You are on page 1of 37

Biología 08

Pabellón II de Ciudad Universitaria

Cátedra Valerani

GUÍA DE ACTIVIDADES

Características de los seres vivos


Células procariontes y eucariontes
Biodiversidad, reinos
Biomoléculas
Membranas biológicas, transporte
Enzimas
Metabolismo
Respiración celular y fermentación
Fotosíntesis
Reproducción.
Ciclo celular.
Duplicación del ADN.
División celular (mitosis, meiosis).
Genética. Leyes de Mendel.
Transcripción y traducción.
Mutaciones.
Genotipo, fenotipo, ambiente.
Evolución.

1
Biología (08) - Bienvenida

La cátedra funciona los días lunes y jueves entre las 7:00 y las 23:00 hs, en el pabellón II de Ciudad Universitaria, y
dicta dos materias:
Biología (08): para aspirantes a las carreras de Ciencias Biológicas, Paleontología, Técnico en Bioterio (FCEyN),
Veterinaria, Psicología, Musicoterapia, Terapia Ocupacional, Agronomía, Diseño de Paisaje y -optativa- Filosofía.
Biología Celular (54): para aspirantes a Medicina y carreras conexas (Nutrición, Kinesiología, Fonoaudiología,
Obstetricia, Enfermería), Odontología, Farmacia y Bioquímica.

Debido a que ambas materias tienen distinto programa, distintas fechas de parcial, distinta modalidad de dictado y
evaluación, recomendamos muy especialmente verificar -tanto al iniciar la cursada como al rendir los exámenes-
estar bien inscripta/o y en el aula correcta.

Plantel docente

Profesora asociada: Alejandra Valerani Ayudantes: María José Buschiazzo


Magalí Cercato
Jefxs de trabajos prácticos: Magalí Bassarsky Raquel Vázquez
Guillermo Bertrán Andrea Ventura
Patricia Pereyra Verónica Wendel
Berni Spolsky María Laura Yankilevich

Es muy importante conservar en algún lugar seguro los nombres de tus docentes, el número de comisión y el
horario y cuatrimestre de cursada. Ante cualquier consulta, inconveniente o reclamo, esa información será
fundamental.

Condiciones de regularidad
Las condiciones de regularidad son las mismas para todas las materias del CBC: se toman dos exámenes parciales;
la nota promedio entre ambos parciales determinará tu condición. Si el promedio entre las notas de los dos
parciales es igual o mayor que 7, se promueve la materia (se aprueba sin rendir examen final). Si la nota promedio
entre los dos parciales es igual o mayor que 4, y menor que 7 corresponde rendir el final; en ese caso, se aprueba
con un 4. En nuestra cátedra, la modalidad del final es la misma que la de los parciales.
Si uno solo de los exámenes ha sido desaprobado (y el promedio resulta menor a 4), es necesario rendir
recuperatorio, que se toma luego del segundo parcial y se califica con “aprobado” o “desaprobado”. Quienes
recuperan un examen ya no podrán promover la materia y deberán (en caso de aprobar el recuperatorio) rendir el
final.
En caso de ausencia a un examen parcial sólo podemos acordar otra fecha si traés el certificado correspondiente,
que acredite una causa de fuerza mayor (certificado médico, constancia de trabajo, etc.). Si te surge un problema
de salud u otro imprevisto el mismo día del parcial, lo mejor es que intentes avisar de tu dificultad el mismo día o
lo más pronto que te sea posible. Podés hacerlo por medio de un compañero, amigo o un familiar, que hablen con
nosotros personalmente, o utilizando el mail de la cátedra. Te pediremos que traigas el certificado
correspondiente y se podrá, entonces, rendirlo al culminar el cuatrimestre.

Régimen de cursada
Las clases de Biología tienen una duración de tres horas, dos veces por semana, y tienen un formato mixto: en
parte teórica y en parte taller. Consideramos que el diálogo que se da en el aula entre alumnos y docentes, y entre
estudiantes entre sí, forma parte del aprendizaje, por lo que la asistencia regular es imprescindible. Cualquier
inconveniente que surja durante la cursada, que impida cumplir con este requisito, debe ser avisado a los
docentes con la mayor antelación posible, para buscar soluciones en conjunto.

2
A lo largo del cuatrimestre puede solicitarse la entrega de tareas domiciliarias o elaboradas en clase, las que serán
calificadas y devueltas. En caso de que no estén aprobadas, podrán ser rehechas y vueltas a entregar.
El trabajo en clase se realiza en pequeños grupos. Es importante que todos los integrantes del grupo participen de
las actividades propuestas y que dialoguen entre sí para resolver dudas y ayudarse mutuamente con el estudio.
Nuestra experiencia nos dice que la aprobación de los parciales depende en gran parte del cumplimiento de estas
tres estrategias de estudio: la asistencia regular a las clases, la entrega de las tareas y el buen funcionamiento de
los grupos.

Blog y mail de la cátedra


La cátedra cuenta con un blog en el que hay información acerca de la cursada y también artículos interesantes
sobre temas de Biología. Los/as alumnos/as podrán navegar, y recurrir a él en busca de información (cronogramas,
distribución de aulas para exámenes, clases de consulta, guías) y de bibliografía adicional.
http://biologiajeru.blogspot.com

También contamos con un mail: biologiaCBCpab2CU@gmail.com


Esta cuenta de correo es revisada periódicamente por diferentes docentes de la cátedra, y está destinada a la
comunicación de imprevistos o inconvenientes que surjan durante la cursada (principalmente aquellos que te
dificulten cumplir con las condiciones de regularidad de la materia), que por su urgencia no puedan esperar a la
próxima clase/encuentro con tus docentes. Cuando te dirijas a nosotros por este medio te pedimos que: escribas
en el asunto del mail el motivo de consulta, te presentes (dando tu nombre, apellido, DNI, materia que estás
cursando junto con el horario, aula y nombre de tus docentes). No respondemos dudas de temas teóricos por este
medio (salvo cuando explícitamente lo indiquemos) ni consultas de tipo administrativo (para lo que debés recurrir
al Departamento de Alumnos y/o a la web del CBC).

Bibliografía de referencia
Estos textos son libros de Biología General que pueden ser utilizados indistintamente para estudiar la materia;
contienen todos los temas que se desarrollarán en el curso, y están accesibles en muchas bibliotecas (incluyendo la
de la FCEyN, en el primer piso de este pabellón).
✓ Audesirk, T.; Audesirk, G.; Byers, B. (2003) Biología. La vida en la Tierra. 6ta Edición. Editorial Prentice Hall.
✓ Curtis, H. Barnes, N, Schnek, A, Massarini, A (2015) Invitación a la Biología en Contexto Social. 7ma Edición.
Editorial Médica Panamericana
✓ Curtis, H.; Barnes, N. (1993) Biología. 5ta Edición en español. Editorial Médica Panamericana.
✓ Curtis, H.; Barnes, N.; Schnek, A.; Flores, G. (2000) Biología. 6ta Edición en español. Editorial Médica
Panamericana.
✓ Purves, W.; Sadava, D.; Orians, G.; Heller, H. (2004) Vida. La Ciencia de la Biología. 6ta Edición. Editorial
Médica Panamericana.
✓ Villée, C. (1996). Biología. Editorial McGraw-Hill.

Además les recomendamos utilizar algunos sitios de Internet que se encuentran detallados en nuestro blog.

Algunos consejos que te pueden ser de utilidad para realizar las tareas

A lo largo de esta guía vas a encontrar varios ejercicios en los que te pedimos que redactes párrafos relacionando
ciertos términos, o que indiques si una oración es verdadera o falsa y justifiques tu elección. Para este tipo de
ejercicios te damos algunas sugerencias que te serán útiles cuando realices las tareas:

3
Para los párrafos:
a. No necesitás definir cada término, pero será necesario que tengas muy en claro qué significan para poder
realizar la tarea. Si no lo sabés te sugerimos que lo busques en tus apuntes de clase o en la bibliografía
recomendada.
b. No te pedimos que expliques el significado de cada término pero todos deben quedar de algún modo
relacionados entre sí, te sugerimos que primero intentes encontrar la relación y luego te pongas a
escribirla.
c. No es necesario que respetes el orden en que aparecen los términos en el enunciado, pero sí es
recomendable que para cada uno mantengas la forma en que aparecen escritos.
d. Esperamos que respetes el máximo de reglones sugerido.

Para los “verdadero / falso”:


a. Consideramos que justificar no significa corregir la afirmación en el caso de que sea falsa, sino argumentar,
o sea, decir por qué pensás que es verdadera o falsa.
b. En algunos casos podrás que dar ejemplos para apoyar tu respuesta. Podrán ser los que vimos en clase o en
algunos casos podrás encontrar otros ejemplos en la bibliografía que te recomendamos.
c. Esperamos que emplees en tu respuesta no más de 4 renglones.

En general para los dos tipos de ejercicios:


a. Al terminar de escribir un texto, resulta de utilidad que lo leas en voz alta para vos mismo y/o dárselo a leer
a otra persona, de esa manera podrás detectar y corregir algunos de los errores más comunes.
b. Podés entregar la tarea manuscrita o utilizar un procesador de texto. En el primer caso te pedimos que
hagas letra clara y cuides la prolijidad, en el segundo caso te sugerimos que aproveches la función de
corrector de textos que tienen los distintos programas para revisar tu escrito.
c. Al evaluar la tarea tendremos en cuenta: la claridad de la redacción, la utilización del vocabulario específico
de la disciplina, la presencia de errores conceptuales, el cumplimiento de las reglas básicas de ortografía y
puntuación, y adecuación al espacio sugerido.

4
Características de los seres vivos

Guía de estudio
1. ¿Cuáles son las características que debe tener algo para que lo consideremos un ser vivo?
2. ¿Qué significa que los seres vivos somos sistemas abiertos? Mencioná dos ejemplos que lo demuestren.
3. ¿A qué llamamos metabolismo?
4. Señalá la diferencia entre crecimiento y desarrollo.
5. ¿En qué se diferencia el crecimiento de un organismo unicelular del de un organismo pluricelular?
6. ¿Qué entendemos por irritabilidad? Mencioná un ejemplo.
7. ¿Qué entendemos por homeostasis? Mencioná un ejemplo.
8. Definí reproducción. Da ejemplos de organismos que se reproduzcan únicamente de manera asexual, únicamente de
manera sexual y de ambas maneras.
9. ¿Cuál es la razón principal por la cual consideramos que los virus no son seres vivos?

Actividades
1) Para cada par de conceptos, redactá un breve texto que los relacione:
a. Sistema abierto – metabolismo.
b. Materia – metabolismo.
c. Energía – respiración celular.
d. Reproducción – ADN.

2) Indicá algún objeto sin vida que posea alguna de las características de los seres vivos. ¿Posee las otras propiedades
de los seres vivos?

Célula procarionte y eucarionte. Biodiversidad. Reinos

Guía de estudio
1) Sobre las células:
a. Averiguá cuáles son las principales características de todas las células.
b. ¿A qué llamamos endomembranas? ¿Qué es una organela? Mencioná tres ejemplos.
c. Señalá al menos tres diferencias entre células eucariontes y procariontes.
d. Da dos ejemplos de cada tipo.
e. Averiguá cuáles son las principales diferencias entre las células animales y las células vegetales.
f. ¿Cuál es la unidad utilizada para medir el tamaño de las células? ¿Cuál es el diámetro aproximado de una célula
procarionte y cuál el de una célula eucarionte?

2) Para poder estudiar la enorme diversidad de seres vivos, se los suele clasificar en reinos.
a. ¿Cuáles son esos reinos? Averiguá qué criterios se utilizan para clasificar a los seres vivos en esos cinco grupos.
b. ¿Cuáles son las principales diferencias entre los cinco reinos?

Actividades
1) A continuación se presentan dos esquemas.
a. ¿Qué tipo de célula es cada una? ¿Qué información usaste para darte cuenta?
b. Completá los esquemas con los nombres de los distintos componentes.
c. Dibujá un esquema de una célula procariontes y señalá los siguientes componentes: citoplasma (o protoplasma),
membrana plasmática, pared celular, ADN (o material genético), ribosomas.
d. Indicá brevemente la o las funciones principales de las siguientes estructuras: membrana plasmática, núcleo,
mitocondria, cloroplasto, ribosoma.
e. Subrayá con distintos colores las estructuras comunes a los tres tipos celulares y las que no comparten

5
1. ….............................................................. 8. …..............................................................

2. ….............................................................. 9. …..............................................................

3. ….............................................................. 10. …..............................................................

4. ….............................................................. 11. …..............................................................

5. ….............................................................. 12. …..............................................................

6. ….............................................................. 13. …..............................................................

7. ….............................................................. 14. …..............................................................

2) Discutí por qué podemos decir que una bacteria es un individuo y una célula muscular no lo es.

3) Dada la siguiente lista de elementos: sauce – levadura – manzana – virus del SIDA – espermatozoide – pulmón –
Escherichia coli – renacuajo – neurona – agua – néctar.
a. indicá cuáles son seres vivos y cuáles no.
b. indicá cuáles son células y cuáles no.

4) Realizá un cuadro comparativo entre los cinco reinos. Los ítems a comparar serán los siguientes:
- Tipo de célula (procarionte o eucarionte)
- Número de Células (unicelulares o pluricelulares)
- Obtención del alimento (autótrofo o heterótrofo)
- Tipo de reproducción (asexual o sexual)
- Rol en los ecosistemas (productor, descomponedor, consumidor)
- Ejemplos (nombre común o científico de organismos de los distintos Reinos)

5) ¿En qué reino se clasifica cada uno de los siguientes seres vivos?
ameba – medusa – ser humano – tilo – coral – levadura – musgo – Staphylococcus pneumoniae

6) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando en no más de 4 renglones:
a. El Reino Animalia incluye organismos unicelulares y pluricelulares.
6
b. El Reino Plantae agrupa a todos los organismos autótrofos.
c. Todos los organismos que se clasifican en el Reino Monera son heterótrofos.

7) Un biólogo colocó células de un hongo y células de un vegetal en distintos frascos de vidrio pero olvidó roturarlos. Si
dispusiera de un microscopio ¿Qué criterios utilizaría para poder diferenciarlos?

8) Para cada conjunto de términos, redactá un párrafo en el que queden relacionados:


a. célula eucarionte – membranas – ADN.
b. levadura – célula – núcleo.
c. bacteria – ADN – Reino Monera.
d. productor – Reino Protista – cloroplasto.

Compuestos químicos. Agua. Biomoléculas.


Guía de estudio
1) Sobre los compuestos químicos:
a. Repasá los conceptos de átomo, molécula y unión química.
b. ¿En qué se diferencian la unión covalente de la unión iónica?
c. ¿Cuál es la principal diferencia entre las moléculas orgánicas e inorgánicas? Da ejemplos de cada una.
d. ¿Qué son los grupos funcionales? Da por lo menos tres ejemplos de grupos funcionales polares y un ejemplo de
grupo funcional no polar.

2) Respondé las siguientes preguntas referidas a la molécula de agua:


a. ¿Qué átomos forman la molécula de agua (es decir, ¿cuál es su composición química)? ¿Cómo se distribuyen/qué
forma adquieren en el espacio (es decir, ¿cuál es su estructura espacial)?
b. Se considera que la molécula de agua está polarizada; investigá qué significa, y explicalo con tus palabras.
c. ¿Te parece que existirán otras moléculas que también estén polarizadas (o dicho de otra manera: otras moléculas
que sean polares como el agua)? ¿Conocés algún ejemplo?
d. Los puentes de hidrógeno permiten unir una molécula de agua con otra. Buscá información que te permita explicar
cómo ocurre esta unión, en qué casos se presenta, y si puede ocurrir con otras moléculas.
e. Buscá en un libro de texto cuáles son las propiedades de la molécula de agua, y que le permiten cumplir funciones en
los seres vivos (es decir, le confieren importancia biológica).

De acuerdo a sus características estructurales, podemos clasificar a las biomoléculas en cuatro grupos:
- Hidratos de Carbono (o carbohidratos). Son los monosacáridos, disacáridos, oligosacáridos y polisacáridos.
- Nucleótidos y ácidos nucleicos (existen solo dos tipos de ácidos nucleicos: ADN y ARN)
- Aminoácidos y proteínas.
- Lípidos. En este grupo se incluye a los triglicéridos, los fosfolípidos y otros (ceras, esteroides, terpenos).

3) Sobre las biomoléculas:


1. Indicá el significado de los siguientes términos: biomolécula, monómero, polímero.
2. Los monosacáridos son hidratos de carbono. ¿Cuál es el monosacárido más importante para los seres vivos? ¿Por
qué?
3. El almidón, el glucógeno y la celulosa son polisacáridos ¿Cuál es el monómero que los compone? ¿Cuál es la función
de cada uno de ellos?
4. ¿Cuál es la importancia del ADN para los seres vivos?
5. ¿Cuál es la función principal de las moléculas de ARN dentro de una célula?
6. ¿Cuáles son los monómeros de los ácidos nucleicos?
7. Buscá información sobre la estructura del ADN y la del ARN ¿En qué se parecen? ¿En qué se diferencian?
8. ¿Qué es el ATP? ¿Cuál es su función principal en las células?
9. ¿En qué grupo de biomoléculas se incluyen los triglicéridos? ¿Qué funciones cumplen?
10.¿En qué grupo de biomoléculas se incluyen los fosfolípidos? ¿Cuál es su función en las células?
7
11.¿Cómo están formadas las proteínas? ¿Cuáles son sus monómeros?
12.Mencioná por lo menos cinco funciones que cumplen las proteínas en los seres vivos.
13.¿Por qué es importante la estructura espacial de una proteína?

Actividades
1) Para cada par de términos, redactá un párrafo en el que queden relacionados:
a. unión covalente – polaridad.
b. ión – solubilidad en agua.
2) Realizá un cuadro comparativo entre los distintos monómeros de las biomoléculas. Los ítems a considerar son:
- Estructura
- Polaridad
- Solubilidad en agua
- Ejemplos y funciones
3) Relizá un cuadro comparativo entre los distintos polímeros biológicos. Los ítems que deberás considerar son: -
Monómero que la forma
- Nombre de la unión entre los monómeros
- Estructura (aclarar si es lineal o ramificada)
- Polaridad
- Solubilidad en agua
- Función biológica
4) Realizá un cuadro comparativo entre los triglicéridos y los fosfolípidos. Deberás compararlos en cuanto a su
estructura, su polaridad, su solubilidad en agua y sus funciones (primero escribí los ejemplos para cada uno y para cada
ejemplo su función y en el caso de los triglicéridos, diferenciá las funciones de grasas y aceites)
5) En base a la información de los cuadros, señalá una diferencia y una semejanza entre:
- la glucosa y un aminoácido
- el ATP y el ADN
- una grasa y una proteína
- la celulosa y un fosfolípido
- el ARN y una proteína
- el glucógeno y una grasa
6) Indicá si las siguientes oraciones son verdaderas o falsas. Para cada una justificá brevemente tu elección:
a. La unión glicosídica es un tipo de enlace débil.
b. La función de una proteína depende de su estructura en el espacio.
c. Los ácidos nucleicos tienen funciones energéticas.
7) Ordená los elementos de la lista según niveles de organización crecientes, nombrando cada nivel:
sistema circulatorio – H2O – hormiga – tejido muscular – una bacteria Escherichia coli – cerebro – pulmón – electrón –
cloroplasto – flor – Na+ – aminoácido – célula epitelial.

Membranas biológicas
Guía de estudio
1. ¿Cuáles son las biomoléculas que constituyen a las membranas biológicas?
2. Señalá los componentes principales de la membrana biológica representada en el dibujo.
3. Mencioná tres funciones importantes de la membrana plasmática.
4. Se dice que las membranas biológicas son mosaicos fluidos ¿A qué hace referencia el concepto de mosaico? ¿Qué
significa que las membranas biológicas son fluidas?
5. ¿Qué significa que las membranas biológicas tienen permeabilidad selectiva? ¿Cuál es la importancia de esta
propiedad? ¿Con qué función de las membranas está relacionada?
6. Mencioná los distintos tipos de transporte a través de las membranas biológicas.
7. ¿A qué se llama ósmosis?

8
Actividades
1) Realizá un cuadro comparando los mecanismos de transporte a través de membrana (difusión simple, difusión
facilitada por canales, difusión facilitada por carriers, transporte por bombas y transporte en masa). Los ítems son:
- Componentes de la membrana que intervienen en el transporte
- Relación con el gradiente de concentración? (a favor, en contra o independiente)
- ¿Gasta energía (consume ATP)?
- Polaridad y nivel de organización al que pertenecen las partículas transportadas
- Ejemplos de partículas transportadas

2) Utilizá la siguiente lista de palabras para completar los espacios en blanco en el texto (considerá que los términos
pueden usarse una vez, más de una vez o ninguna).

ACTIVO – PASIVO – CONSUME – NO CONSUME – SIMPLE – FACILITADA – LOS FOSFOLÍPIDOS – CIERTAS PROTEÍNAS –
INTEGRALES – PERIFÉRICAS – MOLÉCULAS HIDROFÍLICAS – MONOSACÁRIDOS – IONES – A FAVOR – EN CONTRA.

- La difusión a través de las membranas biológicas es un transporte ……………………, es decir que …… …………………
energía. Esto ocurre porque las partículas atraviesan la membrana ……… ..……….………… de su gradiente de
concentración.
- Los gases como el O2 y el CO2 atraviesan las membranas biológicas por difusión ………………………. Este tipo de difusión
ocurre a través de ……… ………………………... de la membrana.
- La difusión……………………….. es la que ocurre a través de …………………… ……………………….. de la membrana.
- Las proteínas que intervienen en el transporte de sustancias son ……………………...…… .
- Los canales son proteínas que permiten el pasaje de …………………….. .
- Los carriers son proteínas que permiten el pasaje de ………………..………… …………………………….. como por ejemplo
………………………………….. .
- Las bombas son proteínas que transportan ………………………. . Estas proteínas gastan ATP porque el transporte es
……… ……..…………………. del gradiente de concentración.
- El agua atraviesa las membranas por ósmosis, que es un transporte ……………..……………… .
3) Si tuvieras por un lado una célula animal y por el otro una esfera formada solo por fosfolípidos, ¿cuáles de las
siguientes sustancias podrían ingresar al interior de cada una? Justificá tus respuestas (no olvides mencionar el nivel de
organización y, cuando corresponda, la polaridad de las partículas):
Agua – oxígeno – proteínas – ácidos grasos – virus – ión cloruro (Cl-) – bacteria.
9
4) Para cada conjunto de términos, redactá un párrafo referido a la membrana plasmática que los relacione:
a. difusión – CO2 – fosfolípidos
b. glucosa – proteínas – gradiente de concentración
c. sodio (Na+) – ATP – canales
d. agua – consumo de energía – ósmosis
e. sustancias polares – transporte pasivo – proteínas

5) ¿Por qué mecanismos podrían ingresar a las células sustancias tóxicas?

6) Suponé que en el almuerzo comiste pollo con puré.


a. Seguí el recorrido de un átomo de carbono del almidón del puré desde que entra a tu boca hasta que lo encontramos
en el citoplasma de una célula muscular. Detallá el camino que seguirá a través de tu aparato digestivo y los
mecanismos de transporte que necesitarán las moléculas involucradas para atravesar las membranas.
b. Seguí el recorrido de un átomo de carbono de una proteína del pollo desde que entra a tu boca hasta que pasa a
formar parte de una proteína en una célula muscular. Detallá el camino que seguirá a través de tu aparato digestivo y
los mecanismos de transporte que necesitarán las moléculas involucradas para atravesar las membranas.

Reacciones químicas. Enzimas.


Guía de estudio
1) Sobre las reacciones químicas:
a. ¿Cuál es el significado de los siguientes conceptos: reacción química – sustrato (o reactivo) – producto?
b. ¿Qué significa que una reacción es exergónica? Definila y da un ejemplo.
c. ¿Qué significa que una reacción es endergónica? Definila y da un ejemplo.

2) Sobre las enzimas:


1. ¿Qué son las enzimas? ¿A qué grupo de biomoléculas pertenecen?
2. ¿Qué es el sitio activo de una enzima?
3. ¿Cómo actúan?
4. ¿Qué significa que las enzimas son específicas?
5. ¿Qué significa que las enzimas son saturables?
6. ¿Cómo se relaciona la estructura espacial de una enzima con la función que cumple?
7. Explicá con tus palabras la siguiente afirmación: Todas las enzimas actúan dentro de su rango de temperaturas
óptimas.
8. ¿Cómo se representa la afirmación del ítem anterior en un gráfico de ejes cartesianos? Dibujá el gráfico y explicalo.
9. ¿Cómo varía la actividad de las enzimas en función del pH? Dibujá el gráfico correspondiente y explicalo.

Actividades
Trabajo Práctico. Actividad enzimática
Materiales:
✓ Tres vasitos de café de plástico (no telgopor)
✓ Agua oxigenada de 20 o 30 volúmenes
✓ Trocitos de hígado crudo
✓ Trocitos de hígado cocido (colocar los trocitos en agua al fuego y dejarlos hervir durante por lo menos 10
minutos)
✓ Trapo y papel de diario para dejar limpio el lugar, y bolsita para tirar los materiales luego de realizado el TP.

Procedimiento:
1. Colocar los trocitos de hígado crudo en uno de los vasos y los de hígado cocido en otro.
2. Cubrir los trocitos con agua oxigenada y colocar más o menos la misma cantidad de agua oxigenada en el tercer
vaso.
3. Observar la intensidad del burbujeo y el cambio de temperatura en los tres recipientes.
4. Anotar los resultados obtenidos.
10
Cuestionario:
a. ¿Qué ocurrió en el vaso con hígado crudo? ¿A qué se deben los resultados observados?
b. ¿Qué ocurrió en el vaso con hígado cocido? ¿A qué se deben los resultados observados en este caso?
c. ¿Cuál es la función del vaso sin hígado?
d. ¿Qué esperarías observar si el experimento con hígado crudo se hubiese realizado a 5ºC? ¿Por qué?
e. Para cada grupo de términos, redactá un párrafo en el que queden relacionados:
- Catalasa – sitio activo – moléculas de oxígeno.
- Agua oxigenada – burbujeo – desnaturalización.

1) La maltosa es un disacárido formado por dos moléculas de glucosa unidas entre sí mediante una unión glicosídica. La
enzima maltasa reconoce a la maltosa y rompe dicha unión. De esta manera se obtienen dos moléculas de glucosa
libres.
a. Representá esta información con un esquema o dibujo.
b. Indicá cuál de las dos oraciones está bien expresada y cuál no:
- La maltasa cataliza la reacción de ruptura de la maltosa.
- La maltasa cataliza a la maltosa.

2) Para cada uno de los siguientes conjuntos de términos, redactá un párrafo en el que queden relacionados:
a. Enzima – sitio activo – producto.
b. Inactivación – estructura – unión al sustrato.
c. Altas temperaturas – función – sitio activo.
d. Actividad enzimática – saturación – sustrato.

3) Se tienen bacterias de aguas templadas en tres cultivos, que presentan condiciones adecuadas para su crecimiento y
reproducción. La única diferencia entre los tres cultivos es la temperatura: El primero está a 2°C, el segundo a 20°C y el
tercero a 45°C. ¿Qué suponés que ocurrirá con el crecimiento y reproducción de las bacterias en cada cultivo? Justificá
tus respuestas en base a lo visto sobre la actividad de las enzimas.

4) Suponé que te invitan a comer un bife con papas fritas.


a. ¿Cuáles son los principales alimentos que estás ingiriendo?
b. Seguí el recorrido de un átomo de carbono de una proteína desde que entra a tu boca hasta que está listo para ser
absorbido como el monómero correspondiente.
c. Seguí el recorrido de un átomo de carbono de almidón desde que entra a tu boca hasta que está listo para ser
absorbido como el monómero correspondiente
d. Seguí el recorrido de un átomo de carbono correspondiente a un lípido desde que entra a tu boca hasta que está
listo para ser absorbido como el monómero correspondiente

5) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
a. Todas las enzimas alcanzan su máxima actividad a 37°C.
b. La estructura primaria de una enzima depende de la estructura terciaria de la misma.
c. Las proteínas de la carne que ingerimos pasan a formar parte de nuestras proteínas con la misma estructura terciaria
que poseían en la vaca.
d. Todas las enzimas se desnaturalizan a pH=2.
e. Las enzimas se saturan por exceso de producto.

Metabolismo

Guía de estudio
1. ¿Qué es un proceso metabólico? ¿Cuál es la relación entre reacción química y proceso metabólico?
2. ¿Cómo pueden clasificarse los procesos metabólicos desde el punto de vista de la energía? ¿Y de la materia?
3. Mencioná cuatro procesos metabólicos y clasificá a cada uno desde el punto de vista de la materia y de la energía.
4. ¿Cuál es la función del ATP en el metabolismo celular?

11
Actividades
1) Observá las siguientes ecuaciones y respondé:

ENZIMA 1
molécula A + molécula B molécula C

ATP ADP + P

ENZIMA 2
molécula C + molécula D molécula E

ATP ADP + P

ENZIMA 3
molécula E + molécula F molécula G

ATP ADP + P

1. ¿Por qué podemos decir que estas tres reacciones constituyen un proceso?
2. ¿Cuáles son los sustratos de este proceso?
3. ¿Cuál es el producto principal de este proceso? ¿Qué otros productos se obtienen?
4. ¿Qué función cumplen las moléculas C y E en este proceso?
5. ¿Cómo se clasifica este proceso desde el punto de vista de la materia? Justificá tu respuesta.
6. ¿Cómo se clasifica este proceso desde el punto de vista de la energía? Justificá tu respuesta.
7. ¿Por qué en cada reacción interviene una enzima diferente? Justificá tu respuesta.

2) Las siguientes ecuaciones representan reacciones químicas y procesos metabólicos.


a. Para cada una, indicá si representa una reacción o un proceso.
b. Para cada una indicá cómo es desde el punto de vista de la energía.
c. Sólo para los procesos, indicá cómo son desde el punto de vista de la materia.

1 ADP + P ATP
2 glucosa + O2 CO2 + H2O
3 glucógeno glucosa
4 monosacárido + monosacárido disacárido
5 aminoácidos proteína
6 ATP ADP + P

Respiración celular aeróbica y fermentación


Guía de estudio
1. ¿Qué entendemos por “respiración” en el lenguaje cotidiano? Diferenciá este concepto del de respiración celular.
2. ¿Qué organismos realizan respiración aeróbica? ¿En qué Reinos se los clasifica?
3. ¿Cuál es la importancia biológica de este proceso metabólico?
4. Decimos que la glucosa es alimento para los seres vivos, dado que nos aporta tanto materia como energía. ¿Cuál de
las dos funciones es la que cumple en la respiración celular? Para que pueda cumplir dicha función ¿qué le ocurre
durante el proceso?
5. ¿Por qué se denomina respiración aeróbica? ¿Cómo la diferenciarías de la respiración anaeróbica?
6. ¿Cuáles son los productos de la respiración celular aeróbica?
12
7. Teniendo en cuenta las respuestas anteriores escribí la fórmula general (o ecuación global) del proceso.
8. ¿Cómo es este proceso desde el punto de vista de la materia y de la energía? Justificá tu respuesta.
9. ¿Cuál es la organela responsable del proceso en células eucariontes? Realizá un esquema de esta organela,
señalando sus partes principales.
10. ¿Cuántas etapas tiene el proceso, cómo se denominan y dónde ocurre cada una en una célula eucariota?
11. La respiración celular es un proceso de óxido-reducción. ¿Qué significa esto? Observando la ecuación global, ¿cuál
es la molécula que se oxida (pierde átomos de hidrógeno) y cuál es la que se reduce (los recibe)?
12. ¿Cuál es la molécula que cumple el rol de intermediario de óxido-reducción? ¿En qué consiste ese rol?
13. Además de la respiración ¿conocés otros procesos metabólicos que se utilizan para obtener energía de la
degradación del alimento? ¿Qué organismos los realizan?

Actividades
1) Tomando como modelo el esquema de la respiración aeróbica, confeccioná uno que represente la fermentación
láctica y otro que represente la fermentación alcohólica.

2) Realizá un cuadro comparativo entre la glucólisis, la decarboxilación oxidativa, el Ciclo de Krebs, la cadena
respiratoria, la fosforilación oxidativa, la fermentación láctica y la alcohólica, teniendo en cuenta los siguientes ítems:
- sustratos
- productos
- lugar de la célula donde ocurre

3) Indicá si las siguientes oraciones son verdaderas o falsas, justificando brevemente:


a. La glucólisis es una reacción exergónica.
b. Los organismos facultativos realizan respiración aeróbica en presencia de oxígeno y respiración anaeróbica en su
ausencia.
c. En la cadena respiratoria el oxígeno molecular (O2) se oxida a agua (H2O).
d. Durante la fermentación láctica ocurre la oxidación total de la glucosa.
e. Los hongos realizan fermentación alcohólica para obtener etanol.
f. Las levaduras producen más CO2 en la fermentación que en la respiración aeróbica.

4) Un estudiante de biología colocó levaduras en un tubo de ensayos y células musculares en otro. En ambos tubos
colocó además glucosa como fuente de energía, pero en ausencia de oxígeno. Por inexperiencia olvidó rotular los tubos.
Usando sus conocimientos sobre los procesos de obtención de energía a partir de la glucosa, ¿cómo podría averiguar
cuál es cada tubo?

5) Suponé que almorzás un bife con arroz.


a. ¿Podría ocurrir que un átomo de C del almidón del arroz pase después de un rato a formar parte de una molécula de
CO2 producida en una célula de tu piel? Justificá tu respuesta con el recorrido correspondiente.
b. ¿Podría ocurrir que un átomo de C del almidón del arroz pase después de un rato a formar parte de una proteína
producida en una célula muscular? Justificá tu respuesta con el recorrido correspondiente.
c. Seguí el recorrido de un átomo de C que forma parte de una proteína del bife desde que ingresa a la boca de una
persona hasta que se encuentra formando parte de un lípido en una célula del corazón.
d. Seguí el recorrido de un átomo de C que forma parte de una molécula de grasa del bife desde que ingresa a la boca
de una persona hasta que se encuentra formando parte del glucógeno en una célula del hígado.

6) Las células vegetales tienen una pared de celulosa, que ellas mismas producen.
a. ¿La síntesis de celulosa es un proceso anabólico o catabólico? Justificá tu respuesta.
b. Redactá un párrafo en el que se relacione este proceso con los siguientes conceptos: O2 – NADH – ATP.

7) Completá el siguiente esquema que resume las etapas de la respiración celular aeróbica (si falta alguna flecha,
agregala también):

13
GLUCOSA

ADP+ P Glucólisis ………….

…………… NADH2

ÁCIDO PIRÚVICO
Coenzima A

Decarboxilación
……..……. del ácido
…………
pirúvico

…………
……..……………………

ADP + P
O2

Ciclo
de Cadena
……..…… Krebs NADH2 respiratoria …..………
y fosforilación
oxidativa

Coenzima A
…………… …………
..………

8) En un laboratorio se tienen los siguientes cultivos de bacterias:


- Cultivo 1: bacterias aerobias estrictas, en presencia de O2
- Cultivo 2: bacterias aerobias estrictas, en ausencia de O2
- Cultivo 3: bacterias facultativas en presencia de O2
- Cultivo 4: bacterias facultativas en ausencia de O2
Indicá qué ocurre con el crecimiento y la reproducción de las bacterias en cada caso. Justificá tus respuestas de la
manera más completa posible.

9) En un laboratorio se tienen células aerobias estrictas en cultivo. Se estudia el ingreso a dichas células de dos
sustancias, que llamaremos A y B. Se realiza el experimento en dos condiciones distintas: en presencia y en ausencia de
oxígeno. La sustancia A entra a las células a la misma velocidad en ambas condiciones, en cambio la sustancia B sólo
14
entra a las células en presencia de oxígeno. De acuerdo a estos datos:
a. ¿Qué tipo de sustancia podría ser A? Justificá tu respuesta.
b. ¿Qué tipo de sustancia podría ser B? Justificá tu respuesta.

Fotosíntesis
Guía de estudio
1. ¿Cómo se denomina a los organismos que producen su propio alimento?
2. ¿En qué reinos se clasifican dichos organismos?
3. ¿Cuál es el principal “alimento” al que hace referencia la primera pregunta?
4. ¿Qué moléculas inorgánicas usan como sustrato para producirlo?
5. Además del producto principal, ¿qué otro producto se obtiene?
6. De dónde proviene la energía?
7. De acuerdo a las respuestas anteriores, escribí la fórmula general (o ecuación global) de la fotosíntesis.
8. ¿Cómo es este proceso desde el punto de vista de la materia y de la energía? Justificá tu respuesta.
9. Vimos que la respiración celular es un proceso de óxido-reducción, y que el NAD funciona como intermediario,
uniéndose transitoriamente a átomos de hidrógeno (H). ¿Sucede algo similar en la fotosíntesis? ¿Cuál es la
molécula responsable? ¿Cuál es la molécula que se oxida (pierde átomos de hidrógeno) y cuál es la que se reduce
(los recibe)?
10. ¿En qué momento del día ocurre? ¿Por qué?
11. ¿Cuál es la molécula sensible a la luz?
12. ¿En qué organela ocurre en células eucariontes?
13. ¿Cuál es la importancia biológica del proceso? (tené en cuenta los dos productos del mismo).

Actividades
1) Completá los recuadros en el esquema:

ADP + P Etapa Etapa


Fotoquímica Bioquímica
NADPH2

2) Teniendo en cuenta los sustratos y productos de cada etapa, en el esquema pueden agregarse dos flechas más
¿Cuáles son? Dibujalas y explicá con tus palabras su significado biológico. (Atención: no se pide que agregues palabras,
solamente dos flechas).

3) Explicá con tus palabras:


a. ¿Por qué la etapa fotoquímica es dependiente de luz?
b. ¿Por qué la etapa bioquímica no depende directamente de la luz?
c. ¿Por qué, si bien la etapa bioquímica no depende directamente de la luz, se sabe que no puede ocurrir en ausencia
prolongada de luz?

4) Realizá un cuadro comparativo entre la etapa fotoquímica y la etapa bioquímica de la fotosíntesis teniendo en cuenta
los siguientes ítems: - sustratos
- productos
- lugar de la célula donde ocurren.

5) Las sales de nitrógeno (N) y de fósforo (P) son fundamentales en la vida de un organismo autótrofo como una planta
¿Por qué?

15
6) Para cada uno de los siguientes conjuntos de términos, redactá un párrafo de no más de ocho renglones. En cada
párrafo los términos deben estar relacionados entre sí:
a. Fotosíntesis – NADPH – O2.
b. Etapa bioquímica – ATP – glucosa.
c. NADPH2 – ATP – síntesis de proteínas.

7) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente tu elección:
a. En la fotosíntesis las moléculas de CO2 aportan los átomos de C para sintetizar glucosa y son transformadas en
moléculas de O2.
b. Las plantas respiran solo de noche y realizan fotosíntesis solo durante el día.
c. Todos los productos de la etapa fotoquímica son sustratos de la etapa bioquímica.
d. Tanto el agua como las sales minerales que las plantas toman del suelo se usan en la fotosíntesis.
e. El ATP producido en la etapa fotoquímica puede utilizarse en cualquier proceso anabólico que ocurra en la célula
autótrofa.

Integración
1) Confeccioná un cuadro comparativo entre la respiración celular aeróbica y la fotosíntesis, considerando los siguientes
ítems:
- Sustratos
- Productos
- Relación con la luz
- Clasificación según la materia y la energía
- Organela responsable en células eucariotas
- Etapas
- Organismos que la llevan a cabo

2) Discutí la validez de las siguientes afirmaciones:


a. El ATP es un intermediario metabólico en la fotosíntesis, pero no cumple dicha función en la respiración celular.
b. Los organismos heterótrofos realizan respiración y no realizan fotosíntesis, mientras que los organismos autótrofos
realizan fotosíntesis y no respiración.
c. Tanto el O2 como la glucosa que se obtienen como producto de la fotosíntesis podrán ser usados por el mismo
organismo que los produjo.
d. Tanto el O2 como la glucosa que produce un organismo autótrofo podrán ser usados por otros organismos.

3) Imaginá una planta de papas.


a. ¿podría ser que un átomo de C de una molécula de CO2 del aire se encuentre luego formando parte de una molécula
de glucosa en el citoplasma de una célula de una hoja? Justificá tu respuesta.
b. ¿podría ser que ese mismo átomo de C pase luego a formar parte del almidón que se encuentra en una célula de la
raíz? Justificá tu respuesta.

4) Si alguno de nosotros come una papa de esa planta:


a. ¿Podríamos encontrar después de un rato el átomo de C del ejercicio anterior formando parte de una molécula de
glucosa en una célula de la piel? Justificá tu respuesta.
b. ¿Podríamos encontrar ese átomo de C luego de un tiempo formando parte de una proteína en una célula muscular?
c. ¿Qué otras moléculas podrían originarse en esa célula a partir de esa glucosa? Nombrá por lo menos cuatro.

5) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente tu elección:
a. Un átomo de C presente en una molécula de CO2 en el aire, podría encontrarse luego de un tiempo formando parte
de una molécula de glucosa dentro de un consumidor.
b. Un átomo de C de una molécula de CO2 que ingresó a la hoja de una planta se podría encontrarse después de un
tiempo saliendo de una célula de la raíz de esa misma planta formando parte de otra molécula de CO2.

6) Suponé que comés puré de papas. Seguí el recorrido del átomo de carbono del almidón desde que entra a tu boca
hasta que pasa a formar parte de una molécula de un lípido en la raíz de una planta. Decí cómo se digiere ese alimento,
mencioná las moléculas de las que forma parte ese carbono y los mecanismos de transporte de esas moléculas a través

16
de las membranas.

Más actividades
1) Leé el siguiente texto, extraído y modificado de Biología, de Curtis y Barnes:
A lo largo de todo este libro hemos enfatizado que la vida sobre la tierra depende de la energía radiante del sol, que es
convertida por los organismos fotosintéticos – principalmente plantas y algas – en la energía química almacenada en los
enlaces de moléculas orgánicas. Aunque se conocen desde hace mucho tiempo bacterias quimioautótrofas que no
dependen de la energía de la luz solar para accionar sus reacciones fijadoras de carbono, estas bacterias se
consideraban hasta hace poco como poco más que curiosidades. Sin embargo, una serie de descubrimientos que
comenzaron en 1977 revelaron la existencia de ecosistemas enteros en los que los productores primarios son bacterias
quimioautótrofas.
Recientemente se han hallado ecosistemas de este tipo en el Pacífico, y en todos ellos las bacterias quimioautótrofas
son los productores primarios de una trama alimentaria compleja. Entre los habitantes más espectaculares se
encuentras las almejas, que miden hasta 20 centímetros de diámetro y cubren el piso de lava. Otros habitantes
permanentes incluyen mejillones, cangrejos y pulpos. Las almejas y mejillones se alimentan de las bacterias y sirven de
alimento a los crustáceos y pulpos.

a. ¿Por qué el texto plantea que “la vida sobre la tierra depende de la energía radiante del sol”? Justificalo brevemente.

b. En el texto se sostiene que la energía radiante del sol se almacena en los enlaces de moléculas orgánicas:
- ¿A qué moléculas orgánicas se refiere?
- ¿Cómo se denomina el proceso al que hace referencia?
- ¿Qué organismos lo realizan?

c. Completá el siguiente cuadro comparativo, referido a los organismos mencionados en el texto:


bacteria
cangrejo alga planta
quimioautótrofa
Obtención del alimento
Reino en que se clasifican
Número de células
Tipo de células

2) Confeccioná un cuadro comparativo entre el ceibo (un árbol), Escherichia coli (una bacteria heterótrofa) y
Saccharomyces cerevisiae (una levadura), en cuanto a tres características que consideres relevantes.

3) Indicá dos semejanzas y dos diferencias entre:


a. Un organismo perteneciente al Reino Monera y uno perteneciente al Reino Vegetal.
b. Una célula de la hoja de una planta y una célula del músculo de un animal.
c. Una bacteria heterótrofa y un protozoo.

4) Para cada par de términos, redactá una oración que los relacione:
a. cloroplasto – autótrofos
b. célula – núcleo
c. célula – fisión binaria
d. ADN – citoplasma

5) Para cada uno de los siguientes conjuntos de términos, redactá un párrafo de aproximadamente cinco renglones. En
cada párrafo los términos deben estar relacionados entre sí:
a. Célula – metabolismo – organelas
b. Célula – sistema abierto – membrana plasmática
c. Célula procarionte – membranas – ADN
6) Indicá si las siguientes oraciones son verdaderas o falsas, justificando tu elección:
17
a. Si un organismo es eucarionte, pluricelular y heterótrofo, es seguro que pertenece al Reino Animal.
b. Si un organismo es eucarionte, pluricelular y autótrofo, es seguro que pertenece al Reino Vegetal.
c. Todas las células presentan una membrana plasmática, un citoplasma y un núcleo.
d. Las proteínas son polímeros de monosacáridos.
e. El ATP es un aminoácido con función energética.
f. La temperatura óptima de las enzimas es de 37ºC.
g. La desnaturalización de una proteína es la pérdida de su estructura espacial, sin pérdida de su función.

7) Para cada uno de los siguientes conjuntos de términos, redactá un párrafo en el que queden relacionados:
a. Agua – puente de hidrógeno – moléculas polares.
b. Reacción endergónica – energía – unión.
c. Enzima – especificidad – producto.
d. Temperatura – inactivación – producto.
e. Desnaturalización – sitio activo – sustrato.

8) En los lagos de aguas templadas viven muchas especies de bacterias. El rango óptimo de temperaturas de las enzimas
de dichas bacterias es de 18ºC – 23ºC.
a. ¿Qué ocurrirá con la actividad de esas enzimas si se las coloca en un medio a 5ºC? ¿Por qué?
b. ¿Qué ocurrirá con la actividad de esas enzimas si se las coloca en un medio a 35ºC? ¿Por qué?

peptidil transferasa
9) Dada la siguiente reacción: aminoácido 1 + aminoácido 2 dipéptido
a. Redactá un breve párrafo referido a la actividad de esta enzima, que contenga los siguientes conceptos: peptidil
transferasa – sustratos – unión fuerte – cataliza.
b. ¿Cómo se llama la unión que se formó?
c. ¿Esta reacción es exergónica o endergónica? Justificá tu respuesta.

10) Las ATPasas son una familia de enzimas que catalizan la siguiente reacción: ATP → ADP + P
a. ¿Esta reacción es exergónica o endergónica? ¿Por qué?
b. Indicá si las siguientes oraciones son V o F y justificá tu elección:
- El ATP es sustrato de esta reacción.
- La ATPasa es sustrato de esta reacción.
c. ¿Qué ocurriría en una célula si todas sus ATPasas dejaran de actuar? Justificá tu respuesta.

11) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente tu elección.
a. Todos los organismos respiran.
b. Todos los organismos realizan glucólisis.
c. Para realizar respiración aeróbica, las células requieren de la presencia de mitocondrias.
d. La glucólisis es un proceso de degradación total de la glucosa.
e. Las plantas son los únicos organismos autótrofos.
f. La fotosíntesis es un proceso anabólico.
g. Las plantas fotosintetizan para obtener ATP para sus procesos anabólicos.
h. La fotosíntesis es un proceso catabólico porque se degrada el agua y se obtiene oxígeno.
i. Una planta requiere solo agua, luz y CO2 para sintetizar todas las biomoléculas que necesita.
j. Todo el oxígeno producido por los organismos fotosintéticos, será utilizado por los organismos no fotosintéticos.

12) Para cada uno de los siguientes conjuntos de términos, redactá un párrafo en el que queden relacionados:
a. Etapa fotoquímica – clorofila – glucosa.
b. Energía lumínica – CO2 – ATP.
c. Etapa bioquímica – H2O – NADP.
d. Intermediario metabólico – ADP – fotosíntesis.
e. Proceso anabólico – CO2 – alimento.

13) Para cada uno de los siguientes conjuntos de términos, redactá un párrafo de aproximadamente ocho renglones. En
cada párrafo los términos deben estar relacionados entre sí:
18
a. reacción endergónica – catabolismo – ATP – enzimas
b. proceso anabólico – oxígeno – ATP – energía
c. proceso catabólico – etanol – NAD – oxígeno
d. procesos catabólicos – materia – heterótrofos – producción de alimento
e. etapa bioquímica – intermediario – ADP – procesos catabólicos
f. glucólisis – intermediarios – NAD – autótrofos

14) Para cada proceso o etapa indicá con una cruz en qué célula puede ocurrir:

célula célula de
neurona levadura Lactobacillus cianobacteria
muscular una hoja
Glucólisis

Ciclo de Krebs

Ciclo de Calvin

Síntesis de almidón

Síntesis de proteínas

Fermentación láctica

Fermentación alcohólica

Síntesis de fosfolípidos

Síntesis de celulosa

15) Nos situamos dentro de una célula de la hoja de una planta, que está produciendo glucosa. Para cada proceso de la
lista, indicá: a) si la glucosa es sustrato o no de ese proceso, y b) si el proceso puede ocurrir o no en esa célula. Justificá
brevemente todas tus respuestas.
- síntesis de celulosa
- respiración celular
- fotosíntesis
- síntesis de glucógeno
- fermentación
- síntesis de proteínas

16) Para cada conjunto de términos, redactá un párrafo que los relacione:
a. procesos anabólicos – heterótrofos – materia orgánica – productores
b. procesos catabólicos – autótrofos – materia inorgánica – consumidores

17) Las proteínas constituyen un alimento que no aporta grandes cantidades de energía. Sin embargo, cuando una persona
ingiere grandes cantidades de proteínas termina aumentando las reservas de lípidos y engordando. ¿Cómo lo explica?

18) Seguí el recorrido del átomo de carbono de una proteína que formaba parte del bife que comiste en el almuerzo
hasta que pasa a formar parte de una proteína que se encuentra en la célula de la hoja de una planta cualquiera, por
ejemplo, en tu jardín.

Reproducción. Ciclo celular. Duplicación del ADN.

Guía de estudio
1. ¿Cuáles son las principales diferencias entre la reproducción sexual y la reproducción asexual?
19
2. ¿A qué llamamos fisión binaria?
3. ¿Cuáles son las fases o períodos del ciclo celular eucarionte y qué eventos importantes ocurren en cada una de ellas?
4. ¿Cuál es la importancia del proceso de duplicación del ADN y cómo se relaciona con la reproducción?
5. Repasá la estructura del ADN. Explicá qué significa que las cadenas son complementarias.
6. Clasificá al proceso de duplicación del ADN según la materia y según la energía. Justificá tu respuesta indicando
claramente cuáles son los sustratos y cuáles son los productos de este proceso.
7. ¿Qué es la cromatina y cómo está compuesta? ¿En qué etapas del ciclo celular se puede observar?
8. ¿Qué son los cromosomas? ¿En qué etapas del ciclo celular se pueden observar? ?¿Cuál es la diferencia entre
cromatina y cromosomas?
9. ¿En qué se diferencian un cromosoma simple y un cromosoma duplicado? ¿A qué se llama cromátides hermanas?

Actividades
1) Ubicá las fases del ciclo celular eucarionte en el siguiente gráfico:

Cantidad de ADN

Períodos del ciclo celular

2) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
1. Los organismos unicelulares se reproducen asexualmente, mientras que los pluricelulares se reproducen
sexualmente.
2. Cuando una célula eucariota pasa por el período S del ciclo celular, su contenido de ADN aumenta al doble.
3. Las células procariontes no duplican su ADN.
4. Si una célula se va a dividir, previamente debe duplicar su ADN.
5. En la duplicación del ADN se utilizan nucleótidos monofosfatados como sustratos.
6. La duplicación del ADN es un proceso catabólico.
7. La enzima ADN polimerasa es un sustrato del proceso de duplicación del ADN.
8. La duplicación del ADN es semiconservativa.
9. En las células eucariontes las cromátides hermanas se forman durante la división celular.
10. Si una célula eucarionte no dispone de timina ni puede sintetizarla, su ciclo celular se detendrá.

3) Dada la siguiente cadena de ADN, escribí abajo la cadena complementaria:

GAACTAGCTAACGATTCATGG

……………..…………….……………………………………..

4) Se quiere obtener de forma experimental copias de moléculas de ADN.


a. ¿Qué elementos agregarías en un tubo de ensayo para lograr ese objetivo?
b. De los elementos mencionados en el punto anterior ¿cuáles son sustratos y cuáles son productos?
c. ¿A qué temperatura obtendría mayor cantidad de producto por unidad de tiempo: a 37°C ó a 4°C?
d. ¿Qué resultado se espera obtener si en el tubo de ensayo se agregan ribonucleótidos en vez de
desoxiribonucleótidos? Justificá tu respuesta.

20
Mitosis y meiosis
Guía de estudio
1. ¿Qué es un cariotipo? Averiguá cómo es el cariotipo humano y qué información se puede obtener de él.
2. ¿Cuál es la importancia biológica de la mitosis? En tu respuesta diferenciá las funciones de la mitosis en los
organismos pluricelulares de su función en organismos unicelulares.
3. ¿Qué organismos se reproducen por mitosis y qué organismos se reproducen por fisión binaria? Nombrá ejemplos.
4. Mencioná cuáles son las fases de la mitosis y los principales eventos que ocurren en cada una de ellas.
5. En un organismo pluricelular, ¿en qué se diferencian las células somáticas de las gametas?
6. ¿Qué significa que una célula es diploide? ¿Qué son los cromosomas homólogos?
7. ¿Qué significa que una célula es haploide?
8. En muchas especies las gametas son haploides. ¿Por qué? ¿Mediante qué proceso de división se obtienen? ¿Cuál es
la importancia de este proceso y cómo se relaciona con la reproducción sexual?
9. Mencioná cuáles son las fases de la meiosis y los principales eventos que ocurren en cada una de ellas.

Actividades
1) Sobre los cariotipos:
a) :Observá el siguiente cariotipo y contá cuantos cromosomas aparecen
b) ¿Cómo aparecen ordenados los cromosomas en un cariotipo?¿Por qué los cromosomas están ubicados de a
pares?
c) ¿A quién te parece que puede pertenecer este cariotipo?
d) ¿Por qué el último par no tiene dos cromosomas de igual tamaño como el resto? ¿A qué puede deberse esto?
e) ¿Por qué los cromosomas tienen distinto tamaño? ¿Será que en todos los cromosomas se repite la misma
información?
f) ¿Por qué algunos cromosomas son más grandes y otros más chicos?
g) Si miraras el cariotipo de otra persona, ¿qué información tendrías de ella sin conocerla? ¿Podrías saber su color
de ojos, o su color de pelo por ejemplo?

Imagen extraida de: https://sites.google.com/site/daccilavinia/scienze/la-genetica?tmpl=%2Fsystem%2Fapp%2Ftemplates%2Fprint%2F&showPrintDialog=1

h) ¿Cuál es su utilidad? ¿Para qué puede servir comparar cariotipos de la misma especie? ¿Y de distinta especie?
a. ¿Cuál es el número característico de cromosomas en la especie humana?
b. ¿Cómo se determina el sexo en nuestra especie?

2) Indicá si las siguientes oraciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
1. Una cromátide contiene una secuencia de ADN idéntica a la de su cromátide hermana.
2. Una célula resultante de la división mitótica tiene la misma cantidad de ADN que la célula madre en G2.

21
3. Una célula 2n=6 tiene 6 cromosomas, con una cromátide cada uno.
4. Los cromosomas homólogos son idénticos en cuanto a la forma y a la información que contienen.
5. La presencia o ausencia de cromátides hermanas determina si una célula es diploide o haploide.
6. Si después de formarse la cigota se inhibe la acción de la ADN polimerasa, el desarrollo del nuevo individuo se
detendrá.

3) Para cada célula observá el número y la forma de sus cromosomas e indicá su complemento cromosómico:

………..… ……..…… ……..…… ……..……

4) a. Para cada fase de la mitosis, indicá su nombre y el complemento cromosómico.


b. En cada dibujo señalá, si fuera posible, un par de cromosomas homólogos y un par de cromátides hermanas.

5) En una especie cuya ploidía es 2n=6, las células presentan en G1 una cantidad de ADN de 80 picogramos. En base a
estos datos completá el cuadro:

Etapa del ciclo Nº de Cantidad Nº de cromátides Nº de moléculas


(célula somática) cromosomas de ADN por cromosoma de ADN en la célula
G1

G2

Metafase
En cada polo
de telofase

6) a. Para cada fase de la meiosis, indicá su nombre y el complemento cromosómico.


22
b. En cada dibujo señalá, si fuera posible, n par de cromosomas homólogos y un par de cromátides hermanas o
recombinantes.

7) Indicá los períodos del ciclo celular en el gráfico:


Cantidad
de ADN

Períodos del ciclo celular

8) ¿Cuáles son las fuentes de variabilidad genética de la meiosis? ¿En qué fase ocurre cada una?

9) Indicá si las siguientes oraciones son verdaderas o falsas, justificando brevemente todas tus respuestas:
a. Una población de papas reproducidas sexualmente presenta mayor variabilidad genética que una población de la
misma especie reproducida asexualmente.
b. En la primera división meiótica se generan dos células diploides.

23
c. La segregación de cromosomas homólogos que ocurre en anafase I genera variabilidad genética.
d. Los cromosomas homólogos son idénticos en cuanto a la forma y a la información que contienen.
e. La presencia o ausencia de cromátides hermanas determina si una célula es diploide o haploide.

10) Completá el cuadro teniendo en cuenta que se parte de una célula 2n=8, que en G1 posee 30 picogramos de ADN

Cantidad Número de Nº de moléculas


de ADN cromosomas de ADN en la célula
G1

G2

Metafase
Migrando a cada
polo en Anafase
En una célula hija
recién formada

11) En una especie cuya ploidía es 2n=6, las células presentan en G1 una cantidad de ADN de 80 picogramos. En base
a estos datos completá el cuadro:

Etapa del ciclo Nº de Cantidad Nº de cromátides Nº de moléculas


(célula germinal) cromosomas de ADN por cromosoma de ADN
G1

G2

Metafase I
En cada polo
de telofase I
Metafase II
En cada polo
de telofase II

12) Completá el cuadro comparativo:


MITOSIS MEIOSIS
Células en las que se produce
(procariontes o eucariontes)
¿Genera variabilidad genética?
Presencia de cromosomas
homólogos
Apareamiento de cromosomas
homólogos
Cantidad de ADN en cada
célula hija respecto a la original
Número de divisiones
(una o dos)
Tipo de división
(ecuacional o reduccional)
¿Requiere de la duplicación
previa del ADN?
24
13) Completá el cuadro teniendo en cuenta que se parte de una célula 2n=46 y que en G2 posee 40 picogramos de
ADN

Número de Número de cromátides


Cantidad de ADN
cromosomas por cromosoma
G1

G2

Metafase I
Migrando a cada
polo en Anafase I
Metafase II
Migrando a cada
polo en Anafase II
En una célula hija
recién formada

14) Confeccioná párrafos de aproximadamente 5 renglones, relacionando los conceptos:


a. cromátides hermanas – ADN polimerasa – mitosis
b. cigota - mitosis - crecimiento
c. variabilidad genética - meiosis - fecundación
d. cromátides hermanas - cromosomas homólogos - ploidía
e. cromátides hermanas - cromátides recombinantes - profase I

15) Para cada célula, indicá el tipo de división que está ocurriendo, la fase en la que se encuentra y su complemento
cromosómico:

25
Genética, Leyes de Mendel
Guía de estudio
1. Averiguá el significado de los siguientes conceptos: alelo – alelo dominante – alelo recesivo – homocigota –
heterocigota.
2. Luego de leer un texto sobre las leyes de Mendel, escribí con tus palabras en qué consistieron sus experimentos.
3. ¿Qué postula la llamada Primera Ley de Mendel?
4. ¿Qué postula la llamada Segunda Ley de Mendel?

Actividades
1) En las ratas de laboratorio el color de pelo negro domina sobre el blanco. En un laboratorio se tienen una rata
macho de pelo negro y una rata hembra de pelo blanco. Se realiza el cariotipo de una célula somática de cada uno
de ellos y se localizan los lugares donde se encuentra la información para dicho carácter. Como convención
usaremos “N” para representar la variante “pelo negro” y “n” para representar la variante “pelo blanco”. Se
obtiene lo siguiente:

Cariotipo del macho: Cariotipo de la hembra:

NNNNnnnn

a. ¿Cuál es la ploidía de esta especie?


b. Dibujá el cariotipo de una gameta del macho y el cariotipo de una gameta de la hembra.
c. Supongamos que una gameta cualquiera del macho fecunda a una gameta cualquiera de la hembra. Dibujá el
cariotipo de la cigota resultante.
d. ¿Cómo será el cariotipo de cualquiera de las células somáticas de los descendientes de esta pareja? ¿Por qué?
e. ¿Qué color de pelo tendrán los descendientes? ¿Por qué?

2) Problemas de genética. Primera ley de Mendel.

Resolvé los siguientes problemas de genética.


No olvides justificar todas las respuestas con las explicaciones y/o los cruzamientos necesarios.

1. En los ogros el color de piel verde domina sobre el color de piel azul.
a. Completá el cuadro:

gen estudiado alelos letra

b. Indicá todos los genotipos posibles para un ogro azul y para un ogro verde.
c. ¿Puede una pareja de ogros azules tener un ogrito de piel verde?
d. ¿Cómo deben ser genotípicamente Shrek y Fiona (que son verdes) para poder tener un ogrito de piel azul?

2. El factor Rh presenta dos alelos: Rh+ domina sobre Rh–.


a. Completá el cuadro:
26
gen estudiado alelos letras

b. Paula es heterocigota para el factor Rh, y Martín es homocigota dominante para este mismo gen. ¿Cuál es la
probabilidad de que esta pareja tenga un hijo de factor Rh–?
c. Ana tiene sangre factor Rh+ y Juan tiene sangre factor Rh– ¿Cuál es la probabilidad de que esta pareja tenga un
hijo de factor Rh+? Si corresponde, planteá todos los casos posibles.

3. Una mujer Rh+ tiene un hijo Rh–.


a. ¿Cuáles son sus genotipos?
b. Indicá los posibles genotipos del padre.
c. ¿Podría esa mujer tener hijos Rh+? Justificá tu respuesta.

4. El albinismo es una enfermedad genética recesiva. Dos personas no albinas (A_) tienen un hijo albino (aa). En
base a esta información:
a. ¿Cuál es la probabilidad de que su segundo hijo manifieste ese rasgo?
b. Dibujá una célula somática de uno de los padres, indicando cromosomas homólogos y alelos (suponer 2n=4)

5. Tres hermanos presentan los siguientes fenotipos y genotipos: uno tiene el lóbulo de la oreja separado, y es
heterocigota; otro tiene el lóbulo de la oreja separado, y es homocigota, y el tercero tiene el lóbulo de la oreja
unido.
a. ¿Cuál es el alelo dominante?
b. ¿Cuál es el genotipo y el fenotipo de los padres?

6. En las ratas de laboratorio el carácter cola larga domina sobre el carácter cola corta. Si tenés una rata de cola
larga ¿Cómo harías para averiguar su genotipo?

7. Un ratón A de pelo blanco se cruza con una ratona de pelo negro y toda la descendencia es de pelo blanco. Otro
ratón B de pelo blanco se cruza con la misma ratona y en la descendencia se observan ratoncitos de pelo blanco
y de pelo negro. Sabiendo que uno solo de los dos ratones es heterocigota
a. ¿Cuál es el alelo dominante?
b. ¿Cuál de los dos ratones es el heterocigota?
c. Dibujá el cariotipo de una célula somática del ratón heterocigota, indicando cromosomas homólogos,
cromátides hermanas y alelos (suponer 2n=4).

8. La ptosis es una enfermedad que consiste en la imposibilidad de abrir los párpados totalmente, y se debe a la
presencia de un alelo dominante. Un óvulo de una mujer enferma es fecundado por un espermatozoide de un
hombre fenotípicamente normal, originando un bebé normal.
a. Indicá el genotipo y el fenotipo de los tres integrantes de la familia.
b. ¿Cuál es la probabilidad de esta pareja de tener hijos enfermos de ptosis?

9. En las langostas, el color de ojos rojo domina sobre el color de ojos blanco. Se cruza una langosta macho de ojos
blancos con una hembra de ojos rojos y se obtienen 303 langostas de ojos blancos y 298 de ojos rojos.
a. Indicá el genotipo y el fenotipo de los padres y de la descendencia.
b. Dibujá las posibles gametas de la hembra indicando cromosomas homólogos y alelos (suponiendo 2n=8)

10. Una mujer de grupo sanguíneo A tiene un hijo de grupo B. Indicá todos los genotipos posibles de la mamá, el
bebé y el papá.

11. Un hombre de grupo sanguíneo A y una mujer de grupo AB tienen un hijo de grupo B ¿Cuál es la probabilidad de
que su próximo hijo sea de grupo A?

27
12. Indicá la respuesta correcta: ¿Qué grupos sanguíneos pueden heredar los hijos de un hombre de grupo B y una
mujer de grupo A, ambos homocigotas?
a) A o B solamente b) A, B, AB o 0 c) A, B o 0 d) AB solamente

3) Problemas de genética. Segunda ley de Mendel.

Resolvé los siguientes problemas de genética. En todos los casos suponemos que los dos genes
estudiados no están ligados (es decir, no se encuentran en el mismo par de homólogos).
No olvides justificar todas las respuestas con las explicaciones y/o los cruzamientos necesarios.

1. En la especie humana los colores oscuros dominan sobre los colores claros. Una mujer morocha y de ojos negros y
un hombre rubio y de ojos celestes tienen dos hijos: uno morocho y de ojos celestes y otro rubio y de ojos negros.
Con estos datos:

a. Completá los cuadros:

gen estudiado 1 alelos letras

gen estudiado 2 alelos letras

b. Indicá los genotipos de los cuatro integrantes de la familia


c. ¿Cuál es la probabilidad de que un tercer hijo sea morocho y de ojos negros?
d. Dibujá una célula del hombre en anafase I, indicando cromosomas homólogos, cromátides hermanas o
recombinantes y alelos (suponer 2n=6).
e. Dibujá una célula de la mujer en anafase II, indicando cromosomas homólogos, cromátides hermanas o
recombinantes y alelos (suponer 2n=6).

2. En una especie de aves, el pico recto domina sobre el pico curvo, y el color gris de las plumas domina sobre el
marrón. Un ave macho heterocigota para ambos genes se cruza con una hembra de pico recto y plumas
marrones. Algunos de sus pichones tienen pico curvo. Con estos datos:

a. Completá los cuadros:

gen estudiado 1 alelos letras

gen estudiado 2 alelos letras

b. De acuerdo a estos datos ¿cuál es la probabilidad de que tengan pichones de pico recto y plumas grises?
c. Suponiendo 2n=4, dibujá: i) una célula somática del macho en metafase y ii) una célula sexual de la hembra en
anafase I. En ambos dibujos señalá un par de cromosomas homólogos, un par de cromátides hermanas o
recombinantes y los alelos para cada gen.
28
3. ¿Cuántas gametas diferentes puede formar...
a. ...una persona que presenta un genotipo heterocigota para dos genes (AaBb).
b. ...una persona que presenta un genotipo heterocigota para el color de pelo y homocigota recesivo para el factor
Rh?
c. ...una persona que presenta un genotipo homocigota para dos caracteres?

4. La fibrosis quística es una enfermedad genética recesiva, que afecta principalmente a los pulmones. Pablo y
Daniela, que son sanos, tienen un hijo, Martín, que padece fibrosis quística. Además Pablo es morocho, mientras
que Daniela y Martín son rubios. En base a estos datos:

a. Indicá el genotipo de los tres integrantes de la familia.


b. ¿Cuál es la probabilidad de que Pablo y Daniela tengan un hijo heterocigota para ambas características?
c. Dibujá una célula germinal de Daniela en metafase II, indicando claramente un par de cromosomas homólogos, un
par de cromátides hermanas o recombinantes y los alelos para el gen estudiado. Considerá 2n=6.

5. Marcos tiene ojos oscuros y padece fenilcetonuria (enfermedad recesiva). Marcela, de ojos claros, es sanita. Pepe,
el hijo de ambos, es de ojos claros y fenilcetonúrico.
a. Indicá el genotipo y el fenotipo de los tres integrantes de la familia
b. ¿Cuál es la probabilidad de que un hermanito de Pepe sea fenilcetonúrico y de ojos claros?
c. Dibujá una célula de Marcos en metafase, otra en metafase I y otra en metafase II, indicando cromosomas
homólogos, cromátides hermanas o recombinantes y alelos (suponé 2n=4).

6. Una mujer de grupo 0 y factor Rh– tuvo un hijo de sangre B Rh+.


a. ¿Cuáles son sus genotipos?
b. Indicá todos los genotipos posibles del papá.

7. Una mujer cuyo fenotipo es B, Rh+ da a luz un bebé de fenotipo A, Rh–.


a. Indicá todos los genotipos posibles de la mamá y del hijo.
b. ¿Qué genotipos podría tener un hombre que seguro no es el papá de ese bebé? Indicá por lo menos tres de esos
genotipos.
c. Si un hombre dice ser el padre, ¿qué genotipos podría tener? ¿Alcanza con que tenga alguno de estos genotipos
para estar seguros de que es el papá?

8. En una especie de zorros el color marrón domina sobre el gris. Por otro lado, algunos tienen orejas redondeadas y
otros tienen orejas punteagudas. Una zorra gris y de orejas redondeadas tiene dos zorritos también grises, uno de
orejas redondeadas y uno de orejas punteagudas. Además se sabe que el papá zorro es marrón y tiene orejas
redondeadas.
a. Indicá los genotipos de todos los integrantes de la familia.
b. Considerando que la especie estudiada presenta una ploidía de 2n=8, completá el siguiente cuadro:

Etapa del N° de N° de cromátides Cantidad


ciclo celular cromosomas por cromosoma de ADN

G1 (interfase) 100

Metafase I

En cada polo
4
de telofase I

9. En una especie de delfín, el carácter aleta dorsal recta domina sobre aleta dorsal curva y el carácter pigmentación
29
uniforme domina sobre el de pigmentación manchada.
R: aleta recta D: pigmentación uniforme
r: aleta curva d: pigmentación manchada
Un delfín de aleta dorsal curva y pigmentación uniforme se cruza con una hembra de aleta dorsal recta y
pigmentación manchada. Tienen dos delfines de aleta dorsal recta y pigmentación manchada
a. ¿Cuál es el genotipo de los padres?
b. ¿Puede haber descendientes con distintos fenotipos a los señalados? Si respondiste afirmativamente,
indicá como podrían ser esos individuos genotípicamente y fenotípicamente.

10. Al cruzar dos ratones sanos y de color blanco (homocigotas recesivos para el color) se obtienen 9 crías sanas y 3
enfermas, todas blancas.
a. ¿La enfermedad es una característica dominante o recesiva?
b. Indicá las proporciones genotípicas de la descendencia.
c. ¿Las proporciones genotípicas y fenotípicas son iguales?
d. Suponiendo un complemento cromosómico 2n=4, dibujá una célula germinal de la hembra en anafase I y una
célula del pulmón del macho en metafase. En ambos esquemas señalá un par de cromosomas homólogos, un par
de cromátides (aclarando si son hermanas o recombinantes) y los alelos estudiados.

Transcripción y traducción. Código genético. Mutaciones.

Guía de estudio
1. Repasá la estructura del ARN y del ADN. ¿En qué se parecen y en qué se diferencian? Confeccioná un cuadro
comparativo entre ellos, eligiendo vos al menos cuatro criterios.
2. ¿A qué llamamos gen? ¿Qué tipo de información contienen la mayoría de los genes?
3. Mencioná los tres tipos de ARN que participan en la síntesis de proteínas.
4. ¿Mediante qué proceso se sintetizan las moléculas de ARN?
5. ¿Cuáles son los sustratos de dicho proceso?
6. ¿Qué rol cumple el ADN en ese proceso?
7. ¿Mediante qué proceso se sintetizan las proteínas?
8. ¿Cuáles son los sustratos de dicho proceso?
9. ¿Qué rol cumplen los distintos tipos de ARN en ese proceso?
10. ¿Qué es el código genético?
11. ¿Qué significa que es universal?
12. ¿Qué significa que es degenerado?
13. ¿A qué se llama mutación? ¿En qué molécula ocurren?
14. ¿A qué se llama mutación puntual? ¿Durante qué proceso pueden ocurrir este tipo de mutaciones?

Actividades
1) Para cada par de términos, redactá una oración en la que queden relacionados funcionalmente:
a. gen – ADN d. cromosoma – ADN
b. gen – ARN e. herencia – ADN
c. gen – proteína f. ADN – mutaciones

2) a. A partir del siguiente fragmento de ADN ¿cuál será la secuencia de nucleótidos del ARN que se obtiene por
transcripción?
Cadena molde: C A G G T A C G C A T T T T A C G A C C G A C G A A C T T A
Cadena codificante: G T C C A T G C G T A A A A T G C T G G C T G C T T G A A T

ARN: …………...…………………………………………………………………………………

30
b. Dado el siguiente fragmento de ARN, ¿cuál es la secuencia de nucleótidos del ADN del cual se transcribió?

ARN: A U G G U U C G A C C C A G U U U U A G C C C G C

Cadena molde: ………...……………………………………………………………………...

Cadena codificante: ………………………………....……………………………………………..

3) Realizá un cuadro comparativo entre los dos procesos en cuanto a los siguientes ítems:
- Sustratos
- Productos
- Tipo de proceso según la materia
- Tipo de proceso según la energía
- Molécula con función de molde
- Enzima principal
- Localización en procariontes
- Localización en eucariontes

4) Indicá si las siguientes afirmaciones son verdaderas o falsas, justificando brevemente:


a. El código genético contiene la información para la síntesis de las proteínas.
b. Dada una secuencia de nucleótidos, el código genético nos permite saber a qué secuencia de aminoácidos
corresponde.
c. Dada una secuencia de aminoácidos, el código genético nos permite saber a qué secuencia de nucleótidos
corresponde.
d. Si a una levadura se le insertara el ARNm de una proteína humana, la levadura produciría dicha proteína.

5) Suponiendo que las dos moléculas de ARN del ejercicio 2) corresponden a ARN mensajero ¿cuáles serán las
secuencias de aminoácidos que se obtendrán al traducirlas?

6) Estos cinco tubos de ensayo contienen biomoléculas en un medio acuoso en condiciones adecuadas. Para cada uno,
indicá si será o no posible sintetizar insulina humana, justificando tu elección:

Tubo Contiene
1 ARNm de insulina humana, ATP, ARNt, ribosomas, enzimas
2 ARNm de insulina humana, aminoácidos, ATP, ARNt, ribosomas, enzimas
3 ARNm de insulina humana, aminoácidos, ATP, ARNt, ribosomas de rata, enzimas
4 ARNm de insulina de cerdo, aminoácidos, ATP, ARNt, ribosomas de rata, enzimas
5 ARNm de insulina humana, aminoácidos, ATP, ARNt de perro, ribosomas de perro, enzimas

7) En cierta especie de plantas, las flores son rojas o blancas. El color rojo se debe a un pigmento rojo que se encuentra
en las células de las flores. Se observa que el alelo para el color rojo (R) domina sobre el alelo para el color blanco (r).
Mediante estudios bioquímicos se determinó que el pigmento rojo es el producto de una reacción catalizada por la
enzima pigmentosintetasa, que puede representarse de la siguiente manera:

pigmentosintetasa
molécula precursora pigmento rojo

A su vez, se logró identificar y secuenciar el gen que codifica para la enzima pigmentosintetasa, ubicado en el par de

31
homólogos nº3.
En los individuos homocigota dominantes (RR) esta secuencia se encuentra en ambos miembros del par.

TTATGCGACTTGAGGCAGCACCCTTGTGAGGTA

Atención: para representar un gen se escribe la secuencia de bases de una sola de las cadenas del ADN, ya que no es
necesario, conocida la complementariedad entre bases, escribir la secuencia de ambas. En este caso transcribimos la
cadena codificante.

1. ¿Cuál es la característica estudiada? ¿Cuáles son sus variantes?


2. Suponiendo que la especie es 2n=6, representá un cariotipo de una célula somática de un individuo heterocigota
para esta característica (recordá que el gen se encuentra en el par de homólogos nº3).
3. Explicá brevemente cuál es la relación entre el fenotipo “color rojo” de las flores y la secuencia de ADN presentada.

Por otro lado, en los individuos homocigota recesivos (rr) no se encuentra la enzima pigmentosintetasa. En los
cromosomas del par nº3 de estas plantas, la secuencia hallada en el mismo locus es la siguiente:

TTATGCGACTTTAGGCAGTACCCATGTGAGGTA

4. Compará esta secuencia con la anterior ¿En qué se diferencian?


5. ¿Cómo explicarías la relación entre el fenotipo “color blanco” de las flores y esta nueva secuencia?
6. Reformulando la pregunta 1.: ¿Cuál es el gen que se corresponde con la característica estudiada? ¿Cuáles son los
alelos de dicho gen?
7. ¿Cómo explicarías el hecho de que los individuos heterocigotas (Rr) presentan flores rojas?
8. Para cada una de las dos secuencias presentadas, escribí la secuencia correspondiente a la cadena molde.
9. Para cada una, hacé la transcripción, es decir, escribí la secuencia de nucleótidos del ARN mensajero
correspondiente.
10. Para cada una, hacé la traducción, es decir, escribí la secuencia de aminoácidos de la proteína correspondiente.
11. Analizá los resultados obtenidos y volvé a responder la pregunta 5.

8) La siguiente secuencia de nucleótidos corresponde a la cadena molde de un fragmento de ADN. Suponé que se trata
de un gen que codifica para una proteína.

TAGCCTACGTATCATCTCCCGGGTACAAAATCAC

1. a. ¿Cuál es la secuencia de la cadena codificante? Escribila.


b. ¿Cuál es el resultado de la transcripción? Escribí la secuencia correspondiente e indicá qué tipo de molécula es.
b. ¿Cuál es el resultado de la traducción? Escribí la secuencia correspondiente e indicá qué tipo de molécula es.
2. Si se produce una sustitución (cambio) del nucleótido de la posición 19 (cuya base nitrogenada es citosina) por un
nucleótido de timina,
a. ¿cuál será la consecuencia en la traducción?
b. ¿la proteína obtenida tendrá la misma estructura espacial y función? ¿Por qué?
3. ¿Puede ocurrir que una sustitución de un nucleótido por otro no altere la secuencia de aminoácidos de la proteína?
¿Por qué? Explicá con un ejemplo.
4. Dadas las siguientes mutaciones puntuales ¿cuál será la consecuencia en la traducción para cada una de ellas?
a. Sustitución del nucleótido de la posición 15 (timina) por adenina.
b. Sustitución del nucleótido de la posición 8 (citosina) por guanina.
c. Inserción (agregado) de un nucleótido de adenina entre las posiciones 22 y 23.
d. Deleción (pérdida) del nucleótido de guanina de la posición 9.
5. Considerando los ejemplos de los puntos 2, 3 y 4, explicá:
32
a. ¿Cuáles son las mutaciones llamadas “silenciosas”? ¿Con qué característica del código genético se relacionan
dichas mutaciones?
b. ¿Qué tipo de mutaciones producen un “corrimiento del marco de lectura”?

9) Indicá si las siguientes oraciones son verdaderas o falsas. Justificá tu elección en no más de cinco renglones.
1. Durante el proceso de traducción se forman enlaces fuertes.
2. El proceso de transcripción es anabólico.
3. El resultado de la transcripción es la secuencia de aminoácidos que forma una proteína.
4. Los ARN de transferencia son sustratos en el proceso de traducción.
5. Los sustratos de la transcripción son los ribonucleótidos trifosfatados.
7. Una mutación puntual siempre provoca el corrimiento del marco de lectura durante la traducción.
8. Un error en la actividad de la ADN polimerasa puede llevar al surgimiento de un nuevo alelo.
9. Una mutación en una célula de la piel podrá heredarse a la descendencia.
10. No todas las mutaciones pueden heredarse.

10) ¿Qué pasará si la ARN polimerasa comete un error cambiando un ribonucleótido durante la transcripción? Justificá
tu respuesta.

CÓDIGO GENÉTICO

1era 3ra
2da
posici posición
posición
ón
U C A G
U UUU fen UCU ser UAU tir UGU cis U
UUC fen UCC ser UAC tir UGC cis C
UUA leu UCA ser UAA stop UGA stop A
UUG leu UCG ser UAG stop UGG trp G
CUU leu CCU pro CAU his CGU arg U
CUC leu CCC pro CAC his CGC arg C
C
CUA leu CCA pro CAA gln CGA arg A
CUG leu CCG pro CAG gln CGG arg G
AUU ile ACU tre AAU asn AGU ser U
AUC ile ACC tre AAC asn AGC ser C
A
AUA ile ACA tre AAA lis AGA arg A
AUG met ACG tre AAG lis AGG arg G
GUU val GCU ala GAU asp GGU gli U
GUC val GCC ala GAC asp GGC gli C
G
GUA val GCA ala GAA glu GGA gli A
GUG val GCG ala GAG glu GGG gli G

Fenotipo, genes y ambiente

1) El fenotipo de un individuo es en parte la expresión de sus genes. ¿Qué otro factor lo determina?
2) Mencioná:
a. dos ejemplos en los que el fenotipo es simplemente la expresión del genotipo.
b. dos ejemplos en los que el ambiente también interviene.

33
c. un ejemplo de una característica del fenotipo que se deba únicamente al ambiente.
d. un ejemplo de una característica del fenotipo de la cual no se sepa con certeza cuál es la participación del
genotipo.

Evolución
1. El caso de la Old Order Amish
Entre las personas pertenecientes a la Old Order Amish (Antigua Orden de los Amish), que viven en Lancaster,
Pensylvannia, hay una frecuencia sin precedentes de un alelo recesivo. Este alelo en estado homocigótico causa una
combinación de enanismo y polidactilia (dedos supernumerarios). La colonia de Amish se ha mantenido virtualmente
aislada del resto del mundo desde que fue fundada en 1770. Desde entonces se registraron más de 60 casos de esta
malformación congénita rara; casi tantos como en todo el resto de la población mundial. Se calcula que
aproximadamente el 13% de los miembros de este grupo –formado por unas 17.000 personas- son portadores de este
alelo. Todos los integrantes de la colonia, descienden de unos pocos individuos. Por azar, uno de ellos debió haber sido
portador de este raro alelo.

Cuestionario
a. ¿El texto trata de un ejemplo referido a una especie o a una población? De acuerdo a esto, decidan si se trata de un
ejemplo de micro o de macroevolución.
b. ¿Cuáles son las condiciones que se presentan en este caso que permiten explicar la altísima frecuencia de este alelo
raro entre los Amish?
c. ¿Qué agente de cambio evolutivo consideran que está actuando? Justifiquen su respuesta.

2. Alteraciones numéricas y poliploidía


Las alteraciones numéricas son mutaciones que, como su nombre indica, alteran el número total de cromosomas típico
de la especie. Se originan frecuentemente por fallas durante la meiosis: la no-disyunción (no segregación de homólogos)
produce gametas con uno o varios cromosomas de más (por ejemplo, la trisomía del par 21 -que causa el síndrome de
Down- se produce cuando una gameta n=23 se fusiona con una gameta con 24 cromosomas).
La poliploidía puede ser resultado de la no-disyunción durante la meiosis. Cuando ocurre este fenómeno, todo el
complemento cromosómico queda, por ejemplo, duplicado (células 4n, o tetraploides), de modo que de cada
cromosoma habrá cuatro homólogos en la misma célula. También puede “repetirse” el genoma más de dos veces.
Los individuos poliploides no pueden reproducirse y dejar descendencia fértil con organismos diploides: pueden
reproducirse entre sí, pero no con sus ancestros inmediatos.
Aquí se presentan algunos ejemplos: - Papa (Solanum tuberosum) 4n=48
- Café (Coffea arabica) 2n=22, 4n=44, 6n=66
- Banana (Musa sapientum) 2n=22, 3n=33
- Maní (Arachis hypogaea) 4n=40
- Batata (Ipomoea batata) 6n=90

Cuestionario
a. En una especie 2n=4, un individuo sufre no-disyunción en un solo par de homólogos; dibujen las gametas que puede
originar, señalando claramente los cromosomas homólogos.
b. Si en una población de frutillas (Fragaria grandiflora, 2n=14), un pequeño grupo de plantas pasaran a tener 56
cromosomas, ¿qué grado de ploidía tendrían? Expliquen brevemente qué pudo haber ocurrido (pueden hacer
esquemas o explicarlo “con palabras”).
c. ¿Cuáles son las fuentes de variabilidad genética que actúan en dicha población?
d. ¿Qué agente de cambio evolutivo podría ponerse en marcha ante esta situación? ¿Por qué?
e. Este caso ¿ilustra un mecanismo microevolutivo o macroevolutivo? ¿Por qué?

3. Los pinzones de Darwin


En el archipiélago de las Galápagos, visitado por Charles Darwin durante su viaje a bordo del Beagle, habitan numerosas
especies de animales y plantas que no han sido encontradas en otros lugares del planeta. Un ejemplo es el de unos
pequeños pájaros llamados genéricamente pinzones. Constituyen unas 13 especies que se parecen mucho entre sí,

34
aunque presentan notables diferencias en la forma de sus picos. En cada isla habitan determinados grupos de pinzones,
es decir, no todas las variedades de pinzones habitan en todas las islas. Por otra parte, en el continente, frente al
archipiélago, se encuentra una única especie de pinzón, parecida también a las que habitan en las islas. De entre lo
muchísimos casos que Darwin estudió y que le permitieron postular su famosa teoría, el de los pinzones es uno de los
más bellos y claros.

Cuestionario
a. Las distintas poblaciones de pinzones ¿pertenecen a la misma o a distintas especies? De acuerdo a esto, decidan si se
trata de un ejemplo de micro o de macroevolución.
b. ¿Con qué característica del hábitat de los pinzones se relaciona la forma del pico? De acuerdo a su respuesta, ¿por
qué en cada isla habitan diferentes grupos de pinzones?
c. ¿Cómo explican la presencia de otra especie de pinzón en el continente?
d. ¿Qué agente de cambio evolutivo actúa en este ejemplo? Justifiquen la respuesta explicando cómo pudo haber sido
la evolución de los pinzones.
e. ¿Qué se podría hacer para comprobar que las 13 variedades de pinzones corresponden a 13 especies diferentes?

4. En una plantación afectada por un parásito, se realizó una fumigación con DDT, con lo cual se logró la desaparición de
dicho parásito. Sin embargo, al poco tiempo se detectó que las plantas estaban nuevamente infectadas por el mismo
parásito. Explicá este hecho teniendo en cuenta los siguientes conceptos: selección natural, reproducción diferencial,
mutaciones y azar.
5. Hace tiempo la pediculosis (infección de piojos) no era frecuente en las escuelas porque esos parásitos eran
mantenidos a raya con peine fino y piojicidas. Sin embargo, actualmente gran cantidad de chicos y chicas tienen piojos.
¿Cómo se explica que los piojicidas que hace años eran efectivos ahora no lo sean? Para desarrollar tu explicación elegí
algunos de los siguientes términos: adaptación al ambiente, mayor capacidad reproductiva, variabilidad genética,
herencia.

Más actividades
1) Indicá si las siguientes oraciones son verdaderas o falsas. Justificá tu elección en no más de cinco renglones.
a. La enzima ADN polimerasa forma uniones covalentes.
b. La cantidad de ADN que hay en una célula en G2 es el doble de la que hay en cada polo de telofase.
c. La división mitótica puede ser un mecanismo de reproducción asexual en organismos eucariontes.
d. La meiosis I es redaccional porque las dos células resultantes tienen la mitad de ADN que tenía la célula madre.
e. Tanto las células procariontes como las eucariontes duplican su ADN en el período S, que es previo a la división
celular.
f. Observando el cariotipo de una célula es posible determinar qué genes constituyen su genoma.
g. Una gameta que tiene 5 cromosomas y una cantidad de ADN de 30 unidades, provino de una célula madre que en
G2 tenía 10 cromosomas y 60 unidades de ADN.
h. La fecundación es una fuente de variabilidad genética.
i. El código genético establece una relación entre dos lenguajes diferentes.
j. Conociendo la secuencia de aminoácidos de una proteína es posible saber la secuencia de nucleótidos del ARN
mensajero a partir del cual se obtuvo dicha proteína.
k. Todas las características del fenotipo de un individuo son el resultado de la interacción de su genotipo con el
ambiente.

2) Los lemures de cola anillada son una especie de primates. Se sabe que el color de sus ojos está codificado en un gen
con dos variantes: el color miel domina sobre el color negro. Por otro lado, los mechones que recubren sus orejas
pueden ser largos (dominante) o cortos (recesivo). Una hembra, homocigota recesiva para ambas características,
tiene, tras sucesivos apareamientos con un mismo macho, cuatro descendientes todos fenotípicamente diferentes
entre sí.
a. Indicá los genotipos y fenotipos de los padres y de las crías.
b. ¿Cuál es la probabilidad de que nazca otro hijo de ojos color negro y mechones largos?
c. Suponiendo que los lemures tienen en sus células somáticas 4 cromosomas, y que en G1 contienen 40 unidades
arbitrarias de ADN, completá la tabla:
35
No de No de cromátides Cantidad
Etapa del ciclo celular
cromosomas en la célula de ADN
G2 (interfase)

Metafase mitótica

En cada polo de telofase II

3) Daniel es de grupo sanguíneo AB y Carla es de grupo 0. Ambos son alérgicos a la penicilina (un antibiótico). Daniel y
Carla tienen su primer hijo. Sabiendo que los cuatro abuelos del bebé toleran bien el antibiótico:
a. Determiná cuál de los dos alelos relacionados con la penicilina es el dominante. Explicá tu deducción.
b. Indicá las proporciones fenotípicas y genotípicas esperadas para este niño.
c. Considerando un complemento cromosómico 2n=6, dibujá una célula de la madre en metafase II y una célula del
padre en anafase. Señalá en cada esquema un par de cromátides (aclarando si son hermanas o recombinantes), los
alelos estudiados y, si es posible, un par de cromosomas homólgos.

4) Dada la siguiente lista de elementos, indicá para cada uno y según corresponda, cuál es su rol en la transcripción y/o
cuál es su rol en la traducción: ARN polimerasa – aminoácidos – ARN de transferencia – ribonucleótidos trifosfatados
– ribosomas – ADN.

5) En una especie de ratones se descubrió una enfermedad hereditaria, debida a una alteración en un gen.
Las secuencias correspondientes a las cadenas molde son:

Alelo “ratón sano”: AGGTACAAAGGCCTTGCACAGCTTTTACT


Alelo “ratón enfermo”: AGGTACAAAGGCCTTGCACTGCTTTTACT

a. Indicá cuáles son los productos de la transcripción y de la traducción de cada alelo (mencioná el nombre de la
molécula resultante y la secuencia de bases correspondiente).
b. Explicá brevemente cómo pudo haberse originado el alelo que codifica para la enfermedad (no olvides mencionar la
fuente de variabilidad involucrada).

6) Las personas que padecen fenilcetonuria son homocigotas recesivas para una mutación en el gen que codifica para
una enzima. Cuando se analiza la enzima de las personas enfermas se observa que ésta se diferencia de la enzima
normal en un sólo aminoácido. Las siguientes frases se refieren a las personas enfermas y dan posibles explicaciones del
fenómeno descrito. Indicá cuál o cuáles de ellas pueden ser correctas y cuál o cuáles no lo son, justificando todas tus
respuestas:
a. El gen de la enzima no está alterado pero la estructura terciaria de la misma es diferente a la proteína normal.
b. El gen mutado difiere del normal en que le sobra un nucleótido.
c. Es imposible que en las células de una persona estén simultáneamente ambos tipos de proteínas.

7) En las plantas de durazno, el alelo que lleva información para la piel lisa del fruto domina sobre la piel con
vellosidades y el alelo para pulpa amarilla domina sobre pulpa blanca. El color amarillo de los frutos se debe a la
presencia de un pigmento que es fabricado por la enzima amarillasa. Una planta de frutos vellosos y pulpa amarilla ha
sido fecundada por el polen de otra planta de pulpa blanca. Se obtuvieron 100 plantas hijas: 25 tienen frutos lisos y
pulpa blanca, 25 frutos lisos y pulpa amarilla, 25 frutos vellosos y amarillos y 25 frutos vellosos y de pulpa blanca.
a) En base a estos datos indicá el genotipo de todos los individuos mencionados.
b) Los duraznos vellosos y amarillos son de mejor comercialización. ¿Qué progenitores elegirías para obtener mayor
cantidad de plantas con este fenotipo?

36
c) Dibujá una célula en anafase II de la planta padre, señalando un par de cromosomas homólogos, un par de
cromátides hermanas y los alelos estudiados. Suponé que las células de esta especie son 2n=4.
d) ¿En qué células de la planta de durazno se encuentra la información genética para fabricar la enzima amarillasa?
Justifcá tu respuesta.

8) La enzima amarillasa del problema anterior produce el pigmento amarillo mediante la siguiente reacción:
amarillasa
molécula A + Mg (magnesio) pigmento amarillo
El gen de la enzima amarillasa posee 2 alelos. Cuando uno de ellos se expresa, se sintetiza la enzima amarillasa, mientras
que a partir del otro alelo se produce una proteína con más aminoácidos (más larga) que no cumple ninguna función.
a. De acuerdo a los dados ¿cuál es el alelo dominante?
b. ¿Cuál es el color de la pulpa del durazno en una planta heterocigota para esta característica?
c. Si una planta homocigota dominante crece en un ambiente donde no hay magnesio ¿Cuál será el color los frutos?
d. ¿Qué tipo de mutación pudo haber originado el segundo alelo? Justificá tu respuesta.

9) Con cada conjunto de términos, redactá un párrafo de no más de 8 renglones:

a. célula diploide – duplicación del ADN – cromátides hermanas


b. cigota – meiosis – gameta – duplicación del ADN
c. reproducción asexual – cromátides hermanas – variabilidad genética
d. reproducción sexual – entrecruzamiento (crossing-over) – variabilidad genética.
e. mutación – alelo – reproducción asexual – población de levaduras.
f. población de gorriones de Buenos Aires – variabilidad genética – reservorio génico – selección natural.

37