You are on page 1of 55

MED3

F.Petit
Département Universitaire de Génétique
Faculté de Médecine - CHRU Lille
Université Lille 2

 Généralités
 Historique
 Caractéristiques génétiques
 Mécanismes moléculaires
 Conséquences 
Exemples
 Dystrophie myotonique de Steinert
 Syndrome de l’X Fragile
 Chorée de Huntington

 L’Anticipation : un phénomène controversé
décrit par H. Steinert en 1909

• B.A. Morel, fin 19e s • Penrose 1948
eugénistes : théorie de la Anti-eugénistes : Biais statistique
dégénérescence

• Cliniciens • Statisticiens
Klein 1960 : Parents 55 ans, Vogel 1980 : Biais statistique
enfants 27 ans
Harper 1970 : Facteur
maternel

Années 90 : description des mutations instables,
correspondant à la répétition de triplets nucléotidiques

Exemple : répétition (CTG)n
……GGAGGGGCCGGGTCCGCGGCCGGCGAACGGGGCTCGAAGGGTCCTTGTAGCCGGGAATGCTG
CTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT
GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGGGGGGA
TCACAGACCATTTCTTTCTTTCGGCCAGGCTGAGGCCCTGACGTGGATGGGCAAACTGCAGGCCTGG
GAAGG…. 

En situation normale, le nombre de répétition est
polymorphique et stable 

Dans les maladies à expansion de triplets :
il existe un SEUIL
 Nombre de répétition au-delà duquel l’instabilité apparaît
 Variable selon la maladie

Plus rarement. expansion du nombre de triplets. la pureté de la répétition .  Instabilité somatique Varie selon le tissu Augmente avec l’âge : aggravation progressive des symptômes  L’instabilité augmente avec la longueur de la répétition. Mutations « dynamiques » :  Instabilité intergénérationnelle (germinale) Le plus souvent. des contractions peuvent être observées.

 Anticipation : aggravation de la maladie au cours des générations  Début des symptômes plus précoce  Evolution plus sévère  En lien avec l’expansion du nombre de triplets au fur et à mesure des générations .

 Biais parental :  L’instabilité varie en fonction du sexe du parent transmetteur  Diffère selon les maladies  Origine mal connue .

ovocyte. …)  Du stade de développement (cellule quiescente ou en division)  Du nombre de répétition  Des séquences environnantes (séquence codante/non- codante) . Les mécanismes moléculaires de l’instabilité sont multiples et encore mal connus  Ils dépendent :  Du type cellulaire (spermatocyte.

 Evénement commun aux différents mécanismes : formation de structures secondaires au niveau de l’ADN ou de l’ARN favorisée par les séquences répétitives CGUC GU UCGUCGUCGUCGUCG CG U CG CGUCGUCGUCGUCG U Exemple : Répétition (CGU)n .

 Evénement commun aux différents mécanismes : formation de structures secondaires au niveau de l’ADN ou de l’ARN favorisée par les séquences répétitives Simple brin épingle épingle stable quadruplexe Stabilité de la structure .

boucle stable. Formation d’une boucle durant les processus de réparation des lésion de l’ADN  Apparition d’une grande expansion Formation d’une Cassure simple brin. excision et ligation de la boucle resynthèse .

 « Dérapage » de la polymérase durant la réplication  Variation légère du nombre de répétitions Situation normale : Séquence répétée : polymérase et hélicase ralentissement de étroitement couplées à la polymérase la fourche de réplication Formation d’une structure Apparition d’une secondaire et « dérapage » délétion ou de la polymérase insertion de petite taille .

2010 Grandes expansions régions non codantes . Petites expansions régions codantes/non codantes Grandes délétions régions non codantes McMurray.

mécanismes multiples . dépendant des mécanismes de réplication  Les petites expansions surviennent à tous les stades de la spermatogenèse. Chez la femme :  Grandes expansions dans les régions non codantes  Surviennent au stade de l’ovocyte primaire  Dépendant des mécanismes de réparation  Chez l’homme :  Les contractions surviennent au stade de spermatogonie.

. 2011 .Les conséquences de l’expansion dépendent de sa localisation : Perte de fonction  Région non codante : ou Toxicité de l’ARN du gène  Région codante : Toxicité de l’ARN et de la protéine exon exon Sicot at al.

.

pays basque  Sévérité : risque vital / risque d’anticipation . 1/500). Affection autosomique dominante  1ère dystrophie musculaire de l’adulte  Prévalence moyenne 1/8000  Répartition mondiale (sauf Afrique)  Pics: Québec (Saguenay.

calvitie… . Atteinte musculaire au 1er plan : déficit musculaire avec myotonie  Atteinte cardiaque : troubles du rythme et de la conduction. endocriniens. digestifs. cataracte précoce. risque de mort subite  Maladie multisystémique : troubles cognitifs.

dysthyroïdie…). cataracte précoce. calvitie  Tardive(> 40 ans) : forme frustre . Expressivité variable : 4 formes cliniques  Congénitale : hydramnios. hypotonie congénitale.  Infantile : atteinte cardiaque et neuromusculaire. difficultés d’apprentissage  Adulte (20 -40ans) : atteinte cardiaque et neuromusculaire. troubles digestifs et endocriniens (diabète type 2. détresse respiratoire.

 Atteinte des muscles faciaux:  Visage allongé  Faciès amimique  Ptôsis  Dysphonie .

spontanée ou à la percussion  EMG: salves myotoniques . Myotonie : lenteur à la décontraction musculaire.

.

.

 Gène DMPK.3  (CTG)n dans la partie 3’ non traduite du gène  Allèles normaux: 5 à 37 CTG  Allèles mutés: > 50 CTG . 19q13.

 Polymorphisme (CTG)n : distribution trimodale dans la population  5 CTG 40% des allèles  11-14 CTG 50% des allèles  19-37 CTG 10% des allèles  Constituent un réservoir pour l’apparition des mutations DM  Dérivent d’un allèle ancestral à 5 CTG .

> 50 .

1993 . Corrélation taille expansion et âge de début  Harley.

 Dépend du nombre de répétitions et du sexe du parent transmetteur (CTG)n du parent Transmission : Paternelle Maternelle .

 Corrélation taille expansion et sévérité/âge de début 80 CTG 350 CTG 1500 CTG .

Toxicité ARNm mutés  Effets « cis » : modification de l’expression des gènes du locus  Effets « trans » :  séquestration de protéines nucléaires essentielles à l’épissage  anomalie d’épissage de nombreux gènes à distance du locus .

ARNm toxiques En trans : En cis : CLCN1 et myotonie Dérégulation SIX5 : TNNT2 et troubles cardiaques cataracte Récepteur à l’insuline et diabète .

.

1/7000 filles  FMR1: expression neuronale  Fonctions: transport nucléocytoplasmique. 1ère cause de retard mental héréditaire  Gène FMR1  Transmission liée à l’X  Touche les 2 sexes (H/F ~ 2/1) : 1/4000 garçons. régulation de la traduction. architecture du cytosquelette. plasticité synaptique .

Chez le garçon :  Déficience intellectuelle constante. traits autistiques  Dysmorphie faciale (visage allongé. sévérité variable  Retard de langage  Troubles du comportement : troubles de l’attention. grandes oreilles)  Macroorchidie post-pubertaire Chez la fille :  Déficience intellectuelle légère à modérée  Troubles du comportement et de la relation (anxiété. timidité…) . hyperactivité.

.

 Expansion de triplets (CGG)n dans la région promotrice  n < 50 gène normal 50<n<200 prémutation ♀ / ♂ « asymptomatiques » n > 200 mutation complète ♂ : X fragile (100%) ♀ : X fragile (50%) Asymptomatiques (50%) (=pénétrance incomplète) .

 Mutation complète : pas de corrélation entre nb de triplets et phénotype  Prémutation :  Risque de passage à la mutation complète lors de la transmission maternelle  Risque augmente avec la taille de la prémutation .

CGG parent 0 50 200 2000 Transmission paternelle Transmission maternelle .

Transmission paternelle de X/X 115/Y la PREMUTATION prémutation sans expansion 115/X XY 115/X XY Anticipation lors de la transmission maternelle 275/X 250/X 235/Y X/Y MUTATION COMPLETE .

75% à 80 ans chez l’homme)  Tremblements  Ataxie cérébelleuse  Troubles cognitifs Chez la femme  20% Insuffisance ovarienne prématurée (<40 ans)  Risque de transmission d’une mutation complète .Syndrome FXTAS (Fragile X Tremor Ataxia Syndrome)  Homme>>Femme  Syndrome neurodégénératif à début tardif (20% 50- 59 ans.

CGG > 200 CGG 60-200 méthylation Pas de transcription Transcription d’ARNs toxiques Perte de fonction FMRP Inclusions neuronales Anomalie de maturation synaptique ♂ FTXAS ♀ IOP Syndrome X Fragile .

.

000-1/15. 6% formes juvéniles  Dégénérescence neuronale progressive :  Troubles du comportement  Mouvements anormaux (chorée)  Troubles cognitifs.000  Transmission autosomique dominante  Age de début variable : le plus souvent 30-50 ans. Fréquence 1/12. démence  Décès en 10-20 ans d’évolution  Instabilité somatique et germinale .

à s’adapter aux nouvelles situations . troubles de l’humeur. impulsivité. visage…)  Maladresse. instabilité  Troubles psychiatriques :  Anxiété. Troubles moteurs :  Bradykinésie  Mouvements involontaires discrets (extrémités. intolérance à la frustration  Troubles cognitifs :  Anosognosie  Troubles de l’attention / concentration  Altération mémoire à court terme  Difficultés à organiser les activités quotidiennes.

 Troubles moteurs :  Rigidité  Dysarthrie. troubles de la déglutition  Troubles psychiatriques  Dépression  Psychose  Troubles cognitifs :  Démence .

 6% des malades  Début moyen 14 ans (5-20 ans)  Retard au diagnostic fréquent car les mouvements anormaux apparaissent secondairement  Le plus souvent. début par syndrome akinéto- hypertonique. déficience intellectuelle)  Mouvements choréiques vers 20 ans en moyenne (5-39 ans) . troubles cognitifs (difficultés scolaires.

.

des noyaux gris (striatum : noyau caudé. putamen)  Altérations neuronales (remodelage dendritique. Atrophie du cortex. inclusions nucléaires) Contrôle Huntington .

3 (CAG)n  Triplet CAG  Corrélation taille de l’expansion/âge de début  Anticipation surtout si transmission paternelle (biais d’apparition des formes juvéniles) . 4p16. Gène IT15.

CAG parent 0 37 200 Transmission paternelle Transmission maternelle .

(CAG)n Clinique Transmission < 27 Non atteint Stable 27-35 Non atteint Instable 32 36-37 Parfois atteint Anticipation Tb comportement (tardivement) surtout si vers 65 ans 37 transmission > 38 Atteint paternelle CH 40 à 40 ans CH 45 à 20 ans .

 Toxicité de l’ARN et de la protéine anormale (CAG)n Séquestration protéines d’épissage Agrégats nucléaires Séquestration d’autres protéines Polyglutamines (facteurs de transcription. ubiquitine et protéasome) Mort neuronale .

ergothérapie  Troubles psychiatriques : psychotropes (anti- dépresseurs. anxiolytiques…)  Prise en charge nutritionnelle (compléments alimentaires. kinésithérapie.…)  Prise en charge sociale  Soutien psychologique familial . Troubles moteurs : psychomotricité. orthophonie.

.Inhiber Activer la dégradation des Restaurer les Thérapies l’expression du protéines mutées et empêcher fonctions cellulaires gène muté leur agrégation cellulaires Ravache et al. 2010 .