You are on page 1of 100

FASE CERO 2018-I

BIOLOGÍA

1 – Ciencias de la Salud

Blgo. Mblgo. Jéssica Morales De R.


RRRRocar

1
FASE CERO 2018-I

ÍNDICE
Páginas
1.- INTRODUCCIÓN A LA BIOLOGÍA 3
2.-LA MATERIA VIVA 11
3.-MACROMOLÉCULAS BIOLÓGICAS 25
4.-CLASIFICACIÓN DE LOS SERES VIVOS 39
5.-LA CÉLULA 52
6.-NUTRICIÓN, METABOLISMO, RESPIRACIÓN Y FOTOSÍNTESIS 56
7.- EL GENOMA CELULAR 72
8.- LA VIDA EN LA TIERRA Y EVOLUCIÓN DEL HOMBRE 89

2
FASE CERO 2018-I

TEMA 1: INTRODUCCIÓN A LA BIOLOGÍA

1. CONCEPTO:
La palabra Biología está formado por dos vocablos griegos bios (vida) y logos (estudio o
tratado). Es una ciencia natural que analiza las características y propiedades de los
organismos vivos, centrándose en su origen, propiedades y desarrollo.

El término Biología fue introducido en Alemania en 1800 y popularizado por el naturalista


francés Jean Baptiste de Lamarck.

Esta ciencia busca descubrir, a partir del análisis de estructuras y procesos, aquellas leyes
de carácter general que regulan el funcionamiento orgánico.

Muchos son los biólogos que a lo largo de la historia han dejado su huella imborrable en esta
ciencia a través o gracias al conjunto de investigaciones y descubrimientos realizados que, de
un modo u otro, han conseguido marcar nuestro pasado, nuestro presente o nuestro futuro.

2. PRINCIPIOS DE LA BIOLOGÍA
a-Universalidad
Hay muchas constantes universales y procesos comunes que son fundamentales para conocer
las formas de vida. Por ejemplo, todas las formas de vida están compuestas por células, que están
basadas en una bioquímica común, que es la química de los seres vivos. Todos los organismos

3
FASE CERO 2018-I

perpetúan sus caracteres hereditarios mediante el material genético, que está basado en
el ácido nucleico ADN, que emplea un código genético universal. En la biología del desarrollo la
característica de la universalidad también está presente: por ejemplo, el desarrollo temprano del
embrión sigue unos pasos básicos que son muy similares en muchos organismos metazoo.

b. Continuidad: el antepasado común de la vida


Se dice que un grupo de organismos tiene un antepasado común si tiene un ancestro común.
Todos los organismos existentes en la Tierra descienden de un ancestro común o, en su caso,
de un fondo genético ancestral. Este último ancestro común universal, esto es, el ancestro
común más reciente de todos los organismos que existen ahora, se cree que apareció hace
alrededor de 3.500 millones de años (véase origen de la vida).
La noción de que "toda vida proviene de un huevo" (del latín "Omne vivum ex ovo") es un
concepto fundacional de la biología moderna, y viene a decir que siempre ha existido una
continuidad de la vida desde su origen inicial hasta la actualidad. En el siglo XIX se pensaba
que las formas de vida podían aparecer de forma espontánea bajo ciertas condiciones (véase
abiogénesis). Los biólogos consideran que la universalidad del código genético es una prueba
definitiva a favor de la teoría del descendiente común universal (DCU) de todas las bacterias,
archaea y eucariotas.
Véase también: Sistema de tres dominios

c. La Homeostasis
La homeostasis es la propiedad de un sistema abierto de regular su medio interno para
mantener unas condiciones estables, mediante múltiples ajustes de equilibrio dinámico
controlados por mecanismos de regulación interrelacionados. Todos los organismos vivos,
sean unicelulares o pluricelulares tienen su propia homeostasis. Por poner unos ejemplos, la
homeostasis se manifiesta celularmente cuando se mantiene una acidez interna estable (pH);
a nivel de organismo, cuando los animales de sangre caliente mantienen una temperatura
corporal interna constante; y a nivel de ecosistema, al consumir dióxido de carbono las plantas
regulan la concentración de esta molécula en la atmósfera. Los tejidos y los órganos también
pueden mantener su propia homeostasis.

d. Interacciones: grupos y entornos


Todos los seres vivos interaccionan con otros organismos y con su entorno. Una de las
razones por las que los sistemas biológicos pueden ser difíciles de estudiar es que hay
demasiadas interacciones posibles. La respuesta de una bacteria microscópica a la
concentración de azúcar en su medio (en su entorno) es tan compleja como la de un león
buscando comida en la sabana africana. El comportamiento de una especie en particular

4
FASE CERO 2018-I

puede ser cooperativo o agresivo; parasitario o simbiótico. Los estudios se vuelven


mucho más complejos cuando dos o más especies diferentes interaccionan en un mismo
ecosistema; el estudio de estas interacciones es competencia de la ecología.

3. CAMPOS DE LA BIOLOGÍA
La biología es una disciplina académica que abarca un amplio campo de estudio que, a
menudo, se tratan como disciplinas independientes. Todas ellas juntas estudian la vida en un
amplio rango de escalas.

De acuerdo a las propiedades de la materia estudiada


-Morfología
-Fisiología
-Genética
-Evolución
-Taxonomía
-Ecología

De acuerdo al tipo de organismo estudiado


Microbiología : Virología ,Bacteriología ,Protozoología ,Micología

Botánica
Zoología

De acuerdo al nivel en el que se estudia la materia viva


-Biología Molecular
-Biología celular
-Histología
-Organología
-Biología de los organismos
o individuos (anatomía)

4. RAMAS DE LA BIOLOGÍA:
Astrobiología: (o xenobiología), que estudia la posibilidad de la vida más allá de la Tierra.
Otros campos se detallan a continuación:

Biofísica: Nivel Cuántico. Estudia las posiciones y el flujo de la energía en los organismos; o
sea, cómo fluye, se distribuye y se transforma la energía en los seres vivientes. Por ejemplo,
la trayectoria de la energía durante el ciclo de Krebs, la transformación de la energía química

5
FASE CERO 2018-I

a energía eléctrica para generar un impulso nervioso, la transferencia de energía


durante un proceso metabólico, el flujo de la energía en el movimiento de los cilios en un
protozoario, etc.

Embriología: Estudia el desarrollo de los animales y las plantas, desde las células germinales
hasta su nacimiento como individuos completos. También se llama Biología del Desarrollo.

Inmunología: Estudio de las reacciones defensivas que despliegan los organismos en contra
de cualquier agente agresivo, sea éste del entorno o del mismo interior del organismo. En
Biología, la Inmunología no se concreta solo al sistema inmune de los seres humanos, sino al
de cada especie que habita el globo. Por ejemplo, gracias a la producción de sustancias que
defienden a las plantas de agentes patógenos, los seres humanos contamos con una amplia
variedad de medicamentos contra diversos padecimientos. Un buen ejemplo es el Ácido
Acetilsalicílico, el cual fue descubierto en la corteza del sauce y que en nosotros actúa como
analgésico, anti-inflamatorio y antitrombótico.

Medicina: Estudia los métodos y remedios por medio de los cuales los organismos enfermos
pueden recuperar la salud. Aunque estamos acostumbrados a relacionar Medicina con
enfermedades humanas, en realidad, la Medicina es una rama de la Biología aplicable a todos
los seres vivientes.

Paleobiología: Se conoce también como Paleontología o Biología Paleontológica. Es el


estudio de los seres vivientes que existieron en épocas prehistóricas. Por ejemplo, el
comportamiento del Tyrannosaurus rex, el registro fósil del Homo sapiens neanderthalensis,
etc.

Bioquímica: Es la ciencia que estudia la base química de las moléculas que componen las
células y los tejidos, que catalizan las reacciones químicas del metabolismo celular como la
digestión, la fotosíntesis y la inmunidad, entre otras muchas cosas.

Bionica: es la aplicación de soluciones biológicas a la técnica de los sistemas de arquitectura,


diseño, ingeniería y tecnología moderna.

Bioética: Estudio de los aspectos éticos de las ciencias de la vida (medicina y biología,
principalmente), así como de las relaciones del hombre con los restantes seres vivos.

6
FASE CERO 2018-I

Biogeografía: Parte de la biología que estudia la distribución geográfica de los animales


y las plantas.

Estratigrafía: Parte de la geología que estudia la disposición y las características de las rocas
sedimentarias y los estratos.

Hidrología: Estudio de las propiedades físicas, químicas y mecánicas del agua continental y
marítima, su distribución y circulación en la superficie de la Tierra, en el suelo y en la
atmósfera.

5. CIENCIAS AUXILIARES O AFINES A LA BIOLOGÍA


-Matemáticas, ciencias de la salud, ética, sociología, historia, física, química, geografía,
genética, antropología, astrofísica y etología.

6. ANTECEDENTES HISTÓRICO DE LA BIOLOGÍA


La biología como ciencia es relativamente joven y aun desde la época de las cavernas el
hombre debió tener conocimiento biológicos para su supervivencia, la historia de la biología
se inició entre Griegos y Romanos. Se divide, para su estudio, en tres grandes etapas.

Antigua: Teorías y descubrimientos realizados desde la prehistoria hasta la edad media (la
edad media o medieval comprende desde la caída del imperio romano desde el siglo V al XV)

Chinos: Primeros conocimientos de medicina, describen las plantas y sus propiedades


terapéuticas. Describen la circulación de la sangre. Usan técnicas de acupuntura (hace 5000
años) Vacunación antivariólica

Hindú: Establecen normas de higiene: Leyes de Manú hindúes siglo III antes de cristo) leyes
sociales y de comportamiento. Describen enfermedades de la mujer, tratamiento de lesiones
traumáticas, cura de heridas, funcionamiento del corazón y la importancia del pulso.
Egipcios: Práctica del embalsamiento los acercaba al estudio de la anatomía.

Griegos:
Filósofos materialistas: Analizan el mundo objetivo:
* Tales de Mileto: Concepción materialista de las cosas.
* Heráclito: principio de contradicción rige el mundo natural
Filósofos idealistas: el mundo es guiado por fuerzas espirituales,
* Aristóteles: inicia estudios de morfología, anatomía comparada y embriológía, en zoología
clasifica animales. Se le llama Padre de la Biología.

7
FASE CERO 2018-I

* Teofrasto de Ereso: establece la primera clasificación de plantas. Padre de la


Botánica.
* Hipócrates: Famoso médico fundador de la medicina científica, quien asoció la ética con la
profesión.
* Claudio Galeno: Más importante médico después de Hipócrates. Realizó estudios de
anatomía y fisiología humana realizando disecciones en animales más no en humanos.
Escuela de Alejandría: Gracias a Ptolomeo desarrolló la Anatomía y Fisiología.

EDAD MEDIA
Época de poco aporte al conocimiento. El cristianismo es la religión oficial.(siglo V al XV)

• Desarrollo de la Escolástica: Filosofía en la que domina la enseñanza de las


doctrinas de Aristóteles para la explicación racional de las creencias y dogmas
• Desarrollo de la Herbolaria en los conventos religiosos, botánica relacionada con la
medicina
• Grandes avances en los pueblos árabes en química, medicina y matemática.

Moderna: Teorías y descubrimientos realizados desde la época del renacimiento europeo


(siglo XV y XVI) hasta el siglo XIX.
-Lamarck (1801): postula la Teoría de la herencia de los caracteres adquiridos (primer intento
de explicar el proceso evolutivo)
-Brown (1831): Descubre el núcleo celular
-Schleiden y Schwann (1839) proponen la Teoría Celular: todos los seres vivos están
formados por células
-Ernst Haeckel(1862) Clasificó el reino protista, es partidario de la evolución postula una
correlación entre las fases del desarrollo embrionario y las etapas de la evolución.
-Robert Remak (1839) descubrió las células ganglionares y del corazón humano.
-Louis Pasteur (1864)Terminó con la Hipótesis de la Generación espontánea. Impulsó la
Microbiología como rama de la biología
-Charles Darwin (1859) (Libro: El origen de las especies por el mecanismo de la selección
natural) y Alfred Russel Wallace Establecen la premisas fundamentales del proceso evolutivo
y el origen de las especies por medio de la selección natural.
-Gregorio Mendel (1860): Realizando cultivos de Pisum sativum “arveja” estableció la
existencia de factores que se transmitían de una generación a otra, descubriendo y
planteando las leyes de la herencia biológica.
-Strasburger y Fleming (1873): observan los cromosomas en células en división.

8
FASE CERO 2018-I

Molecular; Teorías y descubrimiento realizado en el siglo XX


-Alexander Oparin (1922) : plantea los postulados del origen de la vida como un proceso
natural en la evolución de la materia y el universo.
-Stanley Miller (1952): reproduce experimentalmente las condiciones de la tierra Primitiva
generando moléculas biológicas y demostrando la hipótesis de Oparin y Haldane, quien
realizó trabajos paralelos a los de Oparín.
-James Watson y Francis Crick (1953): establecen la estructura del ADN, modelo de doble
hélice. Esto desencadena el descubrimiento del código genético, el desarrollo de la
biotecnología moderna y avances en ingeniería genética (la clonación)
-Matías Nieremberg y Severo Ochoa (1965) :descifran el código genético; relación entre el
ADN los ARN y las proteínas
-Whittaker (1969) : divide los organismos en 5 reinos: Monera, Protista,Fungy, Animalia y
Plantae.
-Ian Wilmut y colaboradores(1996) desarrollaron una oveja obtenida por clonación artificial a
partir de células diferenciadas: Dolly

II. LA CIENCIA Y EL MÉTODO CIENTÍFICO

La ciencia constituye un intento lógico, objetivo y repetible de comprender las fuerzas y


principios que operan en el universo.

La ciencia (palabra que deriva del latín scientia, conocer) no es dogmática (o por lo menos no
debería serla...) y debe entenderse como un proceso que avanza probando y evaluando.
Para considerar a un conocimiento como científico es necesario, por así decirlo, conocer las
reglas del juego las cuales están compiladas en el llamado método científico.

1. GENERALIDADES DEL MÉTODO CIENTÍFICO


Desde tiempos inmemorables diversos filósofos cuestionaron los eventos que ocurrían en el
mundo natural, y muchas veces plantearon respuestas con deducciones no siempre
acertadas. Con el pasar de los años y gracias a las aportaciones de una larga trayectoria de
sabios y/o estudiosos de las ciencias entre los que podemos nombrar a Galileo Galilei y
Francis Bacon se planteó un método para excluir todo aquello que tiene naturaleza subjetiva
y, por lo tanto, no es susceptible de formar parte de lo que denomina conocimiento científico.
En última instancia, aquello que es aceptado por el sentido común propiamente dicho y, por
ello, adquiere carácter de generalmente aceptado por la comunidad científica y la sociedad,
el llamado método científico.

9
FASE CERO 2018-I

2. CONCEPTO DE MÉTODO CIENTÍFICO


"Conjunto de pasos fijados de antemano por una disciplina con el fin de alcanzar
conocimientos válidos mediante instrumentos confiables", "secuencia estándar para formular
y responder a una pregunta", "pauta que permite a los investigadores ir desde el punto A hasta
el punto Z con la confianza de obtener un conocimiento válido". Así el método es un conjunto
de pasos que trata de protegernos de la subjetividad en el conocimiento.

3. ETAPAS DEL MÉTODO CIENTÍFICO


1. Observación: durante ella se define el problema que se desea explicar y se recolectan
y clasifican los datos que aportan al hecho.
2. Identificación de una situación problemática o vacío de información.
3. Hipótesis: una o más explicaciones confrontables de lo observado.
4. Experimentación: Intentos controlados de comprobar de una o mas hipótesis.
5. Obtención e interpretación de resultados
6. Conclusión: ¿se avaló o no la hipótesis? Luego de esta etapa la hipótesis es
modificada o rechazada (lo que causa la repetición de las etapas anteriores).
7. Documentación

4. LOS DOS PILARES DEL MÉTODO CIENTÍFICO


El primero de ellos es la reproducibilidad, es decir, la capacidad de repetir un determinado
experimento, cualquier lugar y por cualquier persona. Este pilar se basa, esencialmente, en la
comunicación y publicidad de los resultados obtenidos. El segundo pilar es la falsabilidad. Es
decir, que toda proposición científica tiene que ser susceptible de ser falsada (falsacionismo).
Esto implica que se pueden diseñar experimentos que en el caso de dar resultados distintos
a los predichos negarían la hipótesis puesta a prueba. La falsabilidad no es otra cosa que el
modus tollendo tollens del método hipotético deductivo experimental.

AUTOEVALUACIÓN
1) Explica el principio biológico de la Universalidad
2) Señala quien introdujo por primera vez el término de biología y quien es considerado como
padre de la Biología
3) Indica que se entiende por campos de la biología y señala cuales son.
4) Señala que estudia la etología, biofísica y xenobiología.
5) Señala cuales son las ciencias auxiliares a la biología.
6) Indica que estudia la genética, biogeografía y micología.

10
FASE CERO 2018-I

TEMA 2: LA MATERIA VIVA

La materia viva en la materia que compone a los seres vivos está formada en su concepto mas
elemental por bioelementos , biomoléculas y macromoléculas.

Estas moléculas se repiten constantemente en todos los seres vivos, por lo que el origen de la
vida procede de un antecesor común, pues sería muy improbable que hayan aparecido
independientemente dos seres vivos con las mismas moléculas orgánicas. Se han encontrado
biomarcadores en rocas con una antigüedad de hasta 3500 millones de años, por lo que la vida
podría haber surgido sobre la Tierra hace 3800-4000 millones de años.

Todos los seres vivos están constituidos por células (véase teoría celular). En el interior de éstas
se realizan las secuencias de reacciones químicas, catalizadas por enzimas, necesarias para la
vida.

NIVELES DE ORGANIZACIÓN DE LA MATERIA VIVA


La biología se ocupa de analizar jerarquías o niveles de organización que van desde la célula
a los ecosistemas. Este concepto implica que en el universo existen diversos niveles de
complejidad.

11
FASE CERO 2018-I

Por lo tanto es posible estudiar biología a muchos niveles, desde un conjunto de


organismos (comunidades) hasta la manera en que funciona una célula o la función de las
moléculas de la misma.
En orden decreciente mencionaremos los principales niveles de organización:
Biosfera: La suma de todos los seres vivos tomados en conjunto con su medio ambiente.
En esencia, el lugar donde ocurre la vida, desde las alturas de nuestra atmósfera hasta el
fondo de los océanos o hasta los primeros metros de la superficie del suelo (o digamos
mejor kilómetros sí consideramos a las bacterias que se pueden encontrar hasta una
profundidad de cerca de 4 Km. de la superficie). Dividimos a la Tierra
en atmósfera (aire),litosfera (tierra firme), hidrosfera (agua), y biosfera (vida).
Ecosistema: La relación entre un grupo de organismos entre sí y su medio ambiente. Los
científicos a menudo hablan de la interrelación entre los organismos vivos. Dado, que de
acuerdo a la teoría de Darwin los organismos se adaptan a su medio ambiente, también
deben adaptarse a los otros organismos de ese ambiente.
Comunidad: Es la relación entre grupos de diferentes especies. Por ejemplo, las
comunidades del desierto pueden consistir en conejos, coyotes, víboras, ratones, aves y
plantas como los cactus. La estructura de una comunidad puede ser alterada por cosas tales
como el fuego, la actividad humana y la sobrepoblación.
Especie: Grupo de individuos similares que tienden a aparearse entre sí dando origen a una
cría fértil. Muchas veces encontramos especies descriptas, no por su reproducción
(especies biológicas) sino por su forma (especies anatómicas).
Poblaciones: Grupos de individuos similares que tienden a aparearse entre sí en un área
geográfica limitada. Esto puede ser tan sencillo como un campo con flores separado de otro
campo por una colina sin flores.
Individuo: Una o más células caracterizadas por un único tipo de información codificada en
su ADN. Puede ser unicelular o multicelular. Los individuos multicelulares muestran tipos
celulares especializados y división de funciones en tejidos, órganos y sistemas.
Sistema: (en organismos multicelulares). Grupo de células, tejidos y órganos que están
organizados para realizar una determinada función, p.ej. el sistema circulatorio.
Órganos: (en organismos multicelulares). Grupo de células o tejidos que realizan una
determinada función. Por ejemplo el corazón, es un órgano que bombea la sangre en el
sistema circulatorio.
Tejido: (en organismos multicelulares). Un grupo de células que realizan una determinada
función. Por ejemplo el tejido muscular cardíaco.
Célula: la más pequeña unidad estructural de los seres vivos capaz de funcionar
independientemente. Cada célula tiene un soporte químico para la herencia (ADN), un
sistema químico para adquirir energía etc.

12
FASE CERO 2018-I

Organela: una subunidad de la célula. Una organela se encuentra relacionada con una
determinada función celular p.ej. la mitocondria (el sitio principal de generación de ATP en
eucariotas).
Moléculas, átomos, y partículas subatómicas: los niveles funcionales fundamentales de
la bioquímica.

II. LA MATERIA VIVA

3.1 CONCEPTO
Es un sistema coloidal y es cambiante, puede ser rígido y viscoso. Un coloide es un sistema
físico compuesto por dos fases:una continua, normalmente fluida, y otra dispersa en forma de
iones y moléculas, por lo general sólidas, de tamaño mesoscópico (es decir, a medio camino
entre los mundos macroscópico y microscópico). Así, se trata de partículas que no son
apreciables a simple vista, pero mucho más grandes que cualquier molécula. En particular, la
comunidad científica define la escala mesoscópica como la situada entre unos 10 nanómetros
y 10 micrómetros.

3.1 CARACTERISTICAS FISICAS DEL PROTOPLASMA

Se conoce como protoplasma al contenido vivo de una célula, es decir, todas las sustancias
de la célula a excepción de las grandes vacuolas y el material que ha sido recientemente
ingerido o que va a ser excretado; consiste en el núcleo embebido en un gel de citoplasma, e
incluye la membrana plasmática.

El protoplasma es una de las sustancias fisicoquímicas más complejas que se conocen, es


una acumulación regulada, integrada, dinámica, balanceada y conservada de sales y agua.
El agua constituye aproximadamente el 75% de la masa del protoplasma y se encuentra en
dos formas de solvatación 10% integrada a los componentes químicos y sales (Na+, Ca++ Cl-
, K +, Mg ++). Y libre (comprometida en forma activa en los procesos protoplasmáticos).

La suspensión de partículas confiere la propiedad coloide al protoplasma. El agua es


indispensable, dado que casi todas las reacciones químicas y en consecuencia, las
actividades celulares se producen en medio acuoso.
Las moléculas y macromoléculas, forman en la materia viva juntamente con el agua un
sistema organizado que permiten todas sus actividades: el sistema coloidal o estado
intermedio de la materia viva.

13
FASE CERO 2018-I

El término coloide designa un estado intermedio entre las soluciones verdaderas y las
suspensiones. Veremos estas diferencias. En las soluciones verdaderas las partículas de la
sustancia disuelta son extraordinariamente pequeñas y pueden ser iones, átomos o moléculas
muy simples. Las SUSPENSIONES, en cambio, contienen comparativamente partículas
grandes, constituidas por el agregado de numerosas moléculas, que tienden a depositarse
por la gravedad si se les deja en reposo.
Cuando las partículas son de tamaño intermedio (entre 0,1 a 0,0001 micrón), no pueden
sedimentar ni formal solución verdadera; en tal caso, se dice que la materia está en ESTADO
COLOIDAL.
Las partículas coloidales están constituidas por grupos moleculares (micelas) o por
macromoléculas individuales como son las que forman a las proteínas y ácidos nucleicos.
Las partículas coloidales pueden pasar a través de los filtros de papel pero no atraviesan una
membrana vegetal o animal como lo hacen las sustancias que Forman soluciones verdaderas.
Todo sistema coloidal supone la existencia de dos fases: una formada por las partículas,
recibe el nombre de FASE DISPERSA; la otra, constituida por un medio que separa las
partículas, es la FASE DISPERSANTE. En la sustancia viva, la fase dispersa consiste en
grandes moléculas proteicas acompañadas de algunas partículas complejas de lípidos y
glúcidos. La fase dispersante está formada de agua que contiene iones y moléculas pequeñas
disueltas.
Como ya se ha expresado, la fase dispersante del sistema coloidal contiene múltiples IONES
Y MOLECULAS. Pues bien, entre las partículas de la fase dispersa y los iones de la rase
dispersante ocurre un sin número de reacciones que son determinantes de los procesos bio-
químicos y físico-químicos de la materia viviente.
Los coloides experimentan cambios reversibles que reciben el nombre de GEL y SOL
respectivamente.
Si a un sistema coloidal se le extrae el agua gradualmente, las partículas dispersas se juntan
hasta formar una especie de red que tiene el agua en su malla. A este estado coloidal se llama
gel.
• El aspecto casi sólido flexible de la materia viva, es debido a su condición de gel. La
gelatina nos da una idea de esta condición.
Las medusas pueden mantener una forma definida porque su materia viva mantiene, sobre
todo, una fase de gel que le da mucha flexibilidad.
• Cuando se incorpora agua a un sistema coloidal, sucede lo contrario. Se produce una
mayor fluidez y se dice que el coloide está en estado de sol.

14
FASE CERO 2018-I

En la materia viva los estados de gel y de sol se alternan normalmente y de manera


repetida. Un aumento de la temperatura puede convertir a un gel en sol; o las condiciones de
acidez o alcalinidad del medio.
Otra característica de los coloides es el hecho de que sus partículas poseen cargas eléctricas
del mismo signo, y puesto que las cargas eléctricas del mismo signo se repelen, las partículas
permanecen separadas y en constante movimiento.
Si la carga de las partículas es neutralizada por una corriente eléctrica de signo contrario cesa
la repulsión de las partículas y éstas se precipitan, desorganizándose el sistema y, por
consiguiente toda la vida.

3.2 ESTADOS DE LA MATERIA VIVA

A. Estado de sol: líquido y fluido


• Efecto tyndal: Es el fenómeno que ayuda por medio de la dispersión de la luz a
determinar si una mezcla homogénea es realmente una solución o un sistema coloidal, como
suspensiones o emulsiones.
• Movimiento browniano: Es el movimiento aparentemente caótico que cualquier
partícula de tamaño pequeño experimenta en el agua o en un gas.
• Electroforesis: Es un método de en el que se utiliza una corriente eléctrica controlada
con la finalidad de separar biomoléculas según su tamaño y carga eléctrica a través de una
matriz gelatinosa.
• Diálisis: Es la semipermeabilidad para que sustancias puedan entrar y salir (soluto y
solvente). Sale de una parte de mayor concentración a una de menor concentración a través
de una membrana semipermeable. Cumple un papel importante en el equilibrio dinámico de
los seres vivos.

B. Estado de gel: Denso, viscoso


• Tixotropía: Es el paso del estado de sol a gel por diversos factores
• Inhibición: Capacidad de captar agua
• Contracción: Capacidad de eliminar agua, es un proceso lento por envejecimiento.
• Sinéresis: Contracción brusca saliendo un líquido fluido.

3.3 FENOMENOS BIOFÍSICOS ELEMENTALES:

Entre la materia viva y el medio acuoso que la rodea se producen intercambios de naturaleza
física. Aunque estos fenómenos no están del todo aclarados, se sabe, sin embargo, que en
ellos intervienen fenómenos físicos de DIFUSION Y OSMOSIS.

15
FASE CERO 2018-I

a) LA DIFUSION:
Se entiende por difusión la tendencia que poseen las partículas de una sustancia en disolución
a emigrar, desde la zona de mayor concentración, hasta repartirse uniformemente en todas
direcciones.
La difusión puede realizarse entre gases o entre líquidos y también entre un cuerpo sólido y
uno liquido (muchas sales se disuelven en el agua). Existen disoluciones de gas en gas (aire
y todas las mezclas gaseosas), de líquido en gas (aire húmedo), de sólido en gas (partículas
de polvo en el ai¬re), de gas en liquido (anhidrido carbónico en agua), de líquido en liquido
(gasolina, mezclas de alcohol y agua), de sólido en liquido (azúcar o sal en agua).

b) LA OSMOSIS:
La ósmosis puede ser considerada como un tipo especial de difusión caracterizado por el
movimiento de agua a través de una membrana semipermeable desde un área en la cual la
concentración es mas baja. Aunque este fenómeno puede tener como disolventes otros que
el agua, dentro de este fenómeno nos interesa que es en un medio acuático que se da en
plantas y animales. Cabe destacar que el flujo del agua a través de una membrana
semipermeable al final alcanza un equilibrio.

c) TENSION SUPERFICIAL:

Una molécula situada en el interior de un líquido está rodeada totalmente de otras moléculas
y sometida, por lo tanto, a la fuerza de atracción de éstas; pero una molécula de la superficie
es atraída únicamente por las moléculas situadas dentro de la semiesfera normal de atracción;
de todo ello se origina una fuerza dirigida hacia abajo que tiende a llevar las moléculas de la
superficie hacia el interior del líquido; esta fuerza, que origina una especie de membrana
elástica, es la TENSION SUPERFICIAL.

d) TURGENCIA Y PLASMOLISIS

Cuando las células de los tejidos tienen una cierta presión de agua interna, se dice que están
turgentes. Si el agua sale del interior y las células se hacen flácidas, se dice que ha producido
una plasmólisis.
En las células vegetales ocurre el fenómeno de presión de turgencia: cuando entra agua, la
célula se hincha pero no se destruye debido a la gran resistencia de la pared celular.

16
FASE CERO 2018-I

e) PRESION OSMÓTICA:

Es la presión ejercida por una solución sobre una membrana semipermeable para impedir el
paso del disolvente.
Es la presión negativa para contrarrestar el paso de agua pura al interior de una solución
acuosa a través de una membrana semipermeable, evitando asi un incremento e el volumen
de a solución.

III. LOS SERES VIVOS

Un ser vivo u organismo es un conjunto material de organización compleja, en la que


intervienen sistemas de comunicación molecular que lo relacionan internamente y con el
medio ambiente en un intercambio de materia y energía de una forma ordenada, teniendo la
capacidad de desempeñar las funciones básicas de la vida que son la nutrición, la relación y
la reproducción, de tal manera que los seres vivos actúan y funcionan por sí mismos sin perder
su nivel estructural hasta su muerte.
La materia está formada por átomos. Los seres vivos, como materia que somos, estamos
también formados por átomos, llamados Bioelementos, que se combinan formando moléculas,
llamadas Biomoléculas y estas son la base de sus estructuras mas complejas.

17
FASE CERO 2018-I

2. COMPOSICIÓN DE LOS SERES VIVOS

Los seres vivos están compuestos por una serie de sustancias conocidas como biomoléculas
que resultan de la asociación de los bioelementos.
Bioelementos primarios: son los más abundantes, representan alrededor del 96% del total de
los átomos del cuerpo humano, dentro de estos están los elementos: C,H,O,N
Bioelementos secundarios representan el 4% del total, dentro de estos están los elementos:
P,S, Ca, Mg,Cl, Na, K, Fe.
Oligoelementos: aparecen en trazas alrededor de 0,1% pero aun así su presencia es esencial
para el óptimo funcionamiento del organismo. Su ausencia determina la presencia de
enfermedades carenciales, dentro de estos están los elementos: cobre, cobalto, selenio, zinc
, fluor, boro, silicio, vanadio, manganeso, molibdeno, estaño.
Como mencionamos los bioelementos se pueden asociar para formar biomóleculas, pero
también tenemos bioelementos libres necesarios como cofactores etc.
Con un criterio químico podemos clasificarlas en dos grupos: en simples y compuestas según
estén constituidas por un mismo elemento químico como 02 o por elementos diferentes como
CO2. Otro criterio de clasificación es en órganicas e inorgánicas.
B. inorgánicas: aquellas que en su estructura no presentan enlaces covalentes C-C. Se
distribuyen ampliamente en nuestro planeta y son imprescindibles para la subsistencia de
todo organismo del planeta ejm H2O, CO2, O2, N2 sales minerales, ácidos y bases
inorgánicas.
B. orgánicas: aquellas que si poseen en su estructura esqueletos de átomos de C-C a los
cuales se unen otros elementos ejm monosacáridos, aminoácidos, ácidos grasos,
nucleótidos, algunos ácido y bases orgánicas y vitaminas.(dar algunos ejm de cada clase),
además de moléculas que no entran precisamente en alguna de estas clasificaciones como
son algunas moléculas nitrogenadas como la urea , las bases nitrogenadas. Muchas
biomoléculas orgánicas forman asociaciones mayores que son las macromoléculas.
Mientras las b. orgánicas cumplen funciones variadas como energéticas, estructurales,
hereditarias, reguladoras, catalíticas, las inorgánicas básicamente proporcionan el ambiente
necesarios para que se realicen las reacciones bioquímicas.

3. CARACTERÍSTICAS BÁSICAS DE LOS SERES VIVOS:


3.1) Compleja organización: organización celular :
Los organismos se encuentran conformados por células, ya que estás son la unidad
fundamental de los mismos. La célula es la mínima parte de los seres vivos que es capaz de
desempeñar por si mismas las funciones que el organismo en sí ejecuta para mantenerse con
vida. Según el organismo este puede ser unicelular o multicelular. Las células se organizan

18
FASE CERO 2018-I

en tejidos, los tejidos en órganos y los órganos en sistemas. La célula posee una
organización que le permite mantener una propiedad vital que es la homeostasis que se
entiende como el mantenimiento y regulación de las condiciones internas. Algunos de los
factores regulados son: termorregulación, osmorregulación: regulación del agua e iones y la
regulación de los gases respiratorios.

3.2)Metabolismo:
El fenómeno del metabolismo permite a los seres vivos procesar sus alimentos para obtener
nutrientes, utilizando una cantidad de estos nutrientes y almacenando el resto para usarlo
cuando efectúan sus funciones. En el metabolismo se efectúan dos procesos fundamentales:
anabolismo (síntesis) y catabolismo (degradación).

3.3)Reproducción
Los seres vivos son capaces de multiplicarse (reproducirse). Mediante la reproducción se
producen nuevos individuos semejantes a sus progenitores y se perpetúa la especie.
En los seres vivos se observan dos tipos de reproducción:
• Asexual (sin sexo): En este tipo de reproducción un solo individuo se divide o se
fragmenta en dos células iguales que poseen características hereditarias similares a la de su
progenitor y recibe el nombre de célula hija. Sus tipos son:
Fisión binaria
Gemación
Endodiogenia
Fisión Múltiple (Esquizogonia)
Plasmotomía
• Sexual (con sexo): En esta forma de reproducción se necesita la participación de dos
progenitores; cada uno aporta una célula especializada llamada gameto (óvulo o
espermatozoide), que se fusionan para formar un huevo o cigoto. Esta forma de reproducción
permite la combinación de diversas características hereditarias.

4. CARACTERÍSTICAS FUNCIONALES DE LOS SERES VIVOS

• Nutrición: es el proceso biológico en el que los organismos asimilan los alimentos y los
líquidos necesarios para el funcionamiento, el crecimiento y el mantenimiento de sus
funciones vitales. La nutrición también es la ciencia que estudia la relación que existe entre
los alimentos y la salud, especialmente en la determinación de una dieta.

19
FASE CERO 2018-I

• Respiración: es una de las funciones principales de los organismos vivos, por medio
de la cual se producen reacciones de oxidación que liberan energía que utilizan los seres
vivos para poder realizar su metabolismo
• Crecimiento o desarrollo y reproducción.
El desarrollo es la adquisición de nuevas características.
El crecimiento se manifiesta como un aumento de la masa celular o como un aumento en el
número de células.
• Irritabilidad: es la capacidad que poseen todos los organismos vivos desde los
unicelulares simples hasta los multicelulares complejos de reaccionar o responder no-
linealmente frente a un estímulo.
Los seres vivos son capaces de detectar y responder a los estímulos que son los cambios
físicos y químicos del medio ambiente, ya sea interno como externo.
• Adaptación y evolución: la adaptación es la característica que ha desarrollado un
organismo mediante selección natural a lo largo de muchas generaciones, para solventar los
problemas de supervivencia y reproducción a los que se enfrentaron sus antecesores.
• La evolución: es un cambio en el perfil genético de una población de individuos, que
puede llevar a la aparición de nuevas especies, a la adaptación a distintos ambientes o a la
aparición de novedades evolutivas.
• Movimiento
Todos los animales se mueven por LOCOMOCIÓN aunque unos con mayor proporción que
otros y las plantas se mueven por CICLOSIS que es el movimiento interno en la célula vegetal.

5. ORGANISMOS AL MARGEN DE LA VIDA


5.1 LOS VIRUS

En biología, un virus (del latín virus, «toxina» o «veneno») es un agente infeccioso


microscópico acelular que solo puede multiplicarse dentro de las células de otros organismos.
Los virus infectan todos los tipos de organismos, desde animales y plantas, hasta bacterias y
arqueas. Los virus son demasiado pequeños para poder ser observados con la ayuda de un
microscopio óptico, por lo que se dice que son submicroscópicos; aunque existen excepciones
entre los Virus núcleo citoplasmáticos de ADN de gran tamaño, tales como el Megavirus
chilensis, el cual se logra ver a través de microscopía óptica

El primer virus conocido, el virus del mosaico del tabaco, fue descubierto por Martinus
Beijerinck en 1899, y actualmente se han descrito más de 5.000, si bien algunos autores
opinan que podrían existir millones de tipos diferentes. Los virus se hallan en casi todos los

20
FASE CERO 2018-I

ecosistemas de la Tierra y son el tipo de entidad biológica más abundante. El estudio


de los virus recibe el nombre de virología, una rama de la microbiología.

A diferencia de los priones y viroides, los virus se componen de dos o tres partes: su material
genético, que porta la información hereditaria, que puede ser ADN o de ARN; una cubierta
proteica que protege a estos genes —llamada cápside— y en algunos también se puede
encontrar una bicapa lipídica que los rodea cuando se encuentran fuera de la célula —
denominada envoltura vírica—. Los virus varían en su forma, desde simples helicoides o
icosaedros hasta estructuras más complejas. El origen evolutivo de los virus aún es incierto,
algunos podrían haber evolucionado a partir de plásmidos (fragmentos de ADN que se
mueven entre las células), mientras que otros podrían haberse originado desde bacterias.
Además, desde el punto de vista de la evolución de otras especies, los virus son un medio
importante de transferencia horizontal de genes, la cual incrementa la diversidad genética.

Los virus a pesar de contar con una materia organizada y compleja, capacidad de
reproducción y evolución, no cuenta con una organización material autopoiética por lo que
son considerados entidades biológicas mas no seres vivos. (Un sistema se define como
autopoiético cuando las moléculas producidas generan la misma red que las produjo y
especifican su extensión)

CICLO REPRODUCTIVO DE UN VIRUS


El ciclo de replicación de los virus es el término utilizado para describir el ciclo de
reproducción de los virus. Este consta generalmente de las siguientes fases: fijación y entrada
en la célula, eclipse, multiplicación y liberación del virus.

Eclipse
Según la duración de la fase de eclipse, se suelen distinguir dos modalidades de ciclo
infeccioso de un virus:
 Ciclo ordinario: el ácido nucleico vírico procede inmediatamente a la transcripción de
su mensaje genético en los ARN necesarios para su multiplicación, y prosigue
rápidamente el ciclo vital. Este tipo de ciclo es el más extendido en la naturaleza.
 Ciclo lisogénico: fue descubierto por André Lwoff en bacteriófagos. El ADN vírico se
cierra por sus extremos generando un ADN circular. Este ADN se inserta en el ADN
bacteriano en un lugar específico en el que la secuencia de nucleótidos bacterianos
es semejante alguna región del ADN vírico.}

21
FASE CERO 2018-I

La bacteria prosigue sus funciones vitales sin que el virus realice ninguna acción, y
cuando el ADN bacteriano se duplica también lo hace el ADN vírico, de manera que el genoma
del virus pasa a las dos bacterias hijas. La multiplicación bacteriana puede seguir durante
generaciones sin que el virus se manifieste. Pero ante una alteración de las condiciones
ambientales, el ADN vírico se separa del bacteriano y prosigue entonces las restantes fases
de ciclo infeccioso, produciendo la muerte de la bacteria y nuevos ejemplares del virus.
Algunos virus que infectan células animales siguen también el ciclo lisogénico, como los
papilomavirus de las verrugas y algunos retrovirus que producen algunos tipos de cáncer.
En el caso de los retrovirus, conviene recordar que el ácido nucleico es ARN monocatenario,
por lo que la transcriptasa inversa ha de copiar el genoma vírico en forma de ADN antes de
que pueda insertarse en el ADN celular.

El ciclo lisogénico, se caracteriza por presentar dos fases iguales al del ciclo lítico, la fase
de anclaje y la fase de penetración (el virus se pega a la pared de la bacteria o célula a partir
de una serie de mecanismos de anclaje y penetra o introduce su ácido nucleico en el interior
de dicha bacteria o célula). En la fase de eclipse, el ácido nucleico viral (ADN bicatenario), se
recombina con el ADN bacteriano y permanece inactivo. Esta forma viral se denomina prófago
y la célula infectada se denomina célula lisogénica. Esta célula se puede mantener así
indefinidamente e incluso puede llegar a reproducirse. Un cambio en el medio celular, va a
llevar consigo un cambio celular y con él, la liberación del prófago, convirtiéndose en un virus
activo que continuará con el ciclo infeccioso o ciclo lítico (La fase de ensamblaje, en la que el
virus se forma en su interior uniéndose la cápsula y el ácido nucleico, y la fase de liberación
o lisis, en la que se libera el virus llevando consigo la destrucción celular). Este ciclo fue
descubierto por Lwoff en bacteriófagos.

El ciclo lítico se denomina así porque la célula infectada por un virus muere por rotura (lisis
en griego), al liberarse las nuevas copias virales. El ciclo lítico es el método de reproducción
viral, este es usualmente el principal método de replicación viral e involucra la destrucción de
células infectadas El ciclo consta de las siguientes fases:
 1. Fase de adsorción o fijación: El virus se une a la célula hospedadora de forma
estable. La unión es específica, ya que el virus reconoce complejos moleculares de
tipo proteico, lipoproteico o glucoproteico, presentes en las membranas celulares.
 2. Fase de penetración o inyección: el ácido nucleico viral entra en la célula mediante
una perforación que el virus realiza en la pared bacteriana.
 3. Fase de eclipse: en esta fase no se observan copias del virus en la célula, pero se
está produciendo la síntesis de ARN,es decir la duplicacion y transcripción de ARN,
necesario para generar las copias de proteínas de la cápsida. También se produce la

22
FASE CERO 2018-I

continua formación de ácidos nucleicos virales y enzimas destructoras del ADN


bacteriano.
 4. Fase de ensamblaje: en esta fase se produce la unión de los capsómeros para
formar la cápsida y el empaquetamiento del ácido nucleico viral dentro de ella.
 5. Fase de lisis o ruptura: conlleva la muerte celular. Los viriones salen de la célula,
mediante la rotura enzimática de la pared bacteriana. Estos nuevos virus se
encuentran en situación de infectar una nueva célula.

5.2 LOS VIROIDES


Los viroides son agentes infecciosos que, al igual que los virus, tienen un ciclo
extracelular que se caracteriza por la inactividad metabólica y un ciclo intracelular en el que
causan infección al huésped susceptible, pero que a diferencia de los virus, los viroides no
poseen proteínas ni lípidos y están constituidos por una cadena cíclica corta de ARN, circular
o con forma de varilla, (que no codifica proteínas). Es importante decir que tanto su forma
intracelular como extracelular son las mismas (ARN desnudo), los mecanismos por los cuales
éstos logran causar infección están relacionados con la autocatálisis de su material genético.
En sí constituyen una etapa primitiva de los virus. Carecen de actividad de ARN mensajero y
se replican de forma autónoma, utilizando el sistema de transcripción de la célula susceptible. Los
viroides se encuentran, casi exclusivamente, en el núcleo de las células infectadas; se desconoce
el modo en que se replican pero se sabe que el ARN que los constituyen no funciona como ARN
mensajero y tampoco se traduce a enzimas que participen en su propia replicación. Los viroides
no codifican para ninguna proteína y llevan a cabo su replicación en la célula hospedadora a través
de la RNA polimerasa II codificada por la célula hospedadora aunque también se ha propuesto la
posibilidad de que lo haga gracias a una RNA polimerasa dependiente de RNA presente en
algunas células eucariotas. Dada su localización, se presume que causan la enfermedad
interfiriendo con la regulación génica de la célula hospedadora en la etapa de corrección del ARN
mensajero celular: particularmente en la eliminación de intrones y de empalmes de exones,
presentando secuencias muy similares a los intrones que normalmente son cortados. Sus ARN se
replican varias veces.

5.3 LOS PRIONES


Un prion es un agente infeccioso formado por una proteína denominada prionica capaz de
formar agregados moleculares aberrantes. Su forma intracelular puede no contener ácido
nucleico. Produce las encefalopatías espongiformes transmisibles, que son un grupo de
enfermedades neurológicas degenerativas tales como la tembladera, la enfermedad de
Creutzfeldt-Jakob y la encefalopatía espongiforme bovina.

23
FASE CERO 2018-I

La proteína del prion es una sialoproteína patógena, la cual tiene alterada su estructura
secundaria, teniendo un incorrecto plegamiento de su estructura terciaria. A diferencia del
resto de los agentes infecciosos (virus, bacterias, hongos etc.), que contienen ácidos
nucleicos (ya sea ADN, el ARN, o ambos), un prion solamente está compuesto por
aminoácidos y no presenta material genético.

Los priones son los responsables de las encefalopatías espongiformes transmisibles en una
variedad de mamíferos, incluida la encefalopatía espongiforme bovina (EEB, también
conocida como "enfermedad de las vacas locas") en el ganado y la enfermedad de Creutzfeldt-
Jakob (ECJ) en humanos. Dichas proteínas mutadas forman agregados supramoleculares y
son patógenas con plegamientos anómalos ricos en láminas beta, y autorreproducibles.

Los priones se propagan mediante la transmisión de proteínas anómalas con mal


plegamiento. Cuando un prion entra en un organismo sano, actúa sobre la forma normal del
mismo tipo de proteína existente en el organismo, modificándola y convirtiéndola en prion.
Estos priones recién formados pueden pasar a convertir más proteínas, provocando una
reacción en cadena que produce grandes cantidades de la proteína prion. Todos los priones
conocidos inducen la formación de amiloides plegado, en los que actúan polimerasas
formando un agregado que consiste en apretadas hojas ß. El período de incubación de las
enfermedades prionicas se determina por la tasa de crecimiento exponencial asociados con
la replicación de priones, que es un equilibrio entre el crecimiento lineal y la rotura de los
agregados (hay que tener en cuenta que la propagación del prion depende de la presencia de
la proteína normalmente plegada en la que los priones pueden inducir plegamiento. Los
organismos que no expresan la forma normal de la proteína prionica no pueden desarrollar o
transmitir la enfermedad)

AUTOEVALUACIÓN
1) De el concepto de bioesfera y ecosistema .
2 )Cuales son las características funcionales de los seres vivos?
3) Que se entiende por homeostasis?
4)Señale y explique los subtipos de reproducción asexual.
5)Indique que son los virus y grafique las etapas del ciclo de vida lítico de un virus
6)Cuales son los fenómenos derivados del estado de gel del protoplasma?

24
FASE CERO 2018-I

TEMA 3: MACROMOLÉCULAS BIOLÓGICAS

Las macromoléculas son moléculas constituidas por varias moléculas que pueden ser
similares entre sí o no. Las macromoléculas cumplen funciones esenciales en la célula,
algunas son componentes estructurales, otras con funciones reguladoras y otras actúan
dirigiendo el metabolismo celular.

Las macromoléculas son moléculas que tienen una masa molecular elevada, formadas por
un gran número de átomos. Generalmente se pueden describir como la repetición de una o
unas pocas unidades mínimas o monómeros, formando los polímeros.
A menudo el término macromolécula se refiere a las moléculas que contienen más de 100
átomos. Pueden ser tanto orgánicas como inorgánicas, y algunas de gran relevancia se
encuentran en el campo de la bioquímica, al estudiar las biomoléculas.

I .LÍPIDOS
Llamados grasas. Son compuestos ternarios (C,H,O), ocasionalmente con P y N. Se
encuentran en los tejidos vegetales y animales. Son de consistencia sólida o aceitosa, poco
soluble en agua pero solubles en solventes no polares como el cloroformo, el eter y el
benceno. Los lípidos tienen poco oxígeno en relación con el carbono e hidrógeno. Su baja
solubilidad en agua se debe a la escasez de oxígeno.

25
FASE CERO 2018-I

Importancia Biológica de los Lípidos:

a. Estructural: Constituyen el 40% de las membranas celulares.


b. Energética: Participan como fuente de energía. 1gramo de lípido otorga 9,3
kilocalorías aprox. En los animales de almacena en el tejido adiposo. En las plantas
se almacena en las semillas bajo la forma de aceite y son utilizados durante la
germinación. Los triglicéridos son los principales lípidos de reserva animal y vegetal.
c. Termoaislante: Al almacenarse en el tejido celular subcutáneo, forma una barrera que
impide la pérdida de calor producida en el tejido muscular.
d. Electroaislante: Los lípidos que existen alrededor de los axones de las neuronas
favorecen la transmisión rápida de los impulsos nerviosos, forman la vaina de mielina.
e. Reguladora: Algunos lípidos actúan como hormonas: testosterona y estrógenos. Las
vitaminas A,D,E y K son de estructura lipídica

Clasificación de los Lípidos:


Los lípidos se clasifican en base a la presencia o ausencia de ácidos grasos en su constitución
en saponificables e insaponificables.

Los ácidos grasos son moléculas formadas por una larga cadena hidrocarbonada de tipo
lineal, y con un número par de átomos de carbono. Tienen en un extremo de la cadena un
grupo carboxilo (-COOH).Los hay insaturados con presencia de dobles enlaces en su cadena
hidrocarbonada y saturados esos dobles enlaces.

A. Lípidos Saponificables: Presentan ácidos grasos. Al descomponerse, liberan ácidos


grasos y alcoholes. Tienen constitución química similar. Susceptibles de ser
saponificables.

1. Lípidos Simples: Constituidos por 1 alcohol y ác. grasos unidos por enlaces
éster.
 Glicéridos: 1 alcohol glicerol + 1 a 3 ác. grasos, unidos por enlace éster.
Son moléculas no polares, no se disuelven en agua. Pueden ser: grasas sólidas (sebo), grasas
semisólidas (margarina), grasas líquidas (aceites).Ejm los triglicéridos.

26
FASE CERO 2018-I

 Céridos: Formado por un alcohol de elevado peso molecular más 1 ác. Graso
saturado. Comúnmente son llamados ceras, insolubles en agua, moldeables
al calor y duras en frío. Ejms,: cera de abeja, cerumen humano, lanolina de
lana y cutina que recubre hojas, flores y frutos; suberina de la pared celular
de células vegetales (corcho).

2. Lípidos Complejos: Son moléculas antipáticas que presentan 2 regiones


definidas: una hidrofóbica y otra hidrofílica. Se clasifican en:

 Fosfolípidos: Importante como componentes de la membrana celular.


 Glicerofosfolípidos: Presentan como alcohol al Glicerol.

 Esfingofosfolípidos: Presenta como alcohol la esfingosina.

 Glucolípidos: Lípidos que presentan en su constitución carbohidratos, que


pueden ser un monosacárido, disacárido o monosacárido derivado. Abunda
en las membranas celulares de animales y protozoos donde forma glucocalix.
Abundan en el tejido nervioso.

27
FASE CERO 2018-I

B. Lípidos No saponificables:Al descomponerse no liberan ni ácidos grasos ni alcohol.


Llamados lípidos Derivados. No son saponificables, no dan jabones.
Esteroides: El principal es el Colesterol: Participa como precursor de los demás esteroides:
hormonas sexuales, otras hormonas como cortisona, aldosterona, corticosterona, cortisol, ác.
Biliares y vitamina D. Es componente de la membrana celular de animales.

Isoprenoides: Molécula hidrocarbonada formadas por la polimerización del isopreno: una


molécula de 5 carbonos. Dentro de estos están el mentilo de menta, alcanfor, limoneno del
limón, las vitaminas A, E y K , los precursores del colesterol, carotenos y xantofilas, etc

28
FASE CERO 2018-I

Prostaglandinas: Derivado del ácido prostanoico y araquidónico. Descubiertas por primera


vez en glándulas de la próstata.
En mamíferos se encuentra en pulmón, mucosa gastrointestinal, bazo, tiroides, riñón, líquido
amniótico, secreciones del endometrio.

I. GLÚCIDOS O CARBOHIDRATOS

Se les llama también Hidratos de carbono, glúcidos o azúcares. Son sustancias cuya
composición es de C, H, O, es decir son compuestos ternarios, aunque algunos glúcidos
complejos pueden presentar N y/o S. Químicamente se presentan como aldehidos o cetonas
de alcoholes polivalentes o aldehidos o cetonas polihidroxilicos y sus derivados.

Función de los Glúcidos:


 Energética: Aportan energía a los seres vivos, son combustible celular y reserva
energética mediante la forma de glucógeno en animales y almidón en las plantas.

29
FASE CERO 2018-I

Estructural: Existen muchas estructura en las cuales los glúcidos forman parte: Ácidos
nucléicos, pared celular en bacterias y plantas, membrana celular en animales,
exoesqueletos de insecto etc.
 Farmacológica: Algunas sustancias como la estreptomicina son glúcidos.
 Destoxificante
 Inmunológica

Clasificación de los Glúcidos:


Se les clasifica en tres grupos según el tamaño y estructura molecular:
1. Monosacáridos
2. Oligosacáridos
3. Polisacáridos

Monosacáridos: o azúcares Simples, son dulces, hidrosolubles, cristalizables. Formadas por


cadenas carbonadas de 3 a 7 carbonos con grupos hidroxilo y presentan grupo funcional
aldehído o cetona tomando el nombre de aldosas (A) o cetosas (C), por lo que pueden ser
clasificados siguiendo estos dos criterios.

Oligosacáridos: Se forman por polimerización de 2 a 9 monosacáridos los que se unen por


enlace “O” glucosídico. Dentro de los oligosacáridos tenemos a:

30
FASE CERO 2018-I

a. Disacáridos: Formados por 2 monosacáridos mediante un enlace glucosídico.


A continuación se señalan algunos de ellos , su nombre común y los monosacáridos
que los constituyen.
DISACÁRIDO NOMBRE COMÚN MONOSACÁRIDOS
CONSTITUYENTES
MALTOSA Azucar de malta GLUCOSA + GLUCOSA
LACTOSA Azucar de leche GLUCOSA + GALACTOSA
CELOBIOSA Azucar de leche GLUCOSA + GLUCOSA
SACAROSA Azucar de caña GLUCOSA + FRUCTOSA
TREHALOSA GLUCOSA + GLUCOSA

b. Trisacáridos:
 Melicitosa: constituida por fructosa, glucosa , glucosa. Presente en la miel.
 Rafinosa: constituida por galactosa , glucosa , fructuosa. Presente en la remolacha
azucarera.

31
FASE CERO 2018-I

Panosa: constituida por glucosa , glucosa , glucosa. Presente en la hidrólisis parcial


de la almilopectina
 Maltotriosa: constituida por glucosa , glucosa, glucosa. Se encuentra en la hidrólisis
parcial de la amilosa.
c. Tetrasacáridos: dentro de estos la estaquiosa constituida por galactosa , galactosa ,
glucosa , fructosa. Presente en legumbres y soya.
d. Pentasacáridos: dentro de estos encontramos a la verbascosa constituida por galactosa
, galactosa , galactosa , glucosa , fructosa. Presente en legumbres, soya y otros
vegetales.
e. Ciclodextrina: corresponden a oligosacáridos cíclicos que se obtienen por hidrólisis del
almidón.

Polisacáridos: Formados por más de 10 residuos de monosacáridosa mas, unidos por enlaces
glucosídicos. No tiene sabor dulce, son insolubles en agua y no cristalizan. Forman soluciones
coloidales al igual que las proteínas. Ejemplos:
 Almidón: Reserva de vegetales (tallos, raices, frutos verdes) y algas. Formados por
glucosas unidas formando cadenas lineales (amilosa) y ramificadas (amilopectina) .

 Glucógeno: Polisacárido de reserva de bacterias, hongos y animales (en hígado y


músculos). Forma cadenas más ramificadas que la amilopectina. Es soluble en agua

32
FASE CERO 2018-I

 Celulosa: Polisacárido estructural constituido por cadenas de glucosas. Forma parte


de pared celular de vegetales y algas. Componente principal de la madera y de la fibra
de algodón. No hidrolizable por enzimas de animales pero sí por algunas bacterias y
hongos, crustáceos, arácnidos y miriápodos. Se encuentra en la pared celular de
hongos. Molécula resistente y dura.

III. PROTEÍNAS

Las proteínas son biopolímeros (macromoléculas orgánicas), de elevado peso molecular,


constituidas básicamente por carbono (C), hidrógeno (H), oxígeno (O) y nitrógeno (N); aunque
pueden contener también azufre (S) y fósforo (P) y, en menor proporción, hierro (Fe), cobre
(Cu), magnesio (Mg), yodo (Y), etc. Las proteínas pueden presentar hasta cuatro niveles
estructurales: estructura primaria, secundaria , terciaria y cuaternaria.

Funciones:
A. Estructural: Forman estructuras protectoras externas(cuernos, escamas, piel, pelo de
mamíferos, plumas) ; y la estructura de la membrana celular.

33
FASE CERO 2018-I

B. Mecánica: Interviene en el movimiento mecánico celular, orgánico y corporal. Esta


función las desempeñan proteínas contráctiles (actina y miosina)
C. Transporte: Proteínas encargadas de movilizar el oxígeno, cobre, hierro y lípidos
(hemoglobina)
D. Catalítica: Proteínas esenciales para el metabolismo que actúan como catalizadores
acelerando las reacciones químicas, favoreciendo la obtención de energía y
regeneración celular. ENZIMAS
E. Regula unciones Corporales: Hormonas y vitaminas
F. Defensa: Como anticuerpos.

Componentes de las proteínas: aminoácidos


Son las unidades básicas que forman las proteínas (> a 50 Aminoácidos). Su denominación
responde a la composición química general que presentan, en la que un grupo amino (-NH2)
y otro carboxilo o ácido (-COOH) se unen a un carbono (-C-). Las otras dos valencias de
ese carbono quedan saturadas con un átomo de hidrógeno (-H) y con un grupo químico
variable al que se denomina radical (-R).

34
FASE CERO 2018-I

Aminoácidos Proteicos:

CLASIFICACIÓN DE LAS PROTEÍNAS


Las proteínas según su constitución se pueden clasificar en holoproteínas y heteroproteínas,
a su vez las holoproteínas se subclasifican en fibrosas y globulares.

NIVELES ESTRUCTURALES DE LAS PROTEÍNAS


Las proteínas pueden llegar a presentar hasta cuatro niveles estructurales dependiendo de la
proteína en cuestión, esto quiere decir que no todas las proteínas presentaran los cuatro
niveles completos. Estos niveles se conocen como nivel primario, secundario, terciario y

35
FASE CERO 2018-I

cuaternario. Las proteínas con nivel terciario y con elevada masa molecular pueden
presentar dominios funcionales.

II. ÁCIDOS NUCLEICOS

Son moléculas orgánicas que constituyen del 5 al 15 % del peso en seco de todas las células.
Compuestas de 5 elementos químicos: C, H, O, N y P, constituidos por miles de unidades
estructurales llamadas NUCLEÓTIDOS. Participan en el almacenamiento y transmisión de la
información genética. Descubierto por Miescher en 1868 en Leucocitos. En 1953 Watson y
Crick determinaron su estructura molecular.

Funciones de los ácidos nucleicos


La función biológica de los ácidos nucleicos, específicamente el DNA es la de contener la
información hereditaria. Otras de las funciones biológicas de los ácidos nucleicos son las de
almacenamiento, replicación, recombinación, y transmisión de la información genética (son
las moléculas que determinan lo que es y hace cada una de las células vivas)

Estructura de los ácidos nucleicos


 Nucleótidos: Son monómeros, unidades moleculares de los ácidos nucleicos compuestos
de: 1 pentosa  ribosa o desoxirribosa

36
FASE CERO 2018-I

 1 grupo fosfato  ácido fosfórico


 1 base nitrogenada  Púrica o pirimídica

 Nucleósido: Base nitrogenada + Pentosa

 Bases Nitrogenadas: 2 clases:


 Purinas Constituidas por 2 anillos: Adenina (A) y Guanina (G)
 Pirimidinas  Constituidas por un anillo: Citosina (C), Timina (T), Uracilo (U)
Este último en el ARN

Relación de complementariedad entre bases: A con T y C con G o C con U.

Clases de Ácidos Nucleicos:


 ADN: Estructura planteada por James Watson y Francis Crick : Modelo Doble
Hélice.
Constituido por nucleótidos con Bases Nitrogenadas: A, G, C, T; en 2 cadenas
antiparalelas, complementarias y helicoidales.

37
FASE CERO 2018-I

 ARN: Constituida por 1 cadena polirribonucleótido


Clases de ARN:
 ARNhn : Heterogénea nuclear. Precursor de ARNm, ARNt, ARNr
 ARNm : Molécula que sale del núcleo hacia los ribosomas con la información para que ellos
sinteticen proteínas
 ARNt : Transporta y adapta aminoácidos durante la síntesis de proteínas.
 ARNr : Constituye aproximadamente el 65% de la composición del ribosoma.

AUTOEVALUACIÓN
1) Señale el concepto de proteínas
2) Indique las funciones que pueden cumplir los carbohidratos
3) Grafique la clasificación de los lípidos
4) Indique que son los ácidos grasos
5) Señale los subtipos de ácidos nucleicos y sus funciones respectivas.

38
FASE CERO 2018-I

TEMA 4: CLASIFICACIÓN DE LOS SERES VIVOS

La sistemática
Que se ocupa de la diversidad de los seres vivos y a sus relaciones evolutivas, es decir ser
encarga de la organización del conjunto total del conocimiento sobre los organismos. Incluye
la información filogenética, taxonómica, ecológica y paleontológica.
Está dividida en dos áreas la filogenética que estudia la historia evolutiva de una especie y
taxonomía que se ocupa del estudio teórico de la clasificaron de los seres vivos, incluyendo
sus bases procedimientos y reglas así como su nomenclatura.
Clasificación. Clasificar es la acción que realiza la ciencia o estudio de la clasificación, es la
ordenación de plantas (u otras entidades) en grupos de tamaño creciente, dispuestos de una
manera jerárquica (sistema o jerarquía de niveles o categorías).
Taxonomía. Es la parte de la Sistemática que proporciona los principios (reglas) y
procedimientos para realizar una clasificación, ya que siguiendo diferentes principios podemos
obtener diferentes clasificaciones.
Nomenclatura La nomenclatura es la parte de la Sistemática que se dedica a dar nombre a
los seres vivos y grupos de seres vivos (taxones).
Los taxones o grupos en que se clasifican los seres vivos se estructuran en una jerarquía de
inclusión, en la que un grupo abarca a otros menores y está, a su vez, subordinado a uno
mayor. A los grupos se les asigna un rango taxonómico o categoría taxonómica que acompaña
al nombre propio del grupo. Algunos ejemplos conocidos son: género Homo, familia Canidae
(cánidos), orden Primates, clase Mammalia (mamíferos), reino Fungi (hongos).

39
FASE CERO 2018-I

Criterios de clasificación de los seres vivos


La filogenia es el principal criterio que actualmente se usa para clasificar los seres vivos.
Independientemente del método esta es única no existe mas que un árbol de la vida.
La filogenia es la relación de parentesco entre especies o taxones en general.
La filogenética es la parte de la biología evolutiva que se ocupa de determinar la filogenia, y
consiste en el estudio de las relaciones evolutivas entre diferentes grupos de organismos a
partir de la distribución de los caracteres primitivos y derivados en cada taxón, utilizando
matrices de información de moléculas de ADN y de morfología
Actualmente se considera al cladismo y a la taxonomía evolutiva clásica como las formas de
estudiar con criterios científico estas relaciones, la primera hace uso del principio de
parsimonia donde la explicación más simple es la más probable, la segunda considera el
grado de divergencia entre las especies.
Antes de entrar a la descripción de estos dos reinos debemos repasar las categorías
taxonómicas presentes en los seres vivos:
Como sea los criterios más utilizados en la clasificación son:
-La presencia de órganos homólogos: aquellos que tienen similar estructura interna aunque
diferente función indica ancestro común. ejm patas delanteras de cocodrilos y aves comunes.
-La citogenética: estudio del cariotipo, forma y número de cromosomas .ejm chimpancé 48
muy pareces a 46 del hombre
-Genética molecular: distancia genéticas ejm entre hombre y chimpancé 1,7 unidades de
mapa (um)
-La bioquímica estudio comparado de ciertas moléculas entre organismo ejm aminoácidos en
hemoglobina.

Breve historia de la clasificación


Por siglos y con diversos propósitos, naturalistas, filósofos, químicos, botánicos y zoólogos,
entre otros estudiosos de la naturaleza, intentaron ordenar de alguna manera los ejemplares
de seres vivos que coleccionaban.
En esos intentos, Aristóteles (384-322 a.C.) desempeñó un papel crucial, porque trató de
establecer criterios que permitieran clasificar animales y plantas en forma sistemática y
jerárquica. En la Grecia clásica, a la que se remonta la historia natural como la entendemos
en la actualidad, varias escuelas de pensamiento consideraban que los elementos físicos eran
universales e inmutables: existían desde la eternidad y seguirían existiendo a través de una
sucesión infinita de generaciones.
Carl Linnaeus (1707-1778), conocido luego de recibir un título de nobleza por Carl von Linné,
y en castellano por Lineo, un naturalista, botánico y zoólogo sueco que se desempeñó en la
Universidad de Upsala, propuso un sistema artificial de clasificación de dos nombres (o

40
FASE CERO 2018-I

binario), compuesto por género y especie. Además, agrupó los géneros en familias, las
familias en clases y las clases en reinos
En 1866 Ernst Haeckel creo el tercer reino Protista (donde agrupó a todos los organismos
unicelulares).
En 1956 Herbert Copeland propuso el Reino Monera.
A mediados del siglo 20 Chatton clasifica en dos reinos procariota y eucariota
Luego dentro de los más importantes Whittaker 1969 propone 5 reinos basados en tipo de
estructura celular: monera, protista, animalia, plantae y fungy.
En 1970 Woese propuso 3 dominios o suprareinos dos con organización procariota y una
eucariota: el Bacteria, Archaea y Eucarya
En 1985 Lynn Margulis y Schwartz proponen una modificación en los 5 reinos planteados por
Whittaker : monera, protoctista (algas todas y protozoarios), fungi, animalia y
plantae.(modificando protistas por protoctistas al introducir algas pluricelulares y algunos
hongos inferiores.

Nomenclatura binomial: cada especie de ser vivo recibe un nombre único en latín construido
con dos palabras el género siempre un sustantivo y la especie un adjetivo o epíteto.

Nomenclatura trinomial al nombre de las especie se le agrega un epíteto adicional. Ejm


Homo sapiens sapiens.

Categorías taxonómicas actuales:


 Dominio, la categoría que separa a los seres vivos por sus características celulares.
Por esta razón, existen dos sistemas de dominios: el más antiguo
:Prokaryota y Eukaryota, y el más reciente :Archaea, Bacteria y Eucarionte.
 Reino: esta categoría divide a los seres vivos por su naturaleza en
común. Archaea y Bacteria son tanto reinos como dominios, por ser
unicelulares, procariontes y diferenciarse en otras características bioquímicas y
biofísicas. El dominio de Eukaryota se lo divide a su vez en cuatro
reinos: Protista (organismos unicelulares y eucariontes como
las células), Fungi ("plantas" heterótrofas), Plantae (organismos autótrofos sin
locomoción) y Animalia (organismos heterótrofos y locomotores)
 Filo o división (fuera de la zoología), la categoría que agrupa a los seres vivos por
su mismo sistema de organización. Ejemplo (para aclarar un poco más): en el reino
animal, las almejas, los caracoles y los pulpos tienen el mismo tipo
de tejidos, reproducción, órganos y sistemas, por lo tanto se agrupan en el
Filo Mollusca.

41
FASE CERO 2018-I

 Clase. Los filos (o divisiones) se dividen en clases por las características más
comunes que hay entre ellos, es decir, por las semejanzas mayores que existan
entre los integrantes de un filo. En el Filo Mollusca, por ejemplo, hay miles de moluscos
y algunos de ellos, por ausencia de concha, se agrupan en la clase Aplacophora.
 Orden. También ésta es una división de la categoría anterior; el orden es una división
de la clase que también se basa en características comunes de algunos seres
vivos dentro de una clase. Dentro de la Clase Mammalia, por ejemplo, se encuentra
el orden Primates, que contiene a todos los seres vivos con cinco dedos, un patrón
dental común y una primitiva adaptación corporal.
 Familia también es una división de la categoría precedente. Una familia es la
agrupación de seres vivos con características comunes dentro de un orden.
Ejemplo: Del Orden Primates proviene la familia Hominidae, que comprende a los
primates bípedos.
 Género, Es la categoría taxonómica que emparenta a las especies relacionadas
entre sí por medio de la evolución. De la familia Hominidae, pongamos por ejemplo,
surge el género Homo, que comprende al humano y sus antecesores.
 Especie Es la categoría más baja. Es usada para referirse a un grupo de individuos
que cuentan con las mismas características permitiendo la descendencia fértil
entre ellos. Ejemplo: un ser humano (Homo sapiens) se relaciona con otro humano
de sexo opuesto y se reproducen, teniendo descendencia entre ellos.
Hay que ser cuidadosos con el significado de estas categorías. Del dominio provienen los
reinos, de los reinos proceden los filos, los filos se dividen en clases, las clases se separan
en órdenes, estas órdenes son agrupaciones de familias, las familias son géneros unidos, un
género es un grupo de especies emparentadas y una especie es un grupo capaz de
reproducirse mutuamente.
Los tres dominios de WOESE

1.-Archaea (Archaebacteria)
Los Archaea son células Procariotas. Al contrario de Bacteria y Eukarya, tienen membranas
compuestas de cadenas de carbono ramificadas unidas al glicerol por uniones de éter y tienen
una pared celular que no contiene peptidoglicano. Mientras que no son sensibles a algunos
antibióticos que afectan a las Bacterias, son sensibles a algunos antibióticos que afectan a los
Eukarya. Los Archae tienen rRNA y regiones del tRNA claramente diferentes de Bacterias y
Eukarya. Viven a menudo en ambientes extremos e incluyen a los metanógenos, halófilos
extremos, y termoacidófilos.

2.- Bacteria (Eubacteria)

42
FASE CERO 2018-I

Las Bacterias son células Procariotas. Como los Eukarya, tienen membranas
compuestas de cadenas de carbono rectas unidas al glicerol por uniones éster. Tienen una
pared celular conteniendo peptidoglicano, son sensibles a los antibióticos antibacterianos
tradicionales, y tienen rRNA y regiones del tRNA claramente diferentes de Archaea y Eukarya.
Incluyen a mycoplasmas, cyanobacteria, bacterias Gram-positivas, y bacterias Gram-
negativas.

3.- Eukarya (Eukaryota)


Los Eukarya (escrito también Eucaria) son Eucariotas. Como las Bacterias, tienen membranas
compuestas de cadenas de carbono rectas unidas al glicerol por uniones éster. Si tienen pared
celular, no contiene ningún peptidoglicano. No son sensibles a los antibióticos antibacterianos
tradicionales y tienen rRNA y regiones del tRNA claramente diferente de Bacterias y Archaea.
Incluyen a protistas, hongos, plantas, y animales.

La siguiente tabla comparativa relaciona las diferentes características eucariotas, bacterianas


y arqueanas:

Dominios ARCHAEA BACTERIA EUCARYA

Estructura celular procariota procariota eucariota

uno circular múltiples


uno circular y
Cromosomas con lineales con
desnudo
cromatina cromatina

glicopéptidos
glúcidos (celul
Composición de la pared celular , proteínas peptidoglicano
osa, quitina)
o glúcidos

Enlace lipídico de la membrana éter éster éster

Ácidos grasos de la membrana ramificados lineales lineales

Flagelo arqueano bacteriano eucariota

80S, pero 70S


(o 55S) en
Ribosoma 70S 70S
mitocondrias y
cloroplastos

en los genes en la mayoría


Intrones No
de ARNt de genes

Operones Sí Sí No

43
FASE CERO 2018-I

Plásmidos Sí Sí raros

Cromatina con nucleosomas e


Sí No Sí
histonas

formil-
Iniciador de ARNt metionina metionina
metionina

ARN polimerasas varias una varias

Subunidades del ARNP 8-12 4-5 12-14

Estreptomicina y cloranfenicol resistente sensible resistente

Toxina diftérica sensible resistente sensible

Las principales características que llevaron a reconocer tres diferentes dominios fueron los
análisis del ARN ribosomal de la subunidad menor: en Bacteria hay una secuencia particular
entre las posiciones 500-545 del ARNr-16S, en Archaea hay una estructura única entre las
posiciones 180-197 o 405-498 del mismo ARNr-16S y en Eukarya el ARNr de la subunidad
menor es 18S y difiere de los procariontes entre las posiciones 585-656.5

LOS REINOS DE LYNN MARGULIS


REINO MONERA
Comprende las bacterias y la cianobacterias, pueden ser autótrofos y heterótrofos. Pueden
ser quimiosínteticas (utilizan como fuente de energías las sales minerales y no la luz) o
fotosintéticas (utilizan como fuente de energía la energía electromagnética).
Pueden ser saprofitos (descomponen la materia orgánica que ya esta en descomposición
parcial) o parásitos(que viven a expensas de otros causándoles daño). Poseen pared celular
de peptidoglucano N-acetil glucosamina N-acetil muramico. Se clasifican según su forma:
bacilos, cocos, espirilos; según su origen evolutivo, según su reacción a la coloración gram:
gram positivos y negativos según las características de su pared celular.
Las Cianobacterias o algas verde azuladas, que comprenden el filo de los Cianofitos,
representan el grupo de células más primitivo. Son microorganismos unicelulares
extremadamente simples que pueden vivir como sencillas células, como finos filamentos, al
igual que los que se muestran aquí, o como colonias simples. Las algas verdea azuladas son
capaces de resistir una amplia variedad de condiciones ambientales, desde hábitats de agua
dulce o marina, hasta terrenos nevados y glaciares. Así mismo pueden sobrevivir y prosperar
con temperaturas muy altas

44
FASE CERO 2018-I

REINO PROTOCTISTAS
Eucariontes que no forman tejido. Pueden ser heterófrofos, unicelular. (protozoos). Autótrofos,
fotosintéticos: unicelulares, pluricelulares (algas) (tipo talo = no hay tejidos (raíz, talla, hoja)).
Incluye todas las algas excepto las verde azules o cianofitas que hora son cianobacterias ,
protozoarios y mohos mucilagenosos. Existen autótrofos y heterótrofos. Pueden ser
unicelulares o pluricelulares. Su reproducción puede ser sexual o asexual y por sus
estructuras de locomoción pueden ser ciliados, flagelados, sarcodinos, y esporozoarios.
Protozoarios: Son organismos heterotróficos para las sustancias carbonadas, son aerobios o
anaerobios facultativos y su nutrición es a través de enzimas y por absorción (raro ingestión).
Su pared celular contiene quitina y glucanos embebidos en una matriz de polisacáridos y
glucoproteínas. Los organismos semejantes a hongos (Agrios, 1997) que hasta 1990 se
consideraban Hongos Verdaderos, poseen una pared celular compuesta de glucanos y
pequeñas cantidades de celulosa pero no quitina, éstos son los Oomycota que ahora se
ubican en el Reino Chromista; sin embargo, se continúan tratando como hongos ya que
existen muchas similitudes con ellos.

REINO FUNGI
Heterótrofos que forman pseudotejidos. Está integrado por seres vivos eucarientes,
unicelulares o pluricelulares (tipo talo) son todos heterótrofos.
Se clasifican en ascomicetos, basiodiomicetos, zigomicetos, mixomicetos.
Se localizan en sitios poco iluminados y húmedos. Pueden ser unicelulares como las
levaduras o plurixcelulares como las setas. Los hongos pluricelulares se agrupan en gametos
formando redes llamadas hifas y al conjunto de hifas se les conoce como micelio. Son
heterótrofos es decir no producen su propio alimento, descomponen materia orgánica por
medio de sus enzimas y absorben los nutrientes, su reproducción puede ser sexual o asexual,
la más común es la esporulación. Por su forma de vida pueden ser: saprofitos, parásitos o
mutualistas( interacción con otro individuo en que los dos se benefician aunque la relación no
es obligatoria como en la simbiosis)
La gran mayoría de los hongos son estrictamente saprófitos, sin embargo también existen
parásitos (obligados o biotróficos y no obligados), hiperparásitos, patógenos y simbiontes.
Existen algunas características que le dan cierta similitud con los animales, como por ejemplo:
heterotrofia para sustancias carbonadas, poseen células móviles (planosporas) que son
similares a las de protozoos y espermios. El núcleo es el típico de una célula eucariótica.
La mayoría posee un cuerpo o talo vegetativo filamentoso llamado MICELIO. Las ramas del
micelio se denominan HIFAS, que crecen en todas direcciones, las que poseen un diámetro

45
FASE CERO 2018-I

de 1-2
micelio puede ser de unos pocos micrómetros hasta varios metros.
En algunos hongos el micelio consiste de muchas células que contienen 1 ó 2 núcleos por
célula. En otros, el micelio es multinucleado y puede o no tener paredes celulares (septas),
en este caso se trata de un Micelio Cenocítico. Las Septas o Tabiques corresponden a la
pared celular formada en directa asociación con la división nuclear.
Los hongos son típicamente inmóviles (con corriente citoplasmática al interior de las hifas),
pero pueden existir esporas móviles que se conocen como zoosporas o planosporas.
Existen hongos cuyo micelio cumple una función vegetativa y reproductiva (todo el talo
constituye el cuerpo reproductivo o fructífero del hongo) a la vez, como es el caso de los
géneros Synchitrium y Spongospora, entonces se le denomina como micelio Holocárpico. Por
otro lado, es importante definir lo que es un MICELIO EUCÁRPICO; éste es aquel en que
existe diferenciación entre la Fase Vegetativa y la Fase Reproductiva.
Los hongos generalmente se reproducen por esporas, las que frecuentemente son
pluricelulares. También las bacterias y criptógamas producen esporas, las que en el primer
caso son unicelulares y poseen las características de una célula procariótica.
Las esporas pueden ser de origen sexual o asexual, inmóviles (aplanosporas) o móviles
(zoosporas o planosporas), de reposo o resistencia o vegetativas. Existen diferentes tipos de
esporas, las que acorde con sus características poseen diferentes nombres.

a) Reproducción Asexual
En algunos hongos, las esporas asexuales se producen dentro de un esporangio (órgano que
produce esporas asexuales endógenas), algunas de estas esporas son móviles por medio de
flagelos y se denominan entonces zoosporas o planosporas, ej.: Phytophthora. Otros hongos
producen esporas asexuales llamadas conidias (cualquier espora de origen asexual
generalmente no resistente y que se forma a partir de hifas especializadas denominadas
conidióforos), ej.: en Deuteromycetes.
En algunos hongos las células terminales o intercalares de las hifas se alargan, redondean y
forman una gruesa pared y luego se separan formando entonces las clamidosporas (también
se pueden formar a partir de una conidia por transformación de 1 ó varias células) que
cumplen la función de espora de resistencia (ej.: género Fusarium).
En otros hongos las esporas asexuales (conidias) se producen en el interior de un cuerpo
fructífero denominado picnidio (conidioma en forma de botella con ostíolo y revestido por
células conidiógenas que producen conidias) o en capas fértiles como esporodoquios
(fructificación en la cual la masa de conidias es soportada por una especie de cojín o
almohadilla donde se ubican conidióforos muy cortos), o acérvulos (los conidióforos se ubican
sobre una agregación de hifas o seudoparénquima que puede ser subcuticular o

46
FASE CERO 2018-I

subepidérmico o de origen más profundo y que posee paredes celulares basales,


laterales o superiores), ej.: en Deuteromycetes.

b) Reproducción Sexual.
La reproducción sexual ocurre en la mayoría de los hongos; en algunos se unen 2 células
(gametos) de tamaño y apariencia similar produciendo un cigoto. En otros, los gametos son
de diferente tamaño y el cigoto que forma se denomina oospora (ej.: Phytophthora). En
algunos hongos no se producen gametos definidos, pero un micelio definido puede unirse con
otro micelio compatible, formando una cigospora (ej.: Rhizopus).
En los Ascomycota, las esporas sexuales generalmente en número de 8, se producen en
una célula cigoto denominada asco y las esporas producidas se denominan ascoporas. Los
ascos pueden producirse en cuerpos fructíferos como los cleistotecios (ascocarpo cerrado sin
ostiolo), peritecios (ascocarpo cerrado provisto de ostiolo) y apotecios (ascocarpo abierto en
forma de platillo), o bien, en forma libre como en el género Taphrina.
En Basidiomycota, las esporas sexuales se producen sobre la parte externa de la célula
cigoto llamada basidia y las esporas se denominan basidiosporas.

EL REINO PLANTAE
Este reino comprende a organismos multicelulares y que se nutren mediante la fotosíntesis
que se realiza por medio de la clorofila de los cloroplastos, (también hay heterotróficos parcial
y totalmente) ; que se reproducen por alternancia de generaciones con una reproducción
sexual con la producción de células gametofitos haploides producidos por meiosis y una
reproducción vegetativa en la cual se genera una célula esporofito diploide incluye al embrión.
Hay que destacar que también el cigoto 2n producido por la fecundación origina el esporofito,
dominante en la mayoría de los vegetales, que es la planta verde en la cual se
diferencian células que luego de sufrir meiosis dan células haploides (esporas), que después
de varias mitosis (conformando una generación) forman un gametofito haploide multicelular,
éste normalmente es dependiente y parásito del esporofito y produce las gametas por mitosis,
reiniciando el ciclo; y poseen paredes celulares constituidas principalmente por celulosa.

Otra contribución de las plantas es la formación de los ambientes. Solamente las regiones
árticas y las profundidades oceánicas carecen de plantas, el resto de los ambientes terrestres,
desde los desiertos a las tundras y los bosques o praderas fueron producidos y moldeados
por las plantas.
Su subclasificación taxonómica es en dos phylum:

47
FASE CERO 2018-I

Phylum Bryophyta: terrestres multicelulares. Presentan la llamada alternancia de


generaciones. Carecen de tejido vascular, tienen tallo y hojas pero no raíces verdaderas. Son
de color verde. Ejm musgos, hepáticas y antoceros .
Musgos: que son plantas pequeñas que tienen un tallito del que salen hojitas pequeñas y
viven en lugares donde hay humedad.

Phylum traqueofitas
Son plantas cuyas células están diferenciadas en tejidos y órganos. Poseen raíces, tallo y
hojas. Aquí se incluyen todas las plantas superiores como helechos, gimospermas y
angiospermas.

División Pterydophytas: son plantas verdes. Se parecen mas a las plantas superiores.
Presentan raíces. Su sistema vascular esta bien desarrollado. Presentan alternancia de
generaciones. La fase gametofito es una planta grande que puede vivir muchos años.

Sus únicos representantes actuales son los helechos, que tienen un tallo subterráneo
del que le salen hojas grandes y compuestas y que presentan en el envés de sus
hojas esporas.

División Spermatophytas: es el grupo vegetal más evolucionado. Se reproducen por semillas.

Clase Gymnospermae: son plantas leñosas grandes, en su mayor parte siempre verdes. Son
productoras de heterosporas ( microsporas y macrosporas). Óvulos y semillas descubiertas
( no están dentro de un ovario). Ausencia de flores y carpelos ejm. Confieras. No producen
fruto y sus semillas se agrupan en una piña o cono especial por lo que también se les conoce
como coníferas como los cipreses y los pinos y abetos

Clase Angiospermae: plantas con flores. Semillas encerradas en ovario que se convierte en
fruto.

Subclase Dicotiledoneas: embriones con dos cotiledones. Haces vasculares ordenados


formando anillos en el tallo. Son más antiguas que las monocotiledonias. Ejm leguminosas y
mayoría de las que producen flores.

48
FASE CERO 2018-I

Subclase monocotiledonias: embriones con un solo cotiledon. Haces vasculares


dispersos al azar por todo el tallo. Ejm gramineas. maíz, trigo, cebada, arroz. cebolla , ajos,
tulipán y orquídeas.

EL REINO ANIMALIA
Comprende a aquellos organismos incapaces de sintetizar un propio alimento, es decir todos
son heterótrofos. Los animales han desarrollado toda una serie de elementos destinados a
facilitarle la locomoción, como son un esqueleto de soporte externo o interno, y un sistema
mecánico que le permite la movilidad de ese esqueleto.

Constituye un amplio grupo de especies eucariotas y pluricelulares. Se caracterizan, en


general, por su capacidad para la locomoción, por la ausencia de pared en sus células y de
clorofila, y por su desarrollo embrionario, que atraviesa una fase de blástula y determina un
plan corporal fijo (aunque muchas especies pueden sufrir posteriormente metamorfosis). Los
animales forman un grupo natural estrechamente emparentado con los hongos y las plantas.

Características generales
La movilidad es la característica más llamativa de los animales de este reino, pero no es
exclusiva del grupo, lo que da lugar a que sean designados a menudo como animales ciertos
organismos que pertenecen al reino Protista.
En el siguiente esquema, se muestran las características comunes a todos los animales:
 Organización celular. Eucariota y pluricelular.
 Nutrición. Heterótrofa por ingestión (a nivel celular, por fagocitosis y pinocitosis), a
diferencia de los hongos, también heterótrofos, pero que absorben los nutrientes tras
digerirlos externamente.
 Metabolismo. Aerobio (consumen oxígeno).
 Reproducción. Todas las especies animales se reproducen sexualmente (algunas sólo
por partenogénesis), con gametos de tamaño muy diferente (oogamia) y zigotos (ciclo
diplonte). Algunas pueden, además, multiplicarse asexualmente. Son típicamente
diploides.
 Desarrollo. Mediante embrión y hojas embrionarias. El cigoto se divide repetidamente
por mitosis hasta originar una blástula.
 Estructura y funciones. Poseen colágeno como proteína estructural. Tejidos celulares
muy diferenciados. Sin pared celular. Algunos con quitina. Fagocitosis, en formas
basales. Ingestión con fagocitosis ulterior o absorción en formas derivadas ("más
evolucionadas"), con capacidad de movimiento, etc.

49
FASE CERO 2018-I

 Simetría. Excepto las esponjas, la mayoría de animales presentan una disposición


regular de las estructuras del cuerpo a lo largo de uno o más ejes corporales. Los tipos
principales de simetría son la radial y la bilateral.

Con pocas excepciones, el más notables el de las esponjas (filo Porifera), los animales tienen
cuerpos diferenciados en tejidos separados. Estos incluyen músculos, que pueden contraerse
para controlar el movimiento, y un sistema nervioso, que envía y procesa señales. Suele haber
también una cámara digestiva interna, con una o dos aberturas. Los animales con este tipo
de organización son conocidos como Eumetazoos, en contraposición a los Parazoos y
Mesozoos, que son niveles de organización más simples dentro de los Metazoos ya que
carecen de algunas de las características mencionadas.
Todos los animales tienen células eucariontes, rodeadas de una matriz extracelular
característica compuesta de colágeno y glicoproteínas elásticas. Ésta puede calcificarse para
formar estructuras como conchas, huesos y espículas. Esto contrasta con otros organismos
pluricelulares como las plantas y los hongos, cuyas células permanecen el sitio mediante
paredes celulares, que desarrollan un crecimiento progresivo.
Todos los animales son heterótrofos.

Filos del Reino Animalia:


Esponjas Mesozoos
Cnidarios Tenóforos
Platelmintos Gnathostomulidos
Nemertinos Gastrotricos
Acantocéfalos Rotíferos
Kinorrincos Priapúlidos
Entoproctos Nemátodos
Nematomorfos Loriciferos
Ectoproctos Moluscos
Anelídeos Sipuncúlidos
Equiúridos Pogonoforos
Artrópodos Tardígrados
Pentastúmidos Onicóforos
Briozoos Foronidos
Braquiópodos Equinodernmos
Lombrices-Flechas Cordados

Los cordados a su vez se clasifican en: Aves, reptiles, anfibios, peces, mamíferos

50
FASE CERO 2018-I

Ubicación taxonómica del hombre


Dominio Eucarya
Reino Animalia
Subreino Bilateria
Superfilo Deuterostomía
Filo Chordata
Subfilo Vertebrata
Clase Mammalia
Subclase Theria
Infraclase Eutheria
Superorden Euarchonta
Orden primates
Suborden Haplorrhini
Infraorden Anthopoidea
Familia Hominidae
Subfamilia Homininae
Tribu Hominini
Género Homo
Especie Homo sapiens.

AUTOEVALUACIÓN
1) Indique que estudia la filogenia y que se entiende por nomenclatura binomial
2) Señale de que se encarga la taxonomía
3) Señale las categorías taxonómicas celulares mas importantes.
4)Señale las características mas importantes de los Archaea
5)Señale las diferencias entre el dominio Bacterya y Eucarya
6)Indique quienes están incluidos en el Reino Protoctista
7)Haga un gráfico de clasificación de las plantas.

51
FASE CERO 2018-I

TEMA 5: LA CÉLULA

La célula es una unidad mínima de un organismo capaz de actuar de manera autónoma.


Todos los organismos vivos están formados por células, y en general se acepta que ningún
organismo es un ser vivo si no consta al menos de una célula. Algunos organismos
microscópicos, como bacterias y protozoos, son células únicas, mientras que los animales y
plantas están formados por muchos millones de células organizadas en tejidos y órganos.
Aunque los virus y los extractos acelulares realizan muchas de las funciones propias de la
célula viva, carecen de vida independiente, capacidad de crecimiento y reproducción propias
de las células y, por tanto, no se consideran seres vivos. La biología estudia las células en
función de su constitución molecular y la forma en que cooperan entre sí para constituir
organismos muy complejos, como el ser humano. Para poder comprender cómo funciona el
cuerpo humano sano, cómo se desarrolla y envejece y qué falla en caso de enfermedad, es
imprescindible conocer las células que lo constituyen.

En 1838 Mathias Schleiden, un botánico de origen alemán, llegó a la conclusión de que todos
los tejidos vegetales estaban formados por células. Al año siguiente, otro alemán, el zoólogo
Theodor Schwann extendió las conclusiones de Schleiden hacia los animales y propuso una
base celular para toda forma de vida.

52
FASE CERO 2018-I

Finalmente, en 1858, Rudolf Virchow al hacer estudios sobre citogénesis de los


procesos cancerosos llega a la siguiente conclusión: "las células surgen de células
preexistentes" o como lo decía en su axioma "ommni cellula e cellula".
La Teoría Celular, tal como se la considera hoy, puede resumirse en cuatro proposiciones:
1. En principio, todos los organismos están compuestos de células.
2. En las células tienen lugar las reacciones metabólicas de organismo.
3. Las células provienen tan solo de otras células preexistentes.
4. Las células contienen el material hereditario.

Forma y tamaño de las células


Al considerar panorámicamente el conjunto de seres vivientes que pueblan la biósfera del
planeta, se encuentra una enorme gama de tamaños, formas y organización de las células.
Sin tener en cuenta las diferencias de origen, tamaño y forma, las partes de que constan las
células son idénticas.

Durante toda su vida las células cambian constantemente de forma, tamaño y estructura; este
cambio depende de la interacción de un gran número de factores, de los cuales los más
importantes son: la función que desempeñan, rigidez de la membrana, tensión superficial,etc.

Características estructurales de las células


-Individualidad: gracias a su membrana plasmática que las separa y comunica con el exterior,
que controla los movimientos celulares y que mantiene el potencial eléctrico de la célula.
-Contienen un medio hidrosalino, el citoplasma, que forma la mayor parte del volumen celular
y en el que están inmersos los orgánulos celulares.
-Autogobierno: gracias a su ADN cuyos genes contienen las instrucciones para el
funcionamiento celular, a su ARN que expresa la información contenida en el ADN y a sus
enzimas y otras proteínas que ponen en funcionamiento la maquinaria celular.

Las características que permiten diferenciar las células de los sistemas químicos no
vivos son:
-Autoalimentación o nutrición. Las células toman sustancias del medio, las transforman de una
forma a otra, liberan energía y eliminan productos de desecho, mediante el metabolismo.
-Autorreplicación o crecimiento. Las células son capaces de dirigir su propia síntesis, una
célula crece y se divide mediante la división celular.
-Diferenciación. Muchas células pueden sufrir diferenciación celular. Cuando una célula se
diferencia, se forman algunas sustancias o estructuras que no estaban previamente formadas
y otras que lo estaban dejan de formarse.

53
FASE CERO 2018-I

-Señalización química. Las células responden a estímulos químicos y físicos tanto del
medio externo como de su interior, con frecuencia las células pueden interaccionar o
comunicar con otras células, generalmente lo hacen por medio de señales o mensajeros
químicos, como hormonas, neurotransmisores, factores de crecimiento.
-Evolución. Esto significa que hay cambios hereditarios (que ocurren a baja frecuencia en
todas las células de modo regular) que pueden influir en la adaptación global de la célula o
del organismo superior de modo positivo o negativo. El resultado de la evolución es la
selección de aquellos organismos mejor adaptados a vivir en un medio particular.

Funciones de las células


Todas las células realizan tres funciones vitales: nutrición, relación y reproducción. Otras
funciones o derivadas de estas serian:
Irritabilidad: es la capacidad del protoplasma para responder a un estímulo. Es más notable
en las neuronas y desaparece con la muerte celular.
Conductividad: es la generación de una onda de excitación (impulso eléctrico) a toda la célula
a partir del punto de estimulación. Esta y la irritabilidad son las propiedades fisiológicas más
importantes de las neuronas.
Contractilidad: es la capacidad de una célula para cambiar de forma, generalmente por
acortamiento. Está muy desarrollada en las células musculares.
Absorción: es la capacidad de las células para captar sustancias del medio.
Secreción: es el proceso por medio del cual la célula expulsa materiales útiles como una
enzima digestiva o una hormona.
Excreción: es la eliminación de los productos de desecho del metabolismo celular.

Organización de la célula procariota o procito.


La clasificación de las en procariotas y eucariotas propuesto por Roger Stanier y Cornelio Van
Niel en 1962, ha sido un concepto profundo y de gran influencia en la biología.

El término procariotas (pro que significa antes y karyon que significa núcleo), para las células
primitivas que presentan nucleoide o tenóforo, ha sido aceptada ampliamente en el mundo
científico. Los organismos que presentan éstas células se denominan procariotas. Estas se
han reunido en el reino Monera y agrupa a las bacterias y las algas verdes – azules. La
característica primordial es que el diseño celular procariota no esta compartimentalizado y en
toda célula procariota se pueden considerar las siguientes partes: pared celular, plasmalema,
citoplasma, ribosomas y nucleoide. Todas las demás características se representan sólo en
algunos procariontes.

54
FASE CERO 2018-I

La nutrición en los organismos procariotas es por absorción de nutrientes orgánicos


para obtener sus materiales de construcción y la energía para el crecimiento.

Organización de la célula eucariota o eucito.


Las células eucariotas están mejor organizadas, en general son de mayor tamaño, tienen un
núcleo verdadero encerrado en una cubierta membranosa doble, y en un citoplasma
organizado en organelos rodeados por membranas y suspendidos en la matriz citoplasmática.
Las células eucariotas presentan cromosomas más complejos que la molécula circular
desnuda de ADN de la célula procariota, con el ADN fijo a proteínas básicas (histonas) y
ácidas. Además en las células diploides se encuentran dos cromosomas de cada clase, y
puede haber muchas clases de ellos. Los cromosomas evolucionan a cromatina durante la
interfase celular y se condensan durante la mitosis; estos acontecimientos no se producen en
el ciclo celular de los procariotas. La inclusión del núcleo en una cubierta produce una barrera
intracelular, dentro del cual se pueden aislar las actividades nucleares complejas, de las
citoplasmáticas.

PROCARIOTAS EUCARIOTAS

Núcleo rodeado por una membrana.


ADN localizado en una región:
Material genético fragmentado en
Nucleoide, no rodeada por una
cromosomas formados por ADN y
membrana.
proteínas.

Por lo general células grandes, (10-100


Células pequeñas 1-10 µm µm), Algunos son microbios, la mayoría son
organismos grandes.

55
FASE CERO 2018-I

TEMA 6: NUTRICIÓN Y METABOLISMO

1. CONCEPTO DE NUTRICIÓN
Los seres vivos son sistemas “abiertos”, esto quiere decir que hay un intercambio continuo de
materia y energía. Este intercambio es el que permite el mantenimiento de la actividad vital.
El recambio material y energético entre el ser vivo y el medio ambiente constituye la nutrición

Desde el punto de vista celular la nutrición corresponde al conjunto de procesos mediante los
cuales la célula obtiene los materiales y la energía que necesita para construir sus propias
estructuras y para realizar sus actividades vitales.

Nutrición de un organismo pluricelular Conjunto de procesos por los cuales los seres vivos
utilizan, transforman e incorporan en sus estructuras una serie de sustancias que obtienen del
medio que les rodea; sustancias que, en forma de nutrientes, están contenidas en el alimento
Alimentación por otro lado es el proceso mediante el cual tomamos del mundo exterior una
serie de sustancias que, contenidas en los alimentos, son necesarias para la nutrición.

2. OBJETIVOS DE LOS PROCESOS NUTRITIVOS :


Los procesos nutritivos tienen tres objetivos fundamentales: Aporte de energía. Aporte de
materiales de construcción de síntesis y renovación de las propias estructuras orgánicas.
Aporte de reguladores, sustancias necesarias para la regulación de los procesos químicos.
La nutrición celular comprende 3 tipos de procesos: Incorporación de las sustancias del medio
extracelular. Metabolismo o utilización química de los nutrientes. Excreción o expulsión al
medio externo de los productos de desecho.

Incorporación de nutrientes: Funciones preparatorias para que los nutrientes puedan llegar
hasta las células.

3. DIGESTIÓN
Digestión intracelular: Tiene lugar en el interior de la célula Realizada por organismos
unicelulares y algunas células de organismos pluricelulares como por ejemplo los glóbulos
blancos.

Digestión extracelular: Tiene lugar fuera de la célula. La realizan animales que poseen aparato
digestivo.

56
FASE CERO 2018-I

4. CIRCULACIÓN O TRANSPORTE
La circulación de los nutrientes en organismos pluricelulares es llevada a cabo por el sistema
circulatorio que además también lleva a cabo el transporte de oxígeno y de los productos de
desecho.

Tipos de sistema circulatorio:


Sistema circulatorio animal. Formado por los vasos sanguíneos, el órgano impulsor (corazón)
y el líquido que circula por los vasos (sangre)

Sistema circulatorio vegetal. Es más sencillo que el sistema circulatorio vegetal. Está formado
por un conjunto de tubos: vasos leñosos (xilema) que conducen la savia bruta vasos liberianos
(floema) que conducen la savia elaborada

5. TIPOS DE NUTRIENTES:
Los tipos de nutrientes que podemos encontrarnos los podemos dividir en dos grupos:
Orgánicos: Glúcidos, Lípidos, Proteínas, Ácidos nucleicos Inorgánicos: Agua y Sales
minerales

6. TIPOS DE NUTRICIÓN
Por el tipo de nutrientes que las células incorporan distinguimos 2 tipos de nutrición: Nutrición
autótrofa Nutrición heterótrofa

Nutrición autótrofa
Nutrición que presentan aquellas células capaces de elaborar su propio alimento, es decir,
materia orgánica, a partir de la materia inorgánica (CO2 y agua) Son organismos autótrofos:
las plantas, las algas y algunas bacterias Dentro de la nutrición autótrofa podemos distinguir
dos tipos, según la fuente de energía utilizada:

Fotosíntesis. La energía procede de la luz solar. Organismos fotosintetizadores: las plantas y


algunas bacterias (bacterias verdes y purpureas).

Quimiosíntesis. La energía se obtiene de reacciones oxidativas exotérmicas. Organismos


quimiosintéticos. Algunas bacterias (nitrificantes, sulfobacterias, ferrobacterias).

57
FASE CERO 2018-I

Nutrición heterótrofa
Nutrición que presentan aquellos organismos que incorporan materia orgánica ya elaborada
por otros organismos. Son organismos heterótrofos: los animales, los hongos, la mayoría de
bacterias y los protozoos Dentro de la nutrición heterótrofa podemos distinguir los siguientes:
Saprofitismo. Se alimentan de materia orgánica en descomposición.
Parasitismo. Obtienen su alimenta a expensas de otro organismo.
Simbiosis. Obtención de beneficios mutuos de tipo nutritivo.
Biofagia. Se alimentan de seres vivos.
Necrofagia. Se alimentan de cadáveres o excrementos.

7. EL METABOLISMO

Del griego μεταβολή [metabolé], ‘cambio’, es el conjunto de reacciones bioquímicas y


procesos físico-químicos que ocurren en una célula y en el organismo. Los complejos
procesos interrelacionados son la base de la vida, a escala molecular, y permiten las diversas
actividades de las células: crecer, reproducirse, mantener sus estructuras, responder a
estímulos, etc.
El metabolismo se divide en dos procesos conjugados: catabolismo y anabolismo.
Las reacciones catabólicas liberan energía; un ejemplo es la glucólisis, un proceso de
degradación de compuestos como la glucosa, cuya reacción resulta en la liberación de la
energía retenida en sus enlaces químicos. Las reacciones anabólicas, en cambio, utilizan
esta energía liberada para recomponer enlaces químicos y construir componentes de las
células como lo son las proteínas y los ácidos nucléicos. El catabolismo y el anabolismo son
procesos acoplados que hacen al metabolismo en conjunto, puesto que cada uno depende
del otro.
La economía que la actividad celular impone sobre sus recursos obliga a organizar
estrictamente las reacciones químicas del metabolismo en vías o rutas metabólicas, donde un
compuesto químico (sustrato) es transformado en otro (producto), y este a su vez funciona
como sustrato para generar otro producto, siguiendo una secuencia de reacciones bajo la
intervención de diferentes enzimas (generalmente una para cada sustrato-reacción).
Las enzimas son cruciales en el metabolismo porque agilizan las reacciones físico-químicas,
pues hacen que posibles reacciones termodinámicas deseadas pero "no favorables",
mediante un acoplamiento, resulten en reacciones favorables. Las enzimas también se
comportan como factores reguladores de las vías metabólicas, modificando su funcionalidad
–y por ende, la actividad completa de la vía metabólica– en respuesta al ambiente y
necesidades de la célula, o según señales de otras células.

58
FASE CERO 2018-I

8. HOMEOSTASIS: REGULACIÓN Y CONTROL

Debido a que el ambiente de los organismos cambia constantemente, las reacciones


metabólicas son reguladas para mantener un conjunto de condiciones en la célula, una
condición denominada homeostasis. Esta regulación permite a los organismos responder a
estímulos e interaccionar con el ambiente. Para entender cómo son controladas las vías
metabólicas, existen dos conceptos vinculados. En primer lugar, la regulación de una enzima
en una ruta es cómo incrementa o disminuye su actividad en respuesta a señales o estímulos.
En segundo lugar, el control llevado a cabo por esta enzima viene dado por los efectos que,
dichos cambios de su actividad, tienen sobre la velocidad de la ruta (el flujo de la ruta). Por
ejemplo, una enzima muestra cambios en su actividad; pero si estos cambios tienen un efecto
mínimo en el flujo de la ruta metabólica, entonces esta enzima no se relaciona con el control
de la ruta.

Existen múltiples niveles para regular el metabolismo. En la regulación intrínseca, la ruta


metabólica se autorregula para responder a cambios en los niveles de sustratos o productos;
por ejemplo, una disminución en la cantidad de productos puede incrementar el flujo en la ruta
para compensarlo. Este tipo de regulación suele implicar una regulación alostérica de las
actividades de las distintas enzimas en la ruta. El control extrínseco implica a una célula en
un organismo pluricelular, cambiando su metabolismo en respuesta a señales de otras
células. Estas señales son enviadas generalmente en forma de mensajeros como
las hormonas, y los factores de crecimiento, que son detectados por receptores celulares
específicos en la superficie de la célula. Estas señales son transmitidas hacia el interior de la
célula mediante mensajeros secundarios que generalmente involucran la fosforilación de
proteínas.

9. RESPIRACIÓN CELULAR

La respiración celular es el conjunto de reacciones bioquímicas que ocurre en la mayoría de


las células, en las que el ácido pirúvico producido por la glucólisis se desdobla a dióxido de
carbono (CO2) y agua (H2O) y se producen 38 moléculas de ATP.

En las células eucariotas la respiración se realiza en las mitocondrias y ocurre en tres etapas
que son estos:
 Oxidación del ácido pirúvico.
 Ciclo de los ácidos tricarboxílicos (ciclo de Krebs)
 Cadena respiratoria y fosforilación oxidativa del ADP a ATP.

59
FASE CERO 2018-I

La respiración celular es una parte del metabolismo, concretamente del catabolismo, en la


cual la energía contenida en distintas biomoléculas, como los glúcidos, es liberada de manera
controlada. Durante la respiración una parte de la energía libre desprendida en estas
reacciones exotérmicas, es incorporada a la molécula de ATP, que puede ser a continuación
utilizado en los procesos endotérmicos, como son los de mantenimiento y desarrollo del
organismo (anabolismo).

La respiración celular podría dividirse en dos tipos, según el papel atribuido al oxígeno:
 Respiración aeróbica: Hace uso del O2 como aceptor último de los electrones
desprendidos de las sustancias orgánicas. Es la forma más extendida, propia de una
parte de las bacterias y de los organismos eucariontes, cuyas mitocondrias derivan de
aquéllas. Se llama aerobios a los organismos que, por este motivo, requieren O2.
 Respiración anaeróbica: No interviene el oxígeno, sino que se emplean otros
aceptores finales de electrones, muy variados, generalmente minerales y, a menudo,
subproductos del metabolismo de otros organismos. Un ejemplo de aceptor es el SO42-
(anión sulfato), que en el proceso queda reducido a H2S:

La respiración anaeróbica es propia de procariotas diversos, habitantes sobre todo de suelos


y sedimentos, y algunos de estos procesos son importantes en los ciclos biogeoquímicos de
los elementos. No debe confundirse la respiración anaerobia con la fermentación, que es una
oxidación-reducción interna a la molécula procesada, en la que no se requiere ni O2 ni ningún
otro aceptor de electrones.

9.1 La glucólisis (del griego glycos:azúcar y lysis:ruptura) o glicolisis


Es la vía metabólica encargada de oxidar o fermentar la glucosa y así obtener energía para la
célula. Ésta consiste de 10 reacciones enzimáticas que convierten a la glucosa en dos
moléculas de piruvato, la cual es capaz de seguir otras vías metabólicas y así continuar
entregando energía al organismo.1
Es la vía inicial del catabolismo (degradación) de carbohidratos, y tiene tres funciones
principales:
1. La generación de moléculas de alta energía (ATP y NADH) como fuente de energía
celular en procesos de respiración aeróbica (presencia de oxígeno) y anaeróbica
(ausencia de oxígeno).

60
FASE CERO 2018-I

2. La generación de Piruvato que pasará al Ciclo de krebs, como parte de la


respiración aeróbica.
3. La producción de intermediarios de 6 y 3 carbonos, los que pueden ser ocupados por
otros procesos celulares.
Cuando hay ausencia de oxígeno (anoxia o hipoxia), luego que la glucosa ha pasado por este
proceso, el piruvato sufre de fermentación, una segunda vía de adquisición de energía que,
al igual que la glucólisis, es poco eficiente. El tipo de compuesto obtenido de la fermentación
suele variar con el tipo de organismo. En los animales, el piruvato fermenta a lactato y en
levadura, el piruvato fermenta a etanol.
En eucariotas y procariotas, la glucólisis ocurre en el citosol de la célula. En células vegetales,
algunas de las reacciones glucolíticas se encuentran también en el ciclo de Calvin, que ocurre
dentro de los cloroplastos. La amplia conservación de esta vía incluye los organismos
filogenéticamente más antiguos, y por esto se considera una de las vías metabólicas más
antiguas.

61
FASE CERO 2018-I

El tipo de glucólisis más común y más conocida es la vía de Embden-Meyerhoff, explicada


inicialmente por Gustav Embden y Otto Meyerhof. El término puede incluir vías alternativas,
como la vía de Entner-Doudoroff. No obstante, Glucólisis será usada aquí como sinónimo
de la vía de Embden-Meyerhoff.

9.2 El ciclo de Krebs (también llamado ciclo del ácido cítrico o ciclo de los ácidos
tricarboxílicos)
Es una ruta metabólica, es decir, una sucesión de reacciones químicas, que forman parte de
la respiración celular en todas las células aerobias, es decir que utilizan oxígeno. En
organismos aeróbicos, el ciclo de Krebs es parte de la vía catabólica que realiza la oxidación
de hidratos de carbono, ácidos grasos y aminoácidos hasta producir CO2, liberando energía
en forma utilizable (poder reductor y GTP).
El metabolismo oxidativo de glúcidos, grasas y proteínas frecuentemente se divide en tres
etapas, de las cuales el ciclo de Krebs supone la segunda. En la primera etapa los carbonos
de estas macromoléculas dan lugar a moléculas de acetil-CoA de dos carbonos, e incluye las
vías catabólicas de aminoácidos (p. ej. desaminación oxidativa), la beta oxidación de ácidos
grasos y la glucolisis. La tercera etapa es la fosforilación oxidativa, en la cual el poder reductor
(NADH y FADH2) generado se emplea para la síntesis de ATP según la teoría del
acomplamiento quimiosmótico.

62
FASE CERO 2018-I

El ciclo de Krebs también proporciona precursores para muchas biomoléculas, como ciertos
aminoácidos. Por ello se considera una vía anfibólica, es decir, catabólica y anabólica al
mismo tiempo.

Reacciones del ciclo de Krebs


El ciclo de Krebs tiene lugar en la matriz mitocondrial en eucariotas y en el citoplasma de
procariotas.

El acetil-CoA (Acetil Coenzima A) es el principal precursor del ciclo. El ácido cítrico (6


carbonos) o citrato se regenera en cada ciclo por condensación de un acetil-CoA (2 carbonos)
con una molécula de oxaloacetato (4 carbonos). El citrato produce en cada ciclo una molécula
de oxaloacetato y dos CO2, por lo que el balance neto del ciclo es:
Acetil-CoA + 3 NAD+ + FAD + GDP + Pi + 3 H2O → CoA-SH + 3 (NADH + H+) + FADH2 + GTP
+ 2 CO2 + 3 H+

Los dos carbonos del Acetil-CoA son oxidados a CO2, y la energía que estaba acumulada es
liberada en forma de energía química: GTP y poder reductor (electrones de alto potencial):
NADH y FADH2. NADH y FADH2 son coenzimas (moléculas capaces de unirse a enzimas)
capaces de acumular la energía en forma de poder reductor para su conversión en energía
química en la fosforilación oxidativa.

La mayoría de las vías catabólicas convergen en el ciclo de Krebs. El ciclo de Krebs siempre
es seguido por la fosforilación oxidativa. Este proceso extrae la energía en forma de electrones
de alto potencial de las moléculas de NADH y FADH2, regenerando NAD+ and FAD, gracias a
lo cual el ciclo de Krebs puede continuar. Los electrones son transferidos a moléculas de O 2,
rindiendo H2O. Pero esta transferencia se realiza a través de una cadena transportadora de
electrones capaz de aprovechar la energía potencial de los electrones para bombear protones
al espacio intermembrana de la mitocondria. Esto genera un gradiente electroquímico de H+,
que es utilizado para la síntesis de ATP mediante la enzima ATP sintetasa. De este modo el
ciclo de Krebs no utiliza directamente O2, pero lo requiere al estar acoplado a la fosforilación
oxidativa.
Por cada molécula de glucosa la energía obtenida mediante el metabolismo oxidativo, es
decir, glucolisis seguida del ciclo de Krebs, equivale a 30/32 moléculas de ATP dependiendo
del tipo de lanzadera para introducir el poder reductor dentro de la mitocondria, si es la
lanzadera de malato-aspartato son 32 y si es la de glicerol 3 fosfato, son 30.

63
FASE CERO 2018-I

9.3 La cadena de transporte de electrones


Es una serie de transportadores de electrones que se encuentran en la membrana plasmática
de bacterias, en la membrana interna mitocondrial o en las membranas tilacoidales, que
median reacciones bioquímicas que producen adenosina trifosfato (ATP), que es el
compuesto energético que utilizan los seres vivos. Sólo dos fuentes de energía son utilizadas
por los organismos vivos: reacciones de oxido-reducción (redox) y la luz solar (fotosíntesis).
Los organismos que utilizan las reacciones redox para producir ATP se les conoce con el
nombre de quimiotrofos, mientras que los que utilizan la luz solar para tal evento se les conoce
por el nombre de fototrofos. Ambos tipos de organismos utilizan sus cadenas de transporte
de electrones para convertir la energía en ATP.

Conceptos generales
La misión de la cadena transportadora de electrones es la de crear un gradiente
electroquímico que se utiliza para la síntesis de ATP. Dicho gradiente electroquímico se
consigue mediante el flujo de electrones entre diversas sustancias de esta cadena que
favorecen en último caso la translocación de protones que generan el gradiente anteriormente
mencionado. De esta forma podemos deducir la existencia de tres procesos totalmente
dependientes:
 Un flujo de electrones desde sustancias individuales.
 Un uso de la energía desprendida de ese flujo de electrones que se utiliza para la
translocación de protones en contra de gradiente, por lo que energéticamente estamos
hablando de un proceso desfavorable.

64
FASE CERO 2018-I

 Un uso de ese gradiente electroquímico para la formación de ATP mediante un


proceso favorable desde un punto de vista energético.

Transportadores redox mitocondriales

El flujo de electrones global se esquematiza de la siguiente forma:

NADH → Complejo I → Q → Complejo III → Citocromo c → Complejo IV → O2



Complejo II

Complejo I
El "complejo I" o NADH deshidrogenasa o NADH:ubiquinona oxidoreductasa (EC 1.6.5.3)
capta dos electrones del NADH y los transfiere a un transportador liposoluble denominado
ubiquinona (Q). Durante este proceso, cuatro protones son translocados a través de la
membrana interna mitocondrial, desde la matriz hacia el espacio intermembrana.
Complejo II
El "Complejo II" o Succinato deshidrogenasa; EC 1.3.5.1 no es un bomba de protones.
Además es el único enzima del ciclo de Krebs asociado a membrana. Este complejo dona
electrones a la ubiquinona desde el succinato y los transfiere vía FAD a la ubiquinona.
Complejo III [
El "complejo III" o Complejo citocromo bc1; EC 1.10.2.2, obtiene dos electrones desde QH2 y
se los transfiere a dos moléculas de citocromo c, que es un transportador de electrones
hidrosoluble que se encuentra en el espacio intermembrana de la mitocondria. Al mismo
tiempo, transloca dos protones a través de la membrana por los dos electrones transportados
desde el ubiquinol.

65
FASE CERO 2018-I

Complejo IV]
El complejo IV o Citocromo c oxidasa; EC 1.9.3.1 capta cuatro electrones de la cuatro
moléculas de citocromo c y se transfieren al oxígeno (O2), para producir dos moléculas de
agua (H2O). Al mismo tiempo se translocan cuatro protones al espacio intermembrana, por los
cuatro electrones. Además "desaparecen" de la matriz 4 protones que forman parte del H2O.

9.4 Acoplamiento con la fosforilización oxidativa


La hipótesis del acoplamiento quimiosmótico, lo que el valió el premio Nobel de química a
Peter D. Mitchell, explica que la cadena de transporte de electrones y la fosforilación oxidativa
están acopladas por el gradiente de protones. El eflujo de protones crea un gradiente de pH
y un gradiente electroquímico. Este gradiente de protones es usado por la ATP sintasa para
formar ATP vía la fosforilación oxidativa. La ATP sintasa actúa como un canal de iones que
"devuelve" los protones a la matriz mitocondrial. Durante esta vuelta, la energía libre de Gibbs
producida durante la generación de las formas oxidadas de los transportadores de electrones
es liberada. Esta energía es utilizada por la síntesis de ATP, catalizada por el componente F1
del complejo FOF1 ATP sintasa
El acoplamiento con la fosforilación oxidativa es un paso clave en la producción de ATP. Sin
embargo, en ciertas ocasiones desacoplarlo puede tener usos biológicos. En la membrana
interna mitocondrial de los tejidos adiposos marrones existe una gran cantidad de
termogenina, que es una proteína desacopladora, que actúa como una vía alternativa para el
regreso de los protones a la matriz. Esto resulta en consumo de la energía en termogénesis
en vez de utilizarse para la producción de ATP. Esto puede ser útil para generar calor cuando
sea necesario, por ejemplo en invierno o durante la hibernación de ciertos animales.
También se conocen desacoplantes sintéticos como el caso del 2,4-dinitrofenol, que se ha
usado como pesticida, debido a su alta toxicidad.

Resumen
La cadena de transporte de electrones mitocondrial utiliza electrones desde un donador ya
sea NADH o FADH 2 y los pasa a un aceptor de electrones final, como el O2, mediante una
serie de reacciones redox. Estas reacciones están acopladas a la creación de un gradiente
de protones generado por los complejos I, III y IV. Dicho gradiente es utilizado para generar
ATP mediante la ATP sintasa.

10. LA FOTOSÍNTESIS

Del griego antiguo φωτο (foto) "luz" y σύνθεσις (síntesis) "unión". Es la base de la vida actual
en la Tierra. Proceso mediante el cual las plantas, algas y algunas bacterias captan y utilizan

66
FASE CERO 2018-I

la energía de la luz para transformar la materia inorgánica de su medio externo en


materia orgánica que utilizarán para su crecimiento y desarrollo.
Los organismos capaces de llevar a cabo este proceso se denominan fotoautótrofos y además
son capaces de fijar el CO2 atmosférico (lo que ocurre casi siempre) o simplemente autótrofos.
Salvo en algunas bacterias, en el proceso de fotosíntesis se producen liberación de oxígeno
molecular (proveniente de moléculas de H2O) hacia la atmósfera (fotosíntesis oxigénica). Es
ampliamente admitido que el contenido actual de oxígeno en la atmósfera se ha generado a
partir de la aparición y actividad de dichos organismos fotosintéticos. Esto ha permitido la
aparición evolutiva y el desarrollo de organismos aerobios capaces de mantener una alta tasa
metabólica (el metabolismo aerobio es muy eficaz desde el punto de vista energético).
La otra modalidad de fotosíntesis, la fotosíntesis anoxigénica, en la cual no se libera oxígeno,
es llevada a cabo por un número reducido de bacterias, como las bacterias púrpuras del azufre
y las bacterias verdes del azufre; estas bacterias usan como donador de hidrógenos el H2S,
con lo que liberan azufre.

Fase fotoquímica
La energía luminosa que absorbe la clorofila se transmite a los electrones externos de la
molécula, los cuales escapan de la misma y producen una especie de corriente eléctrica en
el interior del cloroplasto al incorporarse a la cadena de transporte de electrones. Esta energía
puede ser empleada en la síntesis de ATP mediante la fotofosforilación, y en la síntesis de
NADPH. Ambos compuestos son necesarios para la siguiente fase o Ciclo de Calvin, donde

67
FASE CERO 2018-I

se sintetizarán los primeros azúcares que servirán para la producción de sacarosa y


almidón. Los electrones que ceden las clorofilas son repuestos mediante la oxidación del H2O,
proceso en el cual se genera el O2 que las plantas liberan a la atmósfera.
Existen dos variantes de fotofosforilación: acíclica y cíclica, según el tránsito que sigan los
electrones a través de los fotosistemas. Las consecuencias de seguir un tipo u otro estriban
principalmente en la producción o no de NADPH y en la liberación o no de O2.

Fotofosforilación acíclica
Este proceso permite la formación de ATP y la reducción de NADP+ a NADPH + H+, y necesita
de la energía de la luz, como ya se ha dicho. Se realiza gracias a los llamados fotosistemas,
que se encuentran en la membrana de los tilacoides (en los cloroplastos). Estos están
formados por dos partes:
 Antena, donde se agrupan los pigmentos antena, junto con proteínas, y cuya función
es captar la energía de los fotones para transmitirla al pigmento diana; y el centro de
reacción. Este está formado por proteínas y por pigmentos, encontrándose en él el
llamado pigmento diana, que es aquel que recibe la energía de excitación de la
antena, energía que sirve para excitar y liberar electrones. Aquí también se encuentra
el primer dador de electrones, que repone los electrones al pigmento diana,
 Primer aceptor, que recibe los electrones liberados.
Hay dos tipos de fotosistemas:
 Fotosistema I, que se encuentra sobre todo en los tilacoides de estroma, y cuyo
pigmento diana es la clorofila P700.
 Fotosistema II, que se encuentra sobre todo en los grana y cuyo pigmento diana es
la clorofila P680.
Proceso
El proceso de la fase luminosa, supuesto para dos electrones, es el siguiente: Los fotones
inciden sobre el fotosistema II, excitando y liberando dos electrones, que pasan al primer
aceptor de electrones, la feofitina. Los electrones los repone el primer dador de electrones, el
dador Z, con los electrones procedentes de la fotólisis del agua en el interior del tilacoide (la
molécula de agua se divide en 2H+ + 2e- + 1/2O2). Los protones de la fotólisis se acumulan en
el interior del tilacoide, y el oxígeno es liberado.
Los electrones pasan a una cadena de transporte de electrones, que invertirá su energía
liberada en la síntesis de ATP. ¿Cómo? La teoría quimioosmótica nos lo explica de la siguiente
manera: los electrones son cedidos a las plastoquinonas, las cuales captan también dos
protones del estroma. Los electrones y los protones pasan al complejo de citocromos bf, que
bombea los protones al interior del tilacoide. Se consigue así una gran concentración de
protones en el tilacoide (entre éstos y los resultantes de la fotólisis del agua), que se compensa

68
FASE CERO 2018-I

regresando al estroma a través de las proteínas ATP-sintasas, que invierten la energía


del paso de los protones en sintetizar ATP. La síntesis de ATP en la fase fotoquímica se
denomina fotofosforilación.

Los electrones de los citocromos pasan a la plastocianina, que los cede a su vez al fotosistema
I. Con la energía de la luz, los electrones son de nuevo liberados y captados por el aceptor
A0. De ahí pasan a través de una serie de filoquinonas hasta llegar a la ferredoxina. Ésta
molécula los cede a la enzima NADP+-reductasa, que capta también dos protones del
estroma. Con los dos protones y los dos electrones, reduce un NADP+ en NADPH + H+.
El balance final es: por cada molécula de agua (y por cada cuatro fotones) se forman media
molécula de oxígeno, 1,3 moléculas de ATP, y un NADPH + H+.

Fotofosforilación cíclica
Tiene lugar al mismo tiempo que la acíclica. En ella sólo interviene el fotosistema I. Los
electrones liberados, después de llegar a la ferredoxina, pasan a las plastoquinonas, y siguen
la cadena de transporte de electrones hasta regresar a la plastocianina y al fotosistema I. Por
tanto, se genera ATP en lugar de NADPH. Sirve para compensar el hecho de que en la
fotofosforilación acíclica no se genera suficiente ATP para la fase oscura.

69
FASE CERO 2018-I

Fase bioquímica o ciclo de Calvin: biosíntesis orgánica


La fase bioquímica o ciclo de Calvin o ciclo reductivo de las pentosas-fosfato consiste en un
ciclo de reacciones químicas en las que se incorpora el CO2 de la atmósfera en moléculas
orgánicas, y se originan triosas fosfato, los primeros azúcares previos a la formación de
sacarosa y almidón. Durante este ciclo se emplean el ATP y el NADPH producidos en la etapa
fotoquímica. Se divide en tres etapas: carboxilación, reducción y regeneración.

Este ciclo comienza con una pentosa, la ribulosa-1,5-fosfato, que se carboxila con el CO2, y
se descompone en dos moléculas de ácido-3-fosfoglicérico. Con el gasto de un ATP, el ácido-
3-fosfoglicérico se fosforila en ácido-1,3-bifosfoglicérico. Éste se reduce con el NADPH, y se
libera una molécula de ácido fosfórico, formándose el gliceraldehido-3-fosfato. La molécula
formada puede seguir ahora dos vías: una es dar lugar a más ribulosa-1,5-fosfato para seguir
el ciclo, y la otra es dar lugar a los distintos principios inmediatos: glucosa o fructosa, almidón
y a partir de ellos los demás glúcidos, y los lípidos, proteínas y nucleótidos que requiere la
célula.

70
FASE CERO 2018-I

Hay que destacar que tanto la fase fotoquímica como la fase biosintética se producen a la
vez. Son inseparables, ya que los productos de la fase fotoquímica son empleados en la fase
biosintética. Por otro lado al consumir en la fase biosintética el ATP y NADPH se obtienen
ADP y NADP+ para la fase fotoquímica. Para asegurar que ambas fases se produzcan a la
vez existe una fuerte fotorregulación sobre las enzimas del ciclo de Calvin para que estén
activas por el día e inactivas por la noche, en especial sobre la enzima rubisco. No obstante
existe una variante de fotosíntesis presente en ciertas plantas que permite separar la fijación
del CO2 de la fase fotoquímica. Se trata de la fotosíntesis tipo CAM, empleada por plantas
adaptadas a climas desérticos, para evitar que se abran los estomas por el día para fijar el
CO2, con la consiguiente pérdida de agua.

AUTOEVALUACIÓN
1) Señale el concepto de nutrición, alimentación y digestión.
2) Indique en que consiste la nutrición autótrofa y quienes pueden realizarla.
3) Indique cuales son los mecanismos que ayudan al mantenimiento de la homeostasis.
4) Señale cuales son las etapas y sub etapas de la fotosíntesis
5) Indique cuales son los componentes de la cadena transportadora de electrones.
6) Señale cuales son las etapas de la respiración y su papel en el proceso.

71
FASE CERO 2018-I

TEMA 7: EL GENOMA

Es el conjunto de genes contenidos en los cromosomas,lo que puede interpretarse como la


totalidad de la información genética que posee un organismo o una especie en particular. El
genoma en los seres eucarióticos comprende el ADN contenido en el núcleo, organizado en
cromosomas, y el genoma de orgánulos celulares como las mitocondrias y los plastos; en los
seres procarióticos comprende el ADN de su nucleoide. El término fue acuñado en 1920 por
Hans Winkler, profesor de Botánica en la Universidad de Hamburgo, Alemania, como un
acrónimo de las palabras 'gene' y 'cromosoma'.
Los organismos diploides tienen dos copias del genoma en sus células, debido a la presencia
de pares de cromosomas homólogos. Los organismos o células haploides solo contienen una
copia. También existen organismos poliploides, con grupos de cromosomas homólogos.
La secuenciación del genoma de una especie no analiza la diversidad genética o el
polimorfismo de los genes. Para estudiar las variaciones de un gen se requiere la comparación
entre individuos mediante el genotipado.

En biología molecular y genética, el genoma es la totalidad de la información hereditaria de


un organismo. Está codificado en las moléculas de ADN. El contenido total de ADN en una
célula única se conoce como el ‘genoma’ del organismo, pero algunos organismos tienen sólo
ARN por lo que su genoma es la cantidad total de contenido de ARN.

De lo antes dicho se deduce que el genoma incluye tanto el ADN como el ARN. Por esta
razón, el genoma forma parte incluso de elementos genéticos no cromosómicas como virus,
plásmidos…El contenido total de ADN en el núcleo de una célula se denomina ‘genoma
nuclear’ y el contenido total de ADN en la mitocondria se llama ‘genoma mitocondrial’.
El estudio del genoma y las características relacionadas con los organismos se llama
Genómica. La evolución de los genomas puede ser estudiada e identificada por su
composición, que incluye tamaño, proporción, ADN repetitivo y no repetitivo.

Cantidad de información
El genoma de los seres vivos contiene una cantidad enorme de información. Nota: El ADN de
una simple célula tiene una longitud aproximada de 1,8A.

Las investigaciones llevadas a cabo hasta ahora sugieren que la complejidad del genoma
humano no radica ya en el número de genes, sino en cómo parte de estos genes se usan
para construir diferentes productos en un proceso que es llamado empalme alternativo

72
FASE CERO 2018-I

(alternative splicing). Otra importante razón de esta complejidad radica en el hecho de


que existan miles de modificaciones químicas para fabricar proteínas así como del repertorio
de mecanismos que regulan este proceso.

Tabla que muestra el tamaño aproximado de algunas especies

Campos de aplicación de la investigación genómica


 En medicina, se utilizan las pruebas genéticas para el diagnóstico de enfermedades,
la confirmación diagnostica, la información del pronóstico así como del curso de la
enfermedad, para confirmar la presencia de enfermedad en pacientes asintomáticos y, con
variados grados de certeza, para predecir el riesgo de enfermedades futuras en personas
sanas y en su descendencia. La información sobre el genoma también se puede usar para el
estudio de susceptibilidad a las enfermedades. . Existe la posibilidad de desarrollo de técnicas
o para tratar enfermedades hereditarias. El procedimiento implica reemplazar, manipular o
suplementar los genes no funcionales con genes funcionales. En esencia, la terapia génica
es la introducción de genes en el ADN de una persona para tratar enfermedades. La posible
creación de fármacos a medida del enfermo terapia génica y farmacogenómica.

LOS CROMOSOMAS

En biología y citogenética, se denomina cromosoma (del griego χρώμα, -τος chroma, color y
σώμα, -τος soma, cuerpo o elemento) a cada una de las estructuras altamente organizadas,
formadas por ADN y proteínas, que contiene la mayor parte de la información genética de un
individuo.

73
FASE CERO 2018-I

En las divisiones celulares (mitosis y meiosis) presenta su forma más conocida, cuerpos
bien delineados en forma de X, debido al grado de compactación y duplicación.
En la interfase no pueden ser visualizados mediante el microscopio óptico de manera nítida
ya que ocupan territorios cromosómicos discretos. En las células eucariotas y en las arqueas
(a diferencia que en las bacterias), el ADN siempre se encontrará en forma de cromatina, es
decir asociado fuertemente a unas proteínas denominadas histonas y no-histonas. La
cromatina, organizada en cromosomas, se encuentra en el núcleo de las células eucariotas y
se visualiza como una maraña de hebras delgadas. Cuando comienza el proceso de
duplicación y división del material genético llamado (cariocinesis), esa maraña de hebras inicia
un fenómeno de condensación progresivo que permite visualizar cada uno de los
cromosomas.

Diagrama esquemático de un cromosoma eucariótico ya duplicado y condensado (en


metafase mitótica). (1) Cromátida, cada una de las partes idénticas de un cromosoma luego
de la duplicación del ADN. (2) Centrómero, el lugar del cromosoma en el cual ambas
cromátidas se tocan. (3) Brazo corto. (4) Brazo largo.
Cuando se examinan con detalle durante la mitosis, se observa que cada uno de los
cromosomas presenta una forma y un tamaño característicos.
Cada cromosoma tiene una región condensada, o constreñida, llamada centrómero, que
confiere la apariencia particular a cada cromosoma y que permite clasificarlos según la
posición del centrómero a lo largo del cromosoma.
Otra observación que se puede realizar es que el número de cromosomas de los individuos
de la misma especie es constante. Esta cantidad de cromosomas se denomina número o
Ploidía y se simboliza como 2n o 4n o 1n dependiendo del tipo de célula.
Cuando se examina la longitud de tales cromosomas y la situación del centrómero surge el
segundo rasgo general: para cada cromosoma con una longitud y una posición del centrómero
determinada existe en el núcleo otro cromosoma con características idénticas, o sea, en las

74
FASE CERO 2018-I

células diploides 2n los cromosomas se encuentran formando pares. Los miembros


de cada par se denominan cromosomas homólogos.

Mapa citogenético o cariograma de una niña antes de nacer, resultado de una amniocentesis.

En la figura de la derecha se presentan todos los cromosomas de interfase de una niña


(obsérvese los dos cromosomas X abajo derecha), ordenados por parejas de homólogos y
por su longitud, lo que se denomina cariotipo. Puede observarse que en este cariotipo hay 46
cromosomas (o sea, 2n=46) que es el número cromosómico de la especie humana. Se puede
advertir, también, que los cromosomas homólogos aquí han sido colocados paralelos entre sí
y no están unidos por un único centrómero. Durante la mitosis cada uno de los cromosomas
homólogos se duplica y entonces las cromátidas hermanas ya duplicadas se separan una de
otra hacia dos nuevas células.
Las parejas de cromosomas homólogos que se observan en la imagen tienen, además, una
semejanza genética fundamental: presentan los mismos genes situados en los mismos
lugares a lo largo del cromosoma (tales lugares se denominan locus o loci en plural). Esto
indica que cada miembro del par de homólogos lleva información genética para las mismas
características del organismo. En organismos con reproducción sexual, uno de los miembros
del par de cromosomas homólogos proviene de la madre (a través del óvulo) y el otro del
padre (a través del espermatozoide). Por ello, y como consecuencia de la herencia biparental,
cada organismo diploide tiene dos copias de cada uno de los genes, cada una ubicada en uno
de los cromosomas homólogos.
Una excepción importante al concepto de parejas de cromosomas homólogos es que en
muchas especies los miembros de la pareja de los cromosomas sexuales, no tienen el mismo
tamaño, ni igual situación del centrómero, ni la misma proporción entre los brazos o, incluso,
no tienen los mismos loci. Por ejemplo, el cromosoma Y (que determina el sexo masculino en
humanos) es de menor tamaño y carece de la mayoría de los loci que se encuentran en el
cromosoma X.

75
FASE CERO 2018-I

Estructura y composición química de la cromatina


Los cromosomas eucarióticos son moléculas muy largas de ADN de doble hélice que están
estrechamente relacionadas con proteínas llamadas histonas y proteínas llamadas no
histonas. Los cromosomas se pueden hallar desde estados laxos o poco compactados, como
en los núcleos de las células en interfase, hasta en estados altamente compactados, como
sucede en la metafase mitótica.
Los principales componentes que se obtienen cuando se aísla la cromatina de los núcleos
interfásicos son el ADN, las proteínas histónicas, las proteínas no histónicas y el ARN.

Las histonas
Las histonas son proteínas básicas, ricas en residuos de lisina y arginina, que muestran una
elevada conservación evolutiva y que interaccionan con el ADN formando una subunidad que
se repite a lo largo de la cromatina denominada nucleosoma. Los principales tipos de histonas
que se han aislado en los núcleos interfásicos en diferentes especies eucariontes son: H1,
H2A, H2B, H3 y H4. Además de estas histonas, también existen otras que son específicas de
tejido como la histona H5 muy rica en lisina (25 moles%) específica de eritrocitos nucleados
de vertebrados no mamíferos, y las histonas del endosperma. Asimismo, la cromatina
centromérica se caracteriza por la presencia de una isoforma específica de la histona H3,
denominada CENP-A en vertebrados.
Una de las características más destacables es su elevado conservadurismo evolutivo, sobre
todo de las histonas H3 y H4. La histona H4 de guisante y de timo de ternera se diferencian
solamente en dos aminoácidos. Este dato indica que las interacciones entre el ADN y las
histonas para formar la cromatina deben ser muy semejantes en todos los organismos
eucariontes.
Los genes que codifican las histonas se encuentran agrupados en nichos (o clusters) que se
repiten decenas o centenas de veces. Cada clúster o grupo contiene el siguiente orden de

76
FASE CERO 2018-I

genes que codifican histonas: H1-H2A-H3-H2B-H4. Estos genes son ricos en pares G-
C, ya que codifican proteínas con un elevado contenido en lisina y arginina, pero están
separados por secuencias espaciadoras ricas en pares A-T.
El nucleosoma

La cromatina de núcleos en interfase, cuando se observa mediante técnicas de microscopia


electrónica, se puede describir como un collar de cuentas o un rosario, en el que cada cuenta
es una subunidad esférica o globular que se denomina nucleosoma; los nucleosomas se
hallan unidos entre sí mediante fibras de ADN. Se sigue, entonces, que la unidad básica de
la estructura de la cromatina es el nucleosoma. Un nucleosoma típico está asociado a 200
pares de bases (pb) de ADN y está formado por una médula (core en inglés) y un ligador (o
linker). La médula está formada por un octámero constituido por dos subunidades de las
histonas H2A, H2B, H3 y H4. En otras palabras, se trata de un dímero: 2×(H2A, H2B, H3, H4).
Los trabajos de Aaron Klug y colaboradores sobre la disposición de las histonas en la médula
del nucleosoma le valieron el Premio Nobel de Química en 1982. Alrededor de la médula se
enrolla el ADN (140 pb) dando casi dos vueltas (una vuelta y tres cuartos). El resto del ADN
(60 pb) forma parte del ligador (linker), que interacciona con la histona H1. La cantidad de
ADN asociado con un nucleosoma varía de una especie a otra, de 154 pb a 241 pb; esta
variación se debe fundamentalmente a la cantidad de ADN asociada al ligador (linker). Las
fibras de ADN dúplex desnudo tienen un grosor de 20 Å. La asociación del ADN con las
histonas genera los nucleosomas, que muestran unos 100 Å de diámetro. A su vez, los
nucleosomas se pueden enrollar helicoidalmente para formar un solenoide (una especie de
muelle) que constituye las fibras de cromatina de los núcleos intefásicos con un diámetro
aproximado de 300 Å. Los solenoides pueden volverse a enrollar para dar lugar a
supersolenoides con un diámetro de 4 000 Å a 6 000 Å que constituirían las fibras de los
cromosomas metafásicos.

77
FASE CERO 2018-I

Proteínas cromosómicas no histónicas: el armazón proteico


Las proteínas cromosómicas no histónicas son proteínas diferentes de las histonas que se
extraen de la cromatina de los núcleos con cloruro sódico (NaCl) 0.35 mol/L (disolución salina),
tienen un alto contenido en aminoácidos básicos (25 % o más), alto contenido en aminoácidos
ácidos (20-30 %), una elevada proporción de prolina (7 %), bajo contenido en aminoácidos
hidrofóbicos y una alta movilidad electroforética. Las proteínas cromosómicas no histónicas
que se extraen de la cromatina de los núcleos varían mucho dependiendo de la técnica de
aislamiento empleada. Un grupo de estas proteínas cromosómicas no histónicas presentan
alta movilidad electrofóretica y se denominan abreviadamente HMG (grupo de alta movilidad).
La cantidad de proteínas no histónicas puede variar de unos tejidos a otros en el mismo
individuo y dentro del mismo tejido a lo largo del desarrollo.

Fig. : El armazón proteico de los cromosomas


Nucleosoma. Primer nivel de compactación de la cromatina. La doble hélice del ADN se ve
violeta. Las Histonas se ven coloreadas en el centro: H2A amarillo, H2B rojo, H3 Azul y H4
verde. La definición de esta estructura se realizó con técnicas de cristalografía con una
resolución de 2,5 Ångström
Muchos estudios citogenéticos muestran que el ADN está intensamente enrollado, en los
cromosomas, cuando se observa al microscopio. El primer nivel de compactación lineal del
ADN es el obtenido por el plegamiento de la fibra del ADN alrededor de los nucleosomas
responsable del primer nivel de plegamiento lineal (de 6 a 7 veces). El siguiente nivel de
plegamiento corresponde a la denominada "fibra de 30 nm", que es lo que se observa en
núcleos en interfase. Aunque ha habido mucha controversia para describir esta estructura, la
fibra de 30 nm se considera normalmente como el enrollamiento helicoidal de las fibras de
nucleosomas, que genera la compactación de otras 6-7 veces. En mitosis, la fibra de 30 nm
debe compactarse otras 200-500 veces hasta alcanzar el diámetro observado al microscopio
para las fibras cromosómicas durante la división celular (~700 nm). Por tanto, se han tenido
que producir nuevos superenrollamientos. Sin embargo, la explicación de estos plegamientos
de orden superior ha generado gran controversiaLaemmli y colaboradores en 1977

78
FASE CERO 2018-I

consiguieron aislar cromosomas metafásicos desprovistos de histonas mediante un


tratamiento con sulfato de dextrano y heparina Estos cromosomas metafásicos desprovistos
de histonas presentan una médula central densamente teñida que ha sido denominada
scaffold (armazón). Este armazón proteico (scaffold) es resistente a la acción de la ADNasa,
ARNasa y también a soluciones de ClNa 2M. Sin embargo, desaparece por tratamientos con
urea 4M y dodecil sulfato sódico o por tratamiento con enzimas proteolíticas. Por tanto, se
trata de un armazón proteico.
La observación a microscopía electrónica pone de manifiesto que de este armazón proteico
(scaffold) salen y llegan lazos o fibras que pueden hacerse desaparecer mediante tratamiento
con ADNasa. Por tanto, estos lazos o dominios que arrancan del armazón proteico son lazos
de ADN. Uno de los principales componentes del armazón proteico es la enzima
topoisomerasa II α (topoIIα), una enzima que produce cortes en el ADN dúplex a nivel de
ambas hélices. La topoisomerasa II (girasa) interviene durante la replicación del ADN creando
o relajando los superenrollamientos. En mamíferos se encuentran dos isoformas de esta
enzima (α y ß), con propiedades similares in vitro. Sin embargo, aunque topoIIα y β se
comportan in vivo de forma similar en interfase, en mitosis tienen un comportamiento diferente:
sólo topoIIα está asociado mayoritariamente a los cromosomas. La aparición de la
topoisomerasa II α sólo en el armazón proteico sugiere que se encuentra en la base de los
lazos o dominios de ADN, indicando que esta organización en dominios podría estar
relacionada con la replicación y transcripción. Otras enzimas, como la topoisomerasa I que
produce cortes en el ADN dúplex a nivel de una sola hélice y la HMG-17, se encuentran sólo
en los lazos o dominios y no en el armazón proteico. La evidencia existente hasta el momento
sugiere que las fibras de solenoides (30 nm) formarían los lazos o dominios que emanan del
armazón proteico y que este armazón estaría a su vez enrollado formando una espiral
Además de la enzima topoisomerasa II α, el otro componente fundamental propuesto del
armazón proteico es la condensina 13S. La tinción doble con anticuerpos contra topoIIα y
condensina genera un armazón con aspecto de un "polo de barbero" (un cilindro con bandas
espirales rojas y blancas que simboliza la antigua doble profesión de los barberos como
cirujanos), en la cual alternan "cuentas" enriquecidas en topoIIα y en condensina. Esta
estructura parece estar generada por dos cadenas yuxtapuestas. Parece ser que el
ensamblaje de este armazón proteico tiene lugar en dos fases, ya que la condensina sólo se
asocia en la transición de profase a metafase durante la mitosis. Sin embargo, el papel
estructural de la topoIIα en la organización de los cromosomas aún se discute, ya que otros
grupos argumentan que esta enzima se intercambia rápidamente tanto en los brazos
cromosómicos como en los cinetocoros durante la mitosis. Los dominios de ADN parecen
estar unidos al armazón proteico por unas regiones específicas denominadas abreviadamente
SAR (scaffold associated regions, también denominadas MAR, matrix attachment regions)

79
FASE CERO 2018-I

que se detectan cuando los cromosomas metafásicos desprovistos de histonas se


tratan con endonucleasas de restricción Después de este tratamiento quedan regiones de
ADN unidas al armazón que a su vez resisten la digestión con exonucleasas gracias a que
están protegidas por una proteína. Cuando se digiere esta proteína, las regiones de ADN
protegidas contienen secuencias de varios cientos de pares de bases que son muy ricas en
AT y que presentan sitios de unión para topoisomerasa II e histona H1. Estas regiones de
unión específicas de los dominios al armazón proteico son las regiones SAR. Se ha sugerido
que estas regiones juegan un papel global durante la condensación de los cromosomas
mitóticos y son necesarias para el mantenimiento de la estructura de los cromosomas. Las
regiones SAR también podrían estar implicadas en la expresión génica, al facilitar tanto la
transición como la expansión de una estructura abierta de la cromatina.

En la especie humana, todos los cromosomas X que están en exceso de uno aparecen más
intensamente teñido que el resto de los cromosomas (heteropicnosis positiva) en los núcleos
de células en interfase. Por tanto, las mujeres normales que tienen dos cromosomas X, tienen
un cromosoma X que aparece más intensamente teñido y que está inactivado. Sin embargo,
durante las primeras etapas del desarrollo embrionario (durante los 16 primeros días de
gestación en la especie humana) ambos cromosomas X son activos.
En algunas especies eucariontes, el ADN satélite o ADN minoritario que presenta un
contenido en G+C distinto al ADN principal o mayoritario, está constituido por unas secuencias
cortas de ADN que están repetidas millones de veces. En concreto en ratón se ha demostrado
que el ADN satélite está localizado en la zona centrómerica. Este ADN satélite constituye un
ejemplo de heterocromatina constitutiva cuya presencia y acción es constante en el
cromosoma

Elementos diferenciados en la estructura cromosómica


La organización de la cromatina no es uniforme a lo largo de la estructura del cromosoma. De
hecho, se pueden distinguir una serie de elementos diferenciados: los centrómeros (o
constricciones primarias), los telómeros (o extremos cromosómicos), las regiones
organizadoras del nucléolo (NORs según la abreviatura en inglés) y los cromómeros, todos
ellos caracterizados por contener secuencias específicas de ADN.

Centrómeros
El centrómero es la constricción primaria que utilizando tinciones tradicionales aparece
menos teñida que el resto del cromosoma. Es la zona por la que el cromosoma interacciona
con las fibras del huso acromático desde profase hasta anafase, tanto en mitosis como en
meiosis, y es responsable de realizar y regular los movimientos cromosómicos que tienen

80
FASE CERO 2018-I

lugar durante estas fases. Las estructuras centroméricas que interaccionan con las
fibras del huso se denominan cinetocoros. Además, el centrómero contribuye a la nucleación
de la cohesión de las cromátidas hermanas. En la estructura del centrómero intervienen tanto
el ADN centromérico, que consta fundamentalmente de heterocromatina constitutiva, como
proteínas centroméricas.

Telómeros

Cromosomas humanos (en gris) y sus telómeros (en blanco).


La palabra telómero procede del griego telos, "final" y meros, "parte". Los telómeros son los
extremos de los cromosomas. Son regiones de ADN no codificante, altamente repetitivas,
cuya función principal es la estabilidad estructural de los cromosomas en las células
eucariotas, la división celular y el tiempo de vida de las estirpes celulares. Además están
involucradas en enfermedades tan importantes como el cáncer. En los organismos
procariotas, los cromosomas son circulares y no poseen telómeros. Los telómeros fueron
descubiertos por Hermann Joseph Muller durante la década de 1930. Desde entonces, se ha
avanzado mucho en el conocimiento de los telómeros, gracias a las técnicas de la genética
molecular.
Algunas secuencias conocidas de telómeros

Secuencia del telómero (Dirección 5'a 3'


Grupo Organismo
hasta el fin)

Humanos, ratón, Xenopus,


Vertebrados TTAGGG
Danio rerio

Hongos
Neurospora crassa TTAGGG
filamentosos

81
FASE CERO 2018-I

Physarum, Didymium TTAGGG


Mohos del fango
Dictyostelium AG(1-8)

Protozoos
Trypanosoma, Crithidia TTAGGG
cinetoplástidos

Tetrahymena, Glaucoma
TTGGGG
Protozoos Paramecium
TTGGG(T/G)
ciliados Oxytricha, Stylonychia,
TTTTGGGG
Euplotes

Protozoos
Plasmodium TTAGGG(T/C)
apicomplexa

Plantas
Arabidopsis thaliana TTTAGGG
superiores

Algas verdes Chlamydomonas TTTTAGGG

Insectos Bombyx mori TTAGG

Ascáridos Ascaris lumbricoides TTAGGC

Levaduras Schizosaccharomyces
TTAC (A)(C) G(1-8)
aisladas pombe

TGTGGGTGTGGTG (de copias de ARN)


Saccharomyces cerevisiae
or G(2-3)(TG)(1-6)T (consenso)
Candida glabrata
GGGGTCTGGGTGCTG
Candida albicans
GGTGTACGGATGTCTAACTTCTT
Levaduras Candida tropicalis
GGTGTA[C/A]GGATGTCACGATCATT
agregadas Candida maltosa
GGTGTACGGATGCAGACTCGCTT
Candida guillermondii
GGTGTAC
Candida pseudotropicalis
GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis
GGTGTACGGATTTGATTAGGTATGT

Regiones organizadoras del nucléolo


Además de las constricciones primarias, en algunos cromosomas se puede distinguir otro tipo
de "adelgazamiento" denominada constricción secundaria, las que se hallan relacionadas
normalmente con la presencia de las secuencias de ADN ribosómico. Tales regiones se
denominan "regiones organizadoras del nucléolo" (o, sencillamente, "NOR" por el acrónimo
en inglés para nucleolus organizer regions). Las secuencias de ADN ribosómico quedan
englobadas dentro del nucléolo, que permanece adosado a las NOR durante buena parte del

82
FASE CERO 2018-I

ciclo celular. Los cromosomas portadores de NOR en muchos casos presentan un


segmento que une a esta región con el telómero, el cual se denomina satélite o trabante.

Estructura externa de los cromosomas: número, forma y tamaño


El estudio de la estructura externa de los cromosomas de cualquier especie eucariótica
consiste en analizar la forma, tamaño y número de los cromosomas que posee. El mejor
momento para llevar a cabo dicho estudio suele ser aquel en el que los cromosomas han
alcanzado su máximo grado de contracción y tienen sus bordes perfectamente definidos.
Dicho momento suele ser la metafase mitótica. El estudio de la estructura externa de los
cromosomas culmina con la obtención del cariotipo. Los cromosomas se pueden estudiar en
distintos momentos según la especie y dependiendo de los objetivos planteados. Algunas
especies tienen cromosomas que se pueden observar con gran detalle en interfase, tal es el
caso de Drosophila melanogaster, que posee cromosomas politénicos gigantes que se
observan en las glándulas salivales de dicho insecto, y el de Chironomus tentans, otro díptero.
El cariotipo se confecciona usualmente después de un apropiado pre-tratamiento y tinción de
las células, para hacer más visibles los cromosomas individuales. Al diagrama simplificado de
los cromosomas metafásicos del cariotipo se lo denomina idiograma, que se construye con el
número genómico. Para realizar el ordenamiento de los cromosomas tanto en cariotipos como
idiogramas se debe tener en cuenta el tamaño cromosómico (ubicados de mayor a menor,
con el brazo corto “bc” o "p" hacia arriba y el brazo largo “bl” o "q" hacia abajo); posición del
centrómero (generalmente alineados) y presencia de constricciones secundarias y satélites.
Usualmente las especies animales y vegetales tienen un número de cromosomas constante
y determinado que constituyen su cariotipo (ley de la constancia numérica de los
cromosomas), aunque existen especies con una alta variabilidad cariotípica, no sólo en
número sino en forma y tamaño de los cromosomas.

El protozoario Aulacantha, con 1600 cromosomas en sus células, es la especie con el mayor
número de cromosomas.
El número de cromosomas de una especie (o fase vital) diploide se identifica como 2n mientras
que ese número en una especie (o fase vital) haploide se identifica con la letra n. En aquellas

83
FASE CERO 2018-I

especies que presentan un número repetido de cromosomas superior a dos


complementos se habla de poliploidía, representándose el múltiplo por delante de la letra n.
Así: 3n indicaría un complemento cromosómico triploide, 4n un tetraploide, etc. Todas estas
son situaciones de euploidía. Con la indicación x se quiere expresar el número básico de
cromosomas de una especie que presenta individuos con diversos grados de ploidía o el de
una línea filogenética a partir de la cual diversos taxones han alcanzado situaciones
aneuploides variadas, siendo en este caso el número cromosómico una variación del número
original con aumento o disminución del número básico, por pérdida, fusión o división de
cromosomas (p. ej., n+1 o n-1). Un ejemplo de esta situación anormal la tenemos en los
individuos de la especie humana que presentan el llamado síndrome de Down, situación de
aneuploidía (2n=47) por la presencia de un ejemplar más de lo habitual del cromosoma 21

Constancia del número de cromosomas

84
FASE CERO 2018-I

Cromosomas sexuales
En muchos organismos, uno de los pares de los cromosomas homólogos es distinto al resto,
realizando la determinación del sexo del individuo. A estos cromosomas se les llama
cromosomas sexuales o heterocromosomas e incluso gonosomas, porque determinan el
sexo.
 Sistema de determinación XY: es propio del ser humano y muchos otros animales.
Las hembras, siendo XX, darán gametos iguales con cromosoma X, sexo
homogamético y los machos, siendo XY, darán dos tipos de gametos, uno con el
cromosoma X y otro con el cromosoma Y. La probabilidad de que en la fecundación,
al unirse los gametos, resulte una combinación XX (hembra) o XY (macho) es
aproximadamente del 50 %.
 Sistema de determinación ZW: en otras especies (p. ej. mariposas y aves) ocurre lo
contrario, el sexo masculino es homogamético (ZZ) y el femenino heterogamético
(ZW).
 Sistema de determinación XO: En otras especies (peces, insectos, anfibios, etc) que
no tienen el cromosoma Y, determinándose el sexo por el número de cromosomas X,
macho XO y hembra XX.
Forma de los cromosomas

El cromosoma humano 19 es metacéntrico.


El cromosoma humano 14 es acrocéntrico.

85
FASE CERO 2018-I

Cariotipo espectral, el cariograma se obtiene luego de la identificación y clasifciación de los


cromosomas. El cariotipo que se muestra corresponde a un individuo de sexo femenino ya
que se observan dos cromosomas X.
La forma de los cromosomas es para todas las células somáticas constante y característica
de cada especie. La forma depende fundamentalmente de las constricciones que presente el
cromosoma y de su localización en la cromátida.
El cromosoma se encuentra constituido básicamente por el centrómero que divide el
cromosoma en un brazo corto o brazo p y un brazo largo o brazo q. Algunos cromosomas
presentan satélites en el brazo corto.
Según la posición del centrómero, los cromosomas se clasifican en:
Metacéntricos: El centrómero se localiza a mitad del cromosoma y los dos brazos presentan
igual longitud.
Submetacéntricos: La longitud de un brazo del cromosoma es algo mayor que la del otro.
Acrocéntricos:Un brazo es muy corto (p) y el otro largo (q).
Telocéntricos:Sólo se aprecia un brazo del cromosoma al estar el centrómero en el extremo.
El par de gonosomas o sexocromosomas se constituyen por un cromosoma X
(submetacéntrico mediano) y un cromosoama Y considerado acrocéntrico sin satélites,
aunque en algunas revisiones de la literatura se le refiere como submetacéntrico.

Tamaño cromosómico
Los cromosomas sufren grandes variaciones en su tamaño a lo largo del ciclo celular, pasando
de estar muy poco compactados (interfase) a estar muy compactados (metafase), por tal
motivo, los estudios sobre el tamaño suelen realizarse en metafase mitótica. Además, es
necesario tener en cuenta que los tratamientos para teñir los cromosomas y para obtener las
metafases mitóticas influyen de manera muy importante en el tamaño de los cromosomas. En
cualquier caso, en general es posible decir que hay especies eucarióticas con cromosomas
grandes y especies con cromosomas pequeños. Las monocotiledóneas (vegetales) y los
anfibios y ortópteros (animales) poseen cromosomas muy largos (de 10 a 20 micras). Las
dicotiledóneas, las algas, los hongos y la mayoría de las especies animales poseen
cromosomas pequeños (longitud inferior a 5 micras). Naturalmente, existen algunas

86
FASE CERO 2018-I

excepciones en los ejemplos citados. El cromosoma 1 humano tiene 0,235 pg de ADN,


que equivalen a una longitud total de ADN doble hélice de 7,3 cm y en metafase mitótica
presenta una longitud aproximada de 0,001 cm.

Los cromosomas humanos


El ser humano presenta 23 pares de cromosomas en sus células somáticas: 22 autosomas y
un par de cromosomas sexuales (dos X en el caso de las mujeres y un cromosoma X y un Y
en el caso de los varones). El tamaño total aproximado del genoma humano es de 3 200
millones de pares de bases de ADN (3 200 Mb) que contienen unos 20 000-25 000 genes. De
las 3 200 Mb unas 2 950 Mb corresponden a eucromatina y unas 250 Mb a heterocromatina.
El Proyecto Genoma Humano produjo una secuencia de referencia del genoma humano
eucromático, usado en todo el mundo en las ciencias biomédicas.
La secuencia de ADN que conforma el genoma humano contiene codificada la información
necesaria para la expresión, altamente coordinada y adaptable al ambiente, del proteoma
humano, es decir, del conjunto de proteínas del ser humano. El genoma humano presenta
una densidad de genes muy inferior a la que inicialmente se había predicho, con sólo en torno
al 1,5 % de su longitud compuesta por exones codificantes de proteínas. Un 70 % está
compuesto por ADN extragénico y un 30 % por secuencias relacionadas con genes. Del total
de ADN extragénico, aproximadamente un 70 % corresponde a repeticiones dispersas, de
manera que, más o menos, la mitad del genoma humano corresponde a secuencias
repetitivas de ADN. Por su parte, del total de ADN relacionado con genes se estima que el
95 % corresponde a ADN no codificante: pseudogenes, fragmentos de genes, intrones,
secuencias UTR, entre otras. Aunque tradicionalmente esas secuencias de ADN han sido
consideradas regiones del cromosoma sin función, hay datos que demuestran que esas
regiones desarrollan funciones relacionadas con la regulación de la expresión génica.
En la siguiente tabla se listan los cromosomas humanos, el número de genes que presenta
cada uno, su tamaño en pares de bases y su morfología.

87
FASE CERO 2018-I

Autoevaluación
1) Señala que se entiende por genoma
2) Indica el tamaño del genoma humano y su cantidad aproximada de genes
3) Señala en un dibujo las diferentes partes de un cromosoma
4) Señala el papel que cumplen y las características de las histonas.
5) Señala que se entiende por diploide y haploide
6) Indica que se entiende por centrómero.

88
FASE CERO 2018-I

TEMA 8: EL ORIGEN DE LA VIDA Y LA EVOLUCIÓN HUMANA

8.1 TEORIAS SOBRE EL ORIGEN DE LA VIDA


8.1.1 TEORÍAS IDEALISTAS
Formas de pensamiento basadas en mitos y cuentos que el hombre primitivo creaba para
poder explicar los fenómenos que ocurrían.
Etapa conocida como el oscurantismo científico.
Dentro de estas teorías podemos considerar la teoría de la generación espontánea vitalista
Aristotélica, teoría de la biogénesis, teoría de la eternidad de la vida, teoría cosmozoica y la
teoría de la panspermia.

Teoría de la generación espontánea vitalista Aristotélica


Aristóteles propuso el origen espontáneo para gusanos, insectos y peces a partir de la
interacción de la materia inerte con fuerzas (entelequia) capaces de dar vida. En 1667, el
holandés Johann B, van Helmont propuso la generación espontánea de ratones a partir de
ropa con sudor colocada junto con trigo en un recipiente por 21 días. A pesar de su larga
aceptación, esta teoría fue motivo de arduos debates entre los científicos.

En 1668 Francisco Redi demostró que los gusanos que infestaban la carne provenían de
huevecillos depositados por las moscas. Colocó carne en tres recipientes: uno cerrado
herméticamente, otro cubierto con una gasa, y otro descubierto. Sólo la carne en el último
tenía gran cantidad de larvas y moscas. Con dicho experimento se empezó a demostrar la
falsedad de la generación espontánea. Sin embargo, en 1677 Antoni van Leeuwenhoek
desautorizó estos resultados al encontrar microorganismos sólo visibles al microscopio en
gotas de agua sucia donde parecían surgir súbitamente con gran facilidad. Ello fortaleció los
ánimos de los seguidores de la generación espontánea, pues además, los resultados de Redí
demostraban el origen de las moscas, pero no el de otros organismos. En esos tiempos
Needhad sostuvo que había una fuerza vital que originaba la vida, pues luego de hervir caldo
de res en una botella, taparla y dejarla reposar varios días, observó al microscopio organismos
vivos. Si el calor era suficiente para matar a cualquier organismo, entonces la presencia de
estos era originada por la fuerza vital. Más adelante en 1768, Lazzaro Spallanzani demostró
la inexistencia de generación espontánea: luego de hervir un caldo con microorganismos en
un recipiente de vidrio y cerrarlo para evitar la entrada de aire, el líquido se mantuvo claro y
estéril. Esto lo llevo a concluir que los organismos encontrados por Needhad procedían del
aire que penetraba por el corcho. Los inmovilistas no dieron validez al experimento pues
decían que el calor había alterado el aire del recipiente, eliminando los principios creadores
de la vida.

89
FASE CERO 2018-I

El debate se resolvió en 1862 con los experimentos de Louis Pasteur. Al igual que
Spallanzani, pensaba que los microorganismos del aire causaban la putrefacción de la materia
orgánica. Para demostrarlo diseñó unos matraces con cuello de cisne, donde colocó líquidos
nutritivos que hirvió hasta esterilizarlos. Observó que los microorganismos del aire quedaban
atrapados en el cuello, y aunque éste entraba en contacto con la sustancia nutritiva, no había
putrefacción. Luego, rompió el cuello de un matraz y observó la descomposición de la
sustancia nutritiva al entrar en contacto el líquido con los microorganismos contenidos en el
aire. Así, Pasteur llegó a la conclusión de que los gérmenes penetraban en las sustancias
procedentes del entorno y comprobó la falsedad de la teoría de la generación espontánea.

Teoría de la Biogenesis
No explica el origen de la vida, plantea que la vida solo proviene de la vida.
Teoría de la eternidad de la vida
Planteada por Lord Kelvín sostiene que la evolución de la materia viva ha pasado por diversas
formas, pero siempre ha existido.
Teoría Cosmozoica
En esta teoría Liebig y Col. considera que la vida llegó a la tierra proveniente del espacio,
donde existirían planetas con vida. Sostiene que los primeros seres que llegaron a la tierra
fueron bacterias en el interior de meteoritos.

90
FASE CERO 2018-I

Teoría de la Panspermia
Planteada por Arrhenius (1908) postula que en el universo existen gérmenes de vida en
reposo que se desarrollan cuando encuentran condiciones propicias. Sostiene que fueron
esporas bacterianas las que colonizaron la tierra primitiva. A esta teoría se le pueden oponer
dos argumentos: 1) las condiciones del medio interestelar son desfavorables para la
supervivencia de cualquier forma de vida; además, el calor y combustión causados por la
fricción de un meteorito cuando entra en la atmósfera, puede destruir las esporas o bacterias
que viajan en él; y 2) no explica cómo apareció la vida en el planeta hipotético del cual se
habría desprendido la espora o bacteria.

8.1.2 CONCEPCIONES MATERIALISTAS


Teoría de la generación espontánea de los materialistas Griegos: Señala que los elementos
naturales terrestres interactúan y generan seres vivos.
Teoría de la generación espontánea de los materialismo mecanicista: señala que los seres
vivos han surgido en la naturaleza por procesos mecánicos y al azar. No establece pruebas
ni condiciones.
Teoría científica materialista Dialéctica: señala que los seres vivos han surgidos como
consecuencia de un largo proceso de evolución de la materia. La evolución biológica y el
origen de la vida son parte de la evolución de la materia. Los seres vivos han surgido en la
tierra en condiciones diferentes a las actuales, en una atmósfera reductora, en condiciones
de alta energía. Fue planteada por Alexander I. Oparin y John B.S. Haldane y posteriormente
probada experimentalmente por Miller – Urey. Posteriormente en 1929 M. Muller propuso la
supremacía de los ácidos nucleicos en el origen de la vida.

Teoría de Oparin-Haldane (1924)


Alexander Oparin, bioquímico soviético, lanzó una teoría según la cual los elementos
presentes en la atmósfera y mares primitivos reaccionaron entre sí gracias a la elevada
energía proveniente de la radiación solar, la actividad eléctrica de la atmósfera y los volcanes,
para formar moléculas orgánicas. Luego, éstas se agruparon en otras mayores, como
carbohidratos, proteínas y ácidos nucleicos, y éstas a su vez en complejos temporales. Al
unirse, estos complejos constituyeron sistemas microscópicos esferoides delimitados por una
membrana y que en su interior tenían agua y sustancias disueltas. A estos sistemas Oparin
los llamó coacervados. Demostró que en su interior ocurrían reacciones químicas que podían
originar sistemas cada vez más complejos y que tenían intercambio de materia y energía con
el entorno. Estas propiedades sugirieron una gran similitud con los primeros sistemas
precelulares o protobiontes. Sin embargo, las condiciones adversas del medio causaron la

91
FASE CERO 2018-I

permanencia de sólo las formas más resistentes sobre la Tierra primitiva, mientras que
aquéllas que no lo lograban se disolvían en el océano o sopa primitiva. Después, los
protobiontes evolucionaron y adquirieron la capacidad de incorporar moléculas a su
estructura, y finalmente, de separar porciones iguales de sí mismos. Así, aparecieron lo que
Oparín llamó eubiontes, que ya eran células y, por lo tanto, tenían vida. En 1928, el biólogo
inglés John Haldane propuso en forma independiente una explicación similar a la de Oparin.
Haldane sostenía que una atmósfera reductora, como la primitiva, era una condición
indispensable para la evolución de la vida porque los compuestos orgánicos no podrían ser
estables en una atmósfera oxidante (con O2).

El experimento Miller-Urey (1953)


Años después, Stanley Miller y Harold Urey, bioquímicos ingleses, consiguieron obtener
compuestos orgánicos complejos después de reproducir las condiciones primitivas del
planeta. Miller creó un dispositivo en el cual mezcló hidrógeno, metano y amoníaco, y los
sometió a intensas descargas eléctricas dentro de un circuito cerrado en el que hervía agua y
se condensaba repetidas veces. Se producían así moléculas orgánicas sencillas, como
cianuro de hidrógeno (HCN) y aldehídos, a partir de las cuales surgían otras más complejas,
como azúcares, aminoácidos y nucleótidos. Más adelante en 1960, Juan Oró también obtuvo
aminoácidos y bases nitrogenadas de la reacción de cianuro de hidrógeno, amoniaco,
cianógeno y cianoacetileno. Estos experimentos confirmaron las observaciones de Oparín y
fortalecieron la idea de generación de formas sencillas de vida a partir de moléculas orgánicas
y sistemas cada vez más complejos.

En resumen, estas teorías sugieren que la vida surgió bajo condiciones ambientales adversas
a partir de moléculas orgánicas sencillas que se unieron y formaron macromoléculas como
proteínas, carbohidratos, ácidos nucleicos o lípidos. Estas a su vez, al mezclarse, formaron
glóbulos con capacidad de intercambiar materia y energía con el medio, incorporar moléculas
a su estructura y metabolizarlas. Simultáneamente, las bases nitrogenadas formarían los
nucleótidos, y luego estos se polimerizarían primero en el RNA, y más adelante en la DNA,
dando lugar a la aparición del código genético. De esta manera, las primeras células estaban
en capacidad de dividirse en formas similares y transmitir información hereditaria sin competir
con ningún otro organismo vivo. Sin embargo, mediante la intervención de la selección natural
se habrían diversificado hasta los actuales organismos.

92
FASE CERO 2018-I

8.2 LA EVOLUCIÓN Y TIPOS DE EVOLUCIÓN


Los mecanismos evolutivos son fenómenos que ocurren en todo momento, una manifestación
de ello es la constante formación de nuevas variedades de organismos. Desde el punto de
vista cualitativo podemos identificar dos grados o niveles en los que ocurre la evolución:
 Cuando la variación no involucra la formación de nuevas especies, y
 Aquella en la cual se forman nuevas especies o grupos mayores de organismos.
A esto se le denomina microevolución, macroevolución y megaevolución.
MICROEVOLUCIÓN: Cuando los cambios que se producen en una población; tanto a nivel
de los genes como en su manifestación son pequeños es decir no originan variaciones
grandes en los organismos, por lo cual la población sigue manteniéndose relativamente
estable. La microevolución se produce en el nivel de especie y no origina nuevas especies.
Ejemplo: Resistencia de bacterias frente a antibióticos y la de los insectos a los insecticidas.
MACROEVOLUCIÓN: Cuando los cambios que ocurren en los organismos determinan la
formación de nuevas especies. Ocurre por encima del nivel de la especie, es decir involucra
el aumento de las especies dentro de un género o familia. Ejemplo: El gran número de peces
identificados.
MEGAEVOLUCIÓN: Es cualitativamente el grado de variación más grande. Se emplea esta
categoría para explicar la formación de los grupos biológicos por encima de los órdenes. El
surgimiento de clases, phillums y reinos se incluye en este estudio.

93
FASE CERO 2018-I

EVIDENCIAS DE LA MACROEVOLUCIÓN:
a. Pruebas Paleontológicas ( de los fósiles)
b. Prueba de la Anatomía comparada
b.1 Órganos homólogos
b.2 Órganos análogos
b.3 Órganos rudimentarios
c. Pruebas de la embriología
d. Pruebas citológicas (componentes celulares comunes)
e. Pruebas Bioquímicas
f. Pruebas sanguíneas y serológicas
g. Pruebas de la Genética (ADN)
h. Pruebas biogeográficas y de domesticación
i. Pruebas taxonómicas

1. ETAPAS DE LA EVOLUCIÓN HUMANA

Para los el punto de inicio de la historia de la humanidad empezó con la


aparición de los primates, hace unos 65 millones de años. Los primeros de ellos eran unos
pequeños seres que empezaron a vivir en los árboles en lugar de permanecer en el suelo,
como la mayoría de los mamíferos. Entre las especies que pertenecen a los primates están,
además del ser humano, los simios, monos y musarañas.

Durante su desarrollo evolutivo, estos primates se hicieron de ciertos rasgos especiales:


buena visión, manos con las que se pueden sujetar firmemente objetos y un cerebro
relativamente grande.

94
FASE CERO 2018-I

Por pertenecer a la misma familia, las diferentes especies de primates, en especial monos y
simios, guardan similitud con el ser humano. Según algunos estudiosos, el último ancestro
común entre el ser humano y el chimpancé, nuestro primo más cercano, existió hace 6 ó 7
millones de años. Después de esta separación apareció el primer , el llamado
Australopithecus, que posteriormente dio lugar al Homo habilis, el primer especímen del
género Homo, al que pertenecemos los seres humanos modernos.
Los Homínidos, primates bípedos, habrían surgido hace unos 6 ó 7 millones de años
en África, cuando dicho continente se encontró afectado por una progresiva desecación que
redujo las áreas de bosques y selvas. Como adaptación al bioma de sabana aparecieron
primates capaces de caminar fácilmente de modo bípedo y mantenerse erguidos. Pueden
mantenerse erguidos y caminar en dos pies, tienen un cerebro relativamente grande en
relación con el de los monos y su mano tiene un dedo pulgar desarrollado que les permite
manipular objetos.

Australopithecus: El Australopithecus es el homínido más antiguo que


se conoce. Australopithecus quiere decir "simio sudafricano" y se estima
su antigüedad hasta en 4 millones de años.
En 1925, el paleontólogo Raymond Dart descubrió el cráneo de un
Australopithecus en Taung, al sur de África. El descubrimiento de este
fósil, ancestro del ser humano e íntimamente relacionado con el mono,
provocó polémica porque se encontró en África y hasta entonces se había
fundado el origen del ser humano en Europa. En lugares cercanos a este
descubrimiento se encontraron otras especies de Australopithecus
(afarensis, africanus, robustus, boisei), que confirmaron el origen del hombre en África.

Sus restos demostraron que estos homínidos medían más de un metro de estatura y
que sus caderas, piernas y pies se aparecían más a los de los seres humanos que a los de
los simios. El cerebro se asemejaba al de estos animales y tenía un tamaño similar al del
gorila, tenía un volumen inferior a los 400 centímetros cúbicos.

La mandíbula era grande y el mentón hundido. Caminaban erguidos y podían correr,


a diferencia de los simios. Sus largos brazos acababan en manos propiamente dichas, con
las yemas de los dedos planas, como las de los seres humanos. Se cree que estos seres eran

95
FASE CERO 2018-I

carnívoros, pues a su alrededor se han encontrado huesos y cráneos que habían sido
machacados para extraer el tuétano y los sesos.
Quizá la especie más famosa de Australopithecus es la Australopithecus afarensis, gracias al

descubrimiento, en 1974 en Hadar, Etiopía, de los restos de , una joven mujer de la


que se encontraron 52 huesos de un esqueleto semicompleto, con una edad aproximada de
3.2 millones de años. Esta especie trepaba árboles pero también podía caminar en dos pies.
Durante mucho tiempo se pensó en Lucy como la abuela de la humanidad. Sin embargo, esta
especie pudo haberse extinguido sin que a partir de ella se continuaran las ramas de la
evolución humana.

El género Homo, que apareció hace 2.5 millones de años y que incluye por lo menos
tres especies: Homo habilis (parece ser el primer Homo apareció hace 2.5 millones de años)
, Homo erectus (apareció hace 1.5 millones de años), Homo sapiens (apareció hace tan solo
unos 200.000 años). Uno de los grandes misterios de los estudiosos de la prehistoria es
cuándo, cómo y dónde el género Homo remplazó a los Australopithecus. Con la aparición del
género Homo y su habilidad para fabricar útiles de piedra se inicia la llamada Edad de Piedra.

Homo habilis: coexistiendo con el australopithecus apareció esta especie de


homínidos. Tenían un cerebro más grande, alrededor de 700 centímetros cúbicos. Su
característica más importante fue el cambio en su forma de alimentación: ya no sólo comían
frutas y vegetales sino también animales (ocasionalmente comía carne). Su altura alcanzaba
el metro y 55 cms. Era robusto, ágil, caminaba erguido y tenía desarrollada la capacidad
prensil de sus manos. Sabía usar el fuego, pero no producirlo, y se protegía en cuevas.

96
FASE CERO 2018-I

Homo erectus: Su cuerpo es la culminación de la evolución biológica de los


homínidos: era más alto, más delgado, capaz de moverse rápidamente en dos pies, tenía el
pulgar más separado de la mano y su capacidad craneana era de 800 cm3. También fabricó
herramientas, como el hacha de mano de piedra, y aprendió a conservar el fuego. Son los
primeros homínidos que se distribuyeron ampliamente por la superficie del planeta, llegando
hasta el sudeste y este de Asia. Se extinguió hace unos 125.000 años.

Homo antecessor: En atapuerca se encontraron fósiles de homínidos de unos


800.000 años de antigüedad, se le llamó homo antecessor porque deriva del homo erectus y
sería el antecesor tanto de los neandertales como de los humanos actuales.

Homo neanderthalensis: Vivió en Europa, llamado el hombre de Neanderthal


(Alemania) que enterraba a sus muertos (Los muertos no sólo eran enterrados
cuidadosamente, sino que también el muerto era provisto de utensilios y comida). El hombre
de Neaderthal desapareció bruscamente, su lugar fue ocupado por los hombres modernos,
hace unos 35 mil años. Coincidió durante un tiempo con el Homo sapiens y se desconoce si
esto tuvo algo que ver con su extinción. En contra de lo que se pensaba en el pasado, no es
nuestro antepasado, sino una rama evolutiva paralela a la nuestra. Su esqueleto era

97
FASE CERO 2018-I

extremadamente robusto y eran mucho más fuertes que los humanos actuales. Tenían
una capacidad craneal elevada (incluso superior a la nuestra), pero su cerebro era muy
diferente al nuestro.

Homo sapiens: Al igual que los neandertales, los hallazgos arqueológicos reflejan
cambios importantes en el comportamiento de estas especies: utilización de instrumentos de
piedra y hueso más trabajados, cambios en las formas de cazar, uso y dominio del fuego y
manifestaciones rituales. A la vez que los primeros neandertales poblaban Europa (hace
200.000 años) surgía en África una nueva especie, el Homo sapiens, extendiéndose desde
África hacia Asia y Europa. El Homo sapiens es el único homínido del que podemos estar
seguros que estaba capacitado para desarrollar un lenguaje verbal.
Homo sapiens sapiens: Es el hombre actual. Su capacidad cerebral es de alrededor
de 1400 centímetros cúbicos. Se cree que apareció en Europa hace alrededor de 40.000
años. Los Homo sapiens sapiens se extendieron por la Tierra más que ninguno de los primates
anteriores. Un grupo prehistórico de esta especie fueron los hombres de Cro-Magnon (32 mil
años), llamados así por la cueva cercana a la aldea de Les Eyzies, Francia, donde fueron
hallados sus restos óseos. Los cro-magnones vivieron la última glaciación y aunque su
cerebro no era mayor que el del hombre de Neanderthal, le dieron nuevos usos pues, entre
otras cosas, hicieron y mejoraron muchos instrumentos y armas. Los cro-magnones son
también los artistas más antiguos (pinturas rupestres). El Homo sapiens sapiens es el que
protagonizó, a partir del año 10.000 a.C., cambios muy importantes en la organización
económica y social, como las primeras formas de agricultura y domesticación de animales, y
la vida en ciudades. Observa el esquema evolutivo más ampliado, aceptado y complejo.

98
FASE CERO 2018-I

Curiosidades: Para los biólogos, todos los seres humanos formamos parte de la
misma especie (Homo sapiens sapiens) aunque hay distintas razas. Las líneas generales de
distribución racial se iniciaron en la Prehistoria. Desde el punto de vista físico se pueden
reconocer por lo menos cuatro categorías raciales fundamentales: negroide, caucasoide,
mongoloide, australoide. Lo que dio al hombre moderno su control sobre la Tierra no fue su
físico, sino su capacidad de aprovechar y transmitir a sus descendientes la información
cultural por medio de su inteligencia.

EVOLUCIÓN DEL CRÁNEO:

El cráneo humano ha cambiado drásticamente durante los últimos 3 millones de años.


La evolución desde el Australopithecus hasta el Homo sapiens, significó el aumento de la
capacidad craneana (para ajustarse al crecimiento del cerebro), el achatamiento del rostro, el
retroceso de la barbilla y la disminución del tamaño de los dientes. Los científicos piensan que
el increíble crecimiento de tamaño del cerebro puede estar relacionado con la mayor
sofisticación del comportamiento de los homínidos. Los antropólogos, por su parte, señalan
que el cerebro desarrolló su alta capacidad de aprendizaje y razonamiento, después de que
la evolución cultural, y no la física, cambiara la forma de vida de los seres humanos.

AUTOEVALUACIÓN
1.Señale dos teorías idealistas y dos materialistas.
2.Indique cual fue el aporte de Pasteur con respecto a la Teoría de la Generación Espontánea.
3.Indique que señala la Teoría de la eternidad de la vida y quien la postuló.
4.Señale que considera la Teoría Materialista Dialéctica y quien la postuló.
5.Indique las diferencias entre la macroevolución y microevolución.
6.Señale las características del Homo habilis y el Homo sapiens.

99
FASE CERO 2018-I

100