You are on page 1of 27

5/17/2016

MOLECULAR
GENETICS

BIO20 Introduction
to Biomimetics Prof. Ureah Thea A. Sevilla

DNA – Deoxribonucleic Acid


 DNA makes use of four of the five bases
 Two pyrimidines: thymine and cytosine
 Two purines: adenine and guanine

 The nucleotides are linked together by 3’-


5’phosphodiester bonds
 DNA consists of two polynucleotide strands

 The two strands interact through the base-pairing of


Adenine with Thymine bases and Guanine and Cytosine
bases.

1
5/17/2016

Deoxynucleoside triphosphates
 Deoxyadenosine  Deoxycytidine triphosphate,
triphosphate, dATP dCTP

 Deoxyguanosine  Deoxythymidine
triphosphate, dGTP triphosphate, dTTP

Polynucleotides and Nucleic Acids


 Nucleic acids are formed through linkage of one nucleotide
with another by forming a covalent bond called 3’-5’-
phosphodiester bond forming long polynucleotide chain.

2
5/17/2016

 Linkage of one nucleotide


with another forms a bond
specifically called
3’-5’ phosphodiester bond
 The next nucleotide to be
attached to the growing
polynucleotide chain is
always added at the 3’-
end.

5’  3’ Polynucleotide Chain

3
5/17/2016

Double Strands of DNA

James Watson and Francis Crick

Double strands of DNA

 Anti-parallel strands of
the DNA

4
5/17/2016

Major and Minor Groves of DNA

3.4-nanometer length of
each full twist of the double
helix (360 ° turn)

DNA helix turn

 Right-hand helix turn


 10 base-pair per helix
turn (360° turn)

5
5/17/2016

The Human Genome


 Genome is the complete set of genetic information
of an organism
 The total length of the human genome is over 3
billion base pairs.
 2001 Draft of Human Genome Sequence
 2003 Finished Human Genome

 (50 years after DNA structure solved)

 Costed $3 billion

Importance of Knowing the Genome

 To obtain a ‘blueprint’ – DNA directs all the


instructions needed for cell development and function
 DNA underlies almost every aspect of human health,
both, in function and dysfunction
 to study gene expression in a specific tissue, organ or
tumor
 to study human variation
 to study how humans relate to other organisms
 to find correlations how genome information relates
to development of cancer, susceptibility to certain
diseases and drug metabolism

6
5/17/2016

Central Dogma of Molecular Genetics

DNA Replication
 DNA replication is an essential aspect of cellular
and viral reproduction.
 Replication of a double-stranded DNA results in two
double-stranded DNAs as products.

7
5/17/2016

Semiconservative DNA Replication


 Each strand of a DNA double helix is a template
for synthesis of a complementary strand of DNA

 One template builds DNA continuously; the other


builds DNA discontinuously, in segments

 Each new DNA molecule consist of one old strand


and one new strand

Semiconservative DNA Replication

8
5/17/2016

DNA Replication

 DNA replication is an
exponential process.

DNA REPLICATION PROCESS

INITIATION  ELONGATION  TERMINATION

9
5/17/2016

Enzymes of DNA Replication

 DNA helicase
 Breaks hydrogen bonds between DNA strands

 DNA polymerase
 Joins free nucleotides into a new strand of DNA

 DNA ligase
 Joins DNA segments on discontinuous strand

INITIATION STEP

10
5/17/2016

ELONGATION STEP

Each DNA strand has two ends:


one with a 5’ carbon, and one with
a 3’ carbon.

DNA polymerase can add


nucleotides only at the 3’ carbon.

In other words, DNA synthesis


proceeds only in the 5’ to 3’
direction.

Elongation Step
 At a replication fork, one daughter strand (the
leading strand) is elongated continuously. The other
daughter strand (the lagging strand) is formed as a
series of discontinuous.

11
5/17/2016

TERMINATION STEP
 DNA ligase
 JoinsDNA segments on
discontinuous strand

 Leading strand
– continuous synthesis

 Lagging strand
– discontinuous synthesis

Rate of DNA Replication

12
5/17/2016

Problems
 What is the complimentary sequence of the given
DNA strand?

5’ – ATG CCC GCG AAT GAG CGA GGC TAG – 3’

Problems
 What is the complimentary sequence of the given
DNA strand?

3’ – CCC ATA GCG CAA TTT ACG ATA GCA – 5’

13
5/17/2016

Central Dogma of Molecular Genetics

TRANSCRIPTION – RNA Synthesis


 process of RNA Synthesis
 copying the 5’ – 3’ DNA in the form 5’ – 3’ RNA

 Synthesis of 5’ to 3’ RNA antiparallel to the


template strand (thru base pairing)
T in DNA is transcribed as A in RNA
G in DNA is transcribed as C in RNA
A in DNA is transcribed as U in RNA
C in DNA is transcribed as G in RNA

14
5/17/2016

Structures of RNA
 Ribosomal RNA, rRNA
 isassociated with a number of different proteins as
components of the ribosome (complex as site for
protein synthesis)
 80% of the RNA in the cell

 Transfer RNA, tRNA


 smallestRNA molecule (4S)
 serves as adaptor molecule that carries its specific
amino acid to the site of protein synthesis
 15% of the RNA in the cell

Structures of RNA
 Messenger RNA, mRNA
 carries genetic information from the DNA to the
cytosol, where it is used as the template for protein
synthesis
 5% of the RNA in the cell

15
5/17/2016

Structures of RNA

rRNA

tRNA

TRANSCRIPTION: RNA SYNTHESIS

INITIATION  ELONGATION  TERMINATION

POST-TRANSCRIPTIONAL
MODIFICATION (Eukaryotes)

16
5/17/2016

TRANSCRIPTION: RNA SYNTHESIS

Base-Pairing in
DNA Synthesis and Transcription

Synthesized RNA 5’-CAUUCGAGUUAGCTCUUAAGC – 3’


DNA template 3’- GTAAGCTCAATCGAGAATTCG – 5’

17
5/17/2016

Problems
 Given the DNA template, what is the sequence of
the RNA produced?

5’ – ATG CCC GCG AAT GAG CGA GGC TAG – 3’

Problems
 Given the DNA template, what is the sequence of
the RNA produced?

3’ – CCC ATA GCG CAA TTT ACG ATA GCA – 5’

18
5/17/2016

The Process of Transcription

 RNA polymerase and regulatory proteins attach to


a promoter (a specific binding site in DNA close to
the start of a gene)

 RNA polymerase moves over the gene in a 5' to 3'


direction, unwinds the DNA helix, reads the base
sequence, and joins free RNA nucleotides into a
complementary strand of mRNA

Termination of Transcription
 Rho-independent
termination

Formation of hairpin loop along the


self-complimentary sequence that
cause the release of nascent RNA
from the DNA template

19
5/17/2016

Termination of Transcription
 Rho-dependent Termination
The Rho factor acts as an ATP-dependent unwinding enzyme,
moving along the newly forming RNA molecule towards its 3′
end and unwinding it from the DNA template as it proceeds.

Post-Transcriptional Modifications
 In eukaryotes, RNA is modified before it leaves the
nucleus as a mature mRNA
 Introns (noncoding sequence)
 Nucleotide sequences that are removed from a new
RNA
 Exons (coding sequence)
 Sequences that stay in the RNA

20
5/17/2016

Alternative Splicing
 Alternative splicing
 Allows one gene to encode different proteins
 Introns are removed from RNA and exons are spliced
together in various combinations
 Addition of modified GTP at the 5’-end and
addition of poly-Adenines at 3’-end
 Aftersplicing, transcripts are finished with a modified
guanine “cap” at the 5' end and a poly-A tail at the 3'
end.

Central Dogma of Molecular Genetics

21
5/17/2016

TRANSLATION: PROTEIN SYNTHESIS

INITIATION  ELONGATION  TERMINATION

POST-TRANSLATIONAL
MODIFICATION (eukaryotes)

THE GENETIC CODE

22
5/17/2016

THE STANDARD GENETIC CODE


 Marshall Nirenberg and Philip Leder in 1964
 In the genetic code, nucleotide triplets specify an
amino acid.
43 = 64 possible word codes
61 out of 64 possible word codes for
specific amino acids– referred to as
codons

THE STANDARD GENETIC CODE


Characteristics of the genetic code:
 Specificity – specific codon always code for the

same amino acid


 Redundancy or degeneracy – an amino acid may

have more than one codon coding for it


 Non-overlapping and commaless – code is read

from a fixed starting point as a continuous


 Contatins 3 codons that are stop signals

23
5/17/2016

Problems
 Given the DNA template, what is the amino acid
sequence when it is translated?

5’ – ATG CCC GCG AAT GAG CGA GGC TAG – 3’

Problems
 Given the DNA template, what is the amino acid
sequence when it is translated?

3’ – CCC ATA GCG CAA TTT ACG ATA GCA – 5’

24
5/17/2016

The Ribosome

 Ribosome of E. coli

Elongation Step in Translation

25
5/17/2016

Translation: Protein Synthesis

Termination of Translation Process

26
5/17/2016

Rate of Synthesis in Prokaryotes


 E. coli contains about 15,000 ribosomes, each cell
can synthesize about 750 protein molecules of 300
residues in length per second, at full capacity.

 At 37°C, an E. coli ribosome can synthesize a 300-residue


polypeptide chain in about 20 seconds. This rate is almost
exactly the same as that calculated for prokaryotic transcription.

References:
 Voet, Voet and Pratt, Principles of Biochemistry 3rd
ed. Wiley Publication (2008).
 Lodish H, Berk A, Zipursky SL, et al. Molecular Cell
Biology, 5th edition. New York: W. H. Freeman;
(2004).
 Barnum, S., Biotechnology, Wadsworth – Thomson
Publishing Co. (1998).

27