0.001 <0.001 males expressing channelrhodopsin
<0.001 <0.001 <0.001 <0.001 0.017 0.069 (Ex[gar-3b::ChR2::yfp]) activated at day 1
Day 2 14 Day 2
(488 nm light for 3 ×​ 15 s every 45 min
120
12 for 4.5 h) or recovered for 20 h (day 2).
d–g, Confocal images of DVB (d;
Total neurite length (µm)

100
10

Neurite junctions
80
lim-6int4::wCherry; scale bar,10 μ​m), and
8
quantification of total neurite outgrowth (e),
60 6 number of neurite junctions (f) and time
40 4 to spicule protraction on aldicarb (g).
20 2
Dot represents one worm; magenta
bar, median; boxes, quartiles. One-way
0 n = 41 47 21 16 0 n = 41 47 21 16
ANOVA and post-hoc Tukey HSD. P values
Single Mated Single ‘Mated’ Single Mated Single ‘Mated’
unc-97(su110) unc-97(su110)
shown above plots, bold shows significance
d Day 1: 488 nm activation Day 2: recovery 20 h (P <​  0.05).
Control Ex[gar-3b::ChR2::yfp] Control Ex[gar-3b::ChR2::yfp]
lim-6int4::wCherry

e 0.002 0.497 f <0.001 0.654


g <0.001 0.964
150
10
500
Total neurite length (µm)

8
Time to protraction (s)

400
Neurite junctions

100
6
300

4
50 200

2 100

0 Day 1: activation Day 2: recovery 0 Day 1: activation Day 2: recovery 0 Day 1: activation Day 2: recovery
n= 19 27 25 24 n= 19 27 25 24 n= 68 82 39 46
Control Ex[gar-3b:: Control Ex[gar-3b:: Control Ex[gar-3b:: Control Ex[gar-3b:: Control Ex[gar-3b:: Control Ex[gar-3b::
ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp]

mediated activation of postsynaptic DVB targets (spicule neurons To test whether a reduction in circuit activity affects DVB neurites,
and muscle) resulted in immediate protraction of spicules16 (Fig. 2b, we exposed males to exogenous GABA, expecting to silence the targets
Supplementary Video 2). Repeated activation of the spicule protrac- of GABAergic DVB signalling. This resulted in a reduction in DVB
tion circuit caused a significant increase in DVB neurite length and neurites (Extended Data Fig. 6a–c). To implicate spicule circuit inhi-
junctions (P =​  0.002 and P <​  0.001, respectively; Fig. 3d–f, day 1), bition more specifically, we silenced spicule protraction neurons and
­independent of GABA signalling (Extended Data Fig. 5d–f). Males muscles with a histamine-gated chloride channel in day 5 males; this
exposed to repeated activation, but subsequently allowed to recover, also reduced DVB neurites (Extended Data Fig. 6d–f). In summary,
had DVB neurites that were indistinguishable from those of controls, DVB neurites extend in response to the activity levels of the spicule
suggesting that neurite growth is dynamic and potentially reversible protraction circuit, including postsynaptic targets of DVB.
(Fig. 3d–f). Repeated activation of either spicule neurons or muscles
separately demonstrated that activity in either can induce DVB neurite Neurexin and neuroligin control DVB plasticity
growth (Extended Data Fig. 5g–i). DVB neurite outgrowth appears to be a form of morphological and
We next tested whether activity-induced DVB neurites i­ nfluence functional plasticity that fine-tunes the excitatory and inhibitory
DVB neuron function and worm behaviour. We activated and r­ ecovered balance for coordinated spicule protraction. Several synaptic molecules
males in the same manner as above, and then used the aldicarb assay to have been implicated in excitatory and inhibitory balance, including
analyse spicule protraction behaviour. Males at day 1 following repeated the synaptic adhesion molecule neurexin and its trans-synaptic ­binding
activation of the spicule protraction circuit showed a significant delay partner neuroligin24–27. Males with a deletion allele of the single
in the time to aldicarb-induced protraction (P <​  0.001; Fig. 3g, day 1), C. elegans neuroligin orthologue nlg-1 show increased DVB neurite
implying that activity-induced neurites have a direct and immediate outgrowth at day 3 compared to controls (Fig. 4a–c). The increase in
effect on DVB spicule function. Males that were exposed to repeated DVB neurite outgrowth at day 3 was rescued by GFP-tagged NLG-1
activation of the spicule protraction circuit but allowed to recover expressed under its own promoter (Extended Data Fig. 7a–c), which
had spicule protraction indistinguishable from that of day 2 controls was localized in a punctate pattern in numerous neurons and muscles of
(Fig. 3g, day 2), indicating that induced behavioural changes are the male tail (Extended Data Fig. 8). nlg-1 mutants displayed a spicule
dynamic and repeated activation does not result in lasting protrac- protraction phenotype that matches the expected phenotypes observed
tion defects. upon increased DVB branching (Fig. 4d). Expression of NLG-1 in the

1 6 8 | NA T UR E | V O L 5 5 3 | 1 1 j a n u a r y 2 0 1 8
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a Day 1 Day 3 Day 3 Day 5 Figure 4 | Neuroligin and neurexin


nlg-1(ok259) Control nlg-1(ok259) nlg-1(ok259) influence DVB neurite outgrowth and
spicule protraction behaviour. a, Confocal
lim-6int4::mCherry

images of DVB (lim-6int4::wCherry) in


nlg-1(ok259) mutant and control male worms.
b, c, Quantification of total neurite outgrowth
(b) and number of neurite junctions (c) in
nlg-1(ok259) and control male worms.
b 0.009 c 0.001 d d, Time to aldicarb-induced spicule
<0.001 0.013 0.016 protraction in control and nlg-1(ok259)
0.954 <0.001 0.077
15
0.711 <0.001 0.308
600
0.004 0.677
males. e, Confocal images of DVB (lim-
200
6int4::gfp) in nrx-1(wy778) mutant and control
worms. f, g, Quantification of total neurite
Total neurite length (µm)

Time to protraction (s)


150
Neurite junctions
10 400 outgrowth (f) and number of neurite junctions
100
(g) in nrx-1(wy778) and control worms.
5 200
h, Time to aldicarb-induced spicule
50 protraction in control and nrx-1(wy778).
Scale bars, 10 μ​m. Dot represents one worm;
0 Day 1 Day 3 Day 5 0 Day 1 Day 3 Day 5 0 Day 3 Day 5
magenta bar, median; boxes, quartiles.
n = 21 13 24 24 23 36 n = 21 12 23 24 23 35 n = 37 45 31 27
One-way ANOVA and post-hoc Tukey HSD.
l

)
l

)
tro

tro

tro

tro
tro

tro

tro

tro
59

59

59

59

59
59

59

59
P values shown above plots, bold shows
k2

k2

k2

k2

k2
k2

k2

k2
on

on

on

on
on

on

on

on
o

o
o

o
C

C
C

C
1(

1(

1(

1(
1(

1(

1(

1(
significance (P <​  0.05).
g-

g-

g-
g-

g-

g-

g-

g-
nl

nl

nl

nl

nl

nl

nl

nl
e Day 1 Day 3 Day 3 Day 5
nrx-1(wy778) Control nrx-1(wy778) nrx-1(wy778)
lim-6int4::gfp

f <0.001 g 0.042 h
<0.001 0.003 0.029
0.993 0.006 <0.001 0.962 0.001 <0.001 0.026 <0.001
14 600

12
Total neurite length (µm)

150
Time to protraction (s)
Neurite junctions

10 400

100 8

6
200
50 4

0 Day 1 Day 3 Day 5 0 Day 1 Day 3 Day 5 0 Day 3 Day 5


n = 12 15 21 26 21 26 n = 12 15 21 26 21 26 n = 66 53 53 44
l

)
tro

tro

tro

tro

tro

tro

tro

tro
78

78

78

78

78

78

78

78
y7

y7

y7

y7

y7

y7

y7

y7
on

on

on

on

on

on

on

on
w

w
C

C
1(

1(

1(

1(

1(

1(

1(

1(
x-

x-

x-

x-

x-

x-

x-

x-
nr

nr

nr

nr

nr

nr

nr

nr

DVB neuron, the SPC, PCA and PCB neurons, or the SPC neuron and NRX-1 is broadly expressed throughout the C. elegans nervous
spicule muscles did not rescue the nlg-1 mutant phenotype, whereas ­system29. Expression of the long isoform of NRX-1 in DVB using
expression in the spicule protractor and anal depressor muscles or the lim-6int4 promoter resulted in rescue of the nrx-1(wy778) ­neurite
in the spicule retractor muscles did rescue the phenotype (Extended outgrowth defect (Extended Data Fig. 9d, e). The long NRX-1
Data Fig. 7d, e), indicating that NLG-1 contributes to DVB neurite out- ­isoform still rescued the mutant phenotype even after deletion of the
growth by functioning in multiple postsynaptic DVB muscles. Silencing C-terminal PDZ binding motif, whereas the short NRX-1 isoform did
the spicule protraction circuit in nlg-1 mutant males at day 5 with not (Extended Data Fig. 9d, e). Overexpression of the long isoform
gar-3b::HisCl1 or overnight exposure to exogenous GABA resulted in of NRX-1 in wild-type male DVB neurons significantly increased
no significant reduction in DVB neurite branching (Extended Data DVB neurite length (P =​  0.047) (Extended Data Fig. 9d, e), and when
Fig. 7f, g). These results suggest that the nlg-1 mutant phenotype cannot tagged with GFP, localized diffusely on the soma and neurites of DVB
be explained by indirect alteration of the spicule circuit or more global (Extended Data Fig. 9j). The reduction in time to aldicarb-induced
perturbations in activity as a result of loss of NLG-1. spicule protraction in nrx-1 mutants was rescued by expression of the
Unexpectedly, males with a deletion allele of nrx-1 (which encodes long isoform of NRX-1 in DVB, but overexpression of NRX-1 in wild-
the C. elegans orthologue of neurexin)28 displayed a significant reduc- type worms did not change time to spicule protraction compared with
tion in neurite outgrowth at days 3 and 5, a phenotype opposite to control wild-type males (Extended Data Fig. 9f). These results indicate
the nlg-1 mutant phenotype (P =​  0.006 and P <​  0.001, respectively; that the long isoform of NRX-1 is required in DVB for neurite out-
Fig. 4e–g). nrx-1 mutants showed a corresponding decrease in time growth, which may extend the gene’s role beyond its canonical function
to aldicarb-induced spicule protraction (Fig. 4h). The nrx-1 locus at synapses. Varying the levels of NRX-1 in DVB directly alters the
­produces both a long and short isoform29, and two long isoform-­ extent of neurite outgrowth, and loss of NRX-1 in DVB reduces inhi-
specific mutant alleles recapitulated the null phenotype (Extended Data bition onto the spicule protraction circuit so that spicule protraction
Fig. 9a–c). Repeated channelrhodopsin-mediated activation of the occurs more rapidly.
spicule protraction circuit failed to induce DVB neurites in nrx-1 The exuberant DVB neurite branching phenotype of nlg-1 mutants
mutants (Extended Data Fig. 5d–f), indicating that the nrx-1 pheno- is completely suppressed by loss of NRX-1, and the increase in DVB
type is not explained solely by reduced circuit activity that could be neurite branching observed upon NRX-1 overexpression is not further
envisioned to result from loss of NRX-1. enhanced by loss of NLG-1 (Extended Data Fig. 9g–i). Furthermore,

1 1 j a n u a r y 2 0 1 8 | V O L 5 5 3 | NA T UR E | 1 6 9
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

nrx-1(wy778);nlg-1(ok259) double null mutant males with NRX-1 8. Jarrell, T. A. et al. The connectome of a decision-making neural network.
expressed in DVB showed an increase in neurites, similar to nlg-1 Science 337, 437–444 (2012).
9. White, J. G., Southgate, E., Thomson, J. N. & Brenner, S. The structure of the
mutants (Extended Data Fig. 9g–i). Hence, restoration of NRX-1 nervous system of the nematode Caenorhabditis elegans. Phil. Trans. R. Soc.
expression in DVB with otherwise global loss of NRX-1 and NLG-1 Lond. B 314, 1–340 (1986).
recapitulates NLG-1 loss alone, suggesting that the nlg-1 phenotype 10. Reiner, D. J. & Thomas, J. H. Reversal of a muscle response to GABA during
C. elegans male development. J. Neurosci. 15, 6094–6102 (1995).
requires NRX-1 in DVB. GFP-tagged NRX-1 localized diffusely onto 11. LeBoeuf, B. & Garcia, L. R. Caenorhabditis elegans male copulation circuitry
the membranes of soma and processes and did not appear to change incorporates sex-shared defecation components to promote intromission and
between days 1 and 3 (Extended Data Fig. 9j). By contrast, expression sperm transfer. G3 7, 647–662 (2017).
12. Pokala, N., Liu, Q., Gordus, A. & Bargmann, C. I. Inducible and titratable
of GFP-tagged NLG-1 decreased from days 1 to 3 in DVB-targeted silencing of Caenorhabditis elegans neurons in vivo with histamine-gated
muscles and neurons (Extended Data Fig. 8). Hence, NRX-1 appears chloride channels. Proc. Natl Acad. Sci. USA 111, 2770–2775 (2014).
to function cell-autonomously in DVB to promote DVB neurite 13. Garcia, L. R., Mehta, P. & Sternberg, P. W. Regulation of distinct muscle
behaviors controls the C. elegans male’s copulatory spicules during mating.
outgrowth, whereas NLG-1 operates in postsynaptic partners of Cell 107, 777–788 (2001).
DVB to antagonize NRX-1-dependent growth. Decreases in NLG-1 14. Hobert, O., Tessmar, K. & Ruvkun, G. The Caenorhabditis elegans lim-6 LIM
expression may result in a reduction in the antagonistic relationship, homeobox gene regulates neurite outgrowth and function of particular
thereby permitting more NRX-1-dependent neurite elaboration. Our GABAergic neurons. Development 126, 1547–1562 (1999).
15. Feinberg, E. H. et al. GFP reconstitution across synaptic partners (GRASP)
demonstration of an antagonistic neurexin–neuroligin relationship that defines cell contacts and synapses in living nervous systems. Neuron 57,
influences neurite outgrowth hints at a signalling process downstream 353–363 (2008).
of neurexin that is antagonized by neuroligin and is independent of 16. Liu, Y. et al. A cholinergic-regulated circuit coordinates the maintenance and
bi-stable states of a sensory-motor behavior during Caenorhabditis elegans
neurexin’s PDZ domain. male copulation. PLoS Genet. 7, e1001326 (2011).
Finally, we tested whether manipulations that induce DVB ­neurites 17. Liu, Y., LeBoeuf, B. & Garcia, L. R. Gaq-coupled muscarinic acetylcholine
in males can also induce neurites in hermaphrodite DVB neurons. receptors enhance nicotinic acetylcholine receptor signaling in Caenorhabditis
elegans mating behavior. J. Neurosci. 27, 1411–1421 (2007).
Activation of the anal depressor muscle (gar-3b::ChR2::yfp), loss 18. Jobson, M. A. et al. Spillover transmission is mediated by the excitatory GABA
of NLG-1, loss of NRX-1, or overexpression of NRX-1 in DVB had receptor LGC-35 in C. elegans. J. Neurosci. 35, 2803–2816 (2015).
no effect on the axon morphology of hermaphrodite DVB neurons 19. Garcia, L. R. & Sternberg, P. W. Caenorhabditis elegans UNC-103 ERG-like
potassium channel regulates contractile behaviors of sex muscles in males
(Extended Data Fig. 10). Cell-autonomous sexual identity changes of before and during mating. J. Neurosci. 23, 2696–2705 (2003).
either DVB or postsynaptic muscles using genetic manipulations of the 20. Guo, X., Navetta, A., Gualberto, D. G. & Garcia, L. R. Behavioral decay in aging
sex-determination pathway also did not alter DVB morphology (see male C. elegans correlates with increased cell excitability. Neurobiol. Aging 33,
1483.e5–1483.e23 (2012).
Methods). Thus, sexually dimorphic morphology and plasticity of the 21. LeBoeuf, B. & Garcia, L. R. Cell excitability necessary for male mating behavior
sex-shared DVB neuron seems to be non-autonomously instructed by in Caenorhabditis elegans is coordinated by interactions between big current
male-specific circuit components. and ether-a-go-go family K+ channels. Genetics 190, 1025–1041 (2012).
Experience-dependent neuronal plasticity in the adult brain can 22. Barr, M. M. et al. The Caenorhabditis elegans autosomal dominant polycystic
kidney disease gene homologs lov-1 and pkd-2 act in the same pathway.
include remodelling of dendrites and axons for behavioural adapta- Curr. Biol. 11, 1341–1346 (2001).
tion or homeostatic maintenance of circuits. Our findings regarding 23. Hobert, O., Moerman, D. G., Clark, K. A., Beckerle, M. C. & Ruvkun, G.
male-specific DVB neurite outgrowth in C. elegans reveal the func- A conserved LIM protein that affects muscular adherens junction integrity and
mechanosensory function in Caenorhabditis elegans. J. Cell Biol. 144, 45–57
tional effect of morphological ­remodelling on circuits and behaviour. (1999).
Through neurite outgrowth and rewiring of specific synapses, the 24. Bang, M. L. & Owczarek, S. A matter of balance: role of neurexin and neuroligin
DVB neuron undergoes a functional change that is likely to serve as at the synapse. Neurochem. Res. 38, 1174–1189 (2013).
25. Maćkowiak, M., Mordalska, P. & We˛dzony, K. Neuroligins, synapse balance and
an ­adaptive mechanism, perhaps translating experience into finer coor- neuropsychiatric disorders. Pharmacol. Rep. 66, 830–835 (2014).
dination of circuit activity and subsequent muscle contraction. These 26. Pizzarelli, R. & Cherubini, E. Alterations of GABAergic signaling in autism
findings may have implications for the normal functions of neurexin spectrum disorders. Neural Plast. 2011, 297153 (2011).
27. Chih, B., Engelman, H. & Scheiffele, P. Control of excitatory and inhibitory
and neuroligin in plasticity, and for the many human diseases associ- synapse formation by neuroligins. Science 307, 1324–1328 (2005).
ated with them. 28. Maro, G. S. et al. MADD-4/punctin and neurexin organize C. elegans GABAergic
postsynapses through neuroligin. Neuron 86, 1420–1432 (2015).
Online Content Methods, along with any additional Extended Data display items and 29. Haklai-Topper, L. et al. The neurexin superfamily of Caenorhabditis elegans.
Source Data, are available in the online version of the paper; references unique to Gene Expr. Patterns 11, 144–150 (2011).
these sections appear only in the online paper.
Supplementary Information is available in the online version of the paper.
received 15 May; accepted 5 December 2017.
Acknowledgements We thank Q. Chen for generating transgenic strains and
1. Fu, M. & Zuo, Y. Experience-dependent structural plasticity in the cortex. Trends M. Gendrel for DVB promoter and reporter lines; P. Sengupta, T. G. Drivas,
Neurosci. 34, 177–187 (2011). M. Oren-Suissa, and members of the Hobert laboratory for comments on the
2. Holtmaat, A. & Svoboda, K. Experience-dependent structural synaptic plasticity manuscript; L. R. Garcia and K. Shen for worm strains; and M. VanHoven and
in the mammalian brain. Nat. Rev. Neurosci. 10, 647–658 (2009). D. Colon-Ramos for plasmids. This work was supported by NIH grants from
3. Vitureira, N. & Goda, Y. Cell biology in neuroscience: the interplay between NINDS (M.P.H.:F32NS086285; O.H.:2R37NS039996). O.H. is a Howard Hughes
Hebbian and homeostatic synaptic plasticity. J. Cell Biol. 203, 175–186 Medical Institute investigator. Some strains were provided by the CGC, funded
(2013). by NIH Office of Research Infrastructure Programs (P40 OD010440).
4. Yin, J. & Yuan, Q. Structural homeostasis in the nervous system: a balancing
act for wiring plasticity and stability. Front. Cell. Neurosci. 8, 439 (2015). Author Contributions M.P.H. and O.H. designed the experiments and wrote the
5. Lee, W. C. et al. Dynamic remodeling of dendritic arbors in GABAergic manuscript. M.P.H. performed the experiments.
interneurons of adult visual cortex. PLoS Biol. 4, e29 (2006).
6. Marik, S. A., Yamahachi, H., Meyer zum Alten Borgloh, S. & Gilbert, C. D. Author Information Reprints and permissions information is available at
Large-scale axonal reorganization of inhibitory neurons following retinal www.nature.com/reprints. The authors declare no competing financial
lesions. J. Neurosci. 34, 1625–1632 (2014). interests. Readers are welcome to comment on the online version of the paper.
7. Keck, T. et al. Loss of sensory input causes rapid structural changes of Publisher’s note: Springer Nature remains neutral with regard to jurisdictional
inhibitory neurons in adult mouse visual cortex. Neuron 71, 869–882 claims in published maps and institutional affiliations. Correspondence and
(2011). requests for materials should be addressed to M.P.H. (hartmicp@gmail.com).

1 7 0 | NA T UR E | V O L 5 5 3 | 1 1 j a n u a r y 2 0 1 8
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

Methods ATAATGGTGTATGT, and cloned into MVC12 (flp-18p::nlg-1::gfp11, a gift from


C. elegans strains. Wild-type strains were C. elegans variety Bristol, strain N2. M. VanHoven) to replace the flp-18 promoter using restriction free cloning.
Worms were grown at 23 °C on nematode growth medium (NGM) plates seeded To generate lim-6int4::nlg-1::gfp11 (pMH8), lim-6int4 was PCR-amplified from
with bacteria (Escherichia coli OP50) as a food source. All males contained either pMH1 using primers forward CAAGCTTGCATGCGCGGCCGCACAGCT
him-8(e1489) IV or him-5(e1490) V as indicated by strain. Male worms were TGCATGCCTGGATCCTTAG and r­ev­er­se G­TC­CT­TT­GG­CC­AA­TC­CC­GG­GG­AT
picked at the fourth larval stage onto plates with ten other males (unless otherwise ­CT­AA­GC­TT­CT­TG­CTAAAATTCTCTTTG, and cloned into MVC6 to replace
­indicated), and allowed to moult into adults and age to the day indicated for each the gar-3b promoter using restriction free cloning.
analysis or experiment. To generate flp-13::nlg-1::gfp11 (pMH23), the flp-13 promoter was PCR-amplified
Mutant alleles used in this study include: him-8(e1489) IV, him-5(e1490) V, from N2 genomic DNA using primers forward CAAGCTTGCATGCGCGGC
unc-31(e928) IV, nlg-1(ok259) X, nrx-1(ok1649) V, unc-119(ed3) III, CGCACGCAGTGACGTCATCTTGTTCG and reverse GTCCTTTGGCCAATC
nrx-1(wy778[unc-119(+)]) V, lim-6(nr2073) X, pkd-2(pt8) IV, unc-97(su110) X, CCGGGGATAAATTGTGCCTCCTGATGCTG, and cloned into pMH20 to
unc-25(e156) III, unc-49(e407) III, nrx-1(ok1649)V, and nrx-1(gk246237). replace the gar-3b promoter using restriction free cloning.
All transgenic strains used in this study are listed in Supplementary Table 1 To generate unc-103E::nlg-1::gfp11 (pMH21), the unc-103E promoter was PCR-
ordered by Figures and Extended Data Figures. All plasmids were injected at amplified from N2 genomic DNA using primers forward CAAGCTTGCATGC
25 ng μl​ −1 with coinjection marker ttx-3::gfp or ttx-3::wCherry also at 25 ng μl​ −1 to GCGGCCGCACTCGCGGTGCCCAAAAGGTAGGTTATTGACGTATTCTCC
generate extrachromosomal arrays (unless otherwise noted). and r­ev­er­se G­TC­CT­TT­GG­CC­AA­TC­CC­GG­GG­AT­TA­CC­AC­CA­CC­AC­CA­CAAC
Cloning and constructs. To generate lim-6int4::wCherry (pMG198) and lim-6int4::gfp CACCGATCGACGAC, and cloned into pMH20 to replace the gar-3b promoter
(pMG141), a 291-bp fragment of the lim-6 fourth intron was amplified with p ­ rimers using restriction free cloning.
adding BamHI to forward (CCCCGGATCCTTAGCCAGTTGCATAAATAT) To generate unc-103F::nlg-1::gfp11 (pMH25), the unc-103F promoter was PCR-
and MscI to reverse (GGGGTGGCCACTAAGCTTCTTGCTAAAATTC). This amplified from N2 genomic DNA using primers forward CAAGCTTGCA
fragment was digested and ligated into a pPD95.75 vector with either GFP or TGCGCGGCCGCACCACGCCTGCCTAAGGGATGCCTTAGCTC and r­ev­er­se
codon-optimized mCherry (wCherry). Plasmids were injected at 5 ng μ​l−1 into a G­TC­CT­TT­GG­CC­AA­TC­CC­GG­GG­AT­GA­CA­TT­GC­CA­CGTGGTTGTGTGTGTG,
pha-1(e2123) mutant strain with pha-1(+​) coinjection marker. Extrachromosomal and cloned into pMH20 to replace the gar-3b promoter using restriction free cloning.
arrays were integrated to yield otIs541 and otIs525. lim-6int4 was found to express To generate lim-6int4::HisCl1::gfp (pMH3), the lim-6int4 promoter was PCR-
brightly in DVB, dimly in AVL and RIS, and dimly in about 70% of worms in PVT. amplified from N2 genomic DNA using primers forward GCATGCGCGGCCGCA
To generate lim-6int4::gfp::rab-3 (pMH1), lim-6int4 was PCR-amplified from CTGACTGGGCCGGCCGGATCCTTAGCCAGTTG and r­ev­er­se C­AA­TC­CC­GG­G
pMG193 using primers f­or­wa­rd G­AT­GG­AT­AC­GC­TA­AC­AA­CT­TG­GA­AA­TG­A G­AT­CC­TC­TA­GA­GG­CG­CG­CC­CT­AA­GC­TTCTTGCTAAAATTC, and cloned
A­AT­GG­AT­CC­TT­AG­CC­AG­TT­GCATAAATATTAAAGTCAAATG and reverse into pNP471 to replace the rig-3 promoter using restriction free cloning.
G­­AA­ A­­ C­­A­T­­AC­­C­T­­TT­­G­G­­GT­­C­C­­TT­­T­G­­GC­­C­A­­CT­­A­A­­GC­­T­T­­CT­­TG­CT­AAAATTCT To generate gar-3b::HisCl1::gfp (pMH28), the gar-3b promoter was PCR-
CTTTGATTTG, and cloned into DACR10 (a gift from D. Colon-Ramos) to amplified from pMH20 genomic DNA using primers forward CTTGCAT
replace the ttx-3 promoter using restriction free cloning. The resulting plasmid GCGCGGCCGCACTGACTGGGCCGGCCCATAAGCATCATGAGCAACATC
was injected at 45 ng μ​l−1 with coinjection marker ttx-3::gfp also at 45 ng μ​l−1. An TC and r­ev­er­se C­AA­TCCCGGGGATCCTCTAGAGGCGCGCCAAAGCTGG
extrachromosomal array was integrated to yield otIs659. GTCGATTAATAAATGTGCAG, and cloned into pMH3 to replace the lim-6int4
To generate lim-6int4::ChR2::yfp (pMH17), lim-6int4 was PCR-amplified from promoter using restriction free cloning.
p­MH­1 using primers forward C­TA­GA­TC­AA­AC­AA­GT­TT­GT­AC­AA­AA­AA­AG­CT­T Microscopy. Worms were anaesthetized using 100 mM sodium azide (NaN3) and
G­CATGCCTGGATCCTTAG and reverse C­­A­C­­TT­­T­G­­TA­­C­A­­AG­­A­A­­AG­­C­T­­GG­­G­T­­C mounted on a pad of 5% agar on glass slides. Worms were analysed by Nomarski optics
C­­T­A­­AG­­C­T­­TC­TT­GCTAAAATTCTCTTTG, and cloned into pLR183 (gar-3b:: and fluorescence microscopy, using a Zeiss 880 confocal laser-scanning microscope.
ChR2::yfp, a gift from L. R. Garcia16,30) to replace the gar-3b promoter using restric- Multidimensional data were reconstructed as maximum intensity projections using
tion free cloning. Zeiss Zen software. Puncta were quantified by scanning the original full Z-stack for
To generate lim-6int4::BirA::nrx-1LONG (pMH27), lim-6int4 was PCR-amplified distinct dots in the area overlapping with the processes of the DVB neuron. Figures
from pMH1 using primers forward GAAATGAAATAAAGCTTGCATGAG were prepared using Adobe Photoshop CS6 and Adobe Illustrator CS6.
CTTGCATGCCTGGATCCTTAG and reverse CTTTGGGTCCTTTGGCCAAT Neurite tracing. Confocal Z-stacks were opened using FIJI, and loaded into the
CCCGGCTAAGCTTCTTGCTAAAATTC, and cloned into pMO2331 (srg-13::BirA:: Simple Neurite Tracer plugin32. The primary neurite of DVB was traced from
nrx-1) to replace the srg-13 promoter using restriction free cloning. the centre of the cell soma to the point where the axon projects ventrally and
To generate lim-6int4::BirA::nrx-1SHORT (pMH41), the first exon of the nrx-1 short then turns anteriorly, at the final branch point before it becomes a single process.
isoform was PCR-amplified from N2 genomic DNA using primers forward G­­A­A­­GT­­ Neurites were added by tracing off of this primary neurite, including all neurites
G­G­­AG­­G­T­­GG­­A­G­­GC­­T­C­­CT­­C­A­­GG­­T­G­­TA­­T­T­­CC­TT­GAGCATTTGCGTGGTG and emanating posterior of the last branch point. The simple neurite tracer plugin was
reverse GTTGGAAGGACTGGCGAGAAGAATCCAGTAGTCTCTCC used to analyse the skeletons for neurite length, which were summed to calculate
GGACACATCATTC, and cloned into pMH27 to replace the first 23 exons of the total neurite length, and the number of neurite junctions (a proxy for the number
long isoform of nrx-1 using restriction free cloning. of neurite branches).
To generate lim-6int4::BirA::nrx-1noPDZ (pMH44), the first exon of the nrx-1 Cell ablation. We performed laser ablations using a MicroPoint Laser System
short isoform was PCR-amplified from N2 genomic DNA using ­primers f­or­wa­rd Basic Unit (N2 pulsed laser (dye pump), ANDOR Technology) attached to a Zeiss
C­AA­CG­GC­CA­CA­AT­GA­TG­AG­AA­AC­GG­AA­AC­GG­GA­AT­GG­GG­TG­GC­AT­CT­ Axioplan 2IE widefield microscope (objective EC Plan-Neofluar 100 Å~/1.30 Oil
CG­AG­GAGCTCCCGAGATCTTCAGCGCTC and reverse CTACGAATGCTG M27). This laser delivers 120 μ​Joules of 337-nm energy with a 3-ns pulse length.
AGCGCTGAAGATCTCGGGAGCTCCTCGAGATTATGCCACCCCATTCCC Ablations were performed as previously described33, with pulse repetition rates of
GTTTC, and cloned into pMH27 to delete the last 30 bp of nrx-1 cDNA before the ~15 Hz. Cell identification was performed with GFP or Cherry markers. Ablations
stop codon using restriction free cloning. were performed at the days of adulthood indicated, and worms were analysed
To generate lim-6int4::GFP::nrx-1 (pMH37), eGFP cDNA was PCR-amplified ~​20 h later. Mock-ablated worms were placed on same slide under the microscope
from pMH1 using primers f­or­wa­rd C­TA­TC­GG­AG­CA­GC­AT­TC­AA­TA­CT­AG­GC­A but were not ablated, and were allowed to recover in a similar manner. Before
T­T T­G G­C T­C AAAAAAGACTGTTACG and reverse CGACGATGAC relevant assays were performed (spicule protraction or aldicarb assays), worms
GTAACAGTCTTTTTTGAGCCAAATGCCTAGTATTGAATG, and cloned into were analysed for loss of cell fluorescence under a dissecting scope. When possible,
pMH27 to replace birA cDNA using restriction free cloning. after assays, worms were mounted on glass slides and analysed under a microscope
To generate lim-6int4::nlg-1::gfp1-10 (pMH18), lim-6int4 was PCR-amplified from to validate that cell ablation was successful.
pMH1 using primers forward CAAGCTTGCATGCGCGGCCGCACAGCTT Aldicarb spicule protraction assay. Aldicarb was added to warm liquid NGM
GCATGCCTGGATCCTTAG and r­ev­er­se G­TC­CT­TT­GG­CC­AA­TC­CC­GG­GG­AT­CT agar medium to a final concentration of 5 mM and poured into plates. Worms
­AA­GC­TT­CT­TG­CTAAAATTCTCTTTG, and cloned into MVC6 (gpa-6::nlg- were picked 12 or fewer at a time onto aldicarb plates and observed for spicule
1::gfp1-10, a gift from M. VanHoven) to replace the gpa-6 promoter using restriction protractions longer than 5 s, when the time was recorded for each worm13.
free cloning. Mating assay. L4 male worms were picked and singled onto plates. Non-mated
To generate gar-3b::nlg-1::gfp11 (pMH20), the gar-3b promoter was PCR- males were left individually on plates, whereas mated males had 10 unc-31(e928)
amplified from p­LR­183 using primers forward C­AA­GC­TT­GC­AT­GC­GC­GG­CC­G hermaphrodites added to their plates. We exposed males to uncoordinated
C­AC­CA­TA­AG­CA­TC­AT­GA­GC­AA­CATCTCCACTTCTCGTGAGC and reverse ­hermaphrodites (unc-31/CAPS), to ensure a successful mating experience.
GTCCTTTGGCCAATCCCGGGGATGATTAATAAATGTGCAGGAGGAGTA Following 48 h of being housed either individually or with 10 hermaphrodites, all

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

mated plates were checked for fluorescent progeny to ensure successful ­mating Expulsion steps were recorded for the time between consecutive expulsions,
had occurred, and then mated and non-mated (individually housed) males were and the presence of spicule protraction within 3 s before or after expulsion. The
subjected to confocal microscopy. C. elegans males housed with other males or ­percentage of expulsion steps associated with spicule protraction was calculated
in isolation can engage in mating-like behaviours, which may include spicule for each male. The time between consecutive expulsion steps was calculated by
­protraction. To minimize mating sensory input and self-mating behaviour, we also averaging all times recorded between consecutive expulsions for each male.
analysed DVB neurite outgrowth in males with mutation in pkd-222 and in males Exogenous GABA exposure. Males were picked onto normal NGM plates seeded
genetically paralysed by a mutation in unc-97/LIMS1 (affects body wall muscle with OP50 at the L4 stage, then picked before the day of analysis onto 30 mM GABA10
ultrastructure)23. or control plates seeded with OP50 and left overnight, and then subjected to confocal
Mating behaviour assay. Mating assays were based on procedures described microscopy. For 3-day GABA exposure, males were picked onto 30 mM GABA or con-
­previously 34,35. Males were picked at the L4 stage and kept apart from trol plates seeded with OP50, left for 3 days and then subjected to confocal microscopy.
­hermaphrodites. One male was transferred to a plate covered with a fresh OP50 Measurement of fluorescence intensity. To quantify the fluorescence intensity
lawn containing 15 adult unc-31(e928) hermaphrodites. Day 1 males were counted of nlg-1p::nlg-1::gfp, a stack of images was acquired using confocal microscopy
as less than 18 h after L4 moult. Males were observed for 5 min from the time of with the same acquisition parameters between samples (objective, pixel size, laser
first contact with a hermaphrodite or until they ejaculated, whichever came first. ­intensity, pinhole size, and PMT settings). The fluorescence intensity mean was
Males were scored for their ability to prod the vulva, protract spicules, and transfer obtained using ZEN Black software. For the dorsal spicule muscles, the muscles
sperm. Mating success was calculated as 100×​the number of males that transferred were outlined and the cross-section with the highest mean was recorded. Dorsal
sperm successfully divided by the total number of males tested. The number of spicule muscles include the gubernacular retractor, gubernacular erector, a­ nterior
attempts at prodding was calculated by summing attempts at prodding for each oblique, and anal depressor, which could be outlined easily, whereas the spicule
male. The protraction:prodding ratio was calculated by dividing the number of ­protractor could not always be observed in males after day 1. For the pre-anal
spicule protractions by the number of attempts at prodding for each male. ganglion and DVB or background, a pre-defined circle was used to outline the
Synapse visualization. GRASP plasmid construction is described above. For region of interest, and the cross section with the highest mean was recorded. The
­visualization of synaptic connections between DVB and neurons and muscles ratio of fluorescence intensity was calculated by dividing the mean of the dorsal
downstream of DVB that form the spicule protraction circuit, we injected lim-6int4:: spicule muscles (arbitrary units) by the mean of the DVB or background (arbitrary
nlg-1::gfp1-10 (pMH18) to label the presynaptic DVB, together with gar-3b::nlg-1:: units) or by dividing the mean of the pre-anal ganglion by the mean of the DVB or
gfp11 (pMH20) to label the postsynaptic SPC and spicule protractor m ­ uscles. background (arbitrary units).
Plasmids were injected together at 25 ng μ​l−1 with the coinjection marker Cell-autonomous changes in sexual identity. We tested cell-autonomous changes
ttx-3::gfp (also at 25 ng μl​ −1) to generate extrachromosomal arrays. For v­ isualization in the sexual identity of DVB (lim-6int4 promoter) and muscles (myo-3 promoter)
of synaptic connections between DVB and neurons and muscles downstream of by expressing either the cDNA of fem-3 in hermaphrodites to masculinize each
DVB that express flp-13, we injected lim-6int4::nlg-1::gfp1-10 (pMH18) to label the tissue, or the cDNA of tra-2intracellular domain in males to feminize each tissue38–40.
presynaptic DVB together with flp-13::nlg-1::gfp11 (pMH23) to label the postsy­ In males with feminized DVB or muscles, we observed no suppression of DVB
naptic spicule retractor muscles. Plasmids were injected together at 25 ng μ​l−1 with neurites, and in hermaphrodites with masculinized DVB or muscle, we observed
the coinjection marker ttx-3::gfp (also at 25 ng μ​l−1) to generate extrachromosomal no induction of DVB neurites.
arrays. Synapses between DVB and spicule retractor muscles were not reported in Statistics and reproducibility. We performed two-tailed Student’s t-test or one-way
electron microscopy of an ‘old male’36, possibly owing to the observed decrease in ANOVA with post-hoc Tukey HSD test using R and RStudio; P values are shown on
these synapses after day 1; alternatively, these synapses may have been characteri­zed each graph. No statistical methods were used to predetermine sample size, and the
as one of several ‘unknown’ connections of DVB8. The flp-13 promoter also labels experiments were not randomized. The investigators were not blinded to allocation
CP6 in males, which has few synapses with DVB that were located in the electron during experiments and outcome assessment. Number of independent biological
micoscopy reconstruction anterior to the DVB neurites, and the branched parts of replicates: Fig. 1b–d, 7; Fig. 2a–c, h–k, 3 or more; Fig. 2e, f, 2 or more; Figs 3a–g,
the axons of DVB and CP6 appear not to make contact (Extended Data Fig. 4h). 3 or more; Figs 4a–h, 3 or more; Extended Data Fig. 1a–c, 4 or more, Extended
Spicule activation assay with channelrhodopsin. All-trans retinal was added Data Fig. 1d, 2 or more; Extended Data Fig. 2a, b, 4 or more; Extended Data
to LB/OP50 medium and coated over the entire plate at a final concentration of Fig. 2c–h, 2 or more; Extended Data Fig. 3a–c, 3 or more; Extended Data Fig. 3d–f,
0.1 mM. We obtained strains expressing channelrhodopsin under the gar-3b 2 or more; Extended Data Fig. 4a–c, h, 2 or more; Extended Data Fig. 4d–g, 3 or more;
­promoter17,30,37 labelling spicule protraction neurons and muscles, under the Extended Data Fig. 5a–f, 4 or more; Extended Data Fig. 5g–l, 2 or more; Extended
unc-103E promoter labelling spicule protractors and anal depressor muscles, and Data Fig. 6a–f, 2 or more; Extended Data Fig. 7a–h, 3 or more; Extended Data
under the unc-103F promoter labelling spicule neurons SPC, PCA, and PCB16 (gifts Fig. 8a–c, 3 or more; Extended Data Fig. 8d–f, 2 or more; Extended Data Fig. 9b–i,
from L. R. Garcia). Worms were incubated overnight on retinal plates before all 3 or more; Extended Data Fig. 9j, 2 or more; Extended Data Fig. 10a–c, 3 or more.
assays involving channelrhodopsin-containing strains. For the spicule protraction Data availability. The data that support the findings of this study are available
assay, male worms on retinal plates were individually subjected to 488-nm light from the corresponding author upon reasonable request.
for 10 s, three times with 30 s between trials, on a Nikon eclipse E400 microscope.
Obvious spicule muscle contraction for any of the three trials was recorded as a 30. LeBoeuf, B., Correa, P., Jee, C. & García, L. R. Caenorhabditis elegans male
response. Videos were recorded using a mounted Exo Labs Focus camera. For the sensory-motor neurons and dopaminergic support cells couple ejaculation
activation protocol, male worms on retinal plates were subjected to alternating and post-ejaculatory behaviors. eLife 3, e02938 (2014).
488-nm light three times (15 s light/15 s dark) on a Leica M165 FC dissecting scope, 31. Oren-Suissa, M., Bayer, E. A. & Hobert, O. Sex-specific pruning of neuronal
repeated every 45 min for 4.5 h. Worms were then subjected to confocal micros- synapses in Caenorhabditis elegans. Nature 533, 206–211 (2016).
32. Longair, M. H., Baker, D. A. & Armstrong, J. D. Simple Neurite Tracer: open
copy or aldicarb behavioural assay. Controls for neurite outgrowth and aldicarb source software for reconstruction, visualization and analysis of neuronal
behaviour were performed on males under the same conditions but not exposed processes. Bioinformatics 27, 2453–2454 (2011).
to the channelrhodopsin cofactor all-trans retinal (Extended Data Fig. 5j–l). For 33. Fang-Yen, C., Gabel, C. V., Samuel, A. D., Bargmann, C. I. & Avery, L. Laser
recovery, worms were placed in the dark for ~​20 h after the activation protocol, microsurgery in Caenorhabditis elegans. Methods Cell Biol. 107, 177–206 (2012).
then subjected to the same analysis. A small number of individual males subjected to 34. Garcia, L. R., LeBoeuf, B. & Koo, P. Diversity in mating behavior of hermaphroditic
and male–female Caenorhabditis nematodes. Genetics 175, 1761–1771 (2007).
confocal imaging before and after activation, or after activation and following recov- 35. Hilliard, M. A., Bargmann, C. I. & Bazzicalupo, P. C. elegans responds to
ery, demonstrated addition of neurites following activation, and removal of neurites chemical repellents by integrating sensory inputs from the head and the tail.
following recovery; however, the difficulty of this analysis precluded quantification. Curr. Biol. 12, 730–734 (2002).
Neuronal silencing with histamine chloride channel (HisCl1). Control or transgenic 36. Sulston, J. E., Albertson, D. G. & Thomson, J. N. The Caenorhabditis elegans
worms were picked onto normal NGM plates seeded with OP50 at the L4 stage, then male: postembryonic development of nongonadal structures. Dev. Biol. 78,
542–576 (1980).
picked the evening before the indicated day of analysis onto 10 mM histamine or
37. Correa, P., LeBoeuf, B. & García, L. R. C. C. elegans dopaminergic D2-like
control plates with OP50 bacteria as a food source. For gar-3b::HisCl1 silencing assays, receptors delimit recurrent cholinergic-mediated motor programs during a
males were left on histamine or control plates overnight then subjected to confocal goal-oriented behavior. PLoS Genet. 8, e1003015 (2012).
microscopy the following morning. For lim-6int4::HisCl1 defecation analysis, males 38. White, J. Q. et al. The sensory circuitry for sexual attraction in C. elegans males.
were picked onto histamine plates, allowed to adjust for 5 min and then analysed Curr. Biol. 17, 1847–1857 (2007).
for defecation behaviour. Histamine plates were prepared as previously described12. 39. Lee, K. & Portman, D. S. Neural sex modifies the function of a C. elegans
sensory circuit. Curr. Biol. 17, 1858–1863 (2007).
Defecation assay. Males were placed on control or 10 mM histamine plates with 40. Mowrey, W. R., Bennett, J. R. & Portman, D. S. Distributed effects of biological
food on the day of analysis, allowed to explore for 5 min, and then observed sex define sex-typical motor behavior in Caenorhabditis elegans. J. Neurosci. 34,
for 10–12 min on a low magnification Leica MZ8 light dissecting microscope. 1579–1591 (2014).

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a day 1 day 3 day 5 b <0.001


<0.001
<0.001

total neurite length (µm)


lim-6int4::gfp lim-6int4::gfp

120
80
40
n = 18 25 22

0
day 1 day 3 day 5
c d
0.001
<0.001 <0.001 day 1 day 3 day 5
lim-6int4::gfp flp-10p::gfp
8 10 12
neurite junctions
6
4
2

n = 18 24 22
0

day 1 day 3 day 5

e g

f
h

Extended Data Figure 1 | Progressive neurite outgrowth in DVB in DVB from electron micrograph sections compiled by http://wormwiring.
adulthood. a–c, DVB neuron visualized with lim-6int4::gfp at days 1, 3, org showing DVB neurites. f, Inset of DVB neurites showing presynaptic
and 5 in adult males (a) and quantification of total neurite length (b) specializations identified in electron micrograph sections shown in pink.
and number of neurite junctions (c) (dot represents one worm; magenta g, h, Electron micrograph section showing DVB pseudo-coloured yellow
bar, median; boxes, quartiles; one-way ANOVA and post-hoc Tukey HSD, with presynaptic specialization indicated with red x with SPCR (Image
P values shown above plots, bold shows significance (P <​  0.05)). d, DVB Right1200, Section 14871) (g) and spicule sheath (Image N2YDRG1175,
neurite outgrowth visualized with flp-10::gfp in males at days 1, 3, and 5 Section 14816) (h), shown in white in inset panel. Scale bars, 1 μ​m.
of adulthood (n >​ 10, scale bars, 10 μ​m). e, Tracing reconstruction of male

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a day 5 b day 5
lim-6int4::wCherry neurite trace lim-6int4::gfp neurite trace

c day 1 day 5 d day 1 day 5


ser-2(prom2)::gfp flp-13p::gfp

*
DVA

CP6

e day 1 day 5 f dat-1p::gfp


day 1 day 5
inx-18p::gfp
ray neurons
DVC

g day 1 day 5 h day 1 day 5


srz-102p::gfp srg-4p::gfp
PVT

PVT

Extended Data Figure 2 | DVB neurite outgrowth in adult male visualized with inx-18p::gfp (n =​  5). e, CP6 neuron visualized with
C. elegans is stochastic and other neurons in the male tail do not show flp-13::gfp (cell soma not shown) (n =​  5). f, Ray neurons visualized with
progressive neurite outgrowth in adulthood. a, b, DVB neurites at day 5 dat-1::gfp (ventral view) (n =​  5). g, h, PVT neuron visualized with
visualized with lim-6int4::wCherry (a) or lim-6int4::gfp (b) (n >​ 10 for each). srz-102p::gfp (n =​  5) (g) and srg-4p::gfp (n =​  5) (h) at day 1 and day 5.
DVB posterior neurites were traced through confocal stacks using Simple Axons of indicated neurons highlighted by red dashed lines. Scale
Neurite Tracer4 plugin. c, DVA neuron visualized with ser-2(prom-2)::gfp bars, 10 μ​m.
(n =​ 5) (red dashed line indicates axon of relevant neuron). d, DVC neuron

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a lim-6int4::wCherry Ex[lim-6int4::hisCl::gfp] merge

day 3

b 0.933
<0.001
<0.001 c 0.617
0.562
0.037
<0.001 <0.001 <0.001 0.971 0.370 0.011

100 120
expulsions with spicule protraction (%)

time between expulsions (s)


50
40

80
30

60
20

40
10

20
n = 15 14 11 15
0

n = 15 14 11 15 day 1 day 3 day 3 day 3


day 1 day 3 day 3 day 3 + histamine
+ histamine
control Ex[lim-6int4::
control Ex[lim-6int4::
hisCl::gfp]
hisCl::gfp]

d mock ablated DVB ablated


DIC lim-6int4::gfp DIC lim-6int4::gfp

e lim-6int4::wCherry f lim-6int4::wCherry
merge merge
Ex[lim-6int4::ChR2::yfp]

Ex[gar-3b::ChR2::yfp]
day 1

day 1
Ex[lim-6int4::ChR2::yfp]

Ex[gar-3b::ChR2::yfp]
day 5

day 5

Extended Data Figure 3 | DVB inhibits expulsion-associated spicule (+​histamine is on 10 mM histamine plates; dot represents one worm;
protraction at day 3. Laser ablation of DVB and channelrhodopsin magenta bar, median; boxes, quartiles; one-way ANOVA and post-
expression in DVB and spicule protraction circuit. a, Confocal images of hoc Tukey HSD, P values shown above plots, bold shows significance
male worm with lim-6int4::wCherry and lim-6int4::HisCl1::gfp at day 3. (P <​  0.05)). d, Confocal images of male worms with or without laser
b, Quantification of the percentage of expulsion steps with spicule ablation of DVB at day 1 or 2, visualized with lim-6int4::gfp. e, Confocal
protraction for day 1 control, day 3 control, day 3 control +​ histamine, images of DVB (lim-6int4::wCherry) expressing channelrhodopsin at
and day 3 lim-6int4::HisCl1::gfp +​histamine males. c, Time between day 1 and 5, Ex[lim-6int4::ChR2::yfp]. f, Confocal images of DVB
consecutive expulsion steps for day 1 control, day 3 control, day 3 (lim-6int4::wCherry) and spicule circuit expressing channelrhodopsin at
control +​histamine, and day 3 lim-6int4::HisCl1::gfp +​histamine males day 1 and 5, Ex[gar-3b::ChR2::yfp]. n >​  10 for d–f. Scale bars, 10 μ​m.

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a control
day 3
unc-49(e407) control
day 5
unc-49(e407)

lim-6int4::wCherry

b 0.416
<0.001
0.482 c 0.548
0.010
0.841 d <0.001
200

12
total neurite length (µm)

600
10

time to protraction (s)


150

neurite junctions
8

400
100

6
4

200
50

day 3 day 5 day 3 day 5 day 5


n = 27 43 20 14 n = 27 43 20 14 n = 63 54

0
0

control unc-49(e407) control unc-49(e407) control unc-49(e407) control unc-49(e407) control unc-49(e407)
e control pkd-2(pt8) unc-97(su110)
lim-6int4::wCherry
day 3

f 0.019
<0.001
<0.001
g <0.001
<0.001
<0.001
total neurite length (µm)

10
80 100

neurite junctions
8
6
60

4
20 40

day 3 day 3
0
0

n = 17 19 15 n = 17 19 15
control pkd-2(pt8) unc-97(su110) control pkd-2(pt8) unc-97(su110)
h lim-6int4::wCherry flp-13p::gfp DIC merge merge inset inset schematic
day 1 - lateral view

**
**

*
day 1 - ventral view

*
*
*

*
*
*

Extended Data Figure 4 | DVB neurite outgrowth in unc-49, pkd-2 and differential interference contrast at day 1 in ventral and lateral
and unc-97 mutant males. flp-13p::gfp labels CP6 and spicule retractor views. Inset showing DVB and CP6 axons, with schematic of axons
muscles. a–c, Confocal images (a) and quantification of total neurite demonstrating lack of contact (red is DVB axon, green is CP6 axon,
outgrowth (b) and number of neurite junctions (c) in control and blue dashed lines are spicule retractor muscles). Asterisks in flp-13::gfp
unc-49(e407) males at days 3 and 5. d, Time to spicule protraction on panel mark spicule retractor muscles. Dot represents one worm; magenta
aldicarb at day 5 for control and unc-49(e407) males. e–g, Confocal images bar, median; boxes, quartiles; one-way ANOVA and post-hoc Tukey HSD,
(e) and quantification of total neurite outgrowth (f) and number of neurite P values shown above plots, bold shows significance (P <​  0.05), scale
junctions (g) in control, pkd-2(pt8), and unc-97(su110) males at day 3. bars, 10 μ​m.
h, Confocal images of male worms with lim-6int4::wCherry, flp-10p::gfp,

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a 0.003 b <0.001 c <0.001

80 100

0.8 1.0
10 12
average mating success (%)

protraction/prodding ratio
total prodding attempts
8

0.0 0.2 0.4 0.6


60

6
40

4
20

2
n = 37 28

0
0

day 1 day 3 day 1 (37) day 3 (28) day 1(37) day 3 (28)

d day 1 - 488 nm activation


unc-25(e156) unc-25(e156);
day 1 - 488 nm activation
unc-97(su110) unc-97(su110);
day 1 - 488 nm activation
nrx-1(wy778) nrx-1(wy778);
Ex[gar-3b::ChR2::yfp] Ex[gar-3b::ChR2::yfp] Ex[gar-3b::ChR2::yfp]
lim-6int4::wCherry

e f
0.991 0.321 0.952 0.991
0.006 <0.001 0.998 0.004 0.002 0.998
100
total neurite length (µm)

12
neurite junctions
80

10
8
60

6
40

4
20

n=24 16 24 21 24 20
unc-25(e156) unc-97(su110) nrx-1(wy778) unc-25(e156) unc-97(su110) nrx-1(wy778)
h
0

Ex[gar-3b:: Ex[gar-3b:: Ex[gar-3b:: n=24 16 25 21 23 20 0.143


ChR2::yfp] ChR2::yfp] ChR2::yfp] Ex[gar-3b:: Ex[gar-3b:: Ex[gar-3b:: <0.001 <0.001

g ChR2::yfp] ChR2::yfp] ChR2::yfp]

total neurite length (µm)


day 1 - 488 nm activation

120
control Ex[unc-103E::ChR2::yfp] Ex[unc-103F::ChR2::yfp]
lim-6int4::wCherry

80
40

day 1- 488 nm activation


0

n = 28 28 22
control Ex[unc-103E:: Ex[unc-103F::
ChR2::yfp] ChR2::yfp]

control Ex[unc-103E::ChR2::yfp] Ex[unc-103F::ChR2::yfp]


i <0.001
0.970
<0.001
10
neurite junctions
8
6
yfp

4
2

day 1- 488 nm activation


0

n = 28 28 22
Ex[unc-103E:: Ex[unc-103F::
j
control
0.985 0.236 0.966 k 0.998 0.025 0.008 l 0.416
ChR2::yfp] ChR2::yfp]
7
total neurite length (µm)

time to protraction (s)


6

300
60

neurite junctions
5

200
4
40

100
2
20

n = 22 15 16 16 n = 22 15 16 16
day 1- activation - no retinal day 1 - activation - no retinal day 1 - activation - no retinal
0

control Ex[gar-3b:: Ex[unc-103E:: Ex[unc-103F:: control Ex[gar-3b:: Ex[unc-103E:: Ex[unc-103F:: control (32) Ex[gar-3b:: (45)
ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp] ChR2::yfp]

Extended Data Figure 5 | See next page for caption.

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

Extended Data Figure 5 | Day 1 male mating defects involving spicule activation at day 1 (488-nm light for 3 ×​ 15 s every 45 min for 4.5 h).
coordination, spicule circuit activation in unc-25, unc-97, and nrx-1 g–i, Confocal images (g) and quantification of total neurite outgrowth (h)
mutant males, and spicule neuron or muscle activation induces DVB and number of neurite junctions (i) in control, Ex[unc-103E::ChR2::yfp],
neurite outgrowth. a, Per cent average mating success (sperm transfer) and Ex[unc-103F4::ChR2::yfp] worms after activation at day 1 with retinal
for day 1 and 3 males during 5-min timed mating assays with (488-nm light for 3 ×​ 5 s every 45 min for 4.5 h). j, k, Quantification of
15 unc-31(e928) hermaphrodites (n is number of worms, data points total neurite outgrowth (j) and number of neurite junctions (k) at day 1 in
represent average percentage for each replicate of multiple males). control, Ex[lim-6int4::ChR2::yfp] (DVB), Ex[unc-103E::ChR2::yfp] (neuron-
b, Quantification of attempts at spicule prodding during 5-min timed specific), and Ex[unc-103F4::ChR2::yfp] (muscle-specific) males after
mating assay for day 1 and 3 males. c, Ratio of protraction:prodding activation but in the absence of retinal. l, Time to protraction of control
attempts during 5-min timed mating assay for males at days 1 and 3. and Ex[lim-6int4::ChR2::yfp] males after day 1 activation in the absence of
d–f, Confocal images of lim-6int4::wCherry (d), total neurite length (e), retinal. Dot represents one worm; magenta bar, median; boxes, quartiles;
and number or neurite junctions (f) of unc-25(e156), unc-25(e156);Ex[gar- one-way ANOVA and post-hoc Tukey HSD, P values shown above plots,
3b::ChR2::yfp], unc-97(su110), unc-97(su110);Ex[gar-3b::ChR2::yfp], bold shows significance (P <​ 0.05), scale bars, 10 μ​m.
nrx-1(wy778), and nrx-1(wy778);Ex[gar-3b::ChR2::yfp] males following

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a control
day 3
30mM GABA control
day 5
30mM GABA

lim-6int4::wCherry

b 0.378
0.007
0.014
c 0.491
0.012
0.004

12
150
total neurite length (µm)

10
neurite junctions
8
100

6
4
50

2
day 3 day 5 day 3 day 5
n = 15 16 23 22 0 n = 15 16 23 22
0

control 30mM GABA control 30mM GABA control 30mM GABA control 30mM GABA

d no histamine 10 mM histamine no histamine 10 mM histamine


control control Ex[gar-3b::hisCl::gfp] Ex[gar-3b::hisCl::gfp]
lim-6int4::wCherry
day 5
gfp

0.017 <0.001

e 0.520
0.952
0.270
0.046
0.529
f 0.937
0.812
0.483
<0.001
0.002
12
total neurite length (µm)
200

10
neurite junctions
150

8
6
100

4
50

day 5 day 5
n = 12 12 10 11 n = 12 12 10 11
0

control control Ex[gar-3b:: Ex[gar-3b:: control control Ex[gar-3b:: Ex[gar-3b::


no histamine histamine hisCl::gfp] hisCl::gfp] no histamine histamine hisCl::gfp] hisCl::gfp]
no histamine histamine no histamine histamine

Extended Data Figure 6 | Exposure to exogenous GABA or silencing of control worms with or without overnight 10 mM histamine, and
spicule protraction circuit activity overnight reduces DVB neurites on day gar-3b::HisCl1::gfp worms with or without overnight 10 mM histamine.
5. a–c, Confocal images of lim-6int4::wCherry (a), total neurite length (b), Dot represents one worm; magenta bar, median; boxes, quartiles; one-way
and number or neurite junctions (c) of males exposed overnight to 30 mM ANOVA and post-hoc Tukey HSD, P values shown above plots, bold shows
GABA at days 3 and 5. d–f, Confocal images of lim-6int4::wCherry (d), significance (P <​ 0.05), scale bars, 10 μ​m.
total neurite length (e), and number of neurite junctions (f) at day 5 of

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a control nlg-1(ok259) nlg-1(ok259); nlg-1p::nlg-1::gfp nlg-1p::nlg-1::gfp

lim-6int4::mCherry
day 3

b 0.101
0.999
0.059
c 0.006
0.879
<0.001 d 0.979 0.999 0.458 0.001 0.014 e 0.999 0.742 0.926 <0.001 0.007

0.005 0.811 0.861 <0.001 0.773 0.996 <0.001 0.021 <0.001 <0.001 0.999 0.969 0.005 0.035 <0.001 <0.001 1.000 1.000

200
day 3 day 3 day 3
15
day 3

total neurite length (µm)


total neurite length (µm)
200

15
neurite junctions
neurite junctions

150
150

10

10
100
100

5
50
50

n = 23 24 19 22 n = 23 24 19 22 n = 21 43 31 26 28 28 25 n = 23 43 31 26 28 28 25

0
0
0
0

nlg-1(ok259) nlg-1(ok259)

l
fp

fp

fp
lg 9);

lg 9);

ro
l

l
fp

9)
)

ro
ro

ro
59

::g

::g

::g

nt
::g
::n 5

25

::n 5

nt
nt

nt
k2

1 p k2

1 p k2

1
-1

-1

un -3b -1
-1

3p 1
-1
3E -1
co
un -3b -1

3p 1
-1
-1

3E -1
co
ok

10 nlg-
co

co

10 nlg-

-1 lg-
-1 lg-
o

g- (o

g- (o

g
lg

lg
g
g

lg
lg

g
1(

1(

ga ::nl

c- ::nl
ga ::nl

c- ::nl
nl lg-1

nl g-1

::n

flp ::n

::n
flp ::n

::n
::n

::
g-

g-

::

t4
1p

t4
1p

F
-6 in
F
-6 in
nl

nl

nl

3
n

3
g-

10
g-

r
10
r
nl

lim
nl

lim

c-
c-

un
un
day 5 - nlg-1(ok259)
f no histamine histamine no histamine
Ex[gar-3b::hisCl::gfp]
histamine
Ex[gar-3b::hisCl::gfp]
GABA
lim-6 ::wCherry
gfpint4

0.092 0.256

g 0.997
0.059
0.027
0.995
0.944
h 1.000
0.139
0.107
0.989
0.968

1.000 0.974 0.004 0.806 0.983 0.948 0.009 0.662


12 14
200
total neurite length (µm)

neurite junctions
150

10
8
100

6
4
50

day 5 day 5
n = 23 13 14 16 19 n = 23 13 14 16 19
0

nlg-1(ok259) nlg-1(ok259)
histamine - + - + GABA histamine - + - + GABA
Ex[gar-3b:: Ex[gar-3b::
hisCl::gfp] hisCl::gfp]

Extended Data Figure 7 | NLG-1 expression in multiple male sex PCB and other neurons; unc-103E in male sex muscles; flp-13 in spicule
muscles rescues nlg-1 mutant DVB neurite phenotype. Silencing spicule retractor muscles and CP6. f–h, Confocal images (f) of lim-6int4::wCherry
circuit or exposure to exogenous GABA does not reduce DVB neurites in and Ex[gar-3b::HisCl1::gfp] in day 5 male worms, with total neurite length
nlg-1 mutant males. a–c, Confocal images of DVB (lim-6int4::wCherry) (a), (g) and number of neurite junctions (h) of nlg-1(ok259) worms with or
and quantification of total neurite outgrowth (b) and number of neurite without 10 mM histamine overnight, nlg-1(ok259); gar-3b::HisCl1::gfp
junctions (c) in control, nlg-1(ok259), nlg-1(ok259);nlg-1p::nlg-1::gfp, worms with or without 10 mM histamine overnight, and nlg-1(ok259)
and nlg-1p::nlg-1::gfp day 3 males. d, e, Quantification of total neurite worms with 30 mM GABA overnight. Dot represents one worm; magenta
outgrowth (d) and number of neurite junctions (e) in control or bar, median; boxes, quartiles; one-way ANOVA and post-hoc Tukey HSD,
nlg-1(ok259) mutant males with or without tissue-specific NLG-1 P values shown above plots, bold shows significance (P <​  0.05), scale
expression. Expression patterns for rescue promoters: lim-6int4 in DVB; bars, 10 μ​m.
gar-3b in SPC and spicule protractor muscles; unc-103F in SPC, PCA,

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a day 1 day 3 day 5

nlg-1p::nlg-1::gfp

b dorsal spicule muscles pre-anal ganglion


<0.001
0.120
<0.001 c <0.001
0.499
<0.001
1.3
fluorescence intensity ratio

fluorescence intensity ratio

2.2
1.2

2.0
(au/au)

(au/au)
1.1

1.8
1.0

1.6
1.4
0.9

n = 23 26 20 n = 23 26 20
day 1 day 3 day 5 day 1 day 3 day 5
30mM GABA ON 30mM GABA 3 days
control nlg-1(ok259) nlg-1(ok259) nlg-1(ok259) nrx-1(wy778)
d
nlg-1p::nlg-1::gfp
day 3

dorsal spicule muscles pre-anal ganglion


0.844 0.384 1.000 1.000

e <0.001
0.004 0.295
1.000 0.494
0.937
0.124
0.061
<0.001 0.007
f <0.001 <0.001 0.004
<0.001 0.995 0.982 1.000 <0.001
<0.001
1.000
<0.001 1.000 <0.001 0.115 0.791 0.968 0.485 <0.001 0.998 <0.001 <0.001 0.018 1.000 <0.001
1.3
fluorescence intensity ratio

fluorescence intensity ratio

3.0
1.2

2.5
(au/au)

(au/au)
1.1

2.0
1.0

1.5
0.9

n = 23 26 19 14 14 10 20 27 n = 23 26 19 14 14 10 20 27
day 1 day 3 day 1 day 3 day 3 day 3 day 1 day 3 day 1 day 3 day 1 day 3 day 3 day 3 day 1 day 3
control nlg-1(ok259) nrx-1(wy778) control nlg-1(ok259) nrx-1(wy778)
ys

ys
BA N

BA N
da

da
O

O
BA

BA
3

3
GA

GA
GA

GA

Extended Data Figure 8 | NLG-1 expression decreases from day 1 to as follows: control, nlg-1(ok259), nlg-1(ok259) with overnight GABA
day 3. a, Confocal images of nlg-1p::nlg-1::gfp in males at days 1, 3, and 5. exposure, nlg-1(ok259) with 3-day GABA exposure, and nrx-1(wy778).
Example regions of interest for measurements taken from single planes: e, f, Quantification of fluorescence intensity of nlg-1p::nlg-1::gfp in day 1
blue, dorsal spicule muscles; red, pre-anal ganglion; magenta, DVB. and 3 male worms as follows: control, nlg-1(ok259), nrx-1(wy778), day 3
b, c, Quantification of fluorescence intensity of nlg-1p::nlg-1::gfp in males nlg-1(ok259) with overnight GABA exposure, and nlg-1(ok259) with
at days 1, 3, and 5 reported as a ratio of mean fluorescence in dorsal spicule 3-day GABA exposure, as a ratio of mean fluorescence in dorsal spicule
muscles (b) or pre-anal ganglion (c) normalized to background of DVB, muscles (e) or pre-anal ganglion (f) normalized to background of DVB.
which has little-to-undetectable expression. Dorsal spicule muscles refer Dot represents one worm; magenta bar, median; boxes, quartiles; one-way
to the gubernacular retractor, gubernacular erector, anterior oblique, and ANOVA and post-hoc Tukey HSD, P values shown above plots, bold shows
anal depressor. d, Confocal images of nlg-1p::nlg-1::gfp in day 3 males significance (P <​ 0.05), scale bars, 10 μ​m.

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a nrx-1 (long isoform) 5 kB

nrx-1 (short isoform)


gk246237 ok1649 wy778 PDZ interaction motif *

point mutation deletion deletion <0.001 <0.001


0.845 <0.001 0.999 <0.001

b c d <0.001 0.002 0.178


<0.001 0.929 0.247 <0.001 e <0.001 <0.001 0.201
<0.001 0.908 0.746 <0.001

0.004 <0.001 <0.001 <0.001 0.047 <0.001 0.564 1.000 <0.001 0.211 <0.001 0.913 0.993 <0.001

15
total neurite length (µm)
total neurite length (µm)
20 40 60 80 100 120

150
10

neurite junctions
neurite junctions
8

10
100
6
4

5
50
2

day 3 day 3 day 3


n= 30 29 27 n= 31 30 27 n= 38 38 38 26 22 24 day 3
0

0
0

0
control nrx-1(ok1649) nrx-1(gk246237) control nrx-1(ok1649) nrx-1(gk246237) nrx-1(wy778) n= 38 38 38 26 22 25

::
] :birA
x-1 -6 in l
nrx-1(wy778)

ro
nt

::

::

::

::
t4

Ex ] :birA

Ex ] irA

]T :birA
:
co

] ::birA
x-1 -6 in l
ro
f

Z ::b

nt

::

::

::
t4

t4

t4
:

t4

Ex ] :birA

Ex ] irA

]T :birA
nr [lim
NG

x-1 -6 in

x-1 -6 in

x-1 -6 in

co
0.981

LO

Z ::b
Ex

t4

t4

t4
PD
nr [lim

nr [lim

nr lim
NG

OR

:
nr [lim
NG

x-1 -6 in

x-1 -6 in

x-1 -6 in
SH
LO

no

LO
[
Ex
0.002 0.005

Ex

PD
nr [lim

nr [lim

nr im
NG

OR
SH
LO

no

[ l
Ex
0.001 0.971 0.816
500
time to protraction (s)
400
300
200
100

day 3
n = 76 53 39 38
0

control nrx-1(wy778) Ex[lim-6int4::


Ex[lim-6int4:: nrx-1LONG]
nrx-1LONG]

nrx-1(wy778); nlg-1(ok259)
g nlg-1(ok259) nlg-1(ok259)
Ex[lim-6int4::birA::nrx-1LONG]
nrx-1(wy778)
Ex[lim-6int4::birA::nrx-1LONG]
lim-6int4::gfp
day 3

<0.001 0.004 day 1 day 3


h <0.001 <0.001
0.652 <0.001

0.883
i 0.903 <0.001
<0.001 <0.001 0.876
j merge Ex[lim-6int4:: merge Ex[lim-6int4::
1.000 <0.001 <0.001 0.834 0.981 <0.001 <0.001 0.992
lim-6int4::wCherry gfp::nrx-1LONG] lim-6int4::wCherry gfp::nrx-1LONG]
total neurite length (µm)
150

15

control
neurite junctions
100

10
50

day 3 day 3
n = 19 15 18 29 16 n = 19 15 18 29 16
nrx-1(wy778)
0
0

x- 1 LONG

);

x- 1 LONG
]

;
]
9)

9)

8)
)

)
78

78
78
78

78
-6 in 59 k25

-6 in 59 k25

] 77
y7

y7
7
y7

y7
y

y
-

-
o

w
w
rx

w
rx
w

w
1(

1(
(

(
-1 LO 1(

-1 LO 1(
::n

1(

::n

1(
-1

-1
g-

g-
NG

NG
]
::b );

rx x-

::b );

rx x-
rx

rx
irA

irA
nl

nl
::n ); nr

::n ); nr
nr

nr
;n

;n
m k2

m k2
9)

9)
t4

t4
-6 in 59

-6 in 59
[li (o

[li (o
25

25
Ex lg-1

m k2

Ex lg-1

m k2
ok

ok
t4

t4
[li (o

[li (o
1(

1(
n

n
Ex lg-1

Ex lg-1
g-

g-
nl

nl
n

nlg-1(ok259)

Extended Data Figure 9 | NRX-1 long isoform functions in DVB to at day 3 in control, nrx-1(wy778), nrx-1(wy778);Ex[lim-6int4::birA::nrx-
control DVB neurite outgrowth and NRX-1 expression in DVB controls 1LONG], and Ex[lim-6int4::birA::nrx-1LONG] worms. g–i, Confocal images
neurite outgrowth of nlg-1 mutants. a, Genetic loci of nrx-1 showing long of lim-6int4::wCherry expression (g) and quantification of total neurite
and short isoforms, PDZ binding motif, and locations of point mutation length (h) and number of neurite junctions (i) of day 3 nlg-1(ok259),
gk246237 and deletions ok1649 and wy778. b, c, Quantification of total nlg-1(ok259);Ex[lim-6int4::birA::nrx-1LONG], nrx-1(wy778),
neurite length (b) and number of neurite junctions (c) in controls and nrx-1(wy778);nlg-1(ok259), and nrx-1(wy778);nlg-1(ok259);Ex[lim-
long-isoform-specific mutants nrx-1(ok1649) and nrx-1(gk246237) at 6int4::birA::nrx-1LONG] males. j, Confocal images of lim-6int4::wCherry
day 3. d, e, Quantification of total neurite outgrowth (d) and number and Ex[lim-6int4::gfp::nrx-1LONG] in control, nrx-1(wy778), and
of neurite junctions (e) at day 3 in control, Ex[lim-6int4::birA::nrx-1LONG], nlg-1(ok259) males at day 1 and 3. Dot represents one worm; magenta
nrx-1(wy778), nrx-1(wy778);Ex[lim-6int4::birA::nrx-1LONG], bar, median; boxes, quartiles; one-way ANOVA and post-hoc Tukey HSD,
nrx-1(wy778);Ex[lim-6int4::birA::nrx-1SHORT], and nrx-1(wy778); P values shown above plots, bold shows significance (P <​  0.05) scale
Ex[lim-6int4::birA::nrx-1noPDZ] worms. f, Time to spicule protraction bars, 10 μ​m.

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a day 1 - 488 nm activation


control control Ex[gar-3b::ChR2::yfp] Ex[gar-3b::ChR2::yfp]
lim-6int4::wCherry

control control Ex[gar-3b::ChR2::yfp] Ex[gar-3b::ChR2::yfp]


yfp

b
control nlg-1(ok259) nrx-1(wy778) Ex[lim-6int4::birA::nrx-1LONG]
lim-6int4::wCherry

lim-6int4::gfp
day 3

c
0.738 1.000 0.988
0.996 0.988 0.983 0.996 0.851
worms with abnormal DVB axon (%)
30
20
10

day 1
488 nm activation day 3
0

n = 67 58 58 58 38 59
]
NG
p]

9)

)
l

78
ro

ro

1 LO
yf

25

7
nt

nt
2::

ok

wy

-
co

co

rx
hR

1(

1(

::n
:C

g-

x-

irA
b:

nl

nr
-3

::b
ar

t4
-6 in
[g
Ex

m
[li
Ex

Extended Data Figure 10 | DVB in hermaphrodites does not show neurites (in almost all cases, a single neurite off the axon just posterior
neurite branching upon gar-3b::ChR2::yfp activation or NRX-1 or to the pre-anal ganglion) in day 1 control and Ex[gar-3b::ChR2::yfp]
NLG-1 manipulation. a, Confocal images of lim-6int4::wCherry and with activation, day 3 control, nrx-1(wy778), nlg-1(ok259), and
Ex[gar-3b::ChR2::yfp] expression in day 1 hermaphrodites showing Ex[lim-6int4::gfp::nrx-1LONG] worms. n shows number of worms, data
DVB axon projection after activation with retinal (488-nm light for points represent average percentage for each replicate of multiple
3 ×​ 15 s every 45 min for 4.5 h). b, Confocal images of lim-6int4:: hermaphrodites. Dot represents one worm; magenta bar, median;
wCherry or lim-6int4::gfp in control, nrx-1(wy778), nlg-1(ok259), and boxes, quartiles; one-way ANOVA and post-hoc Tukey HSD, P values
Ex[lim-6int4::gfp::nrx-1LONG] hermaphrodites at day 3. c, Quantification shown above plots, bold shows significance (P <​ 0.05), scale bars, 10 μ​m.
of the percentage of hermaphrodites with DVB axon abnormalities or

© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article doi:10.1038/nature25154

Alcohol and endogenous aldehydes damage


chromosomes and mutate stem cells
Juan I. Garaycoechea1, Gerry P. Crossan1, Frédéric Langevin1, Lee Mulderrig1, Sandra Louzada2, Fentang Yang2,
Guillaume Guilbaud1, Naomi Park2, Sophie Roerink2, Serena Nik-Zainal2, Michael R. Stratton2 & Ketan J. Patel1,3

Haematopoietic stem cells renew blood. Accumulation of DNA damage in these cells promotes their decline, while
misrepair of this damage initiates malignancies. Here we describe the features and mutational landscape of DNA
damage caused by acetaldehyde, an endogenous and alcohol-derived metabolite. This damage results in DNA double-
stranded breaks that, despite stimulating recombination repair, also cause chromosome rearrangements. We combined
transplantation of single haematopoietic stem cells with whole-genome sequencing to show that this damage occurs
in stem cells, leading to deletions and rearrangements that are indicative of microhomology-mediated end-joining
repair. Moreover, deletion of p53 completely rescues the survival of aldehyde-stressed and mutated haematopoietic
stem cells, but does not change the pattern or the intensity of genome instability within individual stem cells. These
findings characterize the mutation of the stem-cell genome by an alcohol-derived and endogenous source of DNA damage.
Furthermore, we identify how the choice of DNA-repair pathway and a stringent p53 response limit the transmission of
aldehyde-induced mutations in stem cells.

The consumption of alcohol contributes to global mortality and ­cancer and repair mechanisms that counteract this. We also establish a method
development1. Most of the toxic effects of alcohol are probably caused that allows us to determine the mutational landscape of individual
by its oxidation product acetaldehyde, which is highly reactive towards HSCs, and in doing so, provide new insight into the p53 response in
DNA2. The enzyme aldehyde dehydrogenase 2 (ALDH2) p ­ revents mutagenized stem cells.
acetal­dehyde accumulation by oxidizing it efficiently to acetate, but
around 540 million people carry a polymorphism in ALDH2 that Ethanol stimulates homologous recombination repair
encodes a dominant-negative variant of the enzyme3. Alcohol con- Aldh2−/−Fancd2−/− mice develop severe HSC attrition, causing spon-
sumption in these individuals induces an aversive reaction and predis- taneous bone marrow failure, which can also be induced by exposing
poses them to oesophageal cancer4. Nevertheless, ALDH2 deficiency these mice to ethanol5,6. This genetic interaction suggests that in the
is surprisingly well tolerated in humans. This could be because of the absence of aldehyde catabolism (such as in Aldh2−/− mice), DNA repair
additional tier of protection provided by FANCD2, a DNA-crosslink- is engaged to maintain blood homeostasis. To test this theory, we set out
repair protein. In fact, genetic inactivation of Aldh2 and Fancd2 in to monitor DNA repair activity in vivo. The Fanconi anaemia pathway
mice leads to cancer and a profound haematopoietic phenotype5,6. repairs DNA crosslinks by using a replication-coupled excision mecha-
In humans, deficiency in DNA-crosslink repair causes the inherited nism that is completed by homologous recombination14,15. We therefore
illness Fanconi anaemia, a devastating condition that leads to abnormal used a method to visualize sister-chromatid exchange (SCE) events in
develop­ment, bone-marrow failure and cancer7. Acetaldehyde geno- bone marrow cells of living mice; these represent recombination repair
toxicity is likely to contribute to this phenotype, as Japanese children transactions coupled to replication (Fig. 1a). The number of SCE events
who are afflicted with Fanconi anaemia and carry the ALDH2 poly- is elevated 2.3-fold in Aldh2−/− mice, indicating that recombination
morphism display earlier-onset bone marrow failure8. Together, these repair is stimulated in response to endogenous aldehydes (Fig. 1b, c).
data suggest that endogenous aldehydes are a ubiquitous source of DNA Moreover, a single exposure to alcohol causes a fourfold increase
damage that impairs blood production. in SCE events in Aldh2−/− mice (Fig. 1b, c, Extended Data Fig. 1a),
It is likely that some of this damage occurs in haematopoietic stem suggesting that physiological acetaldehyde accumulation in blood cells
cells (HSCs), which are responsible for lifelong blood production. HSC is not sufficient to inactivate the homologous recombination repair
attrition is a feature of ageing, and mutagenesis in the remaining HSCs ­factor BRCA216. Fancd2−/− mice do not show a similar induction
promotes dysfunctional haematopoiesis and leukaemia. Moreover, both ­following exposure to ethanol; therefore, detoxification is the primary
humans and mice that lack DNA repair factors are prone to HSC loss, mechanism that prevents DNA damage by aldehydes and alcohol.
and in some cases, bone marrow failure9,10. HSCs employ DNA repair Finally, the number of SCE events in Aldh2−/−Fancd2−/− mice is indis-
and respond to damage in a distinct manner compared to later pro- tinguishable from that in Aldh2−/− mice, showing that homologous
genitors11,12. While these observations point to a fundamental role for recombination repair occurs despite inactivation of FANCD2 (Fig. 1c,
DNA repair in HSCs, recent work has highlighted that the response to Extended Data Fig. 1b).
replication stress maintains HSC function and integrity13. However, The repair of aldehyde-induced DNA damage is therefore not
there is a key gap in our knowledge regarding the identity of the endog- ­limited to the Fanconi anaemia crosslink-repair pathway. As the
enous factors that damage DNA and lead to replication stress. Here recombination machinery is essential for mouse development, we used
we show that alcohol-derived and endogenous aldehydes damage the the isogenic chicken B-cell line DT40, which has been used to define
genomes of haematopoietic cells, and we characterize the surveillance the involvement of homologous recombination in crosslink repair14.
1
MRC Laboratory of Molecular Biology, Cambridge Biomedical Campus, Francis Crick Avenue, Cambridge CB2 0QH, UK. 2Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK.
3
Department of Medicine, University of Cambridge, Addenbrooke’s Hospital, Hills Rd, Cambridge CB2 0QQ, UK.

1 1 j a n u a r y 2 0 1 8 | V O L 5 5 3 | NA T UR E | 1 7 1
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a c d 100 e 100
BrdU pellet Colchicine IP NS (P = 0.9067) DT40 DT40
40
10 10 ∆XRCC2

Survival (%)
Survival (%)
∆XRCC3
12 h, 30 min ∆RAD51C
± Ethanol, 12 h Harvest 1 ∆PALB2 1
BM cells ∆RAD51D
b 30 P < 0.0001 ∆RAD51B

SCEs per metaphase


0.10 ∆FANCC 0.10 ∆FANCC
P < 0.0001
∆BRCA2

20 P < 0.0001 0.01 0.01


0 2 4 6 8 0 2 4 6 8
Acetaldehyde (mM) Acetaldehyde (mM)

(n = 2) (n = 6) (n = 4) f 100 g 100
10 DT40
Wild type Fancd2–/– Wild type + ethanol DT40
∆XRCC2
10

Survival (%)

Survival (%)
∆FANCC ∆XRCC2
10 ∆FANCC/ 1
0 ∆FANCC
– – ∆XRCC2
–/ –/
– –/ –/


pe

pe
2 2 2 2

2 –/

–/

2 –/

–/
dh d dh d
ty

ty
d2

d2
Al anc Al anc 0.10 ∆FANCC/

dh

dh
ild

ild
nc

nc
Al

Al
∆XRCC2
W

W
Fa

Fa
(n = 6) (n = 7) (n = 21) F F
Aldh2–/– Aldh2–/– Fancd2–/– Aldh2–/– + ethanol + Ethanol 1 0.01
0 0.5 1.0 1.5 2.0 0 2 4 6 8
Cisplatin (μM) Acetaldehyde (mM)

Figure 1 | Ethanol induces potent homologous recombination in vivo. the bone marrow of Aldh2−/−Fancd2−/− and control mice (triplicate
a, Treatment of mice with BrdU for differential labelling of sister experiments, 25 metaphases per mouse, n =​  75; P calculated by two-sided
chromatids of bone marrow cells in vivo. Some mice were also treated Mann–Whitney test; data shown as mean and s.e.m.). NS, not significant.
with ethanol, a precursor of acetaldehyde. IP, intraperitoneal injection; d–g, Clonogenic survival of DT40 DNA-repair mutants (triplicate
BM, bone marrow. b, Representative images of bone-marrow metaphase experiments; data shown as mean and s.e.m.).
spreads (n, number of SCEs per metaphase). c, Number of SCEs in

DT40 cells carrying disruptions of key homologous recombination FANCD2 prevents alcohol-induced genomic instability
genes show hypersensitivity to acetaldehyde (Fig. 1d, e), in a similar The active DNA recombination in bone marrow cells indicates that
way to cells lacking the Fanconi anaemia gene FANCC. To test the rela- even in the absence of FANCD2, there is an alternative repair response
tionship between the Fanconi anaemia and homologous recombination to both endogenous and ethanol-derived aldehydes. However, our
pathways, we analysed the sensitivity of cells deficient in both FANCC ­previous work has shown that Aldh2−/−Fancd2−/− mice lose the a­ bility
and XRCC2. These cells showed the same sensitivity to cisplatin as the to maintain blood production5,6. To determine whether this is due to
­single knockout cells (Fig. 1f), but were much more sensitive to acetal­ the accumulation of damaged DNA, we examined ­haematopoietic
dehyde (Fig. 1g), indicating that homologous recombination repair cells for evidence of broken chromosomes. One marker of genetic
confers additional acetaldehyde resistance beyond that provided by instability is the formation of micronuclei, which are formed from
Fanconi anaemia crosslink repair. In summary, detoxification provides lagging or broken chromosomes. Micronuclei are easily quantified
the dominant protection mechanism against endogenous aldehydes; in normochromic erythrocytes (NCEs) in vivo, because they persist
however, when aldehydes damage DNA, cells use both DNA-crosslink following enucleation (Fig. 2a, Extended Data Fig. 1c). There is a
and homologous recombination repair. significant increase in the proportion of NCEs with micronuclei in

a Wild type Aldh2–/– Fancd2–/– b 2.5


9.5-fold,
P < 0.0001
c 25 P = 0.0004 d e 25 Duplication
105 Aneuploidy
1.9-fold, NS

Aberrations in 90 metaphases
Micronucleated NCEs (%)

Abnormal metaphases (%)

2.0 20 Translocation
P < 0.0001 (P = 0.12) 20
der(1,5) 2 3 4 der(1,5)
T(1,5) Deletion
104 Chromatid break
CD71 (FITC)

1.5 2.9-fold, 15 NS 15
P < 0.0001 (P = 0.25)
6 7 8 9 10
103
1.0 10 10
11 12 der(2,13)
T(2,13) 14 15
102 Mn-NCE Mn-NCE 0.5
0.13 ± 0.005% 1.24 ± 0.05% 5 5
0
0.0 16 17 18 19 X Y
0 103 104 105 0 103 104 105 –/

/–
0 0
40, XY, der(1)T(1;5), der(5)T(1;5), der(13)T(2;13)
Fa h2 –/–

– –
Al pe

2 2– –/ –/
–/

– –
–/ –/
nc –

nc –

Al pe

Al pe

DNA (PI) DNA (PI) dh d


Fa h2 –/

–/

Fa h2 –/

–/

2 2 2 2
ty

d2

Al anc dh d dh d
ty

ty
d2

d2
ild

d
nc

Al anc Al anc
ild

ild
d

d
W

F
W

F F
f g 8
h 80 P = 0.0017
3.9-fold,
P < 0.0001
reticulocytes (%)

metaphases (%)
Micronucleated

6 1.9-fold, 3.0-fold, NS 60
Abnormal

P = 0.0001 P < 0.0001 (P = 0.1)


48 30
hours minutes 4 40
or
Ethanol IP Blood sample Colchicine IP Bone marrow 2 20
5.8 g kg–1 measure Mn-Ret M-FISH
0 0
Ethanol – + – + – + – + Ethanol – + – + – + – +
Wild type Aldh2–/– Fancd2–/– Aldh2–/– Wild type Aldh2–/– Fancd2–/– Aldh2–/–
Fancd2–/– Fancd2–/–

Figure 2 | Spontaneous and ethanol-induced genomic instability chromosomal aberrations (90 metaphases per genotype). f, Treatment
in Aldh2−/−Fancd2−/− mice. a, Quantification of micronucleated of mice with ethanol to assess genomic instability with the micronucleus
normochromic erythrocytes (Mn-NCE, CD71− PI+) by flow cytometry. assay (g) or M-FISH karyotyping (h). g, Percentage of micronucleated
b, Percentage of micronucleated normochromic erythrocytes (P calculated reticulocytes (Mn-Ret, CD71+ PI+) after ethanol treatment. P calculated
by two-sided Mann–Whitney test; data shown as mean and s.e.m.; n =​  28, by two-sided Mann–Whitney test; data shown as mean and s.e.m.; n =​  29,
28, 25 and 37 mice, left to right). c, Percentage of abnormal metaphases 15, 25, 15, 20, 10, 28 and 9 mice, left to right. h, Abnormal metaphases
in bone marrow cells (P calculated by one-sided Fisher’s exact test; data in bone marrow cells after ethanol treatment. P calculated by one-sided
shown as mean and s.e.m.; three mice per genotype, 30 metaphases per Fisher’s exact test; data shown as mean and s.e.m.; 3 mice per genotype,
mouse). d, A Aldh2−/−Fancd2−/− metaphase, showing two translocations, 30 metaphases per mouse.
see Extended Data Fig. 1f–i for the complete list of aberrations. e, Types of

1 7 2 | NA T UR E | V O L 5 5 3 | 1 1 j a n u a r y 2 0 1 8
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

both Aldh2−/− (2.9-fold) and Fancd2−/− (1.9-fold) mice compared to a Fancafl/+ Fancafl/– Fancafl/+ Ku70–/– Fancafl/– Ku70–/– (all Vav1-iCre+)

wild-type controls, but the increase is much larger in Aldh2−/− 15 P = 0.0101 55 P = 0.0063 10 2,000 NS (P = 0.15)

Mean corpuscular volume (μm3)

White blood cells (×103 mm–3)


54
Fancd2−/− mice (9.5-fold, Fig. 2b). These micronuclei could represent

Red blood cells (×106 mm–3)


P = 0.0101 P = 0.0088
53 8

Platelets (×103 mm–3)


1,500
genomic instability during blood production. We therefore examined 10
52
NS
cells in metaphase obtained directly from the bone marrow of these 51
50
6
(P > 0.99)
1,000
mice with multiplex fluorescence in situ hybridization (M-FISH). More 49 4
5
than 10% of Aldh2−/−Fancd2−/− bone-marrow cells carried chromo- 48
47 2
500
somal aberrations, encompassing all classes of cytogenetic change 46
(Fig. 2c–e). These aberrations are not clonal events, because each karyo­ 0 45 0 0

type was unique (Extended Data Fig. 1). b Fancafl/+ Vav1-iCre+ Fancafl/– Ku70–/– Vav1-iCre+ c
150 P = 0.0556
Next, we investigated whether this chromosome damage was

HSPCs (% of wild type)


104
exacerbated by exposure to ethanol. As a control, we exposed wild- LKS 0.16% LKS 0.04%

c-Kit (PerCP-Cy5.5)
100
type or Fancd2−/− mice to mitomycin C (Extended Data Fig. 1d).
103
The experimental scheme (outlined in Fig. 2f) shows how we deter-
mined the prevalence of micronuclei in reticulocytes and aberrant 50

metaphases following exposure to ethanol. A single dose of ethanol 0


caused a marked increase in the proportion of reticulocytes containing 0
103 104 105 103 104 105
micronuclei in Aldh2−/− mice. Notably, this induction was comparable
0 0

Fa a fl/+

Ku fl/–

70 /–
Fa 0 –/–


Ku ca fl
–/
a
Sca-1 (PE-Cy7) Sca-1 (PE-Cy7)

nc
nc

7
n
to that observed in wild-type mice following exposure to agents known

Fa
d
to induce genome instability, such as ionizing irradiation or vincris- 105
150

tine (Extended Data Fig. 1e). However, there was a stronger induc- P = 0.0485

HSCs (% of wild type)


tion of micronucleus formation in Aldh2−/−Fancd2−/− mice than in 104
100

CD48 (BV421)
controls (Fig. 2g), which was accompanied by a striking increase in 103
the ­number of abnormal metaphases, with almost 60% of metaphases 50
having ­damaged chromosomes following ethanol exposure (Fig. 2h,
Extended Data Fig. 1g–i). These mice rapidly lost the ability to pro- 0
HSCs 0.008% HSCs 0.001%
duce blood and died from bone-marrow failure (Extended Data Fig. 2). 0 103 104 105 0 103 104 105
0

Fa a fl/+

Ku fl/–

70 /–
Fa 0 –/–


Ku ca fl
–/
These results show that, despite activation of homologous recombi- CD150 (PE) CD150 (PE)

a
nc
nc

7
n
Fa
nation, the Fanconi anaemia crosslink-repair pathway is essential for e P < 0.0001 f P = 0.0043 g P = 0.0002
1.2
CFU-S12 per 105 nucleated BM cells

20
preventing chromosome breakage and loss of blood homeostasis in P < 0.0001 P = 0.0013
100

Micronucleated NCEs (%)


response to aldehydes. 1.0

(% relative to untreated)
15

CFU-S12 survival
0.8

Ku70 contributes to repair of aldehyde-induced DSBs 10 0.6 10


The presence of chromosome breaks and translocations suggests 0.4
that aldehydes cause double-stranded breaks (DSBs), which could be 5
0.2
processed by non-homologous end-joining (NHEJ) repair17. Previous
0 0 1
studies in cell lines and nematodes have indicated that, in the absence (all Vav1-iCre+)
Fa a fl/+
Ku a fl/–

70 /–

Fa a fl/+

Ku a fl/–

70 /–

Fa a fl/+

Ku a fl/–

70 /–
Fa 0 –/–

Fa 0 –/–

Fa 0 –/–


Ku ca fl

Ku ca fl

Ku ca fl
–/

–/

–/
of the Fanconi anaemia pathway, engagement of DSBs by NHEJ leads
nc

nc

nc
nc

nc

nc
7

7
n

n
Fa

Fa

Fa
to further genomic instability18,19. Therefore, we investigated whether Figure 3 | NHEJ cooperates with the Fanconi anaemia pathway to
NHEJ and Fanconi anaemia repair are redundant in resolving endo­ maintain HSC integrity, genomic stability and cellular resistance to
genous DNA damage in HSCs, and whether there is a role for NHEJ in aldehydes. a, Blood parameters of 8- to 12-week old mice (P calculated by
maintaining resistance to acetaldehyde. two-sided Mann–Whitney test; data shown as mean and s.e.m.; n =​ 8, 6, 7
To do this, we crossed mice deficient in the known Fanconi and 5 mice, left to right). b, Representative flow cytometry plot of
anaemia repair gene Fanca with mice lacking the key NHEJ ­factor haematopoietic stem and progenitor cells (HSPCs) of Fancafl/-Ku70−/−
Vav1-iCre mice and control. LKS, Lin−Kit+Sca-1+. c, d, Quantification
Ku70 (encoded by Xrcc6, also known as Ku70). We failed to obtain
of HSPCs (Lin−Kit+Sca-1+) and HSCs (Lin−Kit+Sca-1+CD48−CD150+)
Fanca −/−Ku70 −/− mice, indicating that there was a synthetic by flow cytometry (P calculated by two-tailed Student’s t-test; data shown
lethal interaction between Ku70-dependent NHEJ and Fanconi as mean and s.e.m.; n as in a). e, Counts of colony-forming unit-spleen
­anaemia-crosslink repair (Supplementary Information Table 1). To (CFU-S) colonies from the bone marrow of Fancafl/-Ku70−/− Vav1-iCre
bypass embryonic lethality, we generated blood-specific Fanca knock- and control mice. Each point represents the number of CFU-S12 in a single
out mice (Extended Data Fig. 3) and crossed them with Ku70+/− mice recipient (P calculated by two-sided Mann–Whitney test; data shown as
to produce mice that had the double mutation in HSCs and the blood mean and s.e.m.; n =​  20 mice). f, Frequency of Mn-NCE (P calculated by
compartment (Fancafl/-Ku70−/− Vav1-iCre). These mice were viable, two-sided Mann–Whitney test; data shown as mean and s.e.m.; n as in a).
­indicating that the embryonic lethality of Fanca−/−Ku70−/− is not g, Survival of CFU-S12 after treatment with 4 mM acetaldehyde for 4 h,
due to failed blood production (Supplementary Information Table 1). relative to untreated samples (P calculated by two-sided Mann–Whitney
test; data shown as mean and s.e.m.; n =​  10 mice).
However, blood counts show that Fancafl/-Ku70−/− Vav1-iCre mice are
­anaemic (Fig. 3a) and have fewer HSCs compared to congenic controls
(Fig. 3b–e). Fancafl/-Ku70−/− Vav1-iCre mice also display genomic damage. This result contrasts with the reported negative impact of
instability, with increased frequency of micronuclei-containing NCEs active NHEJ on the viability of Fanconi anaemia-deficient chicken
(Fig. 3f). Finally, we tested whether Ku70 was required to maintain DT40 cells and worms18,19.
resistance of short-term (ST)-HSCs to aldehydes by exposing bone
marrow cells to acetaldehyde in vitro before injecting them into lethally Aldehyde-damaged HSCs are functionally compromised
irradiated recipients. Fancafl/-Ku70−/− Vav1-iCre ST-HSCs were much Our results so far indicate that endogenous aldehydes give rise to
more sensitive to acetaldehyde than either of the single mutant ST-HSCs DSBs in the absence of Fanconi anaemia repair, which are engaged by
(Fig. 3g). These results indicate that in the mouse ­haematopoietic homologous recombination and NHEJ, but ultimately rearrange chro-
­system, in the absence of Fanconi anaemia repair, NHEJ is required mosomes in bone marrow cells. A key question is whether e­ ndogenous
to provide resistance to endogenous and a­ cetaldehyde-induced DNA DNA damage and subsequent mutations accumulate in the HSC

1 1 j a n u a r y 2 0 1 8 | V O L 5 5 3 | NA T UR E | 1 7 3
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
RESEARCH Article

a Sort single HSCs Sort HSC progeny

c-Kit (PerCP-Cy5.5)

CD45.2
Visual
confirmation
Lineage- 16 weeks
CD150+ CD48–
WGS: c-Kit+ Sca-1+
WGS:
Germline Sca-1 (PE-Cy7) HSC clone CD45.1

Wild type (n = 12)


b 1 HSC 5 HSCs c Aldh2–/– (n = 12)
P < 0.0001 P < 0.0001 100 Fancd2–/– (n = 21)
100 100 Aldh2–/–Fancd2–/– (n = 38)

Reconstitution efficiency (%)

Reconstitution efficiency (%)


P = 0.0009 P = 0.0007

75 75 10

Contribution (%)
12 / 36
1

12 / 40
50 50

11 / 12

10 / 12

12 / 21
16 / 79

5 / 38
0.10

6 / 123
25 25

0 0 0.01
0 4 8 12 16
nc 2 –/–

nc 2 –/–

Fa 2 –/–

Fa 2 –/–


Al pe

Al pe
–/

–/
–/

–/
Time (weeks)
d2

d2
d2

d2
ty

ty
Fa ldh

Fa dh
dh

dh
nc

nc
ild

ild

Al
A

P = 0.0138
e
W

W
d Gr-1+ Mac-1+ B220+ CD4+ CD8+
NS (P = 0.33)
100 100

Myeloid chimaerism (%)


Lineage distribution (%)

75 75

50 50

25 25

0 0

nc 2 –/–

nc 2 –/–
Fa ldh /–
Fa ldh e

–/
1 2 3 4 5 6 7 8 910 12 1 2 3 4 5 6 7 8 910 12 1 2 3 4 5 6 7 8 910 12 14 16 1 2 3 4 5 6

A d2 –
A typ

d2
Wild type Aldh2–/– Fancd2–/– Aldh2–/–

ild
Fancd2–/–

W
Figure 4 | Single HSC transplantation reveals that Aldh2−/−Fancd2−/− c, Contribution to blood production over time by five transplanted HSCs
HSCs are functionally compromised. a, Transplantation of single HSCs (data shown as mean and s.e.m.). d, Lineage composition of single-
for the generation of HSC clones in vivo. The HSC progeny (CD45.2+) HSC clones four months after transplant; columns represent individual
were recovered after four months and analysed by whole-genome recipients or clones. e, Proportion of myeloid (Gr-1+Mac-1+) HSC-
sequencing, alongside a germline reference. b, Percentage and number of derived white blood cells (P calculated by two-sided Mann–Whitney test;
irradiated recipients that were positive for reconstitution by one or five data shown as mean and s.e.m.; n =​ 12, 12, 16 and 6 HSC clones, left to
transplanted HSCs (P calculated by two-sided Fisher’s exact test). right).

c­ ompartment. This is a critical question because there is evidence mutations in the HSC. Genomes of Aldh2−/−Fancd2−/− HSCs were
that HSCs differ in their DNA repair capacity and response compared mutated with increased prevalence of indels, rearrangements and trans-
to later progenitors11. Two obstacles had to be overcome in order locations (Fig. 5a, Extended Data Fig. 4).
to ­establish whether endogenous aldehydes mutate the genomes of Although the number of single-base substitutions was significantly
these vital cells. First, the stochastic nature of DNA damage makes it higher in Aldh2−/−Fancd2−/− genomes (Fig. 5b), the total numbers were
unlikely that the same mutation will occur in multiple cells. Second, low and no changes were detected in the type of substitutions (Fig. 5c).
the scarcity of HSCs, especially in the case of Aldh2−/−Fancd2−/− We also found no difference in the frequency or pattern of point muta-
mice, precludes the use of most conventional techniques to assess tions in bone marrow cells of Aldh2−/−Fancd2−/− mice using the Select-
DNA damage. We also wanted to ascertain whether mutations arise cII Big Blue in vivo reporter assay (Extended Data Fig. 5).
in functional stem cells, and therefore avoided whole-genome ampli- A limitation of our approach is that cells with the capacity to engraft
fication or short-term in vitro expansion of cells isolated by flow may represent the least mutated HSCs. Nevertheless, we observed sig-
cytometry. Instead, we decided to define HSCs functionally and nificant increases in the frequency of deletions, which were more preva­
exploit the ability of a single HSC to reconstitute long-term blood lent (Fig. 5d, e) and larger (Fig. 5f) in Aldh2−/−Fancd2−/− genomes.
production following transplantation into a lethally irradiated The mean variant allele frequency (VAF) for all filtered indels was
mouse20. 0.47, establishing that these changes are of clonal origin. By exami­
Our approach combines transplantation of single HSCs with ning the flanking regions, we found that microhomology-­mediated
whole-genome sequencing to obtain the mutational landscape of deletions are the main contributors to the mutations observed in
stem cells, while also allowing us to assess the functional capacity of Aldh2−/−Fancd2−/− HSCs, indicative of end-joining repair of DSBs23
mutant HSCs (Fig. 4a). We carried out transplants with one or five (Fig. 5g, h). Additionally, the increase in the size of the deletions (Fig. 5f)
Aldh2−/−Fancd2−/− HSCs (Fig. 4b). These stem cells rarely engrafted suggests a role for alternative end-joining in the repair of some of these
(with a frequency of 4.8%), contributed less to haematopoiesis and were breaks, as alternative end-joining is characterized by increased resec-
myeloid-biased compared to controls (Fig. 4b–e). These results indicate tion in comparison to classical NHEJ24. Next, we analysed the loca-
that Aldh2−/−Fancd2−/− HSCs are severely functionally compromised tion of indels across the genome, as recent work has suggested a role
and share features with aged HSCs21,22. for the Fanconi anaemia pathway in preventing genomic instability
at ­transcription–replication collisions25,26. However, we found no evi-
Mutational landscape of aldehyde-damaged stem cells dence of microhomology-mediated deletions being enriched at coding
Our ultimate goal was to obtain clonal blood, which provided us with regions or transcribed genes (Fig. 5i, j), suggesting that DSB formation
a physiological method to amplify stem-cell genomes. As outlined in Aldh2−/−Fancd2−/− HSCs is stochastic.
(Fig. 4a), four months after transplantation, we isolated the CD45.2+ The most striking change in Aldh2−/−Fancd2−/− HSCs was the
HSC progeny and performed whole-genome sequencing at 20×​ presence of rearrangements that were not detected in most controls.
­coverage; tail DNA from the donor mouse served as the germline Aldh2−/−Fancd2−/− stem cells contained on average two rearrange-
­reference. This allowed us to detect heterozygous somatic changes, ments per genome; in contrast, we observed only two large deletions
which are absent in the matched germline reference and represent among all ten control HSC genomes (Fig. 5k–l). In summary, these data

1 7 4 | NA T UR E | V O L 5 5 3 | 1 1 j a n u a r y 2 0 1 8
© 2018 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
Article RESEARCH

a Wild-type HSC b c
P = 0.0357 Wild type Aldh2–/– Fancd2–/– Aldh2–/– Fancd2–/–
200 0.5

Substitutions per genome

Relative contribution
P = 0.0159 C>A
Subs 0.4 C>G
Inde titut 150 P = 0.0286
Rearls i C>T
ra 0.3

on
100 C > T at CpG

s
ng
0.2 T>A
ements 50 T>C
0.1
T>G
0 0
n = 161 substitutions, n = 156 substitutions, n = 323 substitutions, n = 664 substitutions,

d2 –

pe

Fa 2 –/–

Al –/–
nc 2 –/
–/
3 genomes 3 genomes 4 genomes 5 genomes

ty

d2
Fa dh
dh
ild

nc
Al
W
Aldh2–/–Fancd2–/– HSCs d NS (P = 0.13) e P = 0.0357 f P = 0.0343
Deletion size
g h P = 0.0357
30 30 1.0 30 30
Insertions per genome

Relative contributution

deletions per genome


Deletions per genome
1 bp

deletions per genome


NS (P = 0.055) P = 0.0159 P = 0.0079

Repeat-mediated
c2 25 25 0.8 2–10 bp 25 25

MH-mediated
11–50 bp NS
20 20 20 (P = 0.054) 20
NS 0.6 > 50 bp
15 NS 15 (P = 0.09) 15 NS 15
c16 0.4
10 (P = 0.99) 10 10 (P = 0.34) 10 NS
(P = 0.054)

n = 35

n = 99
0.2

n=9

n=7
5 5 5 5
0 0 0 0 0
pe

Fa 2 –/–

Al –/–

d2 –

pe

Al –/–

d2 –

pe

Fa 2 –/–

d2 –

pe

d2 –

pe

Al –/–

d2 –

nc 2 –/
–/

–/

nc 2 –/
–/

–/

nc 2 –/
–/

–/

–/

nc 2 –/
–/

–/

nc 2 –/
–/
ty

ty

ty

ty

ty
d2

h2

d2

d2

h2

d2

h2

d2
dh

Fa dh

Fa dh

dh

Fa ldh

Fa ldh

Fa dh
ild

ild

ild

ild

ild
d

d
nc

nc

nc

nc

nc
Al

Al

Al

Al

Al
A

A
W