You are on page 1of 149

Capítulo 1

Identificación del material hereditario

La genética es la ciencia que estudia el material hereditario a cualquier nivel y dimensión.

El término gen se define como la unidad fundamental de la herencia.

La genética es fundamental porque maneja la información de los seres vivos. La genética


abarca tres disciplinas tradicionales:

➢ La genética molecular
➢ La genética de transmisión
➢ La genética de poblaciones

En la actualidad el número de disciplinas ha aumentado a consecuencia de los avances


tecnológicos. Ejemplos son la Genética del desarrollo, inmunogenética, la Ingeniería genética y
la biotecnología.

Muchos de los avances conseguidos fueron en el ámbito de la genética vegetal, con los
diversos programados de mejora genética para el aumento de producción, resistencia a estreses
abióticos y bióticos; y también en la genética humana, con la identificación de la base genética
de enfermedades.

1. Identificación de la naturaleza química del material


hereditario

El año de la partida inicial de la genética se remonta a 1900, cuando tres botánicos (Hugo
de Vries, Carl Correns y Eric Von Tschermak) conciben experiencias similares a las de Mendel
llegando a resultados coincidentes. De esta manera redescubrieron el trabajo de Mendel 35
años después de su publicación (1865). En él se establecieron las reglas básicas sobre la
transmisión por herencia genética. La cuestión que se empieza a abordar a partir de aquí es de
que se compone ese material hereditario.

En las primeras décadas del siglo XX existía un dilema de si eran las proteínas o los ácidos
nucleicos los portadores de la información hereditaria.

➢ Berzelius (1838) acuñó al término proteína a aquellas macromoléculas ricas en


nitrógeno. Se reconocía que estaban compuestos por quince aminoácidos diferentes.
En la actualidad se reconocen unos veintidós aminoácidos que forman parte de las
proteínas. Los dos últimos fueron descubiertos en los años 1985 (selenocisteína,
implicada en el envejecimiento de las células) y 2002 (pirrolisina, encontrado en

1
Capítulo 1. Identificación del material hereditario

arqueobacterias). Los veintidós aminoácidos tienen cadenas específicas en el código


genético, aunque también existen codones especiales.

➢ Miescher (1869) descubrió un material rico en fósforo en el núcleo de los glóbulos


blancos que denominó nucleína (asociación de ácidos nucleicos con proteínas)

➢ En 1900, estudios realizados por Levene demostraron que la nucleína se encontraba


en todos los tipos de células animales analizadas. Más adelante, en 1910, puso de
manifiesto que los ácidos nucleicos estaban formados por unidades a los que llamó
nucleótidos. Estos nucleótidos estarían compuestos de ácido fosfórico, una pentosa
(ribosa o desoxirribosa) y las bases nitrogenadas (adenina, timina, guanina y
citosina).
Levene llegó a la conclusión de que los nucleótidos
se unían a través de los grupos fosfato para formar
largas cadena polinucleotídicas. Además, propuso
la hipótesis del tetranucleótido, según la cual las
cadenas de ácido nucleico están constituidas por las
cuatro bases (A, T, G, C) que se repiten de manera
monótona a lo largo de la cadena polinucleotídica.
Si esta hipótesis fuera cierta sería una molécula
poco informativa, poco flexible para explicar la enorme variedad de los seres vivos.
Esta hipótesis dio pie a pensar que eran las proteínas las portadoras de la información
genética, pues ya se sabía que variaba mucho en la secuencia de aminoácidos
teniendo toda la potencia y variabilidad para explicar esta variedad en los seres vivos.

2. Transmisión del material hereditario en bacterias


(Experimento de Griffith)

En 1928, Griffith describió el llamado fenómeno de transformación bacteriana. Para ello


experimentó con la bacteria Streptococcus pneumoniae. Es uno de los agentes infecciosos que
causan neumonía en los humanos y también es patógena para el ratón. Cuando se inyectan en
ratones esputos de pacientes infectados por neumonía y portadores de esta bacteria, entonces
prolifera y causa la muerte del ratón en un plazo de 24 horas. Al analizar la sangre del ratón
infectado se observa un alto contenido de esta bacteria.

Esta bacteria es extremadamente patógena debido a una cápsula de polisacáridos que


envuelve la pared celular de la bacteria, la cual la hace resistente a los sistemas inmunológicos
del ratón. Cuando tienen la cápsula son virulentos y crecen en el laboratorio en placas de Petri
formando colonias con superficie lisa y aspecto brillante. Dado a que tienen este contorno liso
se llaman Smooth. Esa capa de bacterias por tanto la llamamos S (“smooth” = lisa). La cepa S

2
Capítulo 1. Identificación del material hereditario

más importante es la III


S. Si se inyecta a ratones
con esta cepa patógena
virulenta provocaría la
muerte del animal.

Hay otras cepas de


Streptococcus
pneumoniae que no son
patógenos porque
carecen de la cápsula de
polisacáridos al no tener
la información
necesaria para
sintetizar esa cápsula.
Cuando las analizaba se
veía que su apariencia
era distinta a las otras.
Tenían aspecto rugoso y
se designaron por R
(“rough” = rugoso).
Griffith partió de la cepa
II R, la inyectó a ratones
vivos y observa que los
ratones siguen viviendo.
El sistema inmunológico
puede atacar a estas
cepas ya que no tienen
cápsula.

La patogenidad de las III S es la cápsula, por lo que Griffith las somete a calor para matarlas
y las inyecta. Lo que observa es que el ratón sigue viviendo. Esto se debe a que la degradar las
bacterias, se degrada también la cápsula de polisacáridos que le aportaba la patogenidad a la
célula, y ahora ya no es patógena.

A continuación, Griffith parte de células vivas II R (no patógenas) y las mezcla con las cepas
III S muertas por el calor (no tienen la cápsula). Al inyectar esta mezcla a ratones descubrió que
los animales no sólo mueren de neumonía, sino que muestran en su sangre bacterias III S vivas.
La conclusión que se llegó es que las III S tuvieron que transformar a las II R en III S patógenas.
También se pudo pensar que las II R se pudieron mutar y transformarse en patógenas, cosa que
no se da ya que se ha demostrado que sí se pueden producir mutaciones, pero dentro de la
misma cepa, es decir:

IR IS

II R II S

III R III S

Pero no: IR III S

3
Capítulo 1. Identificación del material hereditario

La conclusión a la que llega es que hay un principio transformante que transforman las II R
a III S. Esta teoría la abordaron Avery, McLeod y McCarty.

3. Identificación de la naturaleza química del principio


transformante

Avery, McLeod y McCarty se interesaron en identificar ese “principio transformante”. Para


ello utilizaron una ventaja tecnológica y fue que el experimento de transformación lo llevaron a
un tubo de ensayo sin utilizar ratones.

Si tenemos en un tubo de ensayo una mezcla de II R y III S, y le añadimos anticuerpos, éstos


actúan en el sistema en contra de aquellas que no tienen cápsula (II R) provocando que las II R
se una al anticuerpo y precipitan en el tubo de ensayo. Las III S son inmunes a esos anticuerpos
y quedan formando colonias turbias en la superficie, a lo largo del tubo de ensayo.

Avery y su equipo parte de un medio de cultivo líquido que contiene III S y lo somete a
centrifugación (fuerza centrífuga), quedando al final todas las bacterias en el fondo del tubo. A
continuación, las III S son sometidas a calor para matarlas y eliminar sus cápsulas para luego
homogenizarlas recuperando un filtrado de cepas III S. En ese filtrado tenemos extracto de
carbohidratos, lípidos, proteínas, ADN y ARN. Este filtrado se mezcla primero con células II R
vivas esperando que las III S transformen a las II R, y efectivamente demuestran lo esperado
encontrando células III S vivas. Más adelante, tras descubrir este hecho, se tuvo que someter el
extracto III S a diferentes tratamientos.

➢ Tratan el extracto con proteasa, que es un enzima que degrada específicamente a


proteínas (con tripsina y quimotripsina). Cuando eliminan todas las proteínas y se

4
Capítulo 1. Identificación del material hereditario

mezclan con las células II R, se observa que la transformación ocurre observando cepas
III S vivas. Con esto se demuestra que las proteínas no son el principio transformante.

➢ Tratan el extracto con ribonucleasas, enzimas que degradan el ARN. Se elimina el ARN
y se mezcla con II R, y se observa que la transformación sigue ocurriendo. Por tanto,
se demostró que el ARN no era el principio transformante.

➢ El extracto lo tratan con desoxirribonucleasas, enzimas que degradan el ADN. El ADN


es eliminado y cuando se mezcla con células II R vivas, se ve que no hay transformación
a III S patógenas, solo observándose un cultivo de células II R.

Como conclusión se sacó, en 1944, que el principio transformante es el ADN. Para llegar a
esta afirmación no fue fácil puesto que anteriormente no se disponían de estos mecanismos y
sistemas. No obstante, hubo gran resistencia a este experimento, ya que seguía dudando si el
principio transformante recaía en el ADN o en las proteínas.

4. Identificación del material genético en fagos

Otro sistema para ahondar en este paradigma era el uso de virus (bacteriófagos o fagos)
que afectan a las bacterias aprovechándose de ellas. Para estos experimentos se usó la bacteria
modelo Escherichia coli, que es la mejor conocida. Los virus que afectan a estas bacterias se
denominan colífagos.

En 1952, Hershey y Chase partieron para sus experimentos del colífago T2, que se ancla a
la superficie de la bacteria para infectarla. El fago está constituido por tres partes: cabeza
icosaédrica de proteínas que envuelve al ADN (fago de ADN); cola de proteínas y por último las
fibras de la cola que son de proteínas y le sirven para adherirse a la superficie de la bacteria. El
mecanismo es el siguiente:

5
Capítulo 1. Identificación del material hereditario

El fago se ancla a la superficie bacteriana para inyectar su material genético dentro de la


bacteria. Lo hace con la cola donde hay una especie de canal que le permite inyectarlo. El fago
aprovecha el aparato biosintético de E. coli en su propio beneficio para ir sintetizando los
componentes de cabeza, cola y fibras de nuevos fagos para luego ensamblarse teniendo partes
fágicas descendientes. Este sistema se trata del sistema lítico ya que mata (lisa) a la bacteria y
los fagos descendientes fagocitan otras bacterias.

4.1. Diseño y resultados de los experimentos de Hershey y Chase

Hershey y Chase partieron de los fagos T2 y de dos tipos de cultivos distintos.

En una de las columnas parten de células de E. coli con el fago T2, y este sistema
bacteria-fago lo hacen crecer en un medio con isótopo radioactivo S35. Durante su
crecimiento en el medio, usan
el azufre para su replicación. El
ADN no contiene azufre, pero
las proteínas sí (metionina
(met) y cisteína (cys)). Las
proteínas van adquirir S35, por
tanto, una columna de
experimento marca la proteína
(marcador específico de
proteínas).

En la segunda columna,
el medio en el que insertan el
sistema bacteria-fago contiene
P32 (marcador específico de
ADN). Cuando el fago se está
replicando, usurpa el ADN de la
bacteria que está marcado con
P32.

Esos fagos los ponen a


infectar bacterias, para lo cual,
estos fagos introducen su ADN
a la bacteria. A continuación, se
agitan los medios de cultivo
para eliminar el fago que
queda en la superficie
bacteriana tras la inyección de su material hereditario. A este agitado se le llama wormg.

Tras este agitado quedan partícula fagocíticas dispersas en el medio de cultivo, por lo
que someten las disoluciones a centrifugación. Se observa que en el fondo quedan las
bacterias y en el sobrenadante quedan las partes fagocíticas.

Posteriormente midieron la radioactividad del sobrenadante de las dos muestras.


Cuando lo hacen en la columna de S35 observan un máximo de radioactividad en el
sobrenadante. Llegaron a la conclusión de que las proteínas no entraron en las bacterias. En

6
Capítulo 1. Identificación del material hereditario

la segunda muestra se observó que en el sobrenadante no existía apenas radioactividad. Esta


observación quiso decir que el ADN entró en las bacterias.

Para mayor claridad del experimento, cuando vuelven a duplicarse las bacterias del
primer cultivo, no hay radioactividad porque las proteínas quedaron en el sobrenadante y
no pasaron a las células. No obstante, en el segundo cultivo, tras la duplicación de sus
bacterias sí se observó la radioactividad, por lo que se observó que el ADN se transmite a las
siguientes generaciones.

En conclusión, el portador del material hereditario es el ADN.

5. El ARN como material hereditario en virus

En 1957, Fraenkel - Conrat y Singer experimentaron con el virus del mosaico del tabaco
(TMV). Este virus se compone de ARN y una cápsula de proteínas. Existen varias cepas del TMV,
entre ellas está el denominado virus de renovación de Holmes (HR). Esta cepa tiene su propio
ARN y cápsula de proteínas, diferentes al resto de los TMV.

Comprobaron que era posible separar el ARN y la cápsula de los dos tipos de virus y
reconstruir virus con la cápsula de un tipo y el ARN de otro, creando un virus híbrido. Cuando
estos híbridos se utilizan para infectar hojas de tabaco, los virus descendientes de la infección
mostraban siempre un tipo de cápsula coincidente con el tipo de ARN utilizado. Además,
causaban las lesiones características del virus que había donado la molécula de ARN. Por tanto,

7
Capítulo 1. Identificación del material hereditario

determinaron que el ARN es el material hereditario del TMV, la biomolécula portadora de


información.

6. Pruebas de que el ADN es el material hereditario en


los eucariotas
Existen dos tipos de pruebas:

• Indirectas

• Directas

Las pruebas indirectas vienen a partir de la observación de que la luz ultravioleta (UV)
produce mutaciones. Su efecto mutagénico lo hace con un valor máximo de 260 nm y justo este
valor es lo máximo de absorbancia que tiene el ADN a la luz ultravioleta. Por lo tanto, es una
prueba indirecta de que el ADN es el portador del material hereditario, ya que las proteínas
absorben a una absorbancia menos mutagénica (280 nm).

Otra prueba indirecta es que, si miramos el contenido de ADN y proteínas, observamos que
la cantidad de ADN es muy constante a lo largo de la vida, mientras que las proteínas y ARN
están sujetos a una menor estabilidad.

Las pruebas directas vienen a partir de metodologías de la ingeniería genética. Se


selecciona una secuencia genética produciendo un cambio, lo cual ese cambio se va a transmitir
a la descendencia.

8
Capítulo 2
Composición, estructura y propiedades
de los ácidos nucleicos

1. Materia de repaso

1.1. Estructura de los ácidos nucleicos

1.2. Las bases nitrogenadas

9
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

1.3. El azúcar

1.4. Estructuras y nombres de los nucleósidos y nucleótidos de ARN


y ADN

10
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

1.5. Denominación alternativa de los nucleótidos

1.6. Cadenas de nucleótidos, oligonucleótidos y polinucleótidos

11
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

2. Composición química de los ácidos nucleicos

2.1. La regla de equivalencia de bases de Chargaff (1949)

En 1949, Chargaff se dispuso estudiar la


composición química del material hereditario. Al
final de sus estudios se concluyó en lo que se
denomina regla de equivalencia de bases.

Analizó, en una primera instancia, su


composición de bases (porcentaje de bases).
Tendríamos que suponer de aquellas que el
porcentaje de bases sería 25% para cada una de ellas,
si se cumpliese la teoría del tetranucleótido. En la
actualidad sabemos que no es así. Para este análisis
llevó a cabo técnicas de cromatografía. Las técnicas
de cromatografía en aquellas, era un sistema en el
cual en una tira de papel tenemos una muestra de
ADN y se empapa en un solvente (mezcla de butanol
y agua). Se coge la muestra de papel en ese solvente,
se empapa y a continuación la muestra se va
arrastrando a lo largo del papel a una distancia
determinada por su afinidad al papel (unos se
desplazan más y otros menos). Es decir, van
arrastrando los nucleótidos a una distancia
dependiendo de su afinidad a por el papel.

Luego, por el grado de absorbancia se deduce si hay más nucleótidos o menos.


Cuanta más absorbancia haya, más nucleótidos habrá, y si hay menos absorbancia menos
nucleótidos tendremos. De esta manera se deduce cuanta cantidad hay de cada nucleótido.

Para todo este proceso, antes debemos purificar el ADN, tratarlo con ácido para
romper los nucleótidos y proseguimos con el experimento hablado.

2.2. Resultados de los experimentos de Chargaff

Tras realizar el experimento, deduce la concentración de A, T, C y G para cada una de


las especies analizadas. Para ello se suele usar el porcentaje de G y C, sumando sus
porcentajes.

El primer dato que se puede observar es que los porcentajes de G y C son muy
variables. El contenido de los cuatro nucleótidos a lo largo de la cadena polinucleotídica es
muy variable entre las especies. Por lo tanto, se invalida la hipótesis del tetranucleótido de
Levene. Esta variabilidad en el contenido de los nucleótidos explica la enorme diversidad
biológica.

12
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

Otra observación importante es que cuando mira la proporción entre T y A es muy


próxima a 1. También encuentra que si mira los porcentajes de G y C la proporción es
próxima a 1. Que no sea 1 es debido a que las cuantificaciones de nucleótidos por
cromatografía en papel no eran precisas. En la actualidad con los nuevos métodos, la
proporción A/T y C/G es siempre 1 (mismo contenido de A = T, C = G).

Si se hace comparación entre las bases púricas (A, G) y las pirimidínicas (C, T), la
relación es muy próxima a 1. No obstante, la relación (A+T) / (C+G) no es próximo a 1. Esto
es lo que se denomina la regla de equivalencia de bases de Chargaff.

No supo darle una explicación a esta equivalencia, pero serviría para secuenciar la
estructura secundaria del ADN.

3. La estructura secundaria del ADN1

El trabajo de Watson & Crick en 1973 supuso el nacimiento de la biología molecular y


genética moderna. La publicación de su modelo tendría una importancia funcional, pues, por
ejemplo, nos puede mostrar su replicación. Más adelante se postularía el modelo de replicación.
Por su modelo de la doble hélice del ADN, Watson & Crick recibieron el premio nobel en 1962.

3.1. Análisis de la estructura del ADN mediante difracción de rayos


X sobre fibras

1
La estructura secundaria del ADN nos da pistas de cómo funciona.

13
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

Para conocer cómo era la estructura de la molécula de ADN se tuvieron que hacer
varios estudios. Una de las claves fue la técnica de la estructura tridimensional del ADN
mediante difracción de rayos X sobre fibras.

Se parte de fibras de ADN. Para obtener esas fibras partimos de una solución con
ADN. Para obtener esas fibras partimos de una solución con ADN con un alto contenido de
agua. Con una pipeta Pasteur, se introduce en la sustancia viscosa y de ahí salen hilos que
son las fibras de ADN. Estas fibras están orientadas en el sentido que están organizadas en
el modelo. También tenemos que tener muy constante la humedad relativa (92%).

Estas fibras de ADN las ponemos en una trayectoria de un haz de rayos X (los
suministra una lámpara de rayos X). Entonces, el patrón de rayos difractantes se recogen
en una película fotográfica sensible a los rayos X. Esta fotografía se imprime y obtenemos
la imagen de la molécula. Esta imagen da bastante información porque el ADN presenta
huecos que se encuentran también en la imagen. Observamos una especie de bandas o
spots que nos da idea de la
estructura secundaria del
ADN.

Este análisis de
difracción nos proporciona
información sobre
características generales del
ADN (diámetro, número de
pares de bases, …), pero
tiene limitaciones. Al estar
en una solución acuosa, los
enlaces químicos que unen
los átomos no están fijos,
pueden rotar. Esto lo que
genera es un cierto grado de incertidumbre, porque diferentes modelos sobres la
estructura secundaria son compatibles con los datos analizados.

3.2. Apilamiento de bases (Astbury, 1938)

Astbury deduce a través de observar la imagen obtenida por difracción de rayos X


dos aspectos:

14
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

1. Las bases de ADN se disponen de forma perpendicular al eje de la molécula y


además de forma apilada como un apilamiento de monedas. El apilamiento es una
consecuencia de que las bases son muy hidrofóbicas, poco solubles en agua. Solo
tienen grupos que le confieren a las bases cierta solubilidad (-C=O y -NH2), pero el
resto de la molécula es muy hidrofóbica. Al ser muy hidrofóbicas tienden estas
moléculas a asociarse entre sí. La forma termodinámica más estable es que estén
apiladas las bases cara con cara.

Este apilamiento de bases tiene importancia ya que les confiere a las cadenas
de ADN cierta rigidez. Si las bases fueran hidrófilas, no habría el apilamiento de bases
y la molécula de ADN estaría enmarañada. Para que el ADN pueda ser funcional tiene
que estar extendido para que los enzimas puedan reconocer las bases.

2. También observa que le diámetro del ADN es de 2nm. La distancia


internucleotídica (distancia entre los nucleótidos adyacentes) es de 0,34 nm.

3.3. El concepto de la hélice en la estructura secundaria del ADN

Un investigador llamado Wilkins pudo conseguir tras varios experimentos un ADN


muy puro. Si el ADN es puro nos va a dar una información más nítida.

Analizó las imágenes de difracción por rayos X. Extrajo ADN y lo cristalizó para ello.
Descubrió que el ADN cuando se le extrae agua forma cristales. Esto quiere decir que las
moléculas de ADN son uniformes y si son así es una evidencia de que tiene una única
estructura secundaria. Si hubiera muchas estructuras no formaría cristales. Tras todo esto,
la cuestión que se abordó fue si estaban ante una estructura o si estaban entre varias.

R. Franklin fue máxima experta en difracción de


rayos X. Obtuvo una foto que se considera una de las
más grandes de la ciencia llamada Foto 51, clave para
deducir como es la estructura del ADN. En esa foto
observa estructuras cruciformes. Esto le sugiere que en
el ADN hay una estructura helicoidal (estructura en
hélice). En definitiva, el primer modelo helicoidal de la
estructura de la molécula de ADN fue propuesto por
Franklin.

Estas hélices son debidas a los enlaces azúcar-


fosfato. Postula que el diámetro del ADN es de 2 nm,
que la distancia internucleotídica es 0,34 nm y que cada vuelta de hélice implica una
magnitud de 3,4 nm. Cuando se analiza el diámetro que es de 2 nm y se compara con la
densidad, este contraste dice que el ADN debe estar formado por más de una cadena
polinucleotídica.

Paulin iría hacia una estructura de tres cadenas. Más adelante, Watson & Crick
trabajan en la estructura secundaria de ADN, pero hubo un momento crítico para
establecer su modelo y fue cuando encontraron la foto 51.

15
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

3.4. Construcción de modelos moleculares a escala de la estructura


secundaria del ADN

Watson & Crick se decantaron por una estructura de dos cadenas polinucleotídicas
en forma de hélice. La pregunta que surgió tras esto fue cómo esas cadenas se asociaban.

Comienzan a elaborar modelos2 de escala de los cuales obtienen que en todos ellos
se establecieron los enlaces azúcar – fosfato en un lugar determinado, en este caso se
localizaban fuera de la molécula. Las bases se encuentran hacia el interior, perpendiculares
al eje de la molécula y apiladas. A estos modelos también le incorporaron los que ya se
sabía cómo la distancia internucleotídica, el diámetro del ADN, …

3.5. Problema del emparejamiento de las bases

En un principio, Watson & Crick, recurrieron a libros de química en los cuales decían
que las bases nitrogenadas adquirían formas tautoméricas. Según esto, los átomos de
hidrógeno no ocupan posiciones fijas, sino que pueden desplazarse de unas posiciones a
otras dando lugar a formas tautoméricas. Se decía que el grupo ceto (C = O) sufría
variaciones en los átomos de hidrógeno y pasaba a enol (-OH); y los grupos amino (-NH2)
podrían pasar a grupos imino (-NH). Entonces, las bases nitrogenadas podrían agruparse de
formas muy distintas por lo que se cambiaba el apareamiento de las bases dependiendo de
las formas tautoméricas.

Watson & Crick decían que no podía haber esta ambigüedad, que debía ser más
estable. J. Donohue dijo que, según su criterio, los libros de texto de química estaban
equivocados.

La forma tautomérica más frecuente son cetonas y amino. En algún que otro caso se
pueden dar enoles e iminos.

2
Son un elemento fundamental para la ciencia. Elimina todo lo que no es fundamental y
muestra las ideas más principales.

16
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

3.6. Las reglas de emparejamiento entre las bases de Watson &


Crick

Las dos cadenas se van a asociar de la siguiente manera:

• Timina y adenina por dos puentes de hidrógeno.

• Citosina y guanina por tres puentes de hidrógeno.

De esta manera repescan la hipótesis de Chargaff en el que la concentración de


timinas era igual que la de adeninas y la concentración de citosinas igual que la de guaninas.
También coinciden en que las bases son complementarias.

3.7. El modelo de la doble hélice

Las cadenas de la doble hélice son


antiparalelas. Esto quiere decir que
tienen polaridad opuesta. Si vamos a un
extremo 5’ – fosfato de una cadena, este
extremo es adyacente al grupo 3’ –
hidroxilo de la otra cadena. El final acaba
en el extremo 3’ – hidroxilo adyacente al
extremo 5’ – fosfato de la otra cadena.

Estamos ante una doble hélice,


como una estructura de caracol donde el
pasamanos son el enlace del azúcar con
el fosfato y en el interior de la “escalera”
se encuentran las bases. Cada vuelta de la
doble hélice son 10 pares de bases donde
cada enlace gira en el sentido del movimiento de las agujas del reloj. El modelo de Watson
& Crick, por lo tanto, es dextrógiro.

17
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

3.8. Los surcos en la molécula de ADN

Tiene dos surcos, uno mayor


(más ancho y más profundo) y otro
menor (menos ancho y menos
profundo).

Si la molécula fuera plana, las


moléculas que se asociaran con el
ADN les sería difícil alojarse allí. Los
surcos permiten que esas moléculas
se asocien a estos lugares de
alojamiento. Generalmente se
asocian al surco mayor, ya que en
este surco los grupos de bases están
más expuestos y serían mejor
reconocidas. Las secuencias de bases
actuarían como señales de
localización.

3.9. Características del modelo de la doble hélice

➢ Doble hélice dextrógira.

➢ El diámetro de la doble hélice es de 2,0 nm.

➢ El esqueleto azúcar – fosfato ocupa una posición exterior.

➢ Las bases nitrogenadas se disponen en el interior perpendicularmente al eje de


la molécula.

➢ La base adenina se empareja con la timina mediante dos puentes de hidrógeno


y la citosina con la guanina mediante tres puentes de hidrógeno.

➢ Las dos cadenas son complementarias y antiparalelas.

➢ La unidad de repetición es un mononucleótido.

➢ La distancia internucleotídica es de 0,34 nm.

➢ Cada par de bases imprime una rotación de +36 grados.

➢ La doble hélice contiene alrededor de 10 pb / vuelta, y cada vuelta ocupa una


distancia de 3,4 nm.

➢ Doble hélice con dos surcos (mayor y menor).

18
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

4. Alternativas al ADN – B

En un primer momento se comentaba que el ADN constaba de una única estructura


secundaria pues formaban cristales, cosa que no sería posible si hubiera más estructuras. Tras
esto, se abordó si había o no más estructuras que la del modelo de doble hélice.

Watson & Crick observaban una


forma que estaba a un 92% de humedad
relativa y ese era el ADN – B. No obstante,
en otra humedad relativa (75%), se
encontraba otra estructura secundaria
distinta al cual se le denominó ADN – A.

Se encontraron otras estructuras


secundarias: ADN – C, ADN – D, ADN – P
(en honor a Pauli). Estas nuevas
estructuras se obtienen en bajas
concentraciones de humedad relativa.
Estas estructuras presentan las
características generales del ADN - B,
pero difieren en parámetros como el
diámetro y el número de pares de bases
por vuelta. Por ejemplo, e ADN – A tiene
un diámetro de 23 Å y tiene 11 pares de
bases por vuelta.

La conclusión a la que se llegó era


que tenía poca significación biológica
porque el ADN se encuentra en altas tasas de humedad relativa. Las demás estructuras se
obtienen en el laboratorio bajando la humedad relativa.

4.1. Análisis detallado de la estructura secundaria del ADN

Para el análisis detallado de la estructura secundaria del ADN, a las secuencias de


ADN se les aplicaba el análisis de refracción de rayos X. Estas secuencias eran altamente
heterogéneas y ya se empezaba a reconocer que la secuencia primaria podría tener
influencia sobre la secundaria. Otra cuestión era que el análisis de refracción de rayos X nos
permitía obtener las características globales de la molécula, pero sobre la fibra de ADN no
permitía distinguir a átomos específicos porque el ADN estaba en disolución y los enlaces
químicos podrían rotar en esa disolución.

Era necesario contar con dos nuevas metodologías. La primera era que se pudiera
sintetizar oligonucleótidos (cadena de ADN relativamente corta de una longitud de
aproximadamente 20 nucleótidos) con una secuencia definida o predeterminada por el
investigador. Si esto se pudiera lograr, se elimina esa fuente de variación.

La segunda metodología sería una consecuencia de la primera. Si tenemos


sintetizados oligonucleótidos se podrían cristalizar esos oligonucleótidos y analizar la

19
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

estructura del ADN mediante cristalografía de rayos X. La ventaja es que al ser cristales los
átomos de la molécula de ADN ocupan posiciones concretas, eliminando ese resultado
diferente.

Cada metodología da información particular de las moléculas, aspectos generales de


la molécula, datos promedio, etc. La cristalografía de rayos X da información sobre
modificaciones locales no globales. Ambas técnicas son complementarias.

En 1978 (veinticinco años después del modelo de Watson & Crick) los químicos
orgánicos desarrollaron una metodología de síntesis de oligonucleótidos con una secuencia
definida. Eran metodologías muy artesanales, muy costosas. Ahora se hace
automáticamente. Ya había la condición primera, solo faltaba cristalizarlos y analizarlos.

Los investigadores Wang et al (1979) publicaron esta metodología. Sintetizaron un


oligonucleótido de solo seis pares de bases con una secuencia alternante de citosina (C) y
guaninas (G)3.

Cristalizaron la cadena oligonucleótida y la analizaron mediante cristalografía de


rayos X. Se observó que el ADN presentaba una estructura de doble hélice donde las
cadenas cortas eran antiparalelas y se daba la complementariedad de bases (C ≡ G). El
hecho revelador es que observaron una anomalía y es que el sentido de giro del dúplex era
levógiro, es decir, tiene un giro antipolar. Los enlaces azúcar – fosfato tienen un discurrir
en zig – zag y esta imagen se puede complementar con las fuerzas de Van der Walls. Los
científicos llegan a descubrir el ADN – Z. Esta
característica del ADN – Z viene dada porque se da
unos patrones alternantes de la configuración de
los enlaces N-glucosídicos, de tal manera que las
citosinas tienen un enlace N-glucosídico con una
configuración que la llamamos ANTI. La
desoxiguanosina tiene una configuración del
enlace glucosídico que se llama SYN. Este patrón
origina el enlace quebrado de los enlaces azúcar –
fosfato.

4.2. Características particulares del ADN – Z

➢ Doble hélice levógira.

➢ El esqueleto azúcar – fosfato sigue un curso en zig – zag debido a la alternancia


de las configuraciones de los enlaces glucosídicos (ANTI y SYN).

➢ La unidad es un dinucleótido.

➢ La doble hélice contiene 12 pb / vuelta, es decir, está más estirada.

➢ Cada dímero imprime una rotación de -60 grados.

C G
3
Forma empírica de representar (CpGpCpGpCpG): d ( )n = 3
G C

20
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

➢ El diámetro de la doble hélice es de 1,8 nm, más estrecho que el ADN -B4.

➢ Doble hélice con un solo surco, equivalente al surco menor del ADN – B.

4.3. Significado biológico del ADN – Z

El ADN – Z es muy diferenciado del ADN – B. En vivo está en disolución y no


cristalizada. Además, su diámetro llamaba la atención. Es una molécula más estrecha (2 nm
de diferencia, una diferencia relativa).

Otra diferencia es que en el ADN – Z los enlaces están menos separados. Cuando
están más cerca existe una mayor repulsión electroestática entre los grupos fosfato que
tienen carga negativa. Esto lo que
hace es que la molécula tiende a
desestabilizarse, es menos estable.
Se encontró que el ADN – Z podía
estabilizarse en condiciones
fisiológicas si hubiera metilaciones
entre las bases nitrogenadas
(adiciones de grupos metilo (-
CH3)). Cuando se metila la citosina
en posición 5’, entonces el ADN – Z
es estable en condiciones
fisiológicas. La pregunta es si hay
metilaciones entre las bases más
frecuentes en eucariotas.

Se encontró que el ADN – Z


se encuentra estable en
5
condiciones fisiológicas .

El ADN – Z es fuertemente
inmunológico. En 1981 se crearon
anticuerpos anti ADN – Z y cuando se les aplican estos anticuerpos a los cromosomas hubo
reconocimiento y se concluyó que el ADN – Z está en los cromosomas. Por lo que en
condiciones fisiológicas hay ADN – Z.

Estudios recientes demuestran que el ADN – Z juega un papel primordial en la


regulación de la expresión de al menos en un número importante de genes. Un ejemplo
que nos sirve para demostrar esta evidencia es el protooncogén c-myc6. Muestra tres
regiones que pueden adquirir la configuración ADN – Z. Este protooncogén cuando no se
expresa presenta la estructura del ADN – B. Pero cuando comienza la transcripción, esas
tres regiones adquieren la configuración de ADN – Z. Estas regiones se expresan cuando
necesita crecer, cuando no lo necesita pasa al ADN – B.

4
Significación biológica.
5
Con superhélices negativas se hace estable en condiciones fisiológicas (virus, bacterias y
eucariotas)
6
Es importante para poder explicar los tipos de cáncer.

21
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

Genes como los que expresan la actina se están transcribiendo continuamente por
lo que la estructura del ADN es del ADN – Z. Juega un papel primordial que nos enseña que
la estructura general es ADN – B y que el ADN – Z es una estructura que se presenta en un
estado transitorio que está relacionado con el inicio de la transcripción.

El ADN que se encuentra en cristalografía de rayos X predomina el ADN – B. Cuando


hay ADN – B el número de pares de bases por vuelta varía entre 8,6 – 13,1 pb / vuelta. Hay
variaciones y lo que se utiliza es el valor promedio que es de 10 pb / vuelta. El número de
pares de bases por vuelta en el ADN – B de forma rigurosa es de 10,4 pb / vuelta.

5. Estructura terciaria del ADN

5.1. El ADN superenrollado

La estructura terciaria7 lo que implica es el plegamiento. J. Vinograd (1965)


hipotetizó con una serie de experimentos con moléculas de ADN de doble cadena circular
de que el eje de la molécula de ADN no era recto sino curvo dando giros en el espacio y
formando estructuras superpuestas a la estructura secundaria de Watson & Crick
denominadas superhélices.

El superenrollamiento afecta tanto a eucariotas como a procariotas, pero es más


sencillo en estos últimos, por los que los usaremos como ejemplo. Los procariotas tienen
un único cromosoma de ADN bicatenario circular cerrado covalentemente en sus extremos.
La conformación que adopta el ADN – B (10,4 pb/vuelta) se corresponde con un estado
estable en condiciones fisiológicas, y se considera relajado o no superenrollado. El eje de la
doble hélice se dispone sobre un plano. En las células, el ADN se encuentra superenrollado
o no relajado para poder alojarse en el interior celular de manera organizada.

El superenrollamiento es introducido en procariotas mediante las enzimas


topoisomerasas, que pueden cortar una o las dos hebras del ADN. Con este corte queda

7
El ADN se encuentra en diferentes grados con estructuras superpuestas

22
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

una molécula lineal que se puede enrollar sobre su eje. Luego se vuelven unir los extremos
y nos queda la estructura superenrollada.

Si la molécula de ADN es dextrógira (ADN – B) y se produce un giro en sentido


antihorario se quita una vuelta del dúplex rompiéndose los puentes de hidrógeno entre las
bases nitrogenadas. El ADN imparte esa energía contraria al dúplex, pero tiene una gran
propensión termodinámica a mantener la estructura secundaria. Tiende entonces a
reformar la vuelta, pero esa energía tiene que transformarse. Toda esa energía se resuelve
formando una estructura superior a la estructura secundaria.

5.2. Superhélices positivas y negativas

La superhélice positiva (SH +) la definimos como giro en el espacio del ADN sobre su
propio eje en la misma dirección8 que el giro del propio dúplex.

La superhélice negativa (SH -) la definimos como giro en el espacio del ADN sobre su
propio eje y en dirección contraria9 que el giro del propio dúplex.

5.3. Caracterización de la topología del ADN10

El número de enlace o “linking number” (L) se define como número de veces que las
dos cadenas del dúplex se cruzan entre sí. Depende de dos parámetros:

➢ Número de vueltas o “twisting number” (T): es el parámetro intrínseco de la


estructura terciaria del ADN. Se calcula por la relación de:
nº pb totales
= nº de vueltas
nº pb⁄vuelta

➢ Número de retorcimientos o “writhing number” (W): es el número de giros del


eje de la molécula de ADN en el espacio, es decir, es el número de superhélices
y es lo que define la estructura terciaria.

L=T+W ∆L = ∆T + ∆W

En una molécula de ADN circular de doble cadena covalentemente cerrada el número


de enlace no cambia, no hay ninguna incisión ni rotura. Por lo tanto, el número de enlace
no cambia: ∆L = 0

Para que el número de enlace cambie (∆L ≠ 0) tiene que haber una incisión o rotura
en al menos en una de las cadenas del dúplex o las dos; luego los extremos libres tienen
que rotar en el espacio; por último, los extremos tienen que volverse a unir. De esta manera
puede haber variación en el número de veces que una cadena cruza la otra.

8
Sentido horario
9
Sentido antihorario
10
Estructura terciaria = topología del ADN

23
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

Si el número de enlace no varía (∆L = 0) no significa que no puedan variar los


parámetros de los que dependen el número de enlace (L), siempre y cuando ∆T = -∆W.

EJEMPLO: ∆T = +1 (ha dado una vuelta de más)

∆W = -1

∆T + ∆W = ∆L = 0

En términos de superhélice (∆W = -1) es una superhélice negativa

∆T = -1
Si hay una vuelta de menos hay que compensarlo con una
∆W = +1 superhélice positiva

5.4. Clasificación de las enzimas ADN topoisomerasas

Por isómeros topológicos entendemos por moléculas de ADN que son exactamente
las mismas excepto por sus números de enlace11.

Para transformar de un isómero a otro si no hay rotura, no puede haber variaciones


en el número de enlace. Los sistemas biológicos que convierten un isómero en otro se
realiza por enzimas específicas denominadas ADN topoisomerasas, variando el número de
enlace. Los ADN topoisomerasas se clasifican en dos tipos atendiendo a su mecanismo de
actuación:

➢ ADN topoisomerasas del tipo I

➢ ADN topoisomerasas del tipo II

Los ADN topoisomerasas de tipo I se caracterizan porque producen un corte en una


de las dos cadenas del dúplex. Generan siempre una variación del número de enlace en una
unidad (positiva o negativa) es decir, pueden producir una superhélice positiva o una
negativa (∆L = ±1). Si quieren producir más superhélices tienen que volver a actuar.

Los ADN topoisomerasas de tipo II se diferencian de los de tipo I en que producen


dos cortes que se producen en ambas cadenas del dúplex. Provocan una variación en el
número de enlace de dos unidades (∆L = ±2). Introducen dos superhélices positivas o dos
negativas.

Dependiendo del enzima que se encuentra se insertan superhélices negativa o


positivas y dentro de estas enzimas pueden ser de tipo I o tipo II.

Están presentes en todas las células (virus, procariotas, eucariotas) por lo que se
supone que ejercen una función importante. Las mejores conocidas son aquellas que se
conocen mejor su mecanismo de actuación y una de esas es la topoisomerasa de E. coli12.

11
Número de veces que una cadena cruza la otra.
12
La vamos utilizar para comprender varios mecanismos como la replicación y la transcripción.

24
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

Los ADN topoisomerasas del tipo I de E. coli son la topoisomerasa I y la


topoisomerasa III. La topoisomerasa I está codificada por un gen de E. coli13 que se
denomina top A. Esta topoisomerasa I elimina superhélices negativas.

Los ADN topoisomerasas del tipo II de E. coli son la topoisomerasa II14 y la


topoisomerasa IV. La topoisomerasa II es una proteína tetramérica (cuatro subunidades).
Dos subunidades están codificadas por un gen de E. coli que se denomina gyr A, y las otras
dos subunidades están codificadas por gyr B. En conjunto es el enzima funcional
tetramérica. Tiene un efecto antagónico a top A ya que introduce superhélices negativas.

Se requiere un equilibrio entre las dos superhélices antagónicas. Si ese equilibrio no


se mantiene, la estructura terciaria no sería estable y sería letal para la célula.

5.5. Densidad superhelicoidal

La estructura terciaria está omnipresente en todos los sistemas biológicos. La cuestión


es cuantas tiene15. Para cuantificarlo es conveniente tener en cuenta un parámetro que se
denomina densidad superhelicoidal (DSH). La DSH es el número de superhélices por cada
vuelta de la doble hélice16. Las cosas cambian si es ADN – B o ADN – Z.

Cuando se estima en todos los sistemas vivos siempre hay varianza. Por lo tanto,
tenemos que coger un valor promedio, un valor tipo, que es muy coincidente en virus,
procariotas y eucariotas como humanos. Este valor es de -0,05. A lo largo de todo el
cromosoma hay variaciones, no es constante.

Este valor nos dice que en términos promedios la densidad superhelicoidal es negativa.
Predominan las
superhélices negativas. En
zonas locales puede haber
superhélices positivas.
Existe una superhélice
negativa por vuelta. Hay
una cada 200 pares de
bases (cuatro millones de
pares de bases) en E. coli.
En nuestro genoma son
muchas más, millones de
superhélices negativas.

En E. coli habría un equilibrio inestable entre una forma y otra. Esa densidad negativa
permite la desnaturalización17 local de las cadenas del dúplex rompiendo los puentes de
hidrógeno. Las superhélices negativas ayudan a separar las cadenas. Esto es muy

13
ADN circular
14
ADN girasa
15
Desde el punto de vista cuantitativo que relevancia tiene.
16
10 pb en la estructura del ADN – B.
17
Separación

25
Capítulo 2 Composición, estructura y propiedades de los ácidos nucleicos

importante ya que en la replicación se necesita separar las cadenas, por lo que facilita la
función del ADN.

5.6. Importancia funcional de la estructura terciaria del ADN

➢ Las superhélices negativas favorecen la estabilización de la estructura de ADN – Z

➢ Implicaciones en las tensiones topológicas que se producen en el ADN durante la


replicación y la transcripción. Se producen cambios topológicos que tienen que
ser abordados por las topoisomerasas. Si no resuelven los problemas las células
serían letales.

➢ La estructura terciaria del ADN y la farmacología clínica. Están basados en


bloquear la actividad de las topoisomerasas. Si las topoisomerasas no actúan se
aborta la replicación y la transcripción.

Las células bacterianas y virus se proliferan a unas fases muy elevadas. Como se
replican rápidamente necesitan de altas tasas de ADN topoisomerasa. Estos
fármacos se aplican al ser humano que inactivan preferentemente a las células
tumorales así atacan menos a las células del cuerpo.

26
Capítulo 3
Organización del ADN en los cromosomas

En la siguiente tabla se muestra la relación entre la longitud del ácido nucleico y las
dimensiones del compartimento que lo contiene en diversos organismos.

Ácido nucleico Compartimento


Organismo Tipo Longitud Dimensiones
TMV ARN 3,3 µm 0,030 x 0,025 µm
Fago lambda ADN 17,0 µm 0,07 x 0,07 µm
H. influenzae ADN 832 µm 1,00 x 0,30 µm
E. coli ADN 1200 µm 2,00 x 0,50 µm
Hombre (núcleo HeLa) ADN 1,8 m Ø = 6 µm

Lo que se puede observar en la tabla es que la longitud tanto de ARN de TMV como el resto
de ADNs excede las dimensiones del compartimento. Si estirásemos todo el material hereditario
de un organismo humano alcanzaría una longitud de 2000 millones de km.

Se llegó a la conclusión de que el ADN tenía que compactarse para poder ocupar el mínimo
compartimento que lo contiene.

1. Compactación de material hereditario en eucariotas

El material hereditario
tiene que compactarse con
ayuda de proteínas. Los niveles
de compactación son
extremadamente ordenados
para luego ser después
descompactados, es decir, el
material hereditario siempre
está en compactación y
descompactación.

27
Capítulo 3. Organización del ADN en los cromosomas

1.1. Estructura del material hereditario nuclear a lo largo del ciclo


celular

Si nosotros observamos el material hereditario de un eucariota a lo largo del ciclo


celular simplemente a microscopía óptica, observamos dos estados diferenciados de
organización del material hereditario. Uno sería en la etapa de interfase1, donde vemos que
el material hereditario se distribuye de modo regular por el núcleo de la célula formando
lo que se denomina la fibra de cromatina.

El otro estado se encuentra en mitosis. Se observa que le material hereditario


adquiere su máxima compactación formando estructura diferenciadas que denominamos
cromosomas.

1.2. La cromatina en interfase

En microscopía electrónica se observa la fibra de cromatina. El material hereditario


se dispone formando una red o entramado por todo el núcleo. La cromatina es la estructura
del material hereditario de eucariotas en interfase.

El diámetro de la fibra se puede medir y se obtiene que este diámetro puede variar
entre 23 y 30 nm. Se considera que el valor tipo es de Ø = 30 nm, de ahí que también se le
llame fibra de 30 nm.

1.2.1. Composición química de la cromatina

• ADN

• Proteínas

o Histonas2: H1, H2A, H2B, H3 y H4

o No histonas: el resto de las proteínas asociadas a la cromatina (ADN


polimerasas, ARN polimerasa, ARN polimerasas, metilasas,
fosforilasas, etc.)

• Ácido ribonucleico (ARN)

Con respecto a las proteínas histonas hay cinco tipos principales: H1, H2A,
H2B, H3 y H4. Son proteínas ricas en aminoácidos muy básicos porque los grupos
amino a pH fisiológico tienen carga positiva (-NH3+). Como ya hemos dicho
anteriormente, las histonas son muy ricas en aminoácidos básicos, más en concreto
de la lisina (lys) y la arginina (arg). Esto nos permite entender porque están
fuertemente unidas al ADN, ya que se unen a los grupos fosfato del ADN que están
cargados negativamente.

Las histonas H3 y H4 son muy conservadas evolutivamente. Sus aminoácidos


no varían a lo largo de los años. Desde que surgió la célula eucariota3 solo sufrieron

1
Periodo del ciclo celular que se encuentra entre dos mitosis sucesivas.
2
Se indican solo los cinco tipos principales.
3
1500 millones de años

28
Capítulo 3. Organización del ADN en los cromosomas

dos o tres cambios. Si hay cambios que afectan la estructura, al ser un asunto crítico
no debería haber muchos cambios.

En los espermatozoides la proteína histonas están muy unidas al ADN y lo


protege de radiaciones.

Con respecto a las proteínas no histonas decir que el material hereditario está
funcionando, los genes se están transcribiendo, por lo que tiene que haber ADN
polimerasas, ARN polimerasas, metilasas, fosforilasas, etc. El ARN no forma parte de
la estructura de la cromatina, pero si el ADN está en transcripción encontramos ARN.

En el núcleo en interfase observamos que existen territorios que forman una


matriz nuclear y esta matriz está compuesta por proteínas y ácidos ribonucleicos o
ARN. Observamos que el ADN está formando como “lazos” (bucles) que están unidos
a esa matriz. Ese ADN está unido a la misma por unas secuencias específicas de
bases4. Se caracterizan por ser secuencias ricas en los pares de bases adenina y
timina. Estudios in vitro demuestran que estas bases tienen afinidad al ADN
polimerasa tipo II. En la interfase este ADN está en funcionamiento. La cromatina
necesita esos bucles para que pueda funcionar.

La fibra de 30 nm tratándola en condiciones de baja fuerza iónica (baja


concentración salina, por ejemplo) emerge la estructura rosaliada. Parecen como
cuentas de un collar unidas por hilos que recuerdan a un rosario. Se estimó el
diámetro de las cuentas y se observó que varía entre 10 a 12 nm. El valor tipo es de
Ø = 10 nm. De esta manera a esta estructura se le comenzó a llamar la fibra de 10
nm de la cromatina. Representa la subestructura de la fibra de 30 nm.

4
Secuencias de Matrix Attachment Regions (MAR)

29
Capítulo 3. Organización del ADN en los cromosomas

1.2.2. Estructura de la fibra de cromatina de 10nm. Modelo del nucleosoma


Se comenzó a realizar análisis
bioquímicos y biofísicos para
caracterizar la fibra de 10 nm. Indican
que las cuentas de esta estructura son
partículas elementales que reciben el
nombre de nucleosomas. Los hilos no
son más que el ácido
desoxirribonucleico.

El nucleosoma está constituido


por una cantidad de ADN con una
longitud promedio de unos 200 pares de
bases (hay variaciones sobre ese valor).
Intervienen cuatro proteínas histonas
formando un octámero. Ese octámero
está formado por dos subunidades de
H2A, dos subunidades de H2B, dos
subunidades de H3 y dos subunidades de
H4. El nucleosoma lo podemos
representar como un cilindro aplastado
como el de la imagen. El nucleosoma lo podemos desglosar en más componentes:

NUCLEOSOMA = 46 pb de ADN + octámero de histonas + ADN espaciador + H1

ADN NÚCLEO PARTÍCULA NÚCLEO

El ADN linker5 es de longitud variable, dependiendo del tipo de organismo.


Tiene una longitud que puede ser muy pequeña (8 pb – 114 pb6). El ADN espaciador
sería el ADN que está comprendido entre dos partículas núcleo adyacentes. El ADN
espaciador forma parte del nucleosoma.

La histona H1 toma una localización externa a la partícula nucleosomal. Es


importante ya que facilita la formación y que se mantenga la estructura de la fibra
de 30 nm por esta localización externa. En condiciones de baja fuerza iónica se retira
fuera el sistema H1.

1.2.3. Disposición del ADN en el octámero de histonas


En un principio se pensaba que el ADN pasaba por el interior del octámero de
histonas, pero en realidad lo que hace es envolverlo, por lo que le es más fácil a las
proteínas implicadas en varias funciones del ADN acceder a él.

5
ADN espaciador
6
Encontrado en el esperma de erizo de mar.

30
Capítulo 3. Organización del ADN en los cromosomas

Da 1,7 giros en sentido antihorario (levógiro). Cuando el ADN se enrolla,


secuencias de ADN que están separasas se reconocen y secuencias de proteínas la
reonocen conjuntamente.

Un cromosoma lineal sin proteínas no puede formar superhélices pero el ADN


está enrollado en un octámero de histonas y cuando se retira queda una superhélice
negativa, es decir, hay una superhélice negativa por cada 200 pares de bases.

1.2.4. El código de las histonas


En un principio se pensaba que el octámero de histonas era estático.

Para que el ADN pueda funcionar tiene que descompactarse por lo que para
ello tiene que haber un reposicionamiento de los nucleosomas para que los genes se
puedan expresar. Nuestro genoma está dinámico, cuando deja de transcribirse se
vuelve compactar.

Las proteína juegan un papel activo en la expresión genética. En principio si


nos planteamos que un gen tiene que expresarse tienen que retirarse los
nucleosomas. Intervienen para ello varios sistemas:

➢ Sistema de remodelado de la cromatina. Unas que juegan un papel


fundamental son la familia de proteñínas SWI / SNF. Son proteínas que
ayudan a desplazar los nucleosomas de la expresión.

➢ La proteínas histonas experimentan en este momento dinámico


abundantes modificaciones postraduccionales, acetilaciones, metilaciones
y fosforilaciones.
N – TERMINAL
Las proteínas que están en
contacto con el ADN (H3 y H4)
están conservadas
evolutivamente. Salen los
extremos amino terminal de
esas hisonas, siendo más
expuestos a esas
modificaciones.

Desde el punto de vista de la


expresión genética estas
modificaciones producen o
están asociadas a que el gen se
exprese o no se exprese. Esa combinación de modificaciones es lo que se
denomina el código de las histonas. Esos cambios, no todos, permanecen
y se heredan a las siguientes generaciones (en la vida del individuo o a
generaciones posteriores sin que vayan en el genoma7).

➢ Hay otros factores que intervienen en este sistema en este sistema


dinámico, como es el cambio de una histona por otras histona similares.
Pueden activar o reprimir la expresión genética.

7
Epigenética

31
Capítulo 3. Organización del ADN en los cromosomas

1.2.5. Empaquetamiento en la fibra de 30 nm8


Para poder ver la formación de la fibra de 30 nm se tiene que trabajar de
manera inversa a como lo hicimos para ver la fibra de 10 nm, aumentando la fuerza
iónica.

Existen diferentes modelo de la estructura de 30 nm: acordeón, supercuentas,


solenoide. Para llegar a la fibra de 30 nm, la fibra de 10 nm adquiere una estructura
helicoidal y luego se compacta. En términos de nucleosoma, por cada vuelta que da
la fibra de 10 nm nos encontramos con sei nucleocomas.

La fibra de 30 nm se asocia a un esqueleto proteico o Scaffold formando una


estructura multilobulada radial. El ADN de la fibra de 30 nm forma esos bucles
alrededor del Scaffold. Adquiere una configuración en hélice que nos explica como
está el ADN en los cromosomas.

1.3. Estructura del cromosoma

Los cromosomas están constituídos por dos cromátidas hermanas unidas por un
centrómero.

Para poder obtener información de la estructura del cromosoma hay que romper
dicha estructura. Se sometieron cromosomas a la presencia de polianiones muy fuertes.
Para ello se utilixó el sulfato de dextrano aunque también se puede usar la heparina. El ADN
es un polianión y si se introduce sulfato de dextrano compite con el ADN por los sitios de
unión a las histonas y se unen a ellas. Estos cromosomas metafásicos desprovistos de
histonas presentan una médula central densamente teñida que ha sido denominada
“scaffold” (armazón). Cuando retiramos las histonas, el ADN sobresale y se ubica en todo
el espacio. Hay ADN que se encuentra unido9 a esta estructura del Scaffold. Los dominios
de ADN parecen estar unidos al armazón proteico por unas regiones específicas

8
La tasa de compactación en esta fibra es de 52 veces mientras que en el cromosoma llega de
8000 a 1000 veces.
9
Secuencias ricas en pares de bases de adenina (A) y timina (T).

32
Capítulo 3. Organización del ADN en los cromosomas

denominadas abreviadamente SARs


(regiones de asociación específicas o
“Scaffold Attachment Regions”) que se
detectan cuando los cromosomas
metafásicos desprovistos de histonas se
tratan con endonucleasas de restricción.
Después de este tratamiento quedan
regiones de ADN unidas al armazón que a su
vez resisten la digestión con exonucleasas
gracias a que están protegidas por una
proteína. Cuando se digiere esta proteína, las
regiones de ADN protegidas contienen
secuencias que se sabe que son especificas
para la unión de topoisomerasas. Estas
regiones regiones de unión especificas de los
dominios al armazón proteico son las
regiones SARs10.

La máxima compactación del material


hereditario es en mitosis y tiene coste
energético. La mitosis supone que el material
hereditario de la célula parental se distribuya en su total integridad a las células hijas. Si el
material hereditario no se transmite integramente puede ser letal para la célula. Se duplica
el material hereditario y tiene que ser destinado a las células hijas en su totalidad.

El sistema se empaqueta en 23 cromosomas.

2. Tipos de cromatina

La mayor parte del material hereditario se compacta hasta la mitosis. A esta cromatina se
le llama eucromatina (cromatina verdadera). Hay una pequeña parte que tiene niveles de
compactación comparables con la mitosis y se le conoce por heterocromatina, la cual no tiene
una compactación gradual. A su vez, la heterocromatina se divide en dos tipos:

• Heterocromatina constitutiva

• Heterocromatina facultativa

2.1. Heterocromatina constitutiva

La heterocromatina constitutiva está fuertemente compactada en interfase y se


encuentra en los centrómeros y en los telómeros o finales de los cromosomas, en los brazos
cromosómicos.

10
Las secuencias que están asociadas a MAR son equivalentes a SAR.

33
Capítulo 3. Organización del ADN en los cromosomas

En la especie humana la heterocromatina constitutiva


es muy abundante en el brazo largo del cromosoma Y. La
heterocromatina constitutiva está en todos los centrómeros
de todos los cromosomas pero no en todos los telómeros.

La heterocromatina constitutiva es generalmente


genéticamente inerte, es decir, tiene muy poco contenido
génico. Además en inerte en un contexto en el que se dificulta
la expresión génica porque está muy compactada11.

2.2. Heterocromatina facultativa

La heterocromatina facultativa es una cromatina que puede funcionar como


eucromatina o como heterocromatina.

La primera evidencia de la presencia en las células la tuvo un genético canadiense


llamado Barr en 1949. Observó que cuando analizaba núcleos de células de mamíferos
procedentes de hembras se observaba una región intensamente teñida a la que de nominó
corpúsculo de Barr. Esta cromatina es lo que se denomina heterocromatina facultativa.

11
Hay genes que les gusta el contexto compactado, pero es una excepción.

34
Capítulo 3. Organización del ADN en los cromosomas

En 1961, un genetista del Reino Unido


constituyó que la heterocromatina facultativa
era una consecuencia del fenómeno de
compensación de dosis en las hembras de
mamíferos.

Sabemos que en hembras existen dos


cromosomas X. La relación autosomas –
cromosoma X es 1. En los varones existe una
relación diferente a las hembras. Por cada 2
autosomas existe un único cromosoma X. Es
decir, existe una diferente dosis de autosomas
y cromosomas X dependiendo del sexo. Este
asunto tiene importancia por dos razones. La
primera es porque genes de los cromosomas X
interaccionas con los genes de autosomas para diferentes procesos como es el del
desarrollo. La otra razón es que existen genes cuya función óptima depende de la dosis12.
Por tanto en las hembras de mamíferos tiene que compensarse inactivando uno de los
cromosomas X, y se inactiva mediante un proceso de heterocromatización.

3. Inactivación del cromosoma X en mamíferos

Antes de empezar debemos tener claro que en los gametos de machos en mamíferos
(esperma) hay un solo cromosoma X y un cromosoma Y13, y en los gametos de las hembras en
mamíferos (óvulo) hay dos cromosomas X.

Tras la fecundación de los gametos, en la fase de blástula tardía es cuando ocurre el proceso
de compactación de dosis. Esta compactación de dosis ocurre en la línea somática pero en la
germinal tiene que activarse para que pase activo a la descendencia. Esta compactación de dosis
ianctiva a uno de los cromosomas X en las células de las hembras.

Ocurre al azar en cada una de las células y en unas células se puede inactivar el cromosma
X heredado por el padre y en otras se inactiva el cromosoma X heredado de la madre. Todas las
células que resultan de la división celular mantienen esa inactivación. En las hembras, el
cromosoma X que está inactivo tiene que activarse en la fase germinal.

Cuando se empezó a estudiar a nivel moleular se observó que una secuencia en el


cromosoma X juega un papel fundamental. Esta secuencia se llama centro de inactivación del
cromosoma X (Xic).

El cromosoma X inactivo alberga diferentes genes que intervienen en el proceso de


compactación de dosis. Uno de los más importantes es el gen XIST. Este gen que está en el
cromosoma X es clave en el proceso de inactivación. Se expresa en el mismo cromosoma X en
el que va a ser inactivado. Este gen se expresa dando lugar a una molécula de ARN y esta
molécula envuelve a la mayor parte del cromosoma X que va a inactivar formando una especie

12
La dosis correcta es que haya un solo cromosoma X.
13
El cromosoma Y tiene pocos genes.

35
Capítulo 3. Organización del ADN en los cromosomas

de envuelta o caperuza. Una vez envuelta la mayor parte del cromosoma X, entonces, recluta al
aparato de remodelado que hace que se condense y se compacte derivando a una inactivación
génica y, por lotanto, compensando la dosis igualándola a la de los varones.

Hay zonas que no están envueltas ya que la heterocromatización es nula y quedan libres de
inactivar genes que no son sensibles a la dosis.

3.1. Inactivación del cromosoma X en hembras heterocigóticas

La inactivación del cromosoma X puede provocar efectos sobre el fenotipo. En


hembras heterocigóticas pueden crear mosaicos en el fenotipo. Un cromosoma X tiene
información genética distinta para un gen al otro cromosoma X.

Un ejemplo lo tenemos en hembras calicó (gatas calicó). En estas hembras se


observan diferentes colores en el pelo y piel. Esto es debido a la compensación de dosis. El
color blanco viene determinado por otro gen al del gen que determina color negro por
ejemplo. El pelaje negro se debe a que son heterocigóticas para ese gen. En la célula de la
blástula hubo inactivación del gen de color naranja al igual que hubo inactivación del gen
de color negro. En cada célula se inactiva un cromosoma X.

36
Capítulo 3. Organización del ADN en los cromosomas

3.2. Mujeres con displasia ectodérmica anhidrótica

Las que experimentan displasia ectodérmica anhidrótica tienen zonas de la piel de


diferentes tonalidades, pierden el pelo y zonas de su piel sufren de disecación. Todos los
genes que están afectados po ese proceso son susceptibles de desarrollar mosaicos.

4. Cromosomas del cariotipo humano

La primera técnica que se usó para ver los


cromosoma fue la tinción de Feulgen. Es una técnica
utilizada en histología para teñir selectivamente el
ADN de las células. Esta técnica consiste en la
hidrolización del ADN de células eucariotas mediante
una dilución débil de ácido clorhídrico (ClH) 1M a 60
°C durante 10 minutos, que libera las bases púricas,
quedando libres los radicales aldehídos de las
pentosas. Luego se le hace reaccionar con un
reactivo que es el reactivo de Schiff. Este reactivo es
una mezcla de fucsina más bisulfuto de sodio.
Provoca un color rosa en los cromosomas y es
específico del ADN (el ARN no libera los grupos
aldehíhido).

La primera vez que se realizó esta técnica para


ver los cromosomas fue en el año 1956 y se observó 46 cromosomas en humanos.

➢ Cariotipo se define como el complemento o dotación cromosómica de una célula o un


individuo.

37
Capítulo 3. Organización del ADN en los cromosomas

➢ Dotación cromosómica haploide se corresponde con una célula que tiene una copia
de cada cromosoma. Dotación diploide se coresponde a dos copias.

4.1. Idiograma

El idiograma es la fotografía o
diagrama de los cromosomas de una célula
dispuestos de una manera ordenada. A
partir de este diagrama encontramos que
podemos disponerlos ordenadamente de
menor a mayor tamaño. De esta manera nos
es más fácil observar si hay alguna anomalía
cromosómica (enfermedades), citogenética
o química.

El cariotipo son el conjunto de


cromosomas de una célula mientras que el
cariograma es la representación de
cariotipo. El cariograma nos permite ver y
asociar cambios cromosómicos con sus
enfermedades.

4.1.1. Síndrome de Klineffelter

Fue la primera enfermedad cromosómica que se reconoció. El síndrome de


Klineffelter conduce a gigantismo, desarrollo de las masmas, feminización en el
fenotipo y retraso mental.

38
Capítulo 3. Organización del ADN en los cromosomas

Se veía en el cariograma que había un cromosoma X o más extra. El grado de


anomalía fenotípica se incrementa cuanto más número de cromosomas X extra
tenga.

La tinción de Faeulgen se utiliza para ver anomalías de este tipo pero cambios
sutiles en los cromosomas no se verían. Para ello se requiere de tácnicas más precisas
para que se pudieran ver anomalías con más detalle.

5. Técnicas de bandeo cromosómico

Caspersson, en los finales de la década de los 60, observó que cuando se tratan los
cromosomas con determinados tratamientos químicos y/o físicos se producen patrones de
bandas transversas que alternan en claro y oscuro a lo largo de todos los cromosomas. Estos
patrones son claramente reproducibles y siempre se originan los mismos en cada cromosoma.
Estas bandas permiten econocer cambios pequeños en las estructuras de los cromosomas.

5.1. Sistemas de bandas

• Bandas G

• Bandas Q: son equivalentes a las bandas G.

• Bandas R

• Bandas C: son bandas específicas de regiones centroméricas.

• Bandas T: son bandas específicas de regiones teloméricas.

39
Capítulo 3. Organización del ADN en los cromosomas

Las bandas G es uno de los sistemas más importantes. Se tratan los cromosmas con
tripsina rompiendo las proteínas. Tiene que ser suave pues si lo dejamos mucho tiempo
solo quedaría ADN y queremos ver la estructura de la cromatina.

La tinción Giemsa es un conjunto de sales cargados positivamente. Reacciona con el


ADN que está cargado negativamente. Eso origina un patrón de bandas transversas claras
y oscuras. Si algunos de los
puntos no se ven es que hay
alguna anomalía.

Las bandas G
comprenden secuencias de
ADN ricas en adenina y timina y
comprenden secuencias de
ADN pobres en genes
codificadores de proteínas. Las
bandas G son las bandas
oscuras o llamadas bandas
positivas. Las bandas claras se
llaman bandas negativas.

Las bandas R14 dan un


patrón de bandas complementaria a las bandas G. Para obtener las bandas R primero se
calientan los cromosomas en metafase. Luego se desnaturaliza parcialmente el ADN y se
separan las cadenas. A continuación lo tiñen con la sal Giemsa y se observa el patrón de
bandas complementarias a G. Las bandas R son ricas en guanina y citosina y son ricas en
genes codificadores de proteínas.

Si hacemos un sistema de bandas en profundidad podemos hasta observar 2000


bandas. Generalmente se utiliza cromosomas en metafase ya que están en su estado
máximo de compactación.

6. Nomenclatura de los cromosomas

La nomenclatura de los cromosomas surge a raíz del descubrimiento de la tácnicas de


bandeo cromosómico.

Los criterios para la clasificación de los cromosomas humanos que observamos en un


cariograma se deciden por un Comité encargado de elaborar el denominado International
System for Human Cytogenetic Nomenclature (ISCN). Este Comité se reúne periódicamente para
actualizar la nomenclatura desde la denominada Coferencia de París (1971). La última
actualización tuvo lugar en el 2016.

➢ Se especifica el cromosoma mediante el número o letra correspondiente.

➢ El brazo corto del cromosoma se designa por p (petit).

14
Reverse = lo contrario

40
Capítulo 3. Organización del ADN en los cromosomas

➢ El brazo largo del cromosoma se designa por q (queue)

➢ Las bandas mayores se designan consecutivamente como p1, p2, p3, etc., contadas a
partir del centrómero. Las sub – bandas se denominan p11, p12, etc., y las sub – sub –
bandas p11.1, p11.2, etc.

Ej. 11p15.2: cromosoma 11, brazo corto, banda 1, sub-banda 5, sub-sub-banda 2

Xp11.2: cromosoma X, brazo corto, banda 1, sub-banda 1, sub-sub-banda 2

➢ El centrómero se representa por “cen”.

➢ El telómero se representa por “ter” (de término).

41
Capítulo 3. Organización del ADN en los cromosomas

42
Capítulo 4
Organización de las secuencias del ADN
en el genoma

1. El “valor-C”

El valor C se define como el contenido de ADN de un núcleo haploide eucariota o el


contenido de ADN de un nucleoide1 bacteriano.

El valor C nos da la ventaja de comparar la cantidad de ADN de los seres vivos. Nos descubre
aspectos importantes para entender la organización del ADN.

En un principio había una reflexión sobre las secuencias de ADN. Era plausible de que
hubiera una relación entre la cantidad de ADN y el número de genes con la complejidad
morfológica de los seres vivos. En principio cabría esperar que organismos más complejos
necesitaran más cantidad de ADN, se esperaba una relación mayor.

La cantidad de ADN la podemos estimar con el valor C.

1.1. Relación entre el “valor-C” y el número de genes en procariotas

Cuando miramos la complejidad morfológica de las bacterias observamos que es


similar. Deberíamos aproximarnos a la diversidad de nichos que puedan colonizar las
bacterias. Existen bacterias que tienen muchos nichos muy restringidos.

▪ Un ejemplo lo encontramos en Mycoplasma genitalium, un parásito obligado.


Es uno de los seres vivos que contiene muy poca información genética2.

▪ Un ejemplo de bacteria que tenga un nicho amplio lo tenemos en Escherichia


coli. Puede vivir en nichos muy diferentes.

▪ Las Archaeas en principio se consideraban bacterias extremófilas (nicho


ecológico muy especializado como aguas termales o lagos salados). Son capaces
de colonizar más nichos, más hábitats. Igualmente, su nicho está más restringido
que E. coli.

1
En las bacterias procariotas el material hereditario forma una masa compacta que ocupa
aproximadamente 1/3 de la célula bacteriana y esta masa compacta se denomina nucleoide.
2
Se necesita un mínimo de información genética para crear una célula.

43
Capítulo 4. Organización de las secuencias del ADN en el genoma

En Mycoplasma genitalium el
tamaño del genoma sería equivalente al
valor C siendo de 0,58 Mb. El número de
genes se encuentra por 500. Al ser un
parásito de organismos es lógico que
tenga poco ADN y pocos genes.

En Escherichia coli en número de


bases es de 4,64 Mb y el número de genes
4400. Tiene que colonizar nichos más
amplios por lo que su genoma debe ser
mayor. En este caso se cumple lo de mayor
complejidad mayor número de genes.

En Archaeas si analizamos el
contenido génico y el tamaño del genoma,
existe una relación entre la cantidad medida del genoma y su complejidad.

1.2. Relación entre el “valor C” y el número de genes en eucariotas

Se observa que existe una cierta relación en que a medida que aumenta la
complejidad aumenta el tamaño del genoma. No obstante, en eucariotas no sigue en su
totalidad esta regla.

Una planta es mucho más compleja que un humano por lo que necesita más ADN.

Dentro de los anfibios se encuentran especies gemelas3, que, aunque no se


distinguen morfológicamente, son especies por estar aisladas reproductivamente. Cuando
se analiza su contenido de ADN puede diferir de entre 10 a 100 veces. A través de valor C
no podemos explicar que haya variaciones en la cantidad del genoma de 10 a 100 veces,

3
Indistinguibles morfológicamente.

44
Capítulo 4. Organización de las secuencias del ADN en el genoma

por lo que surge la paradoja del valor C en la cual se concluye que en eucariotas no existe
relación entre complejidad morfológica y la cantidad de genoma.

2. El genoma nuclear humano

Los genes codificadores de proteína


explican un 25% del 100% del ADN nuclear.
En revistas y literatura importante
defienden que es el 1%.

Los genes codificantes están


organizados en intrones y exones. Estos
exones son la parte codificadora y los
intrones tienen que ser eliminados en el
proceso de transcripción. Solo el 1% de ese
25% son exones, y el 24% restante son
intrones (ADN no codificante). Los genes en
su totalidad ocupan el 25%. El 75% es ADN
repetitivo y otro ADN intergénico.

Las variaciones del valor C vienen explicadas por el ADN no génico. Tiene que haber una
relación entre la cantidad de genes y complejidad morfológica. La clave está en que hay una
relación entre complejidad morfológica y complejidad de estructura, expresión y regulación de
los genes.

Los eucariotas más complejos tienen sus genes más complejos en su estructua, expresión y
regulación de éstos mismos. Son capaces de producir muchas proteínas que eucariotas menos
complejos. Tienen modificaciones postranscripcionales y postraduccionales.

DSCAM es un proteína que tien muchos intrones y muchos exones. Se da en splicing


alternativo para eliminar los intrones en diferentes combinaciones. Al darse diferentes

45
Capítulo 4. Organización de las secuencias del ADN en el genoma

mensajeros van a dar diferentes proteínas. Potencialmente puede producr 38000 proteínas
diferentes.

2.1. Secuenciación del genoma humano

El Proyecto Genoma Humano se aprobó en 1988 con el objetivo de conoce la


secuencia de nucleótidos de los 3200 millones de pares de bases que contiene el genoma
nuclear humano4.

El proyecto público se pone en marcha en 1990 en el Energy Department & National


Institutes of Health (EEUU) IHGSC; International Human Genome Squencing Consortium. Lo
iniciaron con una perspectiva de terminar en 2005. El que dirigió y llevó a cabo el proyecto
empezó siendo Watson pero más adelante el cargo lo llevó Francis Colllins siendo el
director del IHGSC.

En 1998, Craig Venter, director de la empresa Celera Genomics, llevó a cabo un


proyecto privado con un procedimiento más rápido que el que realizaban en el proyecto
público. En realidad iba utilizando la base de dato que publicaba el proyecto público pero
con el procedimiento que ellos llevaban lo iba realizando más rápido.

El proyecto público estudiaba todas las secuencia, tiraban hacia una vía de
conocimiento más global. El proyecto privado solo quería saber las secuencias de genes
codificantes de proteínas para un fin más comercial.

Se llega a una conciliación entre el proyecto público y el proyecto privado en 2001.


Llegan al acuerdo de que publicarán simultáneamente los descubrimientos, F. Collins en
Nature y C. Venter en Science.

En 2003 se concluye el proyecto del genoma humano.

4
Dotación haploide.

46
Capítulo 4. Organización de las secuencias del ADN en el genoma

3. Clases de secuencias del genoma humano nuclear

➢ ADN palindrómico

➢ Genes codificadores de proteínas

➢ Genes de ARN no codificador (ARNnc)

➢ ADN altamente repetitivo:

• En tándem

• Disperso

3.1. ADN palindrómico

Un palíndromo de ADN es un dúplex cuyas dos cadenas tienen la misma secuencia si


se leen en la misma orientación en la misma orientación o polaridad.

Tienen un eje de simetría y éste separa


dos secuencia de ADN que son imágenes
especulares. Esas secuencias separadas se
denominan secuencias de repetición
invertida. Una característica importante es
que puede haber pares de bases que formen
parte del eje de simetría pero que no sean en
sí mismas parte del palíndromo. No tienen
porque estar adyacentes. Pueden estar
separadas por bases que no pertenecen a
éste.

En los palíndromos, las secuencias pueden estar adyacentes o separadas.

3.2. Genes de ARN no codificador (ARNnc)

Los genes de ARN no codificador serían las secuencias de ADN que se transcriben a
ARN que no son ARNm. Hay una tasa muy heterogénea de ARN no codificador.

El ARNm fue descubierto en el proyecto genoma humano público. Tiene un papel


clave en la expresión de las proteínas, regulando en la expresión a proteínas y también
participa en los procesos oncogénicos (cáncer).

47
Capítulo 4. Organización de las secuencias del ADN en el genoma

El ARN no codificante se llama materia oscura porque sabemos muy poco de ese ARN
no codificante.

3.3. ADN altamente repetitivo en tándem

El ADN altamente repetitivo puede ser en tándem o disperso. Son secuencias de ADN
que se repiten un número variable de veces. Esas unidades de repitición pueden repetirse
unas a continuación de las otras en una especie de tartamudeo genético que recibe el
nombre de ADN altamente repetitivo en tándem. Las partes están separadas por ADN no
repetivo.

En función del tamaño de la unidad de repitición y del tamaño del bloque que
constituyen todas las subunidades de repetición se clasifican en:

➢ ADN satélite

➢ ADN minisatélite

• Familia hipervariable

• Familia telomérica

➢ ADN macrosatélite

3.3.1. ADN satélite


Se puede caracterizar el ADN de un genoma extrayendo el ADN de las células
y sometiéndolo a centrifugación con un gradiente de densidad de cloruro de cesio.
Si se coge un tubo de centrífuga y se pone una disolución de cloruro de cesio y se

48
Capítulo 4. Organización de las secuencias del ADN en el genoma

somete a centrifugación, los átomos de Cl y Cs tienden a ir hacia al fondo del tubo,


pero los átomos de Cl y Cs tienen tendencia a difundir hacia arriba. Estas fuerzas
opuestas llegan a un equilibrio dónde la densidad de la disolución incrementa desda
la superficie al fondo (en la parte superior hay menos densidad). Es un método muy
útil para caracterizar moléculas de ADN, por lo menos, primariamente.

Cuando se coge ADN de eucariotas y se somete a centrifugación, los ADNs


migrarán en el tubo de la centrífuga hasta la zona donde la densidad de la disolución
iguale a la del ADN. Se puede separar secuencias de ADN por su densidad.

Un ADN, cuantos más pares


guanina y citosina, mayor
densidad, y cuantos más pares
adenina y timina, menos
densidad.

La mayor parte queda en la


banda pricipal. A parte de la
banda principal, existen bandas
por encima y por debajo de esta.
Algunas de estas bandas contiene
ADN satélite. Otras bandas
satélite no son ADN satélite (por
ejemplo, el ADN mitocondrial).

El tamaño de la unidad de repetición es de entre 5 y 171 pares de bases. El


tamaño del bloque oscila entre 100kb y varias megabases. La localización
cromosómica preferente es en la heterocromatina centromérica.

3.3.2. ADN minisatélite


El tamaño del bloque es entre 0,1 y 20 kilobases. Tiene dos familias

➢ Familia hipervariable: también se


llaman VNTRs (variable number of
tandem repeats). El tamaño de la
unidad de repetición es de 9 a 64
pares de bases y su localización
cromosómica es en regiones
subteloméricas. Se llaman VNTRs
porque tienen una gran variedad,
ya que tienen altas tasas de
mutación. Estas secuencias fueron
descubiertas por Jeffreys, Wilson &
Thein en 1985 y dió lugar a la
técnica de la huella de ADN, para la
indentificación de individuos. Con
esta nueva técnica se pueden
culpar a individuos, y no solo
excluír.

49
Capítulo 4. Organización de las secuencias del ADN en el genoma

➢ Familia telomérica: el tamaño de la unidad de repetición es de 6 pares de


bases (en humanos). Tiene la secuencia de (TTAGGG). A partir de esta
secuencia funciona la telomerasa. La localización cromosómica es en los
telómeros.

3.3.3. ADN microsatélite


Son repeticiones cortas en tándem y tambien se llaman STRs (short tandem
repeats). Las unidades de repetición son más pequeñas (entre 1 y 4 pares de bases).
Estas unidades forman un tamaño de bloque conjunto que es inferior a 100 pares de
bases. La localización cromosómica es disperso a lo largo de los cromosomas, por lo
que es un buen marcadores genéricos (son los marcadores de penúltima generación).
También son altamente variables, por lo que por su facilidad de «extracción» se usan
como huellas de ADN.

Puede haber repeticiones de adenina, por lo que la unidad de repetición es un


nucleótido de ADN. Las más frecuentes son las que se dan la repetición de un
dinucleótido, en concreto, repetición de adenina y citosina. Aparece por ejemplo en
11p15. En el genoma humano hay 100000 ADN microsatélites por genoma haploide.
Estas secuencias favorecen la estabilización de ADN-Z.

3.4. ADN altamente repetitivo disperso

El ADN altamente repetitivo disperso son secuencias de ADN repetitivas que están
disperasas e intercaladas entre otras secuencias de ADN. Es importante porque
cuantitativamente explica el 43% de ADN nuclear humano. Son secuencias que además dan
lugar a la gran parte de la inestabilidad del genoma humano. ¿Por qué producen la
inestabilidad genética? Esto se debe porque son secuenicas que pertenecen a los
elementos transponibles o elementos móbiles, es decir, secuencias de ADN que tienen
potencial en el momento reciente o lo tuvieron en el pasado evolutivo para cambiar de
localización cromosómica (por eso son móviles, cambian de localización cromosómica
creando inestabilidad).

En el proceso de movilización se pueden colocar sobre otros genes, interviniendo en


la expresión de éstos. Los más abundantes son LINEs y SINEs.

➢ LINEs

➢ SINEs

➢ Otros (LTRs y Transposones de ADN)

50
Capítulo 4. Organización de las secuencias del ADN en el genoma

3.4.1. LINEs
Es un acrónimo de “Long interspersed nuclear element”. Son elementos
intercalares de alto período. En el genoma humano existen diferentes tipos de LINEs.

➢ LINE 1: es la más importante. La unidad de repetición es de 6,1 kb. Las


unidades de repetición son relativamente largas. El número de copias en
el genoma humano es de 600000. Esto explica un 17,3% del genoma. Es
el segundo elemento más frecuente del genoma. La localización
preferente son las regiones eucromáticas, ricas en los pares de bases
adenina/timina (bandas G positivas), y en concreto, en regiones
intergénicas. Son elementos móviles, pero están preferentemente en
regiones intergénicas, porque si se colocan es regiones codificadoras
tienen un efecto delectéreo y son eliminadas por la selección natural.

➢ LINE 2

➢ LINE 3

3.4.2. SINEs
Son un acrónimo de “short interspersed nuclear element”: elementos
internucleares intercalares e bajo período. La unidad de repetición es más pequeña
que en las LINEs. Hay diversas familias.

➢ Alu: es la más importante por la presencia en el genoma. El tamaño medio


de la unidad de repetición son 230 pares de bases. La oscilación es
importante. Hay 1200000 copias en el genoma nuclear. Es la secuencia
más repetida del genoma humano. Esto representa un 10,7% del genoma
(menor que la LINE 1). Se localiza preferentemente en regiones
eucromáticas, ricas en los pares de bases C/G (bandas R), y aparecen en
regiones intergénicas.

➢ MIR

➢ MIR 3

3.4.3. Otros (LTRs y transposones de ADN)

4. Localización citogenética preferente del ADN


repetitivo en tándem y disperso

Cromosoma con bandado G. Hay ADN repetitivo en tándem, que está en la región
centromérica, por lo que se trata de heterocromatina constititutiva.

El ADN satélite está en el centrómero.

El ADN microsatélite forma repeticiones en tándem en los telómeros.

La familia hipervariables está en regiones subteloméricas.

51
Capítulo 4. Organización de las secuencias del ADN en el genoma

Después están los loci microsatélites, que están dispersos por el resto del cromosoma. Son
variables y permiten marcar todo el cromosoma.

Los LINEs están en bandas G positivas, siendo aquí la localización preferente. Los SINEs
están en las bandas G negativas, o bandas clara.

El ADN palindrómico estaría distrubído por todo el cromosoma. Los codificadores de


proteínas están distribuídos por todo el cromosoma (aunque este no es igual en todos los
cromosmoas). Los genes de ARN no codificador están en zonas específicas del cromosoma.

52
Capítulo 5
Replicación del ADN. I. Procariotas

La replicación del ADN es la función más inmediata del material hereditario, porque para
que haya transmisión del material hereditario, se requiere que los ácidos nucleicos de una célula
parental se copien fielmente de tal forma que las células hijas contengan dotaciones genéticas
completas de la célula parental de la que procede.

Cuando se analiza la estructura del ADN, en el final del artículo se señala que desarrollar la
estructura del ADN provocaría que se descubriera como se replicaba. Que las cadenas de ADN
se mantuvieran juntas mediante puentes de hidrógeno con la complementariedad de bases ya
les sugería como iba a ser (publican un artículo como modelo de replicación). Este modelo se
denomina modelo semiconservativo.

1. Características generales de la replicación

1.1. Modelos de la replicación del ADN

Según Watson y Crick, para llevar a cabo la replicación del ADN, las dos cadenas del
dúplex parental se separan mediante la ruptura de los puentes de hidrógeno, y cada una

53
Capítulo 5. Replicación del ADN. I. Procariotas

de las cadenas del dúplex sirve como molde para la síntesis de una cadena hija mediante
las reglas de emparejamiento de bases de Watson y Crick (A-T y C-G).

En este modelo se denominó modelo de replicación semiconservativa, porque si


vemos los dúplex hijos, sólo conservan una de las dos cadenas del dúplex parental.
Inmediatamente después, surgen otros modelos alternativos al de Watson y Crick.

Por ejemplo, el modelo de replicación conservativa. Bajo este modelo, el dúplex


parental permanece intacto y el dúplex parental entonces se copia en un nuevo dúplex hijo.
Este dúplex hijo por tanto contiene dos cadenas que son ambas de nueva síntesis. Es por
eso por lo que se denomina conservativo.

Otro modelo que entra en escena es el modelo de replicación dispersiva. Este


modelo postula lo siguiente: las dos cadenas del dúplex parental se rompen en trozos. Cada
uno de estos trozos se copia, sintetizándose nuevos fragmentos de ADN. Los dúplex hijos
serían una mezcla o mosaico de fragmentos de ADN parentales y fragmentos de ADN de
nueva síntesis.

1.1.1. La replicación del ADN de E. coli según el modelo semiconservativo


Se realizó en primer lugar en E. coli. Meselson & Sthal en 1958 realizaron una
serie de experimentos para saber qué modelo era correcto. Estos autores se
propusieron un objetivo: poder idear un sistema de marcado del ADN que permitiera
diferenciar el ADN parental del de nueva síntesis. Hicieron un sistema de marcado
por densidad. Es la primera vez que se usa un marcaje por densidad.

Parten de un cultivo de células de E. coli que lo hacen crecer un medio que


posee el isótopo pesado del nitrógeno N15 1. Se introduce mediante sales con N15, por
ejemplo. Este nitrógeno pesado lo incorporan al ADN. Si este sistema se deja
funcionar durante varias generaciones, todo el ADN de las células de E. coli estarán
marcadas con N15. ¿Cómo se puede analizar la densidad? Usando la técnica de
centrifugación en un gradiente de densidad de CsCl.

1
El isótopo normal es N14.

54
Capítulo 5. Replicación del ADN. I. Procariotas

Este cultivo lo transfieren a un medio con N14. Ese cultivo lo dejan que
experimente diferentes rondas de replicación. El ADN parental es N15 y el de nueva
síntesis es N14. Se deja una generación (generación I), después se aísla el ADN se
somete a centrifugación y se observa una banda de menor densidad que la
generación 0 (está más arriba del tubo de la centrífuga). Es una banda que
corresponde a un ADN híbrido N15 = N14. En la generación II retiran el ADN, separan
por centrifugación en el gradiente, y observan dos bandas, una N14 = N14 y por lo
tanto un ADN ligero y otra banda con densidad intermedia de N14 = N15: Se puede
determinar la cantidad de ADN de cada tipo, mediante espectrofotometría.

En base a estas observaciones son capaces de demostrar que los resultados


experimentales obtenidos sólo se ajustan a un modelo de conservación
semiconservativo.

En la generación I tenemos al fondo del tubo todo el ADN. Siguiendo el modelo


semiconservativo, en la generación I todos los ADN deben ser híbridos (N15 = N14).
Una única banda con densidad intermedia. Si se deja otra generación, los dúplex se
vuelven a separar, habiendo ADN ligero, y dos dúplex de ADN híbridos con densidad
intermedia.

Según estos experimentos se excluye el modelo conservativo (en la primera


generación).

1.1.2. Definiciones
➢ Replicón: unidad de
replicación. La unidad
elemental dónde se
desenvuelven los eventos
de iniciación de la
replicación, de elongación
y de terminación. Todo
replicón tiene un origen
dónde se inicia el proceso
de replicación y término,
dónde finaliza.

La primera imagen de genomas


de E. coli en estado de replicación la
obtuvo Cairns en el año 1963. Esa
imagen se obtuvo aplicando la técnica
de autorradiografía. Fue muy
utilizada en la época.

Lo que se hizo fue hacer crecer células de E. coli en un medio con


desoxitimidina tritiada (dT-H3). Las células se replican y dividen e incorporan al ADN
la desoxitimidina radiactiva.

Esos genomas se ponen en presencia de películas fotográficas. Los átomos


radiactivos de tritio impresionan los granos de plata de la película fotográfica,
dejando una imagen del ADN en el estado de replicación. Lo más relevante que

55
Capítulo 5. Replicación del ADN. I. Procariotas

concluyó Cairns fue que el cromosoma de E. coli se replica en forma de un círculo y


en término de un único replicón. Tiene que tener un origen y un término. Otra cosa
que avanzó es que ese origen es único, siempre el mismo. No hay aleatoriedad en
donde empieza la replicación (un único origen). A partir de ese origen se sigue la
replicación hasta el término.

Cairns hipotetizó equivocadamente que lo hace siguiendo un modelo de


replicación unidireccional.

➢ Modelo de replicación
unidireccional: bajo un modelo
unidireccional, la síntesis del ADN
procede desde el origen, en una única
de generación, mediante el avance de
una horquilla de replicación o punto de
crecimiento. El hueco que se abre es el
ojo de replicación. En la horquilla es
dónde se van uniendo los nucleótidos.

➢ Modelo de replicación
bidireccional: la síntesis de ADN tiene
lugar a partir de un origen mediante la
formación de dos horquillas de
replicación que avanzan en direcciones
opuestas. Las dos horquillas se dirigen
en direcciones contrarias hasta el
término.

¿Cómo se pueden distinguir dos modelos? La idea fue desarrollada por


Prescott y Kuempel en 1972. Cuando se coge un cultivo de E. coli, esas células están
en diferentes estados de replicación. Lo primero que se abordó fue intentar obtener
un cultivo de células de E. coli sincrónico en su estado de replicación. Que todas
estuvieran en el mismo momento de replicación. Se consigue privando al medio de
cultivo de un aminoácido esencial,
porque cuando a un cultivo se le priva de
un aminoácido, las bacterias pueden
terminar los ciclos de replicación ya
iniciados, pero no pueden iniciar nuevas
rondas de replicación.

Ponen a todas las bacterias a


replicarse al mismo tiempo
(administrando el aminoácido), y todas
las bacterias empiezan a replicarse al
mismo tiempo. Este inicio lo hacen en
unas condiciones de marcado del ADN
radiactivo de baja densidad. Al cabo de
un período muy corto introducen un
marcaje radiactivo de baja densidad.
Esto se consigue mezclando cantidades

56
Capítulo 5. Replicación del ADN. I. Procariotas

pequeñas de desoxitimidina tritiada con desoxitimidina normal, y el de alta


densidad se consigue añadiendo en más proporción la desoxitimidina tritiada.

Bajo un modelo de replicación unidireccional, cabría esperar que regiones de


baja densidad estuvieran seguidas por regiones de alta densidad. Si fuera
bidireccional, lo que se observaría es que regiones de ADN de baja densidad, estarían
flanqueadas por dos regiones de alta densidad. Cuando se observan sus imágenes en
autorradiografía, se observa que se corresponde a un modelo de replicación
bidireccional.

1.1.3. Estructura del origen de replicación en E. coli


Es un genoma de 4,2 millones de pares de bases. Se recurre a una estrategia
de transferencia de fragmentos de ADN de la bacteria E. Coli a plásmidos a los cuales
se les había privado de sus propios orígenes de replicación. Era una estrategia de
cerco, que transferida a plásmidos servía como origen de replicación a los propios
plásmidos.

Se encuentra que hay una secuencia de ADN de la bacteria de E. Coli de una


longitud aproximada de una longitud de 245 pares de bases que sirve como origen
de replicación. Esta secuencia en concreto se denomina OriC2. Se procedió a
secuenciarla con las técnicas de secuenciación del ADN. Una vez obtenida esta
secuencia de nucleótidos, se analizó en busca de motivos estructurales3 que fueran
distintivos de OriC y que el aparato de replicación lo pueda distinguir de otras
regiones (para que empiece siempre en el mismo lugar). Se reconocen dos
subdominios en OriC.

Esos subdominios se caracterizan porque tienen repeticiones cortas de


nucleótidos. El primero de los subdominios (izquierda) tiene tres repeticiones de
trece nucleótidos, y el otro subdominio (derecha) contiene cinco repeticiones de
nueve nucleótidos. En este segundo subdominio de nueve nucleótidos, se une una
proteína codificada por la bacteria E. Coli (por su genoma) que se llama proteína
DnaA. A ese subdominio se le unen muchas proteínas DnaA y se piensa que lo hacen
siguiendo el modelo del barril (adoptan forma de barril). Este modelo propicia una

2
El locus OriC
3
Motivos de la secuencia

57
Capítulo 5. Replicación del ADN. I. Procariotas

tensión torsional en el subdominio uno (repeticiones de trece nucleótidos). Esta


tensión torsional hace que se separen parcialmente las dos cadenas del dúplex. Este
proceso está ayudado por la proteína HU de la bacteria, que es una proteína que
además ayuda al empaquetamiento del ADN.

La separación de las cadenas además se ve facilitada porque el primer


subdominio es muy rico en los pares de bases adenina-timina. Al ser rico en esto, la
ruptura de los puentes de hidrógeno se ve facilitada en comparación a si fuera
guanina-citosina (porque sólo tienen dos puentes de hidrógeno, mientras que la
guanina y citosina están unidas por tres).

1.1.4. Terminación de la replicación en E. coli


Las horquillas de replicación
avanzan en direcciones opuestas hasta
que se encuentran en las antípodas del
origen, en una región denominada
punto de encuentro o meeting point.
Cuando se encuentran las dos
horquillas, cesa la replicación y las dos
cadenas del dúplex dan lugar a dos
dobles cadenas.

En este proceso de terminación


de la replicación se ve facilitado por la
presencia de secuencias Ter. Estas
secuencias Ter son secuencias de 23
pares de bases, y conservadas, y
obedecen a una secuencia de
nucleótidos
«AATTAGTATGTTGTAACTAAAGT». C y
B son secuencias de parada para la
replicación.

Una proteína ayuda a esta función, que es la proteína Tus. Ayuda a que pare
la síntesis de ADN.

2. Bioquímica o enzimología de la replicación

La síntesis de ADN la realizó por primera vez Kornberg en 1957. Fue el primero en la síntesis
de ADN in vitro.

En primer lugar, Kornberg demostró que para la síntesis de ADN era necesario una cadena
molde o template, que contiene la secuencia de nucleótidos que se va a copiar.

El segundo elemento que hace falta es un corto oligonucleótido complementario a la


cadena molde que porta un extremo 3’ OH libre que se denomina cebador o primer. Está unido
a la cadena molde mediante puentes de hidrógeno.

58
Capítulo 5. Replicación del ADN. I. Procariotas

La elongación de las cadenas ocurre


mediante enlaces fosfodiéster 3’, 5’ en los que
participa el extremo 3’ OH del primer o cebador
y el desoxirrbonucleósido 5’ fosfato que se
incorpora a la cadena de crecimiento siguiendo
las reglas de emparejamiento de bases de
Watson y Crick.

Cómo resultado del enlace se incorpora en


términos de monofosfato, y en concreto, se
incorpora el fosfato (el más próximo al azúcar) y
se pierde pirofosfato.

Las cadenas efectivamente son


antiparalelas, y todas las moléculas de ADN
crecen en dirección de 5’ a 3’, para respectar las polaridades al final del dúplex.

Para que pasen estas reacciones con suficiente precisión, se necesita un extracto proteico
de la bacteria E. Coli, porque se pensaba que en ese extracto había proteínas que hacían que la
replicación fuese precisa. Se empezó estudiar cuantas enzimas podían polimerizar ADN.

2.1. ADN polimerasas

Después de este costoso camino, hoy en día se sabe que en E. Coli existen 5 enzimas
con actividad polimerizadora de ADN. Esas enzimas se denominan ADN polimerasa I, II, III,
IV y V. Abreviadamente también se denominan pol I, pol II, pol III... La pol I está codificada
por un gen llamado polA, la II, por polB, la III por polC, la IV por dinB.

Hay enzimas que intervienen en procesos de reparación, y la pol III es una replicasa,
lleva a cabo los procesos fundamentales de replicación del ADN.

La pol I es una enzima de reparación, pero también interviene en los procesos de


replicación.

Las que interviene en los procesos de replicación son el ADN polimerasa I y el ADN
polimerasa III, que es la principal enzima replicativa. Estas enzimas desarrollan diferentes
funciones, y el conocimiento de estas funciones es clave. Las dos tienen actividad
polimerizadora, en dirección 5’→3’4. Estas tienen funciones duales, por ejemplo, con
función exonucleasa (enzimas que degradan los extremos de cadena). Hay exonucleasas de
dos tipos:

• Dirección 3’→5’: intervienen sobre extremos 5’ y van degradando nucleótidos.


Esta actividad la tienen tanto la pol I como polo II.

• Dirección 5’→3’: intervienen sobre extremos 5’ y van degradando nucleótidos.


Esta actividad la realiza pol I únicamente.

4
Van adicionando nucleótidos al extremo 3’-OH de la cadena molde.

59
Capítulo 5. Replicación del ADN. I. Procariotas

Polimerasa Exonucleasa Exonucleasa


Función
5’→3’ 3’→5’ 5’→3’
Replicación,
ADN polimerasa I + + +
reparación
Principal
ADN polimerasa III + + - enzima
replicativa

Pol I tiene las dos funciones de exonucleasa. Sin embargo, el ADN polimerasa III solo
tiene actividad exonucleasa de 3’ → 5’5.

Se puede dar el caso de que


se añada a la cadena un nucleótido
incorrecto (no está correctamente
emparejado). Para que no se
produzcan cambios, las pol I y III
tienen una función exonucleasa de
3’ a 5’, pudiendo ser reconocido
por las polimerasas y eliminarlo
del sistema e incorpora el
correcto. Esto es una función
correctora, supervisora de la
replicación. Es muy importante
que sean las polimerasas que sean
las que tengan la actividad de
exonucleasas, porque así se puede
corregir inmediatamente. No es un
sistema perfecto. De cada 10 a 100
millones se introduce una
mutación, que permite la
evolución.

La actividad exonucleásica
5’ a 3’ actúa sobre extremos 5’ de
las cadenas. Su importancia se
verá después.

2.1.1. ADN polimerasa III


El ADN polimerasa III está codificado por el gen pol C, pero esto es una simplificación
porque tiene mucha complejidad estructural. Es un complejo de 900kDa. Interviene 10

5
La punta de flecha se supone que es el extremo 3’.

60
Capítulo 5. Replicación del ADN. I. Procariotas

proteínas distintas o subunidades (codificados por 10 genes distintos). Las subunidades


reciben el nombre α, δ…

Tiene una estrucutra dimérica, y cada monómero copia una de las dos cadenas del
dúplex parental, a medida que avanza la horquilla de replicación.

• La subunidad α tiene función polimerizadora 5’ → 3’.

• La subunidad ε tiene función exonucleásica 3’ → 5’.

La ADN polimerasa I y III avanzan en dirección 5’ a 3’. Eso planteó un dilema que es
el siguiente: «¿si las ADN polimerasa simepre avanzan en dirección 5’ a 3’ cómo puede
replicar dos cadenas de polaridad opuesta?»

Hoy en día se sabe que la replicación de ADN de E.coli se realiza bajo un modelo de
replicación semidiscontinuo. Bajo este modelo, una de las dos cadenas parentales se copia
de manera continua. Esa cadena que se copia de manera continua se denomina cadena
lider ó leading strand. Una de las dos cadenas parentales se copia de manera continua en
la direccion correcta por la ADN polimerasa III.

La otra cadena del dúplex, se copia de manera discontinua, en términos de cortos


fragmentos de ADN de una longitud de 1000 a 2000 nucleótidos que reciben en nombre de
fragmentos de Okazaki. Para referirse a esta cadena que se sintetiza de manera discontinua
la denominaremos lagging strand o cadena rezagada.

Este problema supone un gran trabajo al aparato de replicación.

El siguiente problema es que cuando se analizan la función de las proteínas, se sabe


que las polimerasas no pueden per se empezar la síntesis de una cadena de ADN. Requieren

61
Capítulo 5. Replicación del ADN. I. Procariotas

del primer o cebador. El cebador no puede ser ADN, pero podía ser ARN, porque ya se sabía
que los ARN se pueden sintetizar de novo. No necesitan un cebador o primer.

3. Procesos de iniciación y terminación de la


replicación, y procesos topológicos que intervienen

El primer paso de la iniciación es saber cómo se sintetizan los ARN. Esto se realiza por un
preprimosoma, en el cual interviene un complejo proteico para el precebado, para acondicionar
el sistema para la síntesis del cebador. El preprimosomas está compuesto por PriA, PriB, PriC,
DnaB, DnaC, DnaT, SSB.

➢ PriA

➢ DnaB

➢ SSB: acrónimo de una proteína (single strang binding, proteína de unión a cadena
sencilla). Se une a la cadena sencilla e impide que las cadenas del dúplex vuelvan a
reformar los puentes de hidrógeno, vuelvan a asociarse, y además protege a las
cadenas sencillas de la degradación por nucleasas celulares.

Después interviene una proteína


que se llama primasa, que es
producto de un gen de la bacteria
denominado DnaG. La síntesis del
cebador (ARN) no se realiza por la las
enzimas que hacen normalmente la
transcripción. Se necesita una enzima
específica, que es la primasa, y es
quién va a sintetizar el primer de ARN
(4-15 nucleótidos). Ahora hay que
eliminar el ARN y unir los fragmentos.

Se tiene un dúplex de ADN, se


separan las dos cadenas, una se
sintetiza de manera continua, y otra
lo hace de manera discontinua.

A continuación tenemos un
fragmentos de Okazaki sintetizado,
que tiene un cebador de ARN. Cada
fragmento de Okazaki necesita de un
cebador, que hay que eliminar.
¿Cómo se elimina? El cebador está en el extremo 5’. Interviene pol I, con su función exonucleasa
5’ → 3’ elimina el cebador de cada fragmento de Okazaki. Si se elimina el cebador, queda un
hueco. Para llenar el hueco se utiliza el extremo 3’ OH del fragmento de Okazaki siguiente,
elongando el extremo y rellenando el hueco. Esta función es realizada por pol I.

62
Capítulo 5. Replicación del ADN. I. Procariotas

Al final lo que se tiene es restituído el ADN, pero queda un hueco, o sea, hay que unir los
fragmentos de Okazaki. Sin embargo, las enzimas ADN-polimerasas no tiene capacidad para
establecer uniones entre extremos de cadena. Se requiere el concurso de otra enzima que pueda
unir o sellar extremos de cadena. En E.coli se usa la ADN ligasa, producto del gen lig. Este
proceso hay que realizarlo con todos y cada uno de los fragmentos de Okazaki.

3.1. Helicasas y ADN topoisomerasas

Otras proteínas que juegan un papel importante en la replicación son las helicasas y
las ADN topoisomerasas.

➢ Helicasas: para que pueda


avanzar la replicación se
tienen que separar las
cadenas, y por tanto romper
los puentes de hidrógeno. Las
helicasas rompen los puentes
de hidrógeno y separan las
cadenas. ¿Qué helicasas
actúan? Se han encontrado en
E.coli 9 enzimas con actividad
helicasa. Estas enzimas tienen
afinidad con la cadena sencilla
(se asocian con ellas) y una vez
asociada, migran a lo largo de
la cadena rompiendo los
puentes de hidrógeno. Lo
pueden hacer una dirección u

63
Capítulo 5. Replicación del ADN. I. Procariotas

otra. Hay helicasas que van de dirección 5’ → 3’ y otras que van de 3’ → 5’. La
principal proteína helicasa se piensa que es la helicasa DnaB, que es la que forma
parte del prepriosoma.

Esta actividad helicasa de DnaB se ve ayudada por otras que también se piensa
que cooperan con ella. Son helicasas que van en otra dirección (3’ → 5’). Estas
helicasas se denominan PriA (también en el prepriosoma) y Rep.

➢ ADN-topoisomerasa: alivian las tensiones topológicas que se producen cuando


se abren las horquillas de replicación. Se originan superhélices positivas con la
apertura de las horquillas. Interviene una topoisomerasa del tipo II, en concreto,
la ADN-girasa, que introduce supehélices negativas, aliviando las tensiones
topológicas y pudiendo estirarse el dúplex y siguiendo la replicación.

3.2. Terminación de la replicación

Cuando se eliminan los cebadores quedan huecos en las cadenas y no se pueden


rellenar porque no hay otros fragmentos, por lo que los cromosomas se irían acortando
como resultado de liminar los últimos cebadores de las cadenas hijas. El material
hereditario se perdería progresivamente.

Este problema se resuelve de manera muy sencilla en los ADN de tipo circular como
es en el caso de E. coli. También muchas bacterias y virus tienen un cromosoma circular.
Permite resolver el problema de acortamiento de los cromosomas. Es decir, esta geometría
facilita la resolución.

La ADN polimerasa I con su función exonucleasa 5’ → 3’ elimina el último cebador de


ARN y el hueco se puede rellenar utilizando el extremo 3’ OH de la cadena líder adyacente.

Finalmente la ADN ligasa sella los huecos de la cadena y se termina la replicación.


Cuando se finaliza este mecanismo, las moléculas hijas están entrelazadas, no se
encuentran sueltas. Se necesita separar ese dúplex y esta acción la realiza la topoisomerasa
IV. Cuando actúa quedan separados los dúplex hijos que pueden irse a otra célula de E. coli.

64
Capítulo 6
Replicación del ADN. II. Eucariotas

1. Las fases del ciclo celular

Las etapas fundamentales del ciclo celular son la fase de mitosis (repartición de material
hereditario) e el período de interfase (el material está como fibra de 30nm). En la interfase hay
diferentes períodos:

• G1

• S

• 62

La replicación del ADN tiene lugar en interfase, y en concreto, en la fase S1 de la interfase.


Esta denominación es ciertamente confusa porque si es cierto que el ADN de una célula
eucariota se sintetiza en la fase S, la síntesis de ADN se puede producir en otros momentos (por
ejemplo, en G1 y G2)2. Se incorporan materiales necesarios para replicar el ADN o para dividirse
en la fase de mitosis.

Cuando una célula abandona la fase de mitosis tiene una dotación cromosómica 2n
(diploides). En la fase G1 son 2n. Esta dotación varía en la fase S (replicación) dónde se duplica
el material hereditario, por lo que cuando abandonan la fase S son tetraploides (4n). La fase G2
sigue siendo 4n, y en la mitosis se recupera la diploidía normal de las células.

Una célula típica de mamíferos, el


ciclo celular le dura 24 horas. De esas 24
horas, de 6 a 8 es lo que dura la fase S
(para replicar el material hereditario se
tarda entre 6 y 8 horas). Este tiempo ya
sugiere que la replicación del ADN de los
eucariotas no podía entenderse en
términos de un único replicón o unidad
de replicación como ocurre en E. coli. El
genoma tiene 3200 millones de pares de
bases por célula haploide. Si hubiera un
único origen, y la replicación se fuera
produciendo secuencialmente
cromosoma a cromosoma desde el
origen hasta el término, se tardaría más de un año en acabar.

1
S es de «síntesis».
2
G viene de «gap», vacío, ausencia de replicación.

65
Capítulo 6. Replicación del ADN. II. Eucariotas

Este hecho llevó a pensar que la replicación de ADN de eucariotas debe realizarse en
términos de múltiplos replicones que se activen simultáneamente. En humanos, se estima que
hay 30000 replicones.

Esto se demostró con una imagen de un cromosoma en estado de replicación, en D.


melanogaster. Se ven varios replicones.

2. Características generales de la replicación

2.1. Evidencia de múltiples replicones y activación

Para estudiar cómo se activan esos


replicones, fue necesario la técnica de
autorradiografía. Fue desarrollado por
investigadores como Huberman & Riggs en
1968 y Huberman & Tsai en 1972. Estas
técnicas permiten saber cuántos replicones
hay, sus orígenes y sus términos.
Experimentos similares a «Welderm y Welth»
permiten concluir que la replicación comienza
en un origen y siguen un modelo de
replicación bidireccional.

Experimentos de Taylor, Woods y


Hughes con Vicia faba en 1957 concluyeron
que la replicación en eucariotas sigue un
modelo semiconservativo.

Hay lugares de terminación (secuencias


similares a las secuencias Ter, que les señale dónde acaba el replicón). Parece ser que no
hay señales específicas de ADN que le indiquen al sistema que termine el replicón.

La terminación de cada replicación termina por encuentro. Los replicones adyacentes


siguen creciendo hasta que se encuentran y se fusionan, formándose lo que se denomina
replicones fusionados.

66
Capítulo 6. Replicación del ADN. II. Eucariotas

2.2. Orígenes de replicación


La replicación de cada uno de los replicones no es aleatoria. Hay secuencias que
indican dónde está el origen. Uno en cada uno de los replicones. Hoy en día se sabe cómo
es la estructura del origen de replicación en S. cerevisiae.

¿Cómo se determinó cual era la secuencia mínima que era la secuencia de


iniciación? Se transmitieron secuencias de ADN de S. cerevisiae a plásmidos que se les había
eliminado la suya, hasta dar con la secuencia que permitía a los plásmidos replicarse. Estas
secuencias, se llaman en levaduras, secuencias de replicación autónoma, que
abreviadamente se conoce como ARS. Una vez aislado estés fragmentos se procedió a
secuenciar su ADN, y se mira si hay rasgos característicos de esas secuencias que le permita
al aparato de replicación identificarlas como el origen.

La longitud total de estos ARS es de 200 pares de bases (más pequeños que los OriC).
Cuando se analiza su secuencia se encuentran cuatro subdominios característicos. Estos
subdominios son A, B1; B2, B3.

El A con B1 constituye lo que se denomina la secuencia de reconocimiento del


origen. Aproximadamente 40 pares de bases. A esta secuencia se le unen seis proteínas que
forman el complejo de reconocimiento del origen, conocido abreviadamente como ORC.

Además de esta unión, se produce una unión de un factor proteico al subdominio B3.
Este factor proteico se denomina factor 1 de unión a ARS, abreviadamente ABF 1. ABF1 se
une a B3 y produce una tensión torsional, que promueve la separación de las cadenas del
dúplex en el subdominio B2, algo que se ve facilitado, porque el domino B2 es rico en los
pares de bases adenina-timina.

El ORC se une a la secuencia de reconocimiento de origen. ORC está presente a lo


largo de todo el ciclo celular. ORC juega un papel de mediador e interviene en la regulación
de la activación de otros replicones.

Hay que hablar también de los diferentes acontecimientos antes y después de la


replicación. Así hablamos de un complejo pre-replicativo, que se denomina pre-RC. Este
complejo está justo antes de que empiece la fase S. Lo vamos a encontrar en la fase G1.

67
Capítulo 6. Replicación del ADN. II. Eucariotas

Este complejo está formado por:

• ORC: complejo de reconocimiento del origen.

• Cdc6p: es la proteína del ciclo de división celular 6. Ésta solo se sintetiza en la


fase G1.

• MCM: esta proteína es un acrónimo de la proteína de mantenimiento del


minicromosoma.

• Factor Cdt 1

Cuando comienza la replicación se libera del sistema Cdc6p + Cdt1. La proteína Cdc6p
experimenta una fosforilación por una proteína quinasa y se degrada automáticamente3.

Durante el proceso de replicación sólo queda ORC y MCM. No se sabe bien la función
de MCM, pero se piensa que o altera la estructura del cromosoma para que avance la
horquilla de replicación, o bien puede actuar como una helicasa (separando las dos
cadenas).

Se llega al final de la replicación y al complejo post-replicativo (post-RC). En este


complejo sólo estará ORC. Evidentemente en la fase S no se activan simultáneamente todos
los replicones, pero hay patrones para la activación.

Al transferir secuencias de iniciación humanos a monos, se encuentra que son de 8


kilobases, y son más complejos. En estos fragmentos hay orígenes de replicación primarios
que se utilizan primariamente, pero si no se pueden usar, se pueden usar regiones
alternativas como orígenes de replicación (orígenes de replicación secundaria). En
humanos existen proteínas similares a las que forman parte del complejo de
reconocimiento del origen (ORC). Esto concluye que el estudio de ARS es útil para entender
la replicación en eucariotas superiores como los humanos.

3. Bioquímica o enzimología de la replicación

La síntesis de ADN en eucariotas tiene lugar por medio de enzimas sintetizadores de ADN
que se denominan ADN polimerasas4. Es más compleja que en procariotas como E. coli.

Muchas de ellas intervienen en procesos de reparación de ADN (reparación de mutaciones).

Distinguimos cuatro ADN polimerasas en eucariotas, tres de ellas (α, δ y ε)5 tienen una
localización nuclear e intervienen en la replicación del ADN nuclear. El otro ADN polimerasa (γ)
se localiza en el citoplasma. Está implicada en la duplicación del ADN mitocondrial.

• ADN polimerasa α: se encarga de la síntesis de cebadores (en E. coli era una primasa).
También en eucariotas hay un modelo de replicación semidiscontinuo.

3
No se pueden volver a replicar nunca más.
4
Hay decenas de ADN polimerasas.
5
Para la nomenclatura de los ADN polimerasas se usan letras griegas.

68
Capítulo 6. Replicación del ADN. II. Eucariotas

• ADN polimerasa δ: sintetiza la cadena lagging.

• ADN polimerasa ε: sintetiza la cadena leading.

• ADN polimerasa γ: replicación del ADN mitocondrial.

POLIMERASA EXONUCLEASA EXONUCLEASA


FUNCIÓN
5’→3’ 3’→5’ 5’→3’
Síntesis de
ADN polimerasa α + - -
cebadores
Síntesis de la
ADN polimerasa δ + + -
cadena lagging
Síntesis de la
ADN polimerasa ε + + -
cadena leading
Replicación del
ADN polimerasa γ + + - ADN
mitocondrial

Todas tienen función polimerizadora en dirección 5’ → 3’. El ADN polimerasa α no tiene


función correctora (Función exonucleásica 3’ → 5’. Cuando actúa este ADN polimerasa introduce
nucleótidos.

Ninguna de ellas tiene función exonucleásica 5’ → 3’ (en bacterias, esta función la tenía el
ADN polimerasa I para eliminar los cebadores).

El problema está, entonces, en que las polimerasas no eliminan lo cebadores.

4. Procesos de iniciación, elongación y terminación

4.1. Iniciación y elongación de nuevas cadenas de ADN

Los fragmentos de Okazaki tienen un tamaño de 200 bases en humanos (en bacterias
era de 1000 a 2000). Coincide con el ADN de un nucleosoma.

El ADN polimerasa α sintetiza primero un fragmento de ARN, para que done el


extremo 3’ OH, de un tamaño de aproximadamente 10 bases. Una vez sintetizado esto
corto fragmento, sintetiza un fragmento de ADN de una longitud de aproximadamente 20
bases.

¿Por qué tiene la capacidad de sintetizar las dos cosas? Los ADN polimerasa α es un
complejo proteico constituido por una subunidad catalítica capaz de polimerizar ADN.
Tiene también una subunidad llamada B, que tiene una función de reunir todas las
subunidades en un complejo, y tiene, además, dos proteínas pequeñas de bajo peso
molecular que tiene capacidad de sintetizar ARN.

69
Capítulo 6. Replicación del ADN. II. Eucariotas

La eliminación de
los cebadores de ARN y
ADN6 no es totalmente
conocida. Sin embargo,
para la eliminación de los
cebadores interviene una
endonucleasa, que es la
endonucleasa FEN 1.
Necesita la ayuda o bien
de RNA-asa H o bien de
una helicasa7. Tampoco
se sabe si esta
endonucleasa elimina
solo el ARN o elimina
también el ADN (las 30
bases). Si no tiene
capacidad correctora,
sería útil que eliminara
todo porque en ese trozo
de ADN hay mutaciones.

4.2. Terminación de la replicación

4.2.1. El problema de
la terminación de la
replicación
Cuando se elimina el
último cebador del último
fragmento de Okazaki,
queda un hueco. Si esto
quedara así, cada ronda de
replicación llevaría un
acortamiento de los
cromosomas, o sea,
reducción de los
telómeros.

Los telómeros juegan un papel fundamental en la estructura del cromosoma,


porque protegen a los finales de los cromosomas de la degradación por
endonucleasas celulares. Si se sucede una degradación telomérica, pueden
terminarse todos los telómeros, y todos los cromosomas se fusionarían unos con
otros (se volverían pegajosos), se perdería la individualidad cromosómica. Se
produciría un caos genético que mataría a la célula.

6
Son cebadores mixtos.
7
No se sabe bien

70
Capítulo 6. Replicación del ADN. II. Eucariotas

Además, contribuyen a la arquitectura


tridimensional del material hereditario en el núcleo.
El material hereditario de los cromosomas asociado a
las regiones teloméricas influye con la disposición en
el núcleo, y además tiene asociaciones con la
membrana del núcleo.

Es un problema mayor si ocurre en la línea


germinal, ya que no puede haber una pérdida de
material hereditario, por lo que tiene que desarrollarse un mecanismo para evitar
esto.

Esto concluye en el estudio de una enzima denominada telomerasa. Se


descubrió en 1985 por Blackburn & Greider en un protozoo, junto con experimentos
desarrollados por Szostak.

Juega un papel fundamental para resolver el problema del final de la


replicación. Esta enzima también está en humanos.

4.2.2. La telomerasa
La telomerasa es un complejo ribonucleoproteico, que está constituido por
ARN y proteínas. En humanos, la molécula de ARN tiene una longitud de 450
ribonucleótidos. El componente
proteico es especial, porque esta
proteína que forma parte de la
telomerasa tiene actividad
retrotranscriptasa, es decir, que es
capaz de sintetizar moléculas de ADN
a partir de un molde de ARN. Esta
propiedad de la telomerasa le permite
elongar los telómeros y evitar los
acortamientos que se producen
durante la replicación.

En humanos, esta enzima actúa


en células germinales8 y en células
madre. En el resto de las células del
adulto, no hay actividad de la
telomerasa y por tanto hay
acortamiento telomérico.

En los finales de los


cromosomas, hay ADN minisatélite,
en concreto, ADN minisatélite de la
familia telomérica. Las unidades de
repetición son exanucleótidos. La telomerasa se asocia con una de las dos cadenas
del dúplex (para distinguirlas de manera fácil, una es rica en guanina y otra en
citosina) a la cadena rica en guaninas, a su extremo 3’. Se asocia a esta porque la

8
Productoras de gametos.

71
Capítulo 6. Replicación del ADN. II. Eucariotas

molécula de ARN de la telomerasa tiene complementariedad parcial con las unidades


de repetición teloméricas.

La telomerasa utiliza su actividad retrotranscriptasa, utilizando como molde su


propio ARN y va elongando la cadena rica en guaninas añadiendo una unidad de
repetición. La dirección de avance es 5’ a 3’ (como todas las síntesis de ADN). En un
primer paso se sintetiza una unidad de replicación, y después la telomerasa se
transloca, y vuelve a sintetizar otra unidad de repetición. Esto lo hace múltiples vece,
y entonces elonga el extremo 3’ de la cadena rica en guaninas con múltiples unidades
de repetición.

En la cadena rica en citosinas queda un hueco, que es rellenado por una enzima
ADN polimerasa. Se piensa que interviene el ADN polimerasa α.

¿Qué instrucciones recibe la telomerasa para parar?

Tiene que haber un mecanismo de control para que pare la telomerasa. La


acción de la telomerasa es regulada por proteínas de unión al telómero (telomer
binding proteins, TBP). Dentro de TBP, una importante es la TRF1. Esta proteína
cuando los telómeros se van acortando, incrementa su expresión, y llegado un
momento, genera una estructura plegada de la cromatina, que impide el acceso de
la telomerasa.

En esta estructura plegada de la cromatina también coopera la proteína TRF2.

4.2.3. Envejecimiento e inmortalización


La telomerasa se ha asociado con los procesos de envejecimiento e
inmortalización celular o cáncer. Hace décadas, se demostró que, si se partía de un
cultivo de fibroblastos humanos, estas células se dividían hasta un máximo de 50
veces. Llegados ese momento, las células eran incapaces de reproducirse, pasaban a
un estado de senescencia. En este estado son metabólicamente activas hasta que
mueren. Hoy se sabe que esto es debido a que cada ciclo de replicación se pierde
ADN telomérico, porque son células somáticas y no hay actividad de la telomerasa.

¿Cómo se pude saber que esto era debido a la ausencia de la telomerasa?


Esto se comprobó partiendo de un cultivo de fibroblastos a los cuales se les había
«transformado» el gen de la telomerasa. En ese cultivo se observa que las células
pueden crecer y dividirse indefinidamente, transformándose en un cultivo inmortal.
Hay un reloj biológico mediado por la longitud de los telómeros. Esto es lo que pasa
a nivel celular.

En el individuo completo, uno de los sistemas biológicos que nos permiten


acercarnos a la relación de la telomerasa con el envejecimiento es el síndrome de
Hutchinson-Gilford o progeria9. Esta enfermedad es genética y muy rara (decenas
de casos en el mundo cada año). Las características son: estatura corta, alopecia,
problemas de piel. Se manifiesta en aterosclerosis, que conduce a infarto de
miocardio y problemas cerebrales. Se observa que tienen un acortamiento

9
Del griego envejecimiento prematuro

72
Capítulo 6. Replicación del ADN. II. Eucariotas

progresivo de los telómeros (una tasa más alta que los individuos normales), por lo
que se explica ese envejecimiento.

Una solución sería activar el gen de la telomerasa en vía somática (frenando el


envejecimiento), pero si se activa la telomerasa, se puede obtener una proliferación
anormal de las células derivando en cáncer. Esto puede pasar porque en el 90% de
los cánceres hay actividad telomerasa.

4.2.4. Hipótesis telomérica de la senescencia celular e inmortalización


En la línea germinal o células madre, la relación permanece constante. A
medida que aumentan las divisiones, la longitud de los telómeros permanece
constante, porque hay actividad telomerasa.

En la línea somática, no hay actividad telomerasa, por lo que a medida que


aumentan las divisiones, hay un progresivo decrecimiento de la longitud del
telómero.

Esto conduciría a la unión de


los cromosomas y la muerte de la
célula. Sin embargo, las células
tienen sistemas de supervisión
celular, o check points (puntos de
chequeo).

Hay dos puntos de chequeos


fundamentales. Uno justo antes de
entrar en la fase S, y otro, que ocurre
antes de la fase de mitosis. Cuando
estos sistemas ven que la célula está
perdiendo críticamente los
telómeros, retiran a las células del
ciclo celular, y las conducen a fase
de senescencia (siguen
metabólicamente activas hasta que
mueren).

La célula puede evadir los


sistemas de vigilancia celular (porque estos están sometidos a mutaciones y puede
que no funcionen correctamente), por lo que los sistemas no funcionan, y a medida
que aumentan el número de divisiones celulares, se van acortando los telómeros, y
la célula entra en una fase de crisis, que le llevará a la muerte.

Otra cosa que puede pasar es que cuando la célula elude el check point, la
célula tiene un papel oncogénico, se activa la telomerasa, alonga los telómeros, y se
llega a una fase de inmortalización celular o línea cancerígena.

Hay experimentos que dan esperanza para combatir el envejecimiento sin


producir cáncer. A unos ratones, se les transfirió a células somáticas el gen de la
telomerasa, y además se le modificó su genoma para que fueran más resistentes al
cáncer. Se encontró que esos ratones vivían mucho más tiempo, no tenían signos de

73
Capítulo 6. Replicación del ADN. II. Eucariotas

envejecimiento, no tenían problemas en la piel ni en el pelo, ni problemas


cardiovasculares. Se retrasó el envejecimiento sin producir cáncer.

La enzima telomerasa tiene otras propiedades además de elongar telómeros,


ya que interviene de manera desconocida en el ciclo celular.

74
Capítulo 7
Transcripción y maduración del ARN

Una secuencia de nucleótidos va a dar lugar a una serie de aminoácidos constituyendo una
proteína. Existen dos mecanismos para pasar la información del ADN a las proteínas:
transcripción y traducción. En este tema trataremos la transcripción.

1. Características generales de la transcripción

Guarda cierta similitudes con la replicación, pero


también tienen varias diferencias:

➢ Mediante el mecanismo de la transcripción, una


enzima ARN polimerasa copia fielmente la
secuencia de nucleótidos de una cadena de ADN
dando lugar a una secuencia de nucleótidos de un
ácido ribonucleico o ARN.

➢ Las enzimas ARN polimerasas polimerizan una


cadena de ARN insertando nucleótidos
complementarios a la cadena de ADN que se copia
en dirección 5’ → 3’, de acuerdo con las reglas de
emparejamiento de bases de Watson & Crick.

➢ El inicio de la cadena del ARN es un extremo 5’


trifosfato. Esta diferencia con el ADN se usa para
aislar ARN

75
Capítulo 7. Transcripción y maduración del ARN

➢ En la polimerización del ARN, los sustratos de la reacción son ribonucleótidos y la base


uracilo reemplaza a la base timina del ADN.

➢ La síntesis de ARN no requiere de la presencia de un cebador o primer.

➢ Es frecuente que en virus y eucariotas se transcriban las dos cadenas de un mismo


dúplex para dar productos de ARN diferentes.

1.1. La cadena molde y la cadena codificadora

La cadena en negro es la cadena molde. La complementaria es la cadena


codificadora. El ARN se sintetiza a partir de la cadena molde. El transcrito de ARN tiene la
misma secuencia que la cadena codificadora.

1.2. Unidad de transcripción

La unidad de transcripción es una secuencia de ADN que da lugar a una única


molécula de ARN. Todas las unidades de transcripción comienzan en el promotor y finaliza
en el terminador.

76
Capítulo 7. Transcripción y maduración del ARN

El primer nucleótido de la molécula de


ADN que está representado en la molécula la
ARN se denomina lugar de iniciación
(startpoint). Este primer nucleótido ocupa la
posición de la secuencia de +1. Las bases
posteriores o las posiciones de las bases
posteriores al lugar de iniciación se
denominan downstream, y se numeran
consecutivamente. La siguiente será +2, +3,
+4, etc. Las bases que se posicionan anteriores
al lugar de iniciación se denominan bases
upstream, y se numeran consecutivamente
con un signo negativo. Las anteriores serán -1,
-2, -3, etc.

2. Etapas de la transcripción

Sigue tres etapas:

➢ Iniciación

➢ Elongación

➢ Terminación

Para llevar a cabo estas etapas, es necesario polimerizar ARN, y la polimerización de ARN
se realiza mediante enzimas específicas denominadas ARN polimerasas.

Si vamos a la bacteria E. coli y miramos en su proteoma, sólo hay una enzima ARN
polimerasa, que es capaz de dar lugar a los tres productos diferenciados de ARN (ARN
mensajero, ARN-ribosómico y ARN-transferente1).

La enzima ARN-polimerasa está constituida por diferentes subunidades. Éstas forman por
un lado el núcleo de la enzima. El núcleo está formado por dos subunidades α; una subunidad
β, una subunidad β’ y una ω. Por otro lado, está el factor σ.

2.1. Iniciación de la transcripción

2.1.1. Factor sigma


La transcripción se inicia en las regiones promotoras, y es aquí en dónde se
asocia el ARN polimerasa de E. coli. La parte de la enzima que es capaz de iniciar la
transcripción es el factor σ.

1
Estos son los procariotas, en eucariotas hay más tipos

77
Capítulo 7. Transcripción y maduración del ARN

El núcleo de la enzima tiene


muy poca especificidad por los
promotores, y puede asociarse a
cualquiera región de la unidad de
transcripción.

El factor σ se asocia al núcleo


de la enzima y determina que la
transcripción inequívocamente se
inicie en los promotores. Al unirse
se forma una holoenzima2 y se
empieza a transcribir.

Cuando pasan 8
ribonucleótidos, el factor σ se
disocia de la ARN-polimerasa, y, por
tanto, la fase de elongación la lleva
a cabo exclusivamente el núcleo de
la enzima.

2.1.2. Elementos del promotor.


¿Qué características tienen los promotores para que sean reconocidos por el
factor σ? Para ver que rasgos distintivos tenían, se partió de ADN de diferentes
promotores bacterianos, secuenciarlos,
comparar las secuencias, y observar si
aparece algún rasgo constante o
conservado a lo largo de la secuencia.

¿Cuándo se considera que una


secuencia fuera consenso o conservada?
Se considera cuando está presente más
del 60% de las veces.

En la imagen, la Y significa que son


pirimidinas. R indica que es una base
púrica. N indica que no hay ninguna base
conservada.

Se llega a conocer cuatro elementos del promotor característicos:

➢ Lugar de iniciación3: generalmente es una base púrica rodeada por bases


pirimidínicas, en particular encontramos con frecuencia que se trata de
una Adenina rodeada por Citosina y Timina. CAT. El lugar de iniciación es
la A.

2
Enzima completo.
3
Primera base de ADN que tiene representación en ARN.

78
Capítulo 7. Transcripción y maduración del ARN

➢ Secuencia -10: Es la secuencia TATAAT, también llamada la caja «Pribnow


box». El centro de la secuencia está alrededor de la posición -10
(T80A95T45A60A50T96)4.

➢ Secuencia -35: más upstream que la -10, la secuencia conservada es


TTGACA (T82T84G78C54A45).

➢ Distancia entre secuencias -35 y -10: distancia variable entre 16 y 19


pares de bases. Lo importante es la distancia, no las bases.

Estos son los rasgos que necesita la ARN-polimerasa. Este es el promotor ideal.
Todas las secuencias de genes que se aproximen a este promotor ideal tendrán tasas
de transcripción altas. Son los promotores fuertes. Todos los promotores bacterianos
que experimenten mutaciones que los acerquen al promotor ideal, se denominan
mutaciones UP.

Aquellos promotores bacterianos con secuencias que les alejen del promotor
ideal experimentarán una disminución de la tasa de transcripción. Son promotores
débiles (weak).

Las mutaciones que ocurren en los promotores bacterianos que alejen a su


secuencia del promotor ideal, son mutaciones down. Hay genes que no necesitan
mucha expresión, por lo que pueden tolerar mejor las mutaciones down.

En ingeniería genética, se usan los promotores up para producir masivamente


proteínas.

¿Qué significado tienen las secuencias -35, -10 y la distancia?

La ARN polimerasa contacta primeramente con la secuencia -35 (el factor σ).
La secuencia -35 es entonces, el lugar de reconocimiento de la ARN polimerasa. Una
vez reconocidos los promotores, la ARN polimerasa se desplaza a la secuencia -10, y

4
Los subíndices señalan el grado de conservación.

79
Capítulo 7. Transcripción y maduración del ARN

en ella es dónde se separan las cadenas del


dúplex (necesario para que funcione el
ADN). Esto se ve favorecido porque la
característica de la secuencia -10 es rica
den A-T, y sólo hay que romper dos puentes
de hidrógeno y no tres.

La distancia entre las secuencias -35


y -10 de entre 19 y 16 pares de bases,
porque la ARN-polimerasa tiene que
localizar la secuencia -35 y desplazarse a la
-10. Es pequeña, para que no se dificulte el
movimiento.

2.2. Elongación. Cambios tipológicos

Las topoisomerasas juegan un papel crucial durante la transcripción.

Cuando la ARN polimerasa se va desplazando a lo largo del gen, se originan en la


dirección de avance (o vanguardia) superhélices positivas, y detrás (o retaguardia)
superhélices negativas. Es por esto por lo que son necesarias las topoisomerasas. En la zona
de avance, actúa un ADN topoisomerasa tipo II, la ADN-girasa, que introduce superhélices
negativas. En la zona de atrás, actúa un ADN topoisomerasa del tipo I, el top A, que
introduce superhélices positivas o elimina las negativas.

Si no hay topoisomerasas, no hay transcripción.

2.3. Terminación de la transcripción

La fase de elongación es llevada a cabo sólo por el núcleo de la ARN polimerasa.

80
Capítulo 7. Transcripción y maduración del ARN

Tiene que haber un momento que se pare de transcribir. Siempre debe acabar en el
mismo sitio. Tiene que haber una señal en las unidades de transcripción que le diga que
pare.

En E. coli existen dos maneras de terminar la transcripción. La terminación puede


tener lugar por:

➢ Terminadores intrínsecos o independientes de RHO (ρ): estas señales son


terminadores que presentan como característica fundamental que tienen una
secuencia palindrómica, seguida de un tracto de Adenina-Timina. ¿Por qué para
la ARN polimerasa? Esto es porque el palíndromo puede formar una secuencia
secundaria en forma de horquilla (en el ARN). A continuación de la horquilla hay
uracilos. Esto provoca que se detenga la transcripción (la ARN polimerasa no
puede seguir cuando se encuentra la horquilla).

La molécula de ARN está unida al ADN mediante puentes de hidrógeno muy


débiles entre los uracilos y las adeninas del ADN molde.

➢ Terminadores dependientes de RHO (ρ): para que finalice la transcripción, se


necesita el concurso de la proteína ρ. ¿Por qué esta proteína puede terminar la
transcripción? Porque tiene propiedades de helicasas, y al final de la
transcripción puede eliminar los puentes de hidrógeno, liberándose la molécula
de ARN.

Estos dos mecanismos aparecen con una frecuencia de un 50 %. Con estos


mecanismos se transcriben los ARNm, ARNt y ARNr.

3. Transcripción de genes que dan lugar a ARNm

Lo primero que hay que decir sobre los genes codificadores de proteínas en bacterias es
que generalmente son policistrónicos, es decir, que pueden dar lugar a dos o más proteínas.
Esto es una característica diferenciadora de los eucariotas, que son monocistrónicos.

3.1. Estructura de los ARNm bacterianos

Los que tienen dos cistrones pueden dar lugar a dos proteínas. Se identifica dos
regiones codificadoras. En cada una de las regiones codificadoras se encuentran los
codones que darán lugar los aminoácidos en las proteínas. Las regiones codificadoras
comienzan por el codón de iniciación, generalmente, AUG. Si vamos al final de la región
codificadora se encuentran los codones de terminación. Son codones que sirven de señal
de parada de traducción (en los ribosomas). Hay tres codones de terminación: UAG
(ámbar), UAA (ocre) y UGA (ópalo).

También se encuentran regiones no codificadoras. La región del mensajero que


antecede (upstream) a la región codificadora (la que se encuentra en el extremo 5’ de la
molécula, se denomina líder. También se le llama 5’-UTR (Untranslated Region).

81
Capítulo 7. Transcripción y maduración del ARN

Si vamos al extremo 3’ del mensajero, encontraremos una secuencia no codificadora


que recibe el nombre de tráiler, o por homología con lo anterior, 3’-UTR.

Por último, encontramos otra región no codificadora que se denomina región


intercistrónica, que es la que separa a las regiones codificadoras. Varía de -1 a +40 bases.
Si la distancia es -1, si acaba un cistrón en UAA, el otro puede empezar con AUG usando la
última adenina del anterior. Por eso la distancia es -1.

Hay otra región que está en el extremo 5’-UTR es la secuencia shine-dalgarno. La


célula bacteriana no tiene compartimientos, por lo que cuando sale el extremo 5’ de ARNm,
ya se empieza a traducir.

¿Cómo se enganchan los ribosomas al ARNm? Los ribosomas bacterianos tienen una
velocidad de sedimentación de 70S. La subunidad grande sedimenta a 50S. El mensajero
se asocia a la subunidad pequeña. Hay un reconocimiento mediante puentes de hidrógeno
con el ARNr. El ARNr de 16S (pequeño). Tiene una secuencia que es AUUCCUCCA que es
complementaria con una secuencia del mensajero, que es la secuencia shine-dalgarno. Esta
secuencia está conservada, y permite asociarse con el ARN ribosómico 16S mediante
puentes de hidrógeno para iniciar la síntesis proteica.

82
Capítulo 7. Transcripción y maduración del ARN

4. Transcripción en eucariotas

4.1. Diferencias con procariotas

La transcripción en eucariotas tiene algunas similitudes con procariotas, pero


también muestran diferencias.

• Estructura celular en compartimentos. La transcripción ocurre dentro del


núcleo y los ARN5 salen a través de unos poros situados en la envuelta nuclear
ayudados por proteínas6. Luego van al citoplasma donde se encuentran los
ribosomas y se traducen. No es simultánea con la traducción.

• La célula eucariota tiene hasta 5 tipos diferentes de ARN polimerasas.

• En bacterias, las ARN polimerasas podían reconocer los promotores e iniciar la


transcripción. En eucariotas no pueden iniciar la transcripción por sí solas sin el
concurso de los denominados factores de transcripción.

• La transcripción es más compleja debido a la estructura de la cromatina.

• Los ARNm son típicamente monocistrónicos y son más estables. En bacterias


son policistrónicos, porque así las bacterias sintetizan de golpe proteínas que
intervienen en una misma ruta metabólica. Además, las proteínas se sintetizan
en cantidades iguales. Al sintetizarlos al mismo tiempo se ahorra tiempo.

• La maduración del ARNm requiere en mayor o menor medida diversas


complejas modificaciones durante y después de la transcripción (caperuza, cola
de poli(A), splicing y edición del ARN).

4.2. ARN polimerasas en eucariotas

TIPO PRESENTE EN PRODUCTO


ARN polimerasa I Todos los eucariotas ARNr de mayor tamaño
PreARNm, algunos ARNpn,
ARN polimerasa II Todos los eucariotas ARNpno, algunos ARNmi,
LINEs
ARNt, ARNr de menor
ARN polimerasa III Todos los eucariotas tamaño, algunos ARNpn,
algunos ARNmi, SINEs
ARN polimerasa IV Plantas Algunos ARNpi
Moléculas de ARN que
ARN polimerasa V Plantas participan en la formación
de la heterocromatina

5
La molécula que se origina en la transcripción es un preARNm, que es un precursor
del ARNm (el que se traduce).
6
Transportinas

83
Capítulo 7. Transcripción y maduración del ARN

4.3. Aparato de transcripción basal

Está constituido por la ARN polimerasa y factores de transcripción generales. Por


tanto, el aparato de transcripción basal es el sistema imprescindible para que se reconozcan
los promotores de eucariotas. Los factores de transcripción generales son fundamentales
para que la ARN-polimerasa vaya a los promotores y comience la transcripción, algo que la
ARN-polimerasa no puede hacer por sí misma.

Los factores de transcripción (TFs) se clasifican:

➢ Factores de transcripción generales (GTFs): forman parte del aparato de


transcripción basal.

➢ Factores de transcripción específicos: modulan la tasa de transcripción

Existen distintos factores transcripciones que ayudan a las distintas ARN polimerasa.
Si ayudan a la ARN polimerasa I se denominan TFI. Si ayudan a la ARN polimerasa II se
denominan TFII, y así sucesivamente.

Dentro de cada tipo, hay varios tipos:

➢ TFI

• TFIA

• TFIB

➢ TFII

• TFIIA

• TFIIB

4.4. Elementos del promotor para los genes transcritos por la ARN
polimerasa II

4.4.1. El promotor núcleo


El promotor núcleo es la secuencia mínima de ADN que es reconocida por el
aparato de transcripción basal7. Dentro del promotor núcleo se encuentra:

➢ Lugar de iniciación: muestra unas características menos conservadas que


en bacterias, pero el elemento que más abunda es una adenina
flanqueada por pirimidinas. En eucariotas, también se denomina
abreviadamente Inr (initiator).

➢ TATA box: centrada en una posición -25 (25 pares de bases upstream del
lugar de iniciación). Es rica en los pares de bases adenina-timina, por lo
que quiere decir que es una zona en dónde se despliegan las dos zonas
del dúplex para iniciar la transcripción.

7
ARN polimerasa II + factores de transcripción generales.

84
Capítulo 7. Transcripción y maduración del ARN

➢ BRE (elemento de reconocimiento de TFIIB): situado en una posición -35.


La secuencia conservada obedece a pares de bases guanina-citosina.

➢ DPE (downstream promotor element): Es downstream. Se encuentra en


una posición posterior al lugar de iniciación. Típicamente, esta posición es
+30. La secuencia de bases es RG A/T CGTG.

Se reconocen
secuenciando las zonas
del ADN, alineándolas y
mirando las bases que
se van repitiendo. En la
práctica, en muchos
genes de proteínas no
tiene sus promotores
todos estos elementos.
En alguna bibliografía,
siempre se incluye la caja TATA, ya que se observa que aproximadamente la mitad
presenta esta caja y la otra mitad no (los llamados TATA less).

Con mayor frecuencia se encuentra que el 50% de los genes contienen la TATA
box y el elemento iniciador. En el otro 50% de los genes con promotores TATA less
están constituidos por el elemento iniciación y el elemento DPE.

4.4.2. El promotor regulador


El promotor regulador está constituido por elementos que afecta a la tasa de
transcripción. Secuencias que aumentan o decrecen la tasa de transcripción. Pueden
estar presentes o no (todos ellos) dependiendo del gen.

Se encuentran secuencias que se llaman GC, que son secuencias ricas en


guanina y citosina (repetidas en el elemento regulador). Estas secuencias se llaman
GC-box (caja GC).

Otros elementos que pueden estar


presentes son la caja CAAT (CAAT-box).
Estos elementos y algunos otros como
OCT-box están intercalados en el
promotor. Son elementos que están
relativamente próximos al lugar de
iniciación y al promotor núcleo.

Existen otros elementos reguladores


que afectan a la tasa de transcripción que
pueden estar situados a distancias relativamente grandes del promotor núcleo y del
lugar de iniciación. Los que están más alejados del promotor núcleo reciben el
nombre de intensificadores o enhancers. Son elementos del promotor regulador
que incrementan la tasa de transcripción.

En contraposición a estos intensificadores existen los silenciadores o silencers,


que como su propio nombre indica, decrecen la tasa de transcripción.

85
Capítulo 7. Transcripción y maduración del ARN

La combinación de todos estos promotores reguladores, y del promotor


núcleo, regulan la expresión de genes en eucariotas.

4.5. Maduración de los ARNm

En el momento de la transcripción ya se originan modificaciones del transcripto


primario, de la molécula de ARN que va transcribiendo la molécula ARN, modificaciones
que no se observaban en bacterias. Estas modificaciones aparecen con el nombre de
modificaciones postraduccionales, pero ahora se sabe que estas modificaciones ocurren
simultáneamente con la transcripción, por lo que son modificaciones cotranscripcionales.

Hay dos tipos importantes de modificaciones en el pre-ARNm:

• Adición de una caperuza en el extremo 5’

• Adición de cola de poli(A) en el extremo 3’

4.5.1. Adición de una caperuza en el extremo 5’


Todas las moléculas de ARNm tienen una caperuza en el extremo 5’. Esta
caperuza es una guanina metilada en posición siete, que se adiciona al extremo 5’
mediante un enlace fosfodiéster atípico, esto es, un enlace 5’ 5’.

Tanto la adición de la guanina y la metilación en la posición 7 se realiza


mediante enzimas específicas. Esta guanina que se adiciona es una guanina que no
está codificada por el ADN. Se adiciona cuando la ARN polimerasa ha transcrito del
orden de 20 a 30 nucleótidos. Es una modificación que ocurre cuando aún no se ha
acabado de transcribir la molécula (modificación cotraduccional).

¿Qué función tiene esta caperuza y por qué se adiciona tan rápido? A esta
caperuza se la han atribuido diferentes funciones. La primera, proteger el extremo 5’
de los mensajeros de la degradación por exonucleasas que avancen en dirección 5’
3’. La segunda función es que esta caperuza facilita el transporte de la molécula de
mensajero del núcleo al citoplasma. Coopera esta caperuza en el fenómeno de
splicing. La última función que se le atribuye a la caperuza es que facilita la unión del
extremo 5’ del mensajero con el ARN-ribosómico que contiene la subunidad menor
del ribosoma denominada 40S8. A veces hay modificaciones de los extremos 5’
distintas.

4.5.2. Adición de cola poli(A) en el extremo 3’


La cola de poli(A) es un tracto de adeninas que se añade a los extremos 3’ de
las moléculas precursoras de mensajero. Generalmente se añade después de la
secuencia conservada de AAUAAA. Del orden de 15 a 30 ribonucleótidos downstream
de esta secuencia conservada se añade un tracto de alrededor de 200 adeninas, que
recibe el nombre de cola de poli(A).

8
La de las bacterias era 30S.

86
Capítulo 7. Transcripción y maduración del ARN

Esta cola de poli(A) se encuentra en la gran mayoría de las moléculas de ARNm,


pero no en todas. Una excepción importante son los genes que codifican las histonas,
que no poseen esta cola de poli(A), y sufren otras modificaciones alternativas.

¿Cuáles son las funciones de la cola de poli(A)? La primera función es que


estabilizar la molécula de ARN mensajero, protegiéndola de la degradación por
exonucleasas. Otra de sus funciones es que también coopera en el transporte de
moléculas de mensajero del núcleo al citoplasma. Por último, facilita un mejor
reconocimiento de la molécula de mensajero por parte de los ribosomas.

5. Organización discontinua del gen en eucariotas

5.1. Descubrimiento de la organización discontinua del gen

En el año 1977 hubo un descubrimiento que modificó de manera muy sustantiva la


concepción de cómo se transcriben los genes codificadores de proteínas y otros genes. Fue
una modificación muy importante que ayudó al cambio del concepto de gen. Este
descubrimiento se inició en un congreso realizado en Cold Spring Harbor en la ciudad de
New York. Aquí presentaron sus investigaciones dos grupos, uno dirigido por Sharp9 y otro
por Roberts10. Presentaban investigaciones
sobre la maduración de moléculas
precursoras de ARN-mensajero que dan
lugar a proteínas tardías (que se expresan
tardíamente en el ciclo del adenovirus) en
adenovirus (partes altas de las vías
respiratorias). Vieron que cuando
comparaban el ADN del gen con la molécula
resultante de la transcripción, encontraba
que la región codificadora de los genes de
estos adenovirus estaba interrumpida,
separada por regiones no codificadoras
ausentes en el mensajero. Los genes, por
tanto, eran más largos que los mensajeros,
porque había regiones no codificadoras
intercaladas. Se concluye que estas regiones
no codificadoras tendrían que ser
eliminadas de los transcritos primarios para
dar lugar a moléculas de ARN mensajero
maduras funcionales. Estos investigadores
consiguieron el nobel de medicina en 1993.

9
Procedente del MIT.
10
Procedente de un laboratorio de New York.

87
Capítulo 7. Transcripción y maduración del ARN

5.2. Frecuencia y tipos de genes con organización discontinua

Después de esta información, se empezó a trabajar a ver si esto encontrado en


adenovirus también pasaba en eucariotas. En ese mismo verano ya se encuentran
evidencias en eucariotas.

Se utilizó una técnica de hibridar una de las dos cadenas del gen que codifica la
ovoalbúmina en gallina con la molécula de ARN mensajero resultante. Se observa que sólo
algunos segmentos del ADN del gen son capaces de hibridar con el mensajero. Esas son las
regiones codificadoras. Encuentra que existen regiones de ADN que no son capaces de
encontrar representación en el mensajero, y que sobresalen de la estructura molecular en
forma de lazos o bucles. Estas son las regiones no codificadoras que interrumpen las
regiones si codificadoras.

En la molécula precursora de mensajero hay que eliminar las zonas que


corresponden a las regiones no codificadoras.

Las zonas codificadoras de los genes representadas en los mensajeros se denominan


exones, y las zonas no codificadoras, reciben el nombre de intrones. Por tanto, los genes
eucariotas que presentan una estructura con alternancia de exones e intrones reciben el
nombre de genes discontinuos, a veces denominados genes fragmentados o genes en
mosaico.

Después se encuentra en el gen de la metaglobina de conejos y ratones. El siguiente


paso es ver cuán general es la estructura discontinua del gen en eucariotas.

Se llega a las siguientes conclusiones:

➢ La organización discontinua se encuentra en una diversidad de genes nucleares


y de organelas citoplasmáticas (mitocondrias y cloroplastos): genes que
codifican polipéptidos y genes de ARNr y ARNt.

➢ Es frecuente en genes nucleares eucariotas, especialmente en eucariotas


superiores.

➢ Es muy rara en bacterias y fagos.

En mamíferos, el 94% de los genes tienen una organización discontinua.

5.3. Variación del número y tamaño de los intrones y exones


Los intrones explican la
mayor parte de la longitud de
un gen. En humanos, el exoma
explica el 1,2% del ADN total,
y los genes en su globalidad
explicaban el 25 %.

La molécula de ADN se
transcribe continuamente.
Esta molécula precursora de

88
Capítulo 7. Transcripción y maduración del ARN

ARNm, hay que eliminar los intrones. Esto se realiza por un mecanismo denominado
splicing.

6. Modificación de los pre-ARNm. El splicing

El splicing es un mecanismo que implica cortes en la molécula precursora de mensajero,


eliminación de las secuencias correspondientes a los intrones, y empalme o unión de las
secuencias de ARN correspondientes a los exones.

El fenómeno de splicing encierra una gran interrogante. Tenemos la molécula de pre


mensajero, y hay que eliminar los intrones. Pero esta eliminación tiene que ser extremadamente
precisa, y no se puede eliminar un nucleótido de más o de menos, porque, si esto pasa, hay un
desfase de la pauta de lectura, lo que conduciría a un proteína segmentada o no funcional.

¿Cómo se realiza el splicing


para que sea tan preciso? Durante
la evolución se han desarrollado
diferentes mecanismos de splicing.
Atendiendo a los diferentes
mecanismos, se dividen los intrones
en intrones del grupo I (ARN
ribosómico), del grupo II, intrones
del ARN pre-mensajero nuclear, e
intrones de ARN de transferencia.
Estos son los tipos principales de
intrones. Con menos frecuencia,
hay intrones del grupo III,

twintrons, intrones de arqueas... Nos fijaremos en el


splicing en pre-ARNm y en los del grupo I.

Para llevar a cabo el splicing de pre-ARNm, es


importante reconocer dos hechos:

• Secuencias consenso o secuencias


conservadas en el ARN

• Spliceosoma

6.1. Secuencias consenso

Una forma de que el aparto de splicing sea tan preciso es que hay secuencias en el
ARN muy conservadas, para que el sistema las pueda reconocer. Se coge la molécula de
ARN, se secuencia, y ver si hay secuencias conservadas (la selección natural las conserva).
Son las secuencias consenso en los intrones GT-AG. Estos son los intrones mayoritarios en

89
Capítulo 7. Transcripción y maduración del ARN

los genes codificadores de proteínas. Hay otro tipo de intrones que se dan con menos
frecuencia, que son los intrones AT-AC. Nos centraremos en los GT-AG.

¿Qué secuencias consenso se reconocen? Se ve un lugar donador o un extremo 5’


(hay aquí una secuencia muy conservada). Otra secuencia consenso es el extremo aceptor
o extremo 3’. Por último, también está conservada una secuencia llamada el lugar de
ramificación.

Estamos en el ADN. Lo que cabe esperar es que las secuencias de unión entre el
intrón y el exón sean secuencias muy conservadas. La primera y segunda base del extremo
5’ es GT y están en el 100% de los intrones. Está siempre.

Si nos movemos hacia el extremo 3’ del intrón, se encuentra próximo al extremo 3’


del intrón, un lugar que se llama lugar de ramificación. Lo que es absolutamente
conservada es una A (flanqueada por otras bases más o menos conservadas).

En el extremo 3’, la penúltima y última base del intrón, este extremo se llama lugar
aceptor 3’. En el extremo 3’, en el 100% de los casos aparece una AG. Es por esto por lo
que son intrones GT-AG.

6.1.1. Mecanismo de splicing en las moléculas de pre-ARNm de eucariotas


Sharp y Maniatis
desarrollaron un sistema de
maduración in vitro de moléculas
pre-mensajero (en concreto, el gen
de la betaglobina).

Este splicing se realiza


mediante reacciones de
transesterificación, es decir,
mediante rotura y formación de
enlaces fosfodiéster.

La primera etapa del splicing,


un radical OH de la adenina (en el
lugar de ramificación) reacciona con
el extremo 5’ del intrón, rompiendo
el enlace fosfodiéster de unión al
exón. Como resultado de esa
reacción, se forma la estructura
conocida como Lariat.

90
Capítulo 7. Transcripción y maduración del ARN

¿Cómo se establece la reacción entre la adenina y el OH? La adenina está


unida al ribonucleótido anterior por un enlace fosfodiéster. El extremo 5’ de la
adenina está ocupado formando un enlace fosfodiéster con el ribonucleótido
anterior. El extremo 3’ está formando un enlace fosfodiéster con el ribonucleótido
siguiente. Tiene las dos posiciones ocupadas, ¿cómo se une? Se une mediante un
enlace inusual 5’ 2’. Utiliza la posición 2’OH para formar un enlace fosfodiéster.

La segunda etapa, después de la primera etapa, se libera un radical OH en el


extremo del exón E1. Este hidroxilo reacciona con el extremo 3’ del intrón,
rompiendo el enlace fosfodiéster que lo une al exón 2. Se libera el intrón del y se
empalman los exones. El intrón es digerido por nucleasas celulares.

Esta reacción realizada in vitro está incompleta. ¿Son reacciones que hace el
ARN per se o está ayudada? No se realiza sola, requieren de complejos
ribonucleoproteicos, que constituye el spliceosoma11.

6.2. Spliceosoma
Los spliceosomas son complejos ribonucleoproteicos pequeños nucleares, por lo que
están constituidos por ARN y proteínas. Estos complejos se conocen con el acrónimo
ARNpn. Hay cinco complejos ribonucleoproteicos pequeños nucleares, y están formados
por cinco tipos de ARN pequeños nucleares (ARNpn, small nuclear ARN).

Estos tipos de ARNpn se asocian con proteínas. Se han catalogado más de 50


proteínas distintas. Estos ARNpn se llaman así porque son de pequeña longitud (entre 106
y 185 bases). Son muy ricos en uracilo. Hay diferentes tipos de ARNpn: U1, U2, U4, U5, U6.

A esto se le añaden proteínas, formándose, por ejemplo, si está el ARNpn U1 será


RNPpn U1.

Estos complejos contienen moléculas de ARN que tienen complementariedad con las
secuencias conservadas. Por ejemplo, RNPpnU1 se asocia con la secuencia conservada con
el extremo 5’ o donador por complementariedad de bases y/o mediante puentes de
hidrógeno.

6.3. Las ribozimas

Las ribozimas fueron descubiertos por Thomas Cech en 1981 a partir de sus
investigaciones en el protozoo Tetrahymena, y en concreto, estudiando la maduración de
una molécula precursora de ARN ribosómicos que para este precursor tiene un peso
molecular de 26S.

La molécula precursora tiene dos exones: exón izquierdo y derecho. Están separados
por un intrón con una longitud de 413 bases.

11
Complejo que ayuda al splicing.

91
Capítulo 7. Transcripción y maduración del ARN

La eliminación del intrón se iniciaba con la presencia de una guanosina o cualquier


derivado de la misma (empezando la reacción de splicing). Esta guanosina reacciona con el
extremo 5’ del intrón, rompiendo el enlace fosfodiéster que lo une al exón izquierdo.

Como resultado de esta reacción, en el extremo del exón izquierdo se libera un


extremo OH. Este radical reacciona con el extremo 3’ del intrón o lugar aceptor. Esto
provoca la ruptura del enlace fosfodiéster que une al intrón con el exón de la derecha.

El intrón experimenta una cascada de reacciones espontáneas (circularización, se


elimina un fragmento de 15 nucleótidos, se línea, se circula, se elimina otro fragmento y así
sucesivamente).

Thomas demuestra que el


splicing se realiza sin el concurso
de proteína alguna. El propio ARN
inducida por una guanosina
promueve su autosplicing. No hay
spliceosoma. Estamos hablando
de unos enzimas particulares
llamados ribozimas. Son
particulares, porque según este
autor, estos enzimas incumplen
un principio básico de la
bioquímica, ya que las enzimas
proteicas que se conocían
anteriormente tenían la
particularidad de que actuaban
sobre un sustrato para dar un
producto. Estas enzimas realizan
reacciones sobre su propia
molécula.

Este nombre se sigue manteniendo hoy en día, incluso con una concepción
equivocada, porque Altman descubre que existen moléculas de ARN que son capaces de
actuar sobre un sustrato dando lugar a un producto. Lo comprobó en la ARNasa fosfato
(ribonucleasa fosfato). Esta enzima se encarga de madurar moléculas precursoras del
transferente.

Es un complejo ribonucleoproteico constituido por ARN y proteínas, pero Altman


demuestra que, aislando sólo la molécula de ARN del complejo, es capaz de madurar las
moléculas precursoras del transferente. Las moléculas de ARN se están comportando como
verdaderos enzimas, porque actúan sobre un sustrato para dar un producto diferente.

Se comportan como verdaderos enzimas. Puede haber enzimas de naturaleza ácido


ribonucleico.

92
Capítulo 7. Transcripción y maduración del ARN

7. Las unidades de transcripción complejas

Una unidad de transcripción simple es aquella que da lugar a una única molécula de
mensajero, y por tanto a una única proteína.

Las unidades de transcripción complejas son aquellas capaces de producir dos o más
moléculas de ADN mensajero y por tanto dos o más proteínas. ¿Qué tipos hay?

Las unidades de transcripción complejas pueden ser debidas a:

• Dos o más lugares poliadenilables

• Splicing alternativo

• Ambos

7.1. Dos o más lugares poliadenilación

Hay un lugar de iniciación y un lugar de terminación. En esta unidad puede haber


una unidad adenilable, que se denomina A1. Aquí se corta y se añade la cola de poli(A).
Puede pasar que tengamos otra unidad de poliadenilación, en A2. Entonces se origina otra
molécula de ARN-mensajero más larga.

7.2. Splicing alternativo

En este caso sólo hay un lugar poliadenilable. Tiene que haber un lugar de splicing
S1 y otro S2 (la longitud del intrón). Se origina una molécula de ARN-m llevando a cabo el
proceso de splicing (eliminando el intrón y uniendo los exones). Puede haber splicing
alternativo, es decir, que las moléculas precursoras de ARNm tengan más lugares de splicing
S3. Actúa el spliceosoma, y se escoge el lugar de splicing S1 y S3, por lo que se coge la
distancia entre S1 y S3 como un intrón, y se empalman los exones.

93
Capítulo 7. Transcripción y maduración del ARN

«El intrón de un gen es el exón de otro gen». Si hay un splicing alternativo, se pueden
originar dos mensajeros diferentes y dos proteínas distintas. Estas proteínas proceden del
mismo gen, por lo que se
denomina isoformas. ¿Qué
función tienen estas
isoformas en las células?
Cuando se analiza la función
de estas proteínas, se
observa que pueden tener
funciones similares, o
incluso distintas, llegando en
muchos casos a tener
funciones antagónicas. Las
proteínas de la familia SR
juegan un papel
fundamental en el mecanismo regulador del splicing alternativo, que es el que determina
que lugares de splicing hay que elegir para obtener las diferentes isoformas.

7.3. Frecuencia del splicing alternativo genoma humano

➢ Más del 90% de los genes codificadores de proteínas exhiben una organización
discontinua.

➢ Al menos 70% de genes codificadores de proteínas experimentan splicing


alternativo.

➢ Se estima que hasta un 60% de las mutaciones asociadas con enfermedades


humanas afectan al splicing.

94
Capítulo 8
El código genético

La información genética que está encriptada en


la molécula de ADN se hace asequible a la síntesis
proteica o al aparato de traducción mediante el uso
de un código genético almacenado en el mensajero.

1. Características del código


genético

➢ El código genético está escrito de manera lineal


utilizando como letras las bases de los
ribonucleótidos que componen la molécula de
ARNm

➢ Cada palabra del ARNm contiene tres letras


ribonucleotídicas o codón. Cada grupo de tres
ribonucleótidos especifica un aminoácido.

➢ El código no es solapado. Cada ribonucleótido,


en una posición específica en el ARNm, forma parte de un único codón.

➢ El código no tiene comas. Una vez que comienza la traducción del ARNm, los tripletes
se leen por orden y sin ninguna interrupción.

➢ El código no contiene ambigüedades, cada triplete especifica sólo un único


aminoácido, salvo contadas excepciones.

➢ El código es degenerado, en el sentido en que un determinado aminoácido puede ser


especificado por más de un codón.

➢ El código contiene señales de inicio y fin, codones que son señal del inicio y finalización
de la traducción.

➢ El código es casi universal, los seres vivos usan generalmente un solo diccionario
codificante.

95
Capítulo 8. El código genético

2. Naturaleza del código en tripletes

Hay que hacer referencia a Sidney Brenner1. Empezó a estudiar el código genético desde
muy joven. Empezó sus estudios sobre esto en 1960 aproximadamente. Se sabía que había 20
aminoácidos. En el ARN mensajero hay ribonucleótidos. Piensa que cada base da lugar a un
aminoácido, pero:

n = 1 x 41 = 4 posibilidades

n = 2 x 42 = 16 posibilidades

n = 3 x 43 = 64 posibilidades

Brenner postula que el código es de tres nucleótidos: un código genético de tripletes.

Esta idea teórica necesitaba apoyo experimental. Crick Barnett, Brenner & Watts-Tobin en
1961 someten al ADN del fago T4 a una sustancia química que se denomina colorante de acridina
proflavina2.

Se fijan en un locus concreto que es el locus rII. Observan que cuando se incorpora o se
inserta en el ADN un par de nucleótido (uno
en una cadena y otro en la otra), si fuera una
guanina-citosina, se incorporaría en una
determinada zona una citosina en el
mensajero. Cuando se incorpora una
citosina en medio del mensaje, se produce
un desfase de la pauta de lectura, es decir, si
se lee ordenadamente la secuencia en
tripletes, se cambia la secuencia, a partir del
lugar de inserción. Si se introducen dos pares
de nucleótidos, también se produce un
desfase de la pauta de lectura, pero que
cuando se incorporan tres pares de
nucleótidos, el efecto es muy distinto. En la
molécula de mensajero se insertarán tres
ribonucleótidos, se producen alteraciones
de sólo una pequeña parte del mensaje, pero el resto mantiene la pauta de lectura. Con la
inserción de tres pares no hay corrimiento de los tripletes. Esto demuestra la hipótesis de
Brenner.

3. La naturaleza no solapante y sin comas

1
Nobel de medicina en el año 2002 por el desarrollo y muerte celular.
2
Es un mutágeno químico, introduce mutaciones del tipo de inserciones o deleciones de pares
de bases en el ADN.

96
Capítulo 8. El código genético

Si hay un código solapado, los tres ribonucleótidos de un codón pueden intervenir en la


especificación de más de un aminoácido. Por contra, si el código es no solapado, los tres
ribonucleótidos de cada codón especifican un único aminoácido. Diferentes experimentos
llegaron a la conclusión de que el código es no solapado.

El primero es que cuando se estudian mutaciones en los ribonucleótidos de un único codón,


estas mutaciones sólo afectan a un aminoácido. Esto concuerda con la hipótesis de un código
no solapado. Se encontró estas mutaciones en genes para las proteínas de la cubierta del virus
del mosaico del tabaco (TMV), para modificaciones en genes que modifican la hemoglobina
humana y para mutaciones en el gen que codifica la triptófano-sintetasa en E. coli.

¿Hay espacios entre los tripletes, hay comas? Estudios pioneros realizados en el virus del
mosaico del tabaco, concretamente en el gen que codifica proteínas de la cubierta llegaron a la
conclusión de que los codones, los tripletes en la molécula de mensajero, contenían la
información justa para especificar los aminoácidos de la proteína. No había espacio para los
nucleótidos que no formaran parte en los tripletes. Los codones se van interpretando sin comas
unos adyacentes a otros.

Otro dato interesante que aportó Crick es que propuso que para que se realizara la
traducción del mensajero debía haber moléculas que él denominó moléculas adaptadoras. Esas
moléculas adaptadoras por un lado deberían de reconocer el mensajero (los codones de ese
mensajero) y al mismo tiempo debían de llevar unido el aminoácido correspondiente. Fue en
1959, y en el 63 se descubrieron esas moléculas adaptadoras, y se llamaron «transferentes».

Si hubiera estas moléculas adaptadoras, es muy difícil que el


código fuese solapado, porque habría un impedimento físico para
la unión del transferente al mensajero.

Que el código no sea solapado, no quiere decir que no pueda


haber genes solapados.

3.1. Genes solapados

Es posible que un único ARNm tenga múltiples lugares de iniciación para llevar a cabo
la traducción, dando lugar a los llamados «genes solapados». La existencia de estos genes
se descubrió inicialmente en el fago φx174 (genoma circular y de pequeño tamaño, por lo
que tiene que optimizar la poca información genética que tiene). La traducción se puede

97
Capítulo 8. El código genético

iniciar en diferentes AUG. Puede haber codones de iniciación alternativos. Puede haber
genes solapados que pueden dar lugar a 7 proteínas.

4. El desciframiento del código

4.1. Traducción de ARN mensajeros sintetizados “in vitro”

Un avance metodológico que posibilitó el desciframiento del código es conseguir la


traducción de los ARN mensajeros sintetizados in vitro. Para esto fue clave el
descubrimiento de la enzima polinucleótido-fosforilasa (rNDP) que hace posible la síntesis
de ARN mensajero sintético. Fue descubierta por Grunberg-Manago & Ochoa en 1955
(Nobel en 1959). La polinucleótido-fosforilasa puede llevar a cabo la polimerización de ARN
a partir de ribonucleósidos difosfatos. A partir de ribonucleósidos difosfatos se puede llevar
a cabo la síntesis de ARN. También puede ocurrir que moléculas de ARN se degraden debido
a esta enzima y se originen ribonucleósidos difosfatos. En las células bacterianas, la
polinucleótido-fosforilasa produce generalmente la degradación de ARN, porque el
equilibrio está desplazado claramente hacia la degradación.

Para que haya síntesis de


ARN se consigue partiendo de
altas concentraciones de
ribonucleósidos difosfatos,
promoviendo la síntesis de ARN.
Se permite sintetizar ARN in vitro.

El segundo paso, una vez


pudiendo sintetizar moléculas de
ARN in vitro, sería poder traducir
estas moléculas también in vitro. Al poder hacer esto, se podría establecer reacciones entre
codones y aminoácidos. Se desarrollan los sistemas de traducción de moléculas de ARN
mensajero in vitro en un sistema libre de células. Se cogen los ARNm y se añaden en el tubo
de ensayo extractos de células bacterianas (por ejemplo, E. coli), que contienen proteínas
citoplasmáticas, y que están libres de membranas celulares y ácidos nucleicos.

4.2. Homopolímeros y heteropolímeros

En 1961, Nirenberg & Matthaei obtuvieron los primeros mensajeros sintéticos


formados por un único tipo de ribonucleótidos (homopolímeros de ARN). Por ejemplo, se
sintetizan moléculas de ARN con todos uracilos, y se ve que se sintetiza una proteína sólo

98
Capítulo 8. El código genético

con fenilalanina. Esto se hace para los cuatro ribonucleótidos. Ahora se usan
heteropolímeros para seguir descifrando el código.

El estudio de los heteropolímeros lo realizan Nirenberg, Matthaei & Ochoa.

Se usan heteropolímeros de adenina y citosina en una proporción de 1A:5C. La


ribonucleótido fosforilasa sintetiza secuencias de ARN mensajero aleatoriamente.

• Puede haber que sintetice tres adeninas juntas. La probabilidad de esto es (1/6)3
o sea, una probabilidad del 0,4 %.

• La probabilidad de que fuese una citosina y dos adeninas sería (5/6)(1/6)2 =


2,3%.

Estas probabilidades se pueden comparar con las frecuencias de los aminoácidos


resultado de la traducción. Se observan que aminoácidos se sintetiza.

Se observa que hay lisina con una probabilidad inferior menor al 1 %. El codón más
probable serían 3 adeninas. La glutamina se observa que hay un 2% de glutamina, se
aproxima mucho a una citosina y dos adeninas. Y así con todos.

Se ha avanzado que Ochoa dijo cuál era la composición de los codones que codifican
los aminoácidos. Lo que no se pudo determinar es la secuencia de ribonucleótidos de cada
codón.

99
Capítulo 8. El código genético

4.3. La técnica de unión al triplete

Para seguir conociendo cuál era la secuencia, se usó la técnica de unión al triplete3,
desarrollada en 1964 por Nirenberg y Leder, pudiéndose llevar a cabo la asignación
específica de gran parte de los tripletes (50 tripletes de 64).

En esta técnica, se parte de la idea de que in vitro, los ribosomas pueden unirse a
moléculas de ARN sintetizadas in vitro y constituidas por tres ribonucleótidos (la longitud
del codón). El ribosoma se pude poner en contacto con un ARN sintético. Para saber que
aminoácido corresponde, se puede ir ensayando con diferentes transferentes que portan
los distintos aminoácidos. El que se corresponda al codón, formará un complejo ARN-
transferente-ribosoma-mensajero. Si el transferente no reconoce el codón, no forma el
complejo.

¿Cómo se puede identificar este complejo? Se determinó marcando el aminoácido


transferente radiactivamente4 y pasando los tres componentes por un filtro de
nitrocelulosa. Este filtro de nitrocelulosa permite que pasen a través de los poros las
moléculas pequeñas cómo los transferentes, pero quedan retenidas en el círculo las
moléculas grandes cómo el ribosoma. Si se observa radioactividad asociada al filtro de
nitrocelulosa es que el transferente ensayado es el correcto (es el que corresponde al
codón). Si no se observa radiactividad asociada al filtro es que el transferente no es el
correcto y ha pasado a través de los poros del filtro.

Con este procedimiento se determinaron 50 tripletes de 64. Para poder determinar


el resto, se llevó a cabo un estudio de copolímeros repetidos.

4.4. Copolímeros repetidos

3
Secuencia de ARN de tres ribonucleótidos.
4
Marcaje radiactivo del transferente.

100
Capítulo 8. El código genético

El estudio de copolímeros repetidos fue realizado por Khorana den 1964.

Los copolímeros repetidos son moléculas de ARNm sintético, constituidos por cortas
secuencias repetidas muchas veces. Esta molécula de mensajero no tiene un lugar de
iniciación fijo, pudiendo ser interpretado de manera distinta.

Con esta observación, junto con las obtenidas anteriormente, permitió descifrar el
código genético.

5. El código genético

El desciframiento del código


produjo un diccionario genético
con 61 asignaciones codón-
aminoácido. Hay un codón de
iniciación que generalmente es
AUG y especifica un aminoácido
que es la metionina (en la mayor
parte de las cadenas
polipeptídicas empiezan con una
metionina).

Los tres tripletes restantes,


UUA, UAG y UGA no especifican
ningún aminoácido, ya que son
señales de para de la traducción.

El código genético es
claramente degenerado, porque
la gran mayoría de los aminoácidos están especificados por dos, tres o cuatro codones
diferentes. Algunos, como la met, sólo hay un codón, pero, por ejemplo, la prolina tiene 4
codones, y la serina puede venir codificada por seis5.

El aminoácido 21 es la selenocisteína (su codón es UGA), y el aminoácido 22 es la pirrolisina


(UAG). La información de estos dos aminoácidos, por ejemplo, UAG puede ser pirrolisina o
parada de la traducción, y UGA puede ser selenocisteína o de parada.

¿Como hace para distinguir? En la selenocisteína la clave se encuentra en que el codón


UGA está seguido de una estructura en horquilla en bacterias y en eucariotas. Esa horquilla está
en la región 3’UTR. Esta estructura, cuando se los encuentra el aparato de traducción, le da la
señal de que tiene que introducir la selenocisteína y no parar. La estructura secundaria del
ARNm. Para que se incorpore selenocisteína se adquiere la ayuda de una proteína específica.
Para la pirrolisina (sólo en Archaeas) se supone que se necesita algo parecido (una proteína
«ayudadora»)

5
Nivel máximo de degeneración.

101
Capítulo 8. El código genético

5.1. La hipótesis del tambaleo

El código genético era degenerado. Por ejemplo,


en la serina, la primera y segunda base permanecen
invariables, y cambia la tercera. Esto pasa en otros
aminoácidos, como la valina.

Parece ser que las dos primeras posiciones de los


codones son muy constantes, y la tercera, muy
variable, por lo que puede presentar un tambaleo en
su unión con el transferente. El transferente tiene una
región que se denomina anticodón6 que reconoce al
mensajero. Cada transferente, en el extremo 3’ lleva
un aminoácido. La unión de las dos primeras bases
entre codón-anticodón es muy estricta, y en la tercera
se permite cierta ambigüedad.

5.1.1. Reglas de emparejamientos entre las bases codón-anticodón

En el ARN-t se modifican las bases, pudiendo aparecer algunas, como la


inosina.

5.2. Universalidad del código genético

El código genético es casi universal. Hay excepciones. Por ejemplo, en Mycoplasma


capricolum, UGA no es un codón de parada, si no que codifica triptófano. Algunas
excepciones de dan en el ADN mitocondrial, y otras, aparecen en el nuclear (menos).

6
Triplete que se une al codón mediante puentes de hidrógeno.

102
Capítulo 9
Leyes de la herencia: Mendelismo

La herencia biológica ya se observó en la antigüedad ya que se observaba que los


antepasados eran parecidos o más parecidos en sus caracteres a sus progenitores que individuos
no emparentados. Hace 12000 años se empezaron a hacer las selecciones de razas de plantas y
animales.

Mendel propuso en 1985 los principios de la herencia a partir de cruzamientos entre


variedades de la planta del guisante (Pisum sativum). Los experimentos de Mendel constituyen
un ejemplo eminente del uso del método científico en biología y de una excelente metodología.

1. Los experimentos de Mendel

➢ Mendel estudió los patrones


hereditarios para cada rasgo del
fenotipo individualmente, en lugar
de considerar las características de
los organismos en su conjunto.

➢ Seleccionó caracteres discretos


que presentaban dos formas
claramente distinguibles.

➢ Antes de iniciar los cruces entre las


plantas, se aseguró de que éstas
eran variedades puras, es decir, los
descendientes eran siempre
semejantes a sus progenitores con
respecto a un rasgo determinado.

➢ Eligió la planta del guisante porque


presentaba una serie de
características muy ventajosas
para el estudio.

➢ Cuantificó el número de los


descendientes de cada clase en la
progenie de cruces apropiados,
infiriendo a partir de las
proporciones observadas la
presencia de uno o más genes.

103
Capítulo 9. Leyes de la herencia: Mendelismo

2. Ley de la segregación

Se usa el carácter de la planta que es tamaño alta o enana. Se reproducen estos


experimentos para el resto de carácter. Mendel, en la generación parental, partió de variedades
puras (cuando se hacen cruzamientos dentro de cada variedad se reproducen el carácter en la
descendencia).

Al cruzar plantas enanas con altas,


observa que en la descendencia o la primera
generación filial (F1) todas las plantas
presentan el mismo fenotipo: son altas. Esto
es lo que el reconoce como la uniformidad
en la primera generación filial al cruzar
líneas puras.

A continuación, procede a
autofecundar estas plantas. Obtiene la
segunda generación filial o F2. En la F2
obtiene plantas altas y enanas. El carácter
enano de la generación parental que estaba
oculto en F1 vuelve a aparecen en F2.
Contabiliza cuantas plantas son enanas y
cuantas altas, y encuentra que el carácter
alto enana se da en una proporción de 3:1.
Estos experimentos los interpreta Mendel
cómo que existen dos factores mendelianos

104
Capítulo 9. Leyes de la herencia: Mendelismo

a los que ahora se reconocen cómo genes. Hay dos factores mendelianos en los híbridos de la
F1 que se separan o segregan en los gametos, y la observación de que en F1 todas las plantas
sean altas se debe a que el factor mendeliano (o alelo en la actualidad) para alto es dominante
sobre el alelo para bajo que tiene una condición de recesivo. La segregación en los gametos es
un concepto muy importante, ya que por aquella época se pensaba que la herencia se debía a
una mezcla entre los dos materiales genéticos.

El carácter línea pura se puede decir que son homocigóticos, o sea, que tienen el mismo
alelo.

2.1. Contrastación de la ley de segregación

Se puede hacer recurriendo a la prueba de descendencia. Para comprobar si es


homocigótica, se autofecundan, para ver si todas las descendientes tienen el mismo
fenotipo.

Para ver si es heterocigótica, se autofecunda y se ve que va a haber una proporción


fenotípica de 3 a 1 (3 altas por cada enana). Para las homocigóticas enanas se hace lo mismo
(toda la descendencia va a ser enana).

Otra técnica es el cruzamiento prueba, que sirve para reconocer se una planta es
homocigótica o heterocigótica (si tiene un único alelo o contiene 2). Esta técnica consiste
en cruzar los individuos problema con el homocigótico recesivo. Si el individuo que hay que
probar es homocigótico, sólo producirá A, y al cruzarlo con a, sólo dará Aa, o sea, fenotipo
alto (el dominante). Si es un heterocigoto, entonces puede producir dos tipos de gametos
(A y a). Habrá un fenotipo dominante Aa y un fenotipo recesivo aa. Si es un homocigótico,
todos los descendientes serán de fenotipo alto, y si es heterocigótico, habrá una proporción
1:1 los dos fenotipos (alto y enano).

Se puede demostrar en la meiosis. En la anafase I se separan los alelos al estar en


cromosomas. En la anafase II se separan las cromátides hermanas, resultando cuatro
gametos con R, R, r y r.

105
Capítulo 9. Leyes de la herencia: Mendelismo

Si hay recombinación genética entre los cromosomas homólogos (en la profase de la


primera división meiótica). Si las cromátides no hermanas intercambian productos
cromosómicos, se produce intercombinación. En la anafase I no se segregan los alelos.

En la anafase II, los productos son diferentes (en la anterior era igual).

3. Segunda ley de Mendel: ley de transmisión


independiente

La ley de transmisión independiente


postula que genes que codifican
características diferentes se segregan
independientemente unos de los otros.

Tenemos una generación parental P1


con plantas de semillas amarillas y lisas con
plantas de semillas verdes y rugosas. Son
líneas puras, porque son plantas
homocigóticas. Hace cruzamientos entre las
dos variedades, y observa F1. En F1 todas las
plantas tienen semillas amarillas y lisas. El
alelo para liso es dominante sobre el alelo
para rugoso y el alelo amarillo es dominante
sobre el alelo para verde.

106
Capítulo 9. Leyes de la herencia: Mendelismo

Ahora Mendel autofecunda las plantas de F1. Cuando se analiza F2 se concluye que hay 315
plantas liso amarillo, 108 liso verde, 101 rugoso amarillo y 32 rugoso verde. El doble
heterocigótico es un dihíbrido (porque se refiere a dos caracteres). Se observan proporciones
de 9:3:3:1.

3.1. Cruzamiento de un dihíbrido

También se puede hacer la


prueba de cruzamiento con un
doble homocigótico recesivo,
para saber si es heterocigótico o
homocigótico.

El homocigótico recesivo
sólo produce un tipo de gametos.
El heterocigótico produce 4 tipos
de gametos en proporciones
similares. Cuando se cruza con un
homocigótico recesivo se
producen 4 fenotipos en
proporciones idénticas.

107
Capítulo 9. Leyes de la herencia: Mendelismo

Esta ley también se ve reflejada en la meiosis. Puede haber segregación


independiente, aunque los alelos están en el mismo cromosoma, si los alelos están lo
suficientemente alejados.

3.2. Cruzamiento implicando a tres o más diferencias génicas

108
Capítulo 9. Leyes de la herencia: Mendelismo

4. Apéndice de terminología genética

• Gen: secuencia o conjunto de secuencia de ADN (o ARN) responsables de una o más


funciones.

• Locus: localización cromosómica de una secuencia de uno o más nucleótidos. Plural: loci
(lo términos “gen” y “locus” a veces se utilizan indistintamente).

• Alelo: forma alternativa de un locus.

• Homocigoto: organismo diploide o poliploide con alelos distintos en un locus dado


(adjetivo, homocigótico).

• Heterocigoto: organismo diploide o poliploide con alelos distintos en un locus dado


(adjetivo, heterocigótico).

• Genotipo: conjunto de alelos de un individuo para uno o más loci.

• Fenotipo: la expresión del genotipo en un ambiente determinado. Son los atributos


observables de un organismo.

• Alelo salvaje: alelo que codifica el tipo salvaje o silvestre que es el fenotipo frecuente o
estándar del organismo en la naturaleza.

• Alelo mutante: alelo que difiere del alelo presente en el tipo estándar (salvaje o
silvestre).

• Alelo dominante: alelo cuyo efecto en el fenotipo se opone de manifiesto en


heterocigosis, frente a un alelo recesivo.

• Alelo recesivo: alelo cuyo efecto en el fenotipo no se expresa en heterocigosis.

5. Apéndice de nomenclatura genética

• Alelo salvaje: se representa a menudo por una o más letras que corresponden a alelos
mutantes seguido del superíndice “+”, o simplemente por “+”. La primera letra es
mayúscula si el alelo es dominante o minúscula si el alelo es recesivo.

• Alelo mutante: se representa por una o más letras. Con mayúscula si el alelo es
dominante o con minúscula si el alelo es recesivo, con respecto a los otros alelos bajo
consideración.

• Genotipo: se representa con los símbolos de los alelos sin espacio intermedio. En el caso
de dos o más loci se representan el genotipo del primer locus seguido del genotipo del
segundo locus, y así sucesivamente, sin espacios intermedios. Alternativamente, los
alelos de cada genotipo pueden separarse por una barra oblicua (“/”).

• Cruzamiento: se indica el genotipo y/o fenotipo de los individuos que intervienen en el


cruzamiento separados por el signo “x”. A la izquierda del signo “x” se indica,

109
Capítulo 9. Leyes de la herencia: Mendelismo

generalmente, el sexo femenino (símbolo ♀ o ♀♀ si se trata de una o más hembras,


respectivamente) y a la derecha el masculino (símbolo ♂ o ♂♂ si se trata de uno o más
machos, respectivamente). Siguiendo una flecha en sentido vertical, se muestran los
genotipos y/o fenotipos de las descendencias, o progenitores de las generaciones
siguientes.

• Generación parental: generación de individuos progenitores de una serie de


descendencias. Abreviadamente, P o P1.

• Generación filial: generación de individuos descendientes. F1 es la primera generación


descendiente o filial, F2 es la segunda, y así sucesivamente.

110
Capítulo 10
Extensiones del mendelismo

Dentro de la interacción génica, se distinguen dos tipos:

➢ Interacción alélica: interacción entre alelos de un mismo locus, y cuando se mira la


interacción entre alelos de un mismo locus se observarán fenómenos cómo la
dominancia y la letalidad.

➢ Interacción no alélica: interaccionan alelos de loci distintos. Puede haber


interacciones entre loci diferentes. Esta interacción no alélica da lugar al fenómeno
conocido como epistasis.

1. Interacciones alélicas

1.1. Relaciones de dominancia

Existen casos de dominancia entre alelos. En el caso de Mendel, los alelos de un locus
enmascaran el efecto del otro alelo. Un alelo es dominante sobre otro. Depende de los dos
alelos que estean en ese heterocigoto (las relaciones de dominancia dependen de los
alelos). Para un carácter se puede establecer una escala (fenotípica) y establecer las
diferentes relaciones de dominancia que pueden existir.

Si el heterocigótico ocupa una posición intermedia entre ambos homocigóticos, no


hay dominancia de un alelo sobre otro. Si hay desviaciones de esa posición intermedia,
entonces ya hay relaciones de dominancia. Esa dominancia puede ser incompleta o llegar a
ser completa cuando el heterocigoto posee el mismo valor fenotípico que cualquiera de los
dos homocigotos. En los caracteres que estudió Mendel era dominancia completa.

111
Capítulo 10. Extensiones del Mendelismo

Un ejemplo de dominancia parcial o


incompleta es la flor del dondiego de
noche. Si se cruzan plantas homocigóticas
rojas y blancas, la F1 son rosas. En la F2 se
obtienen plantas de color rojo, de color
rosa y de color blanco, en proporción 1:2:1.
El número de genotipos se iguala al número
de fenotipos.

1.1.1. Alelismo múltiple


En las poblaciones, muchos
loci tienen numerosos alelos.
Mendel escogió un sistema sencillo,
pero la realidad es que, si se miran
muchos loci, se observa que estos
tienen múltiples alelos (en la
población, ya que cada individuo
sólo tiene dos). En toda la población
puede haber muchos alelos. El
alelismo múltiple es cuando hay más
de dos alelos en un loci. Como
ejemplo están los grupos sanguíneos, y el sistema AB0. Este sistema está constituido
por una serie alélica de un total de tres alelos. Estos alelos se denominan como IA; IB
y I0. Para un sistema de tres alelos nos encontramos con tres genotipos posibles (tres
homocigóticos y tres heterocigóticos.

Los IA producen un antígeno que se asocia a la superficie de los glóbulos rojos.


I produce un antígeno diferente, mientras que I0 no produce ningún antígeno.
B

El alelo IA y IB son codominantes (si un organismo es heterocigótico, se van a


producir los dos antígenos), mientras que I0 es recesivo (IA y IB son dominantes sobre
él).

112
Capítulo 10. Extensiones del Mendelismo

1.2. Letalidad

Muchos productos génicos son esenciales para la supervivencia de los individuos, y


existen variantes que pueden causar la muerte del individuo en bien en heterocigosis si son
dominantes o en homocigosis cuando son recesivos.

Un alelo puede ser dominante sobre el fenotipo, pero letal se comportan como
recesivos. Ejemplo: color pelaje amarillo en ratones.

Los ratones que tienen un


alelo para el color del pelo
normal (agutí) tienen el alelo A,
que es el alelo de tipo silvestre.
Sin embargo, hay una mutación,
que tienen el alelo AY, que es
dominante y que expresa un
color de pelaje amarillo.

Agutí con agutí, en la F1


dan agutí, y todos sobreviven.
Cuando se cruzan agutí con
amarillo, salen la mitad agutí y la
mitad amarillo, y todos
sobreviven.

Cuando en descendencias
de heterocigóticos existen
desviaciones de 3/4 1/4 nos
sugiere que hay un gen letal. En
concreto, cuando aparecen
proporciones de 2/3 1/3. Este
alelo es dominante para el color
del pelaje, pero es recesivo para
la letalidad.

Este hecho lo encontró un francés en 1905. Hoy en día se tiene una explicación
molecular. En los ratones agutí, en los pelos se forman unas bandas de color amarillo.

¿Por qué AY produce este efecto? En AY hay una selección en el ADN que afecta a la
región reguladora del locus de tal manera que constantemente se expresa el color amarillo.
Es por esto por lo que es dominante el color amarillo.

Es letal porque esta selección implica a un gen adyacente que es el gen Merc, y juega
un papel fundamental en el desarrollo embrionario del ratón. Es por esto por lo que el gen
no sobrevive.

113
Capítulo 10. Extensiones del Mendelismo

2. Interacción no alélica

2.1. Epistasis

La epistasis es la interacción entre alelos de loci distintos. Los alelos de un locus (locus
epistático) interfieren o inhiben la expresión fenotípica de los alelos del otro locus (locus
hipostático)

La epistasis genera alteraciones en las proporciones fenotípicas mendelianas


esperadas en las descendencias de los cruzamientos.

2.1.1. Tipos de epistasis

En la tabla se indica cuando no hay epistasis y esperaríamos una proporción


clásica de 9:3:3:1. Cuando ocurre epistasis suceden alteraciones en las proporciones
fenotípicas.

Por ejemplo, en la epistasis dominante la proporción es 12:3:1, solo tenemos


tres clases fenotípicas. Cuando el locus “a” tiene un alelo dominante, da el mismo
fenotipo que los alelos del locus “b” (hipostático)

En la epistasis recesiva, si el locus “a” tiene los dos alelos recesivos, se va a


producir un mismo tipo independiente de los alelos que contengan el locus “b”. Las
proporciones son 9:3:4.

En otros ejemplos se dan alteraciones de proporciones fenotípicas y estas


alteraciones conllevan a una reducción de las clases fenotípicas.

114
Capítulo 10. Extensiones del Mendelismo

3. Pleitropía

La Pleitropía se presenta cuando un único gen afecta a varios fenotipos (efectos


pleiotrópicos). Los vamos analizar estudiando el gen PKU en humanos.

Este gen se localiza en el cromosoma 12


y produce una enfermedad que se denomina
la fenilcetonuria. Se caracteriza por una
acumulación de fenilalanina en sangre. Se
puede entender porque este gen codifica
una enzima que se denomina fenilalanina
hidroxilasa. Ésta actúa sobre la fenilalanina y
la pasa a tirosina. Si está mutado no es capaz
de realizar esa conversión y por tanto se
acumula la fenilalanina en sangre.

1. Lo que se produce es que se acumula


fenilalanina en sangre.

2. Mutaciones en el gen provocan un


retraso mental.

3. Asociado con el retraso mental se


observa que los individuos con esta
enfermedad tienen un tamaño de
cabeza reducido.

4. Color de cabello más claro, porque la


tirosina interviene en el color del
pelo.

Esta enfermedad se puede actuar sobre ella en neonatos realizando pruebas de sangre y
test bioquímicos para detectarla. Si se diera el caso, se le da una dieta baja de fenilalanina y
entonces el niño se desarrolla normalmente.

5. Genética y ambiente. Relaciones entre el genotipo y


el fenotipo

No todo se encuentra en los genes. No hay nada fijo en los genes. En la mayoría de los casos
requiere esa combinación del ambiente con los genes.

➢ El genotipo es una característica de un organismo individual que permanece


esencialmente fijo o constante (salvo mutaciones) a lo largo de su vida. Por el
contrario, la mayoría de los fenotipos cambian continuamente a lo largo de la vida del
individuo, dependiendo la dirección de cambio de la sucesión de ambientes que
experimente el individuo.

115
Capítulo 10. Extensiones del Mendelismo

➢ Los individuos heredan de los progenitores los genes no su fenotipo.

➢ Dos individuos cualesquiera comparten el mismo genotipo si tienen el mismo conjunto


de loci y alelos. Dos individuos cualesquiera comparten el mismo fenotipo si se parecen
el uno al otro de alguna forma visible.

➢ Las relaciones entre el genotipo y el fenotipo son muy complejas.

➢ El fenotipo es el resultado, en mayor o menor medida, de las interacciones entre los


genes y el ambiente. En los caracteres con una base genética compleja también
influyen en el fenotipo las interacciones entre los genes.

➢ En muchas ocasiones el efecto del genotipo en el fenotipo no es fijo sino relativo. Un


mismo genotipo puede comportarse de una forma en un ambiente y de otra forma
muy diferente en otro ambiente.

➢ La relación genotipo – fenotipo no tiene por qué ser unívoca en cualquiera de las
direcciones. Así, distintos genotipos pueden dar lugar al mismo fenotipo y, viceversa
distintos fenotipos pueden deberse a un único genotipo.

6. Penetrancia y expresividad variable

6.1. Penetrancia

La penetrancia es
el porcentaje de
individuos que
manifiestan el efecto de
una mutación. Una
mutación puede tener
distintos efectos
dependiendo de su
porcentaje de
penetrancia ya que el
ambiente influye. Hay
casos de penetrancia
completa (100%).

Siempre que haya una mutación, va a causar su efecto en el fenotipo.

En estudios prácticos, la penetrancia del 100% de la mutación es poco casual. En la


mayor parte de los casos, la penetrancia es incompleta. La mayor parte de la enfermedades
tienen penetrancia incompleta.

116
Capítulo 10. Extensiones del Mendelismo

6.2. Expresividad variable


La expresividad variable es el grado en el cual se manifiesta el efecto de la mutación
y también la mayor parte de la mutación tiene penetrancia incompleta y esta expresividad
variable.

En una enfermedad hay una probabilidad que tenga una mutación que no se exprese
o sí, y luego, puede expresarse más fuerte o más débil.

En conclusión, hay interacción genética de los genes con el ambiente.

Un ejemplo lo tenemos de Lobe en Drosophila melanogaster. Afecta al tamaño del


ojo habiendo una mayor o menor reducción de las facetas. El gen es dominante y tiene una
penetrancia del 75%.

Esta mutación tiene expresividad variable. Puede producir diferencias muy claras en
la reducción del tamaño del ojo. En este caso vemos como los dos fenómenos están
relacionados.

Otro ejemplo lo tenemos en la polidactilia en humanos.

Es una característica autosómica


dominante y es debida en mutaciones de
un gen del cromosoma autosomal 14.
Cuando se presenta provoca la presencia
de dedos de la mano y del pie extra. Las
dos manos de un mismo individuo hay
un dedo extra y en la otra mano la tiene
normal. Esto se debe a que cambios de
la expresión de este gen durante el
desarrollo.

7. Heterogeneidad genética

La heterogeneidad genética la podemos dividir en alélica y no alélica o del locus.

➢ Heterogeneidad alélica: se produce cuando mutaciones en el mismo locus ocasionan


fenotipos diferentes. Depende en qué posición del gen podemos tener fenotipos
diferentes.

• Distrofias musculares de Becker y Duchenne


Gen recesivo en el cromosoma X (Xp21.2-p21.1).

Este gen se denomina DMD (gen más grande encontrado: 2,4 Mb). A nuestras células
producir el gen tarda horas y horas. Este locus codifica una proteína que es la
distrofina. Ésta es una proteína fundamental en la estructura y dinámica de las fibras
musculares. Si se producen mutaciones, se produce alteraciones de la estructura del
músculo y por tanto su función, provocando distrofia. La más común en humanos es
la distrofia de Duchenne.

117
Capítulo 10. Extensiones del Mendelismo

En otra parte del gen se pueden producir otras mutaciones que produce la distrofia
muscular de Becker que tiene un efecto más suave que el de Duchenne.

➢ Heterogeneidad no alélica o del locus: mutaciones en diferentes loci (no alelos) causan
enfermedades aparentemente parecidas. Este fenómeno es muy frecuente en las
poblaciones humanas.

Generalmente se puede proceder a un gen que esté asociado a una enfermedad. Ya es


un gen candidato en la diagnosis de la enfermedad.

• Retinitis pigmentosa
Gen autosómico dominante (8q12.1); gen autosómico recesivo (14q31.3); gen en el
cromosoma X (Xp11.4), etc.

Este fenómeno es muy frecuente en las poblaciones humanas.

Generalmente se puede proceder a un gen que esté asociado a una enfermedad. Ya


es un gen candidato en la diagnosis de la enfermedad.

8. Fenocopias

Un factor ambiental puede


ocasionar un fenotipo muy semejante a
un fenotipo controlado genéticamente.

Como ejemplo tenemos la sordera.


La infección de una madre durante la
gestación por el virus de la rubeola
puede causar una sordera en el feto,
aunque ésta puede ser causada,
también por una serie de genes
defectuosos.

9. Interacción genotipo ambiente

Si unas plantas crecen en un medio seco y en uno húmedo con dos genotipos AA y aa, y
estas plantas se pesan, los resultados que se obtienen bajo estas condiciones son que los
recesivos tiene un mayor peso en el medio húmedo.

La relación entre ambos genotipos no es la misma en un ambiente seco que en uno


húmedo. En uno seco, las plantas AA tienen un mayor peso, sin embargo, tienen un menor peso
relativo en un ambiente húmedo.

Un genotipo no se convierte bien en todos los ambientes. En uno sí, pero no tan bien en
otro. Es lo que se llama interacción genotipo-ambiente.

118
Capítulo 10. Extensiones del Mendelismo

En la gráfica, las cruces no son paralelas por lo que hay interacción con un efecto relativo
de las mutaciones.

119
Capítulo 10. Extensiones del Mendelismo

120
Capítulo 11
Base cromosómica de la herencia y
ligamiento al sexo

1. Teoría cromosómica

El inicio del estudio de los caracteres ligados al sexo se pudo comenzar a principios del siglo
XX cuando se reconocieron el cromosoma X y cromosoma Y, y cuando se llegó a reconocer la
teoría cromosómica de la herencia (Sutton y Boveri). Llegaron a la conclusión de que los genes
están en los cromosomas ya que encuentran un paralelismo en el comportamiento de los genes
y los cromosomas durante la meiosis.

Mendel decía que había dos factores llamados genes. Se dan cuenta que uno de los
cromosomas procede de un progenitor y el otro cromosoma del otro progenitor. Los dos genes
mendelianos segregan durante la meiosis según Mendel.

Mencionar que los cromosomas también segregan durante la meiosis.

2. Herencia ligada al sexo

2.1. Características

121
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

➢ Patrón de herencia cruzada: se da en genes ligados al sexo con un efecto recesivo.

➢ Patrón de herencia no recíproco

➢ Los caracteres con un patrón de herencia recesivo se manifiestan con mayor


frecuencia en el sexo heterogamético.

2.2. Los experimentos de Morgan

El investigador que comenzó a profundizar en la herencia ligada al sexo fue el


científico Morgan. Determinó el patrón de la herencia ligada al cromosoma X estudiando
la herencia del carácter ojos blancos en Drosophila.

Empezó a
realizar cruzamientos
con una cepa hembra
de tipo salvaje1 (ojos
rojos) y con machos de
ojos blancos.

La primera
generación da a todos
los individuos de tipo
salvaje. Luego analiza
los cruzamientos entre
estos individuos de F1
para obtener la
segunda generación.

A partir de las descendencias observadas en diferentes cruzamientos observó que ¾


de los individuos mostraban el carácter salvaje y ¼ tenían los ojos blancos. Cuando mira el
sexo de la descendencia ve que todas las hembras son de tipo salvaje, pero en los machos
la mitad eran de tipo salvaje y la otra mitad eran de ojos blancos.

Morgan interpretó de que el locus para ojos blancos estaba ligado en el cromosoma
X.

2.2.1. Interpretación genética de los cruzamientos y descendencias para el


carácter color de ojos
El alelo recesivo siempre se manifiesta al ir ligado siempre al sexo, entonces
en los heterogaméticos siempre se presenta el recesivo.

El progenitor macho transmite el carácter ojos blancos a las hembras hijas, no


a los machos hijos ya que les transmiten el cromosoma Y. Las hembras, por lo tanto,
son las que transmiten ese carácter a los hijos descendientes.

1
Carácter dominante frente a ojos blancos.

122
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

Es por lo que se conoce como patrón de herencia cruzado2.

El patrón de herencia ligada al X no es recíproco. Variando el sexo de los


cruzamientos se obtienen descendencias en las que el carácter se manifiesta en
distintas proporciones en los dos sexos.

2
No ocurre en los autosomas.

123
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

2.3. Tipos de herencia ligada al sexo3

➢ Loci en el cromosoma X

➢ Loci en el cromosoma Y (caracteres holándricos)4

➢ Loci en los cromosomas X e Y (seudoautosómicos)5

Cuando comparamos el
cromosoma Y encontramos loci que
pueden encontrarse en el cromosoma
X o Y.

Las regiones seudoautosómicas


están localizadas en los finales de los
cromosomas.

Al final del brazo corto del


cromosoma X y al final del brazo corto
de Y se encuentra una región
cromosómica compartida que es la
región denominada seudoautosómica
1 o PAR1. También es la región más
importante porque se origina siempre
sinapsis en la meiosis y
entrecruzamientos obligados. Estos
entrecruzamientos son obligados
porque determinan una correcta
segregación de los mismos en meiosis.

Si vamos al extremo del brazo


largo de X y en la región telomérica del
brazo largo de Y existe otra región
seudoautosómica que es PAR26.

Si eliminamos en Y las regiones seudoautosómicas, el resto del cromosoma Y es lo


que se denomina como MSY. Este concepto hay que matizarlo en el sentido de que estos
loci frecuentemente tienen genes con cierto grado de homología con los genes del
cromosoma X (por ejemplo, SMCX en el cromosoma X y SMCY en el Y).

Regiones cromosómicas del Y derivan del cromosoma X. Hay cierto grado de


parentesco. Muchos son funcionales, pero, otros derivan a copias no funcionales y se
denominan seudogenes (genes falsos).

Otros de los genes importantes se localizan próximos a la región seudoautosómica


PAR1 que es el gen SRY. Este gen es el locus determinante del sexo. En la determinación
del sexo en humanos están implicados genes del cromosoma Y, del cromosoma X y genes

3
El término “ligado al sexo” se refiere a los loci que se localizan en el cromosoma X.
4
Su base genética reside en el loci del cromosoma Y.
5
Falsamente autosómicos.
6
Tenemos loci que están compartidos.

124
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

de autosomas, pero el que inicia el paso del determinismo del sexo es SRY. En etapas
tempranas del desarrollo promueve que el tejido gonadal indiferenciado conduzca a la
formación de testículos. Se forman hormonas como la testosterona y la hormona inhibidora
de los conductos de Müller en la mujer. Lo que hace SRY es producir un factor de
transcripción que se une a regiones promotoras activando la expresión de otros genes que
intervienen en el dimorfismo sexual.

En el brazo largo de Y la mayor parte es heterocromatina constitutiva.

3. Análisis de genealogías

En determinados organismos los


patrones de herencia son más difíciles
de determinar al no poder realizar
cruzamientos controlados y/o producir
descendencias poco abundantes.

En estos organismos, la
determinación de los patrones
hereditarios de los caracteres se basa
en el estudio de genealogías.

Cada individuo se indica por orden


de nacimiento y las generaciones se
indican con números romanos,
mientras que la orden de los individuos
se indica en números árabes.

3.1. Genealogía típica de la herencia dominante ligada al X

➢ Los machos afectados transmiten la condición a todas sus hijas y no lo hacen


a ninguno de los descendientes machos.

➢ Hembras heterocigóticas afectadas cuando se cruzan con machos no


afectados, transmiten a la mitad de sus hijos, tanto machos como hembras.

125
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

3.2. Genealogía típica de la herencia recesiva ligada al X

➢ Un varón porta el gen recesivo y muestra el efecto de dicha mutación al ser


homocigóticos para esa mutación.

➢ En la generación II no existe ningún individuo afectado, pero todas las hembras


son portadoras de la mutación. Son heterocigóticas para esa mutación. Los
machos no portan la variación porque portan el cromosoma X de la madre.

➢ La generación siguiente se observa que solo los machos pueden mostrar el


carácter y los hacen con una probabilidad de ½. Ninguna hembra resulta
afectada.

Un ejemplo de herencia recesiva ligada al X es la herencia de la hemofilia en el árbol


genealógico de la reina Victoria de Inglaterra.

La hemofilia es un problema de la coagulación de la sangre. Se debe a que genes que


codifican factores de coagulación de la sangre tienen alteraciones en su secuencia.

Existen dos tipos de hemofilia, A y B. Los de la hemofilia A tienen mutaciones en el


gen que codifica el factor de coagulación VIII y no pueden coagular la sangre. En la hemofilia
de tipo B está alterado otro gen que codifica otro factor que es el IX.

126
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

Existen otros dos fenómenos que son rasgos que tienen un modo de herencia
limitado por el sexo, aunque los genes implicados están en ambos sexos. Por ejemplo,
serían genes implicados en el desarrollo de los ovarios o mamas, o implicados en la creación
de leche en mamíferos, o de la creación de esperma.

Serían como genes que tienen una penetrancia 0.

Otros son los caracteres influidos o controlados por el sexo. Se dan en ambos sexos,
pero más en uno que en otro. Un carácter típico sería la calvicie en humanos. El gen para la
calvicie humana es dominante en hombres y recesivo en mujeres. En mujeres produce que
el pelo sea más endeble.

4. Apéndice. Mecanismos de determinación del sexo

4.1. Mecanismos genéticos

➢ Cromosomas sexuales: par de cromosomas heteromórficos o cromosomas


sexuales

Ejemplo 1: el sistema XY en humanos. Los individuos con el genotipo X0 son


mujeres (síndrome de Turner). Los individuos con genotipo XXY, XXXY, XXXXY
(síndrome de Klinefelter) son varones.

Ejemplo 2: el sistema ZW es idéntico al sistema XY con la excepción que los


machos son homogaméticos y las hembras heterogaméticas (aves, algunos
peces y polillas).

➢ Equilibrio génico: relación entre cromosomas sexuales y autosomas

Ejemplo: en Drosophila, cuando la relación X:A es 1,0 (hembra normal) o


mayor los individuos son hembras. Cuando la relación X:A es 0,50 (macho
normal) o menor los individuos son machos. Si la proporción es 0,67, los
individuos son intersexo.

➢ Grado de ploidía: los sexos vienen determinados por su grado de ploidía.

Ejemplo: en muchos himenópteros (abejas, hormigas, avispas) se da el


fenómeno de haplodiploidía. Los machos son haploides (óvulos no
fecundados) y las hembras diploides (óvulos fecundados)

➢ Efectos de un solo gen: el sexo viene determinado por un único alelo o por
alelos múltiples no asociados con cromosomas heteromórficos.

Ejemplo: si los individuos de la avispa parásita. Bracon hebetor, son


homocigóticos para los alelos de un locus dado se desarrollarán como machos,
y si son heterocigóticos lo harán como hembras.

127
Capítulo 11. Base cromosómica de la herencia y ligamiento al sexo

4.2. Mecanismos dependientes del ambiente


En algunos organismos el sexo viene determinado total o parcialmente por factores
ambientales.

Ejemplo: en algunos reptiles (tortugas y cocodrilos) el sexo viene determinado por la


temperatura de incubación de los huevos.

128
Capítulo 12
Ligamiento y recombinación

1. La recombinación

La recombinación es un mecanismo genético común en todas las formas de vida. Es un


mecanismo mediante el cual se intercambian secuencias de ADN entre cromosomas o moléculas
de ADN distintas.

La recombinación es un mecanismo fundamental generador de variabilidad genética. Hay


que reconocer que la mutación es la última fuente de variabilidad genética, pero la
recombinación es un mecanismo amplificador de la variabilidad porque utiliza múltiples
combinaciones de las mutaciones dando posibilidades ilimitadas de cambio genético.

Para ver la capacidad que tiene de cambio genético miramos todas las secuencias de ADN
y en cada par de nucleótidos la posibilidad de cambio son cuatro bases.

Si se recombinan se producen varias combinaciones resultando un número mayor que el


número de átomos del universo conocido, eliminando la materia oscura.

El mecanismo de recombinación fue descubierto por Morgan. Ya había realizado


cruzamientos con un solo carácter y se aventuró a realizar cruzamientos partiendo de más de
un gen. Para ello se realizó cruzamientos controlados usando dos loci al mismo tiempo y es lo
que se conoce por cruzamiento de dos puntos.

Se hizo cruzamientos para cuerpo amarillo y ojos blancos en Drosophila melanogaster. Son
genes recesivos ligados al sexo.

Hace un primer cruce partiendo de una hembra homocigótica con fenotipo cuerpo amarillo
y ojos blancos y la cruza con un macho de tipo salvaje. A partir de este cruzamiento se obtienen
hembras heterocigóticas y machos de cuerpo amarillo y ojos blancos. Éstos se cruzan entre sí y
se observa que en un 98,7% de los descendientes contienen fenotipos presentes en los
progenitores.

Sin embargo, observa unas clases nuevas1 (1,38%) donde los machos son simplemente de
ojos blancos o solo de cuerpo amarillo y en hembras ocurre lo mismo.

Morgan imaginó que esto sucedía porque los alelos para cuerpo amarillo y ojos blancos se
separan durante la meiosis.

El siguiente paso fue realizar un cruzamiento donde intervienen una hembra de ojos
blancos y otro locus cuya mutación recesiva produce alas pequeñas, y se cruza con un macho
salvaje. Se observa que en F2 hay tipos parentales, machos o hembras, que son salvajes para los

1
Fenotipos y genotipos nuevos.

129
Capítulo 12. Ligamiento y recombinación

dos loci, o mutantes para los dos. También observa tipos nuevos, tipos recombinantes como
individuos con alas pequeñas y ojos blancos.

Lo que llama la atención comparando los dos cruzamientos, es que los porcentajes de tipos
recombinantes son muy distintos (1,3% y 37,2%).

Se concluyó que:

• Los alelos se separan durante la meiosis.

• Se obtiene porcentajes distintos de tipos recombinantes.

1.1. Quiasmas y entrecruzamientos

La separación de alelos en meiosis se da respuesta mediante observaciones


citológicas en los cromosomas en la metafase de la primera división mitótica.

Los cromosomas tienen zonas en los cuales se entrelazan. Estos entrecruzamientos


es lo que se denominan quiasmas. Estos quiasmas podrían representar zonas de
intercambio genético entre los cromosomas que darían lugar a gametos recombinantes2.

2
Constitución genética diferente a los parentales.

130
Capítulo 12. Ligamiento y recombinación

Morgan usó el término de


entrecruzamiento para describir
este intercambio físico entre los
cromosomas que da lugar a la
recombinación.

2. Ligamiento

El ligamiento es la transmisión conjunta de los alelos de distintos loci que residen en un


mismo cromosoma.

Contraponemos el término de ligamiento


al de segregación independiente.

En la segregación independiente serían


dos loci (A y B) bialélicos en diferentes pares
de cromosomas homólogos. Cuatro clases
gaméticas (AB, Ab, aB, ab) segregan al azar ya
que están en diferentes cromosomas.

En el ligamiento completo dos loci (A y B)


bialélicos están en un mismo par de
cromosomas homólogos. No hay quiasmas por
lo que tienden a segregar conjuntamente. Los
gametos mantendrán las mismas
combinaciones alélicas parentales.

Si no hay intercambio físico habrá la


misma combinación que los parentales. Se
dicen que tienen un ligamiento completo
porque tienden a segregar conjuntamente.

2.1. Ligamiento parcial

A veces el ligamiento es parcial porque los loci están suficientemente separados del
cromosoma como para que se den con cierta probabilidad entrecruzamientos entre ellos
durante la meiosis.

En la profase de la primera fase meiótica puede haber entrecruzamientos físicos que


se dan entre cromátidas no hermanas de cromosomas no homólogos. Como resultado de
ese entrecruzamiento, se obtienen productos nuevos que son gametos llamados
recombinantes.

Existen dos cromátidas que permanecen invariables (clases parentales) por lo que se
observan dos gametos sin entrecruzamientos que mantienen las combinaciones
parentales.

131
Capítulo 12. Ligamiento y recombinación

No obstante, se observa la formación de dos gametos con combinaciones nuevas.


Estos dos gametos son recombinantes, tienen combinaciones diferentes a los parentales.
Dos de las cromátidas participan en el entrecruzamiento.

La frecuencia de recombinación máxima entre dos loci es del 50%.

La recombinación
solo es posible en los doble
heterocigotos. Cuando los
alelos dominantes están en
un mismo cromosoma se
denomina acoplamiento.

Se siguen teniendo
heterocigotos, pero los
alelos dominantes no se
encuentran en el mismo
cromosoma.

Si no se tiene un
doble heterocigoto, solo es
heterocigoto para el locus
a/A. Sí puede haber
entrecruzamiento físico,
pero no se producen
combinaciones nuevas. Es
decir, excepto en los dobles
heterocigotos se producen
entrecruzamientos, pero
no combinaciones nuevas.

2.2. Frecuencia de recombinación, distancia genética y mapas


genéticos

Loci más distantes tienen más


probabilidad que se origine un
entrecruzamiento que loci más
próximos en el cromosoma.

Al estar más distantes es más


probable que haya entrecruzamiento
que si estuvieran más próximos.

Los recombinantes no se
producen al azar. Hay zonas donde
aumenta la recombinación.

Morgan tenía consigo un


estudiante (Sturtevant) que sugirió
que ese porcentaje de recombinantes

132
Capítulo 12. Ligamiento y recombinación

podía utilizarse como indicador cuantitativo de su distancia genética entre los loci en el
cromosoma. De esta manera se podrían elaborar mapas genéticos.

3. Mapas genéticos o mapas de ligamiento

Alfred Sturtevant elaboró el primer mapa genético a partir de las frecuencias de


recombinación entre loci localizados en el cromosoma X de Drosophila melanogaster. Parte de
diferentes loci construyendo dobles heterocigotos.

Las frecuencias de recombinación nos indican la distancia. Cuanta más frecuencia, más
distante, cuanta menos frecuencia más próximos.

La unidad de mapa (um) es la distancia entre loci para la cual uno de cada 100 productos
meióticos es recombinante. A esa unidad de mapa se expresa en centimorgan (cM), que
equivale a una frecuencia de recombinación del 1%. De 100 gametos uno es recombinante. Las
distancias de mapa son aditivas, o más bien aproximadamente aditivas.

3.1. Los dobles entrecruzamientos

Esta pequeña diferencia en las distancias de mapa es debida a que la frecuencia de


recombinación estimada a partir de un cruzamiento de dos puntos tiende a infraestimar la
frecuencia de los dobles entrecruzamientos o entrecruzamientos múltiples.

133
Capítulo 12. Ligamiento y recombinación

Cuando hay dobles entrecruzamientos, la combinación alélica es la misma que los


paternos y en este caso estaríamos infraestimando la frecuencia de recombinación. Esto es
lo que explica el desajuste de la distancia.

Cuanto más lejos estean los loci, hay más probabilidad de doble entrecruzamiento.

Esto se resuelve elaborando y recurriendo al cruzamiento de tres puntos, es decir,


cruzando tres loci distintos, no dos.

3.2. Cruzamiento de tres puntos

Se denomina entrecruzamiento de tres puntos al análisis de la segregación de tres


loci ligados cada uno con dos alelos. Con el cruzamiento de tres puntos algunos de los
dobles entrecruzamientos pueden detectarse y las distancias de mapa son más exactas.

En la generación parental se parte de tres loci recesivos. Hembras homocigóticas


para los tres alelos y se cruzan con un macho con tres loci salvaje.

En la generación F1 se obtienen hembras triples heterocigotas. Éstas se cruzan con el


triple recesivo para reconocer los fenotipos y los genotipos. Entonces puede experimentar
entrecruzamiento y recombinación.

➢ Si no se experimenta entrecruzamiento, los gametos conservan la combinación


alélica. Son gametos no recombinantes.

134
Capítulo 12. Ligamiento y recombinación

➢ Se puede recombinar el locus Y y W Ex. Son recombinantes en la zona 1.

➢ El entrecruzamiento también puede establecerse entre W y Ex Y. Se le denomina


zona 2. Tenemos clases recombinantes en la zona 2.

➢ Puede haber un doble entrecruzamiento, habiendo un entrecruzamiento entre la


zona 1 y la zona 2. Cuando hay doble entrecruzamiento se cumple una propiedad:
solo cambia la posición de los alelos del locus B o del locus central con respecto a los
gametos parentales.

Es menos posible que se dé un doble entrecruzamiento que un entrecruzamiento


sencillo.

3.2.1. Ejemplo de cruzamiento de tres puntos en la especie Drosophila


melanogaster.

3.3. Coeficiente de coincidencia e interferencia

Se denomina coeficiente de coincidencia (CC) a la relación existente entre la


frecuencia observada y esperada de dobles recombinantes (FDRo y FDRe respectivamente).
La FDRe es la probabilidad de que un entrecruzamiento (quiasma) en una región
cromosómica no interfiera en la otra región cromosómica. Si no hay ningún quiasma que
interfiera el resultado, es el producto de las probabilidades.

CC = FDRo / FDRe

135
Capítulo 12. Ligamiento y recombinación

El entrecruzamiento en una región


cromosómica puede hacer disminuir la
probabilidad de que se produzca un
entrecruzamiento en una región
cercana. En este caso se da el fenómeno
denominado interferencia (I).

La interferencia se cuantifica
restando el valor del CC de la unidad.

Si no hay interferencia, CC = 1; si
hay interferencia, CC > 1; si no interfiere,
I = 0, CC = 1, I = 1 – CC.

3.4. Función de mapa


La función de mapa da la relación entre la distancia de mapa y la frecuencia de
recombinación.

Es una curva simoidal.

Existen dos funciones de mapa:

• Haldane (no asume interferencia)


w = -1/2 ln (1-2ϴ)

• Kosambi (asume interferencia)


w = ¼ ln ((1+2ϴ) / (1-2ϴ))

w = distancia de mapa, ϴ = frecuencia de recombinación

136
Capítulo 12. Ligamiento y recombinación

4. Apéndice. Notación para cruzamientos con


ligamiento

137
Capítulo 12. Ligamiento y recombinación

138
Capítulo 13
Herencia extranuclear

1. Genoma nuclear y genoma mitocondrial

El ADN de una célula eucariota está organizado en un genoma nuclear y en un genoma


extranuclear o citoplasmático que pertenece a los organelas de las mitocondrias y cloroplastos.
Tomaremos como ejemplo el ADN mitocondrial humano.

Las mitocondrias ejercen una función esencial para la vida de las células. En las
mitocondrias tiene lugar el proceso de fosforilación oxidativa mediante el cual se oxidan los
nutrientes de la célula para dar lugar
ATP (adenosín trifosfato). El ATP es el
principal dador de energía de las células,
aunque no es el único, pero sí el más
eficiente. La mitocondria genera
entorno al 90% del ATP por lo que son
fundamentales como dadores de
energía.

Típicamente las células contienen


centenares de mitocondrias y en cada
mitocondria contiene del orden de 2 a
10 moléculas de ADN mitocondrial que
abreviadamente denominamos ADNmt.

En una célula humana existen un


número variable de moléculas de ADN.
Puede llegar a ser de 0 moléculas de
ADNmt como en las células epidérmicas
diferenciadas, pero típicamente oscilan entre 1000 y 10000 moléculas de ADNmt por célula. El
número más elevado se encuentra en los óvulos donde el número de moléculas de ADNmt lo
podemos cifrar en alrededor de 100000.

2. El genoma mitocondrial humano

El ADN mitocondrial humano es una molécula de ADN generalmente de doble cadena que
tiene una longitud de 16569 pb (≈ 17Kb). Es una molécula pequeña, de un tamaño promedio de
un gen codificador de proteínas del genoma nuclear.

139
Capítulo 13. Herencia extranuclear.

Una forma de caracterizar el ADNmt es analizar el contenido del guanina y citosina. Este
contenido lo podemos reconocer en base a la técnica de gradiente de densidad de ClCs. Cuando
la célula tenga más guanina y citosina irá al fondo del tubo. Si cogemos ADNmt tendremos una
banda que equivale al 44% guanina y citosina.

Si se cogiera todo el ADN mitocondrial y nuclear se vería que el ADN nuclear bandea por
encima del ADNmt en un 41% de guanina y citosina. Por lo tanto, se deduce que el ADNmt tiene
un mayor contenido de guanina y citosina.

El ADNmt también bandea en modo de una banda satélite. El ADN satélite está en bandas
satélites, pero no todas las bandas satélites son ADN satélite. Por el contenido de guanina y
citosina podemos separar el ADNmt.

Hay dos cadenas de ADN y difieren en su secuencia de bases porque una de las dos cadenas
hay preponderancia de guaninas. A esta cadena se le denomina cadena pesada o cadena H.

La otra cadena del dúplex es rica en la base citosina y se le denomina cadena ligera o cadena
L (también cadena púrica).

El ADNmt se replica con una enzima específica que es el ADN polimerasa ɣ. El ADN
polimerasa ɣ lo inicia a partir de dos orígenes de replicación. Existen secuencias específicas que
sirven como orígenes de replicación. Tiene un origen para la cadena pesada (oH) y hay otro para
la cadena ligera (OL). En estos orígenes es donde se comienza la replicación del ADNmt.

La replicación se realiza mediante un mecanismo llamado desplazamiento de cadena. El OH


se utiliza para sintetizar una cadena H hija. Viene el ADN polimerasa y sintetiza y utiliza la cadena
L como molde para sintetizar la cadena H. Cuando se replica la cadena H se sintetiza un
fragmento de ADN extra que da lugar a un tríplex (fragmento de triple cadena). Este fragmento
se denomina ADN 7S o lazo D.

Para la síntesis de la cadena L se desplazaría la cadena L y se utilizaría la cadena H como


molde para sintetizar la cadena L.

140
Capítulo 13. Herencia extranuclear.

2.1. Contenido genético

El ADNmt humano contiene 37 genes, 28 de los cuales están codificados por la


cadena H y los 9 restantes por la cadena L. Utiliza la información de ambas cadenas para
codificar productos. Las cadenas del dúplex tienen información complementaria pero no la
misma.

3. La autonomía limitada del genoma mitocondrial

De los 37 genes del ADNmt, 13 codifican polipéptidos. Estos polipéptidos forman parte de
los complejos multiproteicos que intervienen en la cadena de transporte electrónico en el
proceso de fosforilación oxidativa que conduce la formación de ATP. De estos 13 polipéptidos,
intervienen en todos los complejos del transporte de electrones menos el complejo II.

Los restantes 24 dan lugar a ARN no codificador. Dos son ARN ribosómico (ARNr) y 22 dan
lugar a ARNt.

Las mitocondrias para su funcionamiento dependen críticamente de la información


genética contenida en el genoma mitocondrial. No pueden realizar su función esencial sin la
ayuda de la información del ADN nuclear. Esto quiere decir que el ADN nuclear y ADNmt están
estrechamente relacionados, es decir, el ADNmt es dependiente del genoma nuclear.

Los complejos tienen que estar en las mitocondrias y la mayor parte de los polipéptidos que
necesitan proceden de la expresión de genes del núcleo. Primero hace falta que esos genes se
transcriban en el núcleo, luego que sufran modificaciones transcripcionales, que los ARNm
maduros salgan por los poros, luego que sean interceptados por los ribosomas en el citoplasma

141
Capítulo 13. Herencia extranuclear.

para iniciar la traducción de polipéptidos, éstos que entren a la mitocondria y por último que
participen en los complejos de la cadena de transporte de electrones.

Los ARNr que sintetizan en su interior son suficientes para intervenir en la síntesis proteica
en la mitocondria, pero los ribosomas están formados por ARN y proteínas1 las cuales vienen de
genes codificados en el núcleo. Los ribosomas mitocondriales son los que traducen los 13 ARNm
para esos polipéptidos.

Para que se lleve a cabo la síntesis se necesita ARNt. El ADNmt solo tiene 22 ARNt, los
suficientes para sintetizar los 13 polipéptidos.

No tiene genes para el ADN polimerasa ɣ. La información para su síntesis viene del núcleo
donde se localiza el gen que codifica ese ADN polimerasa ɣ.

3.1. Transcripción

Los 37 genes del ADNmt se transcriben a partir de regiones promotoras.

En el lazo D o ADN 7S2 está una región promotora para la cadena H que se denomina
PH. Es donde se inicia la transcripción. Se realiza por ADN polimerasa ɣ procedente del ADN
nuclear y genera largos transcritos multicistrónicos3. Esos transcritos o moléculas
precursoras se fragmentan en moléculas individuales que dan lugar a los productos
correspondientes.

En la cadena L, existe otro promotor (PL). Éste es utilizado por la ARN polimerasa para
dar lugar a largos transcritos multicistrónicos se sintetizan en dirección opuesta a la cadena
H

En bacterias hay que destacar que la información genética está muy compactada y
que el 93% del genoma mitocondrial contiene información. De hecho, sus genes no
contienen intrones. Además, los ARNm de alto peso molecular, el que está asociado a la
subunidad mayor es 23S y la subunidad menor es 16S4.

Según la teoría endosimbiótica de Lynn Margulis, las mitocondrias proceden de


antiguas bacterias que se asociaron a las células eucariotas en el pasado evolutivo.

4. Herencia y mutaciones del ADN mitocondrial

4.1. Herencia materna

1
Aproximadamente 80 proteína ribosomales.
2
Tríplex
3
Característico de bacterias.
4
El genoma mitocondrial contiene ribosomas 23S y 16S.

142
Capítulo 13. Herencia extranuclear.

La herencia mitocondrial es de origen materno. Hijos e hijas heredan el ADNmt de


sus madres, pero los hijos no lo pueden transmitir a los descendientes. Es decir, la línea de
transmisión es materna.

Podemos llegar a concluir que el ADNmt de las


poblaciones actuales proceden de una única mujer que
vivió hace 140000 a 290000 años en África y esa mujer
se le denomina Eva mitocondrial. Se entiende por un
fenómeno de coalescencia (las cosas se funden en una
o varias). Solo una hembra dejó una línea de
descendencia que nos llegó a nuestros días.

Existe un Adán genético que va por la línea de


los varones. Hablamos del cromosoma Y. Este cromosoma procede de un hombre africano
que vivió hace 200000 años.

El esperma cuando penetra en el óvulo


también lleva consigo algunas mitocondrias y
éstas son eliminadas por mecanismos5, de ahí
que lo que permanezca en el cigoto son las
mitocondrias maternas y que la herencia, por lo
tanto, sea materna.

Hay excepciones en los que el ADNmt


puede ser heredado por el paterno. En estos
casos los sistemas de eliminación pueden fallar
habiendo la coexistencia de genotipos distintos.

4.2. Factores que contribuyen a la alta tasa de mutación


El ADN mitocondrial tiene unas altas tasas de mutación más elevadas que el ADN
nuclear. Las tasas de mutación son diez veces superiores a las del ADN nuclear. De hecho,

5
No se conocen muy bien en las primeras etapas embrionarias.

143
Capítulo 13. Herencia extranuclear.

para estudiar periodos evolutivos avanzados se usa el ADN nuclear, y para estudiar periodos
evolutivos más cortos se usa el ADNmt.

Estas altas tasas de mutación se deben a diferentes causas:

➢ Más rondas de replicación que el ADN nuclear: cada ciclo de replicación, las
ADN polimerasas son muy precisas, pero a veces introducen mutaciones.
Tienen probabilidad de tener más mutaciones y van acumulando más
variaciones.

➢ ADN no protegido por histonas: las histonas protegen al ADN de las agresiones
fisicoquímicas. En el ADNmt al no tener proteínas histonas, no está protegido
y sufre más mutaciones.

➢ Sistemas de reparación del ADN menos eficaces: tienen más altas tasas de
mutación porque estos sistemas son menos eficaces, pero no significa que no
los tengan.

➢ Acción mutagénica de los radicales libres: durante la cadena de transporte de


electrones se originan clases de oxígeno muy reactivo, tales como el
superóxido de hidrógeno. Esto provoca una propagación de radicales libres y
dañan al ADN. Están implicados en el envejecimiento de las células.

4.3. Heteroplasmia

Generalmente las moléculas de ADNmt exhiben la misma secuencia de ADN y


entonces se da el fenómeno conocido como homoplasmia.

En este fenómeno se dan que fragmentos de ADN tienen la misma secuencia, pero
ocasionalmente se originan mutaciones en el ADNmt. Estas mutaciones pueden elevar su
frecuencia en el conjunto en la población total de moléculas de ADNmt dando lugar al
fenómeno conocido por heteroplasmia.

Cuando se dan esas mutaciones, la heteroplasmia puede tener diferentes grados a


un nivel espacial y temporal. El grado (%) de moléculas mutadas puede ser distinto. Lo
podemos encontrar a nivel espacial y temporal.

144
Capítulo 13. Herencia extranuclear.

En un humano si observamos la heteroplasmia, ésta puede variar. Puede ser


diferente en diversos tipos de células, es decir, no es homogénea, sino que presenta
heterogeneidad espacial en el grado de heteroplasmia.

Hay también una variación temporal. El grado va oscilando a lo largo de las


generaciones, no solo de los individuos sino de las generaciones celulares.

¿Por qué hay esa oscilación? La variación puede ser debido a un fenómeno de
segregación pasiva. Puede haber diferencias en las proporciones de ADN mutante y normal
debido a un proceso de error de muestreo a medida que se dividen las células. Se tiene un
tejido y las células se dividen pasando y repartiendo moléculas de ADNmt a las células hijas,
pero no en proporciones equivalentes. Esto es lo que se conoce por un problema de
muestreo por segregación pasiva.

Otra explicación por la que hay esta oscilación es por el proceso de la formación de
óvulos. Cuando se forman en división meiótica, existen cuellos de botella que cambian en
gran medida los grados de heteroplasmia. Aquí el error de muestreo es enorme. En la
formación se acentúa la diferencia en los grados de heteroplasmia.

Las mujeres que tengan mutantes en las mitocondrias, las traspasan a sus hijos con
grandes variaciones. Una mujer que sufra una enfermedad puede que su hijo no la sufra y
viceversa.

5. Enfermedades mitocondriales

5.1. Características de las enfermedades mitocondriales

➢ Variabilidad de expresión muy acentuada debido a la heteroplasmia. Puede ser


espacial o temporal.

➢ Los sistemas orgánicos con altos requerimientos de ATP (sistema nervioso


central y sistema muscular) tienden a estar afectados con mayor gravedad por
las enfermedades mitocondriales.

5.2. Ejemplos clásicos de enfermedades asociadas con mutaciones


mitocondriales

➢ Neuropatía óptica hereditaria de Leber. Los síntomas asociados a esta


enfermedad son ceguera por lesión en el nervio óptico y se debe a mutaciones
en subunidades NADH deshidrogenasa.
Fue la primera enfermedad que se encontró en bases genéticas mitocondriales
(1988).

Se han identificado asociaciones entre variantes del ADNmt y otras enfermedades:

➢ Diabetes tipo 2: el cuerpo produce insulina, pero hay una resistencia de la


glucosa a ser reconocida por la insulina.

145
Capítulo 13. Herencia extranuclear.

➢ Hipercolesterolemia: tipo de colesterol producido por mutaciones en un


autosoma humano relacionado con receptor de LDL acumulándose
(“colesterol malo”).

➢ Hipertensión

➢ Esclerosis múltiple

➢ Parkinson

➢ Deficiencia en carnitina

➢ Obesidad

Los individuos que tengan una mayor heteroplasmia, mayor será el grado de
afectación de enfermedades.

Mutaciones en el ADNmt están implicadas en más del 20% de los casos de diabetes
del tipo 2.

5.3. Estrés oxidativo

La cadena de transporte de electrones genera radicales libres dando lugar a


moléculas de oxígeno reactivas que oxidan proteínas y dañan el ADN produciendo daño o
estrés oxidativo.

El estrés oxidativo juega un papel clave en pacientes con el denominado síndrome


metabólico (SM). El SM es un conjunto de síntomas de enfermedades tales como
hiperglucemia, hipertensión, resistencia a la insulina (diabetes del tipo 2), respuesta
inflamatoria y obesidad.

El coenzima Q-10 es un componente esencial de la cadena de transporte de electrones


mitocondrial. Deficiencias en este coenzima se han asociado con varios tipos de

146
Capítulo 13. Herencia extranuclear.

enfermedades tales como el Parkinson y el SM. Estudios recientes (Alam & Rahman, 2014)
muestran que un suplemento de coenzima Q10 puede ser útil para el tratamiento de la
obesidad y el estrés oxidativo.

Ciertas mutaciones en el ADNmt agravan algunos aspectos del envejecimiento, según


experimentos recientes realizados por Ross et al (2013) en ratones.

Llegaron a concluir que cuando el ADNmt de las madres está dañado y tiene
mutaciones, entonces se acelera el envejecimiento en ratones hijos.

El conjunto de ADNmt condiciona mucho el envejecimiento de la descendencia.


Puede provocar un envejecimiento prematuro. Los radicales libres están implicados en el
envejecimiento. Este envejecimiento está asociado al efecto prolongado y continuados de
los radicales libres.

5.4. Técnica de los tres padres para evitar la transmisión de


mutaciones en el ADNmt

Si queremos evitar que mutaciones pasen a los hijos primero lo que debemos realizar
es un diagnóstico genético preimplantacional (DGP), que es el estudio del ADN de
embriones humanos para seleccionar los que cumplen determinadas características y/o
eliminar los que portan algún tipo de defecto congénito. Para ello se cogen cigotos en
estado de 6-8 células.

Al cigoto de la madre afectada por mutaciones en las mitocondria se le hace el DGP


y se elimina el cromosoma Y para asegurarnos que no sea hombre sino mujer y evitamos
que sufra la enfermedad. No obstante, para realizar este proceso, se depende del grado de
heteroplasmia.

Se coge una muestra y analizamos este grado de heteroplasmia. Si es bajo podremos


hacer el DGP, si es alto no se realiza, hay que analizar los genes del núcleo.

Otra alternativa para evitar la transmisión de mutaciones en el ADNmt es realizar la


técnica de los tres padres.

147
Capítulo 13. Herencia extranuclear.

En esta técnica se hace un reemplazo de las mitocondrias. La mujer afectada se le


reemplaza la mitocondria del óvulo por otras normales.

Se parte de dos óvulos no fertilizados. Por un lado, el óvulo de la paciente y por otro
el óvulo de una mujer donadora con mitocondrias normales no mutadas. A este óvulo se le
retira los cromosomas6, y esto se hace extrayéndole el huso mitótico. Al final tenemos un
óvulo donador con mitocondrias normales y retirado el material hereditario.

Al óvulo de la paciente se le retira el huso mitótico con los cromosomas y se le


inyectan en el óvulo donador. Lo que se consigue es que tengamos un óvulo con
mitocondrias normales de la donante y material hereditario de la paciente.

Este óvulo final se fertiliza con el esperma del varón y tenemos un cigoto que se
desarrolla dando lugar al embrión.

En definitiva, se elimina el ADNmt y en el proceso de extracción de material


hereditario de la afectada se arrastra un 1% de mitocondrias por lo que el grado de
heteroplasmia sería muy bajo, evitando el único problema que podría surgir del reemplazo
de mitocondrias.

Muchas enfermedades se producen por mutaciones en genes nucleares afectando a


proteínas que intervienen en la cadena de transporte de electrones.

¿De las enfermedades mitocondriales cuantas son producidas por mutaciones en


genes nucleares? Se estima que el 80% de enfermedades mitocondriales viene causado por
mutaciones en genes nucleares. En el caso que se conozcan esas mutaciones la diagnosis
genética es eficaz.

➢ Experimentos en monos
(2009)

➢ Experimentos en humanos
(2013) pero no se dejó llevar
a cabo el desarrollo del
embrión.

➢ Experimento en 2015 (Reino


Unido)

➢ 2016: se aplica la técnica de


los tres padres para resolver
la enfermedad del síndrome
de Leigh.

Este experimento de la técnica de


los tres padres se aplicó a una familia
gordana la cual se les murieron dos hijos
por dicha enfermedad. Se les hizo esta
técnica de tres padres en México y el embrión se desarrolló bien.

6
El material nuclear

148
Capítulo 13. Herencia extranuclear.

El problema que puede dar esta técnica es que al haber tres genomas distintos puede
haber incompatibilidad y dar problemas posteriores.

Otro problema sería que se producen intervenciones en el genoma germinal. Si son


varones se puede hacer porque no habría efectos en los varones descendientes.

149