You are on page 1of 12

PHAGOCYTES

Normal Neutrophil Function in Cathepsin G-Deficient Mice


By Debra M. MacIvor, Steven D. Shapiro, Christine T.N. Pham, Abderazzaq Belaaouaj,
Soman N. Abraham, and Timothy J. Ley

Cathepsin G is a neutral serine protease that is highly tic responses to C5a, fMLP, and interleukin-8. Although
expressed at the promyelocyte stage of myeloid develop- cathepsin G has previously shown to have broad spectrum
ment. We have developed a homologous recombination antibiotic properties, challenges of mice with Staphylococ-
strategy to create a loss-of-function mutation for murine cus aureus, Klebsiella pneumoniae, or Escherichia coli yielded
cathepsin G. Bone marrow derived from mice homozygous survivals that were not different from those of wild-type
for this mutation had no detectable cathepsin G protein or animals. In sum, cathepsin G2/2 neutrophils have no obvi-
activity, indicating that no other protease in bone marrow ous defects in function; either cathepsin G is not required for
cells has the same specificity. Hematopoiesis in cathepsin any of these normal neutrophil functions or related azurophil
G2/2 mice is normal, and the mice have no overt abnormali- granule proteases with different specificities (ie, neutrophil
ties in blood clotting. Neutrophils derived from cathepsin elastase, proteinase 3, azurocidin, and/or others) can substi-
G2/2 mice have normal morphology and azurophil granule tute for it in vivo.
composition; these neutrophils also display normal phagocy- r 1999 by The American Society of Hematology.
tosis and superoxide production and have normal chemotac-

C ATHEPSIN G IS A neutral serine protease that is ex-


pressed and synthesized at the promyelocyte stage of
development and is packaged in the azurophil (primary) gran-
to a variety of chemotactic signals, suggesting that cell surface-
bound cathepsin G may play a role in this process.19,20
Cathepsin G has been proposed to play a role in blood
ules.1,2 The amino acid composition and crystal structure of clotting, because it cleaves and inactivates several clotting
cathepsin G are known.3-5 The human and murine cathepsin G factors,21-26 because it can cleave and potentially modulate the
genes have been cloned6,7 and reside within a cluster of function of the thrombin receptor,27-29 and because it can activate
granule-related serine proteases on syntenic regions of human platelets in vitro.30-38 Tight contact is thought to be required between
and mouse chromosomes 14.8-13 The highly related serine neutrophils and platelets for platelet activation to occur33,34;
proteases known as neutrophil elastase (NE), azurocidin, and cleavage of the thrombin receptor or thrombin receptor-like
proteinase 3 are also expressed specifically in promyelocytes proteins could potentially play a role in this process.
and packaged in azurophil granules; these 3 genes are located in Cathepsin G has been proposed to play a role in neutrophil
a tight cluster on human chromosome 19 pter.14 The human and responses against a variety of bacteria. Purified cathepsin G has
mouse cathepsin G genes are highly related and are expressed in been shown to inhibit the growth of several organisms, includ-
identical fashion6,7,15; therefore, these genes are thought to be ing Staphylococcus aureus, Escherichia coli, Pseudomonas
true orthologues of one another. Cathepsin G has chymotrypsin- aeruginosa, and Neisseria gonorrhea; it also displays toxic
like specificity, preferring to cleave at Phe in the P1 position16; a properties against Eimeria tenella sporozoites, Capnocyto-
large number of potential substrates for cathepsin G have been phaga, and Listeria monocytogenes.39-45 The enzymatic activity
identified (discussed below). Although cathepsin G is found in of cathepsin G is not required for its antibacterial activities39,46-
the azurophil granules of neutrophils, this enzyme has also been 48; in fact, 3 peptides derived from cathepsin G (IIGGR [aa 1-5],
found on the surface of neutrophils after degranulation.17,18 HPQYNQR [aa 77-83], and RPGTLCTVAGWGRVSMRRGT
Recent studies have suggested that inhibitors of cathepsin G [aa 117-136]) have direct antimicrobial properties.47,48 The
(a-1 antichymotrypsin and/or specific antibodies directed against precise mechanisms by which these peptides cause bacterial
cathepsin G) can diminish the ability of neutrophils to respond death are currently unknown.
Cathepsin G has a number of potential substrates and
activities that are difficult to classify, including the conversion
From the Departments of Internal Medicine and Genetics, Division of of angiotensin I to angiotensin II,49 the activation and damage of
Bone Marrow Transplantation and Stem Cell Biology, Department of
cultured airway epithelial cells,50 the stimulation of secretion by
Pediatrics, Medicine, and Cell Biology, Division of Rheumatology, and
Department of Pathology, Washington University Medical School, St airway gland serous cells,51 the induction of transendothelial
Louis, MO. albumin flux,52 and the processing of NF-kB (p65) in vitro.53 It
Submitted April 8, 1999; accepted October 4, 1999. is not yet clear that any of these activities represent physiologic
Supported by National Institutes of Health Grants No. DK49786 and roles of this enzyme.
CA49712 (to T.J.L.), BL03774 (to C.T.N.P.), and HL54853 (to S.D.S.). Finally, cathepsin G has been proposed to play an important
Address reprint requests to Timothy J. Ley, MD, Washington Univer- role in tissue remodeling at sites of wounding or tissue injury.
sity Medical School, Division of Bone Marrow Transplantation and Cathepsin G has been shown to cleave and inactivate the
Stem Cell Biology, 660 S Euclid Ave, Campus Box 8007, St Louis, MO neutrophil chemoattractants tumor necrosis factor a (TNFa),54
63110; e-mail: timley@im.wustl.edu.
interleukin-1 (IL-1),55 and IL-8.56 In addition, cathepsin G has
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked ‘‘adver-
been shown to cleave several matrix components, including
tisement’’ in accordance with 18 U.S.C. section 1734 solely to indicate collagen, fibronectin, cartilage proteoglycans, and elastin.57-64
this fact. For this reason, we recently examined the ability of cathepsin
r 1999 by The American Society of Hematology. G-deficient mice (the same mice described in this study) to heal
0006-4971/99/9412-0044$3.00/0 incisional wounds and found that these animals have reduced

4282 Blood, Vol 94, No 12 (December 15), 1999: pp 4282-4293


CATHEPSIN G-DEFICIENT MICE 4283

tensile strength of their healing wounds at 7 days. This defect is protects a probe fragment of 235 nucleotides from S1 nuclease
resolved by 10 days.65 Cathepsin G-deficient mice display digestion. Autoradiograms were exposed for 24 to 72 hours.
excessive neutrophilic inflammation at sites of wounding, Western analysis. Total proteins were prepared from approximately
which may be caused by increased neutrophil chemoattractant 2 3 107 bone marrow cells by sonicating the cells in 200 µL of
extraction buffer (1 mol/L NaCl, 25 mmol/L Tris 7.5, 0.1% Triton
activity in the wound fluid.65 These observations suggest that
X-100); protein was quantified using the Bio-Rad Protein Assay
cathepsin G may be involved in degrading one or more soluble (Bio-Rad Laboratories, Hercules, CA). Equal quantities of total proteins
mediators in the wound milieu that are important for the early were loaded onto 10% sodium dodecyl sulfate-polyacrylamide gel
phases of neutrophil migration into the wound. However, we electrophoresis (SDS-PAGE) gels, transferred to nitrocellulose, and
could not rule out an autonomous defect of cathepsin G- analyzed with a standard Western blotting technique using a rabbit
deficient neutrophils that might contribute to the abnormal antiserum directed against a murine cathepsin G-derived peptide (aa
wound healing. 152-165 numbered from the initiation codon: CANRFQFYNSQTQI),
In this report, we fully describe mice that possess a null followed by detection with chemiluminescence (Amersham, Arlington
mutation of cathepsin G. Cathepsin G2/2 animals have no Heights, IL).
detectable defects in myeloid development or neutrophil func- Determination of cathepsin G and neutrophil elastase activity.
Total bone marrow cells were extracted in extraction buffer as described
tion, suggesting that either cathepsin G is not required for these
above and normalized for total protein context using the Bio-Rad assay.
functions or that related proteases can substitute for the Cathepsin G activity was measured using the peptide substrate N-
functions of cathepsin G in some circumstances. Succinyl-Ala-Ala-Pro-Phe-pNA (Sigma, St Louis, MO) and neutrophil
elastase activity with the substrate N-Methoxysuccinyl-Ala-Ala-Pro-Val-
MATERIALS AND METHODS pNA, as previously described.68
Generation of bone marrow-derived mast cells. Mast cells were
Production of the targeting construct. A 3.7-kb Bgl II genomic generated by culturing murine bone marrow cells for 3 weeks in
fragment containing the 38 part of exon 4 through the 38 flank of the enriched media (RPMI 1640 containing 0.1 mmol/L nonessential amino
murine cathepsin G gene was subcloned into the MJK-KO vector acids, 2 mmol/L L-glutamine, 10% heat-inactivated fetal calf serum,
downstream from the PGK-neo cassette. A 1.6-kb HindIII/Pst I 100 U/mL penicillin, 10 µg/mL gentamicin, and 50 mmol/L 2-mercapto-
fragment containing 58 genomic flanking sequence, exons 1 and 2, ethanol) supplemented with 50% WEHI-3 cell conditioned media
introns 1 and 2, and the 58 part of exon 3 was purified from a pUC 9 (WCM), as previously described.69 After 3 weeks, the cells were
vector and subcloned into pGEM7. This plasmid was then cut with Bgl cultured for an additional 72 hours in 50% WCM/50% enriched media
II and Xho I; the resulting Bgl II/Xho I fragment was subcloned supplemented with 100 U/mL recombinant murine IL-10 (Amersham).
upstream from the PGK-neo cassette and downstream from the RNA was then extracted from the cells and analyzed using S1 nuclease
HSV-TK cassette of the MJK-KO vector.66 Therefore, a 393-bp Pst protection assays. These preparations yielded greater than 90% mast
I-Bgl II fragment containing the 38 end of exon 3, intron 3, and the 58 cells as judged by light microscopic criteria.
end of exon 4 was removed and replaced with a standard PGK-neo Isolation of bone marrow-derived neutrophils. Bone marrow was
cassette in the reverse orientation. This deletion removes the region harvested using Hank’s balanced salt solution (HBSS; 138 mmol/L
encoding aa 92-164 of the cathepsin G protein (numbering from the NaCI, 5.4 mmol/L KCl, 0.4 mmol/L KH2PO4, 0.2 mmol/L Na2HPO4,
initiation codon). 4.1 mmol/L NaHCO3, 5.5 mmol/L glucose) containing 1% bovine
Electroporation, selection, and screening of embryonic stem (ES) serum albumin (BSA). Neutrophils were purified from the bone marrow
cells. Early passage RW4 ES cells (129/SvJ) were maintained on preparations using a discontinuous Ficoll gradient (Histopaque 1119;
feeder layers of murine embryonic fibroblasts in the presence of 103 Sigma). Cells were then washed twice with HBSS containing 1% BSA.
U/mL leukocyte inhibitory factor. ES cells were transfected and Neutrophil purity was consistently 75% to 85%, as assessed by light
selected, and G418-resistant clones were identified by Southern blotting microscopy of Wright-Giemsa–stained cytospins.
using probe A (see Fig 1A). Recombinant clones were confirmed using a Phagocytosis. In vitro, 5 3 104 neutrophils in 100 µL of phosphate-
probe specific for PGK-neo (probe B). buffered saline (PBS; define) were mixed with 10 µL of a 1:5 dilution of
Production of mutant mice. C57Bl/6J blastocysts were microin- 0.9-µm diameter fluorescein isothiocyanate (FITC)-labeled latex beads
jected with 10 to 12 ES cells from 3 independent targeted clones and (Poly Sciences, Inc, Warrington, PA) and incubated for 1 hour at 37°C.
implanted into pseudopregnant Swiss Webster foster females. Chimeric Cells were then washed with media, trypsin-EDTA was added, and the
male progeny with greater than 60% agouti fur were mated with cells were incubated at 37°C for 10 minutes. Cells were then layered
C57Bl/6J females, and their progeny were screened by Southern blot over 4°C fetal calf serum and spun at 1,500 rpm for 5 minutes to remove
analysis (with probe A) for transmission of the targeted allele. Heterozy- uningested beads. After washing, the cells were fixed with 1.0%
gotes were interbred to produce homozygous mutant mice derived from paraformaldehyde in PBS and observed under a fluorescent microscope.
2 of the independently targeted ES clones (no. 11 and 76). Both lines In vivo, 2 mL of zymosan (Sigma) was injected intraperitoneally.
were phenotypically identical. Chimeric males from line 76 were also Total intraperitoneal cells were harvested after 4 hours by injecting 10
bred to 129/SvJ females to obtain cathepsin G-deficient mice in a pure mL of PBS and then withdrawing 7 to 9 mL of fluid for analysis.
129/SvJ background. Mice were maintained in a specific virus free Cytospin preparation of cells were made and stained using Wright-
(SVAF) barrier facility at all times. Giemsa stain.
S1 nuclease protection assays. Total cellular RNA was prepared Superoxide production. Purified bone marrow-derived neutrophils
and analyzed by S1 nuclease protection, as previously described.67 The were resuspended in HBSS (with 1.3 mmol/L CaCl2 and 0.4 mmol/L
gene-specific probes for murine granzyme B,2 murine cathepsin G,7 and MgSO4) and added to tubes containing 0.2 mmol/L cytochrome C
murine b2-microglobulin2 have been described previously. The probe (Sigma) and 0, 5, 10, or 25 ng/mL phorbol 12-myristate 13-acetate
for murine mast cell chymase-2 (mMCP-2) RNA was obtained by (PMA; Sigma) or containing cytochrome C plus 300 U/mL superoxide
polymerase chain reaction (PCR); the forward primer was located in dismutase (SOD; Sigma) with 0, 5, 10, or 25 ng/mL PMA. The cells
IVS-4 (TTCATCTCCcathepsin GTTCTCAAGC) and the reverse primer were incubated for 20 minutes at 37°C in 5% CO2 and then centrifuged
in exon 5 (AGACTTGATGCAGGATGAGA); and the PCR product at 10,000 rpm for 2 minutes. Supernatants were assayed at OD550. The
was 489 bp in length. Correctly processed exon 5 mMCP-2 mRNA amount of superoxide produced was calculated using the following
4284 MACIVOR ET AL

formula: (DOD 3 100)/21.1 5 micromoles of O22 5 (nanomoles of Varying doses of S aureus were injected intraperitoneally (IP) into
O22/mL)/(PMNs/mL/time) 5 nanomoles of O22/PMNs/time. 129/SvJ mice to define the LD50, which was approximately 2.5 3 108
Chemotaxis. Optimal concentrations of several chemotactic agents colony-forming units (CFU). Eight cathepsin G1/1 (5 male and 3
were defined using bone marrow-derived neutrophils, including fMLP female) and 9 cathepsin G2/2 (5 male and 4 female) 10-week-old mice
(1024 mol/L; Sigma), zymosan-activated rat serum (7%), and recombi- were injected IP with 108 CFU S aureus and observed for 15 days.
nant human IL-8 (rhIL-8; 250 ng/mL; Amersham); these optimal Deaths were recorded and analyzed.
concentrations were used for all further experiments.70 Chemotactic Klebsiella pneumoniae (KPA strain) was grown in TSB and passaged
agents were suspended in the bottom wells of micro-chemotaxis once in 129/SvJ mice before use. Varying doses of K pneumoniae were
chambers. The bottom chamber was covered with 2-mm membrane injected IP into wild-type 129/SvJ mice, and the LD50 was determined
filters, and 150,000 bone marrow-derived neutrophils (in Dulbecco’s to be between 5 3 105 CFU and 1 3 106 CFU. Fourteen cathepsin
modified Eagle’s medium [DMEM]/0.1% human serum albumin) G1/1 and 15 cathepsin G2/2 12-week-old male mice were injected IP
derived from wild-type or cathepsin G-deficient mice (all in the pure with 1 3 106 CFU of K pneumoniae. Deaths were recorded and
129/SvJ strain) were suspended in the top wells. After incubation for 75 analyzed.
minutes at 37°C in 5% CO2, the membranes were fixed, stained with E coli (K1) was grown in TSB and passaged twice in 129/SvJ mice
Leukostat (Sigma), and placed on glass slides. Cells from the top before use. Varying doses of E coli were injected IP into wild-type
chamber were removed with a wiper blade. Fifteen fields were counted 129/SvJ mice to determine the LD50, which was 3 3 104 CFU. This
at 4003 magnification. Each experiment was performed in triplicate. dose of bacteria was then injected IP to 13 wild-type mice, 12 cathepsin
Media alone was used as a negative control and subtracted from total G2/2 mice, and 12 NE2/2 mice. Deaths were recorded and analyzed.
counted cells to yield net neutrophil movement. In vitro microbicidal assays. The in vitro bactericidal activities of
Chemoattractant-induced calcium influx. Bone marrow-derived neu- cathepsin G and NE were quantified as described.45 K pneumoniae, E
trophils were loaded with the calcium sensitive dye Fluo-3 (9 µmol/L coli, and S aureus were grown in TSB at 37°C and washed twice with
acetoxymethyl ester Fluo-3; Molecular Probes, Eugene, OR) for 30 PBS. Mid-log phase bacteria (105) were incubated in the absence or
minutes at room temperature in HBSS without calcium or magnesium. presence of purified human NE or cathepsin G (5 µg; Elastin Products
Cells were stained with phycoerythrin (PE)-conjugated anti–Gr-1 Co, Owensville, MO) in a total volume of 100 µL of 10 mmol/L sodium
antibody (Pharmingen, San Diego, CA), washed, and then resuspended phosphate containing 1% (vol/vol) TSB at 37°C for 4 hours. Serial
in HEPES buffer (137 mmol/L NaCl, 5 mmol/L KCl, 1 mmol/L dilutions were then spread on agarose plates and the number of CFUs
Na2HPO4, 5 mmol/L glucose, 1 mmol/L CaCl2, 0.5 mmol/L MgCl2, was determined after overnight incubation. At the time of each assay,
0.1% BSA, and 10 mmol/L HEPES, pH 7.4). Antifluorescein antibody cathepsin G and NE activities were confirmed using the spectrophoto-
was added (per the manufacturer’s recommendation) to quench extracel- metric method of peptide substrate cleavage described above.
lular Fluo-3 signals. The indicated agonist was added and cellular
Fluo-3 fluorescence was measured continuously for 90 seconds using a RESULTS
Coulter ESP flow cytometer (Coulter, Hialeah, FL), as previously
described.71 Targeting of the cathepsin G gene in ES cells and production
In vivo bacterial clearance. All in vivo assays were performed in of mutant mice. We electroporated RW4 ES cells (129/SvJ)
mice having a pure 129/SvJ background. S aureus was grown in tryptic with our cathepsin G targeting vector (Fig 1). Three homolo-
soy broth (TSB) and passaged twice in 129/SvJ mice before use. gous recombinants were identified (using Southern blotting with

Fig 1. The cathepsin G (CG)


locus and targeting strategy. (A)
The structures of the murine ca-
thepsin G gene and the targeting
vector used to create homolo-
gous recombinants are shown.
The PGK-neo cassette was in-
serted in the antisense orienta-
tion with respect to the cathep-
sin G gene. The structure of the
targeted locus and the sizes of
fragments detected by probe A
(which is completely external to
the targeting construct) and
probe B (the PGK-neo cassette)
are shown. (B) Southern blot
analysis of tail DNA from the
progeny of a cross between ca-
thepsin G1/2 animals. Genomic
DNA was cleaved with Xba I and
the blot was hybridized with
probe A. The positions of the
wild-type (7.6 kb) allele and the
targeted (2.2 kb) allele are
shown.
CATHEPSIN G-DEFICIENT MICE 4285

external probe A) of 192 G418-resistant colonies screened of cathepsin G2/2 mice (Fig 2A). The mb2M signal is present
from 2 independent transfections. After injection of C57Bl/6 in bone marrow RNA from all 3 mice and serves as an internal
blastocysts, all 3 of these ES clones gave rise to highly chimeric control for RNA quality and content.
males that were then mated to C56Bl/6 females to obtain Total protein extracts from cathepsin G1/1, 1/2, and2/2
germline transmission of the mutant cathepsin G allele. Chi- bone marrows were analyzed by Western blotting (Fig 2A, right
meric males were also mated to 129/SvJ females to obtain panel); the blot was probed sequentially with a rabbit antimu-
germline transmission in pure 129/SvJ mice. Figure 1B is a rine cathepsin G antibody and a rabbit antimurine b-actin
Southern blot analysis of genomic tail DNA of progeny antibody to control for protein loading. No cathepsin G protein
produced from a cross of cathepsin G1/2 animals. Genomic (,29 kb) is detected in the bone marrow of cathepsin G2/2
DNA was digested with Xba I and hybridized with probe A to mice.
show bands representing the wild-type (7.6 kb) and mutant Total bone marrow extracts were evaluated for cathepsin G
(2.6 kb) alleles. The heterozygous matings produced wild-type, activity using the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe-
heterozygous, and homozygous mice at expected ratios pNA. Importantly, equal amounts of human versus mouse bone
(1/1:1/2:2/25 30:55:31). Cathepsin G2/2 mice develop marrow extracts contained virtually identical amounts of cathep-
normally and are fertile. Mice were evaluated from 2 indepen- sin G activity (data not shown). Marrow extracts derived from
dently targeted ES clones and both had the same phenotype cathepsin G2/2 mice have virtually no detectable cleavage of
(data not shown). this peptide substrate (Fig 3A). Neutrophil elastase-deficient
Cathepsin G2/2 mice contain a null mutation for mice have normal levels of cathepsin G activity, as expected
cathepsin G. Bone marrow was harvested from cathepsin (data not shown). In contrast, cathepsin G2/2 bone marrow
G1/1, 1/2, and 2/2 mice and total cellular RNA was extracts cleave the elastase-specific peptide substrate N-
prepared for analysis by S1 nuclease protection. Figure 2A (left Methoxy Succinyl-Ala-Ala-Pro-Val-pNA as efficiently as wild-
panel) is an S1 nuclease protection analysis of bone marrow cell type marrow extracts, as expected (Fig 3B).
RNA (lanes 1, 2, and 3). RNA samples (10 µg) were hybridized The cathepsin G mutation reduces expression of the down-
with specific probes for exon 5 of murine cathepsin G and for b2 stream mMCP-2 gene. Our laboratory has shown that the
microglobulin (mb2M). Correctly processed murine cathepsin targeted disruption of the granzyme B gene (with a retained
G exon 5 mRNA protects a probe fragment of 212 nt from S1 PGK-neo cassette) also disrupts expression of the downstream
digestion, whereas mb2M mRNA protects a fragment of 190 nt. granzymes C, D, F, and G in adherent lymphokine-activated
Cathepsin G mRNA is present in the bone marrow of 1/1 mice, killer (AdLAK) cells derived from granzyme B2/2 mice. This
is reduced in 1/2 mice, and is undetectable in the bone marrow phenomenon is known as the neighborhood effect and is

Fig 2. The cathepsin G mutation eliminates cathepsin G mRNA and protein expression in the bone marrow of cathepsin G2/2 mice. (A) Lanes
1 through 3 show an S1 nuclease protection analysis of cathepsin G and b2 microglobulin mRNAs in bone marrow samples derived from 1/1,
1/2, and 2/2 mice. In lanes 4 through 6, a Western blot was performed with a rabbit antimurine cathepsin G antibody prepared against a
peptide from a unique region of the cathepsin G protein (see Materials and Methods). After hybridization and chemiluminescence, the blot was
stripped and reprobed for the presence of b-actin to control for protein loading. (B) Analysis of mMCP-2 mRNA in cultured mast cells derived from
the bone marrow of cathepsin G1/1 and 2/2 mice. An S1 nuclease protection assay was performed with probes for mouse b2 microglobulin and
either mouse cathepsin G or mMCP-2, as indicated. The positions of probe fragments protected from S1 nuclease digestion by correctly spliced
mcathepsin G and mMCP-2 are shown. Mast cell mRNA from cathepsin G1/1 animals contains easily detectable mcathepsin G mRNA. RNA
derived from cathepsin G2/2 mast cells shows no cathepsin G mRNA, as expected, and a 10-fold reduction in mMCP-2 mRNA levels.
4286 MACIVOR ET AL

Fig 3. Cathepsin G and neutrophil elastase activities in cathepsin G-deficient mice. The activity of cathepsin G and neutrophil elastase was
determined by the ability of total bone marrow protein extracts to cleave colorometric peptide substrates in vitro, as described in Materials and
Methods. (A) A peptide substrate for cathepsin G (N-Succinyl-Ala-Ala-Pro-Phe-pNA) is used. Cathepsin G2/2 mice have no detectable
conversion of this substrate even after 30 minutes of incubation at 37°C. (B) The conversion of the neutrophil elastase-specific peptide
(N-Methoxysuccinyl-Ala-Ala-Pro-Val-pNA) is shown. Wild-type and cathepsin G2/2 mice have equivalent amounts of neutrophil elastase
activity. These experiments were performed 3 times with identical results.

thought to be caused by the retained PGK-neo cassette in the detectable cathepsin G mRNA and because they comprise only
mutant locus.72-75 1% to 2% of total bone marrow cells.2,7
The targeted mutation of the cathepsin G gene minimally Hematopoiesis, lymphopoiesis, and myeloid granule develop-
alters the expression of the upstream granzymes (B, C, D, ment are normal in cathepsin G2/2 mice. We compared the
and F) in activated cytotoxic T lymphocytes and AdLAK cells.10 hematopoietic development of multiple cathepsin G1/1 and
To determine whether the mutation in the cathepsin G gene cathepsin G2/2 mice derived from 2 different ES cell lines.
affects expression of downstream murine mast cell chymase Complete blood counts and differentials showed no differences
genes,10-13,76,77 we developed PCR-based detection methods for between cathepsin G1/1 and cathepsin G2/2 animals (n 5 8,
the mMCP-1, -2, -4, and -5 genes and screened for their data not shown). Cytospins of bone marrow cells from cathep-
presence (using PCR) on a bacterial artificial chromosome sin G1/1 and cathepsin G2/2 mice were Wright-Giemsa
(BAC) that was known to contain the cathepsin G gene.10 Only stained and evaluated for the presence of myeloperoxidase and
mMCP-2, a chymase known to be expressed in mucosal mast chloroacetate esterase activity; no clear differences were de-
cells,76 was present on this BAC clone, mapping approximately tected (Fig 4A and B). Transmission electron micrography of
30 kb downstream from the cathepsin G gene. Mast cells were bone marrow-derived neutrophils from cathepsin G2/2 mice
cultivated from bone marrow cells that had been incubated for 3 showed normal numbers of electron-dense (azurophil) granules
weeks in WCM and then stimulated for 72 hours in conditioned (Fig 4C) and normal neutrophil morphology. The thymic and
media containing murine rIL-10 (100 U/mL).76,77 An S1 probe splenic tissues of cathepsin G2/2 mice were evaluated by flow
specific for mMCP-2 was developed and used to analyze these cytometry, using the markers for CD3, CD4, CD8, B220, and
mast cell mRNA samples (Fig 2B). Cathepsin G was expressed NK1.1, as previously described.66 Normal numbers and propor-
in cathepsin G1/1 mast cells, but not in cathepsin G2/2 mast tions of all lymphoid compartments were present in both
cells, as expected (lanes 1 and 3, respectively). However, organs, as well as in the peripheral blood (data not shown).
whereas mMCP-2 is expressed in cathepsin G1/1 mast cells, Similarly, normal numbers of Gr-1–positive and CD11b-
there is a 10-fold reduction (as determined by phosphorimag- positive cells were present in the bone marrow and peripheral
ing) of mMCP-2 mRNA levels in cathepsin G2/2 mast cell blood of the mutant mice (data not shown).
mRNA (lanes 2 and 4, respectively). Although bone marrow Normal hemostasis in cathepsin G2/2 mice. Cathepsin
samples and cultured mast cells appear to have nearly equiva- G2/2 mice do not hemorrhage at birth and clot normally when
lent levels of cathepsin G mRNA, the level of cathepsin G tailed or subjected to retroorbital bleeding. The bleeding time of
mRNA per expressing cell may be much higher in promyelo- cathepsin G2/2 mice is 3.9 6 2 minutes (n 5 6), a value that is
cytes, because these are the only bone marrow cells that contain not different from the bleeding times of wild-type littermate
CATHEPSIN G-DEFICIENT MICE 4287

Fig 4. Morphology of neutrophils derived from


cathepsin G-deficient animals. Bone marrow cells
were stained with choracetate esterase (A) or my-
eloperoxidase stains (B) using conditions recom-
mended by the manufacturer (Sigma). The reddish-
pink stain in (A) represents chloracetate esterase
activity, and the dark brown stain in (B) represents
myeloperoxidase activity. Transmission electron mi-
croscopic (TEM) images of bone marrow derived
neutrophils are shown in (C). Note that cathepsin
G2/2 neutrophils have equal numbers of electron-
dense granules and normal morphology.

controls (4.2 6 1.5 minutes, n 5 6). Histopathologic examina- vitro78,79; we therefore asked whether cathepsin G was required
tion of the spleens, livers, kidneys, and lungs from 1- to 2-year-old for this response. Bone marrow neutrophils from cathepsin
cathepsin G2/2 mice showed no evidence of microthrombosis G1/1 and cathepsin G2/2 mice were stimulated with 0 to 25
or chronic organ damage of any kind (data not shown). µg/mL PMA, and cells were analyzed for superoxide produc-
Phagocytosis and superoxide production are normal in tion. Cathepsin G deficiency had no significant effect on the
cathepsin G2/2 neutrophils. Neutrophils isolated from bone production of superoxide at these concentrations of PMA (data
marrow were incubated with FITC-labeled latex beads and not shown).
observed under a fluorescent microscope. At least 98% of Cathepsin G2/2 neutrophils have normal in vitro and in
cathepsin G1/1 and cathepsin G2/2 neutrophils engulfed vivo chemotaxis. Membrane-bound cathepsin G has been
$10 beads. In addition, cathepsin G1/1 and cathepsin G2/2 suggested to play a role in chemotaxis, although the mechanism
mice were injected IP with 2 mL of zymosan. Four hours later, by which it functions in this setting is unknown. We therefore
cells were harvested and cytospins were made. Again, at least examined the in vitro chemotaxis of cathepsin G2/2 neutro-
98% of cathepsin G1/1 and cathepsin G2/2 neutrophils had phils using a Boyden chamber using optimal concentrations of
engulfed at least 10 zymosan particles. C5a (7% zymosan-activated serum), fMLP (1024 mol/L; we
a-1 antichymotrypsin, a serpin that inhibits cathepsin G, has confirmed that a much higher concentration of fMLP is required
been shown to inhibit neutrophil superoxide production in for the optimal chemotaxis of murine neutrophils [1024 mol/L]
4288 MACIVOR ET AL

compared with human neutrophils [1027 mol/L]70), or recombi- 4 or 24 hours after injection. Similar results were obtained 48
nant human IL-8 (250 µg/mL), as shown in Fig 5A. There was hours after injection (data not shown).
no significant reduction in the chemotaxis of cathepsin G2/2 To further assess in vivo chemotaxis, we wanted to determine
neutrophils towards any of these reagents. whether cathepsin G2/2 neutrophils would migrate normally
To determine whether in vivo chemotaxis was altered in to a site of bacterial infection. We therefore injected 3 cathepsin
cathepsin G2/2 mice, we injected 2 mL (58 mg) of thioglyco- G1/1 and 3 cathepsin G2/2 mice with 108 CFU of S aureus
late IP into cathepsin G1/1 and cathepsin G2/2 mice and, at IP. At 2 hours, cells were harvested from the peritoneum and
various time points, peritoneal cells were collected by lavage total cell counts and total number of neutrophils were deter-
and quantified and cell type differentials were performed. As mined, as shown in Fig 5C; there was no significant difference
shown in Fig 5B, there was no difference in either the total between the total number of cells or the total number of
number of cathepsin G1/1 and cathepsin G2/2 cells or the neutrophils in the peritoneal harvests from the wild-type versus
number of cathepsin G1/1 and cathepsin G2/2 neutrophils at cathepsin G2/2 mice.
Finally, we wished to determine whether cathepsin G-
deficient neutrophils had any defects in the early signaling
pathways of fMLP, C5A, or IL-8. We therefore loaded wild-type
or cathepsin G-deficient neutrophils with the calcium-sensitive
dye Fluo-3 and added either no agonist (Mock) or optimal
concentrations of fMLP (1024 mol/L), C5a (7% Zymosan
activated serum), or recombinant human IL-8 (250 ng/mL) and
measured the mean fluorescent intensity in the neutrophils at
5-second intervals in Gr-1–positive cells. For each of the
agonists, cathepsin G2/2 neutrophils mediated calcium fluxes
at least as efficiently as their wild-type counterparts (data not
shown). This indicates that cathepsin G deficiency does not alter
the function of the receptors for any of these chemoattractant
molecules or reduce their ability to mediate calcium fluxes.
Normal survival of cathepsin G2/2 mice in response to S
aureus, K pneumoniae, or E coli challenges. Because cathep-
sin G had previously been shown to be bactericidal for a variety
of organisms, we wished to determine whether cathepsin G2/2
mice were more susceptible to death induced by Gram-positive
or Gram-negative bacterial species. We first determined that 108
CFU of S aureus killed 1 of 6 wild-type 129/SvJ mice, whereas
5 3 108 CFU killed 6 of 6 mice. We injected 1 3 108 CFU of S
aureus IP into 8 additional cathepsin G1/1 and 9 cathepsin

;
Fig 5. Cathepsin G2/2 neutrophils have normal chemotaxis to-
wards a variety of stimuli in vitro and in vivo. (A) Cathepsin G2/2
neutrophils have normal chemotaxis in vitro. Bone marrow-derived
neutrophils from wild-type (1/1) and cathepsin G-deficient mice
(2/2) were added to the top of a modified micro-Boyden chamber
with the chemoattractant on the bottom well. Maximally effective
concentrations of fMLP (1024 mol/L), C5a (7% zymosan activated
serum), and rhIL-8 (250 ng/mL) were used. Net neutrophil movement
per high power field (HPF) is defined as total neutrophils minus
neutrophils migrating towards the media control (between 11 and 15
for different experiments). The data represent the mean from 4
individual mice per group each performed in triplicate. Bars represent
standard deviations. (B) Quantitation of the total cells and neutro-
phils in peritoneal lavage fluid from thioglycolate-treated mice. Mice
were injected with 2 mL of thioglycolate IP, and, at the indicated
times, peritoneal cells were harvested by lavage and quantified.
Cathepsin G 1/1 and 2/2 mice demonstrate nearly identical num-
bers of total cells and neutrophils in the peritoneal harvests. This
experiment was repeated 3 times with similar results. (C) Inflamma-
tion induced by IP injection of S aureus is not altered in cathepsin
G2/2 mice. S aureus (108 CFU) was injected into the peritoneal
cavities of 3 cathepsin G1/1 or 2/2 mice, and peritoneal lavage was
performed 2 hours later. There is no significant difference between
the total cells or the number of neutrophils harvested from cathepsin
G1/1 or 2/2 mice. This experiment was repeated twice with similar
results.
CATHEPSIN G-DEFICIENT MICE 4289

G2/2 129/SvJ mice. The survival of cathepsin G1/1 versus pneumoniae and E coli were chosen, because neutrophil
cathepsin G2/2 animals was not significantly different (Fig 6A). elastase-deficient mice have been shown to have a defect in the
Similarly, we wanted to determine whether cathepsin G was clearance of both organisms.80 Three different doses of K
required for the clearance of Gram-negative organisms. K pneumoniae (1 3 105, 5 3 105, or 1 3 106 CFU) were injected
IP into a total of 27 cathepsin G1/1 mice and 23 cathepsin
G2/2 mice. At every dose tested, the survival of cathepsin
G2/2 mice was not different from that of wild-type mice. Data
from the 1 3 106 CFU dose are shown in Fig 6B. There is a
trend toward fewer deaths in cathepsin G2/2 mice, but this
difference is not statistically significant.
Finally, we defined the LD50 for E coli in 129/SvJ mice,
which was 3 3 104 CFU. This dose of bacteria was adminis-
tered IP to 13 wild-type mice, 12 neutrophil elastase2/2 mice,
or 12 cathepsin G2/2 mice, all in the pure 129/SvJ back-
ground. As shown in Fig 6C, the neutrophil elastase-deficient
mice all succumb to the E coli infection within 48 hours,
whereas approximately 50% of both wild-type and cathepsin
G-deficient mice survive. The difference between the survival
of NE2/2 mice versus wild-type or cathepsin G2/2 mice is
statistically significant (P , .01).
Human cathepsin G does not inhibit growth of E coli or K
pneumoniae in vitro, but neutrophil elastase does. Because
previous reports of the microbicidal activities of cathepsin G
had exclusively used purified human cathepsin G and because 2
of the microbicidal peptides of human cathepsin G (aa 77-83
and aa 117-136) are not completely conserved in mice (see
Discussion), we decided to directly test and compare the
microbicidal activities of highly purified human cathepsin G
and neutrophil elastase. We incubated 105 mid-log phase
bacteria in the absence or presence of purified human cathepsin
G or neutrophil elastase (both at 50 µg/mL) for 4 hours.
Bacterial killing was quantified by applying serial dilutions of
bacteria to agarose plates followed by overnight incubation.
Although human neutrophil elastase inhibits the growth of both
K pneumoniae and E coli, as previously shown,80 the same dose
of cathepsin G has no effect on the growth of either organism
(Fig 7). Neither enzyme affects the growth of S aureus.

DISCUSSION
In this report, we describe mice bearing a loss-of-function
mutation of the cathepsin G gene. These mice have normal
growth, development, and fertility and display normal hemato-
poietic development. The neutrophils of cathepsin G2/2 mice
have normal morphology, normal phagocytosis, and normal
production of superoxide in response to in vitro stimuli. These
neutrophils have no defect in their ability to migrate towards a
variety of chemotactic stimuli in vitro and in vivo. Cathepsin
Fig 6. Survival of mice challenged with IP injections of S aureus, E
coli, and K pneumoniae. (A) Cathepsin G1/1 or 2/2 mice in the G2/2 mice are able to clear S aureus, K pneumoniae, and E
129/SvJ strain were challenged with 108 CFU of S aureus. There is no coli infections as efficiently as wild-type animals, suggesting
significant difference between the survival of 1/1 and 2/2 animals. that this enzyme is not necessary for the normal clearance of
(B) K pneumoniae (1 3 106 CFU) was injected IP into cathepsin G1/1
any of these bacterial species.
or 2/2 animals in the 129/SvJ strain, and survival was plotted. No
difference in survival was noted for the 2 groups. (C) Survival of Even though cathepsin G is one of the most abundant proteins
wild-type, cathepsin G2/2, and NE2/2 mice in response to IP found in human and mouse neutrophils, mice that are deficient
challenge with E coli. E coli (3 3 104 CFU) was injected IP into groups for this enzyme have no clear-cut phenotype, except for a
of 12 cathepsin G2/2, NE2/2, and wild-type (1/1) littermates and
survival was assessed over time. The survival of cathepsin G2/2
transient defect in wound healing that is accompanied by
mice is not different from that of wild-type, but the survival NE2/2 excessive neutrophilic infiltration of wounds.65 The minimal
mice is significantly less than that of the other groups (P I .01). phenotype observed is quite surprising, because a large body of
4290 MACIVOR ET AL

Fig 7. Purified human neutrophil elastase inhibits the growth of E coli and K pneumoniae, but human cathepsin G does not. Mid-log phase
bacteria (105) were incubated in the absence (control) or presence of purified human neutrophil elastase or cathepsin G at 37°C for 4 hours, as
described in Materials and Methods. Serial dilutions were immediately spread on agarose plates and the number of CFUs was determined after
overnight incubation. Although neutrophil elastase inhibits the growth of both Gram-negative rods, cathepsin G does not. Neither enzyme
effects the growth of S aureus. This experiment was repeated twice with similar results.

literature has strongly suggested that cathepsin G might have cathepsin G may be involved in inactivating proinflammatory
specific, nonredundant functions in physiologic settings. molecules at the sites of wound injury, thereby providing a
One potential reason for the lack of an obvious phenotype in dampening effect on continued neutrophil influx at these sites.
these animals is that the cathepsin G mutation is not truly null. Although the precise molecules responsible for this effect are
However, cathepsin G mRNA and protein are not detectable in not known, the ability of cathepsin G to cleave and inactivate
cathepsin G2/2 mice. Even more importantly, bone marrow IL-1, TNF, and IL-854-56 suggest that one or more of these
extracts from cathepsin G2/2 mice have no detectable ability molecules could be involved in this process.
to cleave the peptide substrate N-Succinyl-Ala-Ala-Pro-Phe- Cathepsin G has been shown to cleave and inactivate several
pNA. The complete lack of protease activity against this clotting factors,21-26 cleave and/or modulate the function of the
substrate indicates that there are no other enzymes with the thrombin receptor,27-29 and activate platelets in vitro.30-38 How-
same specificity in the bone marrow. This result also suggests ever, we found no gross hemostatic defects in cathepsin G2/2
that, if the functions of cathepsin G can be rescued by other animals. Because neutrophil elastase has activity in many of the
proteases (eg, neutrophil elastase, azurocidin, and/or protein- same in vitro assays involving clotting factors and platelet
ase-3, which are all presumably present at normal levels in activation, this enzyme may be capable of substituting for
cathepsin G2/2 mice), then these functions must be rescued by cathepsin G in this setting; however, neutrophil elastase defi-
protease activities that are different from that of cathepsin G. cient mice also have no obvious defects in hemostasis.80 It will
This result argues that the gene that we have knocked-out is therefore be important to determine whether mice doubly
indeed the functional orthologue of human cathepsin G, because deficient for both cathepsin G and neutrophil elastase have more
human cathepsin G also cleaves this peptide substrate with high severe defects in hemostasis.
specificity. It is also possible that cathepsin G has specific Cathepsin G-deficient mice have no apparent defect in their
functions that are masked by the presence of the other related ability to clear S aureus, K pneumoniae, or E coli. A large
azurophil granule proteases in vivo. Neutrophil elastase, azuro- number of studies had previously suggested that purified human
cidin, and proteinase-3 are clustered on a different chromosome cathepsin G had growth-inhibitory effects and/or bactericidal
(19 pter) and are coordinately regulated and expressed along effects on S aureus, E coli, and additional bacteria in vitro and
with cathepsin G in the azurophil granules of promyelocytes. that the protease activity of cathepsin G was not required for
The functions of these highly related proteases may be difficult this effect. Three different peptides derived from human cathep-
to fully define until mice deficient for more than 1 of these sin G (aa 1-5, aa 77-83, and aa 117-136) have been shown to
enzymes are analyzed. have microbicidal activity. Although the first peptide (aa 1-5) is
The only assay that suggests that cathepsin G may have conserved in the mouse, the sequence of the second peptide (aa
unique substrates in vivo is wound healing. In the wound 77-83) in mice is HPDYNPQ. Alanine substitutions in positions
healing studies, we learned that incisional wounds displayed a 3, 6, and 7 of the human HPQYNQR peptide each reduce
significant reduction in tensile strength on day 7 after wound- bactericidal activity of the peptide by approximately 2.5-fold.48
ing; this defect was associated with increased neutrophilic The third peptide (aa 117-136) contains 16 of 20 identical
inflammation at the site of wounding.65 The wound strength had residues in the mouse, but 2 of the 4 arginine residues that are
completely normalized by day 10. The wound fluid of cathepsin important for microbicidal function are altered (Arg 117 Gln
G-deficient mice contained significantly increased chemotactic and Arg 133 Ser). Because the 77-83 and 117-136 peptides are
activity for wild-type neutrophils, suggesting that increased not completely conserved, it is possible that human cathepsin G
levels of proinflammatory cytokines (or other mediators) were is important for bacterial killing, but murine cathepsin G is not.
present in this wound fluid. Indirectly, these data suggest that However, in this study, we have not been able to demonstrate a
CATHEPSIN G-DEFICIENT MICE 4291

role for human cathepsin G in bacterial killing in vitro, in additional members of the mast cell chymase family located
contrast to previously published work. Although we do not further downstream). These data also suggest that this large
understand the reason for this difference, our in vitro and in vivo protease gene cluster may contain at least 2 distinct regulatory
results do corroborate one another. domains. One domain would include all of the granzyme genes
Neutrophil elastase-deficient mice have a defect in their upstream from cathepsin G; this domain may be regulated by an
ability to clear both K pneumoniae and E coli.80 Purified human LCR near granzyme B. The second domain, which would
neutrophil elastase inhibits the growth of these two Gram- include cathepsin G and the mast cell chymases, may be
negative rods, but equivalent concentrations of human cathep- controlled by a separate LCR that is active in the myeloid
sin G had no inhibitory activity. The preparations of enzymes compartment, but not the NK/T-compartment. Further experi-
that were used in these assay were both fully active, and the ments will be required to test this hypothesis.
concentrations of the enzymes were carefully confirmed. There- In summary, our experiments have shown that many of the
fore, human and murine neutrophil elastase both have a specific, previously defined in vitro activities of cathepsin G are either
nonredundant ability to kill Gram-negative rods in vitro and in irrelevant or redundant when a whole animal model of cathep-
vivo; cathepsin G cannot substitute for this function in either sin G deficiency is examined. Additional experiments will be
setting. required to further define the normal functions of cathepsin G,
Several recent studies have suggested that cathepsin G is not using mice that are also deficient for neutrophil elastase or
only found in the azurophil granules of neutrophils, but also on the related azurophil granule proteases azurocidin and/or
the surface of these cells.17,18,81 A role for cathepsin G on the cell proteinase 3.
surface has been suggested by the fact that a1 antichymotrypsin
(and also antibodies specific for cathepsin G) can reduce the ACKNOWLEDGMENT
ability of neutrophils to undergo chemotaxis towards a variety The authors thank Dr Bob Senior for many helpful discussions,
of stimuli.19,20 These results suggested that cell surface- Robin Wesselschmidt for blastocyst injections, and Pam Goda and
associated cathepsin G may play a specific role in the chemotac- Kelly Schrimpf for excellent animal care. We thank Dan Link and Jeff
tic response. Additionally, cathepsin G itself has been shown to Haug for performing the neutrophil calcium flux assays, Diane Kelley
have chemotactic activity for neutrophils and monocytes, for the chemotaxis assays, Marilyn Levy for Transmission Electron
suggesting that cathepsin G release by neutrophils may amplify Microscopy, and Sujan Shresta for the flow studies of lymphoid organs.
Nancy Reidelberger expertly prepared the manuscript.
a chemoattractant response.82 However, our data showed that
there is no specific chemotactic defect for cathepsin G-deficient
neutrophils using fMLP, C5a, or rhIL-8 as the chemotactic REFERENCES
stimuli. Similarly, neutrophil calcium fluxes induced by these 3 1. Bainton DF, Ullyot JL, Farquhar MG: The development of
molecules are essentially normal in cathepsin G2/2 neutro- neutrophilic polymorphonuclear leukocytes in the human bone marrow.
phils. In vivo, we observed no clear defect in the ability of J Exp Med 134:907, 1971
2. Hanson RK, Connolly NL, Burnett D, Campbell EJ, Senior RM,
neutrophils to migrate into the peritoneal space of mice treated
Ley TJ: Developmental regulation of the human cathespin G gene in
with thioglycolate or S aureus, suggesting that the in vivo
myelomonocytic cells. J Biol Chem 265:1524, 1990
chemoattractant response (and also the ability of neutrophils to 3. Heck LW, Rostand KS, Hunter FA, Brown A: Isolation, character-
leave the circulation and migrate into the peritoneal space) is ization, and amino-terminal amino acid sequence analysis of human
not impaired in these mice. Although the possibility clearly neutrophil cahtepsin G from normal donors. Anal Biochem 158:217,
exists that other proteases can substitute for the function of 1986
cathepsin G in this setting, it is also possible that cathepsin G 4. Salvesen G, Farley D, Shuman J, Przybyla A, Reilly C, Travis J:
may not be required for neutrophil chemotaxis in vivo. Molecular cloning of human cathepsin G: Structural similarity to mast
Lymphokine-activated killer cells derived from mice that cell and cytotoxic T lymphocyte proteinases. Biochemistry 26:2289,
contain a retained PGK-neo cassette in the granzyme B gene 1987
5. Hof P, Mayr I, Huber R, Korzus E, Potempa J, Travis J, Powers
demonstrate a loss of granzyme B mRNA, as expected, but also
JC, Bode W: The 1.8 A crystal structure of human cathepsin G in
lose expression of granzymes C, D, F, and G. This phenomenon,
complex with Suc-Val-Pro-PheP-(OPh)2: A Janus-faced proteinase with
known as the neighborhood effect, is thought to be due to the two opposite specificities. EMBO J 15:5481, 1996
productive interaction of a locus control region (LCR; presum- 6. Hohn PA, Popescu NC, Hanson RD, Salvesen G, Ley TJ:
ably upstream from granzyme B) with the PGK-neo cassette; Genomic organization and chromosomal localization of the human
this may disrupt normal interactions between the LCR and the cathepsin G gene. J Biol Chem 23:13412, 1989
downstream granzyme genes. In mice containing the granzyme 7. Heusel JW, Scarpati EM, Jenkins NA, Gilbert DJ, Copeland NG,
B mutation, cathepsin G mRNA levels are normal.10,66 We have Shapiro SD, Ley TJ: Molecular cloning, chromosomal location, and
also shown that the retained PGK-neo cassette in the cathepsin tissue-specific expression of the murine cathepsin G gene. Blood
G gene has minimal effects on the expression of the granzymes, 81:1614, 1993
8. Crosby JL, Bleackley RC, Nadeau JH: A complex of serine
suggesting that the neighborhood effect is predominantly unidi-
protease genes expressed preferentially in cytotoxic T-lymphocytes is
rectional.10 In this report, we show that mast cells cultured in
closely linked to the T-cell receptor a- and d-chain genes on mouse
vitro from cathepsin G-deficient mice contain no cathepsin G chromosome 14. Genomics 6:252, 1990
mRNA, as expected, but also demonstrate a 10-fold reduction in 9. Hanson RD, Hohn PA, Popescu NC, Ley TJ: A cluster of
mMCP-2 mRNA levels. These data strongly suggest that the hematopoietic serine protease genes is found on the same chromosomal
retained PGK-neo cassette in the cathepsin G gene has a band as the human a/d T-cell receptor locus. Proc Natl Acad Sci USA
neighborhood effect on the mMCP-2 gene (and perhaps on 87:960, 1990
4292 MACIVOR ET AL

10. Pham CTN, MacIvor DM, Hug BA, Heuse JW, Ley TJ: 29. Renesto P, Chignard M: Enhancement of cathepsin G-induced
Long-range disruption of gene expression by a selectable marker platelet activation by leukocyte elastase: Consequence for the neutrophil-
cassette. Proc Natl Acad Sci USA 93:13090, 1996 mediated platelet activation. Blood 82:139, 1993
11. Huang R, Blom T, Hellman L: Cloning and structural analysis of 30. Selak MA, Chignard M, Smith JB: Cathepsin G is a strong
mMCP-1, mMCP-4, and mMCP-5, three mouse mast cell-specific platelet agonist released by neutrophils. Biochem J 251:293, 1988
serine proteases. Eur J Immunol 21:1611, 1991 31. Selak MA, Smith JB: Cathepsin G binding to human platelets.
12. Caughey GH, Schaumberg TH, Zerweck EH, Butterfield JH, Am J Physiol 266:39, 1990
Hanson RD, Silverman GA, Ley TJ: The human mast cell chymase gene 32. Ferrer-Lopez P, Renesto P, Schattner M, Bassot S, Laurent P,
(CMA1): Mapping to the cathepsin G/granzyme gene cluster and Chignard M: Activation of human platelets by C5a-stimulated neutro-
lineage-restricted expression. Genomics 15:614, 1993 phils: A role for cathepsin G. Am J Physiol 258:C1100, 1990
13. Gurish MF, Nadeau JH, Johnson KR, McNeil HP, Grattan KM, 33. Evangelista V, Rajtar G, de Gaetano G, White JG, Cerletti C:
Austen KF, Stevens RL: A closely linked complex of mouse mast Platelet activation by fMLP-stimulated polymorphonuclear leukocytes:
cell-specific chymase genes on chromosome 14. J Biol Chem 268: The activity of cathepsin G is not prevented by antiproteinases. Blood
11372, 1993 77:2379, 1991
14. Zimmer M, Medcalf RL, Fink TM, Mattman C, Lichter P, Jenne 34. Evangelista V, Piccardone P, White JG, de Gaetano G, Cerletti C:
DE: Three human elastase-like genes coordinately expressed in the Cathepsin G-dependent platelet stimulation by activated polymorpho-
myelomonocyte lineage are organized as a single genetic locus on nuclear leukocytes and its inhibition by antiproteinases: Role of
19pter. Proc Natl Acad Sci USA 89:8215, 1992 P-selectin-mediated cell-cell adhesion. Blood 81:2947, 1993
15. Grisolano JL, Sclar GM, Ley TJ: Early meyloid-specific expres- 35. LaRosa CA, Rohrer MJ, Benoit SE, Rodino LJ, Barnard MR,
sion of the human cathepsin G gene in transgenic mice. Proc Natl Acad Michelson AD: Human neutrophil cathepsin G is a potent platelet
Sci USA 91:8989, 1994 activator. J Vasc Surg 19:306, 1994
36. Cerletti C, Evangelista V, Molino M, de Gaetano G: Platelet
16. Tanaku T, Minematsu Y, Reilly CF, Travis J, Powers JC: Human
activation by polymorphonuclear leukocytes: Role of cathepsin G and
leukocyte cathepsin G. Subsite mapping with 4-nitroanilides, chemical
P-selectin. Thromb Haemost 74:218, 1995
modification, and effect of possible cofactors. Biochemistry 24:2040,
37. Si-Tahar M, Renesto P, Falet H, Rendu F, Chignard M: The
1985
phospholipase C/protein kinase C pathway is involved in cathepsin
17. Maison CM, Villiers CL, Colomb MG: Proteolysis of C3 on
G-induced human platelet activation. Comparison with thrombin.
U937 cell plasma membranes. J Immunol 147:921, 1991
Biochem J 313:401, 1996
18. Owen CA, Campbell MA, Sannes PL, Boukedes SS, Campbell
38. Renesto P, Si-Tahar M, Moniatte M, Balloy V, Van Dorsselaer A,
EJ: A surface-bound elastase and cathepsin G on human neutrophils: A
Pidard D, Chignard M: Specific inhibition of thrombin-induced cell
novel, non-oxidative mechanism by which neutrophils focus and
activation by the neutrophil proteinases elastase, cathepsin G, and
preserve catalytic activity of serine proteases. J Cell Biol 131:775, 1995
proteinase 3: Evidence for distinct cleavage sites within the aminotermi-
19. Stockley RA, Shaw J, Afford SC, Morrison HM, Burnett D:
nal domain of the thrombin receptor. Blood 89:1944, 1997
Effect of alpha-1-proteinase inhibitor on neutrophil chemotaxis. Am J 39. Odeberg H, Olsson I: Antibacterial activity of cationic proteins
Respir Cell Mol Biol 2:163, 1990 from human granulocytes. J Clin Invest 56:1118, 1975
20. Lomas DA, Stone SR, Llewellyn-Jones C, Keogan M-T, Wang 40. Odeberg H, Olsson I: Mechanisms for the microbicidal activity
Z, Rubin H, Carrell RW, Stockley RA: The control of neutrophil of cationic proteins of human granulocytes. Infect Immunity 14:1269,
chemotaxis by inhibitors of cathepsin G and chymotrypsin. J Biol Chem 1975
270:23437, 1995 41. Shafer WM, Onunka VC, Martin LE: Antigonococcal activity of
21. Gramse M, Bingenheimer C, Havemann K: Degradation of human neutrophil cathepsin G. Infect Immunity 54:184, 1986
human fibrinogen by chymotrypsin-like neutral protease from human 42. Shafer WM, Onunka VC: Mechanism of staphylococcal resis-
granulocytes. Thromb Res 19:210, 1980 tance to non-oxidative antimicrobial action of neutrophils: Importance
22. Turkington PT, Blumsom NL, Elmore DT: The degradation of of pH and ionic strength in determining the bacterial action of cathepsin
bovine and human prothrombin by human polymorphonuclear leuko- G. J Gen Microbiol 135:825, 1989
cyte cathepsin G. Thromb Res 44:339, 1996 43. Alford CE, Amaral E, Campbell PA: Listericidal activity of
23. Brezniak DV, Brower MS, Witting JI, Walz DA, Fenton II JW: human neutrophil cathepsin G. J Gen Microbiol 136:997, 1990
Human alpha- to zeta-thrombin cleavage occurs with neutrophil cathep- 44. Guyonnet V, Johnson JK, Bangalore N, Travis J, Long PL: In
sin G or chymotrypsin while fibrinogen clotting activity is retained. vitro activity of the human neutrophil cathepsin G on Eimeria tenella
Biochemistry 29:3536, 1990 sporozoites. J Parasitol 77:775, 1991
24. Turkington PT: Cathepsin G, a regulator of human vitamin K. 45. Miyasaki KT, Bodeau AL: In vitro killing of oral Capnocyto-
Dependent clotting factors and inhibitors. Thromb Res 67:147, 1992 phaga by granule fractions of human neutrophils is associated with
25. Anderssen T, Halvorsen H, Bajaj SP, Osterud B: Human cathepsin G activity. J Clin Invest 87:1585, 1991
leukocyte elastase and cathepsin G inactivate factor VII by limited 46. Bangalore N, Travis J, Onunka VC, Pohl J, Shafer WM:
proteolysis. Thromb Haemost 70:414, 1993 Identification of the primary antimicrobial domains in human neutrophil
26. Allen DH, Tracy PB: Human coagulation factor V is activated to cathepsin G. J Biol Chem 265:13584, 1990
the functional cofactor by elastase and cathepsin G expressed at the 47. Shafer WM, Polh J, Onunka VC, Bangalore N, Travis J: Human
monocyte surface. J Biol Chem 270:1408, 1995 lysosomal cathepsin G and granzyme B share a functionally conserved
27. Weksler BB, Jaffe EA, Brower MS, Cole OF: Human leukocyte broad spectrum antibacterial peptide. J Biol Chem 266:112, 1991
cathepsin G and elastase specifically suppress thrombin-induced prosta- 48. Shafer WM, Hubalek F, Huang M, Pohl J: Bactericidal activity of
cyclin production in human endothelial cells. Blood 74:1627, 1989 a synthetic peptide (CG 117-136) of human lysosomal cathepsin G is
28. Molino M, Blanchard N, Belmonte E, Tarver AP, Abrams C, dependent on arginine content. Infect Immunity 64:4842, 1996
Hoxie JA, Cerletti C, Brass LF: Proteolysis of the human platelet and 49. Reilly CF, Tewksbury DA, Schechter NM, Travis J: Rapid
endothelial cell thrombin receptor by neutrophil-derived cathepsin G. J conversion of angiotensin I to angiotensin II by neutrophil and mast cell
Biol Chem 270:11168, 1995 proteinases. J Biol Chem 257:8619, 1982
CATHEPSIN G-DEFICIENT MICE 4293

50. Nahori M-A, Renesto P, Vargaftig BB, Chignard M: Activation 68. Senior R, Campbell EJ: Cathepsin G in human mononuclear
and damage of cultured airway epithelial cells by human elastase and phagocytes: Comparisons between monocytes and U937 monocyte-like
cathepsin G. Eur J Pharmacol 228:213, 1992 cells. J Immunol 132:2547, 1984
51. Sommerhoff CP, Nadel JA, Basbaum CB, Caughey GH: Neutro- 69. Eklund KK, Ghildyal N, Austen F, Friend DS, Schiller V, Stevens
phil elastase and cathepsin G stimulate secretion from cultured bovine RL: Mouse bone marrow-derived mast cells (mBMMC) obtained in
airway gland serous cells. J Clin Invest 85:682, 1990 vitro from mice that are mast cell-deficient in vivo expresses the same
52. Peterson MW: Neutrophil cathepsin G increases transendothelial panel of granule proteases as mBMMC and serosal mast cells from their
albumin flux. J Lab Clin Med 113:297, 1989 normal littermates. J Exp Med 180:67, 1994
53. Franzoso G, Biswas P, Poli G, Carlson LM, Brown KD, 70. Sugawara T, Miyamoto M, Takayama S, Kato M: Separation of
Tomita-Yamaguchi M, Fauci AS, Siebenlist UK: A family of serine neutrophils from blood in human and laboratory animals and compari-
proteases expressed exclusively in myelo-monocytic cells specifically son of the chemotaxis. J Pharmacol Toxicol Methods 33:91, 1995
processes the nuclear factor-Kappa B subunit p65 in vitro and may 71. Aiuti A, Webb IJ, Bleul C, Springer T, Gutierrez-Ramos JC: The
impair human immunodeficency virus replication in these cells. J Exp chemokine SDF-1 is a chemoattractant for human CD341 hematopoi-
Med 180:1445, 1994 etic progenitor cells and provides a new mechanism to explain the
54. Scuderi P, Nez PA, Derr ML, Wong BJ, Valdez CM: Cathepsin-G mobilization of CD341 progenitors to peripheral blood. J Exp Med
and leukocyte elastase inactivate human tumor necrosis factor and 185:111, 1997
lymphotoxin. Cell Immunol 135:299, 1991 72. Kim C, Epner E, Forrester W, Groudine M: Inactivation of the
55. Hazuda DM, Strickler J, Kueppers F, Simon PL, Young PR: human beta-globin gene by targeted insertion into the beta-globin locus
Processing of precursor interleukin 1 beta and inflammatory disease. J control region. Genes Dev 6:928, 1992
Biol Chem 265:6318,1990 73. Fiering S, Kim C, Epner E, Groudine M: An ‘‘in-out’’ strategy
56. Padrines M, Wolf M, Walz A, Baggiolini M: Interleukin-8 using gene targeting and FLP recombinase for the functional dissection
of complex DNA regulatory elements: Analysis of the beta-globin locus
processing by neutrophil elastase, cathepsin G and proteinase-3. FEBS
control region. Proc Natl Acad Sci USA 90:8469, 1993
Lett 352:231, 1994
74. Fiering S, Epner E, Robinson K, Zhuang Y, Telling A, Hu M,
57. Malemud CJ, Janoff A: Identification of neutral proteases in
Martin DIK, Enver T, Ley TJ, Groudine M: Targeted deletion of 58 HS2
human neutrophil granules that degrade articular cartilage proteogly-
of the murine b-globin LCR reveals that it is not essential for proper
can. Arthritis Rheum 18:361, 1975
regulation of the b-globin locus. Genes Dev 9:2203, 1995
58. Roughley PJ, Barrett AJ: The degradation of cartilage proteogly-
75. Hug BA, Wesselschmidt RL, Fiering S, Bender MA, Epner E,
cans by tissue proteinases. Proteoglycan structure and its susceptibility
Groudine M, Ley TJ: Analysis of mice containing a targeted deletion of
to proteolysis. Biochem J 167:629, 1977
b-globin locus control region 58 hypersensitive 3. Mol Cell Biol
59. Starkey PM, Barrett AJ, Burleigh MC: The degradation of
16:2906, 1996
articular collagen by neutrophil proteinases. Biochem Biophys Acta
76. Ghildyal N, Friend DS, Nicodemus CF, Austen KF, Stevens RL:
483:386, 1977 Reversible expression of mouse mast cell protease 2 mRNA and protein
60. Wintroub BU, Coblyn JS, Kaempfer CE, Austen KF: Cleavage in cultured mast cells exposed to IL-10. J Immunol 151:3206, 1993
of fibronectin by the human neutrophil neutral peptide-generating 77. Eklund KK, Ghildyal N, Austen KF, Stevens RL: Induction by
protease. Proc Natl Acad Sci USA 77:5448, 1980 IL-9 and suppression by IL-3 and IL-4 of the levels of chromosome
61. Reilly CF, Travis J: The degradation of human lung elastin by 14-derived transcripts that encode late-expressed mouse mast cell
neutrophil proteinases. Biochim Biophys Acta 621:147, 1980 proteases. J Immunol 151:4266, 1993
62. Vartio T, Seppa H, Vaheri A: Susceptibility of soluble and matrix 78. Kilpatrick L, Johnson JL, Nickbarg EG, Wang Z, Clifford TF,
fibronectins to degradation by tissue proteinases, mast cell chymase and Banach M, Cooperman BS, Douglas SD, Rubin H: Inhibition of human
cathepsin G. J Biol Chem 256:471, 1981 neutrophil superoxide generation by alpha-1-antichymotrypsin. J Immu-
63. Vartio T: Characterization of the binding domains in the frag- nol 146:2388, 1991
ments cleaved by cathepsin G from human plasma fibronectin. Eur J 79. Kilpatrick L, McCawley L, Naciappan V, Greer W, Majumdar S,
Biochem 123:223, 1982 Korchak HM, Douglas SD: Alpha-1-antichymotrypsin inhibits the
64. Capodici C, Berg RA: Cathepsin G degrades denatured collagen. NADPH oxidase-enzyme complex in phorbol ester-stimulated neutro-
Inflammation 13:137, 1989 phil membranes. J Immunol 149:3059, 1992
65. Abbott RE, Corral CJ, MacIvor DM, Lin X, Ley TJ, Mustoe TA: 80. Belaaouaj B, McCarthy R, Baumann M, Gao Z, Ley TJ, Abraham
Augmented inflammatory responses and altered wound healing in SN, Shapiro SD: Mice lacking neutrophil elastase reveal impaired host
cathepsin G-deficient mice. Arch Surg 133:1002, 1998 defense against gram negative bacterial sepsis. Nat Med 4:615, 1998
66. Heusel JW, Wesselschmidt R, Shresta S, Russell J, Ley TJ: 81. Owen CA, Campbell EJ: Angiotensin II generation at the cell
Cytotoxic lymphocytes require granzyme B for the rapid induction of surface of activated neutrophils: Novel cathepsin G-mediated catalytic
DNA fragmentation and apoptosis in allogeneic target cells. Cell activity that is resistant to inhibition. J Immunol 160:1436, 1998
76:977, 1994 82. Chertov O, Ueda H, Xu LL, Tani K, Murphy WJ, Wang JM,
67. Ley TJ, Maloney KA, Gordon JI, Schwartz AL: Globin gene Howard OM, Sayers TJ, Oppenheim JJ: Identification of human neutrophil-
expression in erythroid human fetal liver cells. J Clin Invest 83:1032, derived cathepsin G and azurocidin/CAP37 as chemoattractants for
1989 mononuclear cells and neutrophils. J Exp Med 186:739, 1997