You are on page 1of 23

I.E.P.

“DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

I. INTRODUCCIÓN A LA BIOLOGÍA
JAMES WATSON Y FRANCIS CRICK 1. ETIMOLOGÍA DE BIOLOGÍA:
James Watson nació el 6 de abril de 1928 en Chicago, Estados Unidos. Sus primeros Deriva de las voces griegas:
estudios fueron en Zoología en la Universidad de su ciudad natal y luego obtuvo el BIOS  VIDA
grado de Ph. D. en la misma especialidad en la Universidad de Indiana, donde comenzó LOGOS  TRATADO O ESTUDIO
su interés por la genética.
En 1950 partió a Copenhague, Dinamarca, a iniciar su postdoctorado. Durante una 2. DEFINICIÓN DE BIOLOGÍA:
conferencia en la ciudad de Nápoles, Biología es la ciencia que estudia todas las manifestaciones de vida que existen,
Italia, conoció a Maurice Wilkins y quedó teniendo en cuenta su origen, estructura, funciones, sus relaciones con el medio
fascinado con sus estudios sobre ambiente y los complicados procesos que en ellas ocurren.
imágenes del patrón de difracción del ADN
a través de rayos X. Decidió trasladarse a 3. ANTECEDENTES HISTÓRICOS:
Inglaterra, al Laboratorio Cavendish de la  El primer biólogo fue Aristóteles, es llamado también el Padre de la Zoología.
Universidad de Cambridge, para sumarse  Teofrasto, estudió en cambio las plantas y se le considera el Padre de la Botánica.
a la investigación sobre la estructura del  William Harvey, médico y fisiólogo Inglés, descubrió el funcionamiento de la
ADN. Fue allí donde conoció a Francis circulación sanguínea.
Crick, quien compartía su pasión por  Hans y Zacarías Janssen, construyeron el primer microscopio compuesto.
desentrañar los secretos de la molécula de  Anton Van Leewenhoeck (Naturalista holandés). Padre de la Protozoología.
la vida. Observó los llamados “animalículos” en su microscopio.
Francis Crick vino al mundo en  Carl Von Linneo (Naturalista sueco). Padre de la Sistemática.
Northampton, Inglaterra, el 8 de junio de  Robert Koch (Médico alemán). Identificó los agentes infecciosos del carbunco,
1916, el segundo de dos hermanos. TBC, y el cólera. Introdujo los medios de cultivo.
Estudió Física en Londres, siendo  Louis Pasteur: Padre de la Microbiología médica. Negó la “Generación
interrumpidos sus estudios de doctorado espontánea” y apoyó la Hipótesis de la Biogénesis.
por la Segunda Guerra Mundial en 1939.  Gregorio Mendel (Monje y Naturalista Austriaco Agustino). Padre de la Genética.
Durante el conflicto bélico trabajó en el  Charles Darwin (Padre de la Evolución). Obras: “Origen de las Especie por la
Ministerio de Marina Británico, lugar que dejó en 1947 para estudiar biología en la Selección Natural” y el “Origen del Hombre”.
Universidad de Cambridge.  Schleiden y Schwann: Propusieron la Teoría Celular.
 Alexander Von Humboldt: Padre de la Biogeografía.
Ambos científicos coincidieron en sus investigaciones sobre la estructura del ADN  Alexander Fleming: Descubrió la Penicilina.
buscando un modelo que esclareciera la forma en que esta molécula se duplica antes  Alexander Ilich Oparin: (Ruso) Publicó el “Origen de la Vida”.
de la división celular, reproduciendo la misma información en dos individuos.  Max Knoll y Ernest Ruska, construyeron el primer microscopio electrónico.
Colaboraron con ellos, Maurice Wilkins, quien les proporcionó fotografías propias y  Ernest Haeckel: (Naturalista alemán). Padre de la Ecología.
Rosalind Franklin, científica dedicada a capturar imágenes en rayos X de ADN  Watson y Crick: (1953): Propusieron el Modelo “Doble Hélice del ADN”.
cristalizado.
Una toma de Franklin, la imagen 51 B, dio la clave a Watson y Crick para construir el
modelo en forma de doble hélice que los llevaría a formar parte de la historia de la
Genética. El paso posterior al descubrimiento fue darlo a conocer a la comunidad
científica mundial: el artículo llamado "Una estructura para el Ácido Desoxirribonucleico"
fue publicado por la Revista Nature el 25 de abril de 1953.
Watson y Crick ganaron el Premio Nobel de Medicina y Fisiología en 1962 "por sus
descubrimientos acerca de la estructura molecular de los ácidos nucleicos y su
importancia para la transferencia de la información en la materia viva", cuando tenían 23
y 36 años respectivamente.
El Premio Nobel de Medicina de 1962 recayó en James Watson, Francis Crick y Maurice
Wilkins. La doctora Rosalind Flanklin murió en 1958, ignorándose por muchos años sus
decisivos aportes al hallazgo de la forma del ADN. ARISTÓTELES LOUIS PASTEUR CHARLES
DARWIN
1 4º SECUNDARIA – I PERIODO - 2008
I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

4. IMPORTANCIA DE LA BIOLOGÍA: 6. EL MÉTODO CIENTÍFICO.


El conocimiento de la Biología nos permite: Es un método de investigación para conocer, describir, explicar los procesos en los
 Explicar los procesos que rigen la existencia de los seres vivos. seres vivos, es una manera de recopilar información y comprobar ideas. Es la forma
 Conocer los agentes causales de las enfermedades y estudiar los mecanismos que en que un científico trata de hallar respuestas a sus interrogantes sobre la naturaleza.
detengan su desarrollo. El método científico consta de los siguientes pasos generales:
 Elaborar antibióticos y otros medicamentos que controlen el curso de las
enfermedades y restablezcan la salud del individuo afectado. A) La Observación del problema:
 Mejorar las características genéticas de plantas y animales por medio de la Las observaciones de un científico, además de ser exactas, deben también constar
Ingeniería Genética. en un registro escrito, película, cinta magnetofónica, archivo electromagnético o en
 Comprender el funcionamiento de los Ecosistemas para aprovecharlos otra forma. Esa información constituye la matriz de datos del experimento. La
racionalmente y protegerlos. observación origina preguntas de tipo ¿Cómo sucedió esto?

5. DIVISIÓN DE LA BIOLOGÍA. B) Planteamiento de una Hipótesis:


 Bacteriología: Estudio de las bacterias. Una hipótesis es una posible respuesta a una pregunta acerca de la naturaleza,
 Bioquímica: Estudia las moléculas y compuestos químicos que intrvienen en los basada en observaciones, lecturas y los conocimientos de un científico.
procesos vitales.
 Botánica: Estudio de las plantas. C) Experimentación:
 Citología: Estudia la estructura y función celulares. Un científico debe diseñar un experimento para probar la hipótesis que propone.
 Histología: Estudia los tejidos y asociaciones celulares. Mientras se realiza un experimento deben anotarse las observaciones exactas.
 Embriología: Estudia las etapas del desarrollo embrionario de un ser vivo.
 Ecología: Estudia la relación de los seres vivos y su medio ambiente. D) Resultados:
 Micología: Estudio de los hongos. Una vez terminado el experimento, los datos obtenidos deben organizarse y
 Paleontología: Estudia los fósiles de seres vivos. analizarse. Los experimentos producen resultados que niegan o dan validez a la
 Protozoología: Estudio de los protozoarios. hipótesis.
 Taxonomía: Estudia la clasificación de los seres vivos.
 Virología: Estudio de los virus. E) Conclusiones y teorías:
 Zoología: Estudio de los animales. Los resultados analizados permiten al investigador llegar a una conclusión, la cual
 Genética: Estudio de la Herencia y la variación. apoya la hipótesis o la niega.
 Evolución: Estudio de los cambios que han experimentado los seres vivos a través Una teoría es una explicación de algo en la naturaleza y que la evidencia o
del tiempo. experimentación ha apoyado repetidas veces.
 Biogeografía: Estudio de la distribución de los seres vivos sobre la tierra.

EL MICROSCOPIO COMPUESTO

EL MÉTODO CIENTÍFICO

2 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

PRÁCTICA DIRIGIDA N° 01 9) El naturalista inglés..........................................................., es considerado el Padre


de la Evolución.
I. Escribe “V” o “F” según corresponda: (1/4 pto. c/u)
10) Los hermanos holandeses................................. y.......................... construyeron el
1.- Gracias a la Biología se pueden producir proteínas humanas como la insulina. ( ) primer microscopio compuesto.
2.- La Micología se encarga del estudio de los hongos. ( )
3.- La Taxonomía estudia a los restos fósiles. ( )
4.- La matemática no es una ciencia auxiliar de la Biología. ( )
5.- Además de teorías, la ciencia tiene leyes o principios. ( ) III. Relaciona: (1/4 pto. c/u)
6.- La Hipótesis consiste en la explicación racional anticipada de la observación ( )
a) Leewenhoeck ( ) Padre de la Ecología
de un fenómeno.
7.- En la medida que otros experimentos continúen apoyando la hipótesis, ésta ( ) b) Knoll y Ruska ( ) microscopio compuesto

se convertirá en una teoría. c) Carcinología ( ) Padre de la Genética


8.- Un experimento único no resulta ser nunca la base adecuada para realizar ( ) d) Hermanos Janssen ( ) Crustáceos
una conclusión. e) Micología ( ) Padre de la Protozoología
9.- Con la experimentación se puede probar la veracidad de una hipótesis. ( )
f) Ernest Haeckel ( ) Moluscos
10.- La Mastozoología estudia a los reptiles. ( )
g) Malacología ( ) Microscopio electrónico
II. Completa: (1/4 pto. c/u)
h) Gregorio Mendel ( ) Hongos
1) ........................................... es considerado el padre de la Biología, mientras
IV. Subraya la respuesta correcta: (1/4 pto. c/u)
que.............................................. se le considera el Padre de la Botánica.
2) .................................................................... propusieron la Teoría Celular por los 1).- Afirmó que la vida se organiza en los líquidos que contenían un principio activo.
a) Francisco RedI b) Luis Pasteur c) Lázaro Spallanzani
años 1838 - 1839.
d) John Needhan e) Oparín
3) ................................................ acuñó por primera vez el término célula al hacer
2).- Sobre la Biogénesis se afirma:
observaciones en un pedazo de corcho.
a) Los microorganismos se encuentran en el ambiente
4) El modelo Doble Hélice en la estructura del ADN lo b) Toda bacteria proviene de otra bacteria
c) Mientras la sustancia esté protegida no habrán microorganismos
propusieron................y.....................
d) Todo microorganismo proviene de otro microorganismo
5) La ciencia que estudia a los peces se llama.................................., mientras que e) Los gusanos son larvas de moscas
la...................................... estudia a los gusanos parásitos.
3).- Realizó el proceso de pasteurización:
6) Una............................................. es una posible respuesta a una pregunta al a) Francisco Redi b) Oparín c) Luis Pasteur
d) Spallanzani e) N.A
planteamiento de un problema, basadas en observaciones, lecturas y los
conocimientos de un científico. 4).- La ciencia biológica que se encarga de nombrar, ordenar y clasificar a los seres
vivos se denomina:
7) Los pasos del Método Científico
a) Biotaxía b) Biogenia c) Taxonomía
son: ....................................... ..................................... d) Filogenia e) Ontogenia
8) La ciencia que estudia la herencia biológica recibe el nombre
5).- Relacionar adecuadamente
de................................, mientras que la......................................., estudia los restos I.Concepto de biología A- Tefrasto
II.Concepto de Protoplasma B-Lamarck
fósiles de los seres vivos.
III.Padre de la Botánica C-Aristóteles
IV.Padre de la biología D-Purkinje

3 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

a) IA, IIB, IIIC, IVD b) IB, IIC, IIIA, IVD c) IC, IID, IIIA, IVB, a) Peces – aves b) Aves – molusco c) Insectos - aves
d) IB, IID, IIIA, IVC e) N.A d) Aves – peces e) N.A

6).- Ornitología, Malacología y Herpetología estudiar respectivamente: 17).- Considerado como el padre de la microbiología:
a) Gallito de las rocas – Helix Aspersa - sapo a) Pasteur b) Aristóteles c) Hipócrates
b) Insectos – constrictor constrictor - caracol d) Teofrasto e) N.A
c) Cóndor – crustáceos - anfibios
d) Cóndor – calamar - caimán 18).- Afirmó que la tierra primitiva esta formada por una atmósfera reductora:
e) Gallito de las rocas – pulpo – rana a) Spallanzani b) Needhan c) Pasteur
d) Oparín e) Redi
7).- La idea de poder producir ratones vivos a partir de camisas sucias y granos de trigo
fue propuesta por: 19).- Los hongos son objetos de estudio de :
a) Spallanzani b) Oparín c) Aristóteles a) Bacteriología b) Micología c) Herpetología
d) Van Helmont e) Francisco Redi d) Virología e) N.A

8).- Realizó experimentos en la que demostró de que los gusanos eran larvas de 20).- Realizó experimentos en la que demostró: que los gusanos eran larvas de moscas:
moscas a) Van Helmont b) Oparín c) Pasteur
a) John Needhan b) Lázaro Spallanzani c) Van Helmont d) Aristóteles e) Redi
d) Luis Pasteur e) Francisco Redi

9).- Se encarga del estudio de los cambios del ser vivo desde que nace hasta que V. Desarrolla en tu cuaderno las siguientes preguntas:
muere:
a) Biotaxia b) Sistematica c) Filogenia 1) Describe en que consisten las especialidades que iniciaron cada uno de los
d) Biogenia e) Ontogenia siguientes científicos o naturalistas): Aristóteles, Cuvier, Darwin, Hooke, Humboldt,
Haeckel, Linneo, Mendel. (4 pts: ½ c/u)
10).- Defendió la Corriente Vitalista, fue considerado como el padre de la Zoología. 2) ¿Cuáles son los campos de acción de la Biología? Escribe 6 acciones y dibújalas.
a) Lamarck b) Teofrasto c) Aristóteles (3 pts: ¼ c/u)
d) Hipócrates e) N.A 3) Explica brevemente la historia del Microscopio. Dibuja sus tres tipos principales.
(4 pts: 1 c/u)
11).- Ornitología – Malacología y Herpetología, estudian respectivamente: 4) Plantea un problema y encuentra su solución utilizando el Método Científico. Dibuja.
a) Gallito de la rocas – caracol - sapo (2 pts: ¼ c/u)
b) Insectos – boa - caracol
c) Caracol – rana - boa 5) Vocabulario: ( ½ pto. c/u)
d) Codorniz – choro - iguana Busca en el diccionario el significado de las siguientes palabras:
e) Gallito de las rocas – choro - rana etimología, prejuicio, auxiliar, fósil, naturalista, evolución, herencia, conclusión, ciencia
y experimento.
13).- Defendió la Corriente Vitalista
a) Lamarck b) Teofrasto c) Aristóteles
d) Demócrito e) Oparín

14).- Los cocos, bacilos, vibriones y espirilos son estudiados por la:
a) Virología b) Micología c) Bacteriología
d) Ficología e) N.A

15).- Son enfermedades virales, excepto:


a) Paperas b) Varicela c) Tuberculosis II. NIVELES DE ORGANIZACIÓN DE LA
d) Sarampión e) Gripe MATERIA VIVA
16).- Ornitología es a …………….………… como Ictiología a ……………………………
1. DEFINICIÓN:

4 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

A) Población.- Es el conjunto de individuos de una misma especie que ocupa un


La materia ha sufrido profundas transformaciones a lo largo del tiempo dando origen a lugar físico determinado en un momento determinado. Ej: una población de seres
diversos grados de complejidad llamados “Niveles de Organización “, los cuales están humanos, de vicuñas, de leones, etc.
divididos en 3 grandes grupos: organización química, biológica y ecológica.
B) Comunidad.- Es el conjunto de individuos de diferente especie que ocupan un
2. NIVELES DE ORGANIZACIÓN: lugar o espacio físico determinado (biocenosis). Ej: Una playa rocosa es una
comunidad formada por estrellas de mar, erizos de mar, cangrejos, etc.
2.1. QUÍMICO: Es el nivel de organización abiótico presentando los siguientes sub
niveles: C) Ecosistema.- Relaciona a todos los seres vivos de una comunidad con el medio
ambiente. Ej: Un lago, un océano, un desierto, un charco, etc.
A) Atómico.- Constituye la base de la organización de la materia, como son los
elementos químicos: C, H, O, N, Na, K, etc. 3. BIOELEMENTOS

B) Molecular.- Se forman por la unión de elementos químicos, por ejemplo: O 2, O3, Son aquellos elementos químicos que los encontramos formando parte estructural y
H2O, HCl, aminoácidos, azúcares simples, bases nitrogenadas, etc. funcional de la materia viva y que dan origen a las biomoléculas. Éstos se clasifican
en:
C) Macromolecular.- Se forman por la unión de moléculas, por ejemplo: muchos
aminoácidos forman las proteínas, muchos azúcares simples forman los 3.1. PRIMARIOS.- Son los más abundantes; se llaman también organógenos porque
polisacáridos, muchos nucleótidos forman los ácidos nucleicos (DNA, ADN), etc. están íntimamente relacionados con la formación de las biomoléculas orgánicas. Se
dividen en:
D) Agregados supramoleculares.- Resultan de la unión de las moléculas a través
de enlaces débiles. Por ejemplo: los virus, ribosomas, membranas, centríolos, etc. BÁSICOS COMPLEMENTARIOS
2.2. BIOLÓGICO: Es el primer nivel de organización biótico (con vida). Presenta los C, H, O, N P, S
siguientes subniveles:
3.2. SECUNDARIOS.- Se encuentran en menor cantidad; llamados también
A) Celular.- Corresponde a las unidades funcionales como son las células. La célula oligogenésicos. Forman parte de biomoléculas orgánicas como las vitaminas y
es la unidad básica de los seres vivos, es decir, la mínima estructura que tiene macromoléculas como las proteínas, etc. Se les considera como minerales,
vida. Ej: bacterias, protozoarios, levaduras, etc. esenciales para regular nuestras funciones vitales. Se dividen en:

B) Tisular.- Corresponde a los tejidos, un tejido es un conjunto de células con el MACROCONSTITUYENTES MICROCONSTITUYENTES
mismo origen, la misma morfología y fisiología. Ej: tejido epitelial, tejido muscular,
etc. Na, Cl, K, Ca, Mg Fe, Co, I, Zn, Cu, Mn, F

C) Organológico.- Corresponde a los órganos, estos resultan de la asociación de


un conjunto de tejidos. Ej: corazón, pulmones, riñones, etc. 4. BIOMOLÉCULAS

D) Sistémico.- Corresponde a los sistemas, un sistema es un conjunto de órganos Son compuestos químicos que los encontramos formando parte estructural y funcional
asociados para cumplir funciones específicas. Ej: sistema nervioso, sistema de la materia viva. Se dividen en:
endocrino, etc.
4.1. BIOMOLÉCULAS INORGÁNICAS: Son las moléculas más sencillas de la materia
E) Individual.- Corresponde al individuo que resulta de la integración de los viva. Se caracterizan porque no derivan o no provienen del átomo de carbono. Ej:
sistemas. Ej: un reptil, un ave, un hombre, etc. agua, sales inorgánicas, gases.

2.3. ECOLÓGICO: Es el segundo nivel de organización superior (abiótico y biótico).


Presenta los siguientes subniveles:
4.2. BIOMOLÉCULAS ORGÁNICAS: Son consideradas las moléculas más complejas
de la materia viva. Se caracterizan porque todas provienen o derivan del átomo de
carbono. Ej: glúcidos simples o monosacáridos aminoácidos, bases nitrogenadas,
vitaminas, etc.

5 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

5. MACROMOLÉCULAS

Son el resultado de la unión de muchas moléculas. Las encontramos formando parte


estructural y funcional de la materia viva. Se dividen en: glúcidos (polisacáridos,
carbohidratos o hidratos de carbono), lípidos, proteínas y ácidos nucleicos.

 Alimentos que poseen proteínas: menestras (leguminosas), carnes (pescado en


primer lugar), leche, huevos, queso, cereales, súper cereales.

 Alimentos que poseen grasas: maní, palta, carnes, huevo, queso, aceites,
helados, chocolates.

 Alimentos que poseen carbohidratos: frutas, menestras (leguminosas),


tubérculos, harinas, dulces, helados

 Alimentos que poseen vitaminas y minerales: esencialmente todo lo fresco


como verduras, leguminosas (menestras), frutas. 2)
BIOMOLÉCULAS

Se dividen en:

PRÁCTICA DIRIGIDA N° 02
I. Escribe “V” o “F” según corresponda: (1/4 pto. c/u) Ejemplos : Ejemplos :
1. Los diversos grados de complejidad que se manifiesta en los seres vivos se debe a
cambios en la materia a los largo del tiempo. ( )
2. El subnivel molecular corresponde al nivel atómico de la materia viva. ( )
3. Los ribosomas y centriolos pertenecen al nivel químico de la materia viva. ( )
4. Una bacteria es un agregado supramolecular del planeta. ( )
III. Completa: ( ¼ pto. c/u)
5. El sistema nervioso del hombre pertenece al nivel tisular. ( )
BIOELEMENTOS
6. Una población es una agrupación de individuos de diferentes especies. ( ) 1. Los bioelementos primarios, también llamados............................................., se
7. Se dividen
Los ácidos nucleicos son ejemplos de biomoléculas orgánicas. ( ) dividen en: ................................ y........................................... .
en: 2. El nivel........................................ está formado por los factores bióticos
8. C, H, O y N son elementos organógenos. ( )
9. Los ácidos nucleicos son ejemplos de macromoléculas. ( ) y............................. .
10. Muchos aminoácidos ( por ejemplo 400) forman una proteína ( ) 3. La................................................... está formada por individuos de diferentes
(Organogenésicos) (Oligogenésicos
)
Se dividen especies que ocupan un lugar determinado. Esta también recibe el nombre
Se dividen
II. Completa los siguientes mapas conceptuales: (1/4 pto. c/u)
en: en : de............................................
1)

Ejemplos: Ejemplos: Ejemplos: Ejemplos:


6 4º SECUNDARIA – I PERIODO - 2008
I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

.
4. Los..............................................................se encuentran en menor cantidad y están
6) Los siguientes elementos son considerados oligoelementos:
formando parte de las.............................. orgánicas como las vitaminas, enzimas, a) c, Na, k b) Na, Cl, Mg c) H, N, K d) Mg, Cl, N e) N.A
además de regular nuestras funciones vitales, etc. 7) Son considerados elementos primarios básicos:
5. Las.................................................................... son las moléculas más sencillas de la a) C, H, P, S b) C, H, O c) C, H, Na, K d) C, H, O, N e) C, K, Fe

materia viva. Se caracterizan porque no..................... o no provienen del átomo de 8) Su deficiencia ocasiona raquitismo y osteomalacia:
a) S b) O c) Ca d) Na e) N.A
carbono.
9) Son considerados oligoelementos microconstituyentes :
6. Los glúcidos complejos son ejemplos de..................................................., en cambio a) Na, K b) C, K c) Na, H d) Zn, Mn e) C, H, O
los glúcidos simples son ejemplos de................................................ 10) El déficit de .... produce una enfermedad conocida como bocio en los adultos.
a) C b) I c) Cu d) Mg e) K
IV. Relaciona: (1/4 pto. c/u)
11) Forma parte de la vitamina B12.
a) Carbohidrato simple. ( ) Agregado supramolecular. a) Ca b) Co c) Cl d) Br e) C
b) Co, Cu, I. ( ) Biomoléculas inorgánicas.
12) Componente de la Hemoglobina:
c) Levadura. ( ) Oligoelementos. a) Fe b) Na c) K d) Mg e) Ca
d) C, H, O. ( ) Subnivel molecular.
13) Forma parte de la sal de mesa:
e) Virus. ( ) Elementos organógenos. a) Na, Mg b) Na c) Cl d) S e) b y c
f) H2O, CO2. ( ) Subnivel celular.
14) No es característica de la reproducción asexual:
g) Ca, Mg. ( ) Macromoléculas. a) Participa un solo progenitor
h) Proteínas. ( ) Microconstituyentes. b) No hay variabilidad genética
c) Si existe variabilidad genética
i) Elementos Traza. ( ) Almidón. d) Generalmente ocurre en organismos multicelulares. e) c y d
j) 200 glúcidos simples. ( ) Macroconstituyentes. 15) La fotosíntesis es un ejemplo de:
a) Catabolismo b) Anabolismo c) a y b d) Homeostasis e) N.A
V. Marque la respuesta correcta: (1/4 pto. c/u)
1) 16) Se define como el incremento de la masa celular:
 Las proteínas, los glúcidos y lípidos pertenecen al nivel biológico de la a) Reproducción b) Metabolismo c) Anabolismo
organización de la materia viva. d) Crecimiento e) Homeostasis
 La mínima estructura que tiene vida son las células.
 Los virus son considerados seres vivos. V. Desarrolla en tu cuaderno las siguientes preguntas:
1. ¿Cuál es la diferencia entre bioelementos primarios y secundarios? Da 5 ejemplos de
 El ecosistema es la unidad ecológica fundamental.
c/u. (4 pts: 1/4 c/u)
a) FVFV b) FFVV c) VFVF d) VFFV e) FFFV
2. ¿Cuál es la diferencia entre biomoléculas inorgánicas y orgánicas? Da 5 ejemplos de
c/u. (4 pts: 1/4 c/u)
2) Son agregados supramoleculares:
3. Escribe 3 ejemplos de macromoléculas y sus unidades estructurales y represéntalas
a) Ribosomas b) Pared celular c) Virus d) Centriolos e) T,.A
gráficamente. (3 pts: 1/2 c/u)
4. Vocabulario.- (½ pto c/u) Busca el significado de los siguientes términos: población,
3) Es un conjunto de individuos de la misma especie que viven en un espacio y
comunidad, ecosistema, órgano, especie, glúcido, lípido, proteína, ácido nucleico,
momento determinado:
elemento.
a) Bioma b) Comunidad c) Ecosistema d) Biotopo e) Población
4) Se puede decir que el hombre se encuentra dentro del nivel ..... de organización. III. EL SER VIVO
a) Químico b) Biológico c) Organológico d) Celular e) Ecológico
5) Los siguientes elementos son bioelementos primarios: 1. CARACTERÍSTICAS DEL SER VIVO.
a) C, H, O b) Na, C, K c) Fe, H, Zn d) p, Na, Fe e) N.A

7 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

Cuando estudiamos los niveles superiores de organización de la materia viviente, Consiste en una serie de cambios o procesos físicos y químicos mediante los cuales
podremos notar que existen determinadas características propias de los seres vivos. los seres vivos mantienen y producen su energía para crecer, conservarse o
Estas son: repararse. Los fenómenos metabólicos, pueden ser anabólicos o catabólicos.
 La organización compleja.
 La irritabilidad a) El Anabolismo:
 El metabolismo. Con este nombre se conoce a las reacciones químicas que permiten cambiar
 La reproducción. sustancias sencillas para formar otras más complejas, dentro de un organismo
 El movimiento o desplazamiento. viviente. A través de este fenómeno el organismo almacena energía, produce
 El crecimiento. nuevos materiales celulares con los cuales puede crecer, desarrollar y repararse.
 La Homeostasis Por ejemplo la Fotosíntesis.
 La Adaptación y Evolución.
b) El Catabolismo:
Se llama así a las reacciones químicas que permiten desdoblar las sustancias
complejas, con liberación de energía y desgaste de materiales celulares. Este
fenómeno permite obtener la energía que el organismo necesita para su
funcionamiento. Por ejemplo la Respiración Celular.

1.4. REPRODUCCIÓN:
La reproducción es una característica distinta de los seres vivos, que permite a las
células duplicar su material genético, transmitido de una generación a otra y, a los
organismos, originar sus descendientes con idénticas características que el
progenitor. La reproducción puede ser asexual o sexual.

1.5. MOVIMIENTO O DESPLAZAMIENTO:


Las plantas, en su mayoría, no se desplazan de un lugar a otro; es decir, son fijas,
pero realizan un movimiento constante durante su crecimiento.
Las algas cianofíceas, las bacterias, las euglenas, los sacordinos (amebas) y los
ciliados (paramecios), reaccionan ante los estímulos del ambiente, produciendo en
su cuerpo movimientos ameboideos, o desplazamientos originados por el batido de
flagelos.
1.1. ORGANIZACIÓN COMPLEJA: El desplazamiento o locomoción de los animales es más visible, es así como
Todos los seres vivos están formados por estructuras complejas llamadas células podemos observar que ellos nadan, bucean, caminan, corren, reptan, saltan, vuelan,
las cuales están a su vez formadas por diversas moléculas inorgánicas y orgánicas. planean, etc.
En algunos seres vivos estas células se organizan para formar tejidos, los cuales
componen órganos, que a su vez forman aparatos o sistemas y todos estos juntos 1.6. CRECIMIENTO:
forman al Ser vivo o individuo. El crecimiento es el aumento de la masa celular de los seres vivos, que puede ser el
resultado del mayor tamaño de las células como ocurre en los animales unicelulares
1.2. IRRITABILIDAD: o también, el crecimiento se debe a la mayor cantidad de células, como es el caso
Todos los seres vivos poseen irritabilidad. Esta propiedad es fundamental en los de los seres pluricelulares.
seres vivos y consiste en responder a los estímulos y cambios físicos o químicos del Casi todas las plantas crecen hasta su muerte; generalmente los animales tienen un
medio en que se encuentran. período de crecimiento limitado, que termina cuando llegan a la adultez. Algunos
Entre los principales estímulos, podemos citar: la variación de la temperatura, los animales pueden regenerar las partes que pierden de su cuerpo, tales como, las
cambios de color, la intensidad o dirección de la luz, los cambios de la presión hidras, las planarias (los gusanos planos), las lagartijas, las salamandras, las
atmosférica, los cambios de sonido, los cambios de la composición química de la estrellas de mar, el cangrejo, etc.
tierra, el agua o el aire, etc. En las plantas se producen las taxias, las nastias y los
tropismos. 1.7. HOMEOSTASIS:
1.3. METABOLISMO: Es la capacidad del organismo para buscar el equilibrio tanto en sus funciones
como en todas las características y propiedades que poseen. Cuando este equilibrio

8 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

se rompe ya sea por factores externos (estrés) o internos (metabolismo inadecuado) 1.- La............................. es la capacidad de los seres vivos para responder frente a un
se tiene como consecuencia el desarrollo de enfermedades.
estímulo determinado del medio ambiente. Las respuestas ante estos estímulos
1.8. ADAPTABILIDAD Y EVOLUCIÓN: pueden ser de.............................. y...................................
Las plantas y los animales soportan los cambios del medio donde viven. Esta
2.- El................................... es el incremento de la masa celular, la cual aumenta en
propiedad se denomina adaptación, debido a la facilidad con que les permite
realizar ajustes inmediatos, que dependen de la irritabilidad de las células. También tamaño y número mientras que la........................................ es la capacidad que tienen
existen ajustes a largo plazo, resultante de fenómenos de selección y mutación los
los seres vivos para mantener un equilibrio interno de su cuerpo con el medio que lo
cuales son la “materia prima” de la evolución. Cada organismo es producto de
interacciones complejas entre genes y las condiciones ambientales. Un organismo rodea.
que ha logrado el éxito está adaptado a su medio y por lo tanto los organismos más
3.- La.............................. es un tipo de movimiento interno que se da a nivel
adaptados o mejor adaptados son producto de la evolución.
del......................................... de las células de las hojas de una planta.
2. FUNCIONES VITALES DE LOS SERES VIVOS: 4.- En la reproducción............................ los descendientes son idénticos al organismo
Son aquella que nos diferencian de los seres inertes:
progenitor. Mientras que en la reproducción............................. los seres
a) Relación: descendientes son semejantes al organismo progenitor.
Nos permite sobrevivir en un ambiente determinado, gracias a nuestros sentidos,
sistema nervioso, sistema locomotor y hormonas. 5.- El anabolismo es una reacción de tipo.................................... porque consume
energía. Mientras que el..................................... libera energía y es una
b) Nutrición:
Nos permite sobrevivir como individuos. Se subdivide en digestión, circulación, reacción.....................................
respiración, excreción, secreción, asimilación, desasimilación. 6.- La........................................ es un proceso en donde los organismos forman
c) Reproducción: descendencia, todo ello con la finalidad de ...........................................................
Permite la continuidad de la especie en el tiempo. 7.-..............................es la función vital que nos permite crecer, desarrollarnos, y

PRÁCTICA DIRIGIDA N° 03 mantener en equilibrio cada parte de nuestro cuerpo.


8. Las..................................... son fijas, pero realizan un movimiento constante durante
I. Escribe “V” o “F” según corresponda: (1/4 pto. c/u)
su crecimiento.
1) La organización específica no es una característica de los seres vivos. ( )
2) La fotosíntesis es un ejemplo de proceso catabólico. ( ) III.- Relaciona: (1/4 pto. c/u)
3) La formación de proteínas es un proceso metabólico. ( )
4) La fiebre es un ejemplo de homeostasis. ( ) a) movimiento ( ) fototropismo
5) Las plantas poseen irritabilidad. ( )
b) adaptación ( ) fiebre y sudor
6) Las bacterias se reproducen en forma sexual con la participación de
( ) c) irritabilidad ( ) respiración celular
gametos.
7) Las branquias de ciertos organismos es un ejemplo de adaptación. ( ) d) catabolismo ( ) ciclosis
8) La nutrición autótrofa se da en bacterias. ( )
e) anabolismo ( ) aletas, branquias
9) Las aletas de los peces y el aparato bucal de los insectos es un tipo de
( ) f) homeostasis ( ) fotosíntesis
adaptación.
10 Un erizo de mar posee organización específica. ( ) g) metabolismo ( ) reproducción sexual
11 Las garrapatas y los zancudos carecen de reproducción sexual. ( )
h) catabolismo ( ) exergónico
12 En la reproducción asexual la esperanza de vida es mayor. ( )
i) cianobacteria ( ) realiza fotosíntesis
II.- Completa: (1/4 pto. c/u)
j) bacteria ( ) endergónico

9 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

k) anabolismo ( ) intercambio materia y energía


10) Marca V o F según corresponda:
l) caracol ( ) reproducción asexual
 Las amebas poseen movimientos
 La ciclosis es un tipo de movimiento
IV.- Subraya la respuesta correcta: (1/4 pto. c/u)  Una bacteria es eucariótica
a) FFV b) VVF c) VFV
1) Capacidad que tienen los seres vivos para mantener un equilibrio interno de su d) VVV e) FFF
cuerpo con el medio que lo rodea:
a) metabolismo b) homeostasis c) anabolismo
d) ciclosis e) N.A. V.- Desarrolla en tu cuaderno las siguientes preguntas:

2) Conjunto de reacciones químicas que ocurren dentro de las células con la finalidad de 1.- Ejemplifica y dibuja cada una de las características de los seres vivos. (1/4 pto. c/u)
intercambiar materia y energía con el medio ambiente: 2.- Menciona que tipo de reproducción tienen los siguientes seres vivos. (1/4 pto. c/u)
a) homeostasis b) irritabilidad c) adaptación
d) metabolismo e) b y c a) Rana : ......................................................................
b) Estrella de mar : ......................................................................
3) No es una característica del ser vivo:
a) adaptación b) organización c) anabolismo c) Pepino de mar : ......................................................................
d) crecimiento e) N.A. d) Cucaracha : ......................................................................

4) Una cianobacteria es un organismo: e) Ornitorrinco : ......................................................................


a) autótrofo b) procariota c) eucariota f) Malagua : ......................................................................
d) heterótrofo e) a y b
g) Hidra de agua dulce : ......................................................................
5) Las malaguas y los erizos de mar son organismos: h) Bacteria : ......................................................................
a) procariotas b) eucariotas c) metabólicos
d) b y c e) N.A.
3.- ¿Cuál es la diferencia entre reproducción sexual y asexual? (4 pts: ½ c/u)
6) Es el incremento de la masa celular como resultado del aumento en el tamaño de las 4.- ¿Cuáles son las funciones vitales de los seres vivos? Explica y dibuja un ejemplo de
células individuales: cada uno. (3 pts: 1 c/u)
a) irritabilidad b) adaptación c) crecimiento
d) metabolismo e) N.A. 5.- Vocabulario.- Busca el significado de las siguientes términos. ( ½ pto c/u)
Materia, molécula, inerte, seudópodo, locomoción, adaptación, energía, tropismo,
7) Se da cuando el estímulo que proviene del medio ambiente es constante y progenitor, nastia, taxia.
permanente en donde el ser vivo modifica determinada forma de vida:
a) irritabilidad b) crecimiento c) metabolismo
d) adaptación e) homeostasis

8) Es cuando el ser vivo produce respuestas específicas frente a un estímulo temporal y


transitorio:
a) adaptación b) reproducción c) homeostasis
d) irritabilidad e) N.A.

9) No es una característica de la reproducción asexual:


a) Se forma un clon.
b) El número de descendientes suele ser abundante en corto tiempo.
IV. BIOLOGÍA MOLECULAR
c) Los descendientes exhiben caracteres recombinados de sus progenitores.
d) No intervienen gametos. 1. BIOELEMENTOS:
e) Se requiere un solo individuo.
1.1. DEFINICIÓN:

10 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

Son todos aquellos elementos químicos que forman parte de los seres vivos en participa en la transferencia y almacenamiento de energía a través del ATP
condiciones normales. (Adenosín trifosfato)
De los 109 elementos existentes 92 son elementos naturales y 17 son obtenidos en  Magnesio (Mg).- Forma parte de las estructuras óseas. Es componente principal
el laboratorio o artificialmente. del pigmento fotosintético de algas y plantas. Su deficiencia produce clorosis.
Si se realiza un análisis químico detallado de cada un o de los eres vivos y luego se  Hierro (Fe).- Componente de proteínas como la hemoglobina, La formación de
promedia los resultados se podrá determinar que algunos bioelementos son más este pigmento, en la que se requiere de este bioelemento, se realiza en la
abundantes que otros. médula ósea (itematopoyesis). Componente de la Mioglobina. Su deficiencia en
humanos y primates produce la Anemia.
 Cobre (Cu).- Existe en pequeñas cantidades en el organismo, la mayor parte se
1.2. CLASIFICACIÓN: halla en el hígado y en menor proporción en el bazo y en la medula ósea. Forma
parte de la hemocianina que es el pigmento encargado de transportar O2 de la
Los Bioelementos se clasifican en 2 grupos: mayoría de Invertebrados. El cobre no es constituyente de la hemoglobina, pero
- Primarios interviene en la formación y maduración de los glóbulos rojos. Interviene en la
- Secundarios síntesis de la melanina, participa en el transporte del Fe a la médula ósea.
 Iodo (I).- Necesario para la síntesis de las hormonas elaboradas por la glándula
a) BIOELEMENTOS PRIMARIOS.- Llamados también Biogenésicos o tiroides: tiroxina y triyodotiroina. Su déficit o carencia produce el bocio en el
Organógenos, incluyen a elementos principales: C, H, O, N, P y S, constituyen el adulto y cretinismo en los niños.
96% del peso de la materia viva.  Fluor (F).- Considerado como el endurecedor del esmalte dentario previniendo la
A través de estos elementos se van a formar las Biomoléculas orgánicas e formación de caries. El exceso produce un moteado dental, manchas amarillas
inorgánicas. que se conoce con el nombre de fluorosis.
 Manganeso (Mn).- Interviene en la síntesis de las grasas.
b) BIOLEMENTOS SECUNDARIOS.- Llamados también Oligoelementos o  Silicio (Si).- Componente de las estructuras duras de algunos org. Esponjas
Oligogénicos. Estos bioelementos van a interactuar en forma libre como parte de siliceas y diatomeas.
moléculas inorgánicas sales o de moléculas Orgánicas como son vitaminas,  Cobalto(Co).- Componente de la vitamina B12 Cianocobalamina.
pigmentos; generalmente se encuentran en forma de Iones es decir con su
respectiva carga eléctrica. 2. BIOMOLECULAS:
Son los compuestos que resultan de la asociación de dos o más bioelementos. Estas
macromoléculas cumplen diversas funciones en el metabolismo celular. Las
1.3. PRINCIPALES BIOELEMENTOS: biomoléculas pueden ser de dos tipos:

 Sodio (Na).- Es el catión más abundante del líquido extracelular, interviene en 2.1. BIOMOLÉCULAS INORGÁNICAS:
la regulación de la presión osmótica entre el medio interno y externo de las Constituidos por escasos bioelementos, unidos por enlaces débiles, debido a la
células. Su deficiencia provoca la deshidratación. También regula el equilibrio ausencia de los enlaces (C-C), por ejemplo el agua, tampones, sales y gases.
ácido base y las funciones nerviosas y musculares.
 Potasio (K).- Es el catión más abundante del líquido intracelular, participa en la 2.1.1. Agua:
transmisión de impulsos nerviosos y en la contracción muscular. Es el Molécula más abundante en todo organismo (70 a 80%), es el solvente biológico
constituyente de enzimas que intervienen en el metabolismo. determinante en todas las reacciones químicas de la vida.
 Cloro (Cl).- Presente en los medios extracelulares o intracelulares, siendo el
principal anión del 1° de ellos, importante en el equilibrio de agua en los A) Importancia biológica:
organismos. Cumple función en la síntesis de ácido Clorhídrico en el estómago.  Regula la temperatura del organismo por medio de la transpiración (acción
 Calcio (Ca).- Es el mineral mas abundante de nuestro organismo, se relaciona termoreguladora).
con el fósforo por la función nutricional. La mayor parte de Calcio se encuentra  Se encuentra presente de acuerdo a los tejidos y a las funciones que realiza,
en los huesos, el resto de calcio lo encontramos en los músculos y otros tejidos por ej. Riñones (83%), esqueleto (40%), cerebro(88%).
blancos como la TIROCALCITONINA (hormona elaborada por la tiroides). El  Participa en la lubricación y protección de los órganos internos.
calcio es esencial por que interviene en la contracción muscular, coagulación  La vida se desarrolla en un medio acuoso.
sanguínea y conducción nerviosa como también en la formación de huesos y
dientes. B) Propiedades:
 Fósforo (P).- Se halla en los huesos y dientes, el resto en los músculos, células  Es disolvente; le permite disociar las moléculas polares, favoreciendo las
cerebrales y sangre. Es el constituyente de los fosfolípidos y del tejido nervioso,
reacciones bioquímicas en las células de los organismos vivos.

11 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

 Presenta elevado calor específico (cantidad de energía que requiere 1 gramo  Transmiten impulsos nerviosos (Na+)
de una sustancia para elevar su temperatura a 1 grado).  Coagulación sanguínea (Ca-+)
 Máxima densidad del agua se alcanza a los 4°C(por debajo de esta  Regulan la ósmosis.
temperatura del agua disminuye).  Algunas actúan como tampones o buffer.
 Pueden formar parte de estructuras como carbonatos y fosfatos de Ca en
C) Estructura: huesos y dientes.
 La molécula está formada por oxígeno e hidrógeno. Se establecen enlaces Ejemplos: Na : catión extracelular más abundante.
covalentes entre los H y el O, de tal manera que se comparten electrones. Cl- : anión extracelular más abundante.
 Es bipolar, debido a que la molécula es angular, pudiendo unir a otras cuatro K+ : catión intracelular más abundante
moléculas mediante puentes de hidrógeno.
 Presenta asimetría por la formación del ángulo interno de 104.5°. 2.1.4. Gases:
Son moléculas inorgánicas constituidas por átomos de un mismo elemento, ej.
H H H CO2, H2S, CH4.
O O
H PRÁCTICA DIRIGIDA Nº 04
H H
H H  I. Escribe “V” si es verdadero o “F” si es falso: (1/4 pto. c/u)
O O
1. El agua es una molécula bipolar. ( )
H H H
O  = 104.5° 2. Una propiedad del agua es su elevado calor específico. ( )
H O
3. La molécula de agua es un pentaedro irregular. ( )
 En ciertas condiciones el agua se puede disociar: HOH – H + OH 4. La naturaleza bipolar del agua, le permite disolver y disociar las
 Posee acidez o alcalinidad. H : hidrogenión o protón. moléculas polares. ( )
OH : oxidrilo o hidroxilo 5. El agua presenta una distribución asimétrica de sus cargas. ( )
6. Los gases están en constante movimiento rápido y desordenado. ( )
 Escala de pH.- Es una escala que mide el grado de acidez o alcalinidad; de
una solución. Fue propuesta por el científico Peter Sorensen. Esta 7. Los caparazones de crustáceos contiene sales. ( )
determinada ente los valores 0 al 14. Teniendo como valor neutro el 7, así 8. La alcalinidad comprende un rango de 3 a 7. ( )
del 0 al 6 es ácido siendo el 0 más ácido y el 6 menos ácido. Los valores
del 7.1 al 14 son denominados alcalinos o básicos. Por ejemplo el pH de la
sangre es de 7.4 (ligeramente alcalino) II. Subraya la alternativa correcta: (1/4 pto. c/u)

2.1.2. Tampones Buffer o Amortiguadores: 1).- Los siguientes elementos son bioelementos primarios:
Son aquellas sustancias que evitan los cambios bruscos de pH en un medio, con el a) C, H, O b) Na, C, K c) Fe, H, Zn d) P, Na, Fe e) N.A
fin de mantener un equilibrio interno orgánico sin variación. Entre los principales
Buffer están: 2).- Los siguientes elementos son considerados oligoelementos:
Bicarbonato.- Principal buffer o tampón extracelular en la sangre y saliva. a) C, Na, k b) Na, Cl, Mg c) H, N, K d) Mg, Cl, N e) N.A
Fosfato.- Principal tampón intracelular.
Hemoglobina.- Regula el pH sanguíneo, destaca entre las proteínas 3).- Su deficiencia ocasiona raquitismo y osteomalacia:
amortiguadoras. a) S b) O c) Ca d) Na e) N.A
2.1.3. Sales:
Son compuestos simples cuyos elementos se unen por enlace iónico o 4).- El déficit de.... produce una enfermedad conocida como bocio en los adultos.
electrovalente. Se disocian en sus respectivos (cationes y aniones) determinando a) C b) I c) Cu d) Mg e) K
potenciales de acción eléctrica. Algunas funciones básicas son:
 Permiten contracción muscular (Ca++, K+). 5).- Forma parte de la vitamina B12.

12 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

a) Ca b) Co c) Cl d) Br e) C 4) Define qué es el pH. Da 3 ejemplos.


(4 pts. : 1 c/u)
6).- Forma parte de la sal de mesa:
a) Na, Mg b) Na c) Cl d) Se e) b y c 5) VOCABULARIO.- ( ½ pto. c/u) Escribe el significado de las siguientes
palabras o términos: Anemia – Frústulo – Espículas – Cretinismo – Xeroftalmia –
7).- No es una característica del agua: Bocio – Anfótero – acuoso – tampón.
a) Actúa en las reacciones como dipolo
b) Es una biomolécula inorgánica binaria. 2.2. BIOMOLÉCULAS ORGÁNICAS
c) Representa el principal solvente orgánico A) GLÚCIDOS (Carbohidratos)
d) Presenta en su constitución enlaces de tipo covalente
e) N.A. A.1. Importancia:
8).- Los valores del pH varía de: - Energética: A los glúcidos por su alto poder energético se les considera los
a) 1-14 b) 0-7 c) 7-14 d) 0-14 e) N.A. combustibles de los seres vivos.
- Estructural: Muchas moléculas de glucosa se combinan para formar
9).- El metabolismo celular, conlleva a la formación de ácidos bases, lo cual alteraría el complejos llamados polisacáridos como por ejemplo, la quitina, etc.
pH del lugar donde ocurre tal proceso, para evitar estos posibles cambios existen los
llamados: A.2. Clasificación:
a) Tampones b) Buffer c) a y c
d) Amortiguadores e) a, b y c - Monosacáridos: Están formadas por una molécula. Entre las más importantes
están:
10).- Es considerado el principal tampón extracelular en la sangre:
a) Fosfato b) Hemoglobina c) T.A. Glucosa.- Se conoce como dextrosa, es la principal fuente de energía de los
d) N.A. e) Bicarbonato seres vivos.
Fructosa.- Se conoce como azúcar de frutas o levulosa.
11).- No es una característica de las sales: Galactosa.-Es el azúcar de la leche.
a) Desempeñar funciones a nivel de la contracción muscular y cardiaca. Ribosa.- Pentosa característica del RNA (ácido ribonucléico).
b) Podemos encontrarla en los huesos. Desoxiribosa.- Pentosa característica del ADN (Acido desoxiribonucléico).
c) Se presenta en la célula en altas concentraciones
d) Participan en la regulación hídrica celular - Disacáridos: Formados por unión de dos monosacáridos mediante enlace
e) c y d glucosídico:
12).- Entre las funciones del agua se encuentran: Sacarosa.- Llamado también azúcar de caña, que usamos a diario en nuestra
a) Disolvente b) Medio de transporte c) Termorregulador mesa es el disacárido de mayor consumo mundial en la alimentación.
d) Termoaislante e) T.A
O O
13).- La capacidad de algunos insectos para caminar sobre el agua sin hundirse se debe a: 1 O + H2O
2
a) Densidad b) Calor específico c) Grado de ionización
d) Tensión superficial e) Viscosidad HO (1 - 2) O

III. Desarrolla en tu cuaderno las siguientes preguntas : GLUCOSA FRUCTOSA

1) Explica la importancia del agua, las sales minerales y gases para los Maltosa.- Está presente en las semillas en germinación.
seres vivos. (6 pts. : 1/3 c/u)
2) Cuáles son las propiedades del agua. (4 pts. : 1 c/u) O O
1 O 4
3) Explica y dibuja el ciclo hidrobiológico y su importancia para los seres
vivos. Glucosa (1, 4) Glucosa
(5 pts. : ½ c/u)

13 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

Lactosa.- Está presente en la leche de los mamíferos. Se usa en farmacia


como vehículo y en medicina como diurético y laxante suave. Celulosa.- Polímero de glucosa, polisacárido estructural que forma parte de las
O O paredes celulares de las plantas, algas. La celulosa es componente principal de
OH O O la madera, el algodón, las fibras vegetales y sus productos derivados como el
1 O 4
papel.
OH
Galactosa (1, 4) Glucosa

- Polisacáridos: Formado por más de diez unidades de monosacáridos unidos GLUCOSA


por enlaces glucosídicos de peso molecular elevado.

Almidón.- Polisacárido de reserva energética en vegetales se le encuentra en


el tallo, raíz y frutos. Está formado por unidades de glucosa. Cuando comemos
arroz, yuca, papa o maíz estamos comiendo almidón, éste por procesos
digestivos en la boca, estómago e intestino se transforma de nuevo en o o
unidades de glucosa. (1- 4)
Pared
Celular
AMILOSA

o o o
o o
(1,4)
Quitina.- Polisacárido estructural que forma la cubierta externa de los insectos,
ALMIDÓN
o
arácnidos y crustáceos, también se le encuentra en paredes celulares de
GLUCOSA hongos.
Papa (1, 6)
o

o o
Exoesqueleto n
Quitinoso o
AMILOPECTINA
NHCOCH3
Glucógeno.- Es un polímero de glucosa, polisacárido de reserva energética de Quitina NAG
origen animal, se almacena en el hígado y músculos; así cuando nosotros
Pared Celular
necesitamos energía extra por un ejercicio fuerte, el glucógeno se desdobla en
unidades de glucosa.

GLUCÓGENO GLUCOSA B) LÍPIDOS

o (1, 6) B.1. Importancia biológica:


Hígado
- Estructural: Los lípidos constituyen aproximadamente el 40% de las
o o
membranas celulares.
(1, 4) - Energética: Las grasas son reserva de energía. Se almacenan en el tejido
adiposo bajo la forma de triglicéridos.

14 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

- Termoaislante: Al almacenarse en el tejido adiposo forma una barrera que


impide la pérdida de calor producido en el tejido muscular. Las ballenas, focas y
otros animales de regiones polares, soportan las bajas temperaturas porque
tiene gran cantidad de lípidos debajo de la piel.
- Electroaislante: Los lípidos que existen alrededor de los axones neuronales
favorecen la transmisión, rápida del impulso a lo largo de los nervios. Las rayas
y anguilas eléctricas no se electrocutan por la gran cantidad de lípidos que
existe alrededor de sus nervios.
- Nutricional: Intervienen en el transporte y absorción de las vitaminas A, D E y
K (liposolubles).

H H H H

H C C C C COOH
Grupo
H H H H
carboxilo PRÁCTICA DIRIGIDA Nº 05
CADENA HIDROCARBONADA
I. Escribe “V” o “F” según corresponde: (1/4 pto. c/u)

H H H 1.- La cadena lineal del almidón se llama amilopectina. ( )


2.- La cadena lineal del almidón se llama amilosa. ( )
H C C C H C3 H8 O 3 3.- La celulosa se encuentra formando parte de la pared celular de las ( )
OH OH OH plantas.
4.- La glicerina forma parte estructural de los lípidos. ( )
GLICEROL O GLICERINA O PROPANOTRIOL 5.- Los oligosacáridos a nivel intestinal pueden ser transformados en ( )
monosacáridos.
B.2. Clasificación: 6.- El ácido palmítico es un ácido graso insaturado. ( )
7.- La lactosa se compone de 2 moléculas de glucosa. ( )
- Lípidos simples: Biomoléculas constituidas por un alcohol y ácidos grasos, 8.- Los glúcidos brindan aporte calórico de 4,1 Kcal. ( )
unidos entre sí por enlaces éster. Dentro de los lípidos simples tenemos a los 9.- El exceso de lípidos se almacena en el tejido adiposo. ( )
Glicéridos y a las Ceras. 10.- Las proteínas tienen como unidades monoméricas a los azúcares. ( )

GLICEROL Triglicéridos
(Grasas neutras) II. Completa: (1/4 pto. c/u)
O O O + 3H2O
1) La unidad básica de las proteínas son los...................................., la molécula básica
A A A de los glúcidos es el......................................... y las moléculas básicas de los lípidos
G G G
son el............................................. y el...................................
- Lípidos complejos: Biomoléculas constituidas por un alcohol, ácidos grasos y 2) El enlace que une dos aminoácidos se llama..................................... y el que une 2
otros grupos químicos. Dentro de los lípidos complejos se encuentran los monosacáridos se denomina....................................
fosfolípidos y los glucolípidos.
3) Los lípidos son considerados biomoléculas de condición............................. porque
- Lípidos derivados: Los principales son los Esteroides. Función: Reguladora, poseen C, H y O. Mientras que las proteínas son.......................................... porque
estructural y metabólica.
además de CHO presentan................................

15 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

4) El................................. constituye la reserva energética de los animales y hongos.


- Las proteínas son biomoléculas principalmente cuaternarias compuestas por C,
Y la................................... es el carbohidrato más abundante en las plantas.
H, O y N, la mayoría contienen adicionalmente azufre (S).
5) El enlace que participa en la formación de los lípidos es el enlace........................ - Todas las proteínas son macromoléculas (alto peso molecular) cuyas unidades
monómeras son moléculas simples denominadas aminoácidos (aa).
Dicho proceso se denomina.........................................
- Son las biomoléculas orgánicas más abundantes en los seres vivos.

III. Relaciona: (1/4 pto. c/u) C.2. Importancia biológica:

a) Queratina ( ) exoesqueleto de insectos. - Estructural.- Constituyen estructuras protectoras externas como los cuernos,
escamas, uñas, pelos y plumas de los animales, además esqueletos celulares
b) Monosacárido ( ) hígado y músculos y corporales. Ejemplo: La Queratina, Tubulina.
c) Glucógeno ( ) unidad estructural de las proteínas.
- Movimiento.- Intervienen en el movimiento a nivel celular y corporal. Esta
d) Quitina ( ) biocatalizador. función la , desempeñan las proteínas contráctiles. Ejemplo: La Actina y la
e) Aminoácido ( ) cadena espiralada de almidón. Miosina.

f) Celulosa ( ) pared celular de los vegetales. - Transporte.- Algunas proteínas son encargadas de transportar oxígeno, CO2,
g) Enzima ( ) unidad estructural de los glúcidos. lípidos, hormonas, Iones.

h) Fosfolípidos ( ) cadena ramificada de almidón. - Biocatalizadores.- Porque aceleran las reacciones intracelulares.
i) Ácido graso + glicerol ( ) uñas, plumas, piel. (Metabolismo). Ejemplo: Enzimas.

j) Insulina ( ) membrana celular. C.3. Clasificación de las proteínas:


k) Amilosa ( ) hormona de naturaleza proteica.
- Según su estructura:
l) Ácido graso saturado ( ) unidad estructural de los lípidos.
m) Ácido graso insaturado ( ) enlaces simples. a) Fibrosas: Cuando sólo tienen un tipo de estructura secundaria. Constituyen
estructuras resistentes, elásticas y flexibles.
n) Amilopectina ( ) enlaces simples y dobles. o El Colágeno que constituye la sustancia intercelular.
o La Queratina que constituye pelos, uñas, pezuñas, cuernos.
o La Elastina que constituye las paredes de los vasos sanguíneos.
V. Desarrolla en tu cuaderno las siguientes preguntas: o La Fibroina que constituye la seda y telas de araña.
o La Fibrina que constituye los coágulos sanguíneos.
1. Explica la importancia de los lípidos. Dibuja. (3 pts : ½ c/u)
2. Menciona 4 hormonas de naturaleza lipídica. Dibuja su estructura. (4 pts : ½ c/u)
b) Globulares: Cuando tienen 2 ó más tipos de estructuras secundarias:
3. Explica las diferencias entre estructura primaria, secundaria y terciaria de las Ejemplo:
proteínas. (6 pts : ½ c/u) o Las Enzimas, biocatalizadores que aceleran las reacciones biológicas.
o Los Anticuerpos, proteinas de defensa contra cuerpos extraños llamados
4. Vocabulario: Escribe el significado de las siguientes palabras o términos: antígenos.
( ½ pt. c/u) o Las Histonas, componentes de la cromatina.
o Las Tubulinas, constituyentes de los cilios, flagelos y centriolos.
Lactosa – Glucosa – Celulosa – Coloidal – Empírico – Colesterol – Sustrato – o Las Albúminas, proteínas de reserva (ovoalbúmina) de transporte
Enzima. (seroalbúmina).

C) PROTEÍNAS - Según su composición:

C.1. Definición:

16 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

a) Simples: Cuando están constituidos únicamente por aminoácidos. Ejemplo: D.1. Definición:
Tubulinas, albúminas, queratina. Son compuestos orgánicos de gran tamaño y peso molecular, las unidades que
lo constituyen se llaman nucleótidos, por tanto, un ácido nucléico puede definirse
b) Conjugadas: Cuando están constituidas por aminoácidos y un grupo como una molécula de polinucleotidos.
protético que se caracteriza por no ser aminoácido, pueden ser:
o Hemoproteínas (grupo Hemo): Hemoglobina, Citocromos, Mioglobina. D.2. Diferencias entre ácidos nucleicos:
o Glucoproteínas (glúcidos): Mucina interferon.
o Fosfoproteínas (fosfatos): Caseina, Vitelina. CARACTERISTICA ADN ARN
o Metaloproteínas (Metal): Hemocianina. Pentosa Desoxiribosa Ribosa
B.N. A. T. G. C AUGC
Cadena Doble Simple
Núcleo, Núcleo,
Ubicación: Mitocondrias y Citoplasma y
Cloroplastos Ribosomas
Copia y
Depósito de
traducción de
Función: información
la información
genética
genética

E) VITAMINAS

E.1. Definición:
Son compuestos orgánicos relativamente sencillos requeridos por los organismos
en pequeñas cantidades. No pueden ser usadas como fuentes de energía.

E.2. Clasificación:
Existen 2 clases de vitaminas.
D) ÁCIDOS NUCLEICOS Vitaminas liposolubles:

17 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

- Son solventes en grasas o lípidos.


- Son transportadoras en la sangre por proteínas fijadoras específicas. 1.- El................ es una molécula que porta la información genética, y el..................
- Se designan mediante la letra: A, D, E, K :
participa en la síntesis de proteínas.
Vitamina A.- Llamada retinol, lo encontramos en las verduras (Nabo, 2.- El enlace.................................... se da entre el..................................................... de
zanahoria), en el hígado, en la mantequilla, queso. Favorece el
un nucleótido con la pentosa de otro nucleótido.
funcionamiento normal de los ojos.
Vitamina D.- Conocida como antirraquítica, lo encontramos en el aceite de 3.- las bases nitrogenadas de tipo............................ son A y G. Mientras que las bases
hígado de bacalao, pescado, huevo, leche, exponer la piel a la luz solar.
nitrogenadas de tipo..................................... son C, T y U.
Vitamina E.- Conocida como tocoferol, es la vitamina de la fertilidad lo
encontramos en aceites vegetales, carne, leche, espinacas, en los gérmenes 4.- En la molécula de ADN la base nitrogenada.............................. se une con
o semillas. La vitamina E es necesaria para la fertilidad de los animales.
la............................. a través de doble enlace; mientras que la ............................... se
Vitamina K.- Es antihemorrágica, lo encontramos en la alfalfa, lechuga.
une con la ............................... por medio de triple enlace..
Vitaminas hidrosolubles:
5.- La molécula básica de los ácidos nucleicos es el................................ formado por
- Son solubles en agua, entre las vitaminas hidrosolubles tenemos al una..............................., una................................................ y
complejo de la vitamina A y la vitamina C.
un................................................
Vitamina B1 (Tiamina o Aneurina).- Su deficiencia causa el Beri-Beri. 6.- Las cadenas del ADN son...................................... porque se encuentran en
Vitamina B2 (Riboflavina).- Su déficit causa la dermatitis y quellosis.
direcciones opuestas y son.......................................... porque donde hay una timina,
Vitamina B3 (Niacina).- Su déficit causa la pelagra o mal de la rosa.
Vitamina B5 (Ácido Pantoténico).- Su déficit causa la calvicie. en la otra, al mismo nivel hay una adenina.
Vitamina B12 (Cianocobalamina).- Su déficit causa la anemia perniciosa.
7.- Un nucleótido de ARN presenta una pentosa llamada..............................,
Vitamina C (Antiescorbútica).- Su déficit causa el escorbuto.
un.......................................................... y una..........................................................
que puede ser: A, G, C, y..............................
PRÁCTICA DIRIGIDA N° 06 8.- Si en el nucleótido de una cadena de ADN hay una base nitrogenada de tipo

I. Escribe “V” o “F” según convenga: (1/4 pto. c/u) adenina, en la otra cadena habrá............................ pero si hay citosina, en la otra
habrá.................................
1) Los Ác. Nucleicos son biomoléculas inorgánicas de tipo poliméricas. ( )
2) El nucleósido es la molécula básica de los ácidos nucleicos. ( ) III. Subraya la alternativa correcta: (1/4 pto. c/u)
3) El “ARN” no tiene timina. ( ) 1).- Es una proteína de función estructural:
a) Inmunoglobulina b) queratina c) Anticuerpo
4) El “ADN” se encuentra formando la cromatina ( ) d) Insulina e) Hemoglobina
5) La molécula de ADN fue estudiada por Singer y Nicholson. ( )
2).- Es una proteína que transporta el O2 en la sangre humana:
6) El azúcar que forma parte de la estructura del ADN es la ribosa. ( ) a) Calmodulina b) Hemoglobina c) Insulina
7) El azúcar de la estructura del ARN es la desoxirribosa. ( ) d) Hemocianina e) N.A
8) El ARN tiene doble cadena antiparalela en espiral. ( ) 3).- Los aminoácidos son compuestos anfóteros porque actúan como:
9) El ADN presenta las siguientes bases nitrogenadas: A, G, C y T ( ) a) Catión b) Ácidos y bases c) bases
d) Ácidos e) Anión
10) El ADN no tiene uracilo. ( ) 4).- Son proteínas globulares asociadas a los ácidos nucleicos:
a) Albúminas b) Anticuerpos c) Histonas
II. Completa: (1/4 pto. c/u) d) Ribulosa e) N.A.
5).- El nombre que toma cada aminoácido se debe a la variación en:

18 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

a) COOH b) NH2 c) H
d) R e) CO V. DOGMA DE LA BIOLOGÍA MOLECULAR
6).- Sí es una característica del enlace peptídico: 1. SÍNTESIS DE PROTEÍNAS:
a) Es de tipo covalente b) Se da entre 2 aminoácidos Es un proceso biológico vital que realizan las células de todos los seres vivos y que
c) Libera una molécula de H2O d) Es estable e) T.A. consiste en la producción de gran cantidad de proteínas, las cuales cumplen una
función importante en el organismo como por Ej.: ser responsables de los caracteres
7).- Las enzimas son biocatalizadores porque: físicos y sexuales, realizar diversas funciones metabólicas, etc.
a) Actúan sobre un sustrato determinado.
b) Reducen la energía de activación.
2. ETAPAS DE LA SÍNTESIS DE PROTEÍNAS:
c) Se desnaturalizan.
d) a y b.
A B C
e) T.A.
ADN ADN ARN
Proteínas
8).- Los aminoácidos catalíticos:
(Núcleo) (Núcleo) (Citoplasma)
a) Tienen la capacidad de transformar el sustrato en producto.
b) están en el sitio activo
A.- Replicación
c) Forman con el sustrato enlaces puente hidrógeno.
B.- Trascripción
d) Sólo b y c
C.- Traducción
e) a y b
2.1. REPLICACIÓN: (ADN ADN)
9).- Es el que le da el carácter básico y ácido respectivamente a la proteína:
¿Para qué se duplica el ADN? Todos los seres vivos son temporales; pueden
a) NH2 – COOH b) Grupo carboxilo – grupo amino
vivir unos minutos como las bacterias, varios siglos como las tortugas marinas; o
c) Grupo amino – grupo carboxilo d) Grupo R – grupo carboxílico
incluso más de un milenio como los olivos, pero para que la especie no se
e) a y c
extinga ha de haber siempre por lo menos un momento en que la información
biológica se replique (auto duplica) y las copias pasan a la descendencia.
10).- No es una etapa de la actividad enzimática:
La célula para dividirse, previamente duplica su “DNA”, de este modo, las
a) Formación del complejo E-S b) Transformación del sustrato
generaciones celulares mantienen una cantidad constante de DNA.
c) Liberación de sustrato d) Reducción de la energía de activación
e) c y d

IV. Desarrolla en tu cuaderno:

1. Elabora un mapa conceptual de las proteínas. (6 pts : ½ c/u)


2. Elabora un esquema de las funciones que desempeñan las proteínas.(4 pts: ½ c/u)
3. Dibuja un nucleótido y un nucleósido y señala sus partes. (4 pts. : ½ c/u)
4. Dibuja una molécula de ADN y una molécula de ARN; señalando sus partes.
(6 pts : ½ c/u)
5. ¿Cuál es la importancia del ADN? (2 pts : ½ c/u)

6. Vocabulario.- Escribe el significado de las siguientes palabras o términos


( ½ pt. c/u)
Síntesis, Pentosa, Oxidrilo, Cadena, Histonas, Purina.

19 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

2.2. TRANSCRIPCIÓN: (ADN ARN):


Consiste en el pasaje de la información genética del ADN (copia de la 3. CÓDIGO GENÉTICO:
información hereditaria) a la molécula de ARN, que empieza a sintetizarse por Se entiende por código genético al “Alfabeto Químico” que posee todo organismo
medio de la complementariedad de las bases nitrogenadas. del planeta, en donde se reúnen una serie de tripletes de nucleótidos de ARN o
también denominados “codones”, los cuales, a su vez guardan una
Cadena superior correspondencia especial con determinados aminoácidos (aa), los cuales al
TRANSCRIPCIÓN Hebra codificante reunirse constituirán a una proteína específica. Las proteínas que logren formarse
Hebra con significado habrán de ser utilizadas con fines: estructurales, inmunológicos, hormonales,
(con sentido) enzimáticos, contráctiles, etc.

ADN ATGCCGTTAGACCGTTAGCGGACCTGAC
TACGGCAATCTGGCAATCGCCTGGACTG
SEGUNDA BASE NITROGENADA
3’ 5’ Hebra inferior
Síntesis U C A G
Hebra templada

NITROGENADAPRIMERA BASE

BASE NTROGENADA TERCERA


de ARNm Hebra sin significado Serina
(Antisentido) Fenilalanina Tirosina Cisteina U
5’ 3’ U
Fenilalanina
Serina
Serina
Tirosina Cisteina C
Leucina Alto Alto A
ARNm AUGCCGUUAGACCGUUAGCGGACCUGAC Leucina
Serina
Alto Triptófano G

Prolina Arginina
2.3. TRADUCCIÓN: (ARN PROTEÍNAS): Leucina Histidina U
Prolina Arginina
Es un proceso que consiste en la síntesis de proteínas a partir de la molécula de Leucina Histidina C
C Leucina
Prolina
Glutamina
Arginina
A
ARN. Se realiza en el citoplasma, específicamente entre las 2 subunidades del Leucina
Prolina
Glutamina
Arginina
G
ribosoma y participan: ribosomas, ARNm y ARNt. El proceso es el siguiente:
Treonina Serina
Isoleucina Asparagina U
 El “ARNm” posee los “codones”, los cuales son tripletes de bases Treonina Serina
Isoleucina Asparagina C
nitrogenadas y son el complemento de los “anticodones”. A Isoleucina
Treonina
Lisina
Arginina
A
Treonina Arginina
 El “ARNt” posee los “anticodones”, los cuales son tripletes de bases Metionina Lisina G
nitrogenadas y son el complemento de los “codones”. Valina Alanina Ác. Aspártico Glicina
 Los ribosomas, al hacer la lectura del ARNm, se detienen ante un codón, U
Valina Alanina Ác. Aspártico Glicina
esperando que el ARNt ingrese con su anticodón correspondiente. Cuando C
G Valina Alanina Ác. Aspártico Glicina
A
existe el encuentro: “codón-anticodón”, un aminoácido se une a otro Valina Alanina Ác. Glutámico Glicina
G
aminoácido formándose así las proteínas.
PRÁCTICA DIRIGIDA N° 07
20 4º SECUNDARIA – I PERIODO - 2008
I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

2. El ……………………… se dirige al ………………………. para colocarse entre


I. Escribe “V” o “F” según corresponda: (1/4 pto. c/u ) los subunidades del …………………………
1. La información genética o hereditaria de todos los seres vivos está Por otro lado el …………………….. capta aminoácidos y posee los
almacenada en el RNA bajo la forma de un código genético. ( ) ……………………….., los cuales son tripletes de bases nitrogenadas que se
2. Un gen es un segmento de ADN que contiene la información genética complementan con los …………………..
necesaria para sintetizar una proteína determinada. ( ) 3. ……………………………. es el alfabeto químico que posee todo organismo
3. El ADN dirige directamente la síntesis de proteínas. ( ) en donde se reúnen una serie de tripletes de nucleótidos, llamados
4. La transcripción es un proceso que consiste en la formación de ARN a ………………………….., los cuales guardan una correspondencia especial
partir de ADN y ocurre en el citoplasma. ( ) con determinados ……………………….. que al reunirse constituirán una
5. El ARNt capta aminoácidos y a la vez posee los anticodones necesarios proteína.
para la síntesis de proteínas. ( ) 4. El ………………… no puede dirigir directamente la …………………………,
6. Para que pueda sintetizarse una proteína es necesario la participación por lo tanto, debe haber una molécula llamada ……………….. que lleve la
de los 3 tipos de ARN. ( ) información genética desde el ………………………. al …………………………
7. El código genético reúne una serie de codones, los cuales son responsables
de la síntesis de un aminoácido particular. ( ) IV. Completa el siguiente mapa conceptual: (1/4 pto. c/u)
La
8. La traducción es un proceso de síntesis de proteínas a partir del ARN
y ocurre en el núcleo celular. ( ) Síntesis de proteínas

II. Relaciona : (1/4 pto. c/u) Comprende tres etapas


a) ARNm ( ) AUG
b) Metionina ( ) citoplasma
c) Transcripción ( ) codón
d) Replicación ( ) ADN
Consiste en la Consiste en la Consiste en la
e) ARNt ( ) núcleo
formación de formación de formación de
f) Triptofano ( ) UGG
g) Traducción ( ) nucleolo
h) ARNr ( ) anticodón

A partir de: A partir de: A partir de:


III. Completa los espacios en blanco: ( ¼ pto. c/u)

1. La ……………………. es un proceso que consiste en la síntesis de


…………………… a partir de ……………………..
Esto ocurre en el : Esto ocurre en el : Esto ocurre en el :
Mientras que la …………………………. implica la síntesis de
……………………… a partir de ……………………

21 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

VI.- Subraya la respuesta correcta: (1/4 pto. c/u) 8. En relación al proceso de síntesis de proteínas, marca la respuesta correcta:
 El ARNr se dirige a los nucleolos donde es organizado en 2 subunidades, los
1. Señala lo incorrecto respecto a la síntesis de ARN: cuales luego formarán los ribosomas.
a) Las cadenas del ADN se separan  El ARNt se dirige al núcleo donde adopta la forma de hoja de trébol para
b) Los nucleótidos de ARN se colocan frente a los nucleótidos de ADN. captar aminoácidos.
c) Sólo hay formación de enlaces puente hidrógeno.  El ARNm se dirige al citoplasma para colocarse entre las 2 subunidades del
d) Hay ruptura y formación de enlaces puente hidrógeno. ribosoma, quien hará la lectura correspondiente.
e) N.A.  Los codones y anticodones derivan del ARNm y se unen para formar
aminoácidos.
2. Señala lo correcto acerca de la síntesis de proteínas y su relación con los
genes: a) VVFV b) FVFV c) VFVF d) FFVV e) VFFF
a) Los genes no almacenan información hereditaria para producir proteínas.
b) Los genes están formados por diferentes tipos de bases nitrogenadas. 9. Anticodón es el término que se aplica a:
c) Las diferentes proteínas que existen en el organismo poseen secuencias a) La lista de aminoácidos que corresponde al código genético.
de aminoácidos colocadas al azar. b) El concepto de que múltiples codones en ocasiones codifican para un solo
d) La secuencia de bases nitrogenadas presentes en el ADN son aminoácido.
responsables de la secuencia de aminoácidos presentes en una proteína. c) La parte del RNAt que interactúa con el codón.
e) b y d d) b y c
e) T.A.
3. La base nitrogenada “Timina” en el ADN es reemplazada por........ en el ARN:
a) Adenina b) Citosina c) Guanina 10. Señala lo incorrecto acerca de la síntesis proteica:
d) Uracilo e) a y d a) Los ribosomas al hacer la lectura del ARNm se detienen ante un anticodon.
b) El proceso de traducción es intracitoplasmático.
4. Proceso que consiste en el pasaje de la información genética del ADN al ARN, c) El ARNt transporta los codones y los aminoácidos hacia el lugar donde el
y que se lleva a cabo en el núcleo : ribosoma lee al ARNm.
a) Replicación b) Transcripción c) Traducción d) a y b
d) Autoduplicación e) N.A. e) a y c
5. Tipo de ARN que posee los codones necesarios, los cuales serán leídos por VI. Resuelve los siguientes ejercicios:
los ribosomas:
a) ARNm b) ARNt c) ARNr
d) b y c e) N.A.
1. Un organismo “x” presenta en su código genético las bases nitrogenadas
que darán origen a una proteína “y” particular, la cual forma parte de su
cuerpo. Por otro lado, se sabe que los siguientes codones: (4 pts. : 1
6. Tipo de ARN que capta aminoácidos y posee los anticodones necesarios para c/u)
la síntesis de un aminoácido particular:
a) ARNm b) ARNt c) ARNr 1ro: UAU 4to: AGC
d) b y c e) N.A. 2do: UGU 5to: CCU
3ro: CGU 6to: GUU
7. El ADN eucariótico:
a) Interviene directamente en la síntesis proteica al abandonar el núcleo y ser Codifican 6 aminoácidos diferentes que al unirse formaran dicha proteína. Lo
trasladado al ribosoma. que debes hacer es lo siguiente:
b) Toma parte indirectamente en la síntesis proteica (el DNA permanece en el
núcleo) a) Usando la tabla del código genético, encuentra los 6 aminoácidos que
c) No tiene nada que ver con la síntesis proteica. Sólo interviene en la división conforman dicha proteína y el orden en que aparecen.
celular. b) Escribe la secuencia de nucleótidos presentes en el ARNm.
d) Interviene en la síntesis proteica que se lleva a cabo en el núcleo. c) Escribe la secuencia de nucleótidos presentes en el ARNt.
e) Codifica para RNAm, pero no para RNAt ni para RNAr. d) Escribe la secuencia de nucleótidos presente en el ADN que dio origen
indirectamente a esta proteína.

22 4º SECUNDARIA – I PERIODO - 2008


I.E.P. “DOSCIENTAS MILLAS PERUANAS” BIOLOGÍA

2. Una bacteria patógena intestinal que produce cuadros de diarrea agudos


en diferentes pacientes, posee una proteína codificada por su genoma, la cual
la hace muy resistente a un determinado tipo de antibiótico. Dicha proteína
forma parte de su membrana y está conformada por gran cantidad de
aminoácidos (aprox. 100). Se han encontrado los siguientes codones dentro
del ARNm que son: AAU, AAA, ACG, GCU, UCU, CAU, CAA, GGU, CGA,
CUG, AAG, GGG. Dichos codones con responsables de la formación de 12
aminoácidos presentes en dicha proteína y aparecen en ese mismo orden.
(5 pts. : 1 c/u)

a) Haciendo uso de la tabla del código genético, encuentra esos 12


aminoácidos que forman parte de dicha proteína y el orden en que
aparecen.
b) ¿Cuál es la secuencia de nucleótidos presentes en el ARNm?
c) ¿Cuál es la secuencia de nucleótidos presente en el ARNt?
d) Escribe la secuencia de nucleótidos presente en la molécula de
ADN bacteriano que dio origen indirectamente a dichos aminoácidos.
e) Encuentra el número de enlaces fosfodiester y puente hidrógeno
en la molécula de ADN.

VIII. Desarrolla en tu cuaderno las siguientes preguntas

1. Define los siguientes términos: (4 pts.: ½ c/u)


ARN Base Nitrogenada Nucleótido Codón Anticodón
Código genético Transcripción ADN
2. ¿Cuál es la función del ARNm y el ARNt? (4 pts.: 2 c/u)
3. ¿Cuál es la diferencia entre transcripción y traducción? (4 pts.: 2 c/u)
4. ¿Qué ocurriría con la síntesis proteica de un organismo si se produce una
mutación en el ADN de sus células? (4 pts. :1 c/u)
5. ¿Cuál crees tú que es la importancia del código genético? (2 pts.)

VOCABULARIO.- Busca el significado de las siguientes palabras: ( ½ pto. c/u)


Dogma – Código – ARN – Replicación – Triplete - Codón

23 4º SECUNDARIA – I PERIODO - 2008