You are on page 1of 196

Volume 143

Number 1

October 1, 2010

www.cell.com

Directing Nerve Regeneration


Lasker Awards Essays
017.A1.0115.A © 2010 Eppendorf AG
 Joystick provides
intuitive control

microinjection

search level

B
A
 Patented axial
injection level
C
injection movement
of the capillary
carrier

 Semi-Automatic
microinjection into
adherent cells

 Pre-pull capillaries for


reproducible injection
of adherent cells
InjectMan
NI 2

Microinjection simplified!
Microinjection is one of the core methods to introduce Eppendorf InjectMan NI 2 microinjector has it all:
foreign DNA and other non-permeable molecules into  Motorized X-Y-Z movements provide precise movement
cells. Nuclear injection of plasmid DNA enables rapid  Pre-setting and storage of up to 2 locations in X-Y-Z,
expression of proteins in specific cells within saves time in returning to pre-set work locations
a population.  Automated Home function for rapid capillary exchange
 Joystick-controlled provides overall ergonomic manipulator
The menu-controlled, programmable micromanipulator  Fine adjustment of work speed made easy with
InjectMan NI 2 is ideally suited for microinjection of adherent positioning wheel
cells. Connection with the FemtoJet and the axial mounting  Can be adapted to all common microscopes
allows injections at 45˚ angle reducing cell damage during
injection and increases cell viability. This guarantees a very For more information visit www.eppendorf.com
rapid, safe and reproducible microinjection process.

www.eppendorf.com • Email: info@eppendorf.com


In the U.S.: Eppendorf North America, Inc. 800-645-3050 • In Canada: Eppendorf Canada Ltd. 800-263-8715
BE THE FIRSTto read the latest issue of any Cell Press journal.

Register for Cell Press Email Alerts and get the complete table of contents as soon as
the issue publishes online — FREE!

Cell Press Email Alerts deliver the news, research, and commentaries featured in each
journal’s latest issue, including the full title of every article, direct links to the articles,
and the complete author list. Plus, to save you time, each research article has a brief
summary highlighting its significant findings.

You don’t have to be a subscriber to sign up for Cell Press Email Alerts. While subscribers have
instant access to the full text of all articles listed in the Email Alerts, non-subscribers can read
the abstracts of all articles as well as the full text of the issue’s Featured Article.

www.cellpress.com
Cancer Research
Gene Expression Analysis You Can Count On
10 12
Achieve fast and accurate measurement of gene expression
Control levels using our comprehensive range of high-performance
Bortezomib 10
8 kits, reagents, and instruments.
HG normalized Cp values

8
6 L Q
uantifygene expression levels using customizable,
6 pathway-specific RealTime ready qPCR panels for the
4
4 LightCycler® 480 qPCR System.
2
2 L P
reservethe original RNA signal-generating
0 0 characteristics using the High Pure RNA Isolation Kit
and Transcriptor Reverse Transcriptase.
-2
HSP1A1 USP7 CASP3 CASP4 BIRC5 CTSS CTSC TIMP1 L A
cquire gene expression data at the right time point
TNFRSF10 BBC3 CASP7 BIRC3 CTSB ATAG4C ADAM10
using the combination of the xCELLigence Real-Time Cell
Analyzer and RealTime ready assays and panels.
Roche products identify small changes in gene expression induced by the
proteasome inhibitor bortezomib: Histograms show differential regulation for L R
elyon accuracy and specificity, regardless of
specific genes after using the High Pure RNA Isolation Kit, Transcriptor First
throughput or instrument. Choose the LightCycler® qPCR
Strand cDNA Synthesis Kit, LightCycler® 480 Probes Master, and RealTime ready
Protease Custom Panel. Further experimental details are described in Cancer
platform appropriate for your research scale, or use
Research Application Note No. 2 found at www.cancer-research.roche.com FastStart Universal qPCR master mixes for high performance
Data kindly provided by H. Barti-Juhász, University, Budapest, Hungary. on other instruments.

Please visit us at www.cancer-research.roche.com for


application notes and more detailed information using Roche
Applied Science products in cancer research.

For life science research only. Not for use in diagnostic procedures.
FASTSTART, HIGH PURE, LIGHTCYCLER, REALTIME READY, and XCELLIGENCE
are trademarks of Roche. Roche Diagnostics GmbH
Other brands and product names are trademarks of their respective holders.
Roche Applied Science
© 2010 Roche Diagnostics GmbH. All rights reserved. 82372 Penzberg, Germany
Editor Editorial Board Douglas Green Dana Pe’er
Emilie Marcus Abul Abbas Leonard Guarente Kathrin Plath
C. David Allis Taekjip Ha Carol Prives
Senior Deputy Editor
Geneviève Almouzni Daniel Haber Klaus Rajewsky
Elena Porro
Uri Alon Ulrike Heberlein Venki Ramakrishnan
Scientific Editors Angelika Amon Nobutaka Hirokawa Rama Ranganathan
Karen Carniol Johan Auwerx Mark Hochstrasser Anne Ridley
Michaeleen Doucleff Richard Axel Arthur Horwich James Roberts
Robert Kruger Cori Bargmann Tony Hunter Alexander Rudensky
Connie M. Lee Konrad Basler James Hurley Helen Saibil
Fabiola Rivas Bonnie Bassler Richard Hynes Joshua Sanes
Lara Szewczak David Baulcombe Thomas Jessell Randy Schekman
Jeffrey Benovic Narry Kim Ueli Schibler
Senior Managing Editor Carolyn Bertozzi Mary-Claire King Joseph Schlessinger
Meredith Adinolfi
Wendy Bickmore David Kingsley Hans Schöler
Deputy Managing Editor Elizabeth Blackburn Frank Kirchhoff Trina Schroer
Andy Smith Joan Brugge Richard Kolodner Geraldine Seydoux
Lewis Cantley John Kuriyan Kevan Shokat
Lead Illustrator Joanne Chory Robert Lamb Pamela Sklar
Andrew A. Tang David Clapham Mark Lemmon Nahum Sonenberg
Illustrators Andrew Clark Beth Levine James Spudich
Yvonne Blanco Hans Clevers Wendell Lim Paul Sternberg
Kate Mahan Stephen Cohen Jennifer Lippincott-Schwartz Bruce Stillman
Pascale Cossart Dan Littman Azim Surani
Production Staff Jeff Dangl Richard Losick Keiji Tanaka
Reyna Clancy Ted Dawson Scott Lowe Craig Thompson
Pier Paolo di Fiore Tom Maniatis Robert Tjian
Editorial Assistant
Marileen Dogterom Matthias Mann Jürg Tschopp
Mary Beth O’Leary
Julian Downward Kelsey Martin Ulrich von Andrian
Bruce Edgar Joan Massagué Gerhard Wagner
Steve Elledge Iain Mattaj Detlef Weigel
Anne Ephrussi Satyajit Mayor Alan Weiner
Ronald Evans Ruslan Medzhitov Jonathan Weissman
Witold Filipowicz Craig Mello Matthew Welch
Marco Foiani Tom Misteli Tian Xu
Elaine Fuchs Tim Mitchison Shinya Yamanaka
Yukiko Goda Alex Mogilner Marino Zerial
Stephen Goff Paul Nurse Xiaowei Zhuang
Joe Goldstein Roy Parker Huda Zoghbi

Cell Office
Cell, Cell Press, 600 Technology Square, 5th Floor, Cambridge, Massachusetts 02139
Phone: (+1) 617 661 7057, Fax: (+1) 617 661 7061, E-mail: celleditor@cell.com
Online Publication: http://www.cell.com

Cell (ISSN 0092-8674) is published biweekly by Cell Press, 600 Technology Square, 5th Floor, Cambridge, Massachusetts 02139. The institutional subscription rate for
2010 is $1,360 (US and Canada) or $1,532 (elsewhere). The individual subscription rate is $202 (US and Canada) or $305 (elsewhere). The individual copy price is $50.
Periodicals postage paid at Boston, Massachusetts and additional mailing offices. Postmaster: send address changes to Elsevier Customer Service Americas,
Cell Press Journals, 11830 Westline Industrial Drive, St. Louis, MO 63146, USA.
The paper used in this publication meets the requirments of ANSI/NISO Z39.48-1992 (Permanence of Paper). Printed by Dartmouth Printing Company, Hanover, NH.
Top-QUALITy LIFe SCIeNCe ReSeARCH e sYm

CoNFeReNCeS pRICeLeSS NeTWoRKINg 40


on

Po
t
KeYs

sia
th

me

n
o
ti
ng seas

e
OctOber 2010 FebrUArY 2011 (continued)
Immunological Mechanisms of Vaccination (S1), Seattle, Neurodegenerative Diseases: the Molecular and cellular basis
Washington, USA for Neurodegeneration (F2), Taos, New Mexico, USA
Mechanisms of cardiac Growth, Death and regeneration (X3)
JANUArY 2011
joint with Molecular cardiology: Disease Mechanisms
tGF-b in Immune responses: From bench to bedside (A2),
and experimental therapeutics (X4), Keystone, Colorado, USA
Snowbird, Utah, USA
Mucosal biology: A Fine balance between tolerance and
Functional consequences of Structural Variation in
Autoimmunity (X5) joint with
the Genome (A1), Steamboat Springs, Colorado, USA
Immunity in the respiratory tract: challenges of the Lung
Frontiers of NMr in biology (A3), Big Sky, Montana, USA
environment (X6), Vancouver, British Columbia, Canada
NK and NKt cell biology: Specificity and redundancy (A4),
evolutionary Developmental biology (c1), Tahoe City, California, USA
Breckenridge, Colorado, USA
DNA replication and recombination (c2), Keystone, Colorado, USA
Adult Neurogenesis (A5), Taos, New Mexico, USA
Histone code: Fact or Fiction? (A6), Midway, Utah, USA MArcH 2011
type 2 Diabetes, Insulin resistance and Metabolic Dysfunction (J1), biofuels (c3), Singapore, Singapore
joint with Obesity (J2), Keystone, Colorado, USA Stem cells, cancer and Metastasis (c4), Keystone, Colorado, USA
tuberculosis: Immunology, cell biology and Novel Vaccination New Frontiers at the Interface of Immunity and Glycobiology (c5),
Strategies (J3) joint with Lake Louise, Alberta, Canada
Mycobacteria: Physiology, Metabolism and Pathogenesis – AAA and related AtP-Driven Protein Machines (c6), Tahoe City,
back to the basics (J4), Vancouver, British Columbia, Canada California, USA
Plant Abiotic Stress tolerance Mechanisms, Water and Global Mechanism and biology of Silencing (c7), Monterey, California, USA
Agriculture (A7), Keystone, Colorado, USA HIV evolution, Genomics and Pathogenesis (X7) joint with
epithelial Plasticity and epithelial to Mesenchymal transition (A8), Protection from HIV: targeted Intervention Strategies (X8),
Vancouver, British Columbia, Canada Whistler, British Columbia, Canada
transmembrane Signaling by GPcrs and channels (b1), Taos, Microbial communities as Drivers of ecosystem complexity (c8),
New Mexico, USA Breckenridge, Colorado, USA
extracellular Matrix and cardiovascular remodeling (b2), Autophagy (D1), Whistler, British Columbia, Canada
Tahoe City, California, USA Hematopoiesis (D2), Big Sky, Montana, USA
the evolution of Protein Phosphorylation (F1), Keystone, Colorado, environmental epigenomics and Disease Susceptibility (D3),
USA Asheville, North Carolina, USA
Stem cells in Development, tissue Homeostasis and Disease (b3),
APrIL 2011
Santa Fe, New Mexico, USA
Metabolic responses to extreme conditions (D4), Big Sky, Montana,
Genomic Instability and DNA repair (b4), Keystone, Colorado, USA
USA
FebrUArY 2011 Immunoregulatory Networks (D5), Breckenridge, Colorado, USA
Lung Development and repair (b5), Santa Fe, New Mexico, USA Drugs from bugs: the Anti-Inflammatory Drugs of tomorrow (Z1)
Immunologic Memory, Persisting Microbes and chronic Disease joint with evolving Approaches to early-Stage Drug Discovery (Z2),
(b6), Banff, Alberta, Canada Snowbird, Utah, USA
Antibodies as Drugs (b7), Keystone, Colorado, USA b cells: New Insights into Normal versus Dysregulated Function
MicrorNAs and Non-coding rNAs and cancer (J5) joint with (D6), Whistler, British Columbia, Canada
MicrorNAs and Human Disease (J6), Banff, Alberta, Canada
MAY 2011
Dendritic cells and the Initiation of Adaptive Immunity (J7) joint Omics Meets cell biology (e1), Alpbach, Austria
with cancer control by tumor Suppressors and Immune effectors
Lipid biology and Lipotoxicity (e2), Killarney, County Kerry, Ireland
(J8), Santa Fe, New Mexico, USA
Pathogenesis of Influenza: Virus-Host Interactions (e3), Hong Kong,
Inositide Signaling in Pharmacology and Disease (X1) joint with
China
PI 3-Kinase Signaling Pathways (X2), Keystone, Colorado, USA
Genetics, Immunology and repair in Multiple Sclerosis (b8), JUNe 2011
Taos, New Mexico, USA changing Landscape of the cancer Genome (F3), Boston,
Massachusetts, USA
Abstract and scholarship deadlines precede meetings by four months. Please check www.keystonesymposia.org/2011meetings for details.
Global Health Travel Award application deadlines for the six designated Global Health conferences precede meeting dates by five months.

www.keystonesymposia.org • 1.800.253.0685 • 1.970.262.1230


Cell Press Display Advertising
Midwest/Southeast/Eastern Canada:
President & CEO Inez Herrero, ph: 585 678 4395; fax: 585 678 4722;
Lynne Herndon e-mail: i.herrero@elsevier.com

Editor in Chief, Vice President of Content Development Mid-Atlantic/New England: Vikki Macomber, ph: 508 928
Emilie Marcus 1255; fax: 508 928 1256; e-mail: v.macomber@elsevier.com

Vice President of Marketing and Publishing West Coast/Western Canada/Asia: Lynne Stickrod, ph: 415
Els Bosma 931 9782; fax: 415 520 6940; e-mail: l.stickrod@elsevier.com

Vice President of Web Development and Operations UK/Europe: James Kenney, ph: +44 20 7424 4216; fax: +44 18
Keith Wollman 6585 3136; e-mail: j.kenney@elsevier.com

Director of Marketing Classified Advertising


Jonathan Atkinson United States and Canada:
Gordon Sheffield, Key Account Manager, ph: 617 386 2189; fax:
Production Supervisor
617 397 2805; e-mail: g.sheffield@elsevier.com
Meredith Adinolfi
UK, Europe, and Asia:
Operations Supervisor
Sabrina Dodge, Key Account Manager, ph: +44 20 7424 4997;
Daniel Fauxsmith
fax: +44 18 6585 3136; e-mail: s.dodge@elsevier.com
Press Officer
Cathleen Genova

ª2010 Elsevier Inc. All rights reserved. or ideas contained in the material herein. Because of rapid advances in
This journal and the individual contributions contained in it are protected the medical sciences, in particular, independent verification of diagnoses
under copyright by Elsevier Inc., and the following terms and conditions and drug dosages should be made. Although all advertising material is
apply to their use: expected to conform to ethical (medical) standards, inclusion in this
Photocopying: publication does not constitute a guarantee or endorsement of the quality
Single photocopies of single articles may be made for personal use as al- or value of such product or of the claims made of it by its manufacturer.
lowed by national copyright laws. Permission of the Publisher and payment Reprints:
of a fee are required for all other photocopying, including multiple or system- Article reprints are available through Cell’s reprint service; for informa-
atic copying, copying for advertising or promotional purposes, resale, and tion, contact Nicholas Pavlow (e-mail: n.pavlow@elsevier.com; ph: (+1)
all forms of document delivery. Special rates are available for educational 212 633 3960).
institutions that wish to make photocopies for nonprofit educational class- Subscription Orders and Inquiries:
room use. For information on how to seek permission, visit www.elsevier. Mail, fax, or e-mail address changes to Elsevier Customer Service Amer-
com/permissions or call (+44) 1865 843830 (UK) / (+1) 215 239 3804 (US). icas, allowing 4–6 weeks for processing. Lost or damaged issues will be
Permissions: replaced, subject to availability, if Cell Press is notified within the claim
For information on how to seek permission, visit www.elsevier.com/ period (US and airmail delivery: 3 months from issue date; surface deliv-
permissions or call (+44) 1865 843830 (UK) / (+1) 215 239 3804 (US). ery: 4 months from issue date). Periodical delivery in the US can take up
Derivative Works: to 3 weeks. Airmail delivery can take 2–4 weeks.
Subscribers may reproduce tables of contents or prepare lists of articles The price of a single copy of Cell is $50 (excluding special issues). All
including summaries for internal circulation within their institutions. orders must be prepaid and in writing. Please include the volume and is-
Permission of the Publisher is required for resale or distribution outside sue number, payment (check or credit card, MasterCard, Visa, or Amer-
the institution. Permission of the Publisher is required for all other deriv- ican Express only), and a delivery address. Allow 4–6 weeks for delivery.
ative works, including compilations and translations (please consult Mailing address: Elsevier Customer Service Americas, Cell Press
www.elsevier.com/permissions). Journals, 11830 Westline Industrial Drive, St. Louis, MO 63146,
USA. Toll-free phone within USA/Canada: 866 314 2355; phone for
Electronic Storage or Usage:
outside US/Canada: (+1) 314 453 7038; fax: (+1) 314 523 5170; e-mail:
Permission of the Publisher is required to store or use electronically any
subs@cell.com; internet: www.cellpress.com or <www.cell.com>.
material contained in this journal, including any article or part of an article
(please consult www.elsevier.com/permissions). Except as outlined Funding Body Agreements and Policies:
above, no part of this publication may be reproduced, stored in a retrieval Elsevier has established agreements and developed policies to allow au-
system, or transmitted in any form or by any means, electronic, mechan- thors whose articles appear in journals published by Elsevier to comply
ical, photocopying, recording, or otherwise, without prior written permis- with potential manuscript archiving requirements as specified as condi-
sion of the Publisher. tions of their grant awards. To learn more about existing agreements and
Notice: policies, visit www.cellpress.com.
No responsibility is assumed by the Publisher for any injury and/or damage Guide for Authors:
to persons or property as a matter of products liability, negligence, or other- For a full and complete guide for authors, please go to www.cell.com/
wise, or from any use or operation of any methods, products, instructions, authors.
stunning quality

Sample Preparation for Next Gen Sequencing


Introducing NEBNext™, a series of highly pure reagents that facilitate sample preparation for downstream applications such
as next generation sequencing and expression library construction. Available in sets, master mixes and modules, these robust
reagents undergo stringent quality controls and functional validation, ensuring maximum yield, convenience and value.

Sequencing coverage map of the E. coli genome after using


NEBNext™ Sample Prep Reagent Set 1 for Sample Preparation

160
Sequence Coverage

140

120

100

80

0 1x106 2x106 3x106 4x106



Genome Position

E. coli strain MG1655 gDNA was prepared with NEBNext Sample Prep Reagent Set I and sequenced on an Illumina Genome
Analyzer II.

For more information about NEBNext, including customized solutions, please contact NEBNext@neb.com.

DNA Amplification Protein Expression & Gene Expression


Cloning & Mapping RNA Analysis
& PCR Analysis & Cellular Analysis
www.neb.com
Leading Edge
Cell Volume 143 Number 1, October 1, 2010

IN THIS ISSUE

SELECT

5 Symmetry Breaking

BENCHMARKS

9 Lasker Lauds Leptin J.S. Flier and E. Maratos-Flier


13 Clinical Application of G.D. Yancopoulos
Therapies Targeting VEGF

17 A Life-Long Quest to Understand D.G. Nathan


and Treat Genetic Blood Disorders

ESSAY

21 MicroRNAs and Cellular Phenotypy K.S. Kosik

PREVIEWS

27 How to Survive Aneuploidy B. Cetin and D.W. Cleveland


29 Auxin Paves the Way S. Pietra and M. Grebe
for Planar Morphogenesis

32 Cell Sorting during Regenerative R. Klein


Tissue Formation

SNAPSHOT

172 Nuclear Receptors III N.J. McKenna and B.W. O’Malley


Antibodies and Related Reagents for Signal Transduction Research

immunocytochemistry, immunohistochemistry, high content screening (HCS) analysis, or flow cytometry applications.
The Alexa Fluor® dye conjugated secondary antibodies are sold under license from Invitrogen, Inc., for research use only in
PathScan® Signaling Nodes
Multiplex IF Kit from Cell Signaling Technology

Immunofluorescent analysis of MCF7 (human breast adenocarcinoma) cells insulin-treated for 5 minutes, using PathScan® Signaling Nodes Multiplex IF Kit #8999.

Cell Signaling Technology, Inc. Alexa Fluor® is a registered trademark of Molecular Probes, Inc.
© 2010 Cell Signaling Technology, Inc. Cell Signaling Technology® and PathScan® are registered trademarks of
PathScan® Signaling Nodes Multiplex IF Kit #8999 from :: The kit allows the analysis of multiple pathway endpoints
Cell Signaling Technology provides a novel multiplex assay to within a single sample, saving time and reagents.
simultaneously assess signaling through key pathway nodes :: The kit is produced and optimized in-house with the
(activated-Akt, p44/42, and S6 Ribosomal Protein) using highest quality antibodies, providing you with the greatest
possible specificity and sensitivity.
automated imaging or laser scanning high content platforms,
or manual immunofluorescence microscopy. The kit provides :: Technical support is provided by our in-house IF group
who developed the product and knows it best.
reagents necessary to perform 100 assays (based on 100 µl
assay volume).

#8999 Kit Targets Detection Dye Ex(max) (nm) Em(max) (nm)


Phospho-Akt (Ser473) Alexa Fluor 555
®
555 565
Phospho-p44/42 (Erk1/2) (Thr202/Tyr204) Alexa Fluor® 488 495 519
Phospho-S6 Ribosomal Protein (Ser235/236) Alexa Fluor 647
®
650 665

for quality products you can trust...


www.cellsignal.com
Orders (toll-free) 1-877-616-2355 | Technical support (toll-free) 1-877-678-8324 support@cellsignal.com | Inquiries info@cellsignal.com | Environmental Commitment eco.cellsignal.com
Articles
Cell Volume 143 Number 1, October 1, 2010

35 Myogenin and Class II HDACs V. Moresi, A.H. Williams, E. Meadows, J.M. Flynn,
Control Neurogenic Muscle Atrophy M.J. Potthoff, J. McAnally, J.M. Shelton, J. Backs,
by Inducing E3 Ubiquitin Ligases W.H. Klein, J.A. Richardson, R. Bassel-Duby,
and E.N. Olson

46 Long Noncoding RNAs U.A. Ørom, T. Derrien, M. Beringer, K. Gumireddy,


with Enhancer-like Function A. Gardini, G. Bussotti, F. Lai, M. Zytnicki, C. Notredame,
in Human Cells Q. Huang, R. Guigo, and R. Shiekhattar

59 Molecular Basis of RNA Polymerase III A. Vannini, R. Ringel, A.G. Kusser, O. Berninghausen,
Transcription Repression by Maf1 G.A. Kassavetis, and P. Cramer

71 Identification of Aneuploidy- E.M. Torres, N. Dephoure, A. Panneerselvam, C.M. Tucker,


Tolerating Mutations C.A. Whittaker, S.P. Gygi, M.J. Dunham, and A. Amon

84 Store-Independent Activation of Orai1 M. Feng, D.M. Grice, H.M. Faddy, N. Nguyen, S. Leitch,
by SPCA2 in Mammary Tumors Y. Wang, S. Muend, P.A. Kenny, S. Sukumar,
S.J. Roberts-Thomson, G.R. Monteith, and R. Rao

99 Cell Surface- and Rho GTPase-Based T. Xu, M. Wen, S. Nagawa, Y. Fu, J.-G. Chen, M.-J. Wu,
Auxin Signaling Controls Cellular C. Perrot-Rechenmann, J. Friml, A.M. Jones, and Z. Yang
Interdigitation in Arabidopsis

111 ABP1 Mediates Auxin S. Robert, J. Kleine-Vehn, E. Barbez, M. Sauer, T. Paciorek,


Inhibition of Clathrin-Dependent 
P. Baster, S. Vanneste, J. Zhang, S. Simon, M. Covanov a,
Endocytosis in Arabidopsis K. Hayashi, P. Dhonukshe, Z. Yang, S.Y. Bednarek,
A.M. Jones, C. Luschnig, F. Aniento, E. Zazı́malova,
and J. Friml

122 Activation-Induced Cytidine Deaminase R. Pavri, A. Gazumyan, M. Jankovic, M. Di Virgilio, I. Klein,


Targets DNA at Sites of RNA Polymerase II C. Ansarah-Sobrinho, W. Resch, A. Yamane,
Stalling by Interaction with Spt5 B.R. San-Martin, V. Barreto, T.J. Nieland, D.E. Root,
R. Casellas, and M.C. Nussenzweig

134 Intestinal Crypt Homeostasis Results H.J. Snippert, L.G. van der Flier, T. Sato, J.H. van Es,
from Neutral Competition between M. van den Born, C. Kroon-Veenboer, N. Barker, A.M. Klein,
Symmetrically Dividing Lgr5 Stem Cells J. van Rheenen, B.D. Simons, and H. Clevers

145 EphB Signaling Directs Peripheral S. Parrinello, I. Napoli, S. Ribeiro, P.W. Digby, M. Fedorova,
Nerve Regeneration through D.B. Parkinson, R.D.S. Doddrell, M. Nakayama,
Sox2-Dependent Schwann Cell Sorting R.H. Adams, and A.C. Lloyd

(continued)
60
years of leadership in
human genetics research,
education and service.
1948–2008
www.ashg.org
RESOURCE
156 Comparative Epigenomic Analysis T.S. Mikkelsen, Z. Xu, X. Zhang, L. Wang, J.M. Gimble,
of Murine and Human Adipogenesis E.S. Lander, and E.D. Rosen

ERRATUM
170 The In Vivo Pattern Y. Ji, W. Resch, E. Corbett, A. Yamane, R. Casellas,
of Binding of RAG1 and RAG2 and D.G. Schatz
to Antigen Receptor Loci

POSITIONS AVAILABLE

On the cover: Peripheral nerves are capable of remarkable regeneration, even after a severe
injury that fully cuts the nerve. In this issue of Cell, Parrinello et al. (pp. 145–155) investigate
the mechanisms through which severed nerve ends rejoin to reconstitute a functional nerve.
Their study shows that wound fibroblasts drive the initial stages of nerve repair by inducing
Schwann cells to sort into cellular tracks that direct axon regrowth. The image on the cover
depicts clusters of Schwann cells that form in response to fibroblast-induced cell sorting as
a result of ephrinB/EphB2 signaling between the cells. The pattern was generated by creat-
ing mirror images from a fluorescent image of sorted Schwann cells.
Cedex XS Analyzer and CASY Systems
NEW! from Roche

Count and Analyze Your Cells


for Consistent Results
Dead Cell

Improve cell culture success and consistency of experimental


Living Cell results by better understanding the status of your cells. With
Roche Innovatis automated multiparameter quality control,
you can monitor your cells and optimize growth conditions
through fast, accurate cellular analysis.
L Obtain accurate results in 20 seconds with only 10 μl of
Cedex Trypan Blue Exclusion Method. Image-based analysis of cell cell sample!
viability using industry-proven Cedex 2 software.
L  se innovative Cedex XS Analyzer Smart Slide technology
U
to rapidly measure cellular parameters with trypan blue
exclusion and high-resolution digital imaging.
debris dead cells viable cells
L  hoose a CASY System to measure cellular parameters
C
using label-free, non-invasive Electrical Current Exclusion
(ECE) and high-resolution size distribution analysis.
cell clusters
More precisely define the state of your cells in vitro by using
the Cedex XS Analyzer or CASY Systems – now available
from Roche.
CASY High-Resolution Size Distribution Analysis. Pulse area analysis
with Electrical Current Exclusion (ECE) distinguishing cell debris, dead cells, For detailed product information and application notes, visit
viable cells, and aggregates. www.roche-applied-science.com

For life science research only.


Not for use in diagnostic procedures. Roche Diagnostics Corporation
CEDEX, CASY, and INNOVATIS are trademarks of Roche. Roche Applied Science
Other brands or product names are trademarks of their respective holders. Indianapolis, Indiana
© 2010 Roche Diagnostics. All rights reserved.
Leading Edge

In This Issue

Stress Factor Chokes Off Transcription


PAGE 59
RNA polymerase (Pol) III transcribes short RNAs essential for cell growth and
stability. Under stress conditions, the conserved protein Maf1 enters the
nucleus and represses Pol III. Vannini et al. now report that Maf1 binds the
clamp domain of Pol III and rearranges a protein subcomplex at the rim of
the active center cleft, impairing the formation of a closed, active promoter
complex. These findings explain how Maf1 can globally repress transcription
at Pol III loci, ensuring cell survival during stress.

Myogenin Is Muscle’s Frenemy


PAGE 35
Maintenance of skeletal muscle structure and function requires innervation by motor neurons, and denervation
causes muscle atrophy. Here, Moresi et al. demonstrate a role for myogenin, an essential regulator of muscle
development, in promoting neurogenic muscle atrophy. Following denervation, myogenin is upregulated and
directly activates the expression of factors that promote muscle atrophy. Thus, myogenin is both a regulator
of muscle development and an inducer of neurogenic atrophy and represents a potential therapeutic target
for muscle-wasting disorders.

Channeling Ca2+ in Breast Cancer


PAGE 84
Dysregulation of Ca2+ homeostasis is associated with numerous diseases,
including cancer. In this issue, Feng et al. identify an unconventional function
for SPCA2, an isoform of the Secretory Pathway Ca2+-ATPase upregulated in
breast cancer cells. SPCA2 interacts directly with Orai1, a Ca2+ channel, to elicit
constitutive Ca2+ influx that is necessary for tumorigenesis. Surprisingly, this
interaction is independent of SPCA2’s pump activity and of ER calcium stores.
These findings reveal a new mechanism of Ca2+ signaling and potential
druggable targets for breast cancer treatment.

ncRNAs Activate!
PAGE 46
The number of long noncoding RNAs (ncRNAs) is on the rise, but for most, a cellular function remains elusive.
In this issue, Ørom et al. identify a large family of new ncRNAs and find that some of them behave as classic
enhancer elements, activating expression of neighboring protein-coding genes. These findings suggest an unan-
ticipated mode of regulation of the mammalian genome impacting process from differentiation and development
to oncogenesis.

Outgrowing Aneuploidy
PAGE 71
Aneuploidy causes a proliferative disadvantage in all normal cells analyzed to date, yet this condition is
associated with cancer, a disease characterized by unabated proliferative potential. To probe how cancer
cells tolerate the adverse effects of aneuploidy, Torres et al. isolated aneuploid yeast strains with improved
proliferation. Molecular characterization of these strains reveals aneuploidy-tolerating mutations that improve
the fitness of multiple different aneuploidies and highlight the importance of ubiquitin-mediated proteasomal
degradation in suppressing the adverse effects of aneuploidy.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 1


Announcing an innovative new textbook from Academic Cell
Primer to The Immune Response, Academic Cell Update Edition
By Tak W. Mak and Mary Saunders

Primer to The Immune Response, Academic Cell Update


Edition, is an invaluable resource for students who
need a concise but complete and understandable
introduction to immunology.

Academic Cell textbooks contain premium journal


content from Cell Press and are part of a new
cutting-edge textbook/journal collaboration
designed to help today’s instructors teach students to
“think like a scientist.”

academiccell.com

Primer to The Immune Response


Academic Cell Update Edition
Academic Cell is a dynamic textbook publishing partnership between
Tak W. Mak Academic Press and Cell Press, two market-leading publishers bringing
The Campbell Family Institute for Breast scientific advances from the world of life science research into the classroom.
Cancer Research, Ontario, Canada
Mary Saunders Order online now from: elsevierdirect.com/9780123847430
The Campbell Family Institute for Breast Request and examination copy from textbooks.elsevier.com
Cancer Research, Ontario, Canada

Paperback/456 pages
ISBN: 9780123847430 Twitter.com/academiccell Facebook.com/academiccell
$79.95/£54.99/€64.95
Symmetric Stem Cell Divisions Carry the Crypt
PAGE 134
Each intestinal crypt has 14 stem cells at its base. Using a multicolor randomly
inducible reporter system to map the individual fates of each crypt stem cell,
Snippert et al. now demonstrate that most of the stem cell divisions are
symmetric. The stem cells compete for residency in the crypt, leading the
crypt to drift towards monoclonality over time. The results indicate that, after
symmetric division, each daughter cell stochastically adopts either the stem
or progenitor cell fate. This model contrasts with a hierarchical view of stem
cell divisions in which each division yields one stem cell and one transit-
amplifying cell.

Auxin Signaling, No Transcription Required


PAGE 99
Auxin signaling in plants is vital for initiating specific transcriptional responses. Now, two studies identify nontran-
scriptional roles for auxin signaling through the AUXIN-BINDING PROTEIN 1 (ABP1) receptor. Xu et al. look at
development of puzzle piece-shaped pavement cells and find that auxin activates two Rho GTPases, which
promote the formation of complementary lobes and indentations in adjacent cells. The response to auxin is
fast and requires ABP1. Auxin is exported by PIN1, and Robert et al. show how auxin itself modulates the cell
surface expression of PIN1. They report that ABP1 promotes clathrin-mediated endocytosis of PIN1 and other
cargos. Auxin binding to ABP1 blocks this activity and dampens endocytosis, leading to more PIN1 at the surface
and elevated levels of auxin export.

Schwann Cells Soothe Frayed Nerves


PAGE 145
Peripheral nerves have remarkable regenerative capabilities. Following a cut,
severed nerve ends refind each other, creating a bridge of new tissue.
Regrowing axons must then traverse this bridge on the journey back to their
targets. Parrinello et al. show that fibroblasts that accumulate at the site of
injury modulate the behavior of Schwann cells via ephrin-B signaling,
promoting their outgrowth from the nerve stumps as multicellular cords. The
Schwann cells provide a platform to guide axons across the wound.

AID Carjacks Stalled Polymerase


PAGE 122
Activation-induced cytidine deaminase (AID) initiates antibody gene diversification by creating U:G mismatches.
However, AID is not specific for antibody genes, and off-target lesions can initiate chromosomal translocations.
How AID finds its targets is unknown. Pavri et al now show that Spt5, a factor associated with stalled RNA
polymerase II (Pol II), is required for class switch recombination. Spt5 interacts with AID and stalled Pol II and
facilitates AID recruitment to both Ig and non-Ig sequences. Thus, AID is targeted to sites of Pol II stalling via
Spt5.

Chromatin Cairns on the Path to Adipogenesis


PAGE 156
The gene regulatory networks that govern adipogenesis are poorly understood. Here, Mikkelsen et al. map
several modified histones and transcription factors across the genome in differentiating mouse and human
adipocytes. The data provide high-resolution views of chromatin remodeling during cellular differentiation and
allow identification of thousands of putative preadipocyte- and adipocyte-specific cis-regulatory elements
based on dynamic chromatin signatures. The authors also utilize the close relationship between open chromatin
marks and transcription factor motifs to identify and validate PLZF and SRF as regulators of adipogenesis.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 3


¬,OOK¬!GAIN

$ISCOVER¬-ORE
s¬!CCESS¬TO¬THE¬¬#ELL¬0RESS¬PRIMARY¬RESEARCH¬JOURNALS¬AND¬
¬4RENDS¬REVIEWS¬TITLES ¬ALL¬ON¬THE¬SAME¬PLATFORM
s¬)MPROVED ¬MORE¬ROBUST¬ARTICLE¬AND¬AUTHOR¬SEARCH
s¬6IDEO ¬ANIMATIONS¬AND¬SOUND¬lLES
s¬%ASY¬TO¬NAVIGATE¬HOME¬PAGE ¬ARTICLES¬PAGES¬AND¬ARCHIVE

WWWCELLCOM
Leading Edge

Select: Symmetry Breaking

Symmetry lies at the core of bilaterian development. Although mostly maintained, in some circumstances it is broken
purposefully to create asymmetric structures, such as the heart. Recent discoveries reveal previously unappreciated
strategies for maintaining or breaking symmetry in flies, nematodes, zebrafish, and mice and explore the functional
consequences of disrupting these morphogenetic processes.

Apoptosis Throws Organs for a Loop


During the pupal stage of Drosophila development, the genital
plate completes a 360 rotation around the body axis. A new report
by Suzanne et al. (2010) shows that this dramatic morphogenetic
event results from the movement of two concentric rings of cells
that surround the genital plate. Each ring rotates by 180 , such
that the inner ring completes the full 360 . Prior work has shown
that the loss of myosin ID (MyoID), a left-right patterning determi-
nant, switches the direction of rotation of the genital plate from
clockwise to counterclockwise. The authors now show that when
The genital plate of the Drosophila pupa goes full circle. MyoID is inactivated in only one of the two ring domains, the rings
Shown at the initial (0 ) and halfway (180 ) points. Image cour- rotate in opposite directions, with the net effect of canceling each
tesy of S. Noselli.
other out. Curiously, this places the genitalia in the same position
as where they normally end up in wild-type flies, and males with
‘‘nonrotating’’ genitalia appear none the worse for wear in terms of fertility. Of course this begs the question, why bother
undertaking this developmental ‘‘loop-de-loop’’? The answer, according to the authors, lies in Drosophila’s evolutionary
history. At some point, one of its ancestors switched from having its genitalia at the 180 position back to 0 and made
this change through the duplication of the functional module that created the initial 180 rotation. The authors further explore
the trigger for the movements and provide evidence implicating localized apoptosis at the anterior regions of the ring bound-
aries. Thus, they propose a model in which cell death releases the rings from neighboring tissue, thereby acting as a brake
release mechanism. Future work may examine what initiates apoptosis in these cells to trigger the movement and may
also spur others to assess the impact of apoptosis in initiating other types of morphogenetic movements.
M. Suzanne et al. (2010). Curr. Biol. Published online September 9, 2010. 10.1016/j.cub.2010.08.056.

Putting an Unusual Twist on Embryogenesis


In C. elegans, left-right asymmetry first arises early in embryogenesis at the transition between
the 4- and 6-cell stages. Pohl and Bao (2010) now show that this initial skew is reinforced and
elaborated at the 8-cell stage by a unique morphogenetic phenomenon that the authors term
chiral morphogenesis. During chiral morphogenesis, the midline, which divides the embryo into
left and right sides, is uncoupled from the antero-posterior axis, such that the midline becomes
tilted to the right. This facilitates differential induction by Notch signaling to distinguish cell fates
Visualizing cellular dynamics
on the left versus the right side of the embryo. At the subcellular level, the authors observe left- during chiral morphogenesis
right asymmetric protrusions and actomyosin contractility in otherwise equivalent sister cells in C. elegans embryos. Image
(ABpl and ABpr). At the molecular level, they show that these structures are triggered by non- courtesy of Z. Bao.
canonical Wnt signaling, well-known for its roles in planar cell polarity. The timing of these
movements appears to be dictated by the division of the neighboring EMS cell. The authors show that the extension of the
ventral protrusion of the ABpl cell coincides with the EMS cell forming a contractile ring, and evidence of direct causality is
obtained in experiments in which EMS cell division is delayed by irradiation. Thus, these finding unexpectedly link cell-cycle
duration and symmetry breaking and point to signaling mechanisms, yet to be fully explored, that mediate communication
between the EMS cell and the ABpl cell.
C. Pohl and Z. Bao (2010). Dev. Cell 19, 402–412.

Wnt Signals Do the Electric Slide


In vertebrates, some regions of the myocardium propagate electrical signals faster than others. In recent work, Panáková
et al. (2010) carefully document the origins of this electrical polarity in zebrafish development and uncover the patterning
signals that give rise to it. They visualize the timing of electrical activation across the myocardium by imaging of fluorescent

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 5


Expand your stem cell library and save
today on the latest books on stem cells
and regenerative medicine

Stem Cells Stem Cell Anthology


Scientific Facts and Fiction From Stem Cell Biology, Tissue Engineering,
Christine Mummery, Ian Wilmut, Anja Van de Stolpe Regenerative Medicine, Cloning and Stem
and Bernard Roelen
Cell Methods
November 2010 | 400 pages | Paperback | Bruce M. Carlson
$79.95 | €57.95 | £48.99 | October 2009 | 450 pp. | Hardback | $150.00 |
ISBN: 9780123815354 €100.00 | £95.00 |AU$222.00 |
ISBN: 9780123756824

Principles of Regenerative
Medicine, 2nd Edition Essential Stem Cell Methods
Anthony Atala and Robert Lanza A Volume in the Reliable Lab Solutions Series
November 2010 | 1400 pages | Hardback | Robert Lanza and Irina Klimanskaya
$199.95 | €143.00 | £125.00 | April 2009 | 628 pp. | Paperback | $75.00 | €50.95
ISBN: 9780123814227 | £45.99 |AU$111.00 | ISBN: 9780123750617

Heart Development and Tissue Engineering


Regeneration, 2-Volume Set Clemens van Blitterswijk, Peter Thomsen, Jeffrey Hubbell,
Ranieri Cancedda, Anders Lindahl Sahlgrenska,
Nadia Rosenthal and Richard P. Harvey
Jerome Sohier and David F. Williams
June 2010 | 1072 pp. | Hardback
| $199.95 | €143.00 | £125.00 | March 2008 | 760 pp. | Hardback | $115.00 |
AU$296.00 | ISBN: 9780123813329 €76.95 | £69.99 |AU$170.00 |
ISBN: 9780123708694

Essentials of Stem Cell


Biology, 2nd Edition Human Stem Cell Manual
Robert Lanza, Roger Pedersen, John Gearhart, E. A Laboratory Guide
Donnall Thomas, Brigid Hogan, James Thomson, Jeanne F. Loring, Robin L. Wesselschmidt and Philip H. Schwartz
Douglas Melton and Sir Ian Wilmut June 2007 | 488 pp. | Spiral bound | $88.95 |
June 2009 | 600 pp. | Hardback | $199.95 €59.95 | £53.99 |AU$132.00 |
| €134.00 | £125.00 | AU$302.00 | ISBN: ISBN: 9780123704658
9780123747297

Handbook of Stem Cells


Foundations of 2-Volume Set with CD-ROM Vol. 1–2
Regenerative Medicine Vol. 1 – Embryonic Stem Cells
Clinical and Therapeutic Applications Vol. 2 – Adult & Fetal Stem Cells
Anthony Atala, Robert Lanza, James Thomson and Robert Lanza, Roger Pedersen, Helen Blau, E. Donnall Thomas,
Robert Nerem John Gearhart, James Thomson, Brigid Hogan, Catherine
Verfaillie, Douglas Melton, Irving Weissman, Malcolm Moore
September 2009 | 750 pp. | Hardback |
and Michael West
$99.95 | €66.95 | £60.99|AU$148.00 |
ISBN: 9780123750853 September 2004 | 1,760 pp. | Hardback | $566.00
| €380.00 | £345.00 | AU$817.00 |
ISBN: 9780124366435

Cell Stem Cell subscribers save 25% on their book order


Secure ordering online at elsevierdirect.com
Enter promo code 28024 at check out
Prices and publication dates subject to change without notice.
dyes sensitive to transmembrane potential and focus their effort on the
observed differences in the conduction velocities between the myocardial
inner curvature (the future base of the ventricle) and the outer curvature
(the future apex of the ventricle). These regional differences do not appear
to arise from intrinsic variation in the prevalence of gap junctions, nor are
they are consequence of the physical effects of heart contraction. Instead,
the authors present evidence implicating the morphogen Wnt11 in estab-
lishing the gradient. Surprisingly, this effect is independent of Wnt11’s role
in planar cell polarity and instead is due to the regulation of a transmembrane
conductance by L-type Ca2+ channels. The pharyngeal arches, which reside
next to the heart, are the apparent source of endogenous Wnt11. Although
An isochronal map of a zebrafish embryonic heart additional work is needed to connect the dots between Wnt11 and L-type
at 72 hr post-fertilization demonstrating the gra- Ca2+ channel regulation, this report is likely to motivate efforts to re-examine
dient of conduction velocities that forms between the impact of Wnt11 signaling on electrically coupled tissues, such as
the outer curvature (OC) and the inner curvature epithelia.
(IC). Image courtesy of C. MacRae. D. Panáková et al. (2010). Nature 466, 874–878.

Generating Rhythm in a Roundabout Way


The regulation of breathing arises from a population of neurons in the brain stem,
known as the preBötzinger complex (preBötC), which establishes the rhythm that
drives motor neurons controlling muscles for breathing. Bouvier et al. (2010) now
examine how interneurons of the preBötC are specified during development. Given
that breathing requires coordination of movement between the left and right sides
of the body, their efforts were motivated in part by prior evidence demonstrating
that neurons that control walking movements (that is, left-right alternation) in mice
derive from neural progenitors that express the homeobox protein Dbx1.The authors
examine the consequences of Dbx1 deficiency and show that Dbx1 null mutants die
at birth due to a lack of breathing movement. This appears to result from the loss of
glutamatergic interneurons that generate the preBötC rhythm. Having identified this
critical preBötC population, they further assess the consequences of disrupting
neuronal communication across the midline by inactivating the axon guidance
receptor roundabout homolog 3 (Robo3) during development in Dbx1-derived
neurons. Interestingly, these mice exhibit preBötC rhythms that are not synchronized In mice, Robo3-expressing commissural
between the left and right sides, which may account for their premature death as interneurons (top) ensure left-right syn-
neonates. The authors make the interesting speculation that left-right asynchrony chronous activity (bottom) of the preBöt-
in diaphragm contractions could contribute to the abnormal posture of individuals zinger complex.
with horizontal gaze palsy with progressive scoliosis (HGPPS), a syndrome that is
linked to mutations in human ROBO3. Having identified this population of commissural interneurons, future work may
shed light on how the circuit dynamics synchronize the activities of the left and right preBötC regions.
J. Bouvier et al. (2010). Nat. Neurosci. 13, 1066–1074.

Robert P. Kruger

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 7


Let the Countess™ do the counting.
Wow! Consistent, fast, and easy.
The Countess™ Automated Cell Counter takes the subjectivity and tedium out
of one of the fundamental steps of cell culture—counting live and dead cells.
The Countess™ automated technology reduces user error and speeds up cell
counting with less sample, less hassle, and a lower cost than any automated cell
counter on the market. Start counting today at www.invitrogen.com/countcells.

THE MOST

For research use only. Not intended for any animal or human therapeutic or diagnostic use, unless otherwise stated.
© 2009 Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners. These products may be covered by
one or more Limited Use Label Licenses (see Invitrogen catalog or www.invitrogen.com). By use of these products you accept the terms and conditions of all applicable Limited Use Label Licenses.
Leading Edge
BenchMarks

Lasker Lauds Leptin


Jeffrey S. Flier1,2,* and Eleftheria Maratos-Flier2,*
1Officeof the Dean, Harvard Medical School, Boston, MA 02215, USA
2Divisionof Endocrinology, Beth Israel Deaconess Medical Center, Boston, MA 02215, UA
*Correspondence: jeffrey_flier@hms.harvard.edu (J.S.F.), emaratos@bidmc.harvard.edu (E.M.-F.)
DOI 10.1016/j.cell.2010.09.021

This year, the Albert Lasker Basic Medical Research Award will be shared by Douglas Coleman and
Jeffrey Friedman for their discovery of leptin, a hormone that regulates appetite and body weight.
By uncovering a critical physiologic system, their discovery markedly accelerated our capacity to
apply molecular and genetic techniques to understand obesity.
The discovery of leptin was a landmark way that newcomers to the field have diffi- obesity or leanness in humans and mice
event in modern physiology. Leptin is culty appreciating the ‘‘landscape’’ of the by disrupting food intake and possibly
a hormone derived from fat that informs research prior to the discovery. This is energy expenditure. For some scientists,
the brain about the status of energy stores surely the case for the field of energy these results suggested that regions
in peripheral tissues, and its discovery balance regulation before and after the within the hypothalamus might be master
closed a physiologic feedback loop that discovery of leptin. Even 30 years before regulators of energy balance, integrating
was long hypothesized to control normal leptin’s discovery, a substantial body of signals from peripheral organs that reflect
energy homeostasis. Now, the Albert evidence suggested that energy intake the energy status of the organism and
Lasker Basic Medical Research Award and expenditure were tightly regulated. then engaging pathways to adjust nutrient
is recognizing the researchers who For example, when animals were forcibly intake and energy expenditure to maintain
produced this breakthrough, Douglas overfed (or starved) and then returned to homeostasis.
Coleman at The Jackson Laboratory their original diets, they reliably and often Experimental support for this concept
and Jeffrey Friedman at The Rockefeller quite precisely returned to their initial emerged slowly. In 1959, the British phys-
University and the Howard Hughes weights. Clearly, a physiologic homeo- iologist William Hervey published a
Medical Institute. static system of some type was in play. prescient study reporting the results
Although the contributions of the two Furthermore, it was known that small of surgically joining normal rats with
awardees differed in approach and lesions in the hypothalamus caused either those given lesions in the ventromedial
occurred three decades apart, their joint
recognition reflects the essential contri-
butions that each researcher made to
this field-changing discovery. Doug Cole-
man is recognized for demonstrating that
a ‘‘satiety factor’’ circulating in the blood
stream was absent in a mutant mouse
strain (ob/ob) that is severely obese
and for correctly predicting that the hypo-
thalamus is the target of this factor.
Stimulated by Coleman’s results, Jeffrey
Friedman took up the ambitious goal of
cloning the genes mutated in the mouse
strain at a time when such a feat was
extremely difficult. He found that the ob
gene encodes a protein hormone that
reverses obesity and metabolic abnor-
malities in the ob/ob mice. These discov-
eries revised our understanding of inte-
grative metabolism and set the stage for
explosive and still accelerating research
efforts in numerous fields.

Background History
Sometimes in science, a single break- Together, Douglas Coleman (left) and Jeffrey Friedman (right) discovered the hormone leptin,
through changes a field in such a dramatic which signals to the brain the state of energy stores in peripheral tissues.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 9


hypothalamus (VMH), which were known in mice. However, his most notable ac- to which they could not themselves
to cause obesity (Hervey, 1959). In these complishments occurred while studying respond but which could be parabiotically
‘‘parabiotic’’ experiments, Hervey con- mice with genetic syndromes of obesity transferred to other animals to regulate
nected the rats through their subcuta- and diabetes, and at the time, The Jack- feeding and weight.
neous tissues, permitting a low-rate son Laboratory was fertile soil for sowing Aware of the experiments by Hervey
exchange of extracellular and blood- such studies. (1959), Coleman surmised that the hypo-
borne elements from one animal to the In 1949, an autosomal recessive thalamus probably contained the center
other. Although Hervey was not the first syndrome of severe obesity appeared that responds to the circulating factor.
researcher to employ this experimental spontaneously in a colony of mice at The As with conclusions from Hervey’s
model, the surgical unions between these Jackson Laboratory. The mutation map- studies, Coleman’s hypothesis proved to
particular rats generated a particularly ped to chromosome 6 and was desig- be right on target. However, in the
interesting result. nated obese (ob). In 1966, Coleman and absence of an identified circulating factor,
As expected, the rats with VMH lesions his associates identified a second obesity many physiologists and obesity investiga-
became obese. Surprisingly, however, the syndrome with very similar symptoms, tors continued to reserve judgment about
normal rats ingested far less food than but this mutation, designated diabetes the ultimate validity of the Coleman
usual and lost substantial weight when (db), mapped to chromosome 4 (Hummel hypothesis, just as they did with Hervey’s
they were joined to the obese rats. Based et al., 1966). Mice homozygous for both of conclusions. Nevertheless, some daring
on these results, Hervey postulated that these mutations demonstrated dramatic investigators pursued this hypothesis
the VMH normally responds to a satiety early onset obesity, insulin resistance and sought to biochemically purify and
signal that regulates feeding. Without (with varying severity of diabetes), infer- identify a factor from fat or other tissues
a functional VMH, the rats could not tility, and a variety of other symptoms, that regulates food intake. This approach,
respond to this signal; they became obese including hyperphagia (i.e., overeating) although rational, did not succeed. For
and then overproduced the satiety signal, and decreased locomotor activity. Of a quarter of a century after Coleman’s
which Hervey postulated was a peripheral interest, when the mutations were bred insightful experiments, researchers iden-
factor. Furthermore, Hervey surmised that onto strains with different genetic back- tified neither a specific factor, its site of
high levels of this signal crossed over into grounds, the mice displayed substantial origin, nor its site of action. In fact, many
the circulation of the normal rats, sup- phenotypic variation in several features, leaders of the field questioned whether
pressing their food intake and weight. including the presence of overt diabetes. the efforts to find such a factor were
Remarkably, this hypothesis proved to The Coleman lab carried out extensive scientifically justified.
be correct. However, given the complexity mouse breeding and phenotyping experi-
of the parabiotic model used in the study, ments in an effort to understand how Friedman Finds the Genes
more pedestrian explanations might the genetic background regulates these Enter Jeffrey Friedman, two decades after
easily have accounted for the decreased metabolic phenotypes, an important but Coleman’s work. Trained as a physician,
food intake of the normal rats. Plus, identi- still largely unresolved question. Friedman initially intended to become a
fying a hypothesized hormone from an Coleman’s most important observa- gastroenterologist. However, the emerg-
unknown site was a daunting task, which tions, however, came from a series of ing power of molecular genetics lured
led many in the field to look elsewhere parabiosis experiments with the mutant him into a basic science laboratory to
for interesting experiments to pursue. animals. When the subcutaneous tissues study physiology and disease. Working
Despite much speculation and the of ob/ob mice were surgically connected at The Rockefeller University, where he
suggestive evidence from this study and to that of either wild-type or db/db obtained a PhD in the laboratory of James
related approaches, no convincing proof animals, the ob/ob mice decreased Darnell Jr., Friedman became interested
had emerged for the existence of a specific feeding and lost weight, and this effect in the genetics of body weight regulation
physiologic system that controls energy reversed when the union was ended. and decided to tackle the daunting task
intake, energy expenditure, and body Control mice were unaffected by the of cloning the ob gene. Initially in collabo-
weight when Douglas Coleman began to union with ob/ob mice (Coleman, 1973). ration with other obesity researchers at
tackle the problem over the next decade. In contrast, when normal mice were Rockefeller, including Rudolph Leibel,
parabiosed to db/db mice, control mice Friedman methodically attacked this
Coleman Connects the Dots stopped eating and lost substantial goal and ultimately accomplished it. The
Douglas Coleman obtained a doctorate in amounts of weight, but the db/db mice results led to insights that were nothing
biochemistry at the University of Wiscon- were unaffected. These results led Cole- short of breathtaking.
sin and took his first position at The Jack- man to conclude correctly that ob/ob In a classic 1994 Nature paper, Fried-
son Laboratory in Bar Harbor, Maine in mice lacked a satiety factor in their blood man and colleagues described the ob
1958, where he expected to remain for stream that regulates feeding and weight. gene as a 4.5 kb transcript expressed
only a couple of years to extend his under- Although both the control and db/db mice exclusively in adipose tissue and pre-
standing of genetics. Instead, he spent his supplied this factor to the ob/ob mice, the dicted to encode a secreted peptide
entire career at The Jackson Laboratory db/db mice did so more robustly. Cole- with 167 amino acids (Zhang et al.,
until he retired in 1991. At the beginning, man, therefore, speculated that db/db 1994). Moreover, the transcript was dis-
his research focused on muscle disorders mice overproduced the circulating factor rupted in both available ob alleles. Soon

10 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


after this initial paper, the Friedman group Indeed, a PubMed search for ‘‘leptin’’ Jak/Stat signaling. Leptin acutely induces
and two others laboratories demon- reveals more than 18,000 citations. The expression of SOCS3 in target neurons,
strated that treating ob/ob mice with the major developments in this intensive and SOCS3 expression is also increased
recombinant peptide dramatically cor- area of research can be grouped into in the hypothalamus of mice with diet-
rected the animal’s obesity and hyper- three areas: the physiologic role of leptin; induced obesity. Most decisively, disrupt-
phagia (Halaas et al., 1995). Thus, the how leptin’s action is limited in human ing the function of SOCS3 enhances
peptide was named ‘‘leptin’’ from the obesity induced by diet or the environ- leptin signaling and limits obesity when
Greek root leptos for ‘‘thin.’’ ment; and the neural and peripheral susceptible mice are placed on diets
Leptin was considerably more potent circuits upon which leptin acts. that cause obesity (Howard et al., 2004).
when injected directly into the CNS than Initially, leptin was thought of as a mole- A second candidate for an inhibitor of
into the blood stream, suggesting that cule produced by excess adipose tissue leptin signaling is the tyrosine phospha-
the primary target of leptin is in the CNS, to provide a negative feedback signal to tase PTP1b. As with SOCS3, disrupting
as Coleman predicted. Furthermore, lep- the brain to limit obesity by reducing PTP1b protects against diet-induced
tin failed to act in db/db mice, which nicely appetite and increasing energy expendi- obesity (Zabolotny et al., 2002).
ruled out a nonspecific basis for the ture. However, new data and physiologic The most critical leptin signals are ex-
weight loss and confirmed Coleman’s thinking have substantially extended erted in the hypothalamus. The hypothal-
hypothesis about the db/db mice lacking this initial understanding. Clearly, leptin amus cannot be probed experimentally
the ability to detect the circulating satiety reverses the syndrome of ob/ob mice, in humans, and thus, our capacity to
factor. Thus, after almost a half a century and recombinant leptin has equally assess the roles of SOCS3 and PTP1b in
of searching, the biochemical cause of dramatic effects on obese humans with human obesity is currently limited. Until
obesity of the ob/ob mouse was finally rare loss-of-function mutations in the lep- approaches are identified to counter
understood. tin gene (Farooqi et al., 1999). However, these inhibitory pathways, the existence
In work that soon followed, the Fried- disappointingly, both mice and humans of leptin resistance in humans will limit
man laboratory and one other group found with more common forms of obesity typi- the therapeutic potential of leptin. Never-
that the db locus encodes a family of leptin cally have high levels of leptin, and more theless, researchers are still actively
receptors that are alternatively spliced importantly, their body weights respond searching for obese individuals that
and members of the cytokine receptor weakly or not at all to pharmacologic respond to leptin alone or in combination
family (Lee et al., 1996). The db allele supplementation of leptin (Heymsfield with other therapies.
altered only a single splice variant that, et al., 1999). This suggests that ‘‘common It seems likely that leptin will also have
unlike the other variants, is expressed obesity’’ is a state of leptin resistance, as therapeutic potential in disorders distinct
strongly in the hypothalamus. This variant opposed to leptin deficiency. from obesity. Several states of ‘‘low lep-
was also the only leptin receptor predicted Of interest, obesity has long been tin’’ are associated neither with obesity
to mediate signaling through the Jak/Stat known to be a state of resistance to nor with mutations of the leptin gene.
pathway. Not surprisingly, the Friedman insulin, the preeminent metabolic hor- For example, leanness and low body fat
laboratory soon demonstrated that leptin mone. Numerous studies have character- can cause low levels of leptin in women
activates STAT3 in the hypothalamus ized the molecular mechanisms and athletes, leading to amenorrhea and
when it is systemically administered implications of insulin resistance associ- anovulation, and leptin supplementation
(Vaisse et al., 1996). Furthermore, selec- ated with obesity. In obese patients, may restore reproductive capacity in
tively deleting this leptin receptor variant raising already high levels of insulin even these cases (Welt et al., 2004). In patients
from neurons recapitulates the major further with exogenous doses typically with syndromes of ‘‘lipodystrophy,’’
features of the ob/ob syndrome. lowers blood glucose, revealing that multiple causes lead to a deficiency of
Together, these findings demonstrated the resistance to insulin action on blood adipose tissue and thus leptin. Treatment
the existence of a previously unknown glucose is relative, not absolute. In con- with leptin dramatically improves fatty
endocrine system through which the trast, raising leptin levels even further in liver and insulin resistance in these
status of energy stores in fat is communi- the obese state has minimal effects on patients (Petersen et al., 2002).
cated by the hormone leptin to regulatory body weight, suggesting that leptin resis- Although a threshold of leptin action is
centers in the brain. Absence of either the tance to this important endpoint is almost clearly required for preventing severe
ligand or the receptor caused severe and absolute. Consequently, the identification obesity, this ‘‘anti-obesity’’ function para-
similar obesity syndromes, revealing the of the molecular mechanisms underlying doxically may not be the singular or even
critical importance of this pathway and leptin resistance is a central question to dominant physiologic role of leptin. Leptin
its potential relevance to human disease. address if we are to understand the path- levels rise in obesity, consistent with
Needless to say, this discovery trans- ophysiology of obesity as it occurs in leptin’s function as a negative feedback
formed the field of nutritional metabolism. most people. signal of energy stores. However, leptin
Studies in mice have identified two expression and circulating levels fall
Leptin Research Today likely mediators of leptin resistance. The quickly when normal mice and humans
Over the ensuing 15 years, researchers most well-characterized one, suppressor are starved. May leptin be a signal for
have learned much more about the of cytokine signaling 3 (SOCS3) (Bjørbaek adapting to starvation, as well as a signal
biology and pathophysiology of leptin. et al., 1998), is an intracellular inhibitor of for resisting excessive weight gain?

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 11


In addition to increased hunger, starva- opiomelanocortin (POMC) are stimulated that the outcome was well worth the
tion induces a specific array of adaptive by leptin, they produce the neuropeptide risk, as was the case here.
endocrine and metabolic consequences, aMSH, which stimulates central melano-
including, most prominently, the suppres- cortin 4 receptors on downstream ACKNOWLEDGMENTS
sion of reproductive capacity and de- neurons. The consequence of this stimu-
creased thyroid function. Importantly, lation is to suppress food intake and We would like to thank Bruce Spiegelman for
these changes are severely blunted body weight. The critical relevance of helpful comments on this article.
when leptin levels are kept constant by this melanocortin circuit is evident not
exogenous supplementation during star- only from its identity as a target of leptin REFERENCES
vation of mice (Ahima et al., 1996). This activation, but also from the fact that
finding led to the hypothesis that falling loss of function of the cognate melano- Ahima, R.S., Prabakaran, D., Mantzoros, C., Qu,
D., Lowell, B., Maratos-Flier, E., and Flier, J.S.
leptin is the dominant signal for initiating cortin 4 receptor is the most common
(1996). Nature 382, 250–252.
a broad program of adaptation to starva- genetic cause of human obesity, account-
Bjørbaek, C., Elmquist, J.K., Frantz, J.D.,
tion. Indeed, the predicted impairments ing for 3%–5% of severe obesity in
Shoelson, S.E., and Flier, J.S. (1998). Mol. Cell 1,
of endocrine function during starvation humans. Leptin also has direct and indi- 619–625.
are also seen in ob/ob mice, such that rect actions in brain regions apart from Coleman, D.L. (1973). Diabetologia 9, 294–298.
these mutant mice are actually experi- hypothalamus, and it is clear that the full
Farooqi, I.S., Jebb, S.A., Langmack, G., Lawrence,
encing the physiology of starvation integrated circuitry of leptin action in brain E., Cheetham, C.H., Prentice, A.M., Hughes, I.A.,
despite their severe obesity. We now will require much additional research. McCamish, M.A., and O’Rahilly, S. (1999). N.
understand that these two faces of Engl. J. Med. 16, 879–884.
leptin, mediating both the response to Conclusions Halaas, J.L., Gajiwala, K.S., Maffei, M., Cohen,
starvation as levels fall and the response What lessons can we learn from the S.L., Chait, B.T., Rabinowitz, D., Lallone, R.L.,
to overfeeding as levels rise, represent discovery of leptin? First, indirect argu- Burley, S.K., and Friedman, J.M. (1995). Science
the full range of leptin biology. In 1998, ments or data supporting the existence 269, 543–546.
we hypothesized that leptin resistance of a physiologic system can be heuristi- Hervey, G.R. (1959). J. Physiol. 145, 136–152.
of weight regulatory pathways during cally important and can serve as Heymsfield, S.B., Greenberg, A.S., Fujioka, K.,
periods of energy excess provides an strong stimuli to drive groundbreaking Dixon, R.M., Kushner, R., Hunt, T., Lubina, J.A.,
evolutionary advantage; it limits the research. Nevertheless, no matter how Patane, J., Self, B., Hunt, P., and McCamish, M.
(1999). JAMA 282, 1568–1575.
capacity of leptin to keep an individual compelling, such arguments are often
excessively lean, which would cause unconvincing to the scientific community Howard, J.K., Cave, B.J., Oksanen, L.J., Tzameli,
I., Bjørbaek, C., and Flier, J.S. (2004). Nat. Med.
a more rapid demise during periods of until the specific molecules underlying
10, 734–738.
food deprivation. the physiology are identified. Second,
Hummel, K.P., Dickie, M.M., and Coleman, D.L.
The discovery of leptin has also the discovery of a powerful regulator of
(1966). Science 153, 1127–1128.
provided a powerful tool to explore the appetite, energy balance, and body
Lee, G.H., Proenca, R., Montez, J.M., Carroll, K.M.,
central neural circuits that control energy weight can still leave many outstanding Darvishzadeh, J.G., Lee, J.I., and Friedman, J.M.
balance and related physiologies. A new questions about the mechanisms under- (1996). Nature 379, 632–635.
era in the neurobiology of energy balance lying disorders of body weight in humans. Petersen, K.F., Oral, E.A., Dufour, S., Befroy, D.,
has been ushered in by the localization This can frustrate efforts to translate the Ariyan, C., Yu, C., Cline, G.W., DePaoli, A.M.,
of leptin receptors in specific regions of discovery into an effective therapy for Taylor, S.I., Gorden, P., and Shulman, G.I. (2002).
the hypothalamus and the characteriza- common forms of obesity. Finally, we J. Clin. Invest. 109, 1345–1350.
tion of the leptin’s ability to modulate should take note of the fact that both Vaisse, C., Halaas, J.L., Horvath, C.M., Darnell,
expression of neuropeptides involved The Rockefeller University and Howard J.E., Jr., Stoffel, M., and Friedman, J.M. (1996).
in regulation of appetite and body Hughes Medical Institute believed in Jeff Nat. Genet. 14, 95–97.
weight. Researchers have demonstrated Friedman’s research project and sup- Welt, C.K., Chan, J.L., Bullen, J., Murphy, R.,
that leptin reduces expression of several ported his efforts during many years of Smith, P., DePaoli, A.M., Karalis, A., and
Mantzoros, C.S. (2004). N. Engl. J. Med. 351,
neuropeptides that potently stimulate hard work when tangible results were
987–997.
feeding, such as Neuropeptide Y (NPY), few and far between. The ability to make
Zabolotny, J.M., Bence-Hanulec, K.K., Stricker-
Agouti-related protein (AgRP), and such long-term bets on people and their
Krongrad, A., Haj, F., Wang, Y., Minokoshi, Y.,
melanin concentrating hormone (MCH). projects is difficult for funding agencies Kim, Y.B., Elmquist, J.K., Tartaglia, L.A., Kahn,
Conversely, leptin administration stimu- and institutions. We should celebrate B.B., and Neel, B.G. (2002). Dev. Cell 2, 489–495.
lates expression of neuropeptides that the cases in which such confidence and Zhang, Y., Proenca, R., Maffei, M., Barone, M.,
suppress feeding and weight. For support is given, especially when the Leopold, L., and Friedman, J.M. (1994). Nature
example, when neurons expressing pro- researchers are successful and prove 372, 425–432.

12 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


Leading Edge
BenchMarks

Clinical Application of
Therapies Targeting VEGF
George D. Yancopoulos1,*
1Regeneron Pharmaceuticals, Inc., 777 Old Saw Mill River Road, Tarrytown, NY 10591, USA

*Correspondence: george@regeneron.com
DOI 10.1016/j.cell.2010.09.028

This year’s Lasker DeBakey Clinical Research Award goes to Napoleone Ferrara for the discovery of
vascular endothelial growth factor (VEGF) as a major mediator of angiogenesis and for the develop-
ment of an effective anti-VEGF therapy for wet macular degeneration, a leading cause of blindness
in the elderly.

Many of us have been lured into a career award, Ferrara made arguably even following decades suggesting that tumors
in science by the hope that we would more exceptional contributions to the might produce a diffusible factor that
someday make a scientific discovery parallel development of a similar therapy stimulates angiogenesis, and that this
benefiting patients suffering from a pre- for cancer. angiogenesis could be required for tumor
viously incurable disease. Only as we growth (Ferrara et al., 2004). The realiza-
progress in our careers do we realize Distinct Vascular Pathologies in Eye tion that the apparently disparate vascular
how difficult and rare such a discovery Diseases and in Cancer pathologies in cancer and eye diseases
is, not to mention how disconnected the The vasculature plays a critical role in a had a common trigger, and thus poten-
actual scientific discovery often is from variety of eye diseases as well as in tially a related cure, awaited the discovery
the development of a new therapeutic cancer growth. In AMD, the most severe and cloning of VEGF.
based on that discovery. Thus it is excep- vision loss occurs in patients who develop
tionally rare that a single individual not the ‘‘wet form’’ of the disease character- The Discovery and Cloning
only makes the seminal discovery but ized by choroidal neovascularization of VEGF and VPF
also helps to champion the development (CNV). CNV refers to the growth of ab- In 1989, Ferrara and Henzel, working at
of an effective new class of therapeutics. normal vessels originating from the cho- Genentech, reported the purification and
Napoleone Ferrara, recipient of this year’s roidal vascular network, directly under- amino-terminal sequence of an endothe-
Lasker DeBakey Clinical Reseach Award, lying the retina. The abnormal vessels do lial-specific mitogen; they termed this
provides a rare such example. not usually invade the neural retina and protein VEGF. Shortly thereafter, Ferrara
Ferrara’s landmark scientific discovery thus do not directly disrupt the retina and colleagues described the molecular
involved the isolation and cDNA cloning and its function. Instead, these abnormal cloning of the cDNA encoding VEGF
of vascular endothelial growth factor vessels become excessively leaky, (Leung et al., 1989). While Ferrara and
(VEGF) as a mitogen for vascular endo- leading to retinal swelling and edema, his colleagues focused on the endothelial
thelial cells. In large part due to Ferrara’s which in turn impairs vision. Optical growth properties of this new protein, a
subsequent efforts, we now know that coherence tomography (OCT) can beauti- parallel effort was unknowingly trying to
VEGF is the most important driver in the fully image the living retina and reveal the purify and clone the same protein, but
body of normal as well as pathological extent of swelling, including within the with an eye toward a totally different
blood vessel growth. We also now realize macula and its foveal region, the tiny biological function. In 1983, the Dvorak
that VEGF not only induces vessel sprout- central portion of the retina that is respon- laboratory identified a tumor-derived
ing and growth but can also regulate sible for the ‘‘central vision’’ critical to factor, which they termed ‘‘vascular per-
vessel function in other ways, so as to important tasks such as reading and meability factor’’ (VPF), that rapidly and
regulate vascular tone and blood pres- driving. OCT images demonstrate that potently induced microvascular perme-
sure, as well as vessel wall integrity and patients with AMD can have marked ability and fluid leak but for which they
vascular permeability. The Lasker com- swelling in their central retina to over three had no molecular sequence (Senger
mittee is recognizing Ferrara for the dis- times normal thickness, resulting in et al., 1983); I remember first hearing the
covery of VEGF and for his specific severe vision loss (Figure 1). VPF story directly from Dvorak in the
contribution to the eye field, where he As Ferrara himself has thoroughly re- mid-1980s at Cold Spring Harbor when
played a key role in the development of viewed, the observation that tumor growth he attended the cloning course that I
an anti-VEGF therapy for age-related is associated with increased vascularity was teaching, along with Fred Alt and Al
macular degeneration (AMD), a leading was initially made over 100 years ago, Bothwell, in which Dvorak was trying to
cause of blindness in the elderly. Although and this observation was then followed gain the expertise to clone this intriguing
not directly acknowledged in the current by a series of classic papers over the factor. Presumably because our training

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 13


of Dvorak was not sufficient, had also evolved to specifi-
cloning of VPF was subse- cally regulate the endothelium
quently undertaken by the by similarly utilizing endothe-
Monsanto Company, which lial-specific receptors, such
published the amino-terminal as other members of the
protein sequence as well as VEGF family as well as the
the cDNA sequence in 1989 more recently discovered
(Connolly et al., 1989; Keck, angiopoietin family (Yanco-
1989). poulos et al., 2000).
Cloning of VEGF and VPF Diligently pursuing his focus
revealed that they were the on VEGF, Ferrara developed
same factor, and this conver- a mouse monoclonal antibody
gence showed that this new to block VEGF, termed
factor had at least two fasci- A.4.6.1. It was initial experi-
nating biologic activities— ments using this antibody in
not only could it induce animal models that estab-
endothelial cell proliferation, lished the primacy of VEGF in
but it could cause vascular tumor angiogenesis—Ferrara
leak and edema. Over the showed that the antibody
next two decades, Ferrara could strongly inhibit tumor
was the clear world leader in growth by limiting tumor-
further elucidating the biology induced angiogenesis, not
and pathological roles of this only providing the first con-
new growth factor, helping vincing evidence that block-
drive more widespread adop- ing tumor angiogenesis could
tion of VEGF as its name. indeed prevent tumor growth
Ferrara early on realized the but simultaneously establish-
value of using genetic inacti- Figure 1. Anti-VEGF Therapy for Wet Age-Related Macular Degener- ing VEGF as the critical target
vation in mice, as well as en- ation in the process (Kim et al.,
gineered biologics that could Swelling of the central retina in a patient with age-related macular degenera- 1993); importantly, the results
work in multiple species, tion, as seen by optical coherence tomography, is reduced by treatment were reproduced in many
with anti-VEGF therapy. Prior to treatment this individual could read 35 letters
as powerful tools. In 1996, on a specialized ‘‘ETDRS’’ eye chart. After treatment, this improved to 66. laboratories using an assort-
he demonstrated that early ment of VEGF-blocking re-
mouse development de- agents, including a clinical
pended on precise dosing of VEGF by was the first to propose that therapies candidate termed the VEGF Trap that
showing that inactivation of even a single designed to prevent such angiogenesis was developed in our laboratory.
VEGF allele resulted in embryonic lethality might provide a useful new way to combat Despite the results with VEGF blockade
due to severe vascular abnormalities. cancer (Folkman, 1971). Folkman, how- reported by Ferrara and others, the phar-
He cleverly developed and elegantly ex- ever, also presented a rather complicated maceutical industry did not immediately
ploited biologics-based blockers (such view of tumor angiogenesis in which there jump on VEGF as an exciting cancer
as antibodies and soluble receptors) to were myriad positive and negative regula- target. In part, this had to do with prevail-
show that VEGF is required for overall tors, almost all of which (such as fibroblast ing views in the field that there were
postnatal growth, and to define its roles growth factors, transforming growth myriad potential targets to attack, and
in structures such as growing bones and factors, collagen fragments known as that no target was more important than
the cycling ovary (Gerber et al., 1999a, endostatin, and plasminogen fragments others. Ferrara pressed on and next
1999b). He also worked with collabora- known as angiostatin) served roles out- humanized A.4.6.1 so that it could be
tors to show that VEGF acted via an endo- side of the vasculature as well; Folkman used in human trials. This humanized
thelial-specific receptor tyrosine kinase, suggested that tumor angiogenesis de- antibody, given the generic name bevaci-
further confirming that evolution had pended on a complex integration of these zumab and the brand name Avastin, first
selected VEGF to act specifically on the various positive and negative regulators entered clinical trials in 1997. Bevacizu-
vascular endothelium by limiting its but did not propose a specific angiogenic mab ultimately achieved FDA approval in
receptor distribution to these cells. pathway nor a key trigger. In contrast, Fer- 2004 as a first-line treatment for meta-
rara showed that angiogenesis depended static colorectal cancer in combination
VEGF and Tumor Angiogenesis on a clear cascade of factors, with VEGF with chemotherapy, based on its statisti-
As noted above, it had long been appreci- as the key initiator of most angiogenic cally and clinically meaningful benefits
ated that neo-angiogenesis accompanies processes; Ferrara’s demonstration of on progression-free survival and overall
and might be required for tumor growth. the primacy of VEGF also pushed the field survival (Ferrara et al., 2004), and has
Building on this background, Folkman to realize that additional growth factors since garnered additional approvals. The

14 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


bevacizumab story provides the definitive increases in VEGF levels in the eyes of competition, Ferrara and Genentech had
demonstration that, in man, specific patients suffering from intraocular neo- far superior VEGF blockers at their
antiangiogenesis blockade can provide vascularization. Shortly thereafter, both disposal. Because of concerns that a
useful tumor control in multiple cancer groups worked in collaboration with Fer- full-length antibody might not diffuse effi-
settings and is a testimonial to the efforts rara to show the benefit of blocking ciently into the retina when injected into
and persistence of Ferrara, and it still VEGF in animal models of ocular neovas- the vitreous, Ferrara and his colleagues
remains the standard for angiogenesis- cularization; Ferrara provided the critically decided to engineer a humanized Fab
based therapeutics. required anti-VEGF blocking reagents for variant of A.4.6.1 for use in the eye that
Kinase inhibitors that target the VEGF these seminal studies. was ultimately given the generic name
receptor signaling pathway have since The introduction of anti-VEGF therapies ranibizumab and the brand name Lucentis
been approved in cancer but do not into the clinic for eye diseases came from a (Ferrara et al., 2006). Ranibizumab had
display as widespread activity while also completely unexpected source, a small other advantages over bevacizumab,
exhibiting broader toxicities. There appear company named NeXstar Pharmaceuti- most notably a much higher affinity that
to be several reasons for this. Biologics- cals. This company was based on Larry allowed it to be active at lower concentra-
based therapies such as bevacizumab Gold’s ‘‘aptamer’’ technology, which was tions, which Ferrara felt might be impor-
are naturally selected to have high affinity being used to develop small synthetic tant in terms of allowing for maintained
and great specificity for their target and RNAs as a new class of drugs, and one activity when the drug would drop to low
also have the benefit of long-circulating of their scientists, Nebojsa Janjic, was levels between monthly injections into
half-lives following injection, allowing for developing an anti-VEGF aptamer with the eye. Genentech initially dosed
rather complete and long-term blockade cancer in mind; however, this aptamer patients with ranibizumab in 2000 and
with little if any off-target activity, which was ineffective when systemically admin- received FDA approval for the treatment
has proven more difficult to achieve with istered in animal tumor models. Stimu- of wet AMD in 2006. The efficacy results
small-molecule kinase inhibitors. Prob- lated by Adamis’ paper, Janjic reasoned were quite stunning, especially when
ably due to the confusion that marked that his aptamer might work better if compared to those obtained with the
the field a few years ago, few biologics- directly injected into the eye. Toward this poorer blocker, Macugen. Instead of
based VEGF-targeted therapies are in end, Janjic met in 1996 with Adamis and merely slowing vision loss, patients on
late-stage clinical trials in cancer; it re- Guyer, who helped Janjic design a clinical average gained vision and maintained
mains to be seen whether either of the development plan for AMD. The aptamer, these gains if dosed on a monthly
two biologicals in phase III trials (that is, termed Macugen, entered clinical trials in schedule. Ranibizumab has since been
the VEGF Trap or Lilly’s ramucirumab 1999. In the meantime, Adamis and Guyer studied in other eye diseases and recently
that targets the VEGF receptor) will pro- decided to try to start their own venture gained approval for retinal vein occlusion.
vide similar or even greater benefit than and searched for the best available VEGF Worldwide, Lucentis is now being used
bevacizumab. inhibitor they could license for use in the to treat about a quarter million patients
eye; it was at this point that I met the pair a year. It perfectly fits the definition of
Anti-VEGF Therapy for Eye as they became interested in our VEGF pharmaceutical blockbuster, in terms of
Diseases Trap, and I became convinced by their providing enormous clinical benefit to
Ferrara played a key role in the develop- compelling rationale. Unfortunately, the many patients while simultaneously pro-
ment of anti-VEGF therapies for eye VEGF Trap was then entangled in a collab- ducing enormous revenues. However,
diseases, an endeavor that depended on oration with the Proctor & Gamble Health there are emerging issues. In part frus-
the contributions and influence of several Care group, which was not interested in trated by the cost of ranibizumab, clini-
key collaborators as well as independent either developing it or out-licensing it for cians explored off-label use of intravitreal
groups. First of all, it should be pointed the eye, and thus Adamis and Guyer had injection of bevacizumab for eye diseases
out that most believe it is the perme- to look elsewhere; several years later, we and claimed to see similar benefit (Rose-
ability-inducing activity of VEGF, first were independently able to progress the nfeld, 2006). While there are certainly
described by Dvorak, that leads to the VEGF Trap into the clinic for eye diseases. concerns in terms of safety risks to
retinal swelling and edema that cause By 2000, Adamis and Guyer had started patients of such off-label use, the National
vision loss in wet AMD; other eye diseases a company called Eyetech and, not having Eye Institute decided that the potential
(such as proliferative diabetic retinopathy) other options, licensed Macugen and pharmacoeconomic value of a lower-
do exhibit the profound pathologic neo- continued its clinical development. In priced alternative warranted running
vascularization that we now know is also phase III, Macugen produced rather clinical trials directly comparing ranibizu-
driven by VEGF. It was in the latter type modest results, somewhat slowing the mab and bevacizumab in AMD; results
of settings that the first definitive link progressive visual decline of AMD but are expected in 2011. In addition, be-
between VEGF and human eye disease was nevertheless approved by the FDA cause patients and physicians are very
was made, simultaneously in 1994 by in 2004; Pfizer entered into the mix and interested in decreasing the frequency of
Adamis and colleagues as well as Aiello paid a huge premium to obtain rights to eye injections, there have been many
and King working in collaboration with this innovative therapeutic. attempts to study less frequent dosing
Ferrara (Adamis et al., 1994; Aiello et al., Although temporally behind the Macu- paradigms; despite these efforts, current
1994); both groups showed marked gen story, and certainly spurred by the evidence supports the need for regular if

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 15


not monthly injection of ranibizumab to in ovarian cancer using an innovative REFERENCES
optimize its benefit. Early studies with ‘‘maintenance design’’ carried out by the
Adamis, A.P., Miller, J.W., Bernal, M.T., D’Amico,
other biologics blockers raise the possi- Gynecological Oncology Group (GOG-
D.J., Folkman, J., Yeo, T.K., and Yeo, K.T. (1994).
bility that an even higher-affinity blocker, 0218). Data from this study can be used Am. J. Ophthalmol. 118, 445–450.
perhaps at higher doses, could provide to make several important points. First,
further visual gains or allow for longer this study shows that, at least in this Aiello, L.P., Avery, R.L., Arrigg, P.G., Keyt, B.A.,
Jampel, H.D., Shah, S.T., Pasquale, L.R., Thieme,
interval dosing. setting, bevacizumab does not primarily
H., Iwamoto, M.A., Park, J.E., et al. (1994).
In many ways, Ferrara’s career repre- work by allowing more efficient delivery N. Engl. J. Med. 331, 1480–1487.
sents the fulfillment of every drug discov- of chemotherapy (as had been proposed
erer’s dream, and the Lasker Award could by others), given that the gained benefit is Bagri, A., Berry, L., Gunter, B., Singh, M., Kasman,
I., Damico, L.A., Xiang, H., Schmidt, M., Fuh, G.,
not be going to a more worthy recipient. at least as good during the monotherapy
Hollister, B., et al. (2010). Clin. Cancer Res. 16,
Ferrara not only made a seminal scientific maintenance stage as during the prior 3887–3900.
discovery, but then he and his colleagues combination stage. Moreover, the study
Connolly, D.T., Olander, J.V., Heuvelman, D.,
at Genentech built on this discovery to convincingly shows that continued main-
Nelson, R., Monsell, R., Siegel, N., Haymore,
spearhead the development of an entirely tenance with anti-VEGF therapy is neces-
B.L., Leimgruber, R., and Feder, J. (1989). J. Biol.
new class of therapeutics with major sary to prevent loss of clinical benefit. Chem. 264, 20017–20024.
applications in two previously distinct In addition to maintenance approaches or
Folkman, J. (1971). N. Engl. J. Med. 285, 1182–
clinical arenas—vascular eye diseases treatment-through-progression strate-
1186.
and cancer. Although Ferrara’s VEGF gies, the benefit of anti-VEGF therapy
antibody is now being used to treat may also be improved by combining with Ferrara, N., Hillan, K.J., Gerber, H.-P., and
about 250,000 cancer patients a year, agents targeting other angiogenic path- Novotny, W. (2004). Nat. Rev. Drug Discov. 3,
391–400.
the current award may have avoided ways; notably, several companies are in
specifically acknowledging Ferrara’s trials combining anti-VEGF agents with Ferrara, N., Damico, L., Shams, N., Lowman, H.,
contribution to the cancer field because other antiangiogenic agents, such as those and Kim, R. (2006). Retina 26, 859–870.
of questions regarding the degree of clin- targeting Angiopoietin-2. Chemothera- Gerber, H.P., Hillan, K.J., Ryan, A.M., Kowalski, J.,
ical benefit of bevacizumab in cancer. peutics may also be developed that work Keller, G.A., Rangell, L., Wright, B.D., Radtke, F.,
Because bevacizumab represents an better on tumors made hypoxic via antian- Aguet, M., and Ferrara, N. (1999a). Development
entirely new way of attacking cancer, utili- giogenic therapy. Although antiangiogene- 126, 1149–1159.
zation of this approach is still a work in sis approaches in cancer are likely to be Gerber, H.P., Vu, T.H., Ryan, A.M., Kowalski, J.,
progress and may require new treatment further optimized as the community learns Werb, Z., and Ferrara, N. (1999b). Nat. Med. 5,
paradigms to optimize benefit. Traditional better how to take advantage of this 623–628.
treatment paradigms in which the anti- approach, there is little doubt that anti- Keck, P.J. (1989). Science 246, 1309–1312.
cancer therapy is stopped after a short VEGF treatments pioneered by Ferrara
treatment period when tumor killing is and his colleagues will long remain the Kim, K.J., Li, B., Winer, J., Armanini, M., Gillett, N.,
Phillips, H.S., and Ferrara, N. (1993). Nature 362,
thought to be completed, or after tumor foundation of such efforts. Thus, it can be
841–844.
progression when the tumor is thought to hoped that this well-deserved Lasker
have become chemo-resistant, make little award for the discovery of VEGF and the Leung, D.W., Cachianes, G., Kuang, W.J.,
Goeddel, D.V., and Ferrara, N. (1989). Science
sense for an antiangiogenesis approach: development of a treatment for AMD is
246, 1306–1309.
the point is not to try to wipe out the tumor a harbinger of prestigious accolades to
initially but instead to provide ongoing come that would also include specific Rosenfeld, P.J. (2006). Am. J. Ophthalmol. 142,
control by limiting host support; any recognition of Ferrara’s contributions to 141–143.
benefit would be expected to dissipate tumor biology and cancer treatment. Senger, D., Galli, S., Dvorak, A., Perruzzi, C.,
as soon as such therapy is stopped. Ferra- Harvey, V., and Dvorak, H. (1983). Science 219,
ra’s colleagues at Genentech have nicely 983–985.
ACKNOWLEDGMENTS
demonstrated this point in very recent Yancopoulos, G.D., Davis, S., Gale, N.W., Rudge,
animal studies (Bagri et al., 2010), as well G.D.Y. works at Regeneron, which is developing J.S., Wiegand, S.J., and Holash, J. (2000). Nature
as in recent clinical studies including one anti-VEGF therapeutics. 407, 242–248.

16 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


Leading Edge
BenchMarks

A Life-Long Quest to Understand


and Treat Genetic Blood Disorders
David G. Nathan1,*
1Robert A Stranahan Distinguished Professor of Pediatrics and Professor of Medicine Harvard Medical School, President Emeritus

Dana-Farber Cancer Institute, Physician-in-Chief Emeritus Children’s Hospital, Boston, MA 02115, USA
*Correspondence: david_nathan@dfci.harvard.edu
DOI 10.1016/j.cell.2010.09.015

This year’s Lasker-Koshland Special Achievement Award in Medical Science is conferred on Sir
David Weatherall for his 50 years of dedication to biomedical research, his groundbreaking discov-
eries about genetic blood diseases, and his life-long passion for bringing improved medical care to
the developing world.

Sir David J. Weatherall is surely in the Hence the strains of Bach in the back- more salutary was the national require-
center of the front row of the first-ranked ground of so many calls to the Weatherall ment for military service once he had
hematologists in the world. His impact home in Oxford. graduated with an MB (Bachelor of Medi-
on medical genetics is second to none. David Weatherall wanted to be a physi- cine) in 1956. Assigned to the British Army
It is no surprise that he has received the cian for as long as he can remember. as a medical officer, he was posted to
2010 Lasker-Koshland Special Achieve- Whether Liverpool’s distinguished history Singapore and then to Malaya, where in
ment Award in Medical Science. 1960 he reported his first cases of
He adds this considerable honor the blood disease thalassemia, an
to a long list of distinguished career inherited hemoglobin disorder that
awards, medals, and honorary provides a measure of protection
degrees from an international host of against malaria. His interest in con-
universities, learned societies, and genital disorders of the red cell,
most particularly, in the view of frus- particularly thalassemia, and their
trated anglophiles who fruitlessly interactions with malaria has never
yearn for royal recognition, the British left him. Fascinated by the role of
Crown itself. gene mutations in human disease
Weatherall was born, raised, and and immediately after he completed
educated in Liverpool, that port city his military commitment, he joined
where the Mersey River meets the the genetics-oriented Johns Hopkins
Irish Sea. At its peak, 40% of Eng- hematology training program. The
land’s trade, huge numbers of immi- program at that time was led clinically
grants, and many British subjects by the late C. Lockard Conley, and
migrating to the west and the east Weatherall was inspired to pursue
passed through Liverpool. Weatherall genetics by the broad influence of
comes from a long line of ‘‘Liverpudli- the late Victor McCusick.
ans.’’ As a youngster, he became From the very beginning of his
infused by interests in science and training, Weatherall demonstrated an
music and by that city’s first love, uncanny capacity to associate with
football. His father was a laboratory excellent scientists. He worked with
technician who went to college at the late Ned Boyer on hemoglobin
night and rose to become the chief genetics and collaborated with the
of the analytical chemistry laboratory Sir David J. Weatherall late Corrado Baglioni, then at the
in a large Liverpool company as well Image courtesy of L. Rose. Massachusetts Institute of Tech-
as a council member of the Royal nology, on hemoglobin fingerprinting
Society of Chemistry, but his first love of tropical medicine, orthopedics, and to prove that the alpha chains of fetal
was music. He was the organist and choir anesthesia was of any influence is and adult hemoglobin are derived from
master of St. Nicholas Church on the Liv- unknown. Whatever the reason, he the same genetic loci (Weatherall and
erpool waterfront. Weatherall’s mother became the first in his family to go to Baglioni, 1962). Weatherall and Baglioni
was also devoted to music and was college and medical school: the results then added further evidence that the
blessed with a beautiful contralto voice. of that decision proved fortunate. Even fetal-to-adult hemoglobin switch involves

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 17


a change in the expression of non-alpha Seattle. Weatherall asked the two protein assemia, malaria, and the hemoglobinop-
chains during development. chemists for help with a critical question athies. In the process of studying thalas-
During his training program at Johns on which he had been working without semia, he has traveled the world many
Hopkins, Weatherall plunged into the great success for months. Can the ex- times over and has trained a substantial
details of thalassemia. The mysterious pected depression of beta globin chain cadre of investigators who direct impor-
disease had been greatly clarified by the synthesis be reliably detected biosynthet- tant clinical and clinical research pro-
classic 1959 review article by Ingram ically in the reticulocytes of patients grams particularly in Southeast Asia.
and Stretton, who correctly predicted with beta thalassemia? Clegg suggested Much of his most original clinical research
the occurrence of both alpha and beta that a carboxymethylcellulose column effort has illuminated the alpha thalas-
thalassemia and proposed that point and a buffer containing 8 molar urea semia syndromes, conditions particularly
mutations in the beta globin gene might and 6-mercaptoethanol might keep the prevalent in Southeast Asia.
be responsible for reduced synthesis of alpha, gamma, and beta globin chains In 1974, when reverse transcriptase
beta globin. But there were many unan- separated, prevent their aggregation, permitted the development of isotopically
swered questions, and Weatherall was permit their independent isolation, and, labeled cDNA probes, both Weatherall’s
determined to master the literature and hence, allow the determination of their group (Ottolenghi et al., 1974) and a group
combine it with his own experience. specific activities after incubation of assembled by Y.W. Kan (Taylor et al.,
In 1965, as the sole author, he published blood from thalassemia patients with a 1974) demonstrated that complete alpha
3
the first edition of The Thalassaemia H- or 14C-labeled amino acid (Weatherall globin gene deletion plays a critical role
Syndromes, a uniquely valuable reference et al., 1965). Though the method was in the development of severe (and usually
text and critical appraisal of the field. malodorous and the fraction collector fatal) hydrops fetalis with Bart’s hemoglo-
In the subsequent three editions, he was permanently encrusted with crystals of binemia. The two papers were published
joined first by his long-time colleague urea, it worked and clearly documented back to back in the same issue of Nature.
John Clegg and subsequently by several that thalassemia is a disorder of unbal- Later it was shown that unusual point
coeditors. The last edition of this monu- anced globin synthesis. Though almost mutations may also inhibit or even arrest
mental contribution to hematology and entirely replaced by modern DNA-based alpha globin gene expression. In fact,
clinical genetics was published in 2001. methods, it remains a valuable if unwieldy in 1975, Weatherall and Clegg demon-
The four editions are heavily cited land- approach to the diagnosis of microcytic strated that a termination codon mutation
marks in medical education and are anemias of unknown etiology. Clegg and in one of the four alpha genes can lead to
magnificent examples of interweaving of Weatherall have been colleagues ever an abnormally elongated alpha chain and
literature with personal experience. They since. an unstable messenger RNA producing
reveal Weatherall’s understanding of Following his remarkably productive alpha + thalassemia, but deletion is the
Darwin’s precept that disorders due to sojourn in Baltimore, Weatherall returned predominant genetic lesion in alpha 0
gene mutations are heavily modified by to the University of Liverpool where, with thalassemia.
environmental circumstances. Finally, his colleagues Clegg and Bill Wood, The development of reasonably spe-
they established Weatherall as one of a young trainee, he established a superb cific beta globin cDNA probes that
the founders of molecular medicine and clinical research program in hematology. permitted interpretable Southern blots
attracted many basic scientists into the He rose to the rank of Professor of Hae- was somewhat more difficult than that of
field. As a result, thalassemia led the matology and remained in Liverpool until alpha globin cDNA probes because of
way toward the clinical applications of 1974 when he moved, again with his two overlap of beta globin DNA sequences
molecular biology. close colleagues, to the University of with delta and gamma sequences. In
In addition to his scientific training, Oxford to be the Nuffield Professor and 1976, a group assembled by Weatherall
Weatherall had two very important then the Regius Professor of Medicine and headed by Sergio Ottolenghi demon-
encounters in Baltimore that were to be and where he founded a research institute strated that both delta-beta thalassemia
extremely influential in his personal and now named the Weatherall Institute of and the form of hereditary persistence of
professional life. In 1960, he met Stella Molecular Medicine. The institute, the first fetal hemoglobin (HPFH) found in Africans
Mayorga-Nestler in the Johns Hopkins of its kind in Europe, opened in 1989 and are due to extensive gene deletions (Otto-
biochemistry department of the then now has a staff of over 400. It is devoted lenghi et al., 1976). The subtle but impor-
School of Hygiene, where she was work- to biomedical research with a strong clin- tant differences between the two that
ing with Roger Herriott of DNA transfor- ical component. He retired from the lead to considerably higher gamma gene
mation fame. They were married in Oxford faculty in 2000 but remains expression in HPFH were detected later
Stella’s California home in 1962. A second a distinguished participant in the institute, by several groups. Only 2 years later
critically important set of encounters now directed by his former student, such a probe was utilized by Orkin and
included Mike Naughton, an excellent Douglas Higgs, a superb physician his coworkers to exclude homozygous
protein chemist who was working in scientist. delta-beta thalassemia in a first trimester
the Howard Dintzis laboratory at Johns In addition to his many book chapters Turkish fetus at risk (Orkin et al., 1978).
Hopkins, and John Clegg, who had joined and The Thalassaemia Syndromes, The alpha thalassemias continued
Naughton after a brief (and stormy) Weatherall has been a coauthor of over to capture Weatherall’s interest and
sojourn in Hans Neurath’s laboratory in 500 articles, most of which focus on thal- attention, and when Douglas Higgs joined

18 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


his laboratory as a budding physician regimen would eliminate iron nearly as dents of thalassemia with insights into
scientist, that interest blossomed into well but be much more acceptable to the clinical course of the disease as
major findings. By this time, Weatherall’s patients (Pippard et al., 1977). They were patients age (O’Donnell et al., 2007). His
research unit had become a reference correct, but the long gaps in which no clinics in Sri Lanka are invaluable ‘‘class-
laboratory for clinicians throughout Great chelator could be present in the blood rooms’’ for young North American and
Britain, southern Europe, and Southeast diminished the efficacy of the treatment. British students of the disease, particu-
Asia. Among these referrals were three On the other hand, many more patients larly for those who wish to find better
blood samples from male patients of could accept the regimen. It became the treatments, to learn quickly about its
northern European origin, each of whom standard of care until very recently when manifestations and for those who intend
had both mental retardation and hemo- deferisirox, an orally active chelator with to contribute to the care of patients
globin H disease, a form of alpha thalas- a long plasma half-life, became available. desperately in need. Even more important
semia usually due to three alpha gene Though Weatherall was rightly doubtful is Weatherall’s creation of an Asian Thal-
deletions. Analysis of the alpha genes of that the globin chain synthesis system assaemia Network in which experts in
the patients and their parents revealed that he had developed with Clegg and India and Thailand give technical assis-
that one parent did indeed have two alpha Naughton (Weatherall et al., 1965) could tance to their colleagues in less devel-
gene deletions (as expected), but the be reliably applied in prenatal diagnosis oped countries such as Bangladesh and
other had an entirely normal complement using blood obtained from the placenta, Cambodia.
of four alpha genes. The patients had only he changed his mind when he saw the Meanwhile, Weatherall continues to
two deletions. Clearly another mutation initial results of the efforts of Kan and Alter travel to major sites of the thalassemia
must have been present to suppress the and their colleagues (Kan et al., 1972). He syndromes, urge world health authorities
expression of the intact alpha genes, moved aggressively to establish a highly and private foundations to pay attention
and that mutation was likely to cause the successful prenatal detection system in to the inherited hemoglobinopathies, tell
mental retardation as well. That was England that became a model of its kind anyone who will listen about the impend-
a puzzle to be solved considerably later (Old et al., 1982) and then adopted more ing world impact of the disorders, and
in a brilliant series of studies by Higgs practical molecular methods when they try to do his best to relieve the suffering
and his colleagues. These studies dem- became available. that these common inherited diseases
onstrated an X-linked helicase deficiency As Weatherall began to pass the bring to those who can least afford to
in the male patients and subtelomeric torch of leadership of laboratory-based deal with them. He does all this with
deletions on chromosome 16 in others research to Higgs, he directed his consid- gem-like intelligence and indefatigable
that were shown to be responsible for erable energy to his first interest, the determination, both mixed with mar-
reduced alpha globin gene expression plight of poor patients in malaria zones velous humor and deep interest in what
and were presumably responsible for the who endure high rates of both malarial his colleagues are doing. Indeed, life in
mental retardation (Gibbons and Higgs, and nonmalarial infections and of in- academic medicine is really all about
2000). herited hemoglobinopathies. His publica- working with great colleagues. I have
The remarkable copresentation of tions in this important area are many, but been blessed with many, none more
mental retardation and alpha thalassemia one of the most interesting is his finding enjoyable or admirable than Sir David
stimulated Weatherall and Higgs to focus in Papua, New Guinea that a single alpha J. Weatherall.
on the molecular anatomy of the alpha gene deletion and particularly two such
globin gene cluster. They provided the deletions provide high protection from
REFERENCES
first RFLP map of the cluster and showed both malarial and nonmalarial infections
that it offered an excellent site for linkage (Allen et al., 1997). How a mild inherited Allen, S.J., O’Donnell, A., Alexander, N.D., Alpers,
analysis (Higgs et al., 1986). Along the disorder of hemoglobin synthesis, limited M.P., Peto, T.E., Clegg, J.B., and Weatherall, D.J.
way, they defined the alpha globin gene in its expression to the red cell and (1997). Proc. Natl. Acad. Sci. USA 94, 14736–
locus control region. The experience manifested only as microcytosis (unusu- 14741.

launched Higgs’ fine career. ally small red blood cells), can influence Gibbons, R.J., and Higgs, D.R. (2000). Am. J. Med.
Weatherall is a broadly interested nonmalarial infection rates requires much Genet. 97, 204–212.

hematologist. Though he made many more understanding of host defense than Higgs, D.R., Wainscoat, J.S., Flint, J., Hill, A.V.,
important contributions to the genetic we have currently. In another fascinating Thein, S.L., Nicholls, R.D., Teal, H., Ayyub, H.,
Peto, T.E., Falusi, A.G., et al. (1986). Proc. Natl.
basis of thalassemia, he never lost an study, Weatherall and his colleagues
Acad. Sci. USA 83, 5165–5169.
opportunity to explore its treatment and demonstrated that HbE/thalassemia, a
Kan, Y.W., Dozy, A.M., Alter, B.P., Frigoletto, F.D.,
prevention. Immediately after Propper very common disorder in Southeast
and Nathan, D.G. (1972). N. Engl. J. Med. 287, 1–5.
and his coworkers suggested that daily Asia, provides very little protection from
O’Donnell, A., Premawardhena, A., Arambepola,
continuous subcutaneous administra- malaria caused by the parasite Plasmo-
M., Allen, S.J., Peto, T.E., Fisher, C.A., Rees,
tion of deferoxamine might prolong the dium vivax. In fact vivax malaria infection D.C., Olivieri, N.F., and Weatherall, D.J. (2007).
lives of multiply transfused thalassemia is one of the factors that increases the Proc. Natl. Acad. Sci. USA 104, 9440–9444.
patients with consequent iron overload severity of that particular thalassemia O’Donnell, A., Premawardhena, A., Arambepola,
(Propper et al., 1977), Pippard and syndrome (O’Donnell et al., 2009). Finally, M., Samaranayake, R., Allen, S.J., Peto, T.E.,
Weatherall showed that a 5 day overnight Weatherall’s efforts have provided stu- Fisher, C.A., Cook, J., Corran, P.H., Olivieri, N.F.,

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 19


and Weatherall, D.J. (2009). Proc. Natl. Acad. Sci. trakul, S., and Boon, W.H. (1974). Nature 251, and Nathan, D.G. (1977). N. Engl. J. Med. 297,
USA 106, 18716–18721. 389–392. 418–423.
Old, J.M., Ward, R.H., Petrou, M., Karagozlu, F., Ottolenghi, S., Comi, P., Giglioni, B., Tolstoshev, Taylor, J.M., Dozy, A., Kan, Y.W., Varmus, H.E.,
Modell, B., and Weatherall, D.J. (1982). Lancet 2, P., Lanyon, W.G., Mitchell, G.J., Williamson, R., Lie-Injo, L.E., Ganesan, J., and Todd, D. (1974).
1413–1416. Russo, G., Musumeci, S., Schillro, G., et al. Nature 251, 392–393.
Orkin, S.H., Alter, B.P., Altay, C., Mahoney, M.J., (1976). Cell 9, 71–80.
Lazarus, H., Hobbins, J.C., and Nathan, D.G. Pippard, M.J., Callender, S.T., Warner, G.T., and Weatherall, D.J., and Baglioni, C. (1962). Blood 20,
(1978). N. Engl. J. Med. 299, 166–172. Weatherall, D.J. (1977). Lancet 2, 737–739. 675–685.

Ottolenghi, S., Lanyon, W.G., Paul, J., Williamson, Propper, R.D., Cooper, B., Rufo, R.R., Nienhuis, Weatherall, D.J., Clegg, J.B., and Naughton, M.A.
R., Weatherall, D.J., Clegg, J.B., Pritchard, J., Poo- A.W., Anderson, W.F., Bunn, H.F., Rosenthal, A., (1965). Nature 208, 1061–1065.

20 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


Leading Edge
Essay

MicroRNAs and Cellular Phenotypy


Kenneth S. Kosik1,*
1Neuroscience Research Institute, Department of Molecular Cellular Developmental Biology, University of California, Santa Barbara, Santa

Barbara, CA 93106, USA


*Correspondence: kenneth.kosik@lifesci.ucsb.edu
DOI 10.1016/j.cell.2010.09.008

This Essay explores the notion that specialized cells have unique vulnerabilities to environmental
contingencies that microRNAs help to counteract. Given the ease with which new microRNAs
evolve, they may serve as ideal facilitators for the emergence of new cell types.

Invariant laws of nature impact the miRNA is suppressed or knocked out. In proteins, lipids, metabolites, and a host
general forms and functions of fact the effects of miRNAs on protein of other molecules—occupy a parameter
organisms; they set the channels levels are generally modest (Guo et al., space within a range of values, which
in which organic design must 2010), and short-circuiting nearly all define the ‘‘cell state.’’ As markers of cell
evolve. But the channels are so miRNA biogenesis by inactivating Dicer identity, miRNAs encode a representation
broad relative to the details that can have surprisingly modest effects on of multiple cell states that all correspond
fascinate us! The physical channels differentiation and patterning; however, to a single identity. That is, many different
do not specify arthropods, anne- contrary experiments have also been states comprise a single identity because
lids, mollusks, and vertebrates, reported (reviewed in Fineberg et al., cells must retain their identities in the face
but, at most, bilaterally symmetrical 2009). Although many miRNAs are highly of both environmental changes and
organisms based upon repeated conserved, some over the entire period internal noise that can result in large
parts . When we set our focus of bilaterian evolution, other miRNAs are variations in molecular composition.
upon the level of detail that regu- only found along a single evolutionary Presumably, protein levels in cells fall
lates most common questions branch, indicating the ease with which within certain boundaries below which
about the history of life, contin- new miRNAs are invented (Kosik, 2009). there is an insufficient amount of the
gency dominates and the predict- Finally, among the puzzling features of protein to achieve function and above
ability of general form recedes to miRNAs are the overall increase in their which toxicity emerges. miRNAs are
an irrelevant background. variety as a function of evolutionary time, good candidates for setting boundary
the lack of conservation of some targets, conditions upon coding transcripts to
Stephen Jay Gould, Wonderful Life: The
and the poorly understood relationship restrict protein levels within a range of
Burgess Shale and the Nature of History.
between targets and phenotypes. values that maintain cell identity in the
Penguin Books, 1989. (pp. 289–290).
The perspective put forth here is that face of homeostatic compensatory
miRNAs serve as a reservoir to assist cells changes. Thus, miRNAs have properties,
Introduction in coping with environmental contin- which can hierarchically link the many
Much is puzzling about microRNAs gencies. For instance, cells may at times parameter settings of the cell state to
(miRNAs). They are highly accurate mar- face short-term oxygen deprivation, but a phenotypic singularity known as cell
kers of cell identity; their profiles unam- a cell that is more dependent on aerobic identity.
biguously distinguish among cellular respiration will require its own adaptive Cells undergoing developmental or
phenotypes, including embryonic stem response. If miRNAs are available for envi- malignant transformation reset their
cells, a vast variety of precursor cells, ronmental contingencies, then their boundary conditions across a specified
terminally differentiated cells, and tumor response must be honed for the needs of collective threshold of multiple parame-
types, even among closely related specific cell types. Evolutionary change ters, which define a new identity. Shifting
cancers (Lu et al., 2005). Furthermore, in begins with mutations—not specialized the miRNA profile during development or
surveying many miRNA profiling studies, cells. The ease of miRNA invention relaxing controls over onco-miRNAs and
the expression differences among certain suggests that new miRNAs will create tumor suppressor miRNAs are associated
miRNAs in various cell types are often conditions for expanding cell diversity with morphing a cell toward a new identity
orders-of-magnitude in contrast to the because the presence of a specific miRNA (Figure 1). Changes in cell identity usually
low variation of most miRNAs following may offset vulnerabilities of specialized occur in the context of mitosis during
environmental influences that do not cells to environmental contingencies. stem cell differentiation, reprogramming,
change cell identity. Although there is oncogenesis, metaplasia, or pathological
a strong correlation between cell identity MicroRNA Profiles Correlate response to injury. Usually controls over
and patterns of miRNA expression, this with Cell Identity the cell cycle are closely linked to the
does not mean that there are strong The complete list of constituent mole- emergence of a new identity, a point
phenotypic effects when an individual cules within a cell—its transcripts, most recently confirmed in several

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 21


complexes found in postmitotic neurons.
miR-9* and miR-124 mediate this dy-
namic shift in subunit composition by
binding to sequences in the 30 untrans-
lated region of BAF53a mRNA, repressing
protein expression, and presumably
changing the kinetic balance of subunits
that drive complex assembly.

miRNA Networks
The control elements over gene expres-
sion and the networks that link them are
often discussed in terms of their role in
sharpening the output and making the
system robust. Because miRNAs target
multiple mRNAs, they can exert distrib-
uted control over broad target fields of
functionally related mRNAs as opposed
to focusing their control on a small
number of genes in a ‘‘final common
pathway.’’ These networks are often
specialized for specific cell types. For
example, miR-21 regulates diverse
Figure 1. Cell Identity and miRNA Profiles mRNAs that collectively control apoptosis
The cell state is the complete list of constituent molecules within a cell each at a specific number of copies and proliferation, and the dysregulation of
at one particular moment in time. The levels of all transcripts are one component of the cell state and each
miR-21 is associated with many types of
transcript is expressed at a range of levels with some maxima and minima depicted as boundaries. Within
these boundaries the cell maintains a discrete identity, for example a specific type of differentiated cell. cancer (Papagiannakopoulos et al.,
When a cell changes its identity—for example by reprogramming to a stem cell or undergoing malignant 2008). miRNAs, including nonhomolo-
transformation—new boundaries are established for the transcriptome. Transcription factors drive cells gous miRNAs, are often physically clus-
across boundaries to new identities and operate in feedback and feedforward loops with microRNAs
(miRNAs). miRNA profiles reflect cell identity with very high accuracy and therefore reduce high-dimen- tered in the genome, and these sets of
sional cell state values to a single profile. miRNAs may target mRNAs with related
biological functions at short distances in
their protein-protein interaction map
studies that enhance the generation of C.H. Waddington, and it has been (Kim et al., 2009). The mouse miRNA
induced pluripotent stem cells by modu- proposed that miRNAs guide a cell past cluster, mmu-mir-183-96-182, targets
lating cell-cycle regulators p53, p21, and epigenetic traps toward its phenotype in Irs1, Rasa1, and Grb2, all of which are
p16(Ink4a)/p19(Arf) (reviewed in Puzio- the face of environmental variation (Horn- located in the insulin-signaling pathway,
Kuter and Levine, 2009). The reverse stein and Shomron, 2006). Although chro- and these miRNAs coordinate the control
and forward arrows of change in cell iden- matin organization may account for the of this signal transduction process
tity are not symmetric. Reprogramming height of the barriers to identity changes (Xu and Wong, 2008). The wide variation
a somatic cell to a stem cell is a rare event (Chi and Bernstein, 2009), relatively subtle in the glucose needs of cells suggests
but potentially possible in any cell. On the balances in the constituents of a protein that the specific workings of this pathway
other hand, pluripotency is easily lost. complex accompany differentiation. An probably differ among cell types. These
Beyond a defined set of growth factors example of this shift mediated by miRNAs specific examples have been generalized
required for sustaining stem cells, pluripo- occurs in vertebrate nervous system to show that coordinated miRNA targeting
tency exists as a state of ‘‘freedom’’ from development. The development of the of closely connected genes is prevalent
other extrinsic factors (Silva and Smith, vertebrate nervous system provides an across pathways (Tsang et al., 2010).
2008) that promote differentiation. example of the influence of miRNAs over Target capture by an miRNA depends
To maintain pluripotency, the cell must epigenetic factors. As precursor cells on the expression level of the miRNA,
minimize not only the effects of extrinsic lose multipotency, a subunit switch the levels of all the target mRNAs,
signals but also intrinsically random fluc- occurs in the mammalian SWI/SNF com- including pseudogene decoy targets
tuations that can initiate unintended plex, which mediates ATP-dependent (Poliseno et al., 2010), and the affinities
differentiation. chromatin remodeling (Yoo et al., 2009). between them. Thus the network effects
The intermediate states through which During development, the BAF53a and of miRNAs can only be interpreted in
cells travel to reach new identities are BAF45a subunits within the neural- a particular cell if the copy numbers of
lined with traps. The concept of steering progenitor-specific complexes swap out all mRNA targets are known. Small
between these danger zones is called in favor of the homologous BAF53b and changes within an miRNA/mRNA target
‘‘canalization’’ and was introduced by BAF45b subunits to form neuron-specific network may broaden random variation

22 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


around a threshold and, as described for toxicity, the fluctuation is better tolerated a large pool of stable miRNA/mRNA
the intestinal specification network in and miRNA regulation becomes extra- duplexes rather than triggering duplex
C. elegans (Raj et al., 2010), give rise to neous. Only the extremes of protein degradation at the moment of binding
a variable ON/OFF expression pattern of copy number variation within an infre- allows an entire control layer to lie poised
a ‘‘master’’ regulatory gene within a popu- quently occurring long tail jeopardize the for the rapid release of a networked set of
lation of cells. Disrupting a network in this cell. However, if the mean copy number mRNAs to undergo translation and
manner thus leads to cell population of the protein is close to the point of achieve a smooth and coordinated iden-
variation and has the potential to expand toxicity—and indeed, optimal function tity transition. Like apoptosis, in which
the phenotypic repertoire of an organ- may require that the protein set point is the cell systematically destroys itself in
ism’s cells. close to the toxic level—then tight regula- a highly controlled sequence of events
miRNAs often operate in feedforward tion is necessary, and this might be to prevent triggering inflammatory reac-
and feedback loops. Genome-scale achieved by miRNAs. In this context, tions, changes in cell identity require an
mapping in C. elegans has revealed 23 a modest effect of miRNAs on protein orderly transition so that residua from
such loops within the transcription levels (Guo et al., 2010) will be highly a parental cell do not create toxic
circuitry (Martinez et al., 2008) including significant. PTEN appears to be an interactions with an emerging daughter
a miRNA/transcription feedback loop example of a gene under exquisitely fine cell while sustaining cell function during
that sets up left-right asymmetry (John- regulation—it is targeted by numerous the transition.
ston et al., 2005). The mediation of pluri- miRNAs—and fine changes in its dosage
potency exit by miR-145 operates as are critical to its cancer-forming potential miRNA Levels Reset during
a double-negative feedback loop with (Alimonti et al., 2010). an Identity Change
the transcription factor Oct4 (Xu et al., Information on the turnover of miRNAs The mapping of an miRNA profile onto cell
2009). The operation of this loop may is just emerging. Often the pairing of the identity—a many onto one mapping—
generate bistability through which the prokaryotic small RNAs with a target corresponds to a phenotypic singularity
cell reaches a single identity unless it mRNA exposes both molecules to rapid within the repertoire of all possible cellular
crosses a barrier at which point it inevi- degradation (Masse et al., 2003). Some identities that the organism is capable of
tably transitions to an alternative identity. miRNA/mRNA duplexes appear to be producing. How the miRNA profile
Identity transitions via bistable states highly stable as long as the identity of undergoes the sweeping coordinated
achieve discrete identities and avoid the cell is stable. On the other hand, in changes associated with a new cell iden-
intermediate states. miR-145 continues neurons (and perhaps other specialized tity is poorly understood. Is there a global
to operate in differentiation at further settings will show similar phenomena), disassembly of RISCs and loss of pre-ex-
stages of mesoderm development in miRNA turnover is rapid. For example, isting miRNAs while new miRNA tran-
regulating smooth muscle cell fate the miR-183/96/182 cluster, miR-204, scription ramps up to fill RISCs or induce
(Cordes et al., 2009). Interestingly, miR- and miR-211 decay rapidly during dark their assembly with a distinct set of miR-
145 in smooth muscle cells maintains its adaptation and are transcriptionally upre- NAs? XRN is a candidate for mediating
functional vector toward differentiation gulated in light-adapted retinas (Krol this transition. In C. elegans, active turn-
but switches some targets through which et al., 2010). Indeed, the specialized over is mediated by the 50 to 30 exoribonu-
it acts. Whether degraded or maintained requirements of neurons, particularly clease XRN-2 to modulate activity of the
as a stable duplex the miRNA is with regard to plasticity, may utilize the mature miRNA (Chatterjee and Gros-
consumed, and thus its action is distinct miRNA system for regulation at a faster shans, 2009) and XRN is necessary for
from the catalytic effects of many protein timescale than in other cells. When a small regeneration in planarian (Rouhana et al.,
regulators of gene expression. Thus the number of mRNAs are locally activated, 2010). Heuristically, an entry point to this
two limbs of the transcriptional feedback the RISC through its component protein, issue is cell transition states. Because
loops operate quite differently: transcrip- MOV10 (also known as Armitage in nature is so effective in establishing
tion factors regulate transcription of the Drosophila and SDE3 in Arabidopsis thali- discrete identities for cells, such states
primary miRNA and miRNAs stoichiomet- ana), can derepress otherwise silenced are not always easy to observe.
rically regulate the translation of the local translation (Banerjee et al., 2009). Developmentally, cells have two strate-
mRNA that encodes the transcription The adaptation of miRNAs for rapid local gies by which they can morph into another
factor. regulation contributes to fundamental cell type. These strategies are distin-
Wu and colleagues (Wu et al., 2009) neuronal properties such as control over guished by ‘‘mitosis required’’ or ‘‘mitosis
have proposed that miRNAs keep the local translation at the synapse and hence optional’’ properties. The mitosis required
system close to the mean and set expres- has facilitated cell specialization. option utilizes precursors that travel
sion boundaries of transcription factors, The RISC allows both the constitutive through stages that progressively narrow
which are otherwise noisy. The mean maintenance of cell identity by silencing the potential of the cell within a lineage
number of copies of different proteins in mRNAs that are not part of the specialized tree until a terminal identity is achieved.
a cell might have a set point, which lies cell’s repertoire as well as the holding of Reaching a terminal identity requires
at different distances from the level of mRNAs of an alternative identity in passage through each discrete precursor
toxicity. When the range of protein levels reserve (Lim et al., 2005), perhaps for in a Waddington landscape. Progression
in a cell fluctuates far from the point of less frequent contingencies. Maintaining toward terminal differentiation through

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 23


a set of precursors can scale the number fore, within the many feedback loops the adaptive responses of cells to an envi-
of cells produced to the morphology of involving miRNAs, transcription factors ronmental contingency is the up- or
the organism and position them correctly. have a ‘‘dominant’’ role. Oncogenic downregulation of proteins. The proper-
For example, the kinetics of neuron changes in cell identity are also domi- ties of miRNAs to adjust protein levels,
generation in the development of the nated by transcription factors that oper- their dispensability under basal condi-
mouse cerebral cortex can be modeled ate in feedback or feedforward loops tions, their conservation, as well as the
by determining the proportion of neuroe- with miRNAs. For example, activation of ease with which new miRNAs appear
pithelial cells that exit versus re-enter the the c-Myc oncogenic transcription factor over evolutionary time all suggest that
cell cycle over the 6 day neuronogenetic induces Lin-28 and Lin-28B, which nega- they are suited for environmental contin-
interval of 11 cell cycles (Caviness et al., tively regulate let-7 biogenesis by pre- gencies. Among the many contingencies
2003). In Drosophila, neuroectodermal venting both Drosha- and Dicer-mediated organisms face is famine. The response
cells have a single fate decision at the let-7 processing (Chang et al., 2009). to limited glucose is mediated by insulin,
time of cell division: differentiate into neu- Thus, a Myc-Lin-28B-let-7 regulatory which lies in a pathway that is highly inter-
roblasts, which specify neural fate circuit appears to reinforce Myc-medi- connected to miRNAs (Xu and Wong,
through their progeny, the ganglion ated oncogenesis. The Lin-28-let-7 core 2008). One developmental response to
mother cells, or specify epidermal differ- circuitry also operates in a positive feed- limited glucose at the organismal level is
entiation (Doe, 2008). In the case of re- back loop through NF-kB, which activates a reduction in body size, and in Drosophila
programming one can reverse the arrow Lin-28 to create a link between inflamma- this adaptation appears to be mediated
of differentiation; however, mitosis tion and cell transformation (Iliopoulos by miR-8 and its target USH (u-shaped)
remains a requirement for successful re- et al., 2009). (Hyun et al., 2009). Flies lacking miR-8
programming. The many control points The two strategies for increasing the are both defective in insulin signaling in
over mitosis operate within a complex variety of specialized cells during devel- the fat body (the counterpart of liver and
circuitry that includes multiple miRNAs opment have important differences. adipose tissue) and smaller in size.
as is apparent in many studies that impli- Lineage reprogramming may reduce the In humans, a miR-8 homolog, miR-200,
cate miRNAs in cancer. dangers of the mitotic state with its risk and a USH homolog, FOG2, mediate the
Changes in cell identity also occur of cancer and directly preserve the epige- same pathway. Another example is the
without cell division or very limited cell netic marks of the starting cell type. But response of the heart to stress and hypo-
division through transition states without without expansion in cell number, growth thyroidism through expression of the
discrete precursors. For example, when of the organism is restricted. Importantly, cardiac-specific miR-208 (van Rooij
zebrafish endothelial cells egress from growth of the organism is not strictly et al., 2007).
the aortic ventral wall they become hema- a matter of size; in the case of the brain, The miR-143/145 locus nicely illus-
topoietic stem cells (Kissa and Herbomel, for example, massively parallel neuronal trates the paradox that specific miRNAs,
2010). Direct conversion of cells has been networks confer emergent properties to which are part of a cell’s unique profile,
achieved repeatedly in the laboratory: the the organism including sapience. The do not result in the loss of the cell’s iden-
transcription factor CEBP can convert B widespread developmental strategy of tity when knocked out, but they do impair
lymphocytes to macrophages (Xie et al., utilizing precursor pools as discrete the cell under certain contingencies. miR-
2004), Math1 can reprogram inner ear cellular intermediates toward the genesis 143/145 knockout mice have impaired
support cells to hair cells (Izumikawa of a mature organism requires the estab- neointima formation in response to
et al., 2005), and MyoD, a transcription lishment of a series of precursor cell vascular injury and have reduced vascular
factor that specifies the skeletal muscle identities along a path of progressively tone (Xin et al., 2009). Hornstein and
lineage, can convert cultured embryonic narrowing potential until the cell reaches Shomron (2006) point to the example of
fibroblasts, chondroblasts, and retinal a terminal identity. The ability of miRNAs miR-1 in D. melanogaster in the context
epithelial cells into contracting muscle to capacitate cellular phenotypy permits of a discussion on canalization. miR-1
cells (Vierbuchen et al., 2010). A method the emergence of large numbers of is a highly conserved muscle-specific
known as direct reprogramming or lineage precursor cell types capable of honing miRNA that does not affect muscle
reprogramming introduces sets of tran- developmental processes toward highly differentiation in D. melanogaster when
scription factors into differentiated cells specialized identities and precise cell knocked out. The phenotype only
that determine the identity of the reprog- numbers. emerges during a rapid growth phase
rammed cell. Three factors—Ascl1, Brn2 (Sokol and Ambros, 2005). This example
(also called Pou3f2), and Myt1l—are suffi- miRNAs as a Reservoir for also makes the point that different cells
cient to convert fibroblasts into neurons Environmental Contingencies and require different responses to the same
(Zhou et al., 2008). In addition to in vitro the Expansion of Animal Phenotypy environmental contingency. In this case,
approaches, pancreatic exocrine cells Many of the puzzling features of miRNAs rapid growth in muscle requires different
have been converted to beta-cells in vivo could be explained if they adapt cells to regulatory circuits than rapid growth in
by the addition of three factors, Ngn3, environmental contingencies. The envi- other cell types.
Pdx1, and Mafa (Lessard et al., 2007). ronment that cells face is many times Cells adapted to an environmental event
Changes in cell identity are closely more complex than the biological adapta- retain a genetic memory of the event.
linked to transcription factors, and there- tions available within the genome. Among When the frequency of an environmental

24 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


contingency falls below a certain level, the estingly, the role of miRNAs in evolution Banerjee, S., Neveu, P., and Kosik, K.S. (2009).
selection pressure on the adaptive of complex multicellularity may extend Neuron 64, 871–884.
response is diminished. However, genetic beyond animals. Among the eukaryotic Caviness, V.S., Jr., Goto, T., Tarui, T., Takahashi,
memory is extended by weakly embed- groups that evolved complex multicel- T., Bhide, P.G., and Nowakowski, R.S. (2003).
Cereb. Cortex 13, 592–598.
ding the miRNA contingency response luarity, miRNAs are also present in red/
Chang, T.C., Zeitels, L.R., Hwang, H.W.,
within a genetic circuitry (that is, a network green algae and brown algae (Cock
Chivukula, R.R., Wentzel, E.A., Dews, M., Jung,
in which a single miRNA targets multiple et al., 2010). J., Gao, P., Dang, C.V., Beer, M.A., et al. (2009).
mRNAs to tune a complex function). The miRNA machinery exists in the De- Proc. Natl. Acad. Sci. USA 106, 3384–3389.
Whereas purifying selection operates on mosponge, Amphimedon queenslandica; Chatterjee, S., and Grosshans, H. (2009). Nature
the miRNA’s role in the genetic circuitry, however, only eight miRNAs have been 461, 546–549.
the miRNA remains in the absence of the detected, none of which bear any ortho- Chi, A.S., and Bernstein, B.E. (2009). Science 323,
contingency and is available to facilitate logy to those in bilateria, and the size of 220–221.
variation (Kirschner and Gerhart, 2005). both the mature miRNA and its precursor Cock, J.M., Sterck, L., Rouzé, P., Scornet, D.,
miRNAs, as part of modular networks, is distinct from other metazoans (Grimson Allen, A.E., Amoutzias, G., Anthouard, V.,
can potentially speed evolutionary et al., 2008). In contrast, the cnidarian Artiguenave, F., Aury, J.M., Badger, J.H., et al.
processes and facilitate novelty (Parter Nematostella vectensis (starlet sea (2010). Nature 465, 617–621.
et al., 2008). anemone) possesses a larger repertoire Cordes, K.R., Sheehy, N.T., White, M.P., Berry,
Given the very different cell responses of more conventional miRNA genes, at E.C., Morton, S.U., Muth, A.N., Lee, T.H., Miano,
J.M., Ivey, K.N., and Srivastava, D. (2009). Nature
to the same contingency, one can pose least one of which is conserved in bilateria
460, 705–710.
the ‘‘chicken and egg’’ question. Did (Prochnik et al., 2007).
Christodoulou, F., Raible, F., Tomer, R., Simakov,
specialized cells give rise to miRNA The ‘‘long fuse’’ transition to metazoan O., Trachana, K., Klaus, S., Snyman, H., Hannon,
diversification or did miRNAs permit cell cell diversity rests upon a core gene set G.J., Bork, P., and Arendt, D. (2010). Nature 463,
specialization? Although framing of the present in the sponge ancestor (Sakarya 1084–1088.
question as an either/or belies the et al., 2007). Although sponges lack the Doe, C.Q. (2008). Development 135, 1575–1587.
complexity of the answer, miRNAs have phenotypic features of cell types seen in Fineberg, S.K., Kosik, K.S., and Davidson, B.L.
many properties that are consistent with the animal kingdom as well as many of (2009). Neuron 64, 303–309.
a role in fostering cell specialization. Chief the corresponding subcellular features of Grimson, A., Srivastava, M., Fahey, B., Woodcroft,
among these properties is the ease with animal cells such as synapses and adhe- B.J., Chiang, H.R., King, N., Degnan, B.M.,
which they can be invented through rens junctions, they do have gene sets Rokhsar, D.S., and Bartel, D.P. (2008). Nature
a reservoir of 70 nucleotide hairpin struc- that characterize animal cell types, and 455, 1193–1197.
tures in the genome, duplication at many of these genes are expressed (Con- Guo, H., Ingolia, N.T., Weissman, J.S., and Bartel,
different chromosomal loci, and formation aco and K.S.K., unpublished data). Pori- D.P. (2010). Nature 466, 835–840.

of miRNA families with different expres- feran gene sets were exapted (Sakarya Hornstein, E., and Shomron, N. (2006). Nat. Genet.
Suppl. 38, S20–S24.
sion levels. Thus, miRNAs may underlie et al., 2007) in a manner that gave rise to
the vast expansion of specialized cells an extraordinary diversity of cells and Hyun, S., Lee, J.H., Jin, H., Nam, J., Namkoong, B.,
Lee, G., Chung, J., and Kim, V.N. (2009). Cell 139,
during early metazoan evolution and a variety of organisms over vast differ-
1096–1108.
support the numerous discrete precursor ences in scale. Positioned within the
Iliopoulos, D., Hirsch, H.A., and Struhl, K. (2009).
cell types that have accompanied cell biological hierarchy at a point where
Cell 139, 693–706.
specialization. phenotypes emerge from gene networks,
Izumikawa, M., Minoda, R., Kawamoto, K.,
At the base of the animal kingdom lies miRNAs, acting broadly on numerous Abrashkin, K.A., Swiderski, D.L., Dolan, D.F.,
the phylum Porifera, a sister group to the transcription factors and other genes Brough, D.E., and Raphael, Y. (2005). Nat. Med.
animal kingdom with an approximately already present in the metazoan ancestor, 11, 271–276.
650 million year fossil record. The few very likely contributed to the emergence Johnston, R.J., Jr., Chang, S., Etchberger, J.F.,
generic cell types in the largest class of of animal phenotypy. Ortiz, C.O., and Hobert, O. (2005). Proc. Natl.
sponge species, the Demosponges, Acad. Sci. USA 102, 12449–12454.
bear little homology to cells found in the Kim, Y.K., Yu, J., Han, T.S., Park, S.Y., Namkoong,
ACKNOWLEDGMENTS B., Kim, D.H., Hur, K., Yoo, M.W., Lee, H.J., Yang,
rest of the animal kingdom. On the other
H.K., and Kim, V.N. (2009). Nucleic Acids Res. 37,
hand, cnidaria, an extraordinarily diversi- My thanks go to T. Papagiannakopoulos, M. 1672–1681.
fied phylum whose members, like the Srivastava, B. Shraiman, M. Khammash, S. Goyal,
Kirschner, M., and Gerhart, J.C. (2005). The Plausi-
sponge, are also derived from two germ P. Neveu, and K. Foltz, whose comments greatly
bility of Life (London: Yale University Press).
layers, has acquired many metazoan cell improved this manuscript.
Kissa, K., and Herbomel, P. (2010). Nature 464,
types including neurons.
112–115.
Thus, the common ancestor of the
REFERENCES Kosik, K.S. (2009). Nat. Rev. Neurosci. 10,
sponge and all other animals represents 754–759.
a critical evolutionary node when animal
Alimonti, A., Carracedo, A., Clohessy, J.G., Krol, J., Busskamp, V., Markiewicz, I., Stadler,
phenotypy arose. At this same node, Trotman, L.C., Nardella, C., Egia, A., Salmena, L., M.B., Ribi, S., Richter, J., Duebel, J., Bicker, S.,
miRNAs characteristic of animals also Sampieri, K., Haveman, W.J., Brogi, E., et al. Fehling, H.J., Schübeler, D., et al. (2010). Cell
arose (Christodoulou et al., 2010). Inter- (2010). Nat. Genet. 42, 454–458. 141, 618–663.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 25


Lessard, J., Wu, J.I., Ranish, J.A., Wan, M., Win- Poliseno, L., Salmena, L., Zhang, J., Carver, B., van Rooij, E., Sutherland, L.B., Qi, X., Richardson,
slow, M.M., Staahl, B.T., Wu, H., Aebersold, R., Haveman, W.J., and Pandolfi, P.P. (2010). Nature J.A., Hill, J., and Olson, E.N. (2007). Science 316,
Graef, I.A., and Crabtree, G.R. (2007). Neuron 55, 465, 1033–1038. 575–579.
201–215. Vierbuchen, T., Ostermeier, A., Pang, Z.P.,
Prochnik, S.E., Rokhsar, D.S., and Aboobaker,
Lim, L.P., Lau, N.C., Garrett-Engele, P., Grimson, A.A. (2007). Dev. Genes Evol. 217, 73–77. Kokubu, Y., Südhof, T.C., and Wernig, M. (2010).
A., Schelter, J.M., Castle, J., Bartel, D.P., Linsley, Nature 463, 1035–1041.
P.S., and Johnson, J.M. (2005). Nature 433, Puzio-Kuter, A.M., and Levine, A.J. (2009). Nat.
Wu, C.I., Shen, Y., and Tang, T. (2009). Genome
769–773. Biotechnol. 27, 914–915.
Res. 19, 734–743.
Lu, J., Getz, G., Miska, E.A., Alvarez-Saavedra, E., Raj, A., Rifkin, S.A., Andersen, E., and van Oude- Xie, H., Ye, M., Feng, R., and Graf, T. (2004). Cell
Lamb, J., Peck, D., Sweet-Cordero, A., Ebert, B.L., naarden, A. (2010). Nature 463, 913–918. 117, 663–676.
Mak, R.H., Ferrando, A.A., et al. (2005). Nature 435,
Rouhana, L., Shibata, N., and Agata, K. (2010). Xin, M., Small, E.M., Sutherland, L.B., Qi, X., McA-
834–838.
Dev. Biol. 341, 429–443. nally, J., Plato, C.F., Richardson, J.A., Bassel-
Martinez, N.J., Ow, M.C., Barrasa, M.I., Hammell, Duby, R., and Olson, E.N. (2009). Genes Dev. 23,
Sakarya, O., Armstrong, K.A., Adamska, M.,
M., Sequerra, R., Doucette-Stamm, L., Roth, 2166–2178.
Adamski, M., Wang, I.F., Tidor, B., Degnan, B.M.,
F.P., Ambros, V.R., and Walhout, A.J. (2008). Xu, J., and Wong, C. (2008). RNA 14, 1276–1283.
Oakley, T.H., and Kosik, K.S. (2007). PLoS ONE
Genes Dev. 22, 2535–2549.
2, e506. Xu, N., Papagiannakopoulos, T., Pan, G., Thom-
Masse, E., Escorcia, F.E., and Gottesman, S. son, J.A., and Kosik, K.S. (2009). Cell 137,
(2003). Genes Dev. 17, 2374–2383. Silva, J., and Smith, A. (2008). Cell 132, 532–536.
647–658.
Papagiannakopoulos, T., Shapiro, A., and Kosik, Sokol, N.S., and Ambros, V. (2005). Genes Dev. 19, Yoo, A.S., Staahl, B.T., Chen, L., and Crabtree,
K.S. (2008). Cancer Res. 68, 8164–8172. 2343–2354. G.R. (2009). Nature 460, 642–646.
Parter, M., Kashtan, N., and Alon, U. (2008). PLoS Tsang, J.S., Ebert, M.S., and van Oudenaarden, A. Zhou, Q., Brown, J., Kanarek, A., Rajagopal, J.,
Comput. Biol. 4, e1000206. (2010). Mol. Cell 38, 140–153. and Melton, D.A. (2008). Nature 455, 627–632.

26 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


Leading Edge
Previews

How to Survive Aneuploidy


Bulent Cetin1 and Don W. Cleveland1,*
1Ludwig Institute for Cancer Research and Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla,

CA 92093, USA
*Correspondence: dcleveland@ucsd.edu
DOI 10.1016/j.cell.2010.09.030

Aneuploidy, or an abnormal number of chromosomes, adversely affects cell growth, but it is also
linked with cancer and tumorigenesis. Now, Torres et al. (2010) help to resolve this paradox by
demonstrating that aneuploid yeast cells can evolve mutations in the proteasome protein degrada-
tion pathway that alleviate imbalances in protein production and increase the cell’s proliferative
capacities.

During mitosis, duplicated chromosomes Earlier work by Torres and colleagues strains also displayed increased energy
are equally distributed to daughter cells (2007) described the physiological con- requirements and enhanced sensitivity to
so that the total number of chromosomes sequences of yeast cells having an extra conditions that interfere with protein syn-
is preserved through many generations. copy of one or more chromosome. The thesis, folding, and degradation. These
Errors in chromosomal segregation can authors generated these disomic strains findings led the authors to propose that
lead to the loss or gain of chromosomes by attempting to mate haploid yeast proteotoxic stress due to imbalanced pro-
in daughter cells, a condition known as cells carrying a mutation that prevents tein expression might be responsible for
aneuploidy. Aneuploidy is a hallmark of fusion of the nuclei (i.e., karyogamy), lead- the reduced fitness of disomic yeast cells
cancer cells (Albertson et al., 2003), but ing to unsuccessful or abortive matings (Figure 1, top). Furthermore, the cells’
the causality of the relationship between (Hugerat et al., 1994). In these experi- enhanced sensitivity to proteasome inhib-
aneuploidy and tumorigenesis remains ments, one chromosome of the parental itors may reflect an increased reliance on
highly complex and controversial yeast strains also contained a selection protein degradation to restore proteomic
(Schvartzman et al., 2010). Aneuploidy marker, such as a gene that supports balance in the disomic yeast cells.
can either promote or suppress tumor growth in the absence of an essential Now, in their new study, Torres and
formation, and the outcome depends on amino acid histidine (HIS) or one that colleagues (2010) examined 13 different
the genetic and cellular context, including confers resistance against G418 (also haploid yeast strains, each with an extra
the specific genes on the abnormal chro- known as Geneticin), an aminoglycoside copy of one of the 16 yeast chromo-
mosome, the extent of the aneuploidy, the that interferes with protein synthesis somes. They grew the disomic strains
already accumulated genetic errors, and elongation (Bar-Nun et al., 1983). During over several generations in the selective
specific features unique to the cell type the abortive matings, the marked chro- medium. Initially, the doubling times of
(Holland and Cleveland, 2009). mosomes were occasionally transferred these strains were significantly longer
Paradoxically, despite its association between two nuclei, and the chromo- than the control cells. However, after
with uninhibited cell growth in cancer, somal markers allowed for the selection a variable number of generations, 11 of
aneuploidy itself has adverse effects on of disomic clones on G418-containing the cultures sped up their doubling
the growth of organisms and their indi- and histidine-deficient media. Most of the times. The authors isolated individual
vidual cells. The most straightforward aneuploid strains isolated possessed a clones from these ‘‘evolved’’ cultures to
reconciliation of these contrasting proper- growth defect on a nonselective medium, identify the basis of their improved growth
ties is that aneuploidy initially inhibits and this deficiency was enhanced on rates (Figure 1, bottom). Comparative
growth, but then the acquisition of addi- the selective medium. Furthermore, the genome hybridization analyses showed
tional mutations or chromosomal shuffling growth defects were due primarily to that descendants of three disomic strains
increases the fitness of cells. In this issue a delay in the G1 phase of the cell had lost large parts of their additional
of Cell, Torres et al. (2010) demonstrate cycle. chromosome. These deletions alone may
that this is indeed true for aneuploid yeast As anticipated, analysis of the tran- have accounted for the improved pro-
cells. The authors find that a general scripts in these disomic yeast strains liferation of the descendants. Of interest,
feature of aneuploidy is proteomic stress revealed that most genes on the extra however, three independent clones pos-
caused by an imbalance in protein syn- chromosome are transcribed at twice sessed the same duplication of a 183 kb
thesis for the genes encoded on the extra the rate as the rest of the genome. On fragment from the short arm of chromo-
chromosome; in several cases, mutations the other hand, expression levels of a some XVIII, suggesting that genes located
in a deubiquitination enzyme can alleviate small number of proteins, especially those in this fragment may also play a role in
this stress and enhance cellular growth that are subunits of multiprotein com- increasing the proliferative ability of these
and fitness. plexes, are not elevated. All of the disomic aneuploid yeasts.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 27


tinase catalytic activity (Hanna et al.,
2006). Nevertheless, mutating Ubp6 may
restore proteomic balance in the cell
by generally boosting protein degrada-
tion by the proteasome or by increasing
the proteasome’s activity on selective
substrates.
To distinguish between these two pos-
sibilities, Torres and colleagues deleted
UBP6 in the disomic strains and then
used a combination of mass spectrom-
etry and SILAC (i.e., stable isotope
labeling with amino acids in cell culture)
to analyze the effects of the deletion on
the yeast proteome. They chose two
disomic strains for these experiments:
disome V, in which deletion of UBP6
improves fitness, and disome XIII, in
which the mutation has no effect.
As expected, adding the extra chromo-
some increased the average abundance
of proteins encoded on the chromosome
by nearly 2-fold. Disomy also caused a
significant change in the relative abun-
dance of a number of proteins across
the whole proteome; whereas some
Figure 1. Aneuploidy Induces Proteotoxic Stress proteins increased in concentration by
(Top) An extra copy of an individual yeast chromosome, or disomy, causes imbalanced expression of the nearly 2-fold, others decreased to nearly
proteins encoded on that chromosome. Adding an inhibitor of protein synthesis, such as G418 (Geneticin), half the levels of haploid cells. For disome
increases the errors in translation and enhances the proteotoxic stress. This stress reduces fitness and
inhibits cell growth primarily during the G1 phase of the cell cycle. V, deleting UBP6 substantially attenuated
(Bottom) Suppressers of proteotoxic stress, including mutations in components of the ubiquitin/protea- these changes in protein abundance, and
some pathway, can ameliorate the proteomic imbalance and restore fitness (Torres et al., 2010). For protein levels approached those of
example, disrupting the deubiquitinase UPB6 can increase the growth rate of aneuploid cells by triggering
more rapid protein degradation by the proteasome.
haploid cells. In particular, loss of UBP6
in disome V downregulates proteins with
relatively high expression levels without
To identify point mutations that could directly help aneuploid yeast affecting their transcription but transcrip-
increased the fitness of the aneuploid recover more normal growth rates. tionally upregulates proteins with rela-
yeast, Torres and colleagues then Indeed, in some cases, it did. Mutating tively low expression levels. Curiously,
sequenced several of the evolved isolates UBP6 increased the fitness of two deleting UBP6 in disome XIII does not
from six of the disomic strains that disomic strains in selective medium and increase transcription of proteins with
retained the extra chromosome. Strik- two strains (disome V and disome XI) in relatively low expression levels, and this
ingly, they found that four genes of the both selective and nonselective media. difference may explain why mutating
ubiquitin/proteasome pathway, UBP6 (a This latter finding is especially important UBP6 does not enhance the fitness of
deubiquitinase), RPT1 (an ATPase of the because a gain of fitness in only the selec- disome XIII.
proteasome), RSP5 (E3 ubiquitin ligase), tive medium could reflect a suppressive The implication from the new findings
and UBR1 (E3 ubiquitin ligase), were function of the UBP6 mutation against by Torres and colleagues is that extra
mutated in the descendents of five dif- the action of the elongation inhibitor chromosomes generally increase proteo-
ferent disomic strains. Two independent G418. A final cautionary note is that the mic stress by elevating the cost of protein
strains (disome V and disome IX) con- effect of mutating UBP6 was not consis- synthesis, folding, and degradation due to
tained distinct truncations in a gene tent across the different disomic strains; the imbalance of proteins produced
encoding the deubiquitinating enzyme in fact, it decreased the fitness of two (Figure 1). Thus, although each additional
Ubp6 that interacts with the proteasome. disomic strains. chromosome creates an altered abun-
Both truncations impair the deubiquiti- How could losing the deubiquitinating dance of a different set of encoded pro-
nase catalytic activity of Ubp6, but not activity of Ubp6 increase the growth rate teins, any extra chromosome leads to
its association with the proteasome (Leg- of aneuploid yeast cells? Ubp6 has been a growth disadvantage.
gett et al., 2002). shown to reduce the activity of the protea- As the authors note, these new results
The authors next tested whether muta- some, although this function of Ubp6 raise the possibility that aneuploid cancer
tions in the Ubp6 deubiquitinase alone apparently does not require the deubiqui- cells are under profound proteotoxic

28 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


stress and thus must rely on the increased stress with proteasome inhibitors controls Hugerat, Y., Spencer, F., Zenvirth, D., and
activity of the ubiquitin/proteasome path- their growth. Simchen, G. (1994). Genomics 22, 108–117.
way to maintain their proliferative state. Leggett, D.S., Hanna, J., Borodovsky, A., Crosas,
This hypothesis provides an elegant ratio- B., Schmidt, M., Baker, R.T., Walz, T., Ploegh, H.,
REFERENCES
nale for extending the use of proteasome and Finley, D. (2002). Mol. Cell 10, 495–507.
inhibitors (such as Velcade) to treating Albertson, D.G., Collins, C., McCormick, F., and
Schvartzman, J.M., Sotillo, R., and Benezra, R.
many types of cancers with aneuploid Gray, J.W. (2003). Nat. Genet. 34, 369–376.
(2010). Nat. Rev. Cancer 10, 102–115.
cells; currently, these inhibitors are clini- Bar-Nun, S., Shneyour, Y., and Beckmann, J.S.
cally approved for treating only the over- (1983). Biochim. Biophys. Acta 741, 123–127. Torres, E.M., Sokolsky, T., Tucker, C.M., Chan,
production of immunoglobulin synthesis Hanna, J., Hathaway, N.A., Tone, Y., Crosas, B.,
L.Y., Boselli, M., Dunham, M.J., and Amon, A.
in multiple myeloma. In this regard, the (2007). Science 317, 916–924.
Elsasser, S., Kirkpatrick, D.S., Leggett, D.S.,
next step is to determine the extent to Gygi, S.P., King, R.W., and Finley, D. (2006). Cell Torres, E.M., Dephoure, N., Panneerselvam, A.,
which tumor cells with chromosomal 127, 99–111. Tucker, C.M., Whittaker, C.A., Gygi, S.P., Dunham,
instability experience proteotoxic stress Holland, A.J., and Cleveland, D.W. (2009). Nat. M.J., and Amon, A. (2010). Cell 143, this issue,
and then to test whether increasing this Rev. Mol. Cell. Biol. 10, 478–487. 71–83.

Auxin Paves the Way


for Planar Morphogenesis
Stefano Pietra1 and Markus Grebe1,*
1Umeå Plant Science Centre, Department of Plant Physiology, Umeå University, SE-90 187 Umeå, Sweden
*Correspondence: markus.grebe@plantphys.umu.se
DOI 10.1016/j.cell.2010.09.029

The coordinated growth of epidermal cells in plant leaves creates the characteristic jigsaw puzzle
appearance of the pavement cells. Now, Xu et al. (2010) report that AUXIN-BINDING PROTEIN 1
mediates auxin activation of two GTPase pathways that antagonistically control planar morphogen-
esis of leaf epidermal cells to create this distinctive pattern.

Multicellular organisms rely on cell mor- Rho-of-plant (ROP) small GTPases dir- signaling pathway is still quite enigmatic.
phogenesis within tissue layers to shape ectly reorganizes the cytoskeleton during Now, in this issue of Cell, Xu et al. (2010)
organs during development. One striking cell morphogenesis (Yang, 2008). How- report that ABP1 senses auxin and
example is the growth of pavement cells ever, it is unknown how auxin is perceived then rapidly activates two antagonizing
in the epidermis of plant leaves. As the and how its signal is transduced to ROP-GTPase pathways in the cytoplasm,
leaves expand, alternations in lobes and responding ROP-GTPases to direct cyto- which orchestrate planar morphogenesis
indentations between cells give the layer skeletal rearrangements. Two auxin of pavement cells.
of pavement cells a characteristic jigsaw receptor systems could be involved: the Xu et al. first demonstrate that auxin
puzzle appearance (Figure 1, left) (Yang, TIR1/AFB family of receptors, which modulates the shape of pavement cells
2008). Although in animals cell morpho- directly modulate gene expression in in the model plant Arabidopsis thaliana;
genesis within the plane of a tissue layer response to auxin (Mockaitis and Estelle, the external application of auxin increases
relies on signaling through the planar 2008), or AUXIN-BINDING PROTEIN 1 the lobing of the pavement cells, whereas
cell polarity pathway (named after the (ABP1), which is located in the secretory mutating four genes required for the
receptor mutant ‘‘frizzled’’), plants have pathway and is secreted in some plant synthesis of auxin reduces interdigitated
different strategies for signaling planar species (Tromas et al., 2010). Disrupting growth (i.e., the lobes decrease in num-
morphogenesis (Fischer et al., 2006). The the ABP1 gene causes early death of plant ber). In a previous study, interfering with
plant hormone auxin is known to coordi- embryos, making it difficult to characterize the expression of two ROP-GTPases,
nate cell morphogenesis within the plane the roles of ABP1 in plant development ROP2 and ROP4, decreased the lobing
of a tissue layer, and an array of specific (Tromas et al., 2010). Thus, the ABP1 of the pavement cells (Fu et al., 2005).

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 29


Figure 1. Interdigitated Growth of Plant Pavement Cells
In the model plant Arabidopsis thaliana, epidermal cells within the plane of the leaf, called pavement cells, contain alternating lobes and indentations. The auxin
efflux carrier PIN1, which localizes polarly in the plasma membranes of lobes, is proposed to facilitate auxin accumulation in the cell wall between lobes and
indentations. This auxin is believed to activate two Rho-of-plant (ROP) small GTPases that antagonistically control morphogenesis of the two pavement cells
(Xu et al., 2010). At the lobe of one cell, AUXIN-BINDING PROTEIN 1 (ABP1) senses the auxin and switches on ROP2, which then promotes assembly of cortical
F-actin microfilaments through the ROP2 effector RIC4. In the adjacent cell, auxin signaling through ABP1 activates ROP6, which then triggers the association of
the effector RIC1 with cortical microtubules. This results in the formation of well-ordered bundles of microtubules that restrict expansion of the cell and generate
an indentation. The two pathways antagonize each other; ROP2 suppresses RIC1 activity, whereas well-ordered microtubules repress the interaction of ROP2
and RIC4.

Now, Xu et al. find that application of of pavement cells, but direct evidence 2010). In further support of such a feed-
auxin does not rescue this phenotype, for this hypothesis is still lacking. back loop, Xu and colleagues find that
indicating that ROP2 and ROP4 probably In plants, the auxin efflux carrier PIN- the activity of ROP2 is diminished in
act downstream of auxin. Indeed, the FORMED1 (PIN1) generates directional pin1 mutant plants, which display re-
authors then show that auxin rapidly acti- flow of auxin in cells by polarly localizing duced lobing of pavement cells.
vates ROP2 in leaf protoplasts (i.e., plant to one end of the cell in the plasma mem- Morphogenesis of pavement cells is not
cells without their cell walls). Conversely, brane (Kleine-Vehn and Friml, 2008). only about lobing, but it also requires the
partially disrupting the function of ABP1 Strikingly, Xu and colleagues find that coordination of indentations in adjacent
abolishes both cell morphogenesis in reducing the function of ABP1 or ROP2/ cells (Figure 1, right). ROP6 controls
response to auxin and rapid activation of ROP4 diminishes the localization of PIN1 indentations by organizing the microtu-
ROP2 in protoplasts. at the lobes of pavement cells. Therefore, bule cytoskeleton at the plasma mem-
These new findings by Xu et al. indicate the authors hypothesize that a positive brane within indentations (Fu et al.,
that auxin sensing by ABP1 is upstream of feedback loop between PIN1 localization 2009). Indeed, Xu and colleagues find
the ROP-GTPases during cell morpho- and ROP2/ROP4 activity ensures auxin that a mutation in ABP1 impairs ROP6
genesis of pavement cells. However, it is flow through the lobe and auxin accumu- activation in protoplasts and reduces
still unknown where in the leaf tissue and lation in the cell wall. Interestingly a similar indentations in Arabidopsis plants,
where in the cell ABP1 perceives the auxin positive feedback loop was recently pro- demonstrating that ABP1 also contributes
signal. Data from other plant species and posed to facilitate auxin transport by to the production of indentations.
Arabidopsis protoplasts suggest that auxin-induced transcriptional activation Interestingly Xu and colleagues show
a fraction of ABP1 is secreted and associ- of the scaffold protein ICR1 (INTERAC- that, at saturating concentrations of auxin
ates with the outer surface of the plasma TOR OF CONSTITUTIVE ACTIVE ROP 1), in protoplasts, the activation of ROP6
membrane (Figure 1, right) (Tromas which directly interacts with ROP- reaches higher levels than that of ROP2,
et al., 2010). Hence, ABP1 may act as an GTPases and mediates polar PIN protein suggesting that the activation kinetics of
auxin receptor at the plasma membrane localization in root cells (Hazak et al., these two ROPs is significantly different.

30 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


This led the authors to propose a model see whether this asymmetry may play of components in the auxin signaling
for how auxin coordinates the formation a role in pavement cell morphogenesis. pathway upstream of ROP. The identifica-
of an indentation and a lobe in adjacent At first glance, it seems as if auxin acts tion of additional factors that interact with
pavement cells (Figure 1, inset). In this differently on planar morphogenesis in ABP1 may also help to pinpoint the exact
working model, PIN1 exports auxin into the root versus the shoot. Whereas subcellular locations where ABP1 senses
the cell wall of the lobe, where it stimu- a gradient of auxin directs planar polarity auxin in leaves and possibly other tissues.
lates ABP1 signaling. At steady-state in roots, the coordination of planar Clearly, the findings by Xu and colleagues
concentrations of auxin, ROP2 seques- morphogenesis in pavement cells relies show that ABP1-mediated auxin signaling
ters the ROP6 effector RIC1 in the lobe, on a self-organizing design in which auxin is a corner piece in the jigsaw puzzle of
but RIC1 represses the activation of triggers differential activity of ROPs. planar morphogenesis in plants, and it
ROP2 in the adjacent cell by stimulating Nevertheless, it will be interesting to deter- will be thrilling to watch the next pieces
the organization of microtubules (Fu mine whether the signaling network fall into place.
et al., 2005). In this way, two antagonistic uncovered by Xu et al. will help to decipher
ROP signaling pathways, which both how auxin is sensed during the formation
depend on ABP1, determine actin-medi- of planar polarity in other tissues. For REFERENCES
ated lobe formation in one cell and example, a second intriguing study in
Fischer, U., Ikeda, Y., Ljung, K., Serralbo, O.,
tubulin-driven indentation in its neighbor this issue of Cell (Robert et al., 2010) Singh, M., Heidstra, R., Palme, K., Scheres, B.,
(Figure 1, inset). The proposed positive reports a role for ABP1 in the endocytosis and Grebe, M. (2006). Curr. Biol. 16, 2143–2149.
feedback loop with auxin-ABP1, ROP2, of PIN proteins in the roots of Arabidopsis.
Fu, Y., Gu, Y., Zheng, Z., Wasteneys, G., and Yang,
and PIN1 could enforce and maintain Clathrin-mediated endocytosis is known Z. (2005). Cell 120, 687–700.
this growth asymmetry. to be required for internalization of several
Fu, Y., Xu, T., Zhu, L., Wen, M., and Yang, Z. (2009).
The findings by Xu and colleagues are PIN proteins (Kleine-Vehn and Friml, Curr. Biol. 19, 1827–1832.
certainly exciting because they elegantly 2008). The new study by Robert and
Hazak, O., Bloch, D., Poraty, L., Sternberg, H.,
integrate ABP1 function into a conceptual colleagues suggests that ABP1 is neces- Zhang, J., Friml, J., and Yalovsky, S. (2010).
framework of signaling in planar morpho- sary for correctly placing the vesicle coat PLoS Biol. 8, e1000282.
genesis. The authors’ model describes protein clathrin at the plasma membrane
Kleine-Vehn, J., and Friml, J. (2008). Annu. Rev.
a possible scenario for steady-state main- of root cells. Furthermore, their findings Cell Dev. Biol. 24, 447–473.
tenance of interdigitated growth at uni- support the hypothesis that auxin can
Mockaitis, K., and Estelle, M. (2008). Annu. Rev.
form auxin concentrations in pavement inhibit PIN1 internalization mediated by Cell Dev. Biol. 24, 55–80.
cells. However, it does not yet address ABP1. To what extent this new function
Robert, S., Kleine-Vehn, J., Barbez, E., Sauer, M.,
the event that breaks the symmetry of ABP1 in roots connects to ABP1’s role
Paciorek, T., Baster, P., Vanneste, S., Zhang, J.,
between adjacent cells and whether auxin in planar morphogenesis of pavement Simon, S., Hayashi, K., et al. (2010). Cell 143, this
is the original polarizing cue. Interestingly, cells remains an exciting question for issue, 111–121.
auxin can orchestrate planar polarization future studies. Tromas, A., Paponov, I., and Perrot-Rechenmann,
in the root epidermis, where a concentra- Another question that remains unan- C. (2010). Trends Plant Sci. 15, 436–446.
tion gradient of auxin provides vectorial swered is whether ABP1 is the sole auxin Xu, T., Wen, M., Nagawa, S., Fu, Y., Chen, J.-G.,
information for the polar positioning of receptor required during pavement cell Wu, M.-J., Perrot-Rechenmann, C., Friml, J.,
hairs close to one end of the cell (Fischer morphogenesis or whether it acts in Jones, A.M., and Yang, Z. (2010). Cell 143, this
et al., 2006). Young leaves, too, display concert with the TIR1/AFB receptor issue, 99–110.
an asymmetry in auxin distribution system. In addition, the study by Xu and Yang, Z. (2008). Annu. Rev. Cell Dev. Biol. 24,
(Yang, 2008), and it will be interesting to colleagues now allows for the exploration 551–575.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 31


Leading Edge
Previews

Cell Sorting during Regenerative


Tissue Formation
Rüdiger Klein1,*
1Department of Molecular Neurobiology, Max-Planck-Institute of Neurobiology, Am Klopferspitz 18, Martinsried 82152, Germany

*Correspondence: rklein@neuro.mpg.de
DOI 10.1016/j.cell.2010.09.018

Regeneration of transected peripheral nerves is a complex process involving the coordinated


action of neuronal axons, glial cells, and fibroblasts. Using rodent models of nerve repair, Parrinello
et al. (2010) find that ephrin signaling between fibroblasts and Schwann cell progenitors, involving
the stemness factor Sox2, is required for nerve regeneration.

Many open wounds in the extremities the sacral plexus and branches in the thigh apposing cells. Ephrin/Eph interactions
involve peripheral nerve injuries. Al- region into smaller nerves innervating in the nervous system induce a wide
though simple nerve crushes generally several hindleg muscles and parts of the range of cellular behaviors including re-
recover without surgical interference, hindleg skin. In contrast to neurons in the pulsive cell and axon guidance, synapse
complete or partial nerve transections central nervous system, the axons of formation, and neuronal plasticity (Klein,
lead to degeneration of the axonal muscle-innervating motoneurons in the 2009), and ephrin/Eph signaling had
segment distal to the lesion, and nerves periphery and those of skin-innervating previously been implicated in regenera-
often fail to regenerate. To facilitate the sensory neurons have a high capacity to tive processes (Pasquale, 2008). Ephrin
regeneration of cut nerves, the two nerve regenerate. A temporal analysis of cell ligands come in two flavors: A-type
stumps are surgically realigned. In spite migration and axon behavior during the ephrins are anchored in the membrane
of this surgical treatment, the transected first 7 days after the nerve cut reveals by glycophosphatidylinositol (GPI) post-
nerve stumps tend to retract and the that nonmyelinating Schwann cells collec- translational modification and preferen-
resulting gap needs to be filled with tively migrate into the nerve bridge from tially bind EphA receptors, and B-type
new tissue (a ‘‘nerve bridge’’). Schwann both stumps as discrete cell cords, which ephrins are transmembrane proteins that
cells (the glial cells that normally en- eventually meet in the middle of the gap. preferentially bind EphB receptors. In the
sheath and myelinate peripheral axons) There they are surrounded and contacted current study, cultured nerve fibroblasts
dedifferentiate to a progenitor/stem cell by fibroblasts but do not appear to inter- are found to express high levels of
state, proliferate, and migrate into the mingle, suggesting a cell sorting event. ephrin-B2, which interacts with EphB
nerve wound forming an environment Migrating Schwann cells are closely fol- receptors (mostly EphB2) expressed on
that is supportive for axonal growth; lowed by regenerating axons from the Schwann cells. By manipulating the levels
they produce trophic factors to support proximal stump, consistent with the model of ephrin-B2 and EphB2, the authors
the injured axons and prevent the that Schwann cells guide regenerating convincingly demonstrate that ephrin-B/
neurons from undergoing apoptosis axons across the injury site (McDonald EphB2 signaling between fibroblasts and
(Heumann et al., 1987). Fibroblasts accu- et al., 2006) (Figure 1). Schwann cells is necessary and sufficient
mulate at the nerve wound and secrete Parrinello and coworkers reasoned that for cell sorting and cluster formation
proteins that promote scar formation, the sorting between Schwann cells and in vitro.
angiogenesis, and inflammation. How fibroblasts may be a key event for Although ephrin/Eph signaling is
the different cell types communicate successful nerve repair. Their analysis thought to primarily induce rapid cell
with each other to orchestrate the forma- reveals that cell sorting depends on two responses by controlling actin dynamics,
tion of a regenerative microenvironment processes: the repulsion of Schwann cells Parrinello and coworkers speculate that
is poorly understood. In this issue, Parri- by fibroblasts and the attractive adhesion Eph-mediated cell sorting may involve
nello and colleagues (Parrinello et al., of Schwann cells to one another. In ex vivo long-term changes in cell behavior by
2010) show that ephrin signaling cocultures, primary rat Schwann cells and regulating gene expression. They find
between fibroblasts and Schwann cells nerve fibroblasts sorted into mutually that the transcription factor Sox2, which
is a key mediator of this process. exclusive cell clusters, and this cell plays important roles in the biology of
To study the early stages of peripheral behavior required signaling via ephrin stem and progenitor cells (Chambers
nerve repair, the authors perform and its receptor Eph between the two and Tomlinson, 2009), including Schwann
complete transections of the rat sciatic cell types. Ephs are a large family of cell progenitors (Le et al., 2005), mediates
nerve. The sciatic nerve is a mixed receptor tyrosine kinases that bind to eph- ephrin-B2-induced Schwann cell clus-
motor/sensory nerve that originates in rin ligands presented on the surface of tering. The treatment of Schwann cells

32 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


and axons during the early phases of nerve
repair in vivo.
Nerve repair is a very complex process,
and despite these new and interesting
findings, many questions remain unan-
swered. How important is ephrin/Eph
signaling for nerve regeneration in
general? Previous work has implicated
the EphA4 receptor as an inhibitor of
regeneration in the central nervous
system (Pasquale, 2008). Hence, ephrin/
Eph signaling may be both beneficial
and detrimental to nerve repair depending
on the specific context. A recent study
also finds that Schwann cell migration is
inhibited by ephrins, this time implicating
GPI-anchored ephrin-As and their
cognate EphA receptors (Afshari et al.,
2010). These observations suggest that
Figure 1. Early Events in Peripheral Nerve Repair multiple members of this large family of
After transection of the sciatic nerve (the edge of the proximal stump is shown on the left), Schwann cells
ligands and receptors may play important
that normally form the myelin sheath dedifferentiate and migrate into the nerve wound. Here, they come in
close contact with fibroblasts that also populate the nerve wound. Activation of ephrin-B/EphB signaling roles by regulating complex cell sorting
between these two cell types activates a signaling cascade in the Schwann cell that leads to accumulation behaviors among several cell types. The
of Sox2 in the nucleus. Sox2-dependent transcription causes the relocalization of N-cadherin to Schwann present study only investigated the
cell contacts and promotes the formation of Schwann cell cords in the nerve wound. Regrowing sensory
axons (in red) grow out onto the Schwann cells and form parallel axon fascicles. response of sensory, not motor, axons
to ephrins in ex vivo preparations. Given
that hindleg-innervating motoneurons
with soluble ephrin-B2 ligand increases Schwann cells and segregate away respond to both ephrin-As and -Bs during
the abundance of Sox2 proteins in from fibroblasts. However, unlike development (Luria et al., 2008), it would
culture, and knockdown of Sox2 using Schwann cells, the axons of sensory be important to elucidate the ephrin
small-interfering RNAs greatly reduces neurons are not repelled by ephrin-B2 responsiveness of regrowing motor axons
cell clustering in the coculture assay with protein, suggesting that they do not of the sciatic nerve. The requirement of
nerve fibroblasts. Sox2 overexpression directly interact with the fibroblasts. the transcription factor Sox2 for EphB-
rescues the cell sorting deficiency of When sensory neurons are instead ex- dependent formation of Schwann cell
Schwann cells derived from EphB2 planted onto Schwann cells that had clusters is intriguing and suggests that
knockout mice, indicating that Sox2 acts been cultured in the presence of stripes Eph signaling may regulate gene expres-
downstream of EphB2. Moreover, EphB of ephrin-B2, the axons grow out onto sion in development and disease.
signaling via Sox2 relocalizes the cell- the Schwann cells, forming fascicles This aspect should be further explored in
surface adhesion molecule N-cadherin that avoid the stripes of ephrin-B2. These other Eph-dependent morphogenetic
to Schwann cell-cell contacts, providing findings demonstrate that ephrin/Eph functions. The underlying intracellular
an explanation for the increased attrac- signaling can influence axonal outgrowth signaling pathways may reveal new
tion between Schwann cells and the indirectly by modulating Schwann cell mechanisms of cell regulation.
formation of cell cords in the nerve bridge behavior. In summary, the elegant work presented
(Figure 1). By manipulating the abun- Finally the authors provide some by Parrinello and colleagues establishes
dance of N-cadherin in Schwann cell evidence that EphB2 signaling mediates new insight into how nerve fibroblasts
cultures, the authors provide compelling collective cell migration in vivo. To inter- and Schwann cells interact in the nerve
evidence that N-cadherin is necessary fere with EphB2 function, sciatic nerve wound to form cords of Schwann cells
and sufficient for cell sorting downstream regeneration was observed in mice lack- that then provide a favorable microenvi-
of EphB2 and Sox2. ing EphB2 or in wild-type rats in which an ronment and a direct substrate for
After having worked out the mecha- inhibitory EphB2-Fc fusion protein is deliv- regrowing axons. They also uncover
nism of Schwann cell-fibroblast commu- ered to the nerve wound via miniature a new signaling pathway downstream of
nication, Parrinello and coworkers asked osmotic pumps. In both cases, axonal EphB2 via Sox2 and N-cadherin that at
whether regenerating axons also respond regrowth is reduced and appears less least partially mediates the cell sorting
to ephrins. After all, many populations of organized compared to controls. Given process, which ultimately leads to the
axons are guided by ephrin/Eph signaling that regrowing axons almost completely formation of Schwann cell cords in the
during development (Egea and Klein, overlap with Schwann cell cords, the nerve bridge. These findings will undoubt-
2007). In the nerve bridge, regenerating authors conclude that EphB2 signaling edly stimulate further work on ephrin/Eph
axons grow in close interaction with directs the migration of Schwann cells signaling in tissue regeneration.

Cell 143, October 1, 2010 ª2010 Elsevier Inc. 33


REFERENCES Heumann, R., Korsching, S., Bandtlow, C., and McDonald, D., Cheng, C., Chen, Y., and Zo-
Thoenen, H. (1987). J. Cell Biol. 104, 1623–1631. chodne, D. (2006). Neuron Glia Biol. 2, 139–147.
Afshari, F.T., Kwok, J.C., and Fawcett, J.W. (2010).
Klein, R. (2009). Nat. Neurosci. 12, 15–20.
J. Neurosci. 30, 4246–4255. Parrinello, S., Napoli, I., Ribeiro, S., Digby, P.W.,
Le, N., Nagarajan, R., Wang, J.Y., Araki, T., Fedorova, M., Parkinson, D.B., Doddrell, R.D.S.,
Chambers, I., and Tomlinson, S.R. (2009). Devel- Schmidt, R.E., and Milbrandt, J. (2005). Proc. Nakayama, M., Adams, R.H., and Lloyd, A.C.
opment 136, 2311–2322. Natl. Acad. Sci. USA 102, 2596–2601. (2010). Cell 143, this issue, 145–155.
Egea, J., and Klein, R. (2007). Trends Cell Biol. 17, Luria, V., Krawchuk, D., Jessell, T.M., Laufer, E.,
230–238. and Kania, A. (2008). Neuron 60, 1039–1053. Pasquale, E.B. (2008). Cell 133, 38–52.

34 Cell 143, October 1, 2010 ª2010 Elsevier Inc.


Myogenin and Class II HDACs
Control Neurogenic Muscle Atrophy
by Inducing E3 Ubiquitin Ligases
Viviana Moresi,1 Andrew H. Williams,1 Eric Meadows,4 Jesse M. Flynn,4 Matthew J. Potthoff,1 John McAnally,1
John M. Shelton,2 Johannes Backs,1,5 William H. Klein,4 James A. Richardson,1,3 Rhonda Bassel-Duby,1
and Eric N. Olson1,*
1Department of Molecular Biology
2Department of Internal Medicine
3Department of Pathology

University of Texas Southwestern Medical Center, Dallas, TX 75390, USA


4Department of Biochemistry and Molecular Biology, University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA
5Present address: Department of Cardiology, University of Heidelberg, 69117 Heidelberg, Germany

*Correspondence: eric.olson@utsouthwestern.edu
DOI 10.1016/j.cell.2010.09.004

SUMMARY Loss of the nerve supply to muscle fibers results in muscle


atrophy mainly through excessive ubiquitin-mediated proteo-
Maintenance of skeletal muscle structure and func- lysis via the proteasome pathway (Beehler et al., 2006). Other
tion requires innervation by motor neurons, such pathologic states and systemic disorders, including cancer,
that denervation causes muscle atrophy. We show diabetes, fasting, sepsis, and disuse, also cause muscle atrophy
that myogenin, an essential regulator of muscle through ubiquitin-dependent proteolysis (Attaix et al., 2008;
development, controls neurogenic atrophy. Myoge- Attaix et al., 2005; Medina et al., 1995; Tawa et al., 1997). The
muscle-specific E3 ubiquitin ligases MuRF1 (also called
nin is upregulated in skeletal muscle following dener-
Trim63) and atrogin-1 (also called MAFbx or Fbxo32) are
vation and regulates expression of the E3 ubiquitin
upregulated during muscle atrophy and appear to represent final
ligases MuRF1 and atrogin-1, which promote muscle common mediators of this process (Bodine et al., 2001; Clarke
proteolysis and atrophy. Deletion of myogenin from et al., 2007; Gomes et al., 2001; Kedar et al., 2004; Lecker
adult mice diminishes expression of MuRF1 and et al., 2004; Li et al., 2004; Li et al., 2007; Willis et al., 2009).
atrogin-1 in denervated muscle and confers resis- However, the precise molecular mechanisms and signaling
tance to atrophy. Mice lacking histone deacetylases pathways that control the expression of these key regulators of
(HDACs) 4 and 5 in skeletal muscle fail to upregulate muscle protein turnover have not been fully defined and it
myogenin and also preserve muscle mass following remains unclear whether all types of atrophic signals control
denervation. Conversely, forced expression of these E3 ubiquitin ligase genes through the same or different
myogenin in skeletal muscle of HDAC mutant mice mechanisms. Further understanding of the molecular pathways
that regulate muscle mass is a prerequisite for the development
restores muscle atrophy following denervation.
of novel therapeutics to ameliorate muscle-wasting disorders.
Thus, myogenin plays a dual role as both a regulator
Myogenin is a bHLH transcription factor essential for skeletal
of muscle development and an inducer of neurogenic muscle development (Hasty et al., 1993; Nabeshima et al.,
atrophy. These findings reveal a specific pathway for 1993). After birth, myogenin expression is downregulated in
muscle wasting and potential therapeutic targets for skeletal muscle but is reinduced in response to denervation
this disorder. (Merlie et al., 1994; Tang et al., 2008; Williams et al., 2009).
Upregulation of myogenin in denervated skeletal muscle
INTRODUCTION promotes the expression of acetylcholine receptors and other
components of the neuromuscular synapse (Merlie et al., 1994;
Maintenance of muscle mass depends on a balance between Tang and Goldman, 2006; Williams et al., 2009). However, it
protein synthesis and degradation. Innervation of skeletal has not been possible to address the potential involvement of
muscle fibers by motor neurons is essential for maintenance of myogenin in neurogenic atrophy because myogenin null mice
muscle size, structure, and function. Numerous disorders, die at birth due to failure in skeletal muscle differentiation (Hasty
including amyotrophic lateral sclerosis (ALS), Guillain-Barré et al., 1993; Nabeshima et al., 1993).
syndrome, polio, and polyneuropathy, disrupt the nerve supply Histone acetylation has been implicated in denervation-
to muscle, causing debilitating loss of muscle mass (referred to dependent changes in skeletal muscle gene expression, and
as neurogenic atrophy) and eventual paralysis. histone deacetylase (HDAC) inhibitors block the expression of

Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc. 35


myogenin in response to denervation (Tang and Goldman, 2006). atrophy was observed in the gastrocnemius and plantaris (GP)
In this regard, the class IIa HDACs, HDAC4 and HDAC5, which weight of Myog/ mice (Figure 1A).
act as transcriptional repressors (Haberland et al., 2009; McKin- Immunostaining for laminin of TA cross-sections clearly delin-
sey et al., 2000; Potthoff et al., 2007), are upregulated in skeletal eated a decrease of muscle fiber size in the WT denervated TA in
muscle upon denervation and repress the expression of Dach2, comparison to the contralateral muscle, indicative of muscle
a negative regulator of myogenin (Cohen et al., 2007; Tang et al., atrophy (Figure 1B). In contrast, the decrease in fiber size was
2008). less evident in the Myog/ denervated TA (Figure 1B). Morpho-
To investigate the potential involvement of myogenin, HDAC4, metric analysis of TA cross-sections highlighted a significant
and HDAC5 in neurogenic atrophy, we performed denervation difference in myofiber size between WT and Myog/ muscles
experiments in mutant mice in which these transcriptional following denervation, confirming the latter were resistant to
regulators were deleted in adult skeletal muscle. We show muscle atrophy (Figure 1C).
that adult mice lacking myogenin fail to upregulate the E3 ubiq- As expected, seven days after denervation, MuRF1 and
uitin ligases MuRF1 and atrogin-1 following denervation and atrogin-1 expression was dramatically upregulated in the GP of
are resistant to neurogenic atrophy. We demonstrate that myo- denervated WT mice (Figure 1D). Remarkably, this upregulation
genin binds and activates the promoter regions of the MuRF1 was significantly reduced in Myog/ denervated GP (Figure 1D),
and atrogin-1 genes, in vitro and in vivo. Similar to adult mice suggesting that the lack of upregulation of MuRF1 and atrogin-1
lacking myogenin, mice lacking Hdac4 and Hdac5 in skeletal in denervated Myog/ muscles was responsible for resistance
muscle do not upregulate myogenin following denervation and to atrophy. Deletion of myogenin mRNA from adult Myog/
are resistant to muscle atrophy. Conversely, overexpression of muscle was confirmed by real-time PCR (Figure 1D). Of note,
myogenin in skeletal muscle is sufficient to upregulate the expression of MyoD (Myod1), another bHLH myogenic regula-
expression of MuRF1 and atrogin-1 and promote neurogenic tory factor (Davis et al., 1987), was highly upregulated in both
atrophy in mice lacking Hdac4 and Hdac5. These findings reveal the contralateral and denervated GP of the Myog/ mice, seven
a key role of myogenin and class IIa HDACs as mediators of days after denervation (Figure 1D). These data show that myoge-
neurogenic atrophy and potential therapeutic targets to treat nin does not regulate Myod1 expression following denervation.
this disorder. The dramatic upregulation of Myod1 following denervation of
Myog/ mice, which are resistant to atrophy, also argues
against a major role of Myod1 in promoting neurogenic atrophy.
RESULTS Accordingly, Myod1 null mice are not resistant to muscle atrophy
following denervation (Jason O’Rourke and E. Olson, unpub-
Adult Mice Lacking Myogenin Are Resistant lished data).
to Muscle Atrophy upon Denervation Denervation is known to affect skeletal myofiber composition
To bypass the requirement of myogenin for skeletal muscle (Herbison et al., 1979; Midrio et al., 1992; Nwoye et al., 1982;
development and investigate its functions in muscle of adult Patterson et al., 2006; Sandri et al., 2006; Sato et al., 2009).
mice, we used a conditional myogenin null allele (Knapp et al., To determine whether the resistance to muscle atrophy ob-
2006), which could be deleted in adult muscle with a tamox- served in mice lacking myogenin was due to differences in
ifen-regulated Cre recombinase transgene (Hayashi and McMa- fiber type composition, we performed fiber type analysis of
hon, 2002; Knapp et al., 2006). Tamoxifen was administered to soleus muscles 2 weeks after denervation. Our findings re-
mice at 2 months of age, and 89% deletion of the conditional vealed no difference in fiber type composition between WT
myogenin allele occurred as measured by PCR genotyping and Myog/ mice (Figure S2). These findings suggest that
from genomic DNA 1 week after tamoxifen injection (see myogenin, which is upregulated following denervation, is
Figure S1 available online). Hereafter, we refer to these mice required for maximal induction of E3 ubiquitin ligase genes
with deletion of myogenin during adulthood as Myog/ mice. and neurogenic atrophy.
To examine the role of myogenin in denervated skeletal We next tested whether myogenin was necessary for medi-
muscle, the sciatic nerve was severed one month following ating other forms of atrophy, such as occurs in response to
tamoxifen administration, and muscle atrophy was assessed fasting. As shown in Figure 1E, the GP muscles of WT and
14 days later by weighing denervated and contralateral tibialis Myog/ mice displayed comparable loss in mass following a
anterior (TA) muscles. Wild-type (WT) denervated TA showed 48 hr fast. We observed the upregulation of MuRF1 and
approximately a 40% decrease in weight following denervation atrogin-1 upon fasting in both WT and Myog/ mice and vali-
in comparison to the contralateral TA (Figure 1A). In contrast, dated the deletion of myogenin in Myog/ mice (Figure 1F).
denervated TA from Myog/ mice showed a minimal decrease These data clearly demonstrate that myogenin is not required
in muscle weight (20%) compared to the contralateral for starvation atrophy, but rather is a specific mediator of
TA (Figure 1A), suggesting that Myog/ mice were partially neurogenic atrophy.
resistant to muscle atrophy. Because we deleted myogenin in
adult mice, muscle development and growth occurred normally Myogenin Activates MuRF1 and Atrogin-1 Transcription
prior to tamoxifen administration. As expected, the muscle Because upregulation of MuRF1 and atrogin-1 was impaired in
weights of the nondenervated contralateral TA in Myog/ and Myog/ mice, we analyzed the promoter regions of the
WT mice were similar (WT TA = 37.82 ± 0.87 mg; Myog/ MuRF1 and atrogin-1 genes for E boxes (CANNTG) that might
TA = 36.27 ± 0.54 mg; t test = 0.19). Comparable resistance to confer sensitivity to myogenin. Indeed, three E boxes are located

36 Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc.


Figure 1. Adult Mice Lacking Myogenin
Are Resistant to Muscle Atrophy upon
Denervation
(A) Percentage of TA or GP muscle weight of
WT and Myog/ mice 14 days after denervation,
expressed relative to contralateral muscle.
*p < 0.05 versus WT. **p < 0.005 versus WT.
n = 4 for each sample. Data are represented as
mean ± standard error of the mean (SEM).
(B) Immunostaining for laminin of contralateral and
denervated TA of WT and Myog/ mice, 14 days
after denervation. Scale bar = 20 microns.
(C) Morphometric analysis of contralateral and
denervated TA of WT and Myog/ mice, 14 days
after denervation. Values indicate the mean of
cross-sectional area of denervated TA fibers as
a percentage of the contralateral fibers ± SEM.
**p < 0.005 versus WT. n = 3 cross-sections.
(D) Expression of MuRF1, atrogin-1, Myogenin and
Myod1 in contralateral () and denervated (+) GP
of WT and Myog/ mice, 7 days after denerva-
tion, detected by real-time PCR. The values are
normalized to WT contralateral GP. Data are rep-
resented as mean ± SEM. *p < 0.05; **p < 0.005
versus WT. n = 4 for each sample.
(E) Weight of GP muscle of WT and Myog/ mice
fed () or fasted (+) for 48 hr. Data are represented
as mean ± SEM. **p < 0.005 versus fed GP.
NS = not significant. n = 6 for each sample.
(F) Expression of MuRF1, atrogin-1 and Myogenin
in fed () and 48 hr fasted (+) GP of WT and
Myog/ mice, detected by real-time PCR. The
values are normalized to WT fed GP. Data are
represented as mean ± SEM. zp < 0.005 versus
WT. **p < 0.005 versus fed. NS = not significant.
n = 6 for each sample.
See also Figure S1 and Figure S2.

expression correlates with MuRF1 and


atrogin-1 expression during muscle cell
differentiation (Figure S3B) (Spencer
et al., 2000). After six days of differentia-
tion, chromatin from C2C12 myotubes
was immunoprecipitated with antibodies
against myogenin or immunoglobulin G
(IgG) as a control. Using primers flanking
the E boxes in the MuRF1 and atrogin-1
promoters, DNA was amplified by PCR
(Figure 2A and Figure S3C). Clear enrich-
in the promoter of the MuRF1 gene, E1 (143 bp), E2 (66 bp), ment of the corresponding promoter sequences in the DNA
and E3 (44 bp), and one conserved E box is located 79 bp immunoprecipitated with antibodies against myogenin com-
upstream of the atrogin-1 gene (Figure S3A). The E boxes pared to IgG was indicative of myogenin binding to the endoge-
upstream of MuRF1 are contained in a genomic region near nous MuRF1 and atrogin-1 promoters.
the binding site for FoxO transcription factors (Waddell et al., We validated in vivo binding of myogenin to the endogenous
2008), but several kilobases away from a region shown to be MuRF1 and atrogin-1 promoters by performing ChIP assays
regulated by NFkB (Cai et al., 2004). The E box upstream of atro- using sonicated chromatin extracts from TA muscles harvested
gin-1 is embedded in a region containing multiple FoxO-binding from mice at 3 days and 7 days after denervation (Figure 2B
sites (Sandri et al., 2004). and Figure S3D). Direct binding of myogenin as a heterodimer
To confirm the binding of myogenin to the MuRF1 and atrogin-1 with E12 proteins to the E boxes E2 and E3 in the MuRF1
promoters, we performed chromatin immunoprecipitation (ChIP) promoter and to the E box in the atrogin-1 promoter was shown
assays using differentiated C2C12 myotubes, as Myogenin by gel mobility shift assays (Figure S3E).

Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc. 37


Figure 2. Myogenin Directly Regulates
MuRF1 and Atrogin-1
(A) ChIP assay performed in C2C12 myotubes
showing myogenin binding to MuRF1 and atro-
gin-1 promoters. Chromatin was immunoprecipi-
tated with antibodies against immunogloblulin G
(IgG), or myogenin. Primers flanking the E boxes
on the MuRF1 and atrogin-1 promoters were
used for amplifying DNA by real-time PCR. Values
indicate the mean of fold enrichment over chro-
matin immunoprecipitated with antibodies against
IgG ± SEM. n = 3.
(B) ChIP assays performed using denervated TA
muscle at 3 and 7 days following denervation
show myogenin binding to the MuRF1 and
atrogin-1 promoters. Values indicate the fold
enrichment over chromatin immunoprecipitated
with antibodies against IgG.
(C) Luciferase assays performed on cell extracts of
C2C12 myoblasts transfected with luciferase
reporter plasmids ligated to the WT (MuRF1-Luc)
(atrogin-1-Luc), or the mutant constructs of
MuRF1 and atrogin-1 genes, with myogenin (+)
or empty () expression plasmid. Data are repre-
sented as mean ± SEM.
(D) b-galactosidase staining of contralateral and
denervated GP muscles isolated from transgenic
mice containing a lacZ transgene under the
control of the WT (MuRF1-WT-lacZ) (atrogin-1-
WT-lacZ) or the mutant (MuRF1-Emut-lacZ)
(atrogin-1-Emut-lacZ) constructs of the MuRF1
or atrogin-1 promoters. Upper panels show
whole muscles. Lower panels show muscle
sections. Scale bar = 20 microns.
See also Figure S3.

To test the responsiveness of the E3


ligase gene promoters to atrophic signals
in vivo, transgenic mice were generated
harboring the same upstream regions of
the genes ligated to a lacZ reporter
(Kothary et al., 1989; Williams et al.,
2009). Transgenic mice with the mutated
versions of these promoter regions
were also generated (MuRF1-Emut-lacZ
and atrogin-1-Emut-lacZ). Seven days
following denervation, b-galactosidase
We further tested the ability of myogenin to activate the expression controlled by the wild-type promoters was upregu-
MuRF1 and atrogin-1 promoter regions in vitro by constructing lated in denervated GP muscle fibers compared to the inner-
luciferase reporter plasmids containing the 600 bp genomic vated contralateral leg muscles (Figure 2D). The expression of
DNA fragment upstream of the MuRF1 gene (MuRF1-Luc) or lacZ in only a subset of myofibers likely reflects the mosaicism
712 bp upstream of the atrogin-1 gene (atrogin-1-Luc) upstream of F0 transgenic mice and, perhaps, variable upregulation of
of a luciferase reporter. Mutant versions of these promoter the E3 ubiquitin ligase genes in different myofibers in response
regions were generated by mutating the myogenin-binding sites to denervation (Moriscot et al., 2010). In contrast to the obvious
in the promoters. By transfecting C2C12 cells, activation of lucif- upregulation of the wild-type transgenes following denervation,
erase was detected in response to myogenin using the wild-type mutation of the E boxes in these promoters abrogated b-galac-
promoters (Figure 2C). This activation was blunted by mutation tosidase expression, revealing an essential role for myogenin in
of the E boxes in the promoters (Figure 2C), indicating that the denervation-dependent activation of MuRF1 and atrogin-1
MuRF1 and atrogin-1 promoter regions contain responsive myo- in vivo (Figure 2D). These results show that the MuRF1 and
genin-binding sites. Similar results were obtained in transfected atrogin-1 genes are targets of myogenin transcriptional activa-
COS1 cells (Figure S3F). tion in response to denervation.

38 Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc.


Figure 3. HDAC4 and HDAC5 Redundantly
Regulate Skeletal Muscle Atrophy
(A) Percentage of TA muscle weight of mice of
the indicated genotype 14 days after denervation,
expressed relative to the contralateral muscle.
Data are represented as mean ± SEM.
**p < 0.005 versus WT. n = 5 for each sample.
(B) Immunostaining for laminin in contralateral and
denervated TA of mice of the indicated genotype,
14 days after denervation. Scale bar = 20 microns.
(C) Morphometric analysis of contralateral and
denervated TA of indicated genotype, 14 days
after denervation. Values indicate the mean of
cross-sectional area of denervated TA fibers as
a percentage of the contralateral fibers ± SEM.
*p < 0.05 and **p < 0.005 versus WT. n = 3
cross-sections.
See also Figure S4 and Figure S5.

fourteen days after denervation, the


TA of denervated dKO mice showed
a decrease in weight of only 10%
compared to the contralateral TA
Mice Null for Class II HDACs Are Resistant to Muscle (Figure 3A), revealing that the dKO mice were more resistant to
Atrophy upon Denervation muscle atrophy compared to Hdac4 skKO or Hdac5 KO mice.
Previous studies showed that the class II HDACs, HDAC4 and The weight of the contralateral TA was comparable among the
HDAC5, are upregulated in skeletal muscle in response to dener- mice (data not shown). Similar differences were also observed
vation (Bodine et al., 2001; Cohen et al., 2007; Tang et al., 2008) among GP muscles between WT and dKO mice (Figure S5).
and are responsible for the repression of Dach2, a negative regu- Immunostaining for laminin 14 days after denervation clearly
lator of Myogenin (Cohen et al., 2007; Tang et al., 2008). In light of demonstrated that the denervated TA fibers from Hdac4 skKO
the role of myogenin in promoting muscle atrophy, we hypothe- and Hdac5 KO mice were larger than the denervated WT fibers
sized that mice lacking HDAC4 or HDAC5 in skeletal muscle and that the denervated TA from dKO mice had a minimal
would be resistant to atrophy following denervation owing to decrease in muscle fiber size compared to the contralateral dKO
a block of Myogenin expression via Dach2. Mice with global dele- TA (Figure 3B). Morphometric analysis on TA sections revealed
tion of Hdac4 display lethal bone abnormalities (Vega et al., 2004), that, although WT mice showed a reduction of 70% in the myo-
so we deleted Hdac4 specifically in skeletal muscle using a condi- fiber cross-sectional area between denervated and contralateral
tional allele and a myogenin-Cre transgene (Hdac4fl/fl; myog-Cre; TA, Hdac4 skKO denervated TA displayed 30% reduction in
hereafter referred to as Hdac4 skKO) (Potthoff et al., 2007). The myofiber cross-sectional area. Hdac5 KO denervated TA also
absence of HDAC4 protein upon Hdac4 gene deletion was showed a substantial reduction in myofiber area (50%) when
confirmed by western blot analysis (Figure S4). Since mice null compared to the contralateral TA, whereas in dKO mice this
for Hdac5 do not display a phenotype (Chang et al., 2004), we reduction was only 25% (Figure 3C). From these results, we
used Hdac5/ mice (hereafter referred to as Hdac5 KO) for these conclude that HDAC4 and HDAC5 redundantly regulate skeletal
experiments. Fourteen days following denervation, WT dener- muscle atrophy and mice lacking these HDACs in skeletal muscle
vated TA showed approximately a 50% decrease in weight in are resistant to muscle atrophy upon denervation.
comparison to the contralateral TA (Figure 3A). In contrast, dener-
vated TA muscles from Hdac4 skKO or Hdac5 KO mice showed Aberrant Transcriptional Responses to Denervation
a decrease of about 30% in muscle weight in comparison to in HDAC Mutant Mice
the contralateral muscles (Figure 3A), suggesting that these We compared the transcriptional responses to denervation in
mice were partially resistant to muscle atrophy. The weight of WT and dKO mice by real-time PCR analysis of denervation-
the contralateral TA was similar among the mice (data not shown). responsive transcripts. As reported previously (Cohen et al.,
HDAC4 and HDAC5 display functional redundancy in different 2007; Tang et al., 2008), Dach2 expression was dramatically
tissues and in a variety of developmental and pathological downregulated upon denervation in WT mice. However, Dach2
settings (Backs et al., 2008; Haberland et al., 2009; Potthoff was only modestly downregulated in the dKO mice (Figure 4).
et al., 2007), so we generated double knockout (dKO) mice by Consistent with the repressive influence of Dach2 on Myogenin
crossing Hdac4 skKO with Hdac5 KO mice to further investigate expression, in WT mice, Myogenin and Myod1 were strongly
the role of HDAC4 and HDAC5 in skeletal muscle atrophy. upregulated three days after denervation, as were MuRF1 and
The dKO mice were viable and fertile and showed no obvious atrogin-1 (Figure 4). In contrast, neither Myogenin nor Myod1
phenotype under normal conditions (data not shown). Strikingly, transcripts were upregulated following denervation of dKO

Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc. 39


Figure 4. dKO Mice Show Altered Gene Expression upon Denervation
Expression of the indicated mRNAs was detected by real-time PCR in WT and dKO denervated GP and normalized to the expression in the contralateral muscle.
Data are represented as mean ± SEM. **p < 0.005 versus dKO. n = 6 for each time point.

mice (Figure 4). The upregulation of MuRF1 and atrogin-1 was vation-induced atrophy, we electroporated the TA of dKO mice
also completely abolished in dKO denervated GP (Figure 4), sug- with either a myogenin expression plasmid or an empty expres-
gesting that the lack of upregulation of MuRF1 and atrogin-1 in sion plasmid. Gene delivery efficiency was monitored by coelec-
denervated dKO muscles was in part responsible for resistance troporation with a GFP vector (Dona et al., 2003; Rana et al.,
to atrophy. 2004). Three days after electroporation, which is sufficient time
for the electroporated plasmids to be expressed in skeletal
Myogenin Overexpression in dKO Muscle Restores muscle (Dona et al., 2003), we denervated one leg of the dKO
Neurogenic Atrophy mice by cutting the sciatic nerve; the TA muscles were harvested
To examine whether forced expression of myogenin was suffi- 10 days after denervation. As seen in Figure 5A, laminin immu-
cient to overcome the resistance of the dKO TA muscle to dener- nostaining of dKO TA muscles clearly revealed a decrease in

Figure 5. Ectopic Expression of Myogenin Induces Muscle Atrophy in dKO Mice Following Denervation
(A) Immunostaining for laminin (red) of cross-section of contralateral and denervated dKO TA electroporated with GFP expression plasmid and control plasmid
(HDAC4/5 dKO Control) or GFP plasmid and myogenin (HDAC4/5 dKO + Myogenin), 10 days after denervation. Histology shows that the dKO denervated
GFP-positive fibers coelectroporated with myogenin are smaller than denervated GFP-positive fibers coelectroporated with control plasmid. Scale
bar = 20 microns.
(B) Morphometric analysis performed on GFP-positive fibers of contralateral () and denervated (+) dKO TA muscles electroporated with GFP expression plasmid
and control plasmid (Control) or GFP plasmid and myogenin (Myogenin), 10 days after denervation. Values indicate the mean of cross-sectional area of
GFP-positive muscle fibers as a percentage of the contralateral control fibers ± SEM. *p < 0.05 versus control. n = 7 for each condition.
(C) Expression of Myogenin, MuRF1, and atrogin-1 in contralateral () and denervated (+) dKO TA muscles electroporated with GFP plasmid and a control
plasmid (Control) or GFP plasmid and myogenin (Myogenin), 10 days after denervation. Values are normalized to the expression in the contralateral control
muscles. Data are represented as mean ± SEM. *p < 0.05 versus control. n = 3 for each sample.
See also Figure S6.

40 Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc.


Figure 6. Model for Neurogenic Atrophy
Denervation of skeletal muscle results in the upregulation
of HDAC4 and HDAC5, which represses Dach2, a negative
regulator of myogenin, resulting in Myogenin expression.
Myogenin activates the expression of MuRF1 and atro-
gin-1, two E3 ubiquitin ligases that participate in the
proteolytic pathway resulting in muscle atrophy. Myoge-
nin also regulates miR-206, which establishes a negative
feedback loop to repress HDAC4 expression and promote
reinnervation.

(Hyatt et al., 2003; Ishido et al., 2004). On the


contrary, we demonstrate here that myogenin
directly regulates MuRF1 and atrogin-1, which
promote the loss of muscle mass in response
to denervation, revealing a mechanistic basis
for neurogenic muscle atrophy and a previously
unrecognized function for myogenin in this
pathological process.
myofiber size in the denervated TA of dKO mice overexpressing Recently, we showed that microRNA (miR) 206 is also upregu-
myogenin compared to the denervated dKO TA electroporated lated in denervated skeletal muscle via a series of conserved E
with the control vector. Morphometric analysis performed on boxes that bind myogenin (Williams et al., 2009). miR-206, in
GFP-positive myofibers showed a significant decrease in the turn, represses expression of HDAC4 and controls a retrograde
size of myofibers of the denervated dKO TA electroporated signaling pathway that promotes reinnervation of denervated
with myogenin versus control vector (Figure 5B). Real-time myofibers (Figure 6). Thus, skeletal muscle responds to denerva-
PCR analysis validated the overexpression of Myogenin in elec- tion by activating an elaborate network of transcriptional and
troporated TA muscle of dKO mice and showed an upregulation epigenetic pathways, involving positive and negative feedback
of the expression of MuRF1 and atrogin-1 (Figure 5C), confirming loops, which modulate nerve-muscle interactions and muscle
the myogenin-dependent regulation of the E3 ubiquitin ligases. growth and function (Figure 6).
The potential role of myogenin in driving muscle atrophy was
further investigated by overexpressing myogenin in the TA Dual Roles of Myogenin in Muscle Development
muscle of WT mice. Morphometric analysis performed on and Atrophy
GFP-positive myofibers showed no significant size difference Our findings reveal the gene regulatory circuitry for muscle
between myofibers electroporated with control or myogenin development is redeployed in adulthood to control aspects of
expression plasmid (Figures S6A and S6B). Real-time PCR anal- muscle disease and stress responsiveness. Thus, myogenin
ysis validated the overexpression of myogenin in electroporated can exert opposing effects on skeletal muscle—either promoting
TA muscle of WT mice and showed an upregulation of the differentiation or degradation—depending on the developmental
expression of MuRF1 and atrogin-1 (Figure S6C). Taken or pathological setting. These contrasting activities of myogenin
together, these findings demonstrate that overexpression of myo- likely reflect differential modulation by signaling pathways and
genin is necessary but not sufficient to induce muscle atrophy. cofactors that enable myogenin to regulate distinct sets of target
genes.
DISCUSSION Similar to myogenin, Dach2 is a transcription factor involved in
both muscle development and muscle atrophy. Dach2 is
The results of this study demonstrate a key role of myogenin, well expressed in the developing somites prior to the onset of
known for its function as an essential regulator of myogenesis, in myogenesis and has been shown to regulate myogenic specifi-
controlling neurogenic atrophy. Myogenin promotes muscle cation by interacting with the Eya2 and Six1 transcription factors
atrophy upon denervation by directly activating the expression (Heanue et al., 1999; Kardon et al., 2002). Indeed, Dach proteins
of MuRF1 and atrogin-1, which encode E3 ubiquitin ligases are required for activation of Six1 targets (Li et al., 2003), sug-
responsible for muscle proteolysis. Upregulation of Myogenin gesting a possible role of Dach proteins in the Six1-mediated
in response to denervation is controlled by a transcriptional regulation of muscle development (Laclef et al., 2003) or fiber
pathway in which HDAC4 and 5 are initially induced and, in type specification (Grifone et al., 2004). Following denervation,
turn, repress the expression of Dach2 (Tang and Goldman, Dach2 plays a role in connecting neuronal activity with myogenin
2006), a negative regulator of Myogenin (Figure 6). expression (Cohen et al., 2007; Tang and Goldman, 2006; Tang
It is generally accepted that muscle atrophy occurs when et al., 2008).
proteolysis exceeds protein synthesis (Eley and Tisdale, 2007; The finding that forced expression of myogenin in HDAC4/5
Glass, 2003; Mammucari et al., 2008; Sandri et al., 2004). Up- mutant mice is sufficient to restore muscle atrophy following
regulation of myogenin in response to denervation has been denervation indicates that myogenin is a key downstream
proposed as an adaptive mechanism to prevent muscle atrophy mediator of the proatrophic functions of these HDACs. It is

Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc. 41


noteworthy, however, that the blockade to muscle atrophy and et al., 2004; Sacheck et al., 2007). In this regard, we have found
E3 ligase expression imposed by the combined deletion of that Myog/ mice display a normal loss of skeletal muscle mass
HDACs 4 and 5 is more pronounced than in Myog/ mice. in response to fasting, further demonstrating that myogenin is
This suggests the existence of additional downstream targets dedicated to neurogenic atrophy and sensing the state of motor
of these HDACs that promote neurogenic atrophy. We also innervation. The fact that MuRF1 and atrogin-1 are upregulated
note that forced overexpression of myogenin in innervated skel- in other atrophy conditions in the absence of myogenin upregu-
etal muscle was not sufficient to induce muscle atrophy lation (Lecker et al., 2004; Sacheck et al., 2007) strongly
(Figure S6) (Hughes et al., 1999). These findings indicate that suggests that other transcription factors known to regulate the
myogenin is necessary, but not sufficient, to regulate the genetic expression of these ubiquitin ligases, such as the FoxO family
program for muscle atrophy and imply the existence of additional or NFkB (Bodine et al., 2001; Sandri et al., 2004; Waddell
denervation-dependent signals that potentiate the ability of et al., 2008), play a role in driving muscle atrophy in a myoge-
myogenin to promote atrophy. nin-independent manner.
MyoD, like myogenin, is upregulated in response to denerva- Our finding that myogenin, in addition to HDAC4 and HDAC5,
tion (Figure 4 and (Charge et al., 2008; Hyatt et al., 2003; Ishido acts as a regulator of neurogenic muscle atrophy through the
et al., 2004). In Myog/ mice, Myod1 expression is dramatically activation of E3 ubiquitin ligases provides a new perspective
elevated compared to WT muscles and is super-induced in on potential therapies for muscle wasting disorders. Class II
response to denervation (Figure 1D). The observation that HDACs are regulated by a variety of calcium-dependent
Myod1 null mice are not resistant to muscle atrophy following signaling pathways that control their nuclear export through
denervation (Jason O’Rourke and E. Olson, unpublished data) signal-dependent phosphorylation (Backs et al., 2008; McKinsey
demonstrates a negligible role for Myod1 in neurogenic atrophy et al., 2000). In a pathological condition such as muscle denerva-
and points to myogenin as the major myogenic bHLH factor tion, HDAC4 and HDAC5 are upregulated, shuttle into the
involved in this process. This is consistent with the finding that, myonuclei adjacent to neuromuscular junctions (Cohen et al.,
although MyoD and myogenin bind the same DNA consensus 2007), and are critical regulators of muscle atrophy. Modulation
sequences, they regulate distinct sets of target genes (Blais of the activity of class II HDACs, through pharmacologic inhibi-
et al., 2005; Cao et al., 2006). tion compatible with the maintenance of steady-state transcrip-
tion of genes regulated by class II HDACs, may represent a new
A Myogenin-Dependent Transcriptional Pathway strategy for ameliorating muscle atrophy following denervation.
for Muscle Atrophy
We show, both in vivo using denervated muscles and in vitro EXPERIMENTAL PROCEDURES
using differentiated C2C12 cells, that myogenin binds the
endogenous MuRF1 and atrogin-1 promoters. We observed Mouse Lines
Mice used in this study are described in the Extended Experimental Proce-
a decrease in myogenin expression and binding to these E3
dures.
ubiquitin ligase promoters between days 3 and day 7 after dener-
vation (Figure 2B and Figure 4), suggesting an especially impor- Denervation
tant role of myogenin in triggering the transcriptional cascade In anaesthetized adult mice, the sciatic nerve of the left leg was cut and a 3 mm
leading to atrophy. Consistent with our finding that myogenin piece was excised. The right leg remained innervated and was used as control.
regulates MuRF1 and atrogin-1 expression, these E3 ubiquitin Mice were sacrificed after 3, 7, 10, or 14 days.
ligases are upregulated upon C2C12 differentiation (Figure S3B)
(Spencer et al., 2000), a process known to be regulated by DNA Delivery by Electroporation
myogenin. Although it is well established that MuRF1 and atro- For gene delivery by electroporation, adult dKO mice were anesthetized; TA
muscles exposed, injected with 30 mg of DNA in a solution of 5% mannitol,
gin-1 function in driving skeletal muscle atrophy (Bodine et al.,
and immediately subjected to electroporation. Electroporation was performed
2001; Clarke et al., 2007; Gomes et al., 2001; Kedar et al., by delivering 10 electric pulses of 20 V each (five with one polarity followed by
2004; Lecker et al., 2004; Li et al., 2004; Li et al., 2007; Willis five with inverted polarity). A pair of 3 3 5 mm Genepaddle electrodes (BTX,
et al., 2009), their potential roles in myogenesis have not been San Diego, CA) placed on opposite sides of the muscle was used to deliver
explored. Considering the important role of ubiquitination in the electric pulses. pCMV-Snap25-GFP (provided by Tullio Pozzan, University
regulating proteolysis, endocytosis, signal transduction (Hicke, of Padua, Padua, Italy) was used in a 1:1 ratio with pcDNA3.1 (Invitrogen) or
EMSV-myogenin plasmid (Rana et al., 2004).
2001), and transcription (Salghetti et al., 2001), it will be inter-
esting to investigate the potential involvement of MuRF1 and
Immunohistochemistry
atrogin-1 in muscle development and regeneration. Cryosections of TA or soleus were fixed in 4% paraformaldehyde in PBS for
10 min at 4 C and washed in PBS. After incubating 30 min with 0.1%
Therapeutic Implications Triton X-100 in PBS, the samples were fixed for 1 hr in 15% goat serum in
Numerous disorders, including motor neuron disease, fasting, PBS supplemented with M.O.M. Mouse IgG blocking reagent (Vector Labora-
cancer cachexia, and sarcopenia, cause muscle atrophy and tories) (BB) at room temperature. Primary antibodies were incubated overnight
the E3 ubiquitin ligase genes are thought to function as final at 4 C (1:100 dilution of rabbit polyclonal anti-laminin antibody; 1:16000
anti-type I myosin heavy chain (MHC) (Sigma). Primary antibodies were
common mediators of different atrophic stimuli. Myogenin is
detected by Alexa Fluor-488 or -555 goat anti-rabbit antibody (Invitrogen)
upregulated upon denervation and spinal cord isolation (Hyatt diluted 1:800 in BB. DAB staining (Vector Laboratories) was used on soleus
et al., 2003), but is not induced in response to other forms of muscle for detecting type I MHC. Soleus muscles were used for metachro-
atrophy, such as fasting, cancer cachexia, or diabetes (Lecker matic ATPase staining as described elsewhere (Ogilvie and Feeback, 1990).

42 Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc.


Staining of transgenic lines positive for b-galactosidase was performed on GP SUPPLEMENTAL INFORMATION
muscles, as previously described (Williams et al., 2009).
Supplemental Information includes Extended Experimental Procedures and
six figures and can be found with this article online at doi:10.1016/j.cell.
Morphometric Analysis 2010.09.004.
Myofiber area was assessed on TA cryosections using ImageJ software
(http://rsb.info.nih.gov/ij/) (NIH). Three H&E-stained cross-sections from three
different mice for each genotype were analyzed. Between 100 and 350 GFP- ACKNOWLEDGMENTS
positive fibers were analyzed for each electroporated TA muscle. The values
are calculated as the percentage of the average of the cross-sectional area We thank Marco Sandri for scientific input, Cheryl Nolen and Svetlana
of each TA over the average cross-sectional area of the contralateral TA fibers. Bezprozvannaya for technical assistance, Jose Cabrera for graphics, and
Jennifer Brown for editorial assistance. Work in the laboratory of E.N.O. was
supported by grants from the National Institutes of Health and the
RNA Isolation and RT-PCR Robert A. Welch Foundation (grant number I-0025). W.H.K. was supported
Total RNA was isolated from GP muscles using Trizol reagent (Invitrogen) by a grant from the Muscular Dystrophy Association and the Robert A. Welch
following the manufacturer’s instructions. Three micrograms of RNA was con- Foundation. J.B. was supported by the Deutsche Forschungsgemeinschaft
verted to cDNA using random primers and Superscript III reverse transcriptase (BA 2258/1-1).
(Invitrogen). Gene expression was assessed using real-time PCR with the ABI
PRISM 7000 sequence detection system and TaqMan or with SYBR green Received: April 20, 2010
Master Mix reagents (Applied Biosystems). Real-time PCR values were Revised: June 1, 2010
normalized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Accepted: August 20, 2010
A list of Taqman probes and Sybr Green primers are available in the Extended Published: September 30, 2010
Experimental Procedures.

REFERENCES
Plasmid Constructs
A list of the plasmids used in this study is available in the Extended Experi- Attaix, D., Combaret, L., Bechet, D., and Taillandier, D. (2008). Role of the
mental Procedures. ubiquitin-proteasome pathway in muscle atrophy in cachexia. Curr. Opin.
Support. Palliat. Care 2, 262–266.
Attaix, D., Ventadour, S., Codran, A., Bechet, D., Taillandier, D., and
Cell Culture Combaret, L. (2005). The ubiquitin-proteasome system and skeletal muscle
COS cells were grown in DMEM supplemented with 10% fetal bovine serum wasting. Essays Biochem. 41, 173–186.
(FBS) and antibiotics (100 U/ml penicillin and 100 mg/ml streptomycin).
Backs, J., Backs, T., Bezprozvannaya, S., McKinsey, T.A., and Olson, E.N.
C2C12 myoblasts were grown in DMEM supplemented with 20% FBS and
(2008). Histone deacetylase 5 acquires calcium/calmodulin-dependent kinase
antibiotics and differentiated in DMEM supplemented with 2% horse serum
II responsiveness by oligomerization with histone deacetylase 4. Mol. Cell.
and antibiotics.
Biol. 28, 3437–3445.
Beehler, B.C., Sleph, P.G., Benmassaoud, L., and Grover, G.J. (2006).
Chromatin Immunoprecipitation Assay Reduction of skeletal muscle atrophy by a proteasome inhibitor in a rat model
ChIP assays were performed using C2C12 myotubes at day six of differentia- of denervation. Exp. Biol. Med. (Maywood) 231, 335–341.
tion or using TA muscles three and seven days after denervation with the ChIP
Blais, A., Tsikitis, M., Acosta-Alvear, D., Sharan, R., Kluger, Y., and Dynlacht,
assay kit (Upstate) following the manufacturer’s instructions. Chromatin was
B.D. (2005). An initial blueprint for myogenic differentiation. Genes Dev. 19,
immunoprecipitated with antibodies against immunogloblulin G (Sigma) or my-
553–569.
ogenin (M-225; Santa Cruz). The sequences of the ChIP primers are available
in the Extended Experimental Procedures. Bodine, S.C., Latres, E., Baumhueter, S., Lai, V.K., Nunez, L., Clarke, B.A.,
Poueymirou, W.T., Panaro, F.J., Na, E., Dharmarajan, K., et al. (2001). Identifi-
cation of ubiquitin ligases required for skeletal muscle atrophy. Science 294,
Luciferase assay 1704–1708.
C2C12 transfections were performed using Lipofectamine 2000 (Invitrogen) as Cai, D., Frantz, J.D., Tawa, N.E., Jr., Melendez, P.A., Oh, B.C., Lidov, H.G.,
previously described (Mercer et al., 2005). COS cells were plated and trans- Hasselgren, P.O., Frontera, W.R., Lee, J., Glass, D.J., et al. (2004). IKKbeta/
fected 12 hr later using FuGENE (Roche Applied Science) following the manu- NF-kappaB activation causes severe muscle wasting in mice. Cell 119,
facturer’s instructions. The MuRF1 and atrogin-1 reporter plasmid cloning 285–298.
strategy is described in the Extended Experimental Procedures. Luciferase
Cao, Y., Kumar, R.M., Penn, B.H., Berkes, C.A., Kooperberg, C., Boyer, L.A.,
assays were performed with the Luciferase Assay kit (Promega) according
Young, R.A., and Tapscott, S.J. (2006). Global and gene-specific analyses
to the manufacturer’s instructions.
show distinct roles for Myod and Myog at a common set of promoters.
EMBO J. 25, 502–511.
Site-Directed Mutagenesis Chang, S., McKinsey, T.A., Zhang, C.L., Richardson, J.A., Hill, J.A., and Olson,
Mutations were introduced into E boxes E2 and E3 of the MuRF1 promoter E.N. (2004). Histone deacetylases 5 and 9 govern responsiveness of the heart
region and in the E box of the atrogin-1 promoter by using the QuikChange II to a subset of stress signals and play redundant roles in heart development.
Site-Directed Mutagenesis Kit (Stratagene). The same E box mutations as Mol. Cell. Biol. 24, 8467–8476.
those used in electrophoretic mobility shift assays were introduced within
Charge, S.B., Brack, A.S., Bayol, S.A., and Hughes, S.M. (2008). MyoD- and
each E box site in the promoters.
nerve-dependent maintenance of MyoD expression in mature muscle fibres
acts through the DRR/PRR element. BMC Dev. Biol. 8, 5–18.
Statistical Analysis Clarke, B.A., Drujan, D., Willis, M.S., Murphy, L.O., Corpina, R.A., Burova, E.,
Data are presented as mean ± standard error of the mean (SEM). Statistical Rakhilin, S.V., Stitt, T.N., Patterson, C., Latres, E., et al. (2007). The E3 Ligase
significance was determined using two-tailed t test with a significance level MuRF1 degrades myosin heavy chain protein in dexamethasone-treated
minor of 0.05. skeletal muscle. Cell Metab. 6, 376–385.

Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc. 43


Cohen, T.J., Waddell, D.S., Barrientos, T., Lu, Z., Feng, G., Cox, G.A., Bodine, Laclef, C., Hamard, G., Demignon, J., Souil, E., Houbron, C., and Maire, P.
S.C., and Yao, T.P. (2007). The histone deacetylase HDAC4 connects neural (2003). Altered myogenesis in Six1-deficient mice. Development 130, 2239–
activity to muscle transcriptional reprogramming. J. Biol. Chem. 282, 33752– 2252.
33759. Lecker, S.H., Jagoe, R.T., Gilbert, A., Gomes, M., Baracos, V., Bailey, J., Price,
Davis, R.L., Weintraub, H., and Lassar, A.B. (1987). Expression of a single S.R., Mitch, W.E., and Goldberg, A.L. (2004). Multiple types of skeletal muscle
transfected cDNA converts fibroblasts to myoblasts. Cell 51, 987–1000. atrophy involve a common program of changes in gene expression. FASEB J.
18, 39–51.
Dona, M., Sandri, M., Rossini, K., Dell’Aica, I., Podhorska-Okolow, M., and
Carraro, U. (2003). Functional in vivo gene transfer into the myofibers of adult Li, H.H., Kedar, V., Zhang, C., McDonough, H., Arya, R., Wang, D.Z., and
skeletal muscle. Biochem. Biophys. Res. Commun. 312, 1132–1138. Patterson, C. (2004). Atrogin-1/muscle atrophy F-box inhibits calcineurin-
dependent cardiac hypertrophy by participating in an SCF ubiquitin ligase
Eley, H.L., and Tisdale, M.J. (2007). Skeletal muscle atrophy, a link between
complex. J. Clin. Invest. 114, 1058–1071.
depression of protein synthesis and increase in degradation. J. Biol. Chem.
282, 7087–7097. Li, H.H., Willis, M.S., Lockyer, P., Miller, N., McDonough, H., Glass, D.J., and
Patterson, C. (2007). Atrogin-1 inhibits Akt-dependent cardiac hypertrophy in
Glass, D.J. (2003). Molecular mechanisms modulating muscle mass. Trends
mice via ubiquitin-dependent coactivation of Forkhead proteins. J. Clin. Invest.
Mol. Med. 9, 344–350.
117, 3211–3223.
Gomes, M.D., Lecker, S.H., Jagoe, R.T., Navon, A., and Goldberg, A.L. (2001).
Li, X., Oghi, K.A., Zhang, J., Krones, A., Bush, K.T., Glass, C.K., Nigam, S.K.,
Atrogin-1, a muscle-specific F-box protein highly expressed during muscle
Aggarwal, A.K., Maas, R., Rose, D.W., et al. (2003). Eya protein phosphatase
atrophy. Proc. Natl. Acad. Sci. USA 98, 14440–14445.
activity regulates Six1-Dach-Eya transcriptional effects in mammalian
Grifone, R., Laclef, C., Spitz, F., Lopez, S., Demignon, J., Guidotti, J.E., organogenesis. Nature 426, 247–254.
Kawakami, K., Xu, P.X., Kelly, R., Petrof, B.J., et al. (2004). Six1 and Eya1
Lu, J., Webb, R., Richardson, J.A., and Olson, E.N. (1999). MyoR: a muscle-
expression can reprogram adult muscle from the slow-twitch phenotype into
restricted basic helix-loop-helix transcription factor that antagonizes the
the fast-twitch phenotype. Mol. Cell. Biol. 24, 6253–6267.
actions of MyoD. Proc. Natl. Acad. Sci. USA 19, 552–557.
Haberland, M., Montgomery, R.L., and Olson, E.N. (2009). The many roles of
Mammucari, C., Schiaffino, S., and Sandri, M. (2008). Downstream of Akt:
histone deacetylases in development and physiology: implications for disease
FoxO3 and mTOR in the regulation of autophagy in skeletal muscle. Autophagy
and therapy. Nat. Rev. Genet. 10, 32–42.
4, 524–526.
Hasty, P., Bradley, A., Morris, J.H., Edmondson, D.G., Venuti, J.M., Olson,
McKinsey, T.A., Zhang, C.L., Lu, J., and Olson, E.N. (2000). Signal-dependent
E.N., and Klein, W.H. (1993). Muscle deficiency and neonatal death in mice
nuclear export of a histone deacetylase regulates muscle differentiation.
with a targeted mutation in the myogenin gene. Nature 364, 501–506.
Nature 408, 106–111.
Hayashi, S., and McMahon, A.P. (2002). Efficient recombination in diverse
Medina, R., Wing, S.S., and Goldberg, A.L. (1995). Increase in levels of polyu-
tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated
biquitin and proteasome mRNA in skeletal muscle during starvation and
gene activation/inactivation in the mouse. Dev. Biol. 244, 305–318.
denervation atrophy. Biochem. J. 307, 631–637.
Heanue, T.A., Reshef, R., Davis, R.J., Mardon, G., Oliver, G., Tomarev, S.,
Mercer, S.E., Ewton, D.Z., Deng, X., Lim, S., Mazur, T.R., and Friedman, E.
Lassar, A.B., and Tabin, C.J. (1999). Synergistic regulation of vertebrate
(2005). Mirk/Dyrk1B mediates survival during the differentiation of C2C12
muscle development by Dach2, Eya2, and Six1, homologs of genes required
myoblasts. J. Biol. Chem. 280, 25788–25801.
for Drosophila eye formation. Genes Dev. 13, 3231–3243.
Merlie, J.P., Mudd, J., Cheng, T.C., and Olson, E.N. (1994). Myogenin and
Herbison, G.J., Jaweed, M.M., and Ditunno, J.F. (1979). Muscle atrophy in rats
acetylcholine receptor alpha gene promoters mediate transcriptional regula-
following denervation, casting, inflammation, and tenotomy. Arch. Phys. Med.
tion in response to motor innervation. J. Biol. Chem. 269, 2461–2467.
Rehabil. 60, 401–404.
Midrio, M., Danieli-Betto, D., Megighian, A., Velussi, C., Catani, C., and
Hicke, L. (2001). A new ticket for entry into budding vesicles-ubiquitin. Cell 106,
Carraro, U. (1992). Slow-to-fast transformation of denervated soleus muscle
527–530.
of the rat, in the presence of an antifibrillatory drug. Pflugers Arch. 420,
Hughes, S.M., Chi, M.M., Lowry, O.H., and Gundersen, K. (1999). Myogenin 446–450.
induces a shift of enzyme activity from glycolytic to oxidative metabolism in
Moriscot, A.S., Baptista, I.L., Bogomolovas, J., Witt, C., Hirner, S., Granzier,
muscles of transgenic mice. J. Cell Biol. 145, 633–642.
H., and Labeit, S. (2010). MuRF1 is a muscle fiber-type II associated factor
Hyatt, J.P., Roy, R.R., Baldwin, K.M., and Edgerton, V.R. (2003). Nerve and together with MuRF2 regulates type-II fiber trophicity and maintenance.
activity-independent regulation of skeletal muscle atrophy: role of MyoD and J. Struct. Biol. 170, 344–353.
myogenin in satellite cells and myonuclei. Am. J. Physiol. Cell Physiol. 285,
Nabeshima, Y., Hanaoka, K., Hayasaka, M., Esumi, E., Li, S., and Nonaka, I.
C1161–C1173.
(1993). Myogenin gene disruption results in perinatal lethality because of
Ishido, M., Kami, K., and Masuhara, M. (2004). In vivo expression patterns of severe muscle defect. Nature 364, 532–535.
MyoD, p21, and Rb proteins in myonuclei and satellite cells of denervated
Nwoye, L., Mommaerts, W.F., Simpson, D.R., Seraydarian, K., and Marusich,
rat skeletal muscle. Am. J. Physiol. Cell Physiol. 287, C484–C493.
M. (1982). Evidence for a direct action of thyroid hormone in specifying muscle
Kardon, G., Heanue, T.A., and Tabin, C.J. (2002). Pax3 and Dach2 positive properties. Am. J. Physiol. 242, R401–R408.
regulation in the developing somite. Dev. Dyn. 224, 350–355.
Ogilvie, R.W., and Feeback, D.L. (1990). A metachromatic dye-ATPase
Kedar, V., McDonough, H., Arya, R., Li, H.H., Rockman, H.A., and Patterson, method for the simultaneous identification of skeletal muscle fiber types I,
C. (2004). Muscle-specific RING finger 1 is a bona fide ubiquitin ligase that IIA, IIB and IIC. Stain Technol. 65, 231–241.
degrades cardiac troponin I. Proc. Natl. Acad. Sci. USA 101, 18135–18140.
Patterson, M.F., Stephenson, G.M., and Stephenson, D.G. (2006). Denervation
Knapp, J.R., Davie, J.K., Myer, A., Meadows, E., Olson, E.N., and Klein, W.H. produces different single fiber phenotypes in fast- and slow-twitch hindlimb
(2006). Loss of myogenin in postnatal life leads to normal skeletal muscle but muscles of the rat. Am. J. Physiol. Cell Physiol. 291, C518–C528.
reduced body size. Development 133, 601–610.
Potthoff, M.J., Wu, H., Arnold, M.A., Shelton, J.M., Backs, J., McAnally, J.,
Kothary, R., Clapoff, S., Darling, S., Perry, M.D., Moran, L.A., and Rossant, J. Richardson, J.A., Bassel-Duby, R., and Olson, E.N. (2007). Histone deacety-
(1989). Inducible expression of an hsp68-lacZ hybrid gene in transgenic mice. lase degradation and MEF2 activation promote the formation of slow-twitch
Development 105, 707–714. myofibers. J. Clin. Invest. 117, 2459–2467.

44 Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc.


Rana, Z.A., Ekmark, M., and Gundersen, K. (2004). Coexpression after electro- Tang, H., and Goldman, D. (2006). Activity-dependent gene regulation in skel-
poration of plasmid mixtures into muscle in vivo. Acta Physiol. Scand. 181, etal muscle is mediated by a histone deacetylase (HDAC)-Dach2-myogenin
233–238. signal transduction cascade. Proc. Natl. Acad. Sci. USA 103, 16977–16982.
Sacheck, J.M., Hyatt, J.P., Raffaello, A., Jagoe, R.T., Roy, R.R., Edgerton, Tang, H., Macpherson, P., Marvin, M., Meadows, E., Klein, W.H., Yang, X.J.,
V.R., Lecker, S.H., and Goldberg, A.L. (2007). Rapid disuse and denervation and Goldman, D. (2008). A histone deacetylase 4/myogenin positive feedback
atrophy involve transcriptional changes similar to those of muscle wasting loop coordinates denervation-dependent gene induction and suppression.
during systemic diseases. FASEB J. 21, 140–155. Mol. Biol. Cell 20, 1120–1131.

Salghetti, S.E., Caudy, A.A., Chenoweth, J.G., and Tansey, W.P. (2001). Tawa, N.E., Jr., Odessey, R., and Goldberg, A.L. (1997). Inhibitors of the
Regulation of transcriptional activation domain function by ubiquitin. Science proteasome reduce the accelerated proteolysis in atrophying rat skeletal
293, 1651–1653. muscles. J. Clin. Invest. 100, 197–203.
Vega, R.B., Matsuda, K., Oh, J., Barbosa, A.C., Yang, X., Meadows, E.,
Sandri, M., Lin, J., Handschin, C., Yang, W., Arany, Z.P., Lecker, S.H.,
McAnally, J., Pomajzl, C., Shelton, J.M., Richardson, J.A., et al. (2004). Histone
Goldberg, A.L., and Spiegelman, B.M. (2006). PGC-1alpha protects skeletal
deacetylase 4 controls chondrocyte hypertrophy during skeletogenesis. Cell
muscle from atrophy by suppressing FoxO3 action and atrophy-specific
119, 555–566.
gene transcription. Proc. Natl. Acad. Sci. USA 103, 16260–16265.
Waddell, D.S., Baehr, L.M., van den Brandt, J., Johnsen, S.A., Reichardt, H.M.,
Sandri, M., Sandri, C., Gilbert, A., Skurk, C., Calabria, E., Picard, A., Walsh, K., Furlow, J.D., and Bodine, S.C. (2008). The glucocorticoid receptor and FOXO1
Schiaffino, S., Lecker, S.H., and Goldberg, A.L. (2004). Foxo transcription synergistically activate the skeletal muscle atrophy-associated MuRF1 gene.
factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal Am. J. Physiol. Endocrinol. Metab. 295, E785–E797.
muscle atrophy. Cell 117, 399–412.
Williams, A.H., Valdez, G., Moresi, V., Qi, X., McAnally, J., Elliott, J.L., Bassel-
Sato, Y., Shimizu, M., Mizunoya, W., Wariishi, H., Tatsumi, R., Buchman, V.L., Duby, R., Sanes, J.R., and Olson, E.N. (2009). MicroRNA-206 delays ALS
and Ikeuchi, Y. (2009). Differential expression of sarcoplasmic and myofibrillar progression and promotes regeneration of neuromuscular synapses in mice.
proteins of rat soleus muscle during denervation atrophy. Biosci. Biotechnol. Science 326, 1549–1554.
Biochem. 73, 1748–1756.
Willis, M.S., Rojas, M., Li, L., Selzman, C.H., Tang, R.H., Stansfield, W.E.,
Spencer, J.A., Eliazer, S., Ilaria, R.L., Jr., Richardson, J.A., and Olson, E.N. Rodriguez, J.E., Glass, D.J., and Patterson, C. (2009). Muscle ring finger 1
(2000). Regulation of microtubule dynamics and myogenic differentiation by mediates cardiac atrophy in vivo. Am. J. Physiol. Heart Circ. Physiol. 296,
MURF, a striated muscle RING-finger protein. J. Cell Biol. 150, 771–784. H997–H1006.

Cell 143, 35–45, October 1, 2010 ª2010 Elsevier Inc. 45


Long Noncoding RNAs
with Enhancer-like Function
in Human Cells
Ulf Andersson Ørom,1 Thomas Derrien,2 Malte Beringer,1 Kiranmai Gumireddy,1 Alessandro Gardini,1 Giovanni Bussotti,2
Fan Lai,1 Matthias Zytnicki,2 Cedric Notredame,2 Qihong Huang,1 Roderic Guigo,2 and Ramin Shiekhattar1,2,3,*
1The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104, USA
2Centre for Genomic Regulation (CRG), UPF, Barcelona, Spain
3Institució Catalana de Recerca i Estudis Avançats (ICREA), Barcelona, Spain

*Correspondence: shiekhattar@wistar.org
DOI 10.1016/j.cell.2010.09.001

SUMMARY to be functional in humans, modulating roughly 30% of protein-


coding genes (Berezikov and Plasterk, 2005).
While the long noncoding RNAs (ncRNAs) constitute While microRNAs represent a minority of the noncoding tran-
a large portion of the mammalian transcriptome, their scriptome, the tangle of long and short noncoding transcripts is
biological functions has remained elusive. A few long much more intricate, and is likely to contain as yet unidentified
ncRNAs that have been studied in any detail silence classes of molecules forming transcriptional regulatory networks
gene expression in processes such as X-inactivation (Efroni et al., 2008; Kapranov et al., 2007). Long ncRNAs are tran-
scripts longer than 100 nts which in most cases mirror the
and imprinting. We used a GENCODE annotation of
features of protein-coding genes without containing a functional
the human genome to characterize over a thousand
open reading frame (ORF). Long ncRNAs have been implicated
long ncRNAs that are expressed in multiple cell lines. as principal players in imprinting and X-inactivation. The
Unexpectedly, we found an enhancer-like function imprinting phenomenon dictates the repression of a particular
for a set of these long ncRNAs in human cell lines. allele, depending on its paternal or maternal origin. Many clus-
Depletion of a number of ncRNAs led to decreased ters of imprinted genes contain ncRNAs, and some of them
expression of their neighboring protein-coding have been implicated in the transcriptional silencing (Yang and
genes, including the master regulator of hematopoi- Kuroda, 2007). Similarly, the X chromosome inactivation relies
esis, SCL (also called TAL1), Snai1 and Snai2. Using on the expression of a long ncRNA named Xist, which is thought
heterologous transcription assays we demonstrated to recruit, in a cis-specific manner, protein complexes establish-
a requirement for the ncRNAs in activation of gene ing repressive epigenetic marks that encompass the chromo-
some (Heard and Disteche, 2006). There is also a report indi-
expression. These results reveal an unanticipated
cating that a long ncRNA expressed from the HOXC locus may
role for a class of long ncRNAs in activation of critical
affect the expression of genes in the HOXD locus which is located
regulators of development and differentiation. on a different chromosome (Rinn et al., 2007). More recently, a set
of long ncRNAs has been identified in mouse, through the anal-
ysis of the chromatin signatures (Guttman et al., 2009). There
INTRODUCTION has also been reports of divergent transcription of short RNAs
flanking transcriptional start sites of the active promoters (Core
Recent technological advances have allowed the analysis of the et al., 2008; Preker et al., 2008; Seila et al., 2008).
human and mouse transcriptomes with an unprecedented reso- In search of a function for long ncRNAs, we used the
lution. These experiments indicate that a major portion of the GENCODE annotation (Harrow et al., 2006) of the human
genome is being transcribed and that protein-coding sequences genome. To simplify our search we subtracted transcripts over-
only account for a minority of cellular transcriptional output (Ber- lapping the protein-coding genes. Moreover, we filtered out the
tone et al., 2004; Birney et al., 2007; Cheng et al., 2005; Kapranov transcripts that may correspond to promoters of protein-coding
et al., 2007). Discovery of RNA interference (RNAi) (Fire et al., genes and the transcripts that belong to known classes of
1998) in C. elegans and the identification of a new class of small ncRNAs. We identified 3019 putative long ncRNAs that display
RNAs known as microRNAs (Lee et al., 1993; Wightman et al., differential patterns of expression. Functional knockdown of
1993) led to a greater appreciation of RNA’s role in regulation multiple ncRNAs revealed their positive influence on the neigh-
of gene expression. MicroRNAs are endogenously expressed boring protein-coding genes. Furthermore, detailed functional
noncoding transcripts that silence gene expression by targeting analysis of a long ncRNA adjacent to the Snai1 locus using
specific mRNAs on the basis of sequence recognition (Carthew reporter assays demonstrated a role for this ncRNA in an RNA-
and Sontheimer, 2009). Over 1000 microRNA loci are estimated dependent potentiation of gene expression. Our studies suggest

46 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


B 1.0 Transcripts Figure 1. Identification of Novel Long
ncRNAs in Human Annotated by GENCODE
A 0.8 (A) Analysis of coding potential using Gene ID for

Cumulative frequency
ancestral repeats (AR), long ncRNAs annotated
coding potential

200 0.6 by GENCODE and protein-coding genes.


(B) Conservation of the genomic transcript
GeneID

100 sequences for AR, long ncRNAs, protein-coding


0.4 Protein-coding genes genes, and (C) of their promoters.
0
0.2 long ncRNAs (D) Expression analysis of 3,019 long ncRNA in
AR Long Protein-coding human fibroblasts, HeLa cells and primary human
AR
ncRNAs genes 0.0 keratinocytes, showing numbers for transcripts
0.0 0.2 0.4 0.6 0.8 1.0 detected in each cell line and the overlaps
C Normalized phastCons score between cell lines. All microarray experiments
have been done in four replicates. See also
1.0 Promoters D Figure S1 and Table S1 and Table S2.

0.8 Fibroblasts HeLa


Cumulative frequency

976 937
126
0.6 222
coding potential, expressed from 2286
unique loci (some loci display multiple
0.4
Protein-coding genes alternative spliced transcripts) of the
91
long ncRNAs 576 human genome (Experimental Proce-
0.2
38 dures, Table S1 available online). The
AR
0.0 average size of the noncoding transcripts
52 24
0.0 0.2 0.4 0.6 0.8 1.0
is about 800 nts with a range from 100 nts
Normalized phastCons score
Keratinocytes to 9100 nts. Interestingly, the long
690 ncRNAs display a simpler transcription
unit than that of protein-coding genes
(Figure S1A). Nearly 50% of our long
a role for a class of long ncRNAs in positive regulation of protein- ncRNAs contain a single intron in their primary transcript (Fig-
coding genes. ure S1A). Moreover, analysis of their chromatin signatures indi-
cated similarities with protein-coding genes. Transcriptionally
RESULTS active ncRNAs display histone H3K4 trimethylation at their
50 -end (Figure S1B) and histone H3K36 trimethylation in the
Noncoding RNAs Are Expressed and Respond to Cellular body of the gene (Figure S1C).
Differentiating Signals Analysis of protein coding potential of the ncRNAs using
To assign a function to uncharacterized human long ncRNAs, we GeneID (Blanco et al., 2007; Parra et al., 2000) shows ncRNAs
identified unique long noncoding transcripts using the annota- coding potential comparable to that of ancestral repeats (Lunter
tion of the human genome provided by the GENCODE (Harrow et al., 2006), supporting the HAVANA annotation of these tran-
et al., 2006) and performed by human and vertebrate analysis scripts as noncoding (Figure 1A). Moreover, comparison of
and annotation (HAVANA) group at Sanger Institute. Such ncRNAs with protein-coding genes and control sequences corre-
genomic annotation is being produced in the framework of the sponding to ancestral repeats (Lunter et al., 2006) reveals that
ENCODE project (Birney et al., 2007). At the time of our analysis, ncRNA sequence conservation is lower than that of protein-
the GENCODE annotation encompassed about one third of the coding genes, but higher than that of ancestral repeats (Figure 1B).
human genome. Such an annotation relies on the human expert A similar case is seen with the promoter regions (Figure 1C). These
curation of all available experimental data on transcriptional results are in concordance with previous observations in the
evidence, such as cloned cDNA sequences, spliced RNAs and mouse genome (Guttman et al., 2009; Ponting et al., 2009).
ESTs mapped on to the human genome. Next we used custom-made microarrays (Experimental
We focused on ncRNAs that do not overlap the protein-coding Procedures) which were designed to include an average of six
genes in order to simplify the interpretation of our functional anal- probes (nonrepetitive sequences) against each ncRNA transcript
ysis of ncRNAs. This included the subtraction of all transcripts to detect their expression. We analyzed the expression pattern
mapping to exons, introns and the antisense transcripts overlap- of ncRNAs using three different human cell lines (Figure 1D).
ping the protein-coding genes. We also excluded transcripts Overall, we detected 1167 ncRNAs expressed in at least one
within 1 kb of the first and the last exons as to avoid promoter of the three cell types and 576 transcripts common among the
and 30 -associated transcripts (Fejes-Toth et al., 2009; Kapranov three cell types (Figure 1D). We validated the expression of 16
et al., 2007), that display a complicated pattern of short tran- ncRNAs that mapped to the 1% of the human genome investi-
scripts (Core et al., 2008; Preker et al., 2008; Seila et al., 2008). gated by the original ENCODE study (Birney et al., 2007) using
Furthermore, we excluded all known noncoding transcripts quantitative polymerase chain reaction (qPCR) in three different
from our list of putative long ncRNAs. This analysis resulted in cell lines (Table S2). Furthermore, we could find evidence for
3019 ncRNAs, which are annotated by HAVANA to have no expression of 80% of our noncoding transcripts in at least one

Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc. 47


human tissue in a recent high throughput sequencing of the ncRNA-a1-7). HEK293 cells were used for these experiments
human transcriptome (Wang et al., 2008). because of the ease of functional knockdown and the detectable
To assess whether ncRNAs respond to cellular differentiating amounts of ncRNA-a1 and ECM1 in this cell line. We compared
signals, we induced the differentiation of human primary kerati- the results obtained using two siRNAs against ncRNA-a1 to data
nocytes using 12-O-tetradecanoylphobol 13-acetate (TPA). We obtained following the transfection of two control siRNAs (for the
monitored the expression of ncRNAs using custom microarrays. visual simplicity only one siRNA is shown (Figure 3A), the values
Expression of protein-coding genes was monitored using for both siRNAs can be seen in Table S4). The two siRNAs
conventional Agilent arrays containing nearly all human mRNAs. produced comparable results. We interrogated a 300 kb window
We prepared RNA from human primary keratinocytes before around the ncRNA-a1 containing six protein-coding genes using
and following treatment with TPA. As shown in Figure 2A and qPCR.
Table S3, we could detect 687 ncRNAs in keratinocytes, where Surprisingly, unlike the silencing action of long ncRNAs in
104 (or 15.1%) respond to TPA treatment by over 1.5-fold. Simi- imprinting and X-inactivation, depletion of ncRNA-a1 adjacent
larly, 21.3% of protein coding-genes display a change in expres- to ECM1 resulted in a concomitant decrease in expression of
sion of over 1.5-fold (Figure 2B). While around half of the the neighboring ECM1 gene (Figure 3A). This effect was specific,
TPA-regulated protein-coding genes increase and a similar as we did not detect any change in the other protein-coding
proportion decrease their expression following differentiation, genes surrounding ncRNA-a1 (Figure 3A). To ascertain that
70% of the TPA-regulated ncRNAs increase their expression ncRNA-a1 is not a component of the ECM1 30 untranslated
whereas only 30% show a decrease (Figures 2A and 2B). Further- region, we used primer pairs spanning the ECM1 and ncRNA-a1
more, analysis of the protein-coding genes in the 500 kb window genes. We were not able to detect a transcript comprised of the
surrounding the TPA-regulated ncRNAs indicates a significant two genes in HEK293 cells, supporting the contention that the
enrichment in genes involved in differentiation and morphogen- two transcripts are independent transcriptional units (Fig-
esis (Figure 2C). An example of such change in expression of an ure S2A). Furthermore, published ChIP experiments (Euskirchen
important gene involved in extra-cellular matrix is shown in et al., 2007) show the presence of RNA polymerase II and tri-
Figure 2D. Extracellular Matrix Protein 1 (ECM1) gene and an methyl H3K4 peaks at the transcription start site of ncRNA-a1
ncRNA adjacent to it displayed a 5 and 1.7 fold induction following in several cell lines, further attesting to an independent transcrip-
TPA treatment, respectively. (Figure 2D, upper panel). qPCR anal- tional start site for ncRNA-a1. Moreover, knocking down the
ysis shows the TPA-mediated induction of ECM1 and the ncRNA ECM1 gene did not affect the expression level of ncRNA-a1 or
as 14 and 4 fold, respectively (Figure 2D, bottom panel). Taken any of the other protein-coding genes analyzed in the locus,
together, we found that many of the GENCODE annotated tran- further supporting the independence of ECM1 transcript from
scripts are expressed in multiple cell lines and that they display that of ncRNA-a1 (Figure S2B).
gene expression responsiveness to differentiation signals. Next we analyzed ncRNA-a2 flanking the histone demethylase
JARID1B/KDAM 5B which also shows increased expression
Noncoding RNAs Display a Transcriptional following keratinocyte differentiation. These experiments were
Activator Function performed in HeLa cells as they showed detectable expression
To assess the function of our set of long ncRNAs, we reasoned of ncRNA-a2. Interestingly, while depletion of ncRNA-a2 did
that similar to long ncRNAs function at the imprinting loci, our not change JARID1B/KDAM 5B levels, the KLHL12, a gene
collection of ncRNAs may act to regulate their neighboring known for its negative regulation of the Wnt-beta catenin
genes. To test this hypothesis, we used RNA interference to pathway, on the opposite strand displayed a significant reduc-
deplete a set of ncRNAs. We initially chose ncRNAs that showed tion (Figure 3B). Although the decrease in KLHL12 was small
a differential expression following keratinocyte differentiation. (about 20%), no other protein-coding gene in the locus displayed
However, to obtain a reproducible knockdown we had to use a difference in expression (Figure 3B).
cell lines that are permissive to transfection by siRNAs. We To extend our findings and to determine whether regulation of
used five different cell lines for our analyses in which the candi- neighboring protein-coding genes is a common function of
date ncRNAs display a detectable expression (Figure 3). ncRNAs, we interrogated the ncRNA-a3 flanking the stem cell
We validated the expression of our experimental set of leukemia gene (SCL, also called TAL1). TAL1 is a basic helix-
ncRNAs and the absence of protein-coding potential using rapid loop-helix protein which serves as the master regulator of hema-
amplification of 50 and 30 complementary DNA ends (50 and 30 topoiesis (Lecuyer and Hoang, 2004). This locus contains two
RACE), PCR and in vitro translation (Figure S3). These experi- ncRNAs on different strands of DNA. We used MCF-7 cells to
ments confirmed the expression of ncRNAs and showed that assess the depletion of ncRNA-a3, since the expression of
they do not yield a product in an in vitro translation assay (Figures ncRNA-a3 and TAL1 could be readily detected in these cells.
S3A and S3B), supporting the noncoding annotation of our set of However, neither PDZK1IP1 nor ncRNA-a4 could be detected
ncRNAs. In two cases, the ncRNAs adjacent to Snai2 and TAL1 by qPCR in MCF-7 cells. Depletion of ncRNA-a3 resulted in
loci, we found evidence of a longer ncRNA transcript than that a specific and potent reduction of TAL1 expression (Figure 3C).
annotated by HAVANA (Figure S3). While depletion of ncRNA-a3 did not affect either STIL or CMPK1
We began by examining small interfering RNAs (siRNAs) genes, a significant reduction in CYP4A11 gene on the opposite
against the ncRNA next to ECM1 in order to assess its functional strand of the DNA was detected (Figure 3C).
role following its depletion (for reasons that will follow, this class We next turned our attention to ncRNA-a4 which was not ex-
of RNA is designated as noncoding RNA-activating1 through 7, pressed at a detectable level in MCF7 cells. We could reliably

48 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


A
120

Number of transcripts
15.1% Repressed
100
29.8 % Induced
104 80
60
40 70.2% 33.3%
687 20
66.7%
0
> ±1.5 > ±2

Long ncRNAs Long ncRNAs

Number of transcripts
5000
21.3% Repressed
4000
4107 Induced
3000 47.7%
2000

1000 52.3% 43.5%


19275 56.5%
0
> ±1.5 > ±2

mRNA mRNA

C
cell differentiation Protein-coding genes around
differentiallyexpressed long ncRNAs
epidermal cell differentiation
Protein-coding genes around
keratinization random positions
keratinocyte differentation
tissue development
ectoderm development
endoderm development
epidermis morphgenesis
tissue morphogenesis
0 5 10 15 20 25 30 35 40
Number of genes
4L

D
a1

TS
A-

AM
S2

nc 1

SA
RN
M

CL
R

AD

EN
EC
TA

5
0
Array quantification
Control
15
+ TPA
10

0
qPCR quantification

Figure 2. Long ncRNAs Display Responsiveness to Differentiation Signals in Human Primary Keratinocytes
(A and B) Distribution of differentially expressed transcripts (dark colors) following TPA treatment for long ncRNAs (A), and mRNAs (B). Lighter colors show total
number of transcripts, darker colors and percentage show number of differentially expressed transcripts. Bar-plots show number and fractions of transcripts
induced (red) or repressed (green) at different fold-change cut-offs.
(C) Gene onthology analysis of genes flanking the differentially expressed long ncRNAs (red) compared to genes flanking random positions (black).
(D) Graphic representation of a locus with induction of the long ncRNA ncRNA-a1 and the adjacent ECM1 gene, with expression values from microarrays (upper
panel) and qPCR quantification of transcripts (lower panel). Microarray experiments and qPCR validation are done in four replicates. Data shown are mean ± SD.
See also Figure S2 and Table S3.

detect ncRNA-a4 in Jurkat cells. While we could not efficiently (Figure 3D). Importantly, reduced levels of ncRNA-a4 resulted
knockdown ncRNA-a3 in Jurkat cells, siRNAs specific to in a consistent and significant decrease in the level of the gene
ncRNA-a4 reproducibly reduced its levels by about 50% CMPK1 which is over 150 kb downstream of ncRNA-a4

Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc. 49


PD A- a3
ZK a4
L1 1
A D

TA 1IP
4

A1

RN A-
M TSL

1
a1

PK
nc N
P4
A-

IL
2

R
AM
EC S2

CM
n c M1

1
RD

SA

CY

nc

ST
RN

CL
R

AD

EN
RP

TA
* ** * *

HEK293 control siRNA Jurkat control siRNA


ncRNA-a1 siRNA ncRNA-a4 siRNA

40 00
32 MT
50
5

F 9

a5
00 U
51

BI 92
RA 00218

B E
41 2

00 TTH
1
C6 -a

A-
B

2
OR
_ 2

3
12
D1

LORNA

CK
1

LC

RN

F6
NR71

O
HL

IP
RI

RO
PQ

nc

E2
AD
AX

KL
nc
JA

*** * N.D. ***


*

HeLa control siRNA HeLa


control siRNA
ncRNA-a2 siRNA
ncRNA-a5 siRNA
a6

C F
PD NA-a3
ZK -a4
TA IP1

B1
A-
nc 11

2
RN
1

CA
nc NA

1
A

ai
PK
P4

L1

Sn
nc

EF
IL
R
R

CM
CY

ST

* * N.D. ** * *
N.D.

MCF-7
control siRNA A549
control siRNA
ncRNA-a3 siRNA
ncRNA-a6 siRNA
100 kb

Figure 3. Stimulation of Gene Expression by Activating RNAs


The thick black line representing each gene shows the span of the genomic region including exons and introns. The targeted activating RNAs are shown in red.
Bar-plots show RNA levels as determined by qPCR.
(A) ncRNA-a1 locus in HEK293 cells.
(B) ncRNA-a2 locus in HeLa cells.
(C) ncRNA-a3 locus in MCF-7 cells.
(D) ncRNA-a4 locus in Jurkat cells.
(E) ncRNA-a5 locus in HeLa cells.
(F) ncRNA-a6 locus in A549 cells. All values are relative to GAPDH expression and relative to control siRNA transfected cells set to an average value of 1. The scale
bar represents 100 kb and applies to all figure panels. Error bars show mean ± SEM of at least three independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001
by two-tailed Student’s t test. See also Figure S3 and Table S4. The results represent at least six independent experiments. See also Figure S3 and Table S4.

(Figure 3D). We do not detect any changes in the other protein- onic development (Barrallo-Gimeno and Nieto, 2005; Savagner,
coding genes surrounding ncRNA-a4. Next we depleted 2001). Snai2 shows a significant reduction in expression when
ncRNA-a5 which is adjacent to the E2F6 gene, an important the adjacent ncRNA-a6 is depleted, an effect that is not seen
component of a polycomb-like complex (Ogawa et al., 2002). on EFCAB1, the only other protein-coding gene within 300 kb
Knockdown of ncRNA-a5 did not affect the E2F6 gene. of the ncRNA-a6 (Figure 3F). In total, we have examined 12 loci
However, depletion of ncRNA-a5 resulted in a specific reduction where we were able to efficiently knockdown the ncRNAs using
in ROCK2 expression levels in HeLa cells, which is located siRNAs (Table S5). We were able to show that in 7 cases, the
upstream of ncRNA-a5 (Figure 3E). ncRNA acts to potentiate the expression of a protein-coding
Finally, we examined the Snai1 and Snai2 loci in A549 cells gene within 300 kb of the ncRNA. It is possible that the remaining
(Figure 3F and Figure 4). The Snail family of transcription factors ncRNAs which did not display a positive effect on the neigh-
are implicated in the differentiation of epithelia cells into mesen- boring genes within the 300 kb window, exert their action over
chymal cells (epithelial-mesenchymal transition) during embry- longer distances which was not assessed in our analysis. Taken

50 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


A Figure 4. Knockdown of ncRNA-a7 Specifi-
cally Targets Snai1 Expression

9
a7
(A) As in Figure 3, the ncRNA-a7 locus is depicted

18
4

A-

VI
11

B
EM
showing effects on RNA levels for the surrounding
1

RN

E2

BP
ai
F

TM
RN

UB
genes with and without knockdown of ncRNA-a7.

CE
Sn

nc
The results represent mean ± SEM of at least six
independent experiments. **p < 0.01 by one-tailed
Student’s t test.
(B) Migration assay of A549 cells with control (right
panel) or ncRNA-a7 (left panel) siRNA transfec-
1.0 ** ** tions.
(C) Quantification of the data shown in (B).
0.5 Experiments in (B) and (C) are done in three repli-
cates and are shown as mean ± SEM. ***p <
0
0.001 by two-tailed Student’s t test. See also
A549 Figure S4 and Table S5.
control siRNA

ncRNA-a7 siRNA
100 kb in a specific reduction in Snai1 levels (Fig-
ure 4A). The expression of the four other
B protein-coding genes in this locus does
not change following the depletion of
ncRNA-a7 siRNA

ncRNA-a7. Concomitantly, knockdown


of ncRNA-a7 has a significant phenotypic
Control siRNA

Snai1 siRNA

effect in cell migration assays, reducing


the number of migrating cells to about
10% of that of the control (Figures 4B
and 4C), consistent with the phenotypic
changes following the depletion of Snai1
(Figures 4B and 4C).
C Since the knockdown of ncRNA-a7 or
Number of cells migrated

5000 Snai1 had similar consequences on


4000 cellular migration, we assessed their
3000 depletion on gene expression in A549
2000 cells using Agilent arrays. We could not
1000 *** detect the basal level of Snai1 on the
***
0 array, while Snai1 was readily detectable
NA

NA

NA

using quantitative PCR. Interestingly,


iR

siR

siR
ls

depletion of Snai1 or ncRNA-a7 resulted


1

a7
ro

ai

A-
nt

Sn

in similar changes in gene expression


RN
Co

nc

profiles (Figure 5A and Table S6). Not


only did we observe a similar trend in
together, our results indicate that a subset of ncRNAs has acti- genes that were affected upon the knockdown of either gene
vating functions and therefore we have named them ncRNA- but also a significant number of genes that were upregulated
activator (ncRNA-a) followed by a number to distinguish each were in common in both treatments (Figures 5A and 5B). Since
activating long ncRNA. Snai1 is a known transcriptional repressor, depletion of Snai1
or ncRNA-a7 should result in an upregulation of Snai1 target
ncRNA-a7 Is a Regulator of Snai1 genes. Indeed, a number of genes that were commonly upregu-
As mentioned above, Snai1 is a member of the Snail zinc-finger lated were direct targets of Snai1 (Figure 5C, upper panel) (De
family, which comprises transcription factors with diverse func- Craene et al., 2005). Depletion of either ncRNA-a7 or Snai1
tions in development and disease (Barrallo-Gimeno and Nieto, also resulted in downregulation of a set of genes with a partial
2005; Nieto, 2002). The Snail gene family is conserved among overlap between the genes downregulated following the two
species from Drosophila to human and has been shown to func- treatments (Figure 5B). Interestingly, Aurora-kinase A a gene
tion as mesodermal determinant genes (Barrallo-Gimeno and that is 6 MB down-stream of ncRNA-a7 was specifically downre-
Nieto, 2005; Nieto, 2002). Snail genes are the regulators of cell gulated following the depletion of ncRNA-a7, suggesting a long
adhesion, migration and epithelial-mesenchymal transition range effect for ncRNA-a7 (Figure 5C). Taken together, these
(EMT) (Barrallo-Gimeno and Nieto, 2005; Nieto, 2002). Analysis results indicate that while the depletion of ncRNA-a7 partially
of the ncRNA close to the Snai1 gene provided us with an oppor- mimic the gene expression profile observed following Snai1
tunity to combine our gene expression analysis with analysis of depletion, there are a number of gene expression changes
changes in cellular migration. Knockdown of ncRNA-a7 resulted resulting from the ncRNA-a7 depletion that occur independently

Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc. 51


Figure 5. Microarray Analysis of Snai1 and
ncRNA-a7 siRNA
Control siRNA

ncRNA-a7 Knockdown
Snai1 siRNA

Snai1 or ncRNA-a7 were knocked down using


siRNA in A549 cells and the isolated RNA analyzed
on microarrays in duplicate experiments.
Control siRNA (A) All genes differentially expressed (>1.5-fold or
A B Expression > 1.5 fold C 4 4 4 Snai1 siRNA
ncRNA-a7 siRNA
<0.6-fold compared to control) in either Snai1 or
Differentially expressed in Snai1 or ncRNA-a7 knock-down

ncRNA-a7 siRNA
ncRNA-a7 knockdown, or both, are shown clus-
3 3 3
Snai1 siRNA

tered in a heat map according to expression

Relative/Gapdh
profile. Numbers are log(2) transformed and color
124 135 206 2 2 2
scale is shown below the heat map.
(B) Analysis of genes showing upregulation (>1.5
1 1 1
fold) or downregulation (<0.6 fold) in both Snai1
and ncRNA-a7 knockdown. Numbers represent
0 0 0
CDH1 PKP2 PLOD2 number of genes regulated in the indicated
Expression < 0.6
condition.
ncRNA-a7 siRNA

(C and D) (C) Validation of microarray data by


Snai1 siRNA

Relative/ 1 1 1 1
qPCR and (D) analysis of the Snai1 locus
Gapdh

168 42 112
and targets of Snai1 upon overexpression of
0 0 0 0
ncRNA-a7. ncRNA-a7 was overexpressed from
Snai1 ncRNA-a7 RNF114 AURKA
Log2 a vector in A549 cells and expression of select
genes were measured by qPCR. Y-axes show
-2 +2 expression value relative to GAPDH of the indi-
cated gene. Values are normalized to those of
control siRNA transfected cells, set to 1. **p < 0.01,
9
a7

D
18
14

A-

VI

***p < 0.001 by one-tailed Student’s t test. See also


B
EM
1

RN
F1

E2

BP
ai

TM
RN

Table S6.
UB

CE
Sn

nc

Control
ncRNA-a7

2.0 2.0 200 2.0 2.0 2.0 2.0 2.0 2.0 2.0
1.5 1.5 150 1.5 1.5 1.5 1.5 1.5 1.5 1.5
1.0 1.0 100
tionally dissect the influence of the 1.0 1.0 1.0 1.0 1.0 1.0 1.0
0.5 0.5 50
ncRNA activation on the expression of 0.5 0.5 0.5 0.5 0.5 0.5 0.5
0 0 0 0 0 0 0 0 0 0 an adjacent gene, we constructed
AURKA CDH1 PKP2 PLOD2
vectors with inserts containing either
ncRNA-a3 and -a4 from a bidirectional
of changes in Snai1. Therefore, it is likely that depletion of promoter, ncRNA-a5 or ncRNA-a7, and placed them down-
ncRNA-a7 may have other effects on gene expression which stream of Firefly luciferase driven by a thymidine kinase (TK)
may be mediated through other targets in trans. promoter in a reporter vector (pGL3-TK-ncRNA-a), (Figure 6A).
To specifically address whether ncRNA-a7 may exert its We included 1–1.5 kb upstream of the ncRNA-as to contain
effects in trans, we assessed the gene expression changes in their endogenous promoters and 500 bps downstream in the
Snai1 locus as well as some of the targets that were changed reporter vector. We also produced a control vector (pGL3-
by depletion of ncRNA-a7 or Snai1 following the overexpression TK-control) in which 4 kb of DNA without transcriptional poten-
of ncRNA-a7 (Figure 5D). Overall, we did not observe changes in tial was cloned down-stream of Firefly luciferase similar to the
gene expression for any of the ncRNA-a7 targets following its ncRNA activation reporters (Figure 6B). A vector containing Re-
overexpression (Figure 5D, ncRNA-a7 was overexpressed 150 nilla luciferase was used to control for transfection efficiency.
fold). While these results suggest that ncRNA-a7 exerts its local Importantly, inclusion of either of the three ncRNA-a inserts
gene expression changes in cis, it is likely that other targets may result in an enhancement of transcription ranging from 2- to
be influenced in trans. Taken together, these experiments reveal 7-fold (Figures 6C–6E). This effect is specific as pGL3-TK-
a role for ncRNA-a in positive regulation of expression of neigh- control vector do not enhance the basal TK promoter activity
boring protein-coding genes and show that this effect is not (Figures 6C–6E). To demonstrate that the observed potentiation
specific to any one locus and may represent a general function of gene expression is mediated through the action of ncRNA-a,
for ncRNAs in mammalian cells. we knocked down the ncRNA-a in question for each reporter
construct using specific siRNAs (Figures 6C–6E). Interestingly
ncRNA Activation of Gene Expression of a Heterologous while depletion of ncRNA-a7 and ncRNA-a5 completely abol-
Reporter ished the increased transcription, depletion of ncRNA-a3
Previous studies have shown that distal activating sequences/ and/or ncRNA-a4 resulted in a partial decrease in transcrip-
enhancers can stimulate transcription when placed adjacent tional enhancement (Figures 6C–6E). These results suggest
to a heterologous promoter, a methodology widely used to vali- that while ncRNA-a play a major role in transcriptional activa-
date potential enhancers (Banerji et al., 1983, 1981; Gillies tion, other DNA elements in the cloned ncRNAa-3/4 region
et al., 1983; Heintzman et al., 2009; Kong et al., 1997). To func- may also contribute to increased transcription.

52 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


A ncRNA insert

TK promoter Firefly luciferase SV40


p(A)
pGL3-TK-ncRNA-a reporter

B
pGL3-TK
No insert
C
pGL3-TK-Control
pGL3-TK
4 kb insert with no known transcription
Control
pGL3-TK-control

**
siRNA
pGL3-TK-ncRNA-a3/4
pGL3-TK-ncRNA-a7

pGL3-TK-control
ncRNA-a3 ncRNA-a4

**
ncRNA-a7
pGL3-TK
2.7 kb insert including ncRNA-a3 and ncRNA-a4 siRNA

pGL3-TK-ncRNA-a5 pGL3-TK-ncRNA-a7

0 1 2 3
FL/RL
(normalized units)
ncRNA-a5
4 kb insert including ncRNA-a5 E
pGL3-TK-ncRNA-a7 pGL3-TK
Control

***
pGL3-TK-Control siRNA

ncRNA-a7 pGL3-TK-ncRNA-a3/4
2.7 kb insert including ncRNA-a7
pGL3-TK
ncRNA-a3
pGL3-TK-Control
D siRNA
pGL3-TK-ncRNA-a3/4
pGL3-TK
pGL3-TK ***
pGL3-TK-Control Control
*

siRNA pGL3-TK-Control ncRNA-a4


pGL3-TK-ncRNA-a5 siRNA
pGL3-TK-ncRNA-a3/4
pGL3-TK
pGL3-TK-ncRNA-a3/4 siRNA ncRNA-a3 and ncRNA-a4
* ncRNA-a5
pGL3-TK-Control siRNA 0 2 4 6 8
pGL3-TK-ncRNA-a5 FL/RL
(normalized units)
0 1 2
FL/RL
(normalized units)

Figure 6. ncRNA-Activators Potentiate Transcription of a Reporter Gene


(A) ncRNA-a 3/4, 5 and 7 were cloned and inserted downstream of luciferase driven by a TK-promoter in a reporter plasmid as shown.
(B) Graphical representation of the inserts in the various vectors used. The pGL3-TK-Control vector contains an insert of approximately 4 kb containing no anno-
tated evidence of transcription. The depicted inserts show exons and transcriptional direction of the ncRNA-a.
(C–E) Luciferase reporter assays. The Firefly luciferase vectors were cotransfected with a Renilla luciferase vector (pRL-TK) for transfection control. (C) The vector
containing ncRNA-a3 and ncRNA-a4 from a bidirectional promoter, with control siRNA or siRNAs toward either of the two ncRNA-a, or both. (D) Reporter with
ncRNA-5, and (E) the reporter with the ncRNA-a7 inserted downstream of luciferase. X axes show relative Firefly (FL) to Renilla (RL) luciferase activity. Cotrans-
fected siRNAs are indicated to the right of the bars. All data shown are mean ± SE from six independent experiments. *p < 0.05, **p < 0.01, ***p < 0.001 by one-
tailed Student’s t test.

Dissection of the ncRNA-a7 in a Reporter Construct (Figure 7A) in which the ncRNA-a7 sequence is reversed (pGL3-
An important property of enhancing sequences is their orienta- TK-ncRNA-a7-RV) in order to assess its orientation indepen-
tion independence (Imperiale and Nevins, 1984; Khoury and dence. The ncRNA-a7-RV construct displayed a similar tran-
Gruss, 1983; Kong et al., 1997). We designed reporter constructs scriptional enhancing activity as the construct containing the

Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc. 53


A Figure 7. RNA-Dependent Activation of a Reporter
ncRNA-a7 insert
Gene by ncNRA-a7
(A) Properties of the ncRNA-a7 containing luciferase
reporter vector. (B, C, E, and F) Luciferase reporter assays.
TK promoter Firefly luciferase SV40 Exon 2 Exon 1 The Firefly luciferase vectors were cotransfected with
p(A)
pGL3-TK-ncRNA-a7 a Renilla luciferase vector (pRL-TK) for transfection
control. (D) Semiquantitative PCR of ncRNA-a7. (B)
Reporter experiments with the ncRNA-a7 insert reversed
as indicated in the left panel. (C) The TK-promoter driving
B luciferase expression was deleted from the construct and
No insert pGL3-TK
expression values are shown relative to the pGL3-TK

***
pGL3-TK-control control plasmid as a reference. (E) Truncated reporter

***
constructs containing the ncRNA-a7 promoter and down-
pGL3-TK-ncRNA-a7
stream sequences, but not the ncRNA-a7 sequence
pGL3-TK-ncRNA-a7-RV [pGL3-TK-delta(ncRNA-a7)], or one with a poly(A) signal
in the beginning of the ncRNA-a7 to induce premature pol-
0 1 2 3 4 yadenylation [pGL3-TK-ncRNA-a7-p(A)]. See also (D) for
FL/RL analysis of expression from these plasmids. (F) Protein
(normalized units)
coding sequences were inserted in place of ncRNA-a7
downstream of the ncRNA-a7 promoter. Full-length
GTSF1L or ID1 sequences are used. X axes show relative
Firefly (FL) to Renilla (RL) luciferase activity. All data shown
D PCR are mean ± SE from six independent experiments. ***p <
C 0.001 by one-tailed Student’s t test.
ncRNA-a7
No promoter

pGL3-Basic

pGL3-Basic-ncRNA-a7
a7

a7 A)
NA
A- K-n cRN K
RN 3-T K-n L3-T

A- p(
A-

siR
-

pGL3-Basic-ncRNA-a7-RV
RN a7
K- pG L3-T pG

nc A-
+ RN

pGL3-TK
c
pG

0 10 20
a7
L

FL/RL
nc

(arbitrary units)
-T
L3
pG

E
No insert pGL3-TK
***

pGL3-TK-ncRNA-a7
***
***

pGL3-TK-delta(ncRNA-a7)

pGL3-TK-ncRNA-a7-p(A)

SV40 p(A) 0 1 2 3 4
FL/RL
(normalized units)

F
No insert pGL3-TK
***

pGL3-TK-control

pGL3-TK-ncRNA-a7
***
***

ORF pGL3-TK-GTSF1L

ORF pGL3-TK-ID1

0 1 2 3
FL/RL
(normalized units)

54 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


ncRNA-a7 insert in its endogenous orientation with respect to arising from protein-coding genes, precursors of microRNAs
the regulated gene (Figure 7B). as well as a wealth of unspliced transcripts described in multiple
To show that luciferase expression requires a promoter and studies (Guttman et al., 2009; Kapranov et al., 2007; Rinn et al.,
that ncRNA-7a cannot act as a proximal promoter, we deleted 2007).
the TK promoter from the reporter vectors. As shown in Taken together, the novelty of our work lies in the following.
Figure 7C, ncRNA-a7 cannot drive transcription of the Firefly First, we show that at multiple loci of the human genome deple-
luciferase in the absence of a proximal TK promoter. These tion of a long ncRNA leads to a specific decrease in the expres-
experiments demonstrate that sequences corresponding to sion of neighboring protein-coding genes. Previous studies
ncRNA-a7 transcription unit can function to activate expression analyzing the function of long ncRNAs in X-inactivation or the
of a heterologous promoter in an orientation-independent imprinting phenomenon point to their role in silencing of gene
manner, but cannot act as a promoter itself. expression (Mattick, 2009). Second, we show that the enhance-
To further verify that ncRNA-a7 is the active component of the ment of gene expression by ncRNAs is not cell specific as we
transcriptional enhancement, we constructed two reporters in observe the effect in five different cell lines. Third, this enhance-
which ncRNA-a7 sequences are either deleted or shortened by ment of gene expression is mediated through RNA, as depletion
placing a strong polyadenylation signal within the ncRNA- of such activating ncRNAs abrogate increased transcription of
a genomic sequence but close to the transcriptional start site, the neighboring genes. Fourth, through the use of heterologous
to induce premature polyadenylation (Figures 7D and 7E). Both reporter assays, we suggest that activating ncRNAs mediate
modifications result in loss of the increased gene expression this RNA-dependent transcriptional responsiveness in cis. Fifth,
(Figure 7E) compared to constructs where ncRNA-a7 is ex- we show that similar to classically defined distal activating
pressed. Finally, to assess whether the RNA corresponding to sequences, ncRNA-mediated activation of gene expression is
ncRNA-7a is critical for increased gene expression, we devel- orientation independent. Sixth, we present evidence that similar
oped constructs where DNA sequences corresponding to two to defined activating sequences, ncRNAs cannot drive transcrip-
different protein-coding genes were positioned in the place of tion in the absence of a proximal promoter. Finally, we demon-
ncRNA-a7 (Figure 7F), keeping the endogenous ncRNA-a7 strate that the activation of gene expression in the heterologous
promoter. Neither of these constructs displayed an increased reporter system is mediated through RNA as multiple
gene expression compared to that of the control constructs approaches depleting the RNA levels lead to abrogation of the
(Figure 7F). Taken together, these experiments demonstrate stimulatory response. Therefore, we have uncovered a new bio-
that the potentiation of gene expression is signaled by the logical function in positive regulation of gene expression for
ncRNA-a and is not merely the result of the transcription of the a class of ncRNAs in human cells.
ncRNA. There are previous reports of individual ncRNAs having a posi-
tive effect on gene expression. The 3.8 kb Evf-2 ncRNA was
DISCUSSION shown to form a complex with the homeodomain-containing
protein Dlx2 and lead to transcriptional enhancement (Feng
We used the annotation of the human genome performed by et al., 2006). Similarly, the ncRNA HSR1 (heat-shock RNA-1)
GENCODE to arrive at a collection of long ncRNAs that are ex- forms a complex with HSF1 (heat-shock transcription factor 1),
pressed from loci independent of those of protein-coding genes resulting in induction of heat-shock proteins during the cellular
or previously described nc RNAs. GENCODE annotation encom- heat-shock response (Shamovsky et al., 2006) and an isoform
passes both protein-coding and noncoding transcripts and relies of ncRNA SRA (steroid receptor RNA activator) functions to coac-
on experimental data obtained through the analysis of cDNAs, tivate steroid receptor responsiveness (Lanz et al., 1999). Our
ESTs and spliced RNAs. Our collection of 3,000 transcripts findings that activating ncRNAs positively regulate gene expres-
correspond to the manual curation of about a 1/3 of the human sion extend these previous studies and demonstrate that the acti-
genome. Analysis of the GENCODE data indicates that nearly vation of gene expression by long ncRNA may be a general func-
all of their noncoding annotated transcripts are spliced tion of a class of long ncRNAs. Moreover, whether ncRNA effects
(Figure S1A). seen in our study are mediated through association with specific
Importantly, the median distance of an ncRNA transcript to transcriptional activators is not known. However, this is a likely
a protein-coding gene is over a 100 kb making it an unlikely scenario given previous examples of an RNA-mediated respon-
scenario for the ncRNA to be an extension of protein-coding siveness. Other possibilities include a formation of an RNA-DNA
transcripts (Figures S2C and S2D). Moreover, transcriptionally hybrid at the locus of the ncRNA or the protein-coding gene which
active ncRNAs display similar chromatin modifications seen may result in enhanced binding of the sequence specific DNA
with expressed protein-coding genes (Figures S1B and S1C). binding proteins or chromatin modifying complexes.
Furthermore, the analyzed ncRNAs display RNA pol(II), p300 A recent study uncovers a set of bidirectional transcripts
and CBP occupancy at levels similar to those of the surrounding (termed eRNA) that are derived from sites in the human genome
protein coding genes, consistent with their transcriptional inde- that show occupancy by CBP, RNA polymerase II and are deco-
pendence (Figure S4). Although our analysis is focused on rated by monomethyl Histone H3 lysine 4 (H3K4) (Kim et al.,
understanding the function of a set of ncRNAs annotated by 2010). Moreover, they show that the expression of such tran-
GENCODE, the human transcriptome includes other forms of scripts is correlated with their nearest protein-coding genes.
ncRNAs with important regulatory functions that have not been There are fundamental differences between their collection of
included in our study. These include the antisense transcripts 2000 transcripts and our GENCODE set of transcripts. First,

Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc. 55


while all their eRNAs are bidirectional, only about 1% of our The precise mechanism by which our ncRNAs function to
ncRNAs show evidence of bidirectionality (see the example enhance gene expression is not known. We envision a mecha-
shown in the TAL1 locus). Second, our analysis of the histone nism by which ncRNAs by virtue of sequence or structural
modifications of a subset of ncRNAs that are expressed in lymph homology targets the neighboring protein-coding genes to bring
(Barski et al., 2007) indicates the presence of H3K4 trimethyla- about increased expression. Our experimental evidence using
tion at the transcriptional start sites and H3K36 trimethylation a heterologous promoter point to the mechanism of action for
at the body of the gene (Figures S1B and S1C). This is in stark activating ncRNAs operating in cis. However, genome-wide
contrast to eRNA loci where there is an absence of H3K4 tri- analysis following depletion of ncRNA-a7 suggested changes
methyl marks and the predominant chromatin signature is the in gene expression that may not be related to the action of
monomethyl H3K4. Third, eRNAs are reported to be predomi- ncRNA-a7 on its local environment and may be a result of wider
nantly not polyadenylated. The majority of our collection of trans-mediated effects of ncRNA-a7. Such regulatory functions
ncRNAs show evidence of polyadenylation as they were ampli- of ncRNAs could be achieved through an RNA-mediated recruit-
fied using oligo-dT-primed reactions and furthermore 41% ment of a transcriptional activator, displacement of a transcrip-
display the presence of a canonical polyadenylation site. Anal- tional repressor, recruitment of a basal transcription factor or
ysis of the protein-coding transcripts revealed that a similar a chromatin-remodeling factor. While we favor a transcriptional
proportion (52%) to that of our ncRNAs contain the canonical based mechanism for ncRNA activation, effects on RNA stability
polyadenylation sites. Finally, while we show that a set of our cannot be excluded. Taken together, the next few years will bring
ncRNAs function to enhance gene expression, there is no about new prospects for the long ncRNAs as central players in
evidence provided for eRNAs exerting a biological function. While gene expression.
we believe that eRNAs designate a different class of ncRNAs than
ncRNA-a described in our study, it is temping to speculate that EXPERIMENTAL PROCEDURES
many of the ncRNA-a and their promoters may correspond to
mammalian enhancers or polycomb/trithorax response elements Extracting Long ncRNA Data
(PRE/TREs). In such a scenario, binding of polycomb or trithorax The HAVANA annotation has been downloaded using the DAS server provided
by the Sanger institute (version July,16th 2008). We removed all annotated
proteins to proximal promoters of ncRNA-a will regulate the
biotypes or functional elements belonging to specific categories such as pseu-
expression of ncRNA-a which in turn impact the expression of dogenes or protein-coding genes. We excluded all transcripts overlapping
the protein-coding gene at the distance. with known protein coding loci annotated by HAVANA, RefSeq or UCSC. Tran-
Another set of recently published ncRNAs were termed long scripts falling into a 1 kb window of any protein-coding gene were also
intervening noncoding RNA or lincRNAs (Guttman et al., 2009). removed. Finally, we excluded all transcripts covered by known noncoding
The comparison of our ncRNAs and the lincRNAs show that RNAs such as miRNAs (miRbase version 11.0 April 2008).
To estimate the evolutionary constraints among mammalian sequences we
about 13% of the ncRNAs defined by ENCODE overlap the
constructed the cumulative distribution of PhastCons scores for ancestral
broad regions encoding a set of recently identified human repeats (ARs), RefSeq genes and long ncRNAs. The cumulative distributions
lincRNAs (Khalil et al., 2009). The overlap between our ncRNAs of these transcripts or repeats are plotted using a log-scale on the y axis.
and lincRNAs are even smaller (4%) if one considers only the
exons corresponding to lincRNAs. Importantly, the studies with Cell Culture and siRNA Transfections
lincRNAs did not reveal any transcriptional effects in neighboring Human primary keratinocytes from four different biological donors were grown
genes (Khalil et al., 2009). Therefore, it is likely that lincRNAs in Keratinocyte medium (KFSM, Invitrogen). Differentiation was induced by
describe a distinct set of ncRNAs compared to those annotated 2.5 ng/ml 12-O-tetradecanoylphorbol-13-acetate (TPA) during 48 hr.
HEK293, A549, HeLa, and MCF-7 cells were cultured in complete DMEM
by GENCODE. Similar to the diverse functions for proteins,
media (GIBCO) containing 10% FBS, and 13 Anti/Anti (GIBCO). Jurkat cells
ncRNAs such as lincRNAs may play other roles in regulating were cultured in complete RPMI media (GIBCO) containing 10% FBS and
gene expression. 13 Anti/Anti (GIBCO). Migration assays were performed as previously
The GENCODE annotation used in this study encompasses described(Gumireddy et al., 2009).
only a third of the human genome. Therefore, the number of For transfections of 293, HeLa, A549, and MCF-7 cells we used Lipofect-
ncRNAs in human cells is likely to grow and may equal or even amine 2000 (Invitrogen) according to the manufacturer’s recommendations
and an siRNA concentration of 50 nM. Jurkat cells were transfected using
surpass the number of protein-coding genes. Our considerations
HiPerFect (QIAGEN) according to the manufacturer’s recommendations and
for selection of ncRNAs excluded all ncRNAs associated with an siRNA concentration of 100 nM.
protein-coding genes and their promoters, as well as known
ncRNAs. Therefore, the repertoire of the noncoding transcripts RNA Purification, cDNA Synthesis, and Quantitative PCR
in human cells contains many more transcripts than those cata- Cells were harvested and resuspended in TRIzol (Invitrogen) and RNA ex-
loged in this study. Specifically, there have been reports of tracted according to the manufacturer’s protocol. cDNA synthesis was done
pervasive amount of antisense transcription as well as transcrip- using MultiScribe reverse transcriptase and random primers from Applied Bio-
tion mapping to promoter regions of protein-coding genes (Core systems. Quantitative PCR was done using SybrGreen reaction mix (Applied
Biosystems) and an HT7900 sequence detection system (Applied Biosys-
et al., 2008; Denoeud et al., 2007; Kapranov et al., 2007; Preker
tems). For all quantitative PCR reactions Gapdh was measured for an internal
et al., 2008; Seila et al., 2008). Whether such transcripts will have control and used to normalize the data.
biological functions similar to those described for activating
ncRNAs in our study is not known. However, it is clear that future Cloning of pGL3-TK Reporters and Luciferase Assay
genome-wide genetic analysis of ncRNAs in mammalian cells pGL3-Basic was digested with BglII and HindIII and the TK promoter from
will begin to shed light on different classes of the ncRNAs. pRL-TK was inserted into these sites. Inserts were amplified from genomic

56 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


DNA and cloned into the BamHI and SalI sites 50 to the luciferase gene. Lucif- Core, L.J., Waterfall, J.J., and Lis, J.T. (2008). Nascent RNA sequencing
erase assays were performed in 96-well white plates using Dual-Glo (Promega) reveals widespread pausing and divergent initiation at human promoters.
according to the manufacturer’s protocol. Science 322, 1845–1848.
De Craene, B., Gilbert, B., Stove, C., Bruyneel, E., van Roy, F., and Berx, G.
Microarrays (2005). The transcription factor snail induces tumor cell invasion through
Custom-made microarrays (Agilent) were designed based on the library of modulation of the epithelial cell differentiation program. Cancer Res. 65,
3019 long ncRNA sequences, with on average six probes targeting each tran- 6237–6244.
script. Human whole genome mRNA arrays were from Agilent (G4112F). Total
Denoeud, F., Kapranov, P., Ucla, C., Frankish, A., Castelo, R., Drenkow, J., La-
RNA samples were converted to cDNA using oligo-dT primers. Labeling of the
garde, J., Alioto, T., Manzano, C., Chrast, J., et al. (2007). Prominent use of
cDNA and hybridization to the microarrays were performed according to Agi-
distal 50 transcription start sites and discovery of a large number of additional
lent standard dye swap protocols. Data analysis was done using the AFM 4.0
exons in ENCODE regions. Genome Res. 17, 746–759.
software. All microarrays were done in four biological replicates.
Efroni, S., Duttagupta, R., Cheng, J., Dehghani, H., Hoeppner, D.J., Dash, C.,
Bazett-Jones, D.P., Le Grice, S., McKay, R.D., Buetow, K.H., et al. (2008).
SUPPLEMENTAL INFORMATION
Global transcription in pluripotent embryonic stem cells. Cell Stem Cell 2,
437–447.
Supplemental Information includes Extended Experimental Procedures, four
figures, and six tables and can be found with this article online at doi:10. Euskirchen, G.M., Rozowsky, J.S., Wei, C.L., Lee, W.H., Zhang, Z.D., Hart-
1016/j.cell.2010.09.001. man, S., Emanuelsson, O., Stolc, V., Weissman, S., Gerstein, M.B., et al.
(2007). Mapping of transcription factor binding regions in mammalian cells
ACKNOWLEDGMENTS by ChIP: comparison of array- and sequencing-based technologies. Genome
Res. 17, 898–909.
Thanks to the HAVANA team for use of their genome annotation. We also thank Fejes-Toth, K., Sotirova, V., Sachidanandam, R., Assaf, G., Hannon, G.J., Kap-
the CRG Genomic Facility and the Functional Genomics Core Facility at Wistar ranov, P., Foissac, S., Willingham, A.T., Duttagupta, R., Dumais, E., and Gin-
and UPenn for expertise in microarray analysis. We thank Dr. Ken Zaret for geras, T.R. (2009). Post-transcriptional processing generates a diversity of
helpful discussions. U.A.O. is supported by a grant from the Danish Research 50 -modified long and short RNAs. Nature 457, 1028–1032.
Council; M.B. is supported by an HFSPO fellowship; A.G. was supported by Feng, J., Bi, C., Clark, B.S., Mady, R., Shah, P., and Kohtz, J.D. (2006). The Evf-
a fellowship from the American Italian Cancer Foundation; R.G. was supported 2 noncoding RNA is transcribed from the Dlx-5/6 ultraconserved region and
through Spanish ministry, GENCODE U54 HG004555-01, and NIH; and R.S. functions as a Dlx-2 transcriptional coactivator. Genes Dev. 20, 1470–1484.
was supported by a grant from NIH, GM 079091.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C.
(1998). Potent and specific genetic interference by double-stranded RNA in
Received: April 23, 2010
Caenorhabditis elegans. Nature 391, 806–811.
Revised: July 1, 2010
Accepted: August 13, 2010 Gillies, S.D., Morrison, S.L., Oi, V.T., and Tonegawa, S. (1983). A tissue-
Published: September 30, 2010 specific transcription enhancer element is located in the major intron of a rear-
ranged immunoglobulin heavy chain gene. Cell 33, 717–728.
REFERENCES Gumireddy, K., Li, A., Gimotty, P.A., Klein-Szanto, A.J., Showe, L.C., Katsaros,
D., Coukos, G., Zhang, L., and Huang, Q. (2009). KLF17 is a negative regulator
Banerji, J., Olson, L., and Schaffner, W. (1983). A lymphocyte-specific cellular of epithelial-mesenchymal transition and metastasis in breast cancer. Nat. Cell
enhancer is located downstream of the joining region in immunoglobulin heavy Biol. 11, 1297–1304.
chain genes. Cell 33, 729–740. Guttman, M., Amit, I., Garber, M., French, C., Lin, M.F., Feldser, D., Huarte, M.,
Banerji, J., Rusconi, S., and Schaffner, W. (1981). Expression of a beta-globin Zuk, O., Carey, B.W., Cassady, J.P., et al. (2009). Chromatin signature reveals
gene is enhanced by remote SV40 DNA sequences. Cell 27, 299–308. over a thousand highly conserved large non-coding RNAs in mammals. Nature
Barrallo-Gimeno, A., and Nieto, M.A. (2005). The Snail genes as inducers of cell 458, 223–227.
movement and survival: implications in development and cancer. Develop- Harrow, J., Denoeud, F., Frankish, A., Reymond, A., Chen, C.K., Chrast, J.,
ment 132, 3151–3161. Lagarde, J., Gilbert, J.G., Storey, R., Swarbreck, D., et al. (2006). GENCODE:
Barski, A., Cuddapah, S., Cui, K., Roh, T.Y., Schones, D.E., Wang, Z., Wei, G., producing a reference annotation for ENCODE. Genome Biol. 7 (Suppl 1),
Chepelev, I., and Zhao, K. (2007). High-resolution profiling of histone methyl- S4 1–9.
ations in the human genome. Cell 129, 823–837. Heard, E., and Disteche, C.M. (2006). Dosage compensation in mammals:
Berezikov, E., and Plasterk, R.H. (2005). Camels and zebrafish, viruses and fine-tuning the expression of the X chromosome. Genes Dev. 20, 1848–1867.
cancer: a microRNA update. Hum. Mol. Genet 14, Spec No. 2, R183-190. Heintzman, N.D., Hon, G.C., Hawkins, R.D., Kheradpour, P., Stark, A., Harp,
Bertone, P., Stolc, V., Royce, T.E., Rozowsky, J.S., Urban, A.E., Zhu, X., Rinn, L.F., Ye, Z., Lee, L.K., Stuart, R.K., Ching, C.W., et al. (2009). Histone modifi-
J.L., Tongprasit, W., Samanta, M., Weissman, S., et al. (2004). Global identifi- cations at human enhancers reflect global cell-type-specific gene expression.
cation of human transcribed sequences with genome tiling arrays. Science Nature 459, 108–112.
306, 2242–2246. Imperiale, M.J., and Nevins, J.R. (1984). Adenovirus 5 E2 transcription unit: an
Birney, E., Stamatoyannopoulos, J.A., Dutta, A., Guigo, R., Gingeras, T.R., E1A-inducible promoter with an essential element that functions indepen-
Margulies, E.H., Weng, Z., Snyder, M., Dermitzakis, E.T., Thurman, R.E., dently of position or orientation. Mol. Cell. Biol. 4, 875–882.
et al. (2007). Identification and analysis of functional elements in 1% of the Kapranov, P., Cheng, J., Dike, S., Nix, D.A., Duttagupta, R., Willingham, A.T.,
human genome by the ENCODE pilot project. Nature 447, 799–816. Stadler, P.F., Hertel, J., Hackermuller, J., Hofacker, I.L., et al. (2007). RNA
Blanco, E., Parra, G., and Guigo, R. (2007). Using geneid to identify genes. maps reveal new RNA classes and a possible function for pervasive transcrip-
Curr. Protoc. Bioinformatics Chapter 4, Unit 4 3. tion. Science 316, 1484–1488.
Carthew, R.W., and Sontheimer, E.J. (2009). Origins and Mechanisms of miR- Khalil, A.M., Guttman, M., Huarte, M., Garber, M., Raj, A., Rivea Morales, D.,
NAs and siRNAs. Cell 136, 642–655. Thomas, K., Presser, A., Bernstein, B.E., van Oudenaarden, A., et al. (2009).
Cheng, J., Kapranov, P., Drenkow, J., Dike, S., Brubaker, S., Patel, S., Long, J., Many human large intergenic noncoding RNAs associate with chromatin-modi-
Stern, D., Tammana, H., Helt, G., et al. (2005). Transcriptional maps of 10 fying complexes and affect gene expression. Proc. Natl. Acad. Sci. U S A.
human chromosomes at 5-nucleotide resolution. Science 308, 1149–1154. Khoury, G., and Gruss, P. (1983). Enhancer elements. Cell 33, 313–314.

Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc. 57


Kim, T.K., Hemberg, M., Gray, J.M., Costa, A.M., Bear, D.M., Wu, J., Harmin, Ponting, C.P., Oliver, P.L., and Reik, W. (2009). Evolution and functions of long
D.A., Laptewicz, M., Barbara-Haley, K., Kuersten, S., et al. (2010). Widespread noncoding RNAs. Cell 136, 629–641.
transcription at neuronal activity-regulated enhancers. Nature. Preker, P., Nielsen, J., Kammler, S., Lykke-Andersen, S., Christensen, M.S.,
Kong, S., Bohl, D., Li, C., and Tuan, D. (1997). Transcription of the HS2 Mapendano, C.K., Schierup, M.H., and Jensen, T.H. (2008). RNA exosome
enhancer toward a cis-linked gene is independent of the orientation, position, depletion reveals transcription upstream of active human promoters. Science
and distance of the enhancer relative to the gene. Mol. Cell. Biol. 17, 3955– 322, 1851–1854.
3965. Rinn, J.L., Kertesz, M., Wang, J.K., Squazzo, S.L., Xu, X., Brugmann, S.A.,
Lanz, R.B., McKenna, N.J., Onate, S.A., Albrecht, U., Wong, J., Tsai, S.Y., Tsai, Goodnough, L.H., Helms, J.A., Farnham, P.J., Segal, E., and Chang, H.Y.
M.J., and O’Malley, B.W. (1999). A steroid receptor coactivator, SRA, func- (2007). Functional demarcation of active and silent chromatin domains in
tions as an RNA and is present in an SRC-1 complex. Cell 97, 17–27. human HOX loci by noncoding RNAs. Cell 129, 1311–1323.
Lecuyer, E., and Hoang, T. (2004). SCL: from the origin of hematopoiesis to Savagner, P. (2001). Leaving the neighborhood: molecular mechanisms
stem cells and leukemia. Exp. Hematol. 32, 11–24. involved during epithelial-mesenchymal transition. Bioessays 23, 912–923.
Lee, R.C., Feinbaum, R.L., and Ambros, V. (1993). The C. elegans hetero- Seila, A.C., Calabrese, J.M., Levine, S.S., Yeo, G.W., Rahl, P.B., Flynn, R.A.,
chronic gene lin-4 encodes small RNAs with antisense complementarity to Young, R.A., and Sharp, P.A. (2008). Divergent transcription from active
lin-14. Cell 75, 843–854. promoters. Science 322, 1849–1851.
Lunter, G., Ponting, C.P., and Hein, J. (2006). Genome-wide identification of Shamovsky, I., Ivannikov, M., Kandel, E.S., Gershon, D., and Nudler, E. (2006).
human functional DNA using a neutral indel model. PLoS Comput. Biol. 2, e5. RNA-mediated response to heat shock in mammalian cells. Nature 440,
Mattick, J.S. (2009). The genetic signatures of noncoding RNAs. PLoS Genet. 556–560.
5, e1000459. Wang, E.T., Sandberg, R., Luo, S., Khrebtukova, I., Zhang, L., Mayr, C., King-
Nieto, M.A. (2002). The snail superfamily of zinc-finger transcription factors. smore, S.F., Schroth, G.P., and Burge, C.B. (2008). Alternative isoform regula-
Nat. Rev. Mol. Cell Biol. 3, 155–166. tion in human tissue transcriptomes. Nature 456, 470–476.
Ogawa, H., Ishiguro, K., Gaubatz, S., Livingston, D.M., and Nakatani, Y. (2002). Wightman, B., Ha, I., and Ruvkun, G. (1993). Posttranscriptional regulation of
A complex with chromatin modifiers that occupies E2F- and Myc-responsive the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in
genes in G0 cells. Science 296, 1132–1136. C. elegans. Cell 75, 855–862.
Parra, G., Blanco, E., and Guigo, R. (2000). GeneID in Drosophila. Genome Yang, P.K., and Kuroda, M.I. (2007). Noncoding RNAs and intranuclear posi-
Res. 10, 511–515. tioning in monoallelic gene expression. Cell 128, 777–786.

58 Cell 143, 46–58, October 1, 2010 ª2010 Elsevier Inc.


Molecular Basis of RNA Polymerase III
Transcription Repression by Maf1
Alessandro Vannini,1,3 Rieke Ringel,1,3 Anselm G. Kusser,1,3 Otto Berninghausen,1 George A. Kassavetis,2
and Patrick Cramer1,*
1Gene Center and Department of Biochemistry, Center for Integrated Protein Science Munich (CIPSM), Ludwig-Maximilians-Universität

München, Feodor-Lynen-Strasse 25, 81377 Munich, Germany


2Division of Biological Sciences, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0634, USA
3These authors contributed equally to this work

*Correspondence: cramer@genzentrum.lmu.de
DOI 10.1016/j.cell.2010.09.002

SUMMARY 17 subunits (Schramm and Hernandez, 2002). Five of its


subunits, Rpb5, 6, 8, 10, and 12, are common to Pol I, II, and
RNA polymerase III (Pol III) transcribes short RNAs III. Subunits AC40 and AC19 are common to Pol I and III and
required for cell growth. Under stress conditions, are homologous to Pol II subunits Rpb3 and Rpb11, respectively.
the conserved protein Maf1 rapidly represses Pol III The two largest Pol III subunits C160 and C128 are homologous
transcription. We report the crystal structure of to Pol II subunits Rpb1 and Rpb2, respectively, and form the
Maf1 and cryo-electron microscopic structures of active center of the enzyme. Subunits C17 and C25 form
a subcomplex with homology to the Pol II subcomplex Rpb4/7
Pol III, an active Pol III-DNA-RNA complex, and
(Ferri et al., 2000; Jasiak et al., 2006; Sadhale and Woychik,
a repressive Pol III-Maf1 complex. Binding of DNA
1994), whereas subunit C11 shares homology with Pol II subunit
and RNA causes ordering of the Pol III-specific sub- Rpb9. The Pol III-specific subunits C82, C53, C37, C34, and C31
complex C82/34/31 that is required for transcription form two subcomplexes. The C53/37 subcomplex shows weak
initiation. Maf1 binds the Pol III clamp and rearranges homology to the Pol II initiation factor TFIIF and is involved in
C82/34/31 at the rim of the active center cleft. This promoter opening, elongation, termination, and reinitiation
impairs recruitment of Pol III to a complex of (Cramer et al., 2008; Carter and Drouin, 2009; Kassavetis et al.,
promoter DNA with the initiation factors Brf1 and 2010; Landrieux et al., 2006), whereas the C82/34/31 subcom-
TBP and thus prevents closed complex formation. plex is involved in promoter recognition and initiation. C34 inter-
Maf1 does however not impair binding of a DNA- acts with TFIIIB, which recruits Pol III to promoters (Thuillier et al.,
RNA scaffold and RNA synthesis. These results 1995; Wang and Roeder, 1997; Werner et al., 1993) and is
involved in open complex formation (Brun et al., 1997).
explain how Maf1 specifically represses transcrip-
To date, structural information on Pol III is limited to a cryo-elec-
tion initiation from Pol III promoters and indicate
tron microscopic (cryo-EM) map that revealed the approximate
that Maf1 also prevents reinitiation by binding Pol location of the two Pol III-specific subcomplexes (Fernández-
III during transcription elongation. Tornero et al., 2007), a homology model for the 10-subunit
core enzyme, and the crystal structure of C25/17 (Jasiak et al.,
INTRODUCTION 2006).
Rapid repression of Pol III transcription ensures cell survival
The eukaryotic genome is transcribed by the multisubunit during stress (Warner, 1999). Pol III repression is mediated by
enzymes Pol I, II, and III, which catalyze DNA-dependent Maf1, a protein that is conserved from yeast to human (Pluta
RNA synthesis. Pol III transcribes genes encoding short, et al., 2001; Upadhya et al., 2002). Maf1 represses Pol III in
untranslated RNAs, including transfer RNAs, 5S ribosomal response to DNA damage, oxidative stress, growth to
RNA (rRNA), the spliceosomal U6 small nuclear RNA (snRNA), stationary phase, treatment with rapamycin or chlorpromazine,
and the signal recognition particle 7SL RNA. Pol III genes are and blocking of the secretory pathway (Upadhya et al., 2002;
essential and involved in fundamental processes such as ribo- Willis et al., 2004). In growing yeast, Maf1 is phosphorylated
some and protein biogenesis, RNA processing, and protein and localized in the cytoplasm. Stress conditions lead to
transport. Pol III transcription is coregulated with Pol I activity, Maf1 dephosphorylation and nuclear import (Oficjalska-Pham
accounting together for up to 80% of nuclear gene transcription et al., 2006; Roberts et al., 2006), which is directed by two
in growing cells (Paule and White, 2000; Grummt, 2003; Willis nuclear localization signal (NLS) sequences (Lee et al., 2009;
et al., 2004). Pol III activity is a critical determinant of cell Moir et al., 2006). In the nucleus, Maf1 binds Pol III to prevent
growth. its interaction with TFIIIB and promoters (Desai et al., 2005;
Pol III is the most complex of the nuclear RNA polymerases. Moir et al., 2006; Roberts et al., 2006). Maf1 also binds Brf1,
It has a total molecular weight of around 700 kDa and comprises a subunit of TFIIIB that resembles the Pol II initiation factor

Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc. 59


A C160 B C
C128

C82

C53

C37/AC40
C34
C31
C25/Rpb5
C17/AC19/Rpb6
Rpb8
C11 E
Active center cleft
Pol III
Rpb10 Pol III-DNA-RNA
Rpb12 Protrusion Clamp
C53/37
C82/34/31 C82/34/31
DNA-RNA
D
Rpb9 (C11)
Front
view

Rpb4/7 Rpb4/7
Pol II X-ray Rpb5 (C25/17) (C25/17)
structure jaw
Rpb8 foot C160 foot
90°

Pol II X-ray
structure

Rpb4/7 Rpb4/7
Elongation

(C25/17) (C25/17)
Protrusion

C53/37 Top
view

DNA non-template C82/34/31 Lobe C82/34/31


DNA template
Rpb9 (C11)
RNA Rpb5 jaw
Rpb5 jaw

Figure 1. Cryo-EM Structures of Pol III and Pol III-DNA-RNA Complex


(A) SDS-PAGE of pure yeast Pol III. The identity of the 17 subunits was confirmed by mass spectrometry.
(B) EM micrographs of Pol III in negative stain (left) and vitrified ice (right). Scale bars represent 10 nm.
(C) Views of the Pol III reconstruction (first row) with corresponding raw single-particle images (second row), low pass-filtered single-particle images (third row),
class averages (forth row), and reference-free averages (fifth row).
(D) DNA-RNA scaffold used in complex formation.
(E) Cryo-EM reconstruction of Pol III (green) and Pol III-DNA-RNA complex (blue). The Pol II X-ray structure (Armache et al., 2005) was fitted to the Pol III map and is
shown as a ribbon model. White dashed lines indicate additional densities between the lobe and Rpb9 (C11), attributed to the C53/37 subcomplex, and between
the clamp and Rpb5, attributed to the C82/34/31 subcomplex, that gets ordered in the DNA-RNA complex.
See also Figures S1 and S4 and Movie S1.

TFIIB (Desai et al., 2005). Maf1-mediated repression is associ- RESULTS AND DISCUSSION
ated with reduced Brf1 and Pol III occupancy at Pol III genes
(Oficjalska-Pham et al., 2006; Roberts et al., 2006). Similar Pol III EM Structure Reveals C82/34/31 Mobility
results have been obtained with human cells, establishing We established a protocol for large-scale purification of Pol III
Maf1 as a conserved global repressor of Pol III transcription from the yeast Saccharomyces cerevisiae (Experimental
(Reina et al., 2006). Procedures). Pure Pol III samples comprised all 17 subunits
Here, we report cryo-EM structures of Pol III in its free form (Figure 1A), were monodisperse, and appeared homogeneous
and in complex with a DNA-RNA scaffold, assign the locations in EM with negative stain (Figure 1B). We collected high-quality
of Pol III subunits, present the Maf1 crystal structure, and cryo-EM data after vitrification under native conditions. A recon-
combine the resulting information with a cryo-EM structure of struction of Pol III from 20,480 single particles led to a map at
a Pol III-Maf1 complex. Together with functional studies, these 21 Å resolution (Figure 1E; Figure S1 available online; Experi-
results establish the mechanism for Pol III transcription repres- mental Procedures) that generally agrees with the previously
sion by Maf1. published map (Fernández-Tornero et al., 2007).

60 Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc.


A Protrusion
B C34
C34
C37 N-term.
Zn8
extension C31 Rpb4/7
C53/37 (C25/17)
dim. module
C53/37
dim. module

C53 N-term.
Rpb4/7 extension
(C25/17)
Top
view C37 C-term.
extension
C82 C82
Pol III-DNA-RNA Clamp
envelope Jaw C53/37

C C34 D E
C34 1 422 1 282
C53/37
Rpb4/7 C53 Dimerization C37 Dimerization
dim. module
(C25/17)
C31
C82 1 317 1 251
Zn8
C34 WH1 WH2 Zn-bdg. C31

1 654

Front C82
C82 WH1 WH2 WH3 WH4 Leu-Zipper
view
Outline view from
Pol II the C25/17 side
X-ray structure

Figure 2. Subunit Architecture of Pol III


(A) Pol III-specific subunits were placed into the cryo-EM envelope of the Pol III-DNA-RNA complex. A homology model of the C53/37 dimerization domain (green)
(Geiger et al., 2010), the human C82 homolog crystal structure (blue; S. Fribourg, personal communication), and the two C34 WH domain crystal structures
(purple) are shown as molecular surfaces. Fitted structures are shown low-pass filtered to the same resolution than the EM map. The 12 subunit Pol II X-ray struc-
ture (Armache et al., 2005) is shown as a green ribbon.
(B) Close-up views of Pol III-specific subunits fitted into the cryo-EM envelope of the Pol III-DNA-RNA complex. Terminal extensions of the C53/37 dimerization
module are highlighted in red.
(C) Location of Pol III-specific subunits on the Pol II structure. The view is related to the one in (A) by a 90 rotation around a horizontal axis.
(D) Location of subunits of the C82/34/31 subcomplex within Pol III.
(E) Domain organization of Pol III-specific subunits. Based on homology modeling (C53, C37), crystallography (C34), or HHPred and secondary structure predic-
tion (C82).
See also Figures S2 and S4 and Movie S1.

The 12-subunit Pol II crystal structure (Armache et al., 2005) Nucleic Acid Binding Restricts C82/34/31
was unambiguously fitted to the EM map (Figure 1E). After that, To see how nucleic acid binding influences the Pol III structure,
two densities remained that could not be assigned to Pol III- we determined the cryo-EM structure of a Pol III complex with
specific insertions or residues lacking from the Pol II structure, a minimal DNA-RNA scaffold (Figure 1D; Experimental Proce-
one at the polymerase lobe and one on top of the clamp dures). This complex mimics an active elongation complex
(Figure 1E). Densities at the lobe and clamp were attributed to (Brueckner et al., 2007). A reconstruction at 19 Å resolution
subcomplexes C53/37 and C82/34/31, respectively (Fernán- was obtained from 11,965 single particles (Figure 1E). The recon-
dez-Tornero et al., 2007). The density at the lobe was fitted with struction revealed density for nucleic acids in the cleft, but also
a homology model of the C53/37 dimerization module based on a structural ordering of the C82/34/31 subcomplex, giving rise
the structure of the related A49/34.5 module in Pol I (Geiger to an extended density between the top of the clamp, the
et al., 2010) (Figure 2). The location of C53/37 agrees with the Rpb5 jaw, and C25/17 (Figures 1E and 2A; Figure S2).
previously reported association of C53/37 with C11 (Chédin A continuous density between the clamp and the jaw could be
et al., 1998) and with the location of the TFIIF dimerization domain fitted with the crystal structure of the human C82 homolog
on the Pol II lobe (Chen et al., 2010; Eichner et al., 2010). The addi- (S. Fribourg, personal communication) (Figure 2). A prominent
tional density at the clamp accounts only for part of the 138 kDa density remained, forming a suspension over the cleft from the
subcomplex C82/34/31, indicating flexibility (Figure 1E). clamp to the protrusion (Figures 1E and 2A–2C). This density

Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc. 61


was assigned to subunit C34 since its two lobes fitted the struc- Maf1 Rearranges C82/34/31
tures of two winged helix (WH) domains in C34 (PDB codes 2dk5 To investigate how Maf1 binds yeast Pol III, we prepared full-
and 2dk8), and since C34 crosslinks to promoter DNA around length recombinant yeast Maf1 and a variant that lacked both
position 21 (Bartholomew et al., 1993), which is adjacent in mobile regions (residues 36–224 and 346–395) and corresponded
the homologous Pol II promoter complex model (Kostrewa to the crystallized human protein. Both variants formed a complex
et al., 2009). The remaining globular density between the clamp with Pol III that could be purified by size-exclusion chromatog-
and C25/17 (Figure 2; Figure S2) was assigned to C31 since this raphy (Figure 3D, lanes 3 and 4). Maf1 binding was specific, as
position explains the known interactions of C31 with subunits human Maf1 did not bind yeast Pol III (data not shown).
C160, C82, C34, and C17 (Chédin et al., 1998; Geiduschek Thus, the two mobile regions are not required for Pol III binding,
and Kassavetis, 2001; Schramm and Hernandez, 2002), the and the human Maf1 crystal structure is relevant for under-
requirement of the adjacent zinc site Zn8 in C160 for C82/34/ standing the Pol III-Maf1 interaction in the yeast system. We
31 binding (Werner et al., 1992), and association of C31 with collected cryo-EM data of the pure Pol III-Maf1 complex and
Pol III after dissociation of the C82/34 heterodimer (Lorenzen used 16,974 particles to obtain a reconstruction at 18.5 Å resolu-
et al., 2007). Thus, all Pol III subunits were assigned to EM densi- tion (Figure 4; Figure S3; Experimental Procedures). The structure
ties consistent with known subunit interactions. revealed a continuous density for C82/34/31, similar to the density
in the Pol III-DNA-RNA complex (Figure 4C; Figure S5).
Maf1 was assigned to a new density on top of the clamp with
Globular Structure of Maf1 the help of difference maps (Figure 4; Figure S3). The Maf1 X-ray
To elucidate Pol III repression by Maf1, we determined the Maf1 structure fitted this density well (Figures 4A and 4C; Figure S3).
structure by X-ray crystallography (Experimental Procedures). To provide additional support for the Maf1 location, we labeled
Limited proteolysis of recombinant S. cerevisiae and human the C-terminal hexahistidine tags on Maf1 and the Pol III subunit
Maf1 revealed two flexible regions, a mobile insertion and an C128 with Ni-NTA-Nanogold and located the labels by 2D cryo-
acidic C-terminal tail (Figure 3A). A human variant that lacked EM image analysis (Experimental Procedures). The locations of
both mobile regions crystallized. The structure was solved by the labels were consistent with Maf1 binding on top of the clamp
bromide phasing and refined to a free R factor of 21.2% at domain (Figure 4B). This location also agreed with published
1.55 Å resolution (Table 1). Maf1 forms a globular structure biochemical and genetic interactions of Maf1 with the N-terminal
with a central five-stranded antiparallel b sheet that is flanked region of C160, which forms most of the clamp (Boguta et al.,
by one helix on one side and three helices on the other 1997; Oficjalska-Pham et al., 2006; Reina et al., 2006)
(Figure 3B). The Maf1 fold is frequently observed, but not in (Figure 4D). Further consistent with this location, C160, C82,
proteins involved in transcription (Holm and Park, 2000; Krissinel and C34 are the key interacting partners of Maf1 in the yeast
and Henrick, 2004). The structure shows that the previously interactome (Gavin et al., 2006).
defined conserved sequence boxes A, B, and C (Desai et al., Maf1 partially overlapped with the assigned locations of the
2005; Pluta et al., 2001; Reina et al., 2006) do not correspond second WH domain in C34 and with C82 and C31 in the Pol III-
to structural modules or defined surface patches (Figure 3C). DNA-RNA complex (Figures 4C and 4E). Consistently, the C82/
Thus, functional data for Maf1 deletion variants must be re-eval- 34/31 density in the Pol III-Maf1 complex differed from that in
uated in light of the structure. The Maf1 structure is conserved the Pol III-DNA-RNA complex. Most of the density assigned to
among eukaryotes, since hydrophobic core residues are the C34 WH domains in the Pol III-DNA-RNA complex was
conserved from yeast to human (Figure 3A). absent in the Pol III-Maf1 complex, indicating a Maf1-dependent
displacement of these domains (Figure 4F; Figure S3). The densi-
ties assigned to C31 and C82 apparently shifted toward the
Regulated Maf1 Localization Rpb5 jaw (Figures 4C and 4F; Figure S3). The differences in
The Maf1 crystal structure reveals that the two NLS sequences the EM structures are visualized in a side-by-side comparison
(yeast residues 205–208 and 328–332; Moir et al., 2006) are and a movie (Figure S4; Movie S1).
surface accessible (Figure 3B). The C-terminal NLS (Ct-NLS) is
located between strands b4 and b5, and the N-terminal NLS Maf1 Impairs Closed Promoter Complex Formation
(Nt-NLS) is part of the directly adjacent mobile region To analyze how the structural changes induced by Maf1 could
(Figure 3B). The adjacent location suggests that phosphorylation repress Pol III transcription, we modeled the Pol III-Brf1-TBP
of the mobile insertion regulates nuclear localization by masking closed promoter complex. Brf1 resembles the Pol II initiation
the NLS sequences (Lee et al., 2009; Moir et al., 2006). This factor TFIIB in its N-terminal region but contains a specific
mechanism is apparently conserved from yeast to human, C-terminal extension that binds TBP (Figure S5) (Khoo et al.,
although the phosphorylation sites within the mobile insertion 1994). We combined the Pol II-TFIIB-TBP closed promoter
differ (Dephoure et al., 2008; Lee et al., 2009; Moir et al., 2006; complex model (Kostrewa et al., 2009) with the structure of
Shor et al., 2010). The Ct-NLS and adjacent residues form the TBP bound to the Brf1 C-terminal residues 437–507 (Juo et al.,
only positively charged region on Maf1 (Figure 3F). Several point 2003). Comparison of the resulting model with the EM densities
mutants that lead to defects in phosphorylation, growth on glyc- revealed that C34 was well positioned for interacting with the
erol at 37 C, or Pol III repression (Moir et al., 2006; Roberts et al., Brf1 N- and C-terminal regions (Figure 5A), consistent with
2006) are exposed around the mobile insertion (Figure 3E, resi- published data (Khoo et al., 1994, Andrau et al., 1999; Brun
dues labeled in red and pink). et al., 1997; Kassavetis et al., 2003). In the Pol III-Maf1 complex,

62 Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc.


A β1 α1 β2 mobile insertion (Nt-NLS) α3
N

{33}
{26}
{174}
A-box B-box

Ct-NLS
α4 α5 β3 β4 β5 acidic tail
C

{51}
{41}
{49}

C-box

B C C C C D
acidic 2 aa 2 aa acidic acidic C160
tail tail A-box C128
tail
C-box C82
β5 β5
β4 β4 C53
α4 α4 Sc Maf1 fl
C37/AC40
α5 α5 C34
C31

Sc X-tal Maf1
α3 α1 α1 α3 C25/Rpb5
β3 β2 180° β2 β3 B-box C17/AC19/Rpb6
Rpb8
β1 β1 N N
N C11
Rpb10
Ct-NLS Ct-NLS Rpb12
mobile insertion (Nt-NLS) mobile insertion (Nt-NLS) mobile insertion (Nt-NLS) 1 2 3 4

E E314 G316E
180°
F 180°
R280A

D248A

D258

D250A

E10A
A240R

R232H
D30N

E5A
negative positive
D298
K233A K331A Ct-NLS Ct-NLS
K329A
K261

Figure 3. Maf1 Crystal Structure


(A) Amino acid sequence alignment of Maf1 from Homo sapiens (H.s.), Schizosaccharomyces pombe (S.p.), and Saccharomyces cerevisiae (S.c.). Secondary
structure elements are indicated (cylinders, a helices; arrows, b strands). Identical and conserved residues are highlighted in green and orange, respectively.
The mobile insertion (human residues 36–82, yeast residues 36–224) includes proteolytic cleavage sites (this work), phosphorylation sites (Dephoure et al.,
2008; Lee et al., 2009; Moir et al., 2006), and the N-terminal NLS (Nt-NLS). The C-terminal NLS (Ct-NLS) is indicated. Dashed lines indicate regions absent
from the crystal structure. The crystallized protein is a human Maf1 variant comprising residues 1–35 and 83–205.
(B) Two views of a ribbon model of the Maf1 crystal structure. Secondary structure elements are labeled according to (A).
(C) Maf1 ribbon model with the conserved boxes A, B, and C highlighted in blue, purple, and rose, respectively.
(D) Purification of Pol III-Maf1 complexes. Two hundred microrams of Pol III and a 5-fold molar excess of full-length yeast Maf1 or a variant comprising residues
1–35 and 225–345 (lane 1) were incubated for 20 min at 20 C, subjected to gel filtration, and analyzed by SDS-PAGE. Lanes 2, 3, and 4 show Pol III, the Pol III
complex with the Maf1 variant, and the Pol III complex with full-length Maf1, respectively.
(E) Surface conservation of Maf1. Identical and conserved residues are highlighted in green and yellow, respectively. Mutations at residues labeled in red, pink,
and wheat show severe, mild, or no phenotypes, respectively (Dephoure et al., 2008; Moir et al., 2006; Roberts et al., 2006).
(F) Surface charge distribution of Maf1. Red, blue, and white areas indicate negative, positive, and neutral charge, respectively.

C34 adopts a different position that is apparently incompatible To test this model, we investigated by size-exclusion chroma-
with Brf1 interaction, suggesting that Maf1 impairs Pol III recruit- tography whether the Pol III-Maf1 complex can bind to
ment to Brf1-containing promoters (Figures 5A and 5B). a preassembled functional Brf1-TBP-DNA promoter complex

Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc. 63


Table 1. Maf1 X-Ray Diffraction and Refinement Statistics ation factor-independent transcription assay using a 30 -tailed
DNA template and a priming RNA dinucleotide (Bardeleben
Data Set NaBr Soak Native
et al., 1994). Consistent with the model, both complexes were
Data Collection
equally active in RNA synthesis, and an excess of Maf1 or DNA
Space group P 212121 P 212121 did not change activity (Figure 6C). We also performed RNA
Unit cell axis: 48.1, 48.3, 48.4, 48.8, extension assays using a minimal DNA-RNA scaffold (Damsma
a, b, c (Å) 80.5 79.3 and Cramer, 2009). The presence of Maf1 neither prevented
Peak Remote Inflection scaffold binding nor elongation to the end of the template, and
Wavelength (nm) 0.9196 0.9211 0.9200 0.91870 this was independent of the order of factor addition (Figure 6D).
Resolution (Å)a 26.83–1.9 26.83–1.9 26.83–1.9 25.974–1.55 To rule out that nucleic acids displace Maf1 from Pol III or
Rmerge (%)a 7.7 (50.7) 6.0 (39.2) 7.0 (51.3) 5.2 (58.9) prevent its binding, we tested by size-exclusion chromatography
I/s (I)a 22.0 (2.5) 22.7 (3.0) 22.0 (2.4) 22.3 (1.2)
whether Pol III binds Maf1 and nucleic acids simultaneously. Pol
III-Maf1 complexes with tailed template or bubble scaffold could
Completeness (%)a 99.0 (99.5) 98.8 (99.4) 98.9 (99.5) 94.3 (87.4)
be purified, independent of the order of addition (Figure 6E).
Redundancya 3.9 (4.0) 3.8 (3.9) 3.8 (4.0) 3.0 (1.9)
Thus, Maf1 prevents neither nucleic acid binding in the active
Refinement center nor RNA synthesis. The observation that Pol III can simul-
Resolution (Å) 1.55–25.97 taneously bind Maf1 and nucleic acids suggests that the
Number of reflections 26,183 increased Maf1 occupancy at Pol III genes under repressive
Rwork (%) 18.81 conditions (Geiduschek and Kassavetis, 2006; Oficjalska-
Rfree (%) 21.15 Pham et al., 2006; Roberts et al., 2006) is due to Maf1 binding
Number of atoms
to elongation complexes. Pol III in such Maf1-containing elonga-
tion complexes would be unable to reinitiate, explaining the
Protein 1313
observation that Maf1 represses multiple-round transcription
Water 142
by Pol III (Cabart et al., 2008).
B factors (Å2)
Protein 33.64
Conclusions
Water 43.95
Our results converge with published data on the mechanism of
Rmsd from ideal Pol III-specific transcription repression by Maf1. Cellular stress
Bond lengths (Å) 0.006 leads to dephosphorylation of a mobile surface region in Maf1

Bond angles ( ) 0.959 that unmasks adjacent NLS sequences, leading to nuclear
Rmerge = S jI  < I > j/S j where I is the integrated intensity of a given import of Maf1. In the nucleus, Maf1 binds free Pol III at its clamp
reflection. domain and rearranges the C82/34/31 subcomplex. This impairs
R = S kFobsj  jFcalck/S j Fobsj. Rfree was calculated with 5% of data Pol III binding to a TBP-Brf1-promoter complex and specifically
excluded from refinement. abolishes initiation from Pol III promoters, which require Brf1.
a
The highest-resolution shell is shown in parentheses. Maf1 also binds Pol III that is engaged in transcription elongation,
leaving activity intact but preventing reinitiation. Since Pol III
genes are short and elongation is fast, this leads to rapid shut-
(Kassavetis et al., 2005). We used U6 snRNA promoter DNA from down of all Pol III transcription.
position 40 to +20 relative to the transcription start site +1
(Figure 6A, closed scaffold). Whereas free Pol III stably bound
EXPERIMENTAL PROCEDURES
the Brf1-TBP-DNA complex, the Pol III-Maf1 complex did not,
even when a 5-fold molar excess was used (Figure 6B, lanes Pol III Preparation
3, 5). When we repeated the experiment with a mismatched The Saccharomyces cerevisiae strain NZ16 (Lannutti et al., 1996), carrying the
bubble region at positions –11 to +2 (Figure 6A, bubble scaffold), gene for an N-terminally His6-FLAG4-RET1-tagged C128 subunit on the parent
the same result was obtained (Figure 6E, lanes 6, 7). Further, plasmid pYE(CEN3)30 was grown to OD600 = 6–7 at 30 C in YPD media in
preassembled Pol III-Brf1-TBP-DNA complex did not bind a 200 L fermenter (Infors ABEC). Cells were lysed by bead beating in ice-
Maf1, even when a 5-fold molar excess was used (Figure 6B, cooled buffer A [200 mM Tris-HCl (pH 8.0), 500 mM (NH4)2SO4, 10 mM
MgCl2, 10% glycerol, 10 mM b-mercaptoethanol, 1 mM PMSF, 1 mM benza-
lane 4). Thus, the interactions of Pol III with Maf1 and a Brf1-
midine, 200 mM pepstatin, 60 mM leupeptin]. Subsequent steps were per-
TBP-DNA complex are mutually exclusive, showing that Maf1 formed at 4 C. Glass beads were separated by filtration, and the lysate was
impairs formation of a closed promoter complex. This is consis- cleared by centrifugation (60 min, 8000 g, Sorvall SLA-1500). A whole-cell
tent with evidence that Maf1 prevents Pol III promoter interaction extract was obtained after centrifugation at 125,000 g for 90 min (Beckman
(Desai et al., 2005; Moir et al., 2006; Roberts et al., 2006). Ti45) by separation of the clear upper-middle phase from the turbid lower
phase. The supernatant was processed by step-wise ammonium sulfate
precipitation. Thirty-five percent (NH4)2SO4 was added, and the sample was
stirred for 30 min and cleared by centrifugation (60 min, 8000 g, Sorvall
Maf1 Does Not Inhibit Pol III Activity
SLA-1500). The supernatant was precipitated over night after addition of
The above model predicts that Maf1 inhibits binding of promoter 70% (NH4)2SO4. The pellet was recovered by centrifugation (60 min, 8000 g,
DNA over the active center cleft, but not in the cleft. To test this, Sorvall SLA-1500) and resuspended in 3 liters of buffer B (40 mM HEPES
we compared pure Pol III and Pol III-Maf1 complexes in an initi- [pH 7.8], 5 mM MgCl2, 10% glycerol, 1 mM EDTA, 10 mM b-mercaptoethanol,

64 Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc.


A Protrusion B
Maf1 density
Lobe

Rpb4/7
Front view (C25/17)
(cross-
section)
C160 foot

Pol III-DNA-RNA
Pol III-Maf1

C D E
Top
view
Maf1 X-ray Maf1 X-ray C34
Pol II Maf1 X-ray
X-ray
Protrusion
Rpb4/7
(C25/17)

Layer of
cross-section
in (A)
Clamp
Clamp C82
Rpb5 Jaw domain
Lobe

70°

F G
Maf1 X-ray (background) Density for the
C34 WH domains
Protrusion Maf1 X-ray Clamp
Protrusion Maf1 X-ray

Lobe Shifted densities


in Pol III-Maf1

Rpb5 Jaw

Front Rpb5 Jaw


view

Layer of cross- Side view Front view (close-up)


section in (F)
(C128 side, cross-section)

Figure 4. Cryo-EM Structure of the Pol III-Maf1 Complex


(A) Comparison of cross-section of EM structures of the Pol III-Maf1 complex (red) and the Pol III-DNA-RNA complex (blue) reveals an additional density for Maf1.
(B) Different views of reference projections of the Pol III-Maf1 3D reconstruction (top row), corresponding Nanogold-labeled particles used for alignment (second
row), raw Nanogold-labeled particles (third row), Nanogold locations (circles) on the Pol III-Maf1 structure (forth row), and surface representations of reconstruc-
tions with the C128 N terminus and the location of Maf1 indicated by white and yellow dots, respectively (bottom row).
(C) Fit of the Maf1 X-ray structure (red surface, low-pass filtered to the resolution of the EM map) to the Pol III-Maf1 EM map (red grid). For comparison, the cryo-
EM map of the Pol III-DNA-RNA complex is shown (blue).
(D) Ribbon representation of the Pol III-Maf1 complex. The Pol II X-ray structure (Armache et al., 2005) is shown in green, and the Maf1 structure in red. The clamp
C160 residues 1–245 are yellow. The Pol III-Maf1 cryo-EM map is shown as a red mesh.
(E) Steric clash of Maf1 (red ribbon) with C34 (purple) and C82 (cyan) as observed in the Pol III-DNA-RNA complex.
(F) Comparison of cross-sections of EM structures of the Pol III-Maf1 complex (red) and the Pol III-DNA-RNA complex (blue) reveals a shift of the C82/34/31
subcomplex upon Maf1 binding.
(G) Close-up view of the region above the clamp. Parts of the C34 densities in the Pol III-DNA-RNA complex (blue) are absent in the Pol III-Maf1 complex (red).
See also Figures S3and S4 and Movie S1.

Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc. 65


A Pol III-Brf1-TBP closed
promoter complex model
90° 90°
Brf1 C-term.
&
Brf1 N-term. TBP TBP
C
Brf1 C-term.
DNA non-template C34
DNA template Rpb4/7 Brf1 N-term.
(C25/17)
DNA non-template
DNA template
Pol II X-ray Pol II X-ray

C34
Top C Side view
view (C128 side)

B Pol III-Brf1-TBP closed Maf1 initiation


Brf1 C-term.
promoter complex model repression model
(schematic outline)

TBP
Brf1 C-term.
P

Maf1 C34
TB

C34

Brf1 N-term.
Side view
Active site Active site
(C128 side)

Brf1 N-term.
Outline of Outline of
Pol III-DNA-RNA Pol III-DNA-RNA

Figure 5. Mechanism of Pol III Repression by Maf1


(A) Model of the Pol III-Brf1-TBP-DNA closed promoter complex. The Pol II structure is silver, the C34 WH domains are magenta, the Brf1 N-terminal domain is
green, the Brf1 C-terminal domain is orange, TBP is dark purple, and the closed promoter DNA is cyan/blue. The model is based on the homologous Pol II-TFIIB-
TBP-DNA closed promoter complex model (Kostrewa et al., 2009) and the Brf1-TBP-DNA structure (Juo et al., 2003).
(B) Schematic view of Maf1-dependent repression of the formation of a Pol III-Brf1-TBP-DNA closed promoter complex. Colors are as in (A).
See also Figure S5.

1 mM PMSF, 1 mM benzamidine, 200 mM pepstatin, 60 mM leupeptin). The of 50 mM (NH4)2SO4, supplemented with a 10-fold molar excess of recombi-
sample was applied to a 250 ml Biorex resin column (Biorad). Bound proteins nant full-length C53/37 heterodimer, and incubated for 60 min. The sample
were eluted with buffer C (buffer B + 500 mM KCl + 5 mM imidazole [pH 8.0]). was concentrated to 1 ml with an Amicon Ultra-4 centrifugal filter unit
The eluting proteins were loaded onto a 12 ml Ni-NTA Agarose (QIAGEN) (MWCO 10 kDA, Millipore) and applied to gel filtration chromatography on
column. Subsequent washing steps were performed with buffer C containing a Superose 6 column (Superose 6 10/300 GL, GE Healthcare) with buffer G
10 mM imidazole and buffer D [40 mM HEPES (pH 7.8), 5 mM MgCl2, 250 mM [20 mM HEPES pH 7.8, 50 mM (NH4)2SO4, 100 mM MgCl2, 10 mM ZnCl2,
(NH4)2SO4, 10% glycerol, 10 mM imidazole, 10 mM b-mercaptoethanol, 1 mM 5 mM DTT]. Pol III-containing fractions were pooled, concentrated to
PMSF, 1 mM benzamidine, 200 mM pepstatin, 60 mM leupeptin]. Proteins 1 mg/ml with an Amicon Ultra-4 centrifugal filter unit (MWCO 10 kDA, Millipore)
were eluted with buffer D containing 250 mM imidazole and loaded onto and flash frozen in liquid N2 after addition of 10% glycerol.
a HiTrap Heparin 5 ml column (GE Healthcare) and fractionated by application
of a salt gradient from 250 to 1000 mM (NH4)2SO4 with buffer E (40 mM HEPES Cryo-EM Structure Determinations
[pH 7.8], 5 mM MgCl2, 20% glycerol, 0.5 mM EDTA, 10 mM b-mercaptoetha- Purified Pol III was diluted to 0.1 mg/ml in buffer G and applied to glow-dis-
nol, 1 mM PMSF, 1 mM benzamidine, 200 mM pepstatin, 60 mM leupeptin). charged precoated carbon holey grids (Quantifoil R3/3, 2 nm carbon on top).
Pooled fractions eluting at 500 mM (NH4)2SO4 were diluted 5-fold with buffer Samples were flash frozen in liquid ethane with a semiautomated controlled-
E, loaded onto an anion exchange column (Mono Q 10/100 GL, GE Health- environment system (Vitrobot, FEI Company) at 4 C, 95% humidity, and stored
care), and fractionated with a salt gradient from 50 to 1000 mM (NH4)2SO4 in in liquid nitrogen until transfer to the microscope. Micrographs were recorded
buffer F (40 mM HEPES [pH 7.8], 1 mM MgCl2, 5 mM DTT). Pol III-containing under low dose conditions of 15 e/Å2 on a FEI Tecnai Spirit microscope
fractions eluted at 600 mM (NH4)2SO4, were pooled, diluted to a concentration operating at 120 kV, equipped with a LaB6 filament and a Gatan side entry

66 Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc.


A B D Maf1 add. pre post

B P c. + sc.
bb f1

.
f1

sc
B u Ma
+ ub Clo Ma
Sc Maf1 fl - - - + +

II- -T rf1- d s fold

f1 e s sed

le
+
Pol III - + + + +

f
Po I-B + B los sca

M B P T B c.
NTP - - + + +

P
l I af1 P C ed

Br bl
e
Po I-M TB los

-T
+15

l I rf1 P C

B
Po I-B TB

1
-
-
24 bp

24 bp

l I rf1

l I rf1
af
Po BP

Po I-B
-T

Po I I

I
I

I
I
lI
lI
f1
Br
Sc Maf1 fl
+3
+2
+1
0
1 2 3 4 5
Elongation

1 2 3 4 5 6 7
E

.
. + c.

ile f1
m
M e sc e s

a
te
86 bp

M
d
l
bb
Bu

Ta
ld
Po e sc te
fo

II 1 +

+
a

l
pl

af

l I bb

1
Bu tem

af

af
Po -Bu
M
II-

II-
d

II
bb
ile

lI

lI

lI
Po

Po
Ta
10 bp

Tailed
9 bp

template C Sc Maf1 fl

ld
Sc ld

Sc d
fo
l
fo

10 affo
1

af
1

af

af
II

af
1

M
lI
TP

Sc
af

M
Po

x
M
N

10
5x

2x

5x
DNA non-template
no

no

no

+
DNA template
RNA

Elongation Closed Bubble 1 2 3 4 5 6 7 8


scaffold scaffold scaffold Pol III Pol III-Maf1 1 2 3 4 5 6

Figure 6. Maf1 Impairs Closed Promoter Complex Formation but Not Pol III Activity
(A) Nucleic acid scaffolds.
(B) Competition assays reveal that Maf1 impairs binding of Pol III to a Brf1-TBP-DNA complex. Preassembled Pol III-Brf1-TBP-DNA or Pol III-Maf1 complexes
were incubated with a 5-fold molar excess of competing factor or complex as indicated and subjected to gel filtration, and the peak fraction was analyzed by
SDS-PAGE. In lanes 3, 4, and 6, the presence of DNA was revealed by the high A260/A280 ratio (1) compared to the A260/280 ratio (0.6) in lanes 2, 5, and 7.
(C) Factor-independent Pol III transcription assays. Preincubated Pol III-DNA (lanes 3–5) and Pol III-Maf1 complexes (lanes 6–8) efficiently transcribe the tailed
template (A). Addition of increasing amounts of Maf1 to preincubated Pol III-DNA complexes does not impair transcription (lanes 4 and 5). Increased amounts of
scaffold have no effect (lanes 6–8).
(D) RNA extension assay. The elongation scaffold (A) was efficiently transcribed to produce run-off product (+15) by Pol III upon addition of NTPs (lane 3).
Preincubation or addition of Maf1 (lanes 4 or 5, respectively) did not impair activity.
(E) Pol III can simultaneously bind Maf1 and nucleic acids. Preassembled Pol III-Maf1 and Pol III-DNA complexes were incubated with 5-fold molar excess of DNA
or Maf1, respectively, and subjected to gel filtration, and the peak fraction was analyzed by SDS-PAGE and silver staining. Staining of a Pol III-Maf1 complex
(without DNA) is identical to that in lanes 4, 5, and 6.

cryoholder. Images were acquired at underfocus values in the range of 1.5– density for a complete C25/17 complex and other additional densities ap-
4 mm on a 2k 3 2k FEI Eagle CCD camera applying a pre-exposure of peared that could be confirmed by an independent 23 Å reconstruction from
100 ms at a magnification of 90,0003, resulting in a pixel size of 3.31 Å/px 12,174 particles (data not shown). Projections of the 20,480 particle Pol III
on the object scale. Image-processing operations were carried out with reconstruction, as well as their corresponding particle averages, were
SPIDER (Frank et al., 1996). Initial particle selection was performed with compared to averages resulting from a reference-free 2D alignment method
EMAN (Ludtke et al., 1999). Reference particles were picked manually to avoid with the program refine2d (Ludtke et al., 1999). A high portion of similar aver-
discrepancies due to defocus and ice differences. Automatically selected ages showed that the alignment and refinement based on the reference struc-
particles were verified visually. Windowed particles were aligned to 83 projec- ture was not significantly biased. A cryo-EM data set of Pol III, prepared as
tions of the Pol II X-ray structure (1Y1W, Gaussian low-pass filtered to 35 Å), above, incubated with a 3-fold molar excess of DNA-RNA scaffold, was
which lacked the mobile OB and HRDC domains of Rpb4/7. Particle assign- collected, and a reconstruction at 19 Å resolution was obtained with 11,965
ment to the reference projections was evenly distributed, barring few overrep- particles. A 18.5 Å reconstruction of a size-exclusion purified Pol III-Maf1
resented outliers that were limited to prevent predominant views (Figure S1). complex (see preparation for interaction assays) was obtained from 16,974
Backprojection of the particle images with the angles from reference-based particles. The resolution of the structures could not be improved when
alignment resulted in a reconstruction that showed additional densities at 96,944 particles collected on film at 200 keV with a FEI Polara microscope
the clamp and C25/17 and was used as a reference for 20 rounds of angular were used.
refinement. Images were backprojected in real space with the refined angles.
The resulting reconstruction was Gaussian low-pass filtered to 25 Å and used Maf1 Crystal Structure Determination
as reference for another round of alignment and refinement, and this proce- DNA encoding S. cerevisiae or human Maf1 was PCR-amplified from genomic
dure was iterated until convergence. A 21 Å reconstruction of Pol III from DNA and cloned into pET-28b vector (Novagen) with the NdeI/NotI restriction
a data set of 20,480 particles was obtained. During early stage of refinement, sites, resulting in a N-terminal hexahistidine tag. E. coli BL21 (DE3) RIL cells

Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc. 67


(Stratagene) were transformed with the plasmid and grown in LB medium at tively, in buffer M for 60 min at 4 C and purified by gel filtration (Superose 6 10/
37 C to an OD600 of 0.6. Expression was induced with 0.5 mM IPTG for 300 GL, GE Healthcare) in buffer M. Purified complexes were then incubated
16 hr at 18 C. Cells were lysed by sonification in buffer H (50 mM HEPES with a 5-fold molar excess of the competing factors, incubated in buffer M for
[pH 7.8], 0.5 M NaCl, 10 mM imidazole, 5 mM MgCl2, 10 mM EDTA, 10% glyc- 60 min at 4 C, applied again to gel filtration, and analyzed by SDS-PAGE. For
erol, 10 mM b-mercaptoethanol). After centrifugation, the supernatant was the nucleic acid binding assay, size exclusion-purified complexes were
loaded onto a 3 ml Ni-NTA column (QIAGEN) equilibrated with buffer H, but analyzed by silver-stained gels. For factor-independent transcription assays,
20 mM imidazole. The column was washed with 20 column volumes (CVs) 1.5 pmol Pol III or Pol III-Maf1 complex were incubated for 30 min at 20 C
and eluted with buffer H, but 300 mM imidazole. Proteins were purified by with 2 pmol or variable amounts of a pre-annealed tailed-template scaffold
anion exchange chromatography (Mono Q, GE Healthcare). The column was (nontemplate DNA: 50 -GGCTACTATAAATAAATGTTTTTTTCGCAACTATGTGT
equilibrated with buffer I (50 mM HEPES [pH 7.8], 5 mM MgCl2, 100 mM TCGCGAAGTAACCCTTCGTGGACATTTGGTCAATTTGAAACAATACAGAGA
EDTA, 10 mM b-mercaptoethanol, 10% glycerol), and proteins were eluted TGATCAGCAGT-30 ; template DNA: 50 -ACTGCTGATCATCTCTGTATTGTTTC
with a linear gradient of 20 CVs from 10 mM to 1 M NaCl. After concentration, AAATTGACCAAATGTCCACGAAGGGTTACTTCGCGAACACATAGTTGCGAA
the sample was applied to a Superdex-75 size-exclusion column (GE Health- AAAAACATTTATTTATAGTAGCCTGCA-30 ) in the presence of 0.5 mM GpG
care) equilibrated with buffer L (25 mM HEPES [pH 7.0], 25 mM NaCl, 5 mM RNA primer. Complexes were incubated for 30 min at 20 C in the presence
DTT) for crystallization experiments or buffer M [50 mM HEPES (pH 7.8), of 0.3 mM ATP, GTP, CTP, NS [a-32P]UTP in 20 ml reaction mixtures containing
40 mM (NH4)2SO4, 100 mM MgCl2, 10 mM ZnCl2, 5 mM DTT] for binding exper- 40 mM Tris-HCl (pH 8.0), 60 mM NaCl, 7 mM MgCl2, 7% glycerol, 5 mM DTT.
iments. For partial proteolysis, 100 ml purified Maf1 at 1 mg/ml were mixed with Reactions were stopped by addition of an equal volume of 23 loading buffer
1 mg trypsin or chymotrypsin. The reactions were carried out at 37 C in buffer R (8 M urea, 23 TBE) and incubation for 5 min at 95 C. RNA products were sepa-
containing 1 mM CaCl2. Aliquots of 10 ml were taken at 1, 3, 5, 10, 30, and rated by denaturing gel electrophoresis and visualized with a Typhoon 9400
60 min, and the reaction was stopped by addition of 5 3 SDS sample buffer phosphoimager (GE Healthcare). For RNA extension assays, 5 pmol of Pol III
and incubation at 95 C for 5 min. Samples were analyzed by SDS-PAGE. or Pol III preincubated (10 min at 20 C) with a 5-fold molar excess of Maf1
The N termini of digestion products were analyzed by Edman sequencing. was incubated for 30 min at 20 C with 5 pmol of a preannealed minimal nucleic
For crystallization, human Maf1 variant 1–35;83–205 was concentrated to acid scaffold (template DNA: 30 -TTACTGGTCCGGATTCATGAACTCGA-50 ;
40 mg/ml. Crystals were grown within 2 days at 20 C in hanging drops over nontemplate DNA: 50 -TAAGTACTTGAG-30 ; RNA: 50 -FAM-UGCAUUUCGAC
a reservoir solution containing 50 mM MES (pH 6.0) and 175 mM sodium CAGGC-30 ). Maf1 was added at a 5-fold molar excess, followed by incubation
oxalate. Native crystals were transferred into reservoir solution containing for 5 min at 20 C. For RNA elongation, complexes were incubated for 10 min
25% glycerol and were flash cooled in liquid nitrogen. Crystals were soaked with 1 mM NTPs at 28 C in transcription buffer (60 mM ammonium sulfate,
for 0.5–2 min in a reservoir solution containing 25% glycerol and 0.5 M NaBr 20 mM HEPES [pH 7.6], 8 mM magnesium sulfate, 10 mM zinc chloride, 10%
and flash frozen in liquid nitrogen. Diffraction data were collected at 100 K glycerol, 10 mM DTT). Reactions were stopped and RNA products were
on a PILATUS 6M detector at the Swiss Light Source (SLS), Villigen, separated and visualized as above.
Switzerland (Table 1). Three-wavelength anomalous diffraction data were
collected from a bromide-soaked crystal. Data were processed with MOSFLM
ACCESSION NUMBERS
(Leslie et al., 1986) and scaled with SCALA (Evans, 2007), and data quality was
assessed with Phenix.Xtriage (Adams et al., 2010). Program Phenix.HySS
The coordinate file and structure factors for the Maf1 crystal structure were
(Adams et al., 2010) identified six bromide sites that were used for phasing
deposited in the Protein Data BBank under accession code 3NR5. The EM
with program SOLVE (Terwilliger and Berendzen, 1999). Density modification
structures of Pol III, the Pol III-DNA-RNA complex, and the Pol III-Maf1
was carried out with RESOLVE (Terwilliger, 2003). The model was built with
complex have been deposited in the EMDB database under accession codes
COOT (Emsley and Cowtan, 2004) and refined with Phenix.Refine (Adams
EMD-1753, EMD-1754, and EMD-1755, respectively.
et al., 2010) to a free R factor of 21% (Table 1).

Nanogold Labeling SUPPLEMENTAL INFORMATION


Size exclusion-purified Pol III was incubated for 60 min at 4 C in buffer N (buffer
M + 15 mM imidazole) with a 10-fold molar excess of recombinant full-length Supplemental Information includes five figures and one movie and can be
Maf1. The complex was then incubated with a 20-fold molar excess of found with this article online at doi:10.1016/j.cell.2010.09.002.
Ni-NTA-Nanogold (Nanoprobes, INC) for 30 min. The sample was concentrated
to 1 ml with an Amicon Ultra-4 centrifugal filter unit (MWCO 10 kDA, Millipore) ACKNOWLEDGMENTS
and applied to gel-filtration chromatography on a Superose 6 column (Super-
ose 6 10/300 GL, GE Healthcare) with buffer G. Fractions were pooled and We thank R. Beckmann, T. Becker, C. Ungewickel, J. Bürger, and T. Mielke for
samples prepared for cryo-EM as above. Cryo-EM data were collected as for help with E.M. We thank A. Imhof (Zentrallabor für Proteinanalytik) and T. Fröh-
free Pol III but at an underfocus range of 3–4 mm to obtain high image contrast. lich (Laboratory for Functional Genome Analysis) for mass spectrometry. We
A large portion of particles showed both His tags bound with Nanogold clusters. acknowledge the crystallization facility at the department of E. Conti at the
These were picked from the micrographs and aligned to projections of the Pol Max Planck Institute of Biochemistry, Martinsried. We thank D. Deak for help
III-Maf1 reconstruction. The strong signal of the Nanogold was dampened in with figure preparation. A.V. was supported by a European Molecular Biology
the images by manually applying a threshold to the histograms. The in-plane Organization long-term fellowship and by the European Union training
rotation parameters resulting from the alignment were applied to the original program Marie Curie (MEIF-CT-2006-040653). P.C. was supported by the
images, and the rotated images were compared to corresponding 2D surface Deutsche Forschungsgemeinschaft, the SFB646, the TR5, the Nanosystems
views with the location of Maf1 and the N terminus of C128 indicated (Figure 4). Initiative Munich, the Elitenetzwerk Bayern, and the Jung-Stiftung.
The length of the His6-tag and the 0.9 nm linker between the gold cluster and A.V. prepared Pol III complexes, A.V. and A.G.K. determined EM structures,
the nickel-NTA group of the Nanogold reagent give an expected mean vari- R.R. prepared and crystallized Maf1, R.R. and A.V. determined the Maf1
ability of 2 nm radius that was taken into account. The gold signal on the X-ray structure, R.R. and A.V. conducted functional assays, G.A.K. advised
N terminus of C128 displayed more apparent variability, which is explained on Pol III preparation, A.V., R.R., A.G.K., and P.C. wrote the manuscript, and
by the presence of four additional tandem FLAG sequences. P.C. designed and supervised research.

Interaction and Transcription Assays Received: May 3, 2010


Brf1-TBP complex was obtained as a triple fusion protein as described (Kassa- Revised: July 6, 2010
vetis et al., 2005). Pol III-Brf1-TBP-DNA and Pol III-Maf1 complexes were Accepted: August 11, 2010
preassembled with 5-fold molar excesses of Brf1-TBP-DNA and Maf1, respec- Published: September 30, 2010

68 Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc.


REFERENCES Ferri, M.L., Peyroche, G., Siaut, M., Lefebvre, O., Carles, C., Conesa, C., and
Sentenac, A. (2000). A novel subunit of yeast RNA polymerase III interacts with
Adams, P.D., Afonine, P.V., Bunkóczi, G., Chen, V.B., Davis, I.W., Echols, N., the TFIIB-related domain of TFIIIB70. Mol. Cell. Biol. 20, 488–495.
Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). Frank, J., Radermacher, M., Penczek, P., Zhu, J., Li, Y., Ladjadj, M., and Leith,
PHENIX: a comprehensive Python-based system for macromolecular struc- A. (1996). SPIDER and WEB: processing and visualization of images in 3D
ture solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221. electron microscopy and related fields. J. Struct. Biol. 116, 190–199.
Andrau, J.C., Sentenac, A., and Werner, M. (1999). Mutagenesis of yeast
Gavin, A.C., Aloy, P., Grandi, P., Krause, R., Boesche, M., Marzioch, M., Rau,
TFIIIB70 reveals C-terminal residues critical for interaction with TBP and
C., Jensen, L.J., Bastuck, S., Dümpelfeld, B., et al. (2006). Proteome survey
C34. J. Mol. Biol. 288, 511–520.
reveals modularity of the yeast cell machinery. Nature 440, 631–636.
Armache, K.J., Mitterweger, S., Meinhart, A., and Cramer, P. (2005). Structures
Geiduschek, E.P., and Kassavetis, G.A. (2001). The RNA polymerase III tran-
of complete RNA polymerase II and its subcomplex, Rpb4/7. J. Biol. Chem.
scription apparatus. J. Mol. Biol. 310, 1–26.
280, 7131–7134.
Geiduschek, E.P., and Kassavetis, G.A. (2006). Transcription: adjusting to
Bardeleben, C., Kassavetis, G.A., and Geiduschek, E.P. (1994). Encounters of
adversity by regulating RNA polymerase. Curr. Biol. 16, R849–R851.
Saccharomyces cerevisiae RNA polymerase III with its transcription factors
during RNA chain elongation. J. Mol. Biol. 235, 1193–1205. Geiger, S.R., Lorenzen, K., Schreieck, A., Hanecker, P., Kostrewa, D., Heck,
Bartholomew, B., Durkovich, D., Kassavetis, G.A., and Geiduschek, E.P. A.J.R., and Cramer, P. (2010). RNA polymerase I contains a TFIIF-related
(1993). Orientation and topography of RNA polymerase III in transcription DNA-binding subcomplex. Mol. Cell 39, 583–594.
complexes. Mol. Cell. Biol. 13, 942–952. Grummt, I. (2003). Life on a planet of its own: regulation of RNA polymerase I
Boguta, M., Czerska, K., and Zo1adek, T. (1997). Mutation in a new gene MAF1 transcription in the nucleolus. Genes Dev. 17, 1691–1702.
affects tRNA suppressor efficiency in Saccharomyces cerevisiae. Gene 185, Holm, L., and Park, J. (2000). DaliLite workbench for protein structure compar-
291–296. ison. Bioinformatics 16, 566–567.
Brueckner, F., Hennecke, U., Carell, T., and Cramer, P. (2007). CPD damage Jasiak, A.J., Armache, K.J., Martens, B., Jansen, R.P., and Cramer, P. (2006).
recognition by transcribing RNA polymerase II. Science 315, 859–862. Structural biology of RNA polymerase III: subcomplex C17/25 X-ray structure
Brun, I., Sentenac, A., and Werner, M. (1997). Dual role of the C34 subunit of and 11 subunit enzyme model. Mol. Cell 23, 71–81.
RNA polymerase III in transcription initiation. EMBO J. 16, 5730–5741. Juo, Z.S., Kassavetis, G.A., Wang, J., Geiduschek, E.P., and Sigler, P.B.
Cabart, P., Lee, J., and Willis, I.M. (2008). Facilitated recycling protects human (2003). Crystal structure of a transcription factor IIIB core interface ternary
RNA polymerase III from repression by Maf1 in vitro. J. Biol. Chem. 283, complex. Nature 422, 534–539.
36108–36117.
Kassavetis, G.A., Han, S., Naji, S., and Geiduschek, E.P. (2003). The role of
Carter, R., and Drouin, G. (2009). The evolutionary rates of eukaryotic RNA transcription initiation factor IIIB subunits in promoter opening probed by
polymerases and of their transcription factors are affected by the level photochemical cross-linking. J. Biol. Chem. 278, 17912–17917.
of concerted evolution of the genes they transcribe. Mol. Biol. Evol. 26,
Kassavetis, G.A., Soragni, E., Driscoll, R., and Geiduschek, E.P. (2005). Re-
2515–2520.
configuring the connectivity of a multiprotein complex: fusions of yeast
Chédin, S., Riva, M., Schultz, P., Sentenac, A., and Carles, C. (1998). The RNA TATA-binding protein with Brf1, and the function of transcription factor IIIB.
cleavage activity of RNA polymerase III is mediated by an essential TFIIS- Proc. Natl. Acad. Sci. USA 102, 15406–15411.
like subunit and is important for transcription termination. Genes Dev. 12,
Kassavetis, G.A., Prakash, P., and Shim, E. (2010). The C53/C37 subcomplex
3857–3871.
of RNA polymerase III lies near the active site and participates in promoter
Chen, Z.A., Jawhari, A., Fischer, L., Buchen, C., Tahir, S., Kamenski, T., Ras- opening. J. Biol. Chem. 285, 2695–2706.
mussen, M., Lariviere, L., Bukowski-Wills, J.C., Nilges, M., et al. (2010). Archi-
tecture of the RNA polymerase II-TFIIF complex revealed by cross-linking and Khoo, B., Brophy, B., and Jackson, S.P. (1994). Conserved functional domains
mass spectrometry. EMBO J. 29, 717–726. of the RNA polymerase III general transcription factor BRF. Genes Dev. 8,
2879–2890.
Cramer, P., Armache, K.J., Baumli, S., Benkert, S., Brueckner, F., Buchen, C.,
Damsma, G.E., Dengl, S., Geiger, S.R., Jasiak, A.J., et al. (2008). Structure of Kostrewa, D., Zeller, M.E., Armache, K.J., Seizl, M., Leike, K., Thomm, M., and
eukaryotic RNA polymerases. Annu. Rev. Biophys. 37, 337–352. Cramer, P. (2009). RNA polymerase II-TFIIB structure and mechanism of tran-
scription initiation. Nature 462, 323–330.
Damsma, G.E., and Cramer, P. (2009). Molecular basis of transcriptional muta-
genesis at 8-oxoguanine. J. Biol. Chem. 284, 31658–31663. Krissinel, E., and Henrick, K. (2004). Secondary-structure matching (SSM),
a new tool for fast protein structure alignment in three dimensions. Acta Crys-
Dephoure, N., Zhou, C., Villén, J., Beausoleil, S.A., Bakalarski, C.E., Elledge,
tallogr. D Biol. Crystallogr. 60, 2256–2268.
S.J., and Gygi, S.P. (2008). A quantitative atlas of mitotic phosphorylation.
Proc. Natl. Acad. Sci. USA 105, 10762–10767. Landrieux, E., Alic, N., Ducrot, C., Acker, J., Riva, M., and Carles, C. (2006).
Desai, N., Lee, J., Upadhya, R., Chu, Y., Moir, R.D., and Willis, I.M. (2005). Two A subcomplex of RNA polymerase III subunits involved in transcription termi-
steps in Maf1-dependent repression of transcription by RNA polymerase III. J. nation and reinitiation. EMBO J. 25, 118–128.
Biol. Chem. 280, 6455–6462. Lannutti, B.J., Persinger, J., and Bartholomew, B. (1996). Probing the protein-
Eichner, J., Chen, H.T., Warfield, L., and Hahn, S. (2010). Position of the DNA contacts of a yeast RNA polymerase III transcription complex in a crude
general transcription factor TFIIF within the RNA polymerase II transcription extract: solid phase synthesis of DNA photoaffinity probes containing a novel
preinitiation complex. EMBO J. 29, 706–716. photoreactive deoxycytidine analog. Biochemistry 35, 9821–9831.

Emsley, P., and Cowtan, K. (2004). Coot: model-building tools for molecular Lee, J., Moir, R.D., and Willis, I.M. (2009). Regulation of RNA polymerase III
graphics. Acta Crystallogr. D Biol. Crystallogr. 60, 2126–2132. transcription involves SCH9-dependent and SCH9-independent branches of
the target of rapamycin (TOR) pathway. J. Biol. Chem. 284, 12604–12608.
Evans, P. (2007). SCALA - Scale Together Multiple Observations of Reflec-
tions. (Cambridge: MRC Laboratory of Molecular Biology). Leslie, A.G.W., Brick, P., and Wonacott, A.T. (1986). Daresbury Lab. Inf. Quart.
Fernández-Tornero, C., Böttcher, B., Riva, M., Carles, C., Steuerwald, U., Protein Crystallogr. 18, 33–39.
Ruigrok, R.W., Sentenac, A., Müller, C.W., and Schoehn, G. (2007). Insights Lorenzen, K., Vannini, A., Cramer, P., and Heck, A.J. (2007). Structural biology
into transcription initiation and termination from the electron microscopy struc- of RNA polymerase III: mass spectrometry elucidates subcomplex architec-
ture of yeast RNA polymerase III. Mol. Cell 25, 813–823. ture. Structure 15, 1237–1245.

Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc. 69


Ludtke, S.J., Baldwin, P.R., and Chiu, W. (1999). EMAN: semiautomated soft- ylation and control of RNA polymerase III-dependent transcription in cancer
ware for high-resolution single-particle reconstructions. J. Struct. Biol. 128, cells. J. Biol. Chem. 285, 15380–15392.
82–97. Terwilliger, T.C. (2003). SOLVE and RESOLVE: automated structure solution
Moir, R.D., Lee, J., Haeusler, R.A., Desai, N., Engelke, D.R., and Willis, I.M. and density modification. Methods Enzymol. 374, 22–37.
(2006). Protein kinase A regulates RNA polymerase III transcription through
Terwilliger, T.C., and Berendzen, J. (1999). Automated MAD and MIR structure
the nuclear localization of Maf1. Proc. Natl. Acad. Sci. USA 103, 15044–15049.
solution. Acta Crystallogr. D Biol. Crystallogr. 55, 849–861.
Oficjalska-Pham, D., Harismendy, O., Smagowicz, W.J., Gonzalez de Peredo,
Thuillier, V., Stettler, S., Sentenac, A., Thuriaux, P., and Werner, M. (1995).
A., Boguta, M., Sentenac, A., and Lefebvre, O. (2006). General repression of
A mutation in the C31 subunit of Saccharomyces cerevisiae RNA polymerase
RNA polymerase III transcription is triggered by protein phosphatase type
III affects transcription initiation. EMBO J. 14, 351–359.
2A-mediated dephosphorylation of Maf1. Mol. Cell 22, 623–632.
Paule, M.R., and White, R.J. (2000). Survey and summary: transcription by Upadhya, R., Lee, J., and Willis, I.M. (2002). Maf1 is an essential mediator of
RNA polymerases I and III. Nucleic Acids Res. 28, 1283–1298. diverse signals that repress RNA polymerase III transcription. Mol. Cell 10,
1489–1494.
Pluta, K., Lefebvre, O., Martin, N.C., Smagowicz, W.J., Stanford, D.R., Ellis,
S.R., Hopper, A.K., Sentenac, A., and Boguta, M. (2001). Maf1p, a negative Wang, Z., and Roeder, R.G. (1997). Three human RNA polymerase III-specific
effector of RNA polymerase III in Saccharomyces cerevisiae. Mol. Cell. Biol. subunits form a subcomplex with a selective function in specific transcription
21, 5031–5040. initiation. Genes Dev. 11, 1315–1326.
Reina, J.H., Azzouz, T.N., and Hernandez, N. (2006). Maf1, a new player in the Warner, J.R. (1999). The economics of ribosome biosynthesis in yeast. Trends
regulation of human RNA polymerase III transcription. PLoS ONE 1, e134. Biochem. Sci. 24, 437–440.
Roberts, D.N., Wilson, B., Huff, J.T., Stewart, A.J., and Cairns, B.R. (2006). Werner, M., Hermann-Le Denmat, S., Treich, I., Sentenac, A., and Thuriaux, P.
Dephosphorylation and genome-wide association of Maf1 with Pol III-tran- (1992). Effect of mutations in a zinc-binding domain of yeast RNA poly-
scribed genes during repression. Mol. Cell 22, 633–644. merase C (III) on enzyme function and subunit association. Mol. Cell. Biol.
Sadhale, P.P., and Woychik, N.A. (1994). C25, an essential RNA polymerase III 12, 1087–1095.
subunit related to the RNA polymerase II subunit RPB7. Mol. Cell. Biol. 14, Werner, M., Chaussivert, N., Willis, I.M., and Sentenac, A. (1993). Interaction
6164–6170. between a complex of RNA polymerase III subunits and the 70-kDa compo-
Schramm, L., and Hernandez, N. (2002). Recruitment of RNA polymerase III to nent of transcription factor IIIB. J. Biol. Chem. 268, 20721–20724.
its target promoters. Genes Dev. 16, 2593–2620. Willis, I.M., Desai, N., and Upadhya, R. (2004). Signaling repression of tran-
Shor, B., Wu, J., Shakey, Q., Toral-Barza, L., Shi, C., Follettie, M., and Yu, K. scription by RNA polymerase III in yeast. Prog. Nucleic Acid Res. Mol. Biol.
(2010). Requirement of the mTOR kinase for the regulation of Maf1 phosphor- 77, 323–353.

70 Cell 143, 59–70, October 1, 2010 ª2010 Elsevier Inc.


Identification of Aneuploidy-
Tolerating Mutations
Eduardo M. Torres,1,2 Noah Dephoure,3 Amudha Panneerselvam,1 Cheryl M. Tucker,4 Charles A. Whittaker,1
Steven P. Gygi,3 Maitreya J. Dunham,5 and Angelika Amon1,2,*
1David H. Koch Institute for Integrative Cancer Research
2Howard Hughes Medical Institute
Massachusetts Institute of Technology, Cambridge, MA 02139, USA
3Department of Cell Biology, Harvard University Medical School, Boston, MA 02115, USA
4Lewis-Sigler Institute, Princeton University, Princeton, NJ 08540, USA
5Department of Genome Sciences, University of Washington, Seattle, WA 98195, USA

*Correspondence: angelika@mit.edu
DOI 10.1016/j.cell.2010.08.038

SUMMARY bearing an extra copy of one or more of almost all of the yeast
chromosomes (henceforth disomic yeast strains), display
Aneuploidy causes a proliferative disadvantage in all decreased fitness relative to wild-type cells and share traits
normal cells analyzed to date, yet this condition is that are indicative of energy and proteotoxic stress: metabolic
associated with a disease characterized by unabated alterations, increased sensitivity to conditions that interfere
proliferative potential, cancer. The mechanisms that with protein translation, folding, and turnover (Torres et al.,
allow cancer cells to tolerate the adverse effects of 2007), a cell proliferation defect (specifically a G1 delay), and
a gene expression signature known as the environmental stress
aneuploidy are not known. To probe this question,
response (Gasch et al., 2000). These shared traits are due to the
we identified aneuploid yeast strains with improved
additional gene products produced from the additional chromo-
proliferative abilities. Their molecular characteriza- somes. Primary aneuploid mouse cells exhibit similar pheno-
tion revealed strain-specific genetic alterations as types (Williams et al., 2008). On the basis of these findings, we
well as mutations shared between different aneuploid proposed that aneuploidy leads to an ‘‘aneuploidy stress
strains. Among the latter, a loss-of-function mutation response.’’ In this response, cells engage protein degradation
in the gene encoding the deubiquitinating enzyme and folding pathways in an attempt to correct protein stoichiom-
Ubp6 improves growth rates in four different aneu- etry imbalances caused by aneuploidy. This puts a significant
ploid yeast strains by attenuating the changes in burden on these protein quality-control pathways, resulting in
intracellular protein composition caused by aneu- increased sensitivity to compounds that interfere with protein
ploidy. Our results demonstrate the existence of degradation and folding. Synthesis and neutralization of the
proteins produced from the additional chromosomes also lead
aneuploidy-tolerating mutations that improve the
to an increased need for energy.
fitness of multiple different aneuploidies and highlight
The increased sensitivity of many aneuploid yeast strains to
the importance of ubiquitin-proteasomal degradation cycloheximide and proteasome inhibitors suggests that ubiqui-
in suppressing the adverse effects of aneuploidy. tin-mediated protein degradation is one of the protein quality
control pathways as being affected in aneuploid cells. During
INTRODUCTION ubiquitin-mediated protein degradation, multiple ubiquitin
molecules are covalently linked to a substrate, which allows
Aneuploidy, defined as any chromosome number that is not a recognition by the 26S proteasome (Varshavsky, 2005). Upon
multiple of the haploid complement, is associated with death recognition, ubiquitin chains are removed, and substrates are
and severe developmental abnormalities in all organisms fed into the catalytic cavity of the proteasome. Two deubiquiti-
analyzed to date (reviewed in Torres et al., 2008; Williams and nating enzymes, Rpn11 and Ubp6, remove ubiquitin from
Amon, 2009). Aneuploidy is the leading cause of miscarriages substrates (Chernova et al., 2003; Hanna et al., 2003; Verma
and mental retardation in humans and is found in 90% of human et al., 2002; Yao and Cohen, 2002). Both of these proteases
cancers (Hassold and Jacobs, 1984; Holland and Cleveland, are associated with the proteasome and are essential for ubiqui-
2009). Despite the high incidence of aneuploidy in tumors, its tin recycling. In the absence of either protein, levels of free
role in tumorigenesis remains uncertain (Holland and Cleveland, ubiquitin rapidly decline as a result of degradation of ubiquitin
2009; Schvartzman et al., 2010). chains by the proteasome. In addition to a role in ubiquitin recy-
To shed light on the relationship between aneuploidy and cling, Ubp6 regulates proteasomal degradation. In its absence,
tumorigenesis, we previously determined the effects of aneu- proteasomal degradation of several substrates is accelerated
ploidy on normal cells. Twenty strains of budding yeast, each (Hanna et al., 2006; Peth et al., 2009). The results described

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 71


A 10 Dis V C Figure 1. Evolution of Aneuploid Yeast
8
Dis VIII Strains
Doubling Time (h)

Dis XI
n = 14 n = 24 (A) Doubling times of disome V (open squares), dis-
6 WT
ome VIII (open triangles), disome XI (open circles),
4
and wild-type cultures (open diamonds) were
2 n = 19
measured at the indicated times. The arrows indi-
0
1 2 3 4 5 6 7 8 9 V cate the generation when growth rates increased.
Time (d) (B) Doubling times of wild-type cells (black bar),
B *
*
* parental disomes (red bars), and evolved isolates
*
8 * *
* VIII
(open bars) were determined in His+G418
Doubling Time (h)

* *
6
* *
* * * IX medium at room temperature (n = 3, error bars
* *
*
* * represent ± standard deviation [SD], *p value <
4
XI 0.01, Student’s t test). Nomenclature: The Roman
2 numerals describe the identity of the disomic chro-
0
mosome. The number after the dash indicates
Dis I
Dis I-9.1
Dis I-9.2
Dis II
Dis II-9.1
Dis II-9.2
Dis IV

Dis IX
Dis IX-9.1
Dis IX-9.2
Dis X
Dis X-9.1
Dis X-9.2
Dis XI
Dis XI-9.1
Dis XI-9.2
Dis XII
Dis XII-9.1
Dis XII-9.2
Dis XIII
Dis XIII-9.1
Dis XIII-9.2
Dis XIV

Dis XV

Dis XVI
Dis XVI-9.1
Dis XVI-9.2
Dis V

Dis VIII
Dis VIII-9.1
Dis VIII-9.2
WT

Dis IV-9.1
Dis IV-9.2

Dis XIV-9.1
Dis XIV-9.2

Dis XV-9.1
Dis XV-9.2
Dis V-9.1
Dis V-9.2

when the clone was isolated (after 9 or 14 days


of continuous growth), and the number after the
8 * *
*
*
XIV period describes the identity of the clone.
* * *
* *
* * * (C) Gene expression analysis of wild-type,
Doubling Time (h)

6 * * * * *
* * parental, and evolved disomic strains grown in
*
4 XVI batch culture, ordered by chromosome position.
Experiments (columns) are ordered by the number
WT
Dis V
Dis V-14.1
Dis V-14.2
Dis VIII
Dis VIII-14.1
Dis IX
Dis IX-14.1
Dis XI
Dis XI-14.1
Dis XI-14.2
Dis XIV
Dis XIV-14.1
Dis XVI
Dis XVI-14.1
Dis XVI-14.2
2
of the chromosome that is present in two copies.
0 Data were normalized to account for the extra
Dis I
Dis I-14.1
Dis I-14.2
Dis II
Dis II-14.1
Dis II-14.2
Dis IV

Dis IX
Dis IX-14.1
Dis IX-14.2
Dis X
Dis X-14.1
Dis X-14.2
Dis XI
Dis XI-14.1
Dis XI-14.2
Dis XII
Dis XII-14.1
Dis XII-14.2
Dis XIII
Dis XIII-14.1
Dis XIII-14.2
Dis XIV

Dis XV

Dis XVI
Dis XVI-14.1
Dis XVI-14.2
Dis V

Dis VIII
Dis VIII-14.1
Dis VIII-14.2
WT

Dis IV-14.1
Dis IV-14.2

Dis XIV-14.1
Dis XIV-14.2

Dis XV-14.1
Dis XV-14.2
Dis V-14.1
Dis V-14.2

chromosome present in disomic strains. Upregu-


-2.00
-1.33
-0.67
0.00
0.67
1.33
2.00

lated genes are shown in red and downregulated


ones in green.
See also Tables S1, S2, and S3 and Figures S1
and S2.

here indicate that Ubp6, through its role in protein degradation strains that proliferate well despite the presence of a disomic
control, affects the proliferative abilities of several aneuploid chromosome. To isolate variants of disomic yeast strains
yeast strains. with decreased doubling time, we used continuous growth
The consequences of system-wide aneuploidy of only a single under conditions that select for the presence of the disomic
chromosome are severe in all organisms analyzed to date chromosome rather than a traditional mutagenesis approach
(reviewed in Torres et al., 2008). In striking contrast, in most to keep the number of genetic alterations low (Experimental
cancer cells, aneuploidy is common, typically involving many Procedures).
chromosomes, but proliferation potential in these cells is high Environmental conditions such as media composition greatly
(reviewed in Albertson et al., 2003). To resolve these contradic- influence the outcome of evolution experiments (Gresham
tory observations, we hypothesized that genetic alterations et al., 2008; Zeyl, 2006). Therefore, we initially chose two sets
must exist that allow cancer cells to tolerate the adverse effects of disomic yeast strains, one that required growth in medium
of aneuploidy. To test this idea, we isolated aneuploid yeast lacking uracil and histidine (UraHis medium) to select for
strains with increased growth rates and characterized their the presence of the extra chromosome, and another that
genetic alterations. This analysis revealed strain-specific genetic required growth in medium lacking histidine and containing the
changes and mutations shared between different aneuploid antibiotic G418 (His+G418 medium). The doubling time of the
strains. We characterized further one of these shared genetic disomic yeast strains was significantly longer in His+G418
alterations, a loss-of-function allele in the gene encoding the medium than in UraHis medium (data not shown). We
deubiquitinating enzyme Ubp6. Our studies show that inactiva- suspect that this is due to G418’s ability to cause frameshifts
tion of UBP6 improves the proliferation rates of four different during translation (Davies and Davis, 1968; Davies et al., 1964).
disomic yeast strains and suggest a mechanism for this suppres- The increase in frameshifts further enhances the burden on the
sion. Deletion of UBP6 attenuates the effects of aneuploidy on protein quality-control pathways that help aneuploid cells deal
cellular protein composition. Our results demonstrate the with the proteins produced from the additional chromosomes.
existence of aneuploidy-tolerating mechanisms. Enhanced The greater difference in doubling time between wild-type
proteasomal degradation appears to be one of them. and aneuploid cells in His+G418 medium together with the
finding that some disomic strains (e.g., disome V) appeared
RESULTS to lose large parts of the additional chromosome more readily
in UraHis medium (data not shown) prompted us to perform
Isolation of Aneuploid Yeast Strains the selection for disomic strains with increased proliferative rates
with Increased Proliferative Abilities in His+G418 medium. Passaging of cells in this medium initially
To identify genetic alterations that suppress the adverse effects led to an increase in doubling times in many strains (Figure 1A;
of specific aneuploidies or perhaps even multiple different Table S1 available online). We do not yet understand the molec-
aneuploidies, we sought variants of 13 different disomic yeast ular basis for this transient slowing of cell proliferation, but we

72 Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc.


note that it is reminiscent of the crisis period observed during caused by Ty element-mediated recombination. Our results
serial passage of primary mammalian cells in culture (Todaro indicate that cells carrying an extra chromosome rapidly evolve
and Green, 1963). Populations with decreased doubling times and acquire genomic alterations. These include point mutations
emerged shortly thereafter (Table S1). (see below), truncations, amplifications, and whole-genome
We isolated single colonies after 9 days (37–66 generations; duplications.
Table S1) and 14 days (64–105 generations; Table S1).
Doubling-time measurements confirmed that 11 out of 13 Expression of the Genes Encoded by the Duplicated
disomic yeast strains had produced clones with significantly Chromosomes Is Not Attenuated in the Evolved Isolates
increased proliferation rates (Figure 1B) and changed the cell- We showed previously that the majority of genes present on the
cycle distribution to be more similar to that of wild-type cells disomic chromosome are expressed according to gene copy
(i.e., Figure S1A). We predicted that we would obtain two types number exhibiting an average increase in gene expression of
of suppressor mutations: mutations that improve the growth of approximately 1.82-fold (Torres et al., 2007). Downregulation of
disomic yeast strains only in His+G418 medium in which the gene expression of the disomic chromosome, like loss of large
cells are coping with the additive stresses of G418 and aneu- parts of the additional chromosome, could lead to increased
ploidy and are therefore more sensitive to suppressor mutations proliferation rates. Gene expression analysis of the evolved
with milder effects, and mutations that improve proliferation irre- strains that retained both copies of the disomic chromosome
spective of which medium cells are cultured in. This appeared to showed that gene expression of the chromosome present at
be the case. All evolved isolates obtained from disomes IX, XI, two copies was not attenuated even though proliferation rates
XIII, and XVI (the disomic strains whose proliferation is only mini- were increased (Figure 1C). Average expression of genes
mally affected in YEPD medium to begin with) showed fitness present on the disomic chromosome was increased an average
gain only in His+G418 medium but not in YEPD (Figure S1B). of 1.84-fold compared to the rest of the genome. Thus, attenua-
This phenomenon of genomic alterations being condition tion of gene expression of the disomic chromosome is not
specific has been observed previously (i.e., Dettman et al., responsible for the improved proliferation rates.
2007). We conclude that aneuploidy-tolerating mutations exist Our previous analysis of the disomic strains revealed a
that are growth condition specific and that improve proliferation transcription profile shared by different disomes (Torres et al.,
more generally. 2007). This aneuploidy signature was only seen under conditions
that eliminated the differences in growth rate between aneuploid
Evolved Isolates Obtained from Four Disomic Strains strains (cells were grown in the chemostat under phosphate-
Exhibit Gross Chromosomal Rearrangements limiting conditions). Gene expression analysis of the evolved
To determine the basis for the decrease in doubling time in the isolates grown under these conditions confirmed that global
evolved disomic strains, we first examined their karyotypes. gene expression patterns were maintained, with each evolved
Comparative genome hybridization (CGH) analysis revealed strain clustering most closely with its parental disomic strain
that the overall chromosomal composition was not altered in (Figure S2A). Interestingly, the gene expression patterns of
the majority of disomic strains (Table S2). Thus, the improved the two evolved disomic strains that we analyzed were more
growth rates of these isolates must be caused by alterations similar to each other than to the parental disomic strain
that are undetectable by CGH analysis. (Figure S2A). This result suggests that the genetic alterations in
Descendants of strains disomic for chromosome IV experi- the different isolates affect the same pathways and lead to a
enced loss of the entire additional chromosome and most similar transcriptional response in the evolved strains.
diplodized (Table S2). Isolates obtained from strains disomic To determine whether the evolved strains share a transcrip-
for chromosome XII, XIV, or XV had lost large parts of one tional profile that is distinct from that shared by the parental
copy of the duplicated chromosome but also carried a duplica- strains, we subtracted the original disome expression values
tion of a region of the left arm of chromosome XIII (TEL13L– from that of the evolved strains. This analysis revealed a common
YML046W; 183 kb, 345 genes; Table S2). It is highly likely that expression pattern among the evolved strains (Figure S2; Table
loss of all or part of the chromosome present in two copies is S3). Ion transport, especially iron, and a subset of ribosomal
in large part responsible for the increase in proliferation rate proteins were significantly enriched in the decreased expression
seen in the evolved strains, but we speculate that genes exist cluster (Table S3). Genes with increased expression were
in region TEL13L–YML046W, whose 2-fold increase in copy enriched for genes involved in amino acid metabolism (p value =
number improves proliferation of three different disomic yeast 9.69 3 1020). This group includes many of the genes respon-
strains. sible for biosynthesis of aromatic amino acids, branched chain
Truncations of the duplicated chromosome occurred in or next amino acids, and arginine (Table S3). The significance of this
to Ty elements, retrotransposons that are scattered throughout expression signature is at present unclear, but we speculate
the yeast genome. This correlation indicates that homologous that increased protein synthesis as a result of the presence of
recombination between these repeated elements was respon- an additional chromosome (see below) may bring about the
sible for the loss of these regions. The ends of regions need for increasing production of amino acids. Strain-specific
TEL13L–YML046W were also at or near Ty elements. Given expression changes also occurred. For example, a small group
that region TEL13L–YML046W does not carry a centromere of genes increased in expression in both isolates from disome
but is nevertheless stably inherited, it is highly likely that the IX (Figure S2B). However, these gene groupings were rarely
duplicated region TEL13L–YML046W represents a translocation enriched for particular classes of genes, although they may be

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 73


more informative when combined with knowledge of the muta- Loss of UBP6 Function Suppresses the Proliferation
tions carried by these strains. We conclude that descendants Defect of Several Disomic Yeast Strains
of disomic strains with improved growth share a gene expression We decided to test whether a causal relationship exists between
signature. mutations in UBP6 and improved proliferation rates of the
evolved strains, because sequence analysis identified prema-
Identification of Point Mutations Associated with ture stop codons in UBP6 in two different evolved disomic
Increased Proliferation Rates in Aneuploid Yeast Cells strains. Ubp6 contains an ubiquitin-like (UBL) domain in its N
Evolved aneuploid strains that proliferate faster yet have main- terminus that mediates binding to the proteasome and a pepti-
tained both copies of the disomic chromosome probably harbor dase domain in the C-terminal half of the protein (Figure 2A).
heritable alterations not detectable by CGH. We selected 14 Strain Dis V-14.1 carries a nonsense mutation resulting in the
strains in which to identify these genetic alterations because conversion of glutamic acid 256 to a stop codon (ubp6E256X;
their proliferation rates were significantly improved compared Figure 2A). Strain Dis IX-14.1 harbors an UBP6 allele that carries
to the parent strain (Figure 1B). Tiling arrays or deep sequencing a premature stop codon at position 404 (Figure 2A). Both muta-
identified 43 single-nucleotide polymorphisms (SNPs) that led to tions leave the UBL domain of the protein intact but cause
nonsynonymous changes (Table 1) and four SNPs that led to enough of a truncation to inactivate Ubp6’s protease activity.
synonymous genetic alterations that were verified by Sanger To determine whether the expression of this truncated version
sequencing (Table S4, part A). In two evolved isolates of disome of UBP6 was at least in part responsible for the decrease in
XIII, we could not detect any nonsynonymous genetic changes. generation time of strains Dis V-14.1 and Dis IX-14.1, we
A 1 base pair deletion, ten synonymous alterations, and 21 analyzed disome V cells carrying the ubp6E256X mutation.
nonsynonymous alterations were present in the parental disomic To assess the effects of this mutation on fitness, we performed
strains (Table S4, part B). We note that the mutations already a competition assay. In this assay, strains disomic for chromo-
present in the parental disomic strains were probably acquired some V carrying a GFP-PGK1 fusion integrated at URA3
during their construction and could also confer a growth were cocultured with disome V cells carrying the ubp6E256X
advantage. mutation also marked with URA3. We then monitored the
Each evolved strain contained between two and seven SNPs, fraction of GFP positive cells in the cultures over time by flow
and little overlap was detected among descendants from the cytometry. Control experiments showed that, with the exception
same parent strain (Table 1), indicating that different alterations of strains disomic for chromosome XIV, the GFP-PGK1 fusion
lead to improved proliferation in the different disomic strains. did not affect the proliferation rate of the different disomic strains
Identical point mutations were only isolated among different (data not shown).
descendants of disomes XI and XIV, indicating that a selective Disome V cells carrying the ubp6E256X mutation proliferated
sweep had not occurred in the evolution experiments. Interest- significantly better than disome V cells wild-type for UBP6
ingly, all three evolved disome XVI strains contained unique (Figure 2B; Figure S3). A truncation mutation in UBP6 was also
mutations in the poorly characterized SVF1 gene (Table 1). The identified in disome IX strains with improved proliferative
emergence of mutations in this gene in three independent abilities. In this strain too, replacement of the UBP6 locus with
isolates of disome XVI with improved growth properties the ubp6E256X allele led to an increase in fitness (Figure 2B;
suggests that inactivation or hyperactivation of this factor (we Figure S3). Remarkably, the same allele also led to an increase
do not know how the identified point mutations affect SVF1 in proliferation rates in strains disomic for chromosome VIII and
function) confers a selective advantage on strains disomic for XI (Figure 2B). The ubp6E256X allele did not improve the prolifer-
chromosome XVI. ative abilities of wild-type cells or of five other disomes (disome I,
Mutations in two genes were identified in descendants of XII, XIII, XV, XVI) that we analyzed (Figure S3) and had adverse
different disomes. Point mutations in the gene encoding the effects only in disome II and disome XIV cells (Figure 2B;
vacuolar-targeting factor Vsp64 were identified in descendants Figure S3). Deletion of UBP6 had similar effects on disomic
of disome IX and XI (Table 1). Mutations (premature stop codons) strains as expression of the UBP6 truncation. An increase in
in the gene encoding the deubiquitinating enzyme Ubp6 were fitness was observed in coculturing assays and in doubling-
identified in descendants of disome V and IX. This finding raises time measurements (Figures 2C and 2D; Figure S4; data not
the interesting possibility that mutations exist that improve shown). Analysis of cell-cycle progression of disome V and dis-
growth rates of more than one disome. ome XI cells lacking UBP6 revealed that the deletion suppresses
Genes involved in chromatin remodeling, stress response, and the G1 delay of these two disomic strains (Figure S1A). Finally,
protein folding, as well as ribosomal RNA (rRNA) processing, we found that inactivation of UBP6 led to an increase in fitness
were among those mutated in the evolved disomic strains and of strains disomic for chromosome XI, and V in YEPD medium
could contribute to the improved proliferative abilities of the but not of strains disomic for chromosome VIII or IX (Figure 2E).
evolved disomic strains. Striking, however, was the fact that We conclude that inactivation of UBP6 improves the growth
fast growing descendants of strains disomic for chromosomes rates of four different disomic strains in the presence of the
V, VIII, IX, XI, and XIV harbored mutations in genes encoding translation inhibitor and proteotoxic compound G418. In two
proteins involved in proteasomal degradation (UBP6, RPT1, disomic strains, growth improvement was also seen in the
RSP5, UBR1). These results suggest that changes in protein absence of the drug. Inactivation of UBP6 did not significantly
degradation lead to an improvement in fitness in multiple influence the growth of otherwise wild-type cells in YEPD
aneuploid yeast strains. (Figure 2E) or His+G418 (Figure 2C; Figures S3 and S4).

74 Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc.


Table 1. Nonsynonymous Genetic Changes in the Evolved Disomic Strains
Straina Gene Mutation Methodb Protein Function
Dis V-14.1 SNT1 L431R S, T Subunit of the Set3C deacetylase complex
Dis V-14.1 RAD3 (het) D148N S, T 50 to 30 DNA helicase, involved in nucleotide excision repair
Dis V-14.1 UBP6c E256X S, T Ubiquitin-specific protease
Dis V-14.1 DYN1 L526R S Cytoplasmic dynein heavy chain
Dis V-14.1 TSL1 N127D S Subunit of trehalose 6-phosphate synthase
Dis V-14.1 Chr X, 31906 C to G S, T Intergenic region
Dis V-14.1 Chr XIII, 442441 A to C S, T Intergenic region
Dis VIII-14.1 RPT1 Q281K T ATPase part of the 19S regulatory particle of the proteasome
Dis VIII-14.1 Chr V, 140399 C to G T Intergenic region
Dis IX-14.1 VPS64c Q23X T Vacuole targeting factor
Dis IX-14.1 UBP6c E404X T Ubiquitin-specific protease
Dis XI-9.1 VPS64c E103G S Vacuole targeting factor
Dis XI-9.1 SRC1 I721V S Inner nuclear membrane protein
Dis XI-9.1 Chr IX, 338123 C to T S Intergenic region
Dis XI-9.1 Chr XIII, 818616 G to T S Intergenic region
Dis XI-9.2 SAS10 G311V S Subunit of processome complex
d
Dis XI-9.2 RSP5 V591M S, T Ubiquitin-protein ligase
Dis XI-9.2 Chr IX, 183614d G to A S, T Intergenic region
Dis XI-14.1 RSP5d V591M S, T Ubiquitin-protein ligase
Dis XI-14.1 Chr IX, 183614d G to A S, T Intergenic region
Dis XIV-9.1 YGR266W D450Y S Protein of unknown function
Dis XIV-9.1 Chr VII, 827547 C to T S Intergenic region
Dis XIV-9.1 LAG2d D644E S Protein involved in determining longevity
Dis XIV-9.1 YNL234Wd D16N S Heme-binding protein involved in glucose signaling
Dis XIV-9.1 Chr XIV, 623023d C to S S Intergenic region
Dis XIV-9.2 UBR1 F951C S Ubiquitin-protein ligase
Dis XIV-9.2 DCS2 H269Y S Stress induced protein
Dis XIV-9.2 CCT7 P114R S Subunit of the chaperonin Cct ring complex
Dis XIV-9.2 Chr XIV, 148095 A to W S Intergenic region
Dis XIV-9.2 LAG2d D644E S Protein involved in determining of longevity
Dis XIV-9.2 YNL234Wd D16N S Heme-binding protein involved in glucose signaling
Dis XIV-9.2 Chr XIV, 623023d C to S S Intergenic region
Dis XIV-14.2 PRR2 E260X T Serine/threonine protein kinase
Dis XIV-14.2 BUD9 E499D T Protein involved in bud-site selection
Dis XIV-14.2 Chr XVI, 572683 C to G T Intergenic region
Dis XVI-9.1 SAS3 S689R S Histone acetyltransferase catalytic subunit of NuA3 complex
Dis XVI-9.1 SVF1e W178X S Protein with a potential role in cell survival pathways
Dis XVI-14.1 SEC31 S1116T S Essential component of the COPII coat of secretory pathway vesicles
Dis XVI-14.1 UTP10 P173S S Subunit of processome complex involved in production of 18S rRNA
Dis XVI-14.1 SVF1e A320P S Protein with a potential role in cell survival pathways
Dis XVI-14.2 GRX4 F188L S Glutathione-dependent oxidoreductase
Dis XVI-14.2 SVF1e E220X S Protein with a potential role in cell survival pathways
Dis XVI-14.2 Chr I, 71729 T to C S Intergenic region
a
9.1 and 9.2 refer to isolates 1 and 2 from day 9, respectively. 14.1 and 14.2 refer to isolates 1 and 2 from day 14, respectively.
b
S, solexa sequencing; T, tiling arrays.
c
This gene is mutated in descendants of different disomes.
d
This mutation is present in more than one isolate.
e
Three different mutations of SVF1 are present in three isolates of disome XVI.

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 75


A D E

Figure 2. Loss of UBP6 Function Increases the Fitness of Strains Disomic for Chromosome V, VIII, IX, or XI
(A) Schematic of the Ubp6 domain structure. The N terminus contains an ubiquitin-like domain (UBL, amino acids 1–83), and the C terminus harbors the ubiquitin
hydrolase domain (amino acids 83–499). The positions of the catalytic cysteine 118 and the two early stop codons at positions 256 and 404 identified in evolved
disome V-14.1 and disome IX-14.1, respectively, are shown.
(B) The percentage of cells in cocultures of strains carrying PGK1 fused to GFP (open squares) and strains harboring a C-terminal truncated version of ubp6
(E256X, closed triangles) was determined at the indicated times. All strains were grown in His+G418 medium.
(C) The percentage of cells in cocultures of strains carrying PGK1 fused to GFP (open squares) and strains harboring a UBP6 deletion (ubp6D, closed triangles)
was determined at the indicated times. All strains were grown in His+G418 medium.
(D) Doubling times of the WT, disome V, evolved disome V-14.1, and disome V ubp6D strains grown in His+G418 medium (n = 3, error bars represent ± SD).
(E) Doubling times of the WT, disome V, disome VIII, disome IX and disome XI strains either wild-type for UBP6 or carrying a UBP6 deletion grown in YEPD medium
(n = 3, error bars represent ± SD; *p value < 0.01, Student’s t test).
See also Figures S3, S4, and S5.

Next, we wished to determine the degree to which loss of Dis V-14.1 cells with that of disome V cells deleted for UBP6.
UBP6 function contributes to the increased fitness of evolved Deletion of UBP6 did not affect cell-cycle progression or
Dis V-14.1 cells. We compared the doubling times of evolved doubling time in wild-type cells (Figure S1A). However, it led to

76 Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc.


A B Figure 3. Ubiquitin Depletion Is Not
Responsible for the Aneuploidy Tolerance
Caused by Loss of UBP6 Function
(A) Wild-type, ubp6D, disome V, and disome V
ubp6D cells were grown in His+G418 medium
to an OD600 of 1.0 when 100 mg/ml cycloheximide
(time = 0 min) was added. Free ubiquitin and ubiq-
uitin conjugates were analyzed by immunoblotting
with an anti-ubiquitin antibody at the indicated
times.
(B) Ubiquitin levels in the presence (+) or absence
() of 100 mg/ml CuSO4.
(C– H) The percentage of cells in cocultures of
C D E strains carrying PGK1 fused to GFP (open
squares) and strains harboring a UBP6 deletion
(closed triangles) was determined at the indicated
times. All strains carry a CUP1-UBI4 multicopy
plasmid whose expression was induced with
100 mg/ml CuSO4. The following strains were
compared: wild-type and UBP6 deletion cells (C),
disome V PGK1-GFP and disome V ubp6D cells
(D), disome XI PGK1-GFP and disome XI ubp6D
F G H (E), wild-type and ubp6E256X truncation strains
(F), disome VIII PGK1-GFP and disome VIII
ubp6E256X cells, (G) and disome XI PGK1-GFP
and disome XI ubp6E256X cells (H). All strains
were grown in His+G418 medium.
See also Figure S6.

a significant decrease in doubling time in disome V cells (4.2 ± ments of disomic strains brought about by the inactivation of
0.2 hr compared to 5.8 ± 0.8 hr; Figure 2D), but doubling times UBP6 (Figures 3D and 3E; Figure S6A). Similar results were
were not as short as those of the evolved Dis V-14.1 strain obtained in disome VIII or XI strains harboring the ubp6E256X
(3.8 ± 0.1; Figure 2D). Conversely, restoring UBP6 function to truncation allele (Figures 3G and 3H; Figure S6B) and in compe-
the evolved Disome V-14.1 isolate reduced the proliferative tition experiments where only the UBP6 deleted strains overex-
potential of these cells (Figure S5). We conclude that loss of pressed ubiquitin (Figure S6C). Our results indicate that low
UBP6 function contributes to the increased proliferative abilities levels of ubiquitin are not responsible for the improved fitness
of Dis V-14.1 cells but other genetic alterations found in this of disomic strains lacking UBP6.
strain also contribute to the increased proliferation rates of this
isolate. Aneuploid Yeast Cells Show an Increased Reliance
on Proteasomal Degradation for Survival
Ubiquitin Depletion Is Not Responsible for the Increased Ubp6 deubiquitinates substrates at the proteasome. This activity
Proliferation Rates of Disomic Strains Lacking UBP6 serves two purposes: recycling of ubiquitin and rescue of protea-
Loss of Ubp6 function causes ubiquitin depletion. This leads to some substrates from degradation. UBP6 antagonizes the protea-
cycloheximide sensitivity that can be suppressed by overex- some not only through its deubiquitinating activity but also through
pression of ubiquitin (Hanna et al., 2003). Ubiquitin depletion a noncatalytic mechanism (Hanna et al., 2006; Peth et al., 2009).
was also observed in disome V ubp6D cells (Figure 3A). To deter- To determine whether the catalytic or noncatalytic function of
mine whether ubiquitin depletion was responsible for the Ubp6 was involved in modulating the fitness of disomic yeast
increased growth rate of disome V ubp6D cells, we examined strains, we examined the consequences of replacing the catalytic
the consequences of increased ubiquitin expression. Disome V cysteine 110 with alanine (ubp6CA). Expression of the ubp6CA
and XI cells were cocultured with disome V ubp6D and disome allele did not affect the proliferative abilities of wild-type cells
XI ubp6D cells, respectively. All strains carried a multicopy (Figure 4A; Figure S7). In contrast, coculture of disome VIII, IX,
plasmid expressing the ubiquitin-encoding gene, UBI4, under and XI cells with disomic cells carrying the ubp6CA allele showed
the control of the copper inducible CUP1 promoter. Addition of that strains harboring the catalytic dead version of the protein
100 mM CuSO4 significantly increased the steady state levels quickly outcompete disomes carrying the wild-type UBP6 allele
of free ubiquitin in all strains (Figure 3B). As expected, deletion (Figures 4B–4D). Our results demonstrate that Ubp6’s protease
of UBP6 suppressed the subtly adverse effects of overexpres- activity antagonizes proliferation in several disomic yeast strains.
sion of ubiquitin in wild-type cells (Figures 3C and 3F). However, Inhibition of the catalytic activity of the mammalian homolog of
high levels of ubiquitin did not abolish the growth rate improve- Ubp6, Usp14, leads to accelerated degradation of a number of

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 77


A B Figure 4. Disomic Strains Exhibit an
Increased Reliance on the Proteasome for
Survival
100 WT GFP 100 Dis VIII GFP (A–D) The percentage of cells in cocultures of
ubp6CA Dis VIII ubp6CA strains carrying PGK1 fused to GFP (open
80 80
Percent Cells

Percent Cells
squares) and strains harboring a catalytic dead
60 60 version of UBP6 (ubp6CA, closed triangles) was
determined at the indicated times. The following
40 40 strains were compared: wild-type and ubp6CA
cells (A), disome VIII PGK1-GFP and disome VIII
20 20 upb6CA cells (B), disome IX PGK1-GFP and dis-
ome IX ubp6CA cells (C), and disome XI PGK1-
0 0
0 10 20 30 40 50 0 10 20 30 40 50 GFP and disome XI ubp6CA cells (D). All strains
Time (h) Time (h) were grown in His+G418 medium.
(E) Proliferation capabilities of WT, rpn6-ts,
parental disomes and disomes harboring the
C D rpn6-ts allele cells on YEPD medium at 25 C,
30 C, and 35 C; 10-fold serial dilutions are shown.
100 Dis IX GFP 100 Dis XI GFP See also Figure S7.
Dis IX ubp6CA Dis XI ubp6CA
80 80
Percent Cells

Percent Cells

60 60

40 40 deletion of UBP6 on the proteome of a


yeast strain whose fitness is improved
20 20
by the deletion of UBP6 (disome V) and
0 0 one that is not (disome XIII). To measure
0 10 20 30 40 50 0 10 20 30 40 50 relative protein abundance in disomic
Time (h) Time (h) and wild-type cells, we utilized stable
E isotope labeling with amino acids in cell
o o o
25oC 30oC 35oC 25oC 30oC 35oC 25 C 30 C 35 C
culture (SILAC)-based quantitative mass
WT WT WT
rpn6-ts rpn6-ts rpn6-ts spectrometry (Extended Experimental
Dis I Dis VIII Dis XI
Dis XI rpn6-ts
Procedures).
Dis I rpn6-ts Dis VIII rpn6-ts
Dis II Dis IX Dis XVI SILAC analysis of disome V and XIII
Dis II rpn6-ts Dis IX rpn6-ts Dis XVI rpn6-ts
Dis V Dis X
relative to wild-type cells revealed quanti-
Dis V rpn6-ts Dis X rpn6-ts tative information for 2953 proteins
(60.7% of all verified open reading frames
[ORFs]) and 3421 proteins (70.3% of all
proteins (Lee et al., 2010). These findings lead us to hypothesize verified ORFs), respectively (Figures 5C and 5E; Table S5). The
that increased proteasomal degradation of an unknown number analysis of the average abundance of proteins encoded by the
of proteins improves the fitness of disomic yeast strains. A genes located on chromosome V and XIII demonstrated that
prediction of this hypothesis is that lowering of proteasomal the average protein levels of chromosome V-located and chro-
activity decreases the fitness of disomic yeast strains. This mosome XIII-located genes were increased by 1.8-fold and
appears to be the case. We previously showed that several 1.9-fold compared to the nonchromosome V or XIII encoded
disomic strains exhibit increased sensitivity to the proteasome proteins, respectively. This correlation is best seen when
inhibitor MG132 (Torres et al., 2007). Furthermore, a conditional proteins are sorted with respect to the chromosomal position
loss-of-function allele in the proteasome lid subunit Rpn6 encod- of their encoding genes (Figures 5C and 5E). To control for arti-
ing gene (Ben-Aroya et al., 2008) was synthetic lethal with dis- facts caused by growth in medium containing heavy lysine, we
omy XII and disomy XIV (data not shown) and decreased the performed a reverse labeling experiment, growing disome V cells
proliferative abilities of almost all disomic strains tested in light medium and wild-type cells in heavy medium and
(Figure 4E). Finally, we found that the ubiquitin profile in strains compared the results of both analyses. We obtained quantitative
disomic for chromosome V, VIII, or XI resembles that of hypo- information on 2755 proteins, of which 2433 were detected in
morphic proteasome mutants: the levels of free ubiquitin are both forward and reverse experiments (r2 = 0.59). Of these,
slightly reduced (Figures 3A and 3B). Our results indicate that 431 proteins show significant up- or downregulation in disome
proteasomal degradation is a rate-limiting pathway in most, or V with high reproducibility (0.49 < log2 ratio < 0.49; r2 = 0.78,
perhaps all, disomic yeast strains. n = 431; Extended Experimental Procedures).
An interesting additional aspect of the quantitative assess-
Consequences of Chromosome V or XIII Disomy ment of the protein composition of the disomic strains is that
on Cellular Protein Composition we are able to determine whether there are proteins whose levels
To test the idea that increased protein degradation leads to do not increase according to gene copy number. A comprehen-
improved fitness of disomic strains, we examined the effects of sive analysis of multiple disomic strains will be presented

78 Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc.


A B Figure 5. Quantification of the Proteome of
Disome V and Disome XIII Strains
The plots show the log2 ratio of the relative protein
abundance compared to wild-type. Protein levels
are shown in the order of the chromosomal loca-
tion of their encoding genes: wild-type/wild-type
ratios (A), Dubp6/wild-type ratios (B), disome
V/wild-type ratios (C), disome V Dubp6/wild-type
ratios (D), disome XIII/wild-type ratios (E), and dis-
ome XIII Dubp6/wild-type ratios (F). SD, standard
deviation; n, number of proteins quantified. See
also the Extended Experimental Procedures. The
C D
number in the graphs shows the fold increase in
protein levels of proteins encoded by genes
located on the disomic chromosome relative to
the rest of the proteome.

in disome V and 22 genes in disome XIII)


or posttranscriptionally (16 genes in dis-
F ome V and 43 genes in disome XIII).
E
Characterization of the feedback mecha-
nisms that ensure accurate stoichiome-
tries of these proteins will be an important
aspect of understanding the effects of
aneuploidy on cell physiology.

Deletion of UBP6 Attenuates


the Effects of Disomy V
on Cellular Protein Composition
Having established the effects of disomy
V on the yeast proteome, we next wished
elsewhere, but several general conclusions are summarized to test the hypothesis that loss of UBP6 function improves the
here. We previously analyzed the abundance of a small number fitness of aneuploid cells such as disome V cells by increasing
of proteins in disomic yeast strains and found that the levels of the degradation of proteins that are in excess in this strain. If
several of these, especially subunits of macromolecular this was the case, the protein composition of disome V ubp6D
complexes such as ribosome subunits, did not exhibit a coordi- cells should be more similar to wild-type cells than that of disome
nate increase between gene copy number and protein levels V cells is to wild-type cells. This appears to be the case.
(Torres et al., 2007). Consistent with these observations, we We obtained quantitative information on 2895 proteins for
find that a considerable fraction of proteins located on chromo- disome V ubp6D cells (Figure 5D; Table S5) and on 3491 proteins
some V, 30 of a total 135 proteins detected in both disome V for cell lacking UBP6 (Figure 5B; Table S5). For the analysis of the
experiments, were not upregulated according to gene copy effects of UBP6 on protein composition, we only included
number. Ninety percent of the proteins that exhibit this property proteins for which quantitative information was obtained in all
are part of macromolecular complexes. Similar results were four strains (2352 proteins). To determine whether deletion of
obtained with disome XIII cells. Twenty-one percent of proteins UBP6 attenuates the effects of disomy V on the intracellular
(65 of 312) did not show coregulation of protein levels with protein composition, we rank-ordered all of the proteins accord-
gene copy number. Sixty-eight percent of these proteins func- ing to their relative protein abundance levels in the strain disomic
tion in large macromolecular complexes. A discrepancy between for chromosome V and then asked how the expression of these
gene copy number and protein levels was most evident for proteins changes in disome V cells lacking UBP6. To quantify
ribosomal subunits, but was also observed for subunits of a potential attenuating effect, we created three bins: one that
ribonucleotide reductase and the vacuolar ATPase. The enrich- encompasses all the proteins whose levels fall within one
ment of protein complex subunits in the group of disome- standard deviation (SD) of the distribution (between 0.49 and
encoded proteins that does not show a coordinate upregulation 0.49, 1947 proteins; Figure 6A), one that encompasses proteins
with gene copy number is of high statistical significance, when whose relative abundance was low in disome V cells (log2 ratio <
compared to all proteins encoded by chromosome V or XIII 0.49; 141 proteins Figure 6A), and one that encompasses
that are part of protein complexes (p value = 1.1 3 1010 for proteins whose relative abundance was high in the disome V
disome V; p value = 3.8 3 103 for disome XIII). Analysis of strain (log2 ratio > 0.49; 264 proteins; Figure 6A). We then calcu-
RNA and protein levels indicates that downregulation of gene lated the mean of the protein abundance changes for each strain
expression occurred either at the level of transcription (14 genes for all three categories and compared them with each other.

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 79


A All Proteins E All Proteins Figure 6. Loss of UBP6 Function Preferen-
1.5
-35
1.5
P = 2*10-22
tially Affects Proteins Overproduced in
P = 3*10

1 1 ratio < -0.51 Disome V and Disome XIII Cells Relative to


ratio < -0.49 n = 112
n = 141
Dis V = -0.81
Dis XIII = -0.87
Dis XIII ubp6Δ = -0.95
the Wild-Type
0.5 Dis V ubp6Δ = -0.44 0.5 WT = 0.19
(A) Comparison of the means of the log2 ratios of
Log2 ratio

Log2 ratio
WT = -0.15 ubp6Δ = -0.36
ubp6Δ = -0.07 Disome V/WT Disome XIII/WT

0
Disome V ubp6Δ /WT
WT/WT
0
Disome XIII ubp6Δ /WT
WT/WT
relative abundance of proteins. Proteins are binned
-0.49 < ratio < 0.49
n = 1,947
ratio > 0.49
n = 264
ubp6Δ //WT -0.51 < ratio < 0.51
n = 2,171
ratio > 0.51
n = 371
ubp6Δ /WT
based on their relative levels in disome V cells. Bin 1
-0.5 -0.5 Dis XIII = 0.00
Dis V = -0.02
Dis V ubp6Δ = 0.00
Dis V = 0.96
Dis V ubp6Δ = 0.34 Dis XIII ubp6Δ = 0.00
Dis XIII = 1.04
Dis XIII ubp6Δ = 0.63 (left bars) contains proteins whose levels are lower
WT = 0.01
than one SD of the mean (ratio < 0.49, n = 141).
WT = 0.00 WT = 0.13 WT = -0.16
-1 ubp6Δ = 0.00 ubp6Δ = -0.09 -1 ubp6Δ = -0.01 ubp6Δ = 0.07
-19
P = 3*10
Bin 2 (middle bars) contains proteins whose levels
-1.5 -1.5
fall within one SD of the mean (0.49 < ratio < 0.49,
B All RNAs F All RNAs
1 1 n = 1947). Bin 3 (right bars) contains proteins whose
n = 141
n = 112 levels are greater than one SD (ratio > 0.49, n =
Dis XIII = -0.64

0.5
Dis V = -0.53
Dis V ubp6Δ = -0.26 0.5
Dis XIII ubp6Δ = -0.83
WT = 0.15
264). Only proteins that were detected in all four
WT = 0.07 ubp6Δ = -0.17
experiments were used for this analysis: disome
Log2 ratio

Log2 ratio
ubp6Δ = -0.08
Disome XIII/WT
0
Disome V/WT
Disome V ubp6Δ /WT 0 Disome XIII ubp6Δ /WT V compared to the wild-type (black bars), disome
WT/WT WT/WT
ubp6Δ //WT n = 2,171 n = 371 ubp6Δ /WT V ubp6D compared to the wild-type (dark gray),
n = 1,947 n = 264 Dis XIII = -0.04 Dis XIII = 0.76
Dis V = -0.13 Dis V = 0.46 Dis XIII ubp6Δ = -0.04 Dis XIII ubp6Δ = 0.72 ubp6D compared to the wild-type (light gray), and
-0.5 Dis V ubp6Δ = 0.08 Dis V ubp6Δ = 0.49 -0.5 WT = 0.09 WT = 0.15
WT = 0.10
ubp6Δ = -0.19
WT = 0.15
ubp6Δ = -0.25
ubp6Δ = 0.06 ubp6Δ = 0.18 the wild-type/wild-type comparison (white bars)
-10
P = 2*10
are shown.
-1 -1
(B) RNA levels of the same genes analyzed in (A).
(C) The same analysis as in (A) was performed for
C Chr V Proteins G Chr XIII Proteins proteins encoded by genes located on chromo-
3 3 -5
P = 8*10
some V. The SD was that of the distribution of
-5
P = 4*10
ratio > 1.44
0.36 < ratio < 1.55
ratio > 1.55
n = 23
chromosome V-encoded proteins. The bins are
2 0.24 < ratio < 1.44 n = 15 2
n = 190 Dis XIII = 2.54
n = 105
Dis V = 0.84
Dis V = 1.93
Dis V ubp6Δ = 0.93 Dis XIII = 0.94 Dis XIII ubp6Δ = 1.39 as follows: ratio < 0.24, n = 16; 1.44 > ratio >
Log2 ratio

Log2 ratio

ratio < 0.36 Dis XIII ubp6Δ = 0.91


Dis V ubp6Δ = 0.84 WT = 0.31 WT = -0.50
ratio < 0.24
n = 16 WT = -0.02 ubp6Δ = -0.47
n = 16
Dis XIII = 0.01
WT = -0.01 ubp6Δ = 0.26 0.24, n = 105; and ratio > 1.44, n = 15. Nomencla-
ubp6Δ = -0.01 ubp6Δ = -0.02
1 Dis V = -0.25 1 Dis XIII ubp6Δ = -0.05
Dis V ubp6Δ = 0.16 WT = 0.13 ture is as in (A).
WT = -0.10 ubp6Δ = -0.13
ubp6Δ = -0.06
Disome V/WT Disome XIII/WT (D) RNA levels of the same proteins analyzed in (C).
0 Disome V ubp6Δ /WT 0 Disome XIII ubp6Δ /WT
WT/WT WT/WT (E) Comparison of the means of the log2 ratios of
ubp6Δ //WT ubp6Δ /WT

-3
relative abundance of proteins. Proteins are binned
P = 6*10
-1 -1 based on their relative levels in disome XIII cells as
D Chr V RNAs H Chr XIII RNAs described for disome XIII cells: bin 1 (left bars),
2 n = 16
Dis V = 0.32
n = 105
Dis V = 0.68
n = 15
Dis V = 0.90
2.5
ratio < 0.51, n = 112; bin 2 (middle bars), 0.51 <
Dis V ubp6Δ = 0.67 Dis V ubp6Δ = 0.93 Dis V ubp6Δ = 1.01
1.5 WT = 0.07 WT = 0.13 WT = 0.20 2 n = 190 ratio < 0.51, n = 2,171; bin 3 (right bars), ratio > 0.51,
ubp6Δ = -0.19 ubp6Δ = -0.24 ubp6Δ = -0.40 Dis XIII = 0.90 n = 23

P = 8*10 -3
Dis XIII ubp6Δ = 0.90
WT = 0.10
Dis XIII = 1.81
Dis XIII ubp6Δ = 1.53
n = 371. Only proteins that were detected in all four
Log2 ratio

Log2 ratio

1 1.5 ubp6Δ = 0.06 WT = 0.24


n = 16
Dis XIII = 0.37 ubp6Δ = 0.44 experiments were used for this analysis: Disome
Dis XIII ubp6Δ = 0.19
0.5 1 WT = 0.28 XIII compared to the wild-type (black bars), disome
ubp6Δ = 0.05
Disome V/WT
Disome V ubp6Δ /WT
XIII ubp6D compared to the wild-type (dark gray),
0 WT/WT
0.5
ubp6Δ //WT Disome XIII/WT
ubp6D compared to the wild-type (light gray), and
Disome XIII ubp6Δ /WT
-0.5 0
WT/WT
the wild-type/wild-type comparison (white bars)
ubp6Δ /WT

-1 -0.5
are shown.
(F) RNA levels of the same proteins analyzed in (E).
(G) The same analysis as in (E) was performed for proteins encoded by genes located on chromosome XIII. The SD was that of the distribution of chromosome XIII
encoded proteins. The bins are: ratio < 0.36, n = 16; 1.55 > ratio > 0.36, n = 190; and ratio > 1.55, n = 23. Nomenclature is as in (E).
(H) RNA levels of the same proteins analyzed in (G).
Error bars represent ± standard error of the mean. p, p value paired Student’s t test.

The mean of proteins whose levels fall within one SD of most likely due to the limited number of proteins that could be
the distribution (0.49 and 0.49) was similar between wild-type, analyzed. The standard deviation we used for this analysis was
ubp6D, disome V, and disome V ubp6D cells (disome V = 0.02; that of the distribution of proteins located on chromosome V,
disome V ubp6D = 0.00; n = 1947; Figure 6A). In contrast, which was 0.60. The average log2 expression level of chromo-
deletion of UBP6 led to the attenuation in expression levels some V proteins was 0.84. The mean of proteins whose levels
of proteins whose relative abundances were low (log2 ratio < fall within one SD of the distribution (0.24 and 1.44) was the
0.49) in disome V cells (disome V = 0.81; disome V same between disome V and disome V ubp6D cells (disome
ubp6D = 0.44; p value = 3 3 1019; n = 141; Figure 6A). The V = 0.84; disome V ubp6D = 0.84; n = 105; Figure 6C). For
effects of deletion of UBP6 were most dramatic among the proteins with low relative expression levels in disome V cells
proteins with the highest relative expression levels in disome V (log2 ratios below 0.24), some attenuation was seen as a conse-
cells (ratio > 0.49). Whereas the mean of this bin was 0.96 quence of UBP6 deletion (disome V = 0.25; disome V ubp6D =
for the disome V strain, it was 0.34 for disome V ubp6D cells 0.16; n = 16; p value = 6 3 103; Figure 6C). The attenuation seen
(n = 264; p value = 3 3 1035; Figure 6A). for chromosome V proteins with the relative highest levels (ratios
The attenuating effects of deletion of UBP6 were also above 1.44) was striking. Whereas the mean of this bin was 1.93
observed for proteins encoded by genes located on chromo- for disome V strain, it was 0.93 for disome V ubp6D cells (n = 15;
some V, although the effects were not as dramatic, which is p value = 4 3 105; Figure 6C).

80 Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc.


To determine whether transcriptional or posttranscriptional soon after cultures experienced a decrease in doubling time.
mechanisms were responsible for the attenuating effects of Nevertheless, it appears that many different types of genetic
deletion of UBP6, we measured RNA levels in these strains. alterations can lead to improved growth in aneuploid yeast
Microarray analysis showed that deletion of UBP6 caused an strains. Conversely, most strains appeared to share a common
upregulation of transcription of proteins with low relative expres- set of gene expression changes, perhaps indicating similar
sion levels in disome V cells (Figure 6B). This finding indicates phenotypic consequences.
that transcriptional effects are responsible for the attenuating Although our analysis is far from comprehensive, it was never-
effects of UBP6 deletion on proteins underrepresented in theless striking that different types of genetic alterations pre-
disome V cells. In contrast, decreased transcription was not dominate in different aneuploid strains. This observation raises
responsible for the attenuating effects of the UBP6 deletion on the possibility that different disomic yeast strains evolve by
proteins with high relative expression levels in disome V cells different pathways. What determines this difference is not yet
(Figures 6B and 6D). These data show that inactivating UBP6 clear, but perhaps different forms of genomic instability exist
attenuates the effects of disomy V on the proteome in at least among the disomes that lead to the favoring of one form of
two ways: (1) Inactivation of the ubiquitin protease promotes evolution over another.
the downregulation of proteins with high relative expression The genetic alterations we identified as causing aneuploidy
levels in disome V cells by a posttranscriptional mechanism. tolerance fall into two classes: (1) genetic changes unique to
We presume that increased protein degradation is this mecha- a specific isolate or a disomic strain and (2) alterations found in
nism. (2) Deletion of UBP6 promotes the upregulation of proteins descendants of several disomic strains. Of special interest are
with low relative expression levels in disome V cells by increasing genetic alterations that affect the proliferation of multiple
their transcription, most likely by affecting the abundance of aneuploidies. We identified three potential cases: a duplication
proteins that regulate transcription of these genes. of 183 kb on chromosome XIII and mutations in VPS64 and
Are the attenuating effects of deleting UBP6 specific to disome UBP6. The UBP6 mutations indeed led to increased proliferation
V cells? Deletion of UBP6 had a similar effect on the proteins with in four different disomes. It will be interesting to determine
high relative expression levels in disome XIII cells, even though whether and how the other genetic alterations affect multiple
the proteins whose levels are increased in disome XIII cells different disomes.
relative to wild-type are different than in disome V cells (Fig-
ures 6E and 6G; p value = 2 3 1022). Transcriptional profiling Modulation of the Ubiquitin-Proteasome Pathway
indicated that this attenuating effect occurred at the posttran- Affects Growth Rates in Aneuploid Yeast Cells
scriptional level (Figures 6F and 6H). In contrast to disome V We have demonstrated that inactivation of UBP6 improves
cells, deletion of UBP6 did not increase the abundance of proliferation of strains disomic for chromosome V, VIII, IX, and
proteins with low relative expression levels in disome XIII cells XI. This effect was especially striking in –His+G418 medium,
(Figure 6E). where we believe the combination of frameshifts induced by
Our results indicate that deletion of UBP6 causes attenuation G418 and disomy places an especially high burden on the
of proteins with high relative expression levels in disomic cells by proteasome. How does inactivation of UBP6 improve the fitness
posttranscriptional mechanisms, most likely by increasing of some aneuploid strains? Our analysis of UBP6 mutants
protein degradation. We propose that in disome V cells this indicates that Ubp6’s proteasome-antagonizing function is
effect on the protein composition increases growth rates, responsible for the increase in fitness of the aneuploid strains.
because proteins that inhibit proliferation of disome V cells are Quantitative proteomic approaches further indicate that deletion
among the proteins whose levels are lowered by the deletion of UBP6 reverts the overall protein composition of disome V and
of UBP6. This is not the case in disome XIII cells. We further XIII cells to a state that is more similar to that of wild-type cells.
suggest that the attenuation of low expressed proteins, which This appears to be mediated by direct posttranscriptional effects
occurs in disome V cells but not disome XIII cells, contributes on high abundance proteins in disome V and XIII cells and
to the differential effect of the UBP6 deletion on the two disomic through indirect transcriptional effect on low-abundance
strains. proteins in disome V cells.
Inactivation of UBP6 attenuates protein levels in both disome
DISCUSSION V and XIII cells, so why does this improve fitness in disome V but
not disome XIII cells? Attenuation of downregulated proteins,
Aneuploidy-Tolerating Mutations which we observe in disome V cells but not disome XIII cells,
This study is to our knowledge the first to describe genetic could be responsible for the differential effects of the UBP6
alterations that allow cells to tolerate the adverse effects of deletion. Another not mutually exclusive possibility is that the
aneuploidy. Our analysis of 13 evolved disomic strains identified proteins that antagonize proliferation in disome V cells are
gross chromosomal rearrangements, chromosome loss, poly- more efficiently degraded in the absence of UBP6 because
ploidization, and point mutations associated with increased they are proteasome substrates. In contrast, proteins respon-
proliferation rates. Their characterization revealed a surprising sible for decreasing the fitness of disome XIII cells are not. The
diversity in genetic alterations leading to improved growth rates. transcription factor Gcn4 illustrates this point. GO search termi-
We suspect that this is, to some extent, due to the experimental nology revealed that genes encoding proteins involved in amino
design. The number of evolved strains that we analyzed was acid metabolism were significantly enriched among the genes
small, and clones with improved growth properties were isolated most highly expressed in disome V cells and downregulated

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 81


when UBP6 was deleted in these cells (49 out of 175, p value = fitness of specific aneuploidies or the aneuploid state overall
3 3 1033). Eighty-four of the 175 attenuated genes contain could provide key insights into how cancer cells evolve to
binding sites for the Gcn4 transcription factor in their promoters escape the adverse effects of aneuploidy. Interestingly, 12 of
(http://rsat.ulb.ac.be/rsat/). The GCN4 gene is located on chro- the 29 genes found mutated in the evolved yeast strains have
mosome V and the levels of the protein are increased in disome human homologs, some of which have been found to be upregu-
V cells. We did not obtain quantitative information on Gcn4 lated in tumors.
protein levels from disome V ubp6D cells, but previous work Finally, our results raise the possibility that aneuploid cancers
showed that Gcn4 degradation is accelerated in the absence are under profound proteotoxic stress. This increased reliance of
of UBP6 (Hanna et al., 2006). Deletion of GCN4 did not improve aneuploid tumor cells on the ubiquitin-proteasome pathway
the fitness of disome V cells (E.T., unpublished data), but could provide the framework for the development of new cancer
scenarios such as the one described for Gcn4 could be the therapeutics with a broad application spectrum and provide the
reason for why deletion of UBP6 affects the growth properties rational for the use of already approved proteasome inhibitors
of some aneuploids but not others. such as Velcade in the treatment of aneuploid tumors in general.
The identification of mutations that accelerate protein degra-
dation as conferring aneuploidy tolerance and the observation EXPERIMENTAL PROCEDURES
that several disomic cells harbored mutations in components
of the ubiquitin-proteasome system highlight the importance of Yeast Strains
All strains are derivatives of W303 (A2587) and are listed in Table S6. The UBP6
ubiquitin-mediated protein degradation in the survival of aneu-
deletion, UBP6 truncation alleles, and PGK1-yEGFP-CaURA3 were created
ploid cells. Based on the observations that yeast strains carrying with the PCR-based method described in Longtine et al. (1998). The
additional yeast chromosomes show synthetic interactions with ubp6C110A allele was provided by D. Finley. The temperature-sensitive
mutations that affect proteasome function and exhibit an rpn6-ts allele is described in Ben-Aroya et al. (2008). Disomy of all strains
increased sensitivity to conditions that interfere with protein was confirmed by CGH analysis (Torres et al., 2007) and is available at
turnover and folding (and strains harboring non-yeast DNA do http://puma.princeton.edu/ and in the Gene Expression Omnibus under
accession number GSE20464. Microarray gene expression data are also
not), we previously proposed that aneuploid cells are more
deposited under this accession number.
dependent on these pathways for survival than wild-type cells
(Torres et al., 2007). Excess proteins produced by the additional Evolution of Aneuploid Yeast Cells
chromosomes place an increased burden on the cell’s protein After inoculation from frozen stock directly into selective media, batch cultures
quality control systems. The results presented here support of wild-type and disomic strains were kept in exponential phase by manual
this idea. The quantitative assessment of the cellular protein dilutions twice a day into fresh selective medium (His+G418) for 14 days
composition of disome V and XIII cells revealed that the addi- at room temperature. Optical densities varied between OD600nm of 0.1
and 1.0. Doubling times were calculated daily.
tional chromosomes are indeed producing proteins. Although
the proteins that engage the protein degradation and folding
Competition Experiments
machineries will be different for each additional chromosome, Approximately equal amounts of cells with and without PGK1-GFP were mixed
the necessity to degrade and fold excess proteins compromises in selective medium at OD600nm = 0.2 and maintained in exponential growth
the cell’s ability to fold and degrade proteins whose excess phase. Relative cell populations in the cultures were measured by flow cytom-
presence in the cell interferes with essential cellular processes. etry as cells containing PGK1-GFP exhibit three orders of magnitude higher
Well-known examples of such proteins are a- and b-tubulin green fluorescence than the non-GFP cells.
(Anders et al., 2009; Katz et al., 1990) and histones (Gunjan
Solexa Sequencing
and Verreault, 2003; Meeks-Wagner and Hartwell, 1986). We
DNA libraries were generated with the Illumina DNA preparation kit. A
propose that in the absence of UBP6, clearance of excess summary of the number of reads, total number of bases sequenced, and
proteins is increased. This improves the fitness of strains, in coverage are presented in Table S7. We used the assembled genome of
which the proteasome neutralizes the excess proteins that S288C (http://downloads.yeastgenome.org/) and aligned our wild-type strain
impair growth. It is important to note that the increased reliance (W303, A2587) sequences with the Maq software package (http://maq.
on protein folding and degradation for survival and enhancement sourceforge.net/). We found 1396 SNPs in W303 compared to S288C. Using
the assembled S288C genome and taking into account the SNPs found in
of these pathways to improve fitness will not apply to the
W303, we created a reference genome. The methods of SNP identification
condition of polyploidy. In polyploid cells, the entire genome is are described in detail in the Extended Experimental Procedures.
duplicated and protein stoichiometries are not affected. Other techniques are described in the Extended Experimental Procedures.

Aneuploidy-Tolerating Mutations— Implications ACCESSION NUMBERS


for Cancer
In humans, more than 90% of all solid tumors are aneuploid. The Gene Expression Omnibus accession number for all the microarray data
Whether and how aneuploidy promotes tumor formation remains including CGH and gene expression analysis reported in this paper is
GSE20464.
controversial (Holland and Cleveland, 2009; Schvartzman et al.,
2010). Irrespective of aneuploidy’s role in tumorigenesis, it is
SUPPLEMENTAL INFORMATION
clear from our studies that for tumor cells to acquire high
proliferative potential and to become malignant, they must over- Supplemental Information includes Extended Experimental Procedures, seven
come the antiproliferative effects associated with aneuploidy. figures, and seven tables and can be found with this article online at
Obtaining a comprehensive list of genes that modulate the doi:10.1016/j.cell.2010.08.038.

82 Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc.


ACKNOWLEDGMENTS Hanna, J., Hathaway, N.A., Tone, Y., Crosas, B., Elsasser, S., Kirkpatrick, D.S.,
Leggett, D.S., Gygi, S.P., King, R.W., and Finley, D. (2006). Deubiquitinating
We are grateful to Daniel Finley, Philip Hieter, and Juergen Dohmen for enzyme Ubp6 functions noncatalytically to delay proteasomal degradation.
reagents and to Daniel Finley, John Hanna, Frank Solomon, and members of Cell 127, 99–111.
the Amon lab for suggestions and their critical reading of this manuscript. Hassold, T.J., and Jacobs, P.A. (1984). Trisomy in man. Annu. Rev. Genet. 18,
This work was supported by National Institutes of Health grant GM56800 69–97.
and a Charles King Trust postdoctoral Fellowship to ET. M.J.D. and C.M.T.
Holland, A.J., and Cleveland, D.W. (2009). Boveri revisited: chromosomal
were supported in part by National Institutes of Health grant P50
instability, aneuploidy and tumorigenesis. Nat. Rev. Mol. Cell Biol. 10,
GM071508. A.A. is also an Investigator of the Howard Hughes Medical
478–487.
Institute.
Katz, W., Weinstein, B., and Solomon, F. (1990). Regulation of tubulin levels
Received: February 10, 2010 and microtubule assembly in Saccharomyces cerevisiae: consequences of
Revised: June 14, 2010 altered tubulin gene copy number. Mol. Cell. Biol. 10, 5286–5294.
Accepted: August 3, 2010 Lee, B., Lee, M., Park, S., Oh, D., Elsasser, S., Chen, P., Gartner, C., Dimova,
Published online: September 16, 2010 N., Hanna, J., Gygi, S., et al. (2010). Enhancement of proteasome activity by
a small-molecule inhibitor of Usp14. Nature 467, 179–184.
REFERENCES
Longtine, M.S., McKenzie, A., 3rd, Demarini, D.J., Shah, N.G., Wach, A.,
Brachat, A., Philippsen, P., and Pringle, J.R. (1998). Additional modules for
Albertson, D.G., Collins, C., McCormick, F., and Gray, J.W. (2003).
versatile and economical PCR-based gene deletion and modification in
Chromosome aberrations in solid tumors. Nat. Genet. 34, 369–376.
Saccharomyces cerevisiae. Yeast 14, 953–961.
Anders, K.R., Kudrna, J.R., Keller, K.E., Kinghorn, B., Miller, E.M., Pauw, D.,
Meeks-Wagner, D., and Hartwell, L.H. (1986). Normal stoichiometry of histone
Peck, A.T., Shellooe, C.E., and Strong, I.J. (2009). A strategy for constructing
dimer sets is necessary for high fidelity of mitotic chromosome transmission.
aneuploid yeast strains by transient nondisjunction of a target chromosome.
Cell 44, 43–52.
BMC Genet. 10, 36.
Ben-Aroya, S., Coombes, C., Kwok, T., O’Donnell, K.A., Boeke, J.D., and Peth, A., Besche, H.C., and Goldberg, A.L. (2009). Ubiquitinated proteins
Hieter, P. (2008). Toward a comprehensive temperature-sensitive mutant activate the proteasome by binding to Usp14/Ubp6, which causes 20S gate
repository of the essential genes of Saccharomyces cerevisiae. Mol. Cell 30, opening. Mol. Cell 36, 794–804.
248–258. Schvartzman, J.M., Sotillo, R., and Benezra, R. (2010). Mitotic chromosomal
Chernova, T.A., Allen, K.D., Wesoloski, L.M., Shanks, J.R., Chernoff, Y.O., and instability and cancer: mouse modelling of the human disease. Nat. Rev.
Wilkinson, K.D. (2003). Pleiotropic effects of Ubp6 loss on drug sensitivities Cancer 10, 102–115.
and yeast prion are due to depletion of the free ubiquitin pool. J. Biol. Chem. Todaro, G.J., and Green, H. (1963). Quantitative studies of the growth of
278, 52102–52115. mouse embryo cells in culture and their development into established lines.
Davies, J., and Davis, B.D. (1968). Misreading of ribonucleic acid code words J. Cell Biol. 17, 299–313.
induced by aminoglycoside antibiotics. The effect of drug concentration. Torres, E.M., Sokolsky, T., Tucker, C.M., Chan, L.Y., Boselli, M., Dunham,
J. Biol. Chem. 243, 3312–3316. M.J., and Amon, A. (2007). Effects of aneuploidy on cellular physiology and
Davies, J., Gilbert, W., and Gorini, L. (1964). Streptomycin, Suppression, and cell division in haploid yeast. Science 317, 916–924.
the Code. Proc. Natl. Acad. Sci. USA 51, 883–890. Torres, E.M., Williams, B.R., and Amon, A. (2008). Aneuploidy: cells losing their
Dettman, J.R., Sirjusingh, C., Kohn, L.M., and Anderson, J.B. (2007). Incipient balance. Genetics 179, 737–746.
speciation by divergent adaptation and antagonistic epistasis in yeast. Nature Varshavsky, A. (2005). Regulated protein degradation. Trends Biochem. Sci.
447, 585–588. 30, 283–286.
Gasch, A.P., Spellman, P.T., Kao, C.M., Carmel-Harel, O., Eisen, M.B., Storz,
Verma, R., Aravind, L., Oania, R., McDonald, W.H., Yates, J.R., 3rd, Koonin,
G., Botstein, D., and Brown, P.O. (2000). Genomic expression programs in the
E.V., and Deshaies, R.J. (2002). Role of Rpn11 metalloprotease in deubiquiti-
response of yeast cells to environmental changes. Mol. Biol. Cell 11,
nation and degradation by the 26S proteasome. Science 298, 611–615.
4241–4257.
Williams, B.R., and Amon, A. (2009). Aneuploidy: cancer’s fatal flaw? Cancer
Gresham, D., Desai, M.M., Tucker, C.M., Jenq, H.T., Pai, D.A., Ward, A.,
Res. 69, 5289–5291.
DeSevo, C.G., Botstein, D., and Dunham, M.J. (2008). The repertoire and
dynamics of evolutionary adaptations to controlled nutrient-limited Williams, B.R., Prabhu, V.R., Hunter, K.E., Glazier, C.M., Whittaker, C.A.,
environments in yeast. PLoS Genet. 4, e1000303. Housman, D.E., and Amon, A. (2008). Aneuploidy affects proliferation and
spontaneous immortalization in mammalian cells. Science 322, 703–709.
Gunjan, A., and Verreault, A. (2003). A Rad53 kinase-dependent surveillance
mechanism that regulates histone protein levels in S. cerevisiae. Cell 115, Yao, T., and Cohen, R.E. (2002). A cryptic protease couples deubiquitination
537–549. and degradation by the proteasome. Nature 419, 403–407.
Hanna, J., Leggett, D.S., and Finley, D. (2003). Ubiquitin depletion as a key Zeyl, C. (2006). Experimental evolution with yeast. FEMS Yeast Res 6,
mediator of toxicity by translational inhibitors. Mol. Cell. Biol. 23, 9251–9261. 685–691.

Cell 143, 71–83, October 1, 2010 ª2010 Elsevier Inc. 83


Store-Independent Activation of Orai1
by SPCA2 in Mammary Tumors
Mingye Feng,1 Desma M. Grice,3,6 Helen M. Faddy,3,6 Nguyen Nguyen,2,6 Sharon Leitch,1 Yingyu Wang,5 Sabina Muend,1
Paraic A. Kenny,4 Saraswati Sukumar,2 Sarah J. Roberts-Thomson,3 Gregory R. Monteith,3 and Rajini Rao1,*
1Department of Physiology
2Department of Oncology
School of Medicine, The Johns Hopkins University, Baltimore, MD 21205, USA
3School of Pharmacy, The University of Queensland, Brisbane, QLD 4072, Australia
4Department of Developmental and Molecular Biology, Albert Einstein Cancer Center, Albert Einstein College of Medicine, Bronx,

NY 10461, USA
5Department of Mechanical Engineering, Whiting School of Engineering, The Johns Hopkins University, Baltimore, MD 21218, USA
6These authors contributed equally to this work

*Correspondence: rrao@jhmi.edu
DOI 10.1016/j.cell.2010.08.040

SUMMARY and Maller, 2002). Crosstalk with other signaling mechanisms,


such as the Ras pathway, regulates cell-cycle transition and
Ca2+ is an essential and ubiquitous second cell proliferation (Cook and Lockyer, 2006; Cullen and Lockyer,
messenger. Changes in cytosolic Ca2+ trigger events 2002). Dynamic regulation of Ca2+ signaling is achieved by coop-
critical for tumorigenesis, such as cellular motility, eration of various cellular components including receptors,
proliferation, and apoptosis. We show that an isoform channels, transporters, buffering proteins, and downstream
of Secretory Pathway Ca2+-ATPase, SPCA2, is upre- effectors (Berridge et al., 2003). Thus, inappropriate activation
of Ca2+ influx channels or downregulation of Ca2+ efflux
gulated in breast cancer-derived cells and human
and sequestration mechanisms could increase basal Ca2+ to
breast tumors, and suppression of SPCA2 attenuates
augment Ca2+ signaling and tumor cell proliferation. Alterna-
basal Ca2+ levels and tumorigenicity. Contrary to tively, changes that deplete the endoplasmic reticulum (ER)
its conventional role in Golgi Ca2+ sequestration, Ca2+ store can confer cellular resistance to apoptosis (Monteith
expression of SPCA2 increased Ca2+ influx by et al., 2007).
a mechanism dependent on the store-operated In most nonexcitable cells, depletion of ER stores elicits sus-
Ca2+ channel Orai1. Unexpectedly, SPCA2-Orai1 tained Ca2+ influx by store-operated Ca2+ (SOC) entry, defining
signaling was independent of ER Ca2+ stores or the major Ca2+ influx pathway. Upon the stimulation of cell-
STIM1 and STIM2 sensors and uncoupled from Ca2+- surface receptors, depletion of ER Ca2+ results in release of
ATPase activity of SPCA2. Binding of the SPCA2 Ca2+ from lumenal EF hand domains of ER-localized STIM
amino terminus to Orai1 enabled access of its proteins, triggering their translocation to ER-plasma membrane
junctions where they bind and activate Orai1, the pore subunit
carboxyl terminus to Orai1 and activation of Ca2+
of the Ca2+ release-activated Ca2+ (CRAC) channel, and result-
influx. Our findings reveal a signaling pathway in
ing in refilling of ER stores (Cahalan et al., 2007; Gwack et al.,
which the Orai1-SPCA2 complex elicits constitutive 2007; Lewis, 2007; Vig and Kinet, 2007). Store-operated Ca2+
store-independent Ca2+ signaling that promotes influx is essential for maintaining ER Ca2+ content at a precise
tumorigenesis. level and functions in various physiological processes such
as gene transcription, cell-cycle progression, and apoptosis
INTRODUCTION (Parekh and Putney, 2005). Dysfunction of store-operated Ca2+
signaling mediated by STIM and Orai1 leads to inhibition of phys-
Basal Ca2+ concentrations are tightly controlled within a narrow iological and pathophysiological activities including breast tumor
submicromolar range by an array of Ca2+ channels and pumps cell migration and tumor metastasis (Yang et al., 2009), vascular
that are susceptible to dysregulation in cancer. Transient smooth muscle cell proliferation and migration (Potier et al.,
changes in cytosolic Ca2+ induce downstream signaling events, 2009), and T cell activation and tolerance (Oh-Hora et al., 2008).
which regulate a wide range of cellular functions (Berridge et al., The Secretory Pathway Ca2+-ATPases (SPCA) are ATP-pow-
2003; Clapham, 2007; Roderick and Cook, 2008). Ca2+ signaling ered pumps that deliver Ca2+ and Mn2+ ions into the Golgi lumen
is required for every stage of the eukaryotic cell cycle, including for protein sorting, processing, and glycosylation (Durr et al.,
activation and expression of transcriptional factors and cyclin- 1998). In higher vertebrates, including human, this essential
dependent kinases that are necessary for cell-cycle progression function is carried out by the ubiquitously expressed SPCA1 iso-
(Hogan et al., 2003; Roderick and Cook, 2008), as well as centro- form, with orthologs in lower eukaryotes including yeast, nema-
some duplication and separation (Fukasawa, 2007; Matsumoto tode, and fruit fly (Missiaen et al., 2007). A closely related second

84 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


isoform, SPCA2, shares similar transport characteristics and proliferation and survival. Phosphorylation of ERK1/2 drives acti-
appears at first glance to have a redundant role, given its vation of transcriptional factors and expression of downstream
absence in lower eukaryotes (Vanoevelen et al., 2005; Xiang proteins such as cyclin D1, which is essential for completion of
et al., 2005). The limited tissue distribution of SPCA2 includes the G1/S transition (Coleman et al., 2004; Roderick and Cook,
mammary epithelium, where it is sharply upregulated during 2008). Levels of phospho-ERK and cyclin D1 reduced dramati-
lactation. Whereas SPCA1 showed a modest 2-fold induction cally in SPCA2KD cells, as well as in cells incubated in low extra-
upon lactation, SPCA2 increased by 35-fold and was localized cellular Ca2+, relative to control cells (Figure 1F).
to the lumenal secretory cells of the mammary gland (Faddy We examined the effects of depleting endogenous SPCA2 on
et al., 2008). the transformed phenotype of MCF-7 cells by monitoring growth
We hypothesized that transformation of mammary epithelial of cells in soft agar. Fewer and smaller colonies were observed in
cells to a cancerous phenotype would be accompanied by dys- soft agar seeded with SPCA2KD cells compared to control cells,
regulation of Ca2+ transporters and their downstream signaling and normalized results showed a clear reduction of growth
pathways, augmenting proliferation and tumor formation. in SPCA2KD cells (Figure 1G). Conversely, overexpression of
Furthermore, localized, inappropriate secretion of Ca2+ in the SPCA2 in nontumorigenic MCF-10A cells conferred the ability
absence of calcium buffers could result in microcalcifications to form colonies in soft agar (Figure 1H) and increased prolifera-
that appear as radiographic ‘‘signatures’’ on mammograms tion rate (Figure 1I). We also monitored tumor generation in
used in diagnosis of breast cancer (Morgan et al., 2005). nude mice injected subcutaneously in the flank with control
Although microcalcifications have been extensively used to or SPCA2KD MCF-7 cells. We show that SPCA2KD conferred
characterize abnormalities in the breast tissue, a mechanistic only sporadic and delayed tumor formation relative to control
understanding of the source of calcium and the specific path- (Figure 1J).
ways that lead to their deposition has remained elusive. To determine whether oncogenic activity of endogenous
In this study, we show that SPCA2 elicits constitutive Ca2+ SPCA2 was mediated by Ca2+ signaling, we measured basal
signaling, mediated by Orai1, which correlates with oncogenic cytoplasmic Ca2+ levels in control MCF-7 and SPCA2KD cells.
activities of mammary tumor cells. Unexpectedly, SPCA2- We showed significant reduction of intracellular Ca2+ levels in
induced Ca2+ signaling was independent of its Ca2+ pump SPCA2KD cells and in cells growing in low extracellular Ca2+,
activity, and not regulated by store depletion or STIM proteins. but not in SPCA1KD cells (Figure 1K). On the other hand, overex-
SPCA2 interacted with Orai1 by its N terminus and activated pression of SPCA2 in MCF-10A cells significantly increased
Ca2+ influx by the C terminus. These findings reveal a Ca2+ basal Ca2+ concentration (Figure 1L). Although basal Ca2+ levels
signaling mechanism in which Orai1 mediates store-indepen- varied between cell lines, these levels could be modulated by
dent Ca2+ influx, and dysregulation of SPCA2 constitutively acti- SPCA2 expression levels. Thus, SPCA2 appears to play a role
vates this pathway leading to oncogenic activity of tumor cells. in regulating basal Ca2+, and upregulation of SPCA2 results in
constitutive increase of basal Ca2+ and cell proliferation associ-
RESULTS ated with oncogenesis.

Upregulation of SPCA2 Induces Oncogenic Signaling SPCA2 Elicits Constitutive Ca2+ Signaling Independent
in Mammary Tumor Cells of Transport Function
We used quantitative RT-PCR to investigate the expression of To investigate the molecular basis of SPCA2-induced Ca2+
SPCA isoforms in a range of breast cancer-derived and nonma- signaling, we began by monitoring Ca2+-dependent localization
lignant mammary epithelial cells. In contrast to comparable of the nuclear factor of activated T cells, NFAT (Crabtree and
mRNA levels of SPCA1, SPCA2 was highly upregulated in Olson, 2002; Huang et al., 2006), in HEK293 cells where expres-
lumenal-like breast cancer-derived cell lines (Figure 1A). Exami- sion of SPCA2 is relatively low (Figure S2A). In resting cells, GFP-
nation of mRNA levels in breast tissue from a small pool of breast tagged NFAT localized exclusively in the cytoplasm. Following
cancer patients confirmed this upregulation (Figure 1B) and treatment with thapsigargin, a blocker of sarco/endoplasmic
prompted us to mine data from microarray profiles of 295 reticulum Ca2+-ATPases (SERCA), depletion of ER Ca2+ resulted
primary human breast tumors: highest levels of SPCA2 were in store-operated Ca2+ entry, elevation of basal Ca2+ level, and
found in ERBB2+ tumors, among five transcriptional subtypes nuclear translocation of NFAT-GFP in nearly 100% of cells, as
(Figure S1 available online). Consistent with mRNA levels, expected (Figures 2A and 2B). Whereas transient expression of
protein expression of SPCA2 was higher in MCF-7 cells, a human SPCA1 in HEK293 cells did not alter cytoplasmic localization
breast adenocarcinoma cell line, relative to MCF-10A, a nonma- of NFAT-GFP under resting conditions, transient expression of
lignant human mammary epithelial cell line; in contrast, there was SPCA2 elicited nuclear translocation of NFAT-GFP in 75% of
no increase in SPCA1 expression in MCF-7 (Figure 1C). We used cells. This was inhibited by store-operated Ca2+ channel
lentiviral delivery of shRNA constructs to knock down expression blockers, miconazole (Clementi and Meldolesi, 1996), and
of endogenous SPCA proteins in MCF-7 cells (Figure 1D). Prolif- 2-APB (Parekh and Putney, 2005) at the reported concentra-
eration was inhibited in SPCA2KD cells, with growth rates slower tions, and in low extracellular Ca2+, indicating Ca2+ entry through
than mock-transduced cells, and similar to cells growing in low plasma membrane Ca2+ channels. Inhibition of the Ca2+-acti-
extracellular Ca2+ (0.1 mM). In contrast, SPCA1KD did not vated Ser/Thr phosphatase calcineurin by FK506 also prevented
cause this growth phenotype (Figure 1E). The RAS-RAF-MEK- nuclear relocalization of NFAT-GFP in SPCA2-transfected cells
ERK1/2 pathway is known to play an essential role in cell (Figures 2A and 2B). Accordingly, NFAT was predominantly

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 85


Figure 1. Upregulation of SPCA2 Induces Oncogenic Signaling in Mammary Tumor Cells
mRNA levels were measured by quantitative real-time RT-PCRs and normalized to 18S rRNA in (A) a panel of breast epithelial cell lines relative to 184A1 and (B) in
human breast tumor samples compared to matched normal surrounding breast tissue. n = 3 in (A).
(C) Immunoblot of SPCA expression in MCF-10A and MCF-7 cells.
Immunoblot (D) and normalized proliferation (E) of MCF-7 cells lentivirally transduced with shRNA against SPCA isoforms are shown. n = 3 in (E).
(F) Immunoblot of ERK 1/2 phosphorylation and cyclin D1 expression in MCF-7 cells transduced with shSPCA2.
Micrographs and normalized growth of (G) MCF-7 cells with SPCA2 knockdown or (H) MCF-10A cells with SPCA2 overexpression in soft agar are shown; n = 3.
Immunoblot showing relative SPCA2 expression levels is shown in (H).
(I) Normalized proliferation of MCF-10 cells with SPCA2 overexpression; n = 3.
(J) Tumor incidence in nude mice injected with MCF-7 cells; n = 6, p = 0.005 (log-rank test).
(K) Basal Ca2+ levels in MCF-7 cells with SPCA2 knockdown. From left to right: n = 80, 80, 77, 81, 69. **p < 0.01 (Student’s t test).
(L) Basal Ca2+ levels in MCF-10A cells with SPCA2 overexpression. Vector, n = 23; SPCA2, n = 23. **p < 0.01 (Student’s t test).
Error bars represent standard error (K and L) or standard deviation (A, E, G, H, and I).

86 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


Figure 2. SPCA2 Elicits Constitutive Ca2+ Signaling Independent of Transport Function
Representative live images (A) and quantification of nuclear localization (B) of NFAT-GFP in HEK293 cells transfected with SPCA1 or SPCA2, or treated with
drugs. n = 3 in (B).
(C) Immunoblot showing phosphorylation status of NFAT following expression of SPCA1or SPCA2 or treatment with thapsigargin (TG) or FK506.
(D) Alignments showing conserved aspartates in phosphorylation (P) domain (D379 in SPCA2) or transmembrane helix 6 (D772 in SPCA2) of P-type Ca2+-
ATPases.
(E) Immunoblot and normalized growth of yeast K616 expressing SPCA2 or mutants D379N and D772A in BAPTA medium; n = 4.
(F) Representative live images, quantification of NFAT translocation in HEK293 cells, and immunoblot showing expression of SPCA2 WT or mutants; n = 3.
(G) Basal Ca2+ levels in HEK293 cells expressing SPCA1, SPCA2, or D379A mutant. From left to right, n = 57, 47, 46, 44. **p < 0.01 (Student’s t test).
Error bars represent standard error (G) or standard deviation (B, E, and F).

dephosphorylated in TG-treated- or SPCA2-expressing cells but Golgi/vesicular stores. To determine whether constitutive Ca2+
remained phosphorylated in cells transfected with SPCA1 or signaling elicited by SPCA2 was dependent on its Ca2+ pumping
empty vector and in FK506-treated cells (Figure 2C). ability, we generated two variants: mutant D379N lacks the
These findings were unexpected, given the known function conserved and essential aspartate that is transiently phosphory-
of SPCA2 in pumping Ca2+ away from the cytoplasm into lated by ATP in the catalytic cycle, and mutant D772A disrupts

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 87


Figure 3. SPCA2-Mediated Ca2+ Signaling Is Store Independent
(A) Localization of YFP-STIM1 in HEK293 cells following TG treatment or SPCA2 expression.
(B) Representative Ca2+ traces following emptying of stores with 2 mM Ionomycin in HEK293 cells with or without SPCA2 expression. Vector, n = 40; SPCA2,
n = 25. Cells were cultured in low Ca2+ medium (0.1 mM) after transfection, followed by a 30 min incubation in normal Ca2+ (2 mM) immediately before calcium
imaging experiments to allow restoration of stores (as described in Extended Experimental Procedures—Calcium imaging).
(C) Representative images of GFP-SPCA1 and NFAT-mCherry following TG treatment or SPCA2 expression in HEK293 cells and (D) quantification of nuclear
NFAT-mCherry translocation. n = 3 in (D).
(E) Quantification of NFAT nuclear translocation following STIM1 knockdown or expression of dominant-negative STIM1 mutant in cells treated with TG or
expressing SPCA2; n = 3.

88 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


a conserved and essential Ca2+-binding site (Figure 2D) (Wei S3G). However, despite expression of dominant-negative
et al., 2000). Both mutants failed to rescue growth of a yeast D76A DERM or knockdown of STIM1 and STIM2 expression,
strain lacking endogenous Ca2+ pumps in BAPTA-supplemented either singly or in combination, SPCA2 retained the ability to
medium, consistent with loss of Ca2+-ATPase activity increase basal Ca2+ concentration and cause NFAT-GFP trans-
(Figure 2E), but retained ability to elicit constitutive NFAT trans- location to the nucleus, evidently by a STIM-independent Ca2+
location in HEK293 cells (Figure 2F). Also, mutant D379N signaling mechanism (Figure 3E and Figures S3F and S3G).
induced growth of MCF-10A in soft agar similar to wild-type We showed that SPCA2 expression in HEK293 cells resulted in
(WT) SPCA2 (Figure S2B). Furthermore, introduction of SPCA2, Ca2+ influx from the extracellular medium, as shown by Mn2+
either WT or D379N mutant, resulted in elevated basal cyto- quench of intracellular preloaded Fura-2 as well as 45Ca2+
plasmic Ca2+ levels in HEK293 cells, relative to cells transfected uptake (Figures S4A and S4B). Initial rates of uptake, monitored
with empty vector or SPCA1 (Figure 2G). This was reminiscent of within the first 60 s, were significantly increased by expression of
the effect of upregulation of endogenous SPCA2 on basal Ca2+ SPCA2 (Figure 3F and Figures S4D–S4I). Additionally, measure-
levels in MCF-7 cells (Figure 1K). We conclude that SPCA2, ment of 45Ca2+ efflux and Fura2 fluorescence confirmed that
but not SPCA1, induces constitutive Ca2+ influx and signaling SPCA2-induced elevation of intracellular Ca2+ did not result
by a mechanism that is independent of its known function as from decreased rates of Ca2+ efflux (Figures S4C–S4F). Consis-
a Ca2+-ATPase. tent with these findings, knockdown of endogenous SPCA2 in
MCF-7 cells also diminished store-independent Ca2+ entry
SPCA2-Mediated Ca2+ Signaling Is Store Independent without changing internal Ca2+ stores (Figures 3G–3I). Taken
To investigate the possibility that SPCA2 could elicit ER Ca2+ together, our results reveal a mechanism for SPCA2-mediated
store depletion leading to constitutive store-operated Ca2+ entry Ca2+ signaling that is independent of both ER and Golgi Ca2+
(SOCE), we examined the status of the ER Ca2+ store. YFP- stores.
STIM1, the ER-localized Ca2+ sensor protein, was present in
a reticular, ER-like pattern in resting cells and redistributed to SPCA2 Interacts with Orai1 to Mediate Ca2+ Entry
punctae after store depletion with thapsigargin (Liou et al., Our results suggested that SPCA2 elicited Ca2+ influx through
2005), as expected (Figure 3A). Transient transfection with plasma membrane Ca2+ channels. Immunofluorescence and
SPCA2 did not elicit puncta formation of YFP-STIM1, suggesting cell-surface biotinylation showed partial localization of endoge-
that the ER store was not Ca2+ depleted (Figure 3A). Next, we nous SPCA2 to the plasma membrane in MCF-7 cells, where it
directly measured the ER Ca2+ content by ionomycin treatment has the potential to elicit Ca2+ influx (Figures 4A and 4B). Next,
to completely release Ca2+ from intracellular stores. In Ca2+- we sought evidence for physical interaction between SPCA2
free medium, peak levels of Ca2+ released by ionomycin were and candidate Ca2+ channels. Although SPCA2-mediated Ca2+
identical in cells transfected with SPCA2 or empty vector influx was independent of ER stores, we observed coimmuno-
(Figure 3B and Figures S3A and S3B). In a different, independent precipitation of the endogenous store-operated channel
approach, we used a thapsigargin-insensitive, ER-localized Orai1 and native SPCA2 in MCF-7 cells (Figure 4C). We verified
Ca2+-ATPase to ensure that intracellular ER stores were replete and extended these findings using epitope-tagged proteins
with Ca2+. N-terminal GFP-tagged SPCA1 partially mislocalized expressed in HEK293 cells: we could document robust coimmu-
to the ER (Figure S3C) where it is functional in filling the stores noprecipitation of Orai1-Myc and HA-SPCA2 (Figure 4D).
and preventing nuclear translocation of NFAT-mCherry after Consistent with the specificity of the Orai1-SPCA2 interaction,
thapsigargin treatment (Figure S3D and Figures 3C and 3D). HA-SPCA1 did not coimmunoprecipitate with Orai1 (Figure 4D).
Despite coexpression with ER-localized GFP-SPCA1, SPCA2 Similar to endogenous protein, up to 10% of HA-SPCA2
was capable of eliciting nuclear translocation of NFAT-mCherry could be labeled by cell-surface biotinylation, including both
(Figures 3C and 3D). HA-tagged SPCA1 localizes to the Golgi WT and the pump-inactive D379N mutant; in contrast, SPCA1
(Figure S3C) and does not interfere with thapsigargin-induced was barely detectable (Figure 4E). Surface residence of SPCA2
SOCE, nor with SPCA2-induced nuclear translocation of correlated with total expression levels, and with elevation of
NFAT-mCherry (Figure 3D), indicating that Ca2+ signaling by basal Ca2+ (Figure S5A). We also used cell-surface biotinylation
SPCA2 is also independent of Golgi stores. It was previously to confirm that a portion of SPCA2-complexed Orai1 was found
reported that knockdown of STIM1 or expression of the domi- at the plasma membrane (Figures S5B and S5C). Although
nant-negative mutant D76A DERM blocked SOC signaling SPCA2 preferentially interacted with lower molecular weight
(Huang et al., 2006; Roos et al., 2005), as seen by the failure of bands of posttranslationally modified Orai1 as has been reported
TG to elicit nuclear translocation of NFAT (Figure 3E and Figures for STIM1 (Park et al., 2009; Vig et al., 2006), we confirmed that
S3E and S3F). Also, knockdown of STIM2, the feedback regu- all forms of Orai1 reached the plasma membrane where they
lator of cytosolic and ER Ca2+ levels, was shown to lower basal could be biotinylated (Figure 4B). Epitope-tagged SPCA2 and
Ca2+ concentration (Brandman et al., 2007) (Figures S3E and Orai1 also partially colocalized by confocal immunofluorescence

(F) Initial rates of Ca2+ influx in HEK293 cells with or without SPCA2 expression, calculated from the experiments shown in Figure S4, with 0.5 mM, 1.0 mM, or
2.0 mM extracellular Ca2+. Vector: n = 30 (0.5 mM), 25 (1.0 mM), 28 (2.0 mM); SPCA2: n = 28 (0.5 mM), 23 (1.0 mM), 25 (2.0 mM).
Representative Ca2+ traces (G) and average intracellular Ca2+ concentration representing store-independent Ca2+ influx (H) and internal Ca2+ store content (I) in
ControlKD and SPCA2KD MCF-7 cells. ControlKD, n = 36; SPCA2KD, n = 30. *p < 0.05 (Student’s t test).
Error bars represent standard error (B, F, G, H, and I) or standard deviation (D and E).

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 89


Figure 4. SPCA2 Interacts with Orai1 to Mediate Ca2+ Entry
(A) Confocal micrographs of immunofluorescence staining of endogenous SPCA2 in MCF-7 cells showing partial plasma membrane localization.
(B) Cell-surface biotinylation of endogenous SPCA2 and Orai1 in MCF-7 cells. T and B represent total lysate and biotinylated fraction, respectively.
(C) Coimmunoprecipitation of endogenous SPCA2 and Orai1 in MCF-7 cells.
(D) Coimmunoprecipitation of HA-SPCA with Orai1-Myc following expression in HEK293.
(E) Cell-surface biotinylation of HA-tagged SPCA1, SPCA2, or D379N SPCA2 expressed in HEK293.
(F) Basal Ca2+ in MCF-7 cells after knockdown of endogenous SPCA2 or Orai1. ControlKD, n = 47; SPCA2KD, n = 54; Orai1KD, n = 52. **p < 0.01 (Student’s t test).
(G) Normalized proliferation of MCF-7 cells with SPCA2 or Orai1 knockdown; n = 3.
(H) Immunoblot of ERK 1/2 phosphorylation and cyclin D1 expression in MCF-7 cells with SPCA2 or Orai1 knockdown.
(I) Normalized growth of MCF-7 cells with SPCA2 or Orai1 knockdown in soft agar; n = 3.
(J) Tumor incidence in nude mice injected with MCF-7 cells; controlKD, n = 10; SPCA2KD, n = 8, p = 0.007 (log-rank test); Orai1KD, n = 9, p = 0.045 (log-rank test).
Immunoblot (K) and normalized growth in soft agar (L) of MCF-10A cells with knockdown of Orai1 in control and cells overexpressing SPCA2. n = 3 in (L).
Error bars represent standard error (F) or standard deviation (G, I, and L).

90 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


microscopy (Figure S5D). Unlike STIM (Yeromin et al., 2006), that together were critical for interaction between the SPCA2
interaction between SPCA2 and Orai1 was not affected by store N terminus and Orai1 (Figure 5F). Three-dimensional structure
depletion with thapsigargin, consistent with a store-independent of the SPCA2 N terminus, predicted by I-TASSER server (Wu
regulation of Orai1 function (Figure S5E). Supporting this possi- et al., 2007), suggested that Val71, Thr75, and Ser78 were
bility, neither WT STIM1 nor the constitutively active STIM1 spatially clustered, whereas Val95 was on the remote side
mutant (D76A) (Huang et al., 2006; Liou et al., 2005) was in the (Figure 5G, Figures S6B and S6C, and Table S1).
same protein complex as SPCA2 (Figure S5F). These findings Finally, we evaluated the effect of Orai1 expression on the
point to Orai1 as a likely candidate for mediating SPCA2-regu- intracellular localization of N-terminal fragments of SPCA1 and
lated, store-independent Ca2+ influx in breast cancer cells. SPCA2 in HEK293 cells. When expressed alone, both fragments
To evaluate this possibility, we suppressed the expression of were localized intracellularly, with the SPCA1 N-terminal frag-
endogenous Orai1 in MCF-7 cells: Orai1KD lowered basal Ca2+ ment diffusely distributed in the cytosol, and the SPCA2
to levels comparable to those seen upon depleting endogenous N terminus concentrated in the perinuclear region. Although
SPCA2 (Figure 4F). In addition, Orai1KD in MCF-7 cells sup- the coexpression of Orai1 did not change localization of the
pressed cell proliferation (Figure 4G) and inhibited the RAS SPCA1 N terminus, there was a redistribution of the SPCA2
pathway, as did SPCA2KD (Figure 4H and Figure S5G). Further- N terminus to the cell surface, providing additional evidence
more, Orai1KD suppressed colony formation in soft agar, to that the N-terminal domain of SPCA2, but not SPCA1, interacts
a similar extent as SPCA2KD (Figure 4I), and tumor generation physically with Orai1 (Figure 5H).
in nude mice (Figure 4J). Simultaneous knockdown of both
Orai1 and SPCA2 did not confer additive phenotypes (Figures Cooperation of SPCA2 N and C Termini in Ca2+ Signaling
S5H, S5J, and S5K). In MCF-10A cells overexpressing SPCA2, We further investigated the molecular mechanism of SPCA2-
cell transformation and elevation of basal Ca2+ level were activated Ca2+ signaling. We noticed that the isolated N terminus
reversed by knockdown of Orai1, consistent with a role for of SPCA2 did not elicit NFAT translocation despite being
Orai1 downstream of SPCA2 (Figures 4K–4L and Figure S5L). able to interact directly with Orai1, while the C terminus was
As expected for a store-independent mechanism of Orai1 activa- sufficient to induce NFAT translocation when it was linked to
tion, depletion of STIM1 (Figures S5M–S5O) or STIM2 (Figures two or more transmembrane domains and targeted to the
S5I–S5K), the upstream activators of Orai1 in SOCE signaling, membrane (Figure 6A and Figures S7A and S7B). Surprisingly,
did not confer comparable phenotypes in MCF-7 cells. Taken a similar membrane-anchored construct containing the SPCA1
together, our data point to promotion of tumorigenic pathways C terminus was also able to activate constitutive Ca2+ signaling
by SPCA2 in breast cancer cells, mediated by interaction with even though full-length SPCA1 could not (Figure 6A). In addition,
Orai1. both SPCA1 and SPCA2 membrane-anchored C-terminal
domains physically interacted with Orai1 (Figure S7C). We
Amino Terminus of SPCA2 Interacts with Orai1 hypothesized that access of the SPCA C terminus to Orai1
To dissect the molecular determinants of the SPCA2-Orai1 inter- was blocked in the full-length proteins, and binding of the
action, we evaluated the efficiency of coimmunoprecipitation SPCA2 N terminus to Orai1 led to exposure of the C terminus
between a series of SPCA chimeric proteins and Orai1. In each and activation of downstream Ca2+ signaling. Analysis of
case, the ability of a chimeric protein to coimmunoprecipitate deletion and point mutants of the SPCA2 C terminus identified
with Orai1 correlated with ability to elicit NFAT translocation, essential functional residues including several positive charges
suggesting that physical interaction between the two proteins (lysines and arginines) and a putative PDZ binding domain (Fig-
was required for Ca2+ signaling. Chimeras containing the ure 6A and Figure S7D), conserved between human, rat, and
SPCA2 N terminus showed stronger binding with Orai1 and mouse SPCA proteins (Figure S7E). We then measured intracel-
more effective NFAT translocation (Figures 5A–5C). lular Ca2+ concentrations upon expression of SPCA2 C-terminal
Next, we examined physical interaction between Orai1 and constructs in HEK293 cells. Basal Ca2+ level was elevated
major intracellular soluble domains of SPCA2, including N and dramatically by expression of the SPCA2 C terminus but
C termini and the large intracellular loop, which contains the remained the same as GST control when lysines (arginines)
iconic aspartate of P-type ATPases (D379). Of these, only the were mutated or the putative PDZ domain was deleted
N terminus was able to pull down Orai1 (Figure 5D). To further (Figure 6B). The N-terminal domain of SPCA2, but not SPCA1,
map regions within the SPCA2 N terminus responsible for had a dominant-negative effect, dramatically inhibiting NFAT
binding to Orai1, we performed GST pull downs between Orai1 translocation induced by full-length SPCA2 or the C terminus
and a series of SPCA1 and SPCA2 fragments. The SPCA1 (Figure 6C), whereas SOCE was not blocked by the SPCA2
N terminus did not bind to Orai1, consistent with an absence N terminus or full-length with the C terminus deleted (SPCA2
of functional interaction between SPCA1 and Orai1 (Figure 5E). D924–946) (Figure S7F). Importantly, expression of the mem-
A region of 40 amino acids within the N terminus of SPCA2 brane-anchored SPCA2 C terminus in MCF-10A cells was able
was able to effectively interact with Orai1 (Figure 5E; construct to induce cell transformation, consistent with the fact that it
SPCA2N-8, aa 67–106). Surprisingly, this region was highly was identified to be the functional domain of SPCA2 and elicited
conserved between the two isoforms, with 50% amino acid constitutive Ca2+ signaling (Figure 6D). STIM1 CRAC activation
identity (Figure S6A). We therefore conducted mutational domain (Park et al., 2009) showed a similar effect, supporting
replacement of amino acids in the SPCA2 N terminus with the the role of Ca2+ signaling in cell transformation (Figures S7G
equivalent residues in SPCA1 and identified four amino acids and S7H).

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 91


Figure 5. N-Terminal Domain of SPCA2 Interacts with Orai1
(A) Schematic of SPCA chimeras. N1 and C1 have the N and C termini of SPCA2 replaced by corresponding regions of SPCA1. N2 and C2 have N and C termini of
SPCA1 replaced by corresponding regions of SPCA2. ‘‘P’’ indicates the conserved aspartate that is transiently phosphorylated by ATP in the catalytic cycle. ‘‘L’’
represents intracellular loop.
(B) Interaction between Orai1 and SPCA chimeras was examined by coimmunoprecipitation in HEK293 cells.
(C) Quantification of NFAT nuclear translocation in HEK293 cells expressing SPCA chimeras described in (B). n = 3; error bars represent standard deviation.

92 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


We next expressed GST fusions of various Orai1 domains Mechanism of Orai1-Mediated Ca2+ Signaling
including N and C termini, extra- and intracellular loops Induced by SPCA2
together with full-length SPCA2 or the N-terminal fragment of It has been reported that STIM1 and Orai1 mediate CRAC
SPCA2. Both N and C termini, but not the loops of Orai1, currents in endothelial cells, and knockdown of either elicits
were able to pull down both full-length and N terminus of cell-cycle arrest (Abdullaev et al., 2008). Another recent study
SPCA2, revealing that SPCA2 and Orai1 interacted within the implicated a store-dependent role for Orai1 in cell migration of
cytoplasm (Figures 6E and 6F). We then mapped subregions the metastatic breast cancer line MDA-MB-231, based on
of Orai1 N and C termini to further explore SPCA2 interaction a requirement for STIM1 (Yang et al., 2009). We note that
domains (Figure 6G). GST pull-down experiments identified SPCA2 expression is very low in MDA-MB-231 (data not shown),
a fragment (aa 48–91) of the Orai1 N terminus that bound consistent with a Ca2+ signaling mechanism distinct from the
SPCA2 with a higher affinity than the full-length N terminus. store-independent pathway reported here. Although the impor-
Mutation L273S, previously shown to disrupt the coiled-coil tance of SOC signaling is well established, the store independent
domain of the C terminus of Orai1 (Muik et al., 2008), severely Ca2+ signaling described in our study suggests that multiple
reduced the interaction with SPCA2 (Figure 6G). Taken mechanisms may invoke Orai1 activation. Interaction between
together, we propose a model for SPCA2 interaction with SPCA2 and Orai1 was not affected by ER store depletion and
Orai1 and activation of Ca2+ signaling. We suggest that the N activation of SOC signaling, and SOCE was not inhibited by
terminus of SPCA2 binds Orai1, resulting in a conformational expression of SPCA2, supporting that SPCA-induced signaling
change and exposure of the C terminus, which can interact may function independently of the SOC pathway and different
with Orai1 either directly or together with other proteins to acti- pools or fine subdomains of Orai1 are involved in the two
vate Ca2+ influx (Figure S7I). pathways.
ER-localized Ca2+ sensor STIM proteins, which regulate
SOCE, did not physically interact with SPCA2 or participate in
DISCUSSION regulation of the SPCA2-Orai1 signaling pathway. In addition,
internal Ca2+ store content was not depleted by suppression or
Role of SPCA2 and Orai1 in Breast Tumorigenicity overexpression of SPCA2. Thus, it remains to be determined
Our findings reveal a mechanism for activation of the so-called how the store-independent, Orai1-mediated mechanism of Ca2+
SOCE channel Orai1 that is independent of ER and Golgi influx is regulated. One possibility is that signaling activity of
Ca2+ stores and sensors. This store-independent mode of SPCA2 is regulated by its trafficking between Golgi and plasma
endogenous Orai1 activation in breast cancer-derived MCF-7 membrane. Interaction with Orai1 at the cell surface may be
cells underlies constitutive Ca2+ signaling, proliferation, and dependent on a specific conformation of SPCA2, which could
anchorage-independent growth and implicates a hitherto unrec- be regulated by kinase-mediated phosphorylation, Ca2+ binding,
ognized role for Orai1 in breast tumorigenicity. We also identified or changes in pH between extracellular and Golgi lumen.
a role for SPCA2 in tumorigenicity and revealed a functional link Removal of a potential PDZ-binding motif in the last four residues
to RAS signaling. The RAS-ERK pathway regulates cell-cycle of the C-terminal tail of SPCA2 abolished Ca2+ signaling, sug-
progression and cell proliferation, and it is well known that gesting that interaction with scaffold proteins may be important
hyperactivation of the RAS gene family correlates with various for activation of this signaling pathway.
human cancers (Bos, 1989). GTP-exchange factors (GEFs) and Based on the function of a series of chimeras and mutant
GTPase-activating proteins (GAPs) control activity of RAS by proteins, we propose a model in which cooperation of N and
regulating the balance of GTP binding and hydrolysis (Donovan C termini of SPCA2 is required for Orai1-mediated Ca2+
et al., 2002; Downward, 1996). Recent studies have suggested signaling. Whereas the N terminus of SPCA2 binds strongly to
that GEFs and GAPs can be regulated by different Ca2+ signals, Orai1, the C terminus elicits activation of Ca2+ influx. Although
such as amplitude of the Ca2+ signals and frequency of Ca2+ the Orai1-binding domain within the SPCA2 N terminus is highly
oscillation (Cook and Lockyer, 2006). By monitoring activation conserved with the corresponding region of SPCA1, no interac-
of ERK and expression of the downstream protein cyclin D1, tion was detected between the SPCA1 N terminus and Orai1.
we revealed a correlation between SPCA2 and Orai1-mediated Replacement of four residues within the minimal Orai1-binding
increase of basal Ca2+ levels and constitutive activation of RAS domain of the SPCA2 N terminus (Val71, Thr75, Ser78, and
signaling in MCF-7 cells, placing the SPCA2-Orai1 pathway in Val95) to the corresponding less hydrophobic or charged resi-
the RAS signaling network. dues in SPCA1 abolished the interaction with Orai1.

(D) Interaction between the SPCA2 N terminus (N: aa 1–106), intracellular loop (L: aa 353–733), C terminus (C: aa 923–946), and Orai1 was examined by GST pull-
down in HEK293 cells.
(E) Mapping of regions in SPCA1/2 that interact with Orai1. GST-SPCA1/2 N-terminal fragments were coexpressed with HA-Orai1 in HEK293 cells, and interac-
tion with Orai1 was examined by GST pull-down. Sequence conservation between SPCA1 and SPCA2 is shown on top, with black, gray, and white bars repre-
senting identical, similar, and different amino acids, respectively, as defined by ClustalW.
(F) Screening of SPCA2 N terminus for amino acids critical for the interaction with Orai1 in HEK293 cells. Point mutations in SPCA2 N terminus convert amino
acids to the equivalent residues in SPCA1 N terminus.
(G) Predicted 3D structure of the SPCA2 N terminus with residues essential for interaction with Orai1 shown in red.
(H) Localization of SPCA1/2 N termini, with or without coexpression of Orai1.

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 93


Figure 6. Cooperation of SPCA2 N- and C-Terminal Domains in Ca2+ Signaling
(A) SPCA2 C terminus was sufficient to activate Ca2+ signaling. Functions of deletion and point mutants of SPCA2 C-terminal domain were examined by NFAT
translocation assay in HEK293 cells. Full-length SPCA proteins were HA-tagged, and all C terminus fragments shown were GST-tagged; n = 3.
(B) Basal intracellular Ca2+ concentrations in HEK293 cells, with the expression of GST-tagged deletion and point mutants of the SPCA2 C-terminal domain
described in (A). From left to right, n = 49, 45, 46, 48, 40, 54, 59.
(C) Effects of N-terminal fragments of SPCA proteins on NFAT translocation induced by SPCA2 full-length or C-terminal fragment shown in (A). n = 3.
(D) Immunoblot and normalized cell growth in soft agar of MCF-10A cells transduced with vector, SPCA2, GST, and membrane-anchored SPCA2 C terminus
(GST-tagged); n = 3.
(E and F) Interaction between Orai1 N termini (N: aa 1–91), C termini (C: aa 255–301), intracellular loops (L1: aa 141–177), extracellular loops (L2: aa198-234), and
SPCA2 full-length or N terminus.
(G) Interaction between Orai1 full-length and subregions of N terminus (N: aa 1–91; N1: aa 1–47; N2: aa 48–91), C terminus (C: aa 255–301), C terminus mutation
(C-L273S), and SPCA2.
Error bars represent standard error (B) or standard deviation (A, C, and D).

Interestingly, C-terminal constructs of both SPCA isoforms, Therefore, we propose a mechanism in which accessibility of
anchored to the membrane by a minimum of two transmem- SPCA C termini is blocked in the full-length protein and binding
brane helices, were able to elicit Ca2+ influx and signaling. of the N terminus to Orai1 is required for functional availability
Consistent with this, critical amino acids within the C terminus of the C terminus. Consistent with this hypothesis, we find that
were conserved in both isoforms from rat, mouse, and human. expression of the soluble N-terminal domain from SPCA2, but

94 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


not SPCA1, has a dominant-negative effect in blocking activa- developmental program ensures a coordinated regulation of
tion of Ca2+ signaling. Long-range conformational interactions Ca2+ pumps, channels, receptors, and buffers, there is emerging
between the N terminus and other cytosolic domains have appreciation for a pronounced dysregulation of these processes
been noted in SPCA and other P-type pumps, as well as changes in breast-derived tumor cells. For example, an aberrant switch in
in accessibility of the C-terminal tail (Huster and Lutsenko, 2003; heterotrimeric G protein preference by the calcium sensing
Lecchi et al., 2005; Wei et al., 1999). Recently, Garside et al. receptor, CaSR, in breast cancer cells leads to stimulation of
(2010) identified an alternative transcript of SPCA2, encoding cAMP signaling and increased secretion of PTHrP, which in
an 20 kDa membrane-anchored C-terminal fragment, in turn is believed to contribute to a ‘‘vicious cycle’’ or feedforward
tissues including brain, testes, salivary glands, and pancreas. loop of bone metastasis and osteolysis (Mamillapalli et al., 2008).
Expression of this transcript was under the control of MIST1, Thus, the upregulation of SPCA2 in the altered signaling environ-
a basic helix-loop-helix transcription factor, and appeared to ment of tumor cells may result in constitutive Ca2+ signaling and
be independent of the full-length transcript. This suggests the cell growth. Inappropriate secretion of Ca2+ from these cells, in
intriguing possibility that a C-terminal fragment of SPCA2 may the absence of calcium buffers, could lead to microcalcifications
elicit Ca2+ signaling independent of the full-length transporter. that are diagnostic of breast cancer. Finally, the separation of
signaling function from transport activity in SPCA2, evidenced
Physiological and Pathophysiological Perspectives by our findings, is highly unusual in pumps. An extreme case is
of SPCA2-Induced Ca2+ Signaling SUR1, an ABC transporter that lacks known transport activity
The conventional role of ATP-powered Ca2+ pumps is to scav- but is essential for conferring ATP sensitivity to KATP channels
enge and extrude cytoplasmic Ca2+ in order to terminate a signal, in insulin-secreting pancreatic b cells (Aittoniemi et al., 2009).
and as a prerequisite for additional signaling events. Unexpect- In summary, we identified a store-independent SPCA2-Orai1
edly, high levels of expression of the Ca2+ efflux pump SPCA2 signaling pathway. Upregulation of SPCA2 led to constitutively
increased rather than lowered basal cytoplasmic Ca2+ levels, active Ca2+ signaling and correlated with oncogenic activity in
and conversely, attenuation of SPCA2 expression was accom- breast cancer. Both SPCA2 and Orai1 emerge as druggable
panied by a decrease in basal Ca2+. We speculate that this targets of therapeutic potential in the treatment of some breast
unconventional mechanism may be physiologically important cancer subtypes.
in eliciting high rates of transcellular Ca2+ flux during lactation
(Lee et al., 2006) and in other Ca2+-secreting tissues, including EXPERIMENTAL PROCEDURES
salivary glands and intestinal epithelia, where SPCA2 is
Materials and additional experimental procedures are described in the Supple-
expressed at high levels. Total calcium concentration in milk
mental Information.
can reach up to 100 mM, five to six orders of magnitude greater
than typical cytoplasmic concentrations (0.1 mM). Thus, SPCA2 Analysis in Human Breast Tumors
there must be energy-dependent transport processes for A gene expression dataset consisting of the microarray profiles of 295 primary
effective transcellular movement of Ca2+ from blood into milk. human breast tumors (van de Vijver et al., 2002) was obtained from Rosetta
In mammary gland, a 30-fold transcriptional increase in the Inpharmatics (Seattle, WA, USA). Tumors were assigned to transcriptional
subtypes based on their gene expression profiles (Lumenal A [n = 88], Lumenal
plasma membrane Ca2+ pump isoform, PMCA2, is accompanied
B [n = 81], Normal-like [n = 31], Basal-like [n = 46], and ERBB2+ [n = 49]) as
by apical efflux of Ca2+ into milk (Reinhardt et al., 2004).
described (Chang et al., 2005). One probe on the array (annotated as
Compared to modest changes in SPCA1 levels, SPCA2 was KIAA0703) corresponded to SPCA2. Tumors were grouped by transcriptional
found to be upregulated during pregnancy (8-fold) and dramat- subtype and analyzed for SPCA2 expression. Statistical significance
ically upon lactation (35-fold on day 1). Furthermore, SPCA2 between groups was assessed by comparing medians using the Kruskall-
expression was restricted to the lumenal cells of lactating glands Wallis test followed by Dunn’s Multiple Comparison Test (Prism version 5,
(Faddy et al., 2008). Our findings raise the possibility that SPCA2 Graphpad Inc.).

traffics to the basolateral membrane where it can interact with


NFAT Translocation Assay
Ca2+ channels to elicit Ca2+ influx and promote transcellular Monitoring of nuclear translocation of NFAT was performed 24 hr post-trans-
Ca2+ transport. fection in HEK293 cells. Fresh medium was added 2 hr before the start of the
The unusual role of SPCA2 in activation of Ca2+ influx super- experiment. Localization of NFAT-GFP and NFAT-mCherry in cells was exam-
sedes its ATP-dependent Ca2+ sequestering activity and may ined by fluorescent microscopy. 100–300 cells were manually counted on each
be a raison d’etre for its redundant expression along with coverslip, 3 wells for each condition, and the fraction of cells with nuclear NFAT
was calculated. Where indicated, 2 mM thapsigargin was added for 30 min,
SPCA1 in mammals and higher vertebrates. It is noteworthy
10 mM miconazole was used for 1 hr, and 50 mM 2-APB was used for 1 hr.
that in lower eukaryotes (yeast, worm, fly) and vertebrates (fish)
there is only a single ubiquitously expressed SPCA protein, Calcium Imaging and Mn2+ Quench
which functions in transporting Ca2+ and Mn2+ into the secretory Cells were loaded with Fura-2 AM at 1 mg/ml in calcium recording buffer
pathway. The advent of the SPCA2 gene in higher eukaryotes (126 mM NaCl, 2 mM MgCl2, 4.5 mM KCl, 10 mM Glucose, 20 mM HEPES
including frog, mouse, rat, and human may correlate with a newly pH 7.4, 2 mM CaCl2; no CaCl2 was added for the 0 Ca2+ buffer) for 30 min
required role in Ca2+ signaling. At the molecular level, a longer at room temperature (RT). After loading, cells were rinsed in the same calcium
recording buffer without Fura-2 for 20 min. Cells were excited at 340 nm and
and divergent N terminus appears to have endowed SPCA2
380 nm, and Fura AM emission at 505 nm was monitored. Intracellular Ca2+
with the ability to interact with unique partners, and discrete concentration was calculated based on the ratio of 340/380 nm. For Mn2+
cell- and tissue-specific distribution would appear to regulate quench of Fura-2 fluorescence, 0.5 mM of Mn2+ was added to nominally
its function. Whereas in lactation, an exquisitely orchestrated Ca2+-free buffer. Cells were excited at 360 nm, the isosbestic point of

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 95


Fura-2, and emission at 505 nm was monitored. The average fluorescence of HA were used to detect Myc-SPCA2 and HA-Orai1. In Figure S7B, anti-GST
10 time points (50 s) before Mn2+ addition was set as 100%. and anti-HA were used to detect GST-SPCA2C and HA-Orai1.

Construction, Production, and Infection of Lentiviruses Coimmunoprecipitation and GST Pull-Down


and Retroviruses Coimmunoprecipitation (co-IP) and GST pull-down assay in HEK293 cells
Replication-incompetent lentivirus was used to package shRNA for knock- were performed 24 hr after transfection. Co-IP in MCF-7 cells for endogenous
down in MCF-7 cells and HEK293 cells. Cells were incubated with viruses proteins was performed 24–48 hr after seeding cells. Cells were lysed in lysis
for 48 hr and selected with puromycin (2-4 mg/ml). buffer (20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1 mM Na3EDTA, 1 mM EGTA,
Retroviral gene transfer and expression system (Clontech, Mountain View, 5 mM Na4P2O7, 1 mM Na3VO4, 10 mM NaF, supplemented with 1% Triton
CA, USA) was used for stable expression of SPCA2 in MCF-10 cells. SPCA2 X-100 and protease inhibitor cocktail [Roche]). 1/10 of the lysate was saved
gene was cloned into pLXRN vector to package retroviruses. Viruses were as ‘‘input.’’ For co-IP, cell lysate was incubated 1 hr with GammaBind Plus
collected 48 hr after transfection and added to MCF-10A cells. Cells Sepharose (GE Healthcare, Waukesha, WI, USA) for preclearance and 1–4 hr
were treated with G418 (400 mg/ml) after 48 hr infection and selected cells with antibodies (anti-Myc or anti-SPCA2) at 4 C. GammaBind beads were
were used to assay proliferation and colony formation in soft agar. added and incubated for 1 hr at 4 C. For GST pull-down assay, cell lysate
was incubated 2 hr with glutathione Sepharose 4B. Beads were washed using
lysis buffer supplemented with 1% Triton X-100 before SDS-PAGE and immu-
Cell Proliferation Assay
noblotting. 1/2 of the ‘‘input’’ and 1/2 to 1/8 of the co-IP/pull-down fraction
Proliferation was monitored using a Celltiter 96 Aqueous One Solution cell
were loaded to SDS-PAGE gels. To co-IP cell-surface Orai1 with SPCA2, cells
proliferation assay kit (Promega, Madison, WI, USA) according to manufac-
were biotin-labeled, lysed, and immunoprecipitated using anti-SPCA2 anti-
turer’s instructions. Briefly, 0.5–1 3 104 cells were plated into a 96-well plate.
body. The proteins on the GammaBind beads were eluted with lysis buffer
After every 24 hr, 20 ml of Celltiter 96 Aqueous One Solution reagent was added
containing 1% SDS and incubated with neutravidin resin overnight at RT.
to each well and incubated for 2 hr at 37 C, 5% CO2. The absorbance at
Beads were washed in the same buffer. Only the portion of Orai1 that bound
490 nM was recorded using a 96-well plate reader.
to SPCA2 at the cell surface was detected using SDS-PAGE and immunoblot-
ting. 1/2 of the ‘‘input’’ and 1/2 of the biotinylated fraction were loaded to SDS-
Colony Formation in Soft Agar PAGE gels.
Colony formation in soft agar assay was performed using a CytoSelect
96-well cell transformation assay kit (Cell Biolabs, San Diego, CA, USA). In Functional Complementation in Yeast
a 96-well plate, 0.5–1 3 104 cells were resuspended in DMEM containing Yeast growth assays were performed as described before (Xiang et al., 2005).
0.4% agar and 10% FBS and layered onto a base agar consisting of The yeast strain K616 (pmr1Dpmc1Dcnb1D) was used as host for plasmids
DMEM with 0.6% agar and 10% FBS. Following solidification, growth medium expressing SPCA2. Freshly grown cells were inoculated into each well of
was added on to the cell agar layer. One to two weeks later, colonies were 96-well plates at 0.05 optical density (OD) 600 nm. Plates were incubated over-
imaged under the microscope, the agar layer was solubilized, and cells night at 30 C and resuspended by agitation, and OD600 nm was measured
were lysed and quantified with CyQuant GR dye. The plate was read in a using a FLUOstar Optima plate reader.
FLUOstar Optima plate reader (BMG Labtechnologies) using a 485/520 nm
filter set. Three-Dimensional Structure Prediction
I-TASSER method was used to predict 3D protein structure from the primary
Tumor Formation in Nude Mice amino acid sequence of the SPCA2 N terminus. I-TASSER was ranked as
Female 4- to 6-week-old athymic nude mice (NCI) were received by the animal the No.1 server in recent CASP7 and CASP8 experiments (Critical Assessment
facility personnel and acclimated at the facility for 2 weeks. Estrogen pellets of Protein Structure Prediction).
(SE-121, 0.72 mg/pellet, 60 days release) were obtained from Innovative
Research of America. For each animal, a pellet was implanted into the back SUPPLEMENTAL INFORMATION
of the neck through a 1 cm cut and the wound was closed by a wound clip.
After 3 days of implantation, the animals were ready to be injected with cells. Supplemental Information includes Extended Experimental Procedures, seven
MCF-7 cells transduced with control or SPCA2 shRNA or Orai1 shRNA were figures, and one table and can be found with this article online at doi:10.1016/
trypsinized and diluted to 1.5–3 3 107 cells per ml in PBS. 3 3 106 cells per j.cell.2010.08.040.
animal were injected subcutaneously into the flank of each of 6–10 mice.
The incidence of tumor formation was recorded in each animal once per ACKNOWLEDGMENTS
week, starting 14–18 days after injection. Animal care was in accordance
with institutional guidelines. One animal with subsequent tumor necrosis We thank Dr. Paul Worley and Dr. Guo Huang (Johns Hopkins University) for
was euthanized, others were sacrificed after 10 weeks of observation. kind gifts of plasmids expressing Orai1, STIM1, and NFAT. This work was sup-
ported by grant GM62142 from the National Institution of Health to R.R.,
Immunofluorescence 569644 from the National Health and Medical Research and Cancer Council
Cultured HEK293 and MCF-7 cells on coverslips were pre-extracted with Queensland to G.R.M. and S.J.R.-T., Department of Defense-Center of Excel-
PHEM buffer (60 mM PIPES, 25 mM HEPES, 10 mM EGTA, and 2 mM lence Grant W81XWH-04-1-0595 to S.S., laboratory startup funds from the
MgCl2, pH 6.8) containing 0.025% saponin for 2 min, then washed twice for Albert Einstein College of Medicine to P.A.K., American Heart Association
2 min with PHEM buffer containing 0.025% saponin and 8% sucrose. The cells Pre-doctoral fellowship 0815058E to M.F., and American Psychological Asso-
were fixed with a solution of 4% PFA and 8% sucrose in PBS for 30 min at room ciation scholarship to H.M.F. and D.M.G.
temperature and blocked with a solution of 1% BSA and 0.025% saponin in
PBS for 1 hr. Primary antibodies were diluted 1:500 in 1% BSA and incubated Received: December 28, 2009
with the cells for 1 hr. Alexa-Fluor 488 goat anti-rabbit IgG (Invitrogen) and Revised: June 3, 2010
Alexa-Fluor 568 goat anti-mouse IgG were used at a 1:1000 dilution for Accepted: August 24, 2010
30 min. Cells were mounted onto slides using Dako Fluorescent Mounting Published: September 30, 2010
Medium. Slides were imaged on a Zeiss LSM510-Meta confocal microscope.
In Figure 4A, anti-SPCA2 was used. In Figure 5H, anti-SPCA2, anti-SPCA1, REFERENCES
and anti-HA were used to detect SPCA2N, SPCA1N, and HA-Orai1. In
Figure S3C, anti-Myc, anti-SPCA1, and anti-Golgi97 were used to detect Abdullaev, I.F., Bisaillon, J.M., Potier, M., Gonzalez, J.C., Motiani, R.K., and
Myc-STIM1, HA-SPCA1, and Golgi 97. In Figure S5D, anti-SPCA2 and anti- Trebak, M. (2008). Stim1 and Orai1 mediate CRAC currents and

96 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


store-operated calcium entry important for endothelial cell proliferation. Circ. Lecchi, S., Allen, K.E., Pardo, J.P., Mason, A.B., and Slayman, C.W. (2005).
Res. 103, 1289–1299. Conformational changes of yeast plasma membrane H(+)-ATPase during
Aittoniemi, J., Fotinou, C., Craig, T.J., de Wet, H., Proks, P., and Ashcroft, F.M. activation by glucose: role of threonine-912 in the carboxy-terminal tail.
(2009). Review. SUR1: a unique ATP-binding cassette protein that functions Biochemistry 44, 16624–16632.
as an ion channel regulator. Philos. Trans. R. Soc. Lond. B Biol. Sci. 364, Lee, W.J., Monteith, G.R., and Roberts-Thomson, S.J. (2006). Calcium trans-
257–267. port and signaling in the mammary gland: targets for breast cancer. Biochim.
Berridge, M.J., Bootman, M.D., and Roderick, H.L. (2003). Calcium signalling: Biophys. Acta 1765, 235–255.
dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell Biol. 4, 517–529. Lewis, R.S. (2007). The molecular choreography of a store-operated calcium
channel. Nature 446, 284–287.
Bos, J.L. (1989). ras oncogenes in human cancer: a review. Cancer Res. 49,
4682–4689. Liou, J., Kim, M.L., Heo, W.D., Jones, J.T., Myers, J.W., Ferrell, J.E., Jr., and
Meyer, T. (2005). STIM is a Ca2+ sensor essential for Ca2+-store-depletion-
Brandman, O., Liou, J., Park, W.S., and Meyer, T. (2007). STIM2 is a feedback
triggered Ca2+ influx. Curr. Biol. 15, 1235–1241.
regulator that stabilizes basal cytosolic and endoplasmic reticulum Ca2+
levels. Cell 131, 1327–1339. Mamillapalli, R., VanHouten, J., Zawalich, W., and Wysolmerski, J. (2008).
Switching of G-protein usage by the calcium-sensing receptor reverses its
Cahalan, M.D., Zhang, S.L., Yeromin, A.V., Ohlsen, K., Roos, J., and
effect on parathyroid hormone-related protein secretion in normal versus
Stauderman, K.A. (2007). Molecular basis of the CRAC channel. Cell Calcium
malignant breast cells. J. Biol. Chem. 283, 24435–24447.
42, 133–144.
Matsumoto, Y., and Maller, J.L. (2002). Calcium, calmodulin, and CaMKII
Chang, H.Y., Nuyten, D.S., Sneddon, J.B., Hastie, T., Tibshirani, R., Sorlie, T.,
requirement for initiation of centrosome duplication in Xenopus egg extracts.
Dai, H., He, Y.D., van’t Veer, L.J., Bartelink, H., et al. (2005). Robustness, scal-
Science 295, 499–502.
ability, and integration of a wound-response gene expression signature in pre-
dicting breast cancer survival. Proc. Natl. Acad. Sci. USA 102, 3738–3743. Missiaen, L., Dode, L., Vanoevelen, J., Raeymaekers, L., and Wuytack, F.
(2007). Calcium in the Golgi apparatus. Cell Calcium 41, 405–416.
Clapham, D.E. (2007). Calcium signaling. Cell 131, 1047–1058.
Monteith, G.R., McAndrew, D., Faddy, H.M., and Roberts-Thomson, S.J.
Clementi, E., and Meldolesi, J. (1996). Pharmacological and functional proper-
(2007). Calcium and cancer: targeting Ca2+ transport. Nat. Rev. Cancer 7,
ties of voltage-independent Ca2+ channels. Cell Calcium 19, 269–279.
519–530.
Coleman, M.L., Marshall, C.J., and Olson, M.F. (2004). RAS and RHO GTPases Morgan, M.P., Cooke, M.M., and McCarthy, G.M. (2005). Microcalcifications
in G1-phase cell-cycle regulation. Nat. Rev. Mol. Cell Biol. 5, 355–366. associated with breast cancer: an epiphenomenon or biologically significant
Cook, S.J., and Lockyer, P.J. (2006). Recent advances in Ca(2+)-dependent feature of selected tumors? J. Mammary Gland Biol. Neoplasia 10, 181–187.
Ras regulation and cell proliferation. Cell Calcium 39, 101–112. Muik, M., Frischauf, I., Derler, I., Fahrner, M., Bergsmann, J., Eder, P., Schindl,
Crabtree, G.R., and Olson, E.N. (2002). NFAT signaling: choreographing the R., Hesch, C., Polzinger, B., Fritsch, R., et al. (2008). Dynamic coupling of the
social lives of cells. Cell Suppl. 109, S67–S79. putative coiled-coil domain of ORAI1 with STIM1 mediates ORAI1 channel
Cullen, P.J., and Lockyer, P.J. (2002). Integration of calcium and Ras signal- activation. J. Biol. Chem. 283, 8014–8022.
ling. Nat. Rev. Mol. Cell Biol. 3, 339–348. Oh-Hora, M., Yamashita, M., Hogan, P.G., Sharma, S., Lamperti, E., Chung,
Donovan, S., Shannon, K.M., and Bollag, G. (2002). GTPase activating W., Prakriya, M., Feske, S., and Rao, A. (2008). Dual functions for the endo-
proteins: critical regulators of intracellular signaling. Biochim. Biophys. Acta plasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and
1602, 23–45. tolerance. Nat. Immunol. 9, 432–443.
Parekh, A.B., and Putney, J.W., Jr. (2005). Store-operated calcium channels.
Downward, J. (1996). Control of ras activation. Cancer Surv. 27, 87–100.
Physiol. Rev. 85, 757–810.
Durr, G., Strayle, J., Plemper, R., Elbs, S., Klee, S.K., Catty, P., Wolf, D.H., and
Park, C.Y., Hoover, P.J., Mullins, F.M., Bachhawat, P., Covington, E.D.,
Rudolph, H.K. (1998). The medial-Golgi ion pump Pmr1 supplies the yeast
Raunser, S., Walz, T., Garcia, K.C., Dolmetsch, R.E., and Lewis, R.S. (2009).
secretory pathway with Ca2+ and Mn2+ required for glycosylation, sorting,
STIM1 clusters and activates CRAC channels via direct binding of a cytosolic
and endoplasmic reticulum-associated protein degradation. Mol. Biol. Cell
domain to Orai1. Cell 136, 876–890.
9, 1149–1162.
Potier, M., Gonzalez, J.C., Motiani, R.K., Abdullaev, I.F., Bisaillon, J.M., Singer,
Faddy, H.M., Smart, C.E., Xu, R., Lee, G.Y., Kenny, P.A., Feng, M., Rao, R.,
H.A., and Trebak, M. (2009). Evidence for STIM1- and Orai1-dependent store-
Brown, M.A., Bissell, M.J., Roberts-Thomson, S.J., et al. (2008). Localization
operated calcium influx through ICRAC in vascular smooth muscle cells: role in
of plasma membrane and secretory calcium pumps in the mammary gland.
proliferation and migration. FASEB J. 23, 2425–2437.
Biochem. Biophys. Res. Commun. 369, 977–981.
Reinhardt, T.A., Lippolis, J.D., Shull, G.E., and Horst, R.L. (2004). Null mutation
Fukasawa, K. (2007). Oncogenes and tumour suppressors take on centro-
in the gene encoding plasma membrane Ca2+-ATPase isoform 2 impairs
somes. Nat. Rev. Cancer 7, 911–924.
calcium transport into milk. J. Biol. Chem. 279, 42369–42373.
Garside, V.C., Kowalik, A.S., Johnson, C.L., Direnzo, D., Konieczny, S.F., and
Roderick, H.L., and Cook, S.J. (2008). Ca2+ signalling checkpoints in cancer:
Pin, C.L. (2010). Mist1 regulates the pancreatic acinar cell expression of
remodelling Ca2+ for cancer cell proliferation and survival. Nat. Rev. Cancer 8,
ATP2C2, the gene encoding secretory pathway Ca2+-ATPase 2. Exp. Cell.
361–375.
Res., Published online June 23, 2010. 10.106/j.yexcr.2010.06.014.
Roos, J., DiGregorio, P.J., Yeromin, A.V., Ohlsen, K., Lioudyno, M., Zhang, S.,
Gwack, Y., Feske, S., Srikanth, S., Hogan, P.G., and Rao, A. (2007). Signalling
Safrina, O., Kozak, J.A., Wagner, S.L., Cahalan, M.D., et al. (2005). STIM1, an
to transcription: store-operated Ca2+ entry and NFAT activation in lympho-
essential and conserved component of store-operated Ca2+ channel function.
cytes. Cell Calcium 42, 145–156.
J. Cell Biol. 169, 435–445.
Hogan, P.G., Chen, L., Nardone, J., and Rao, A. (2003). Transcriptional regu- van de Vijver, M.J., He, Y.D., van’t Veer, L.J., Dai, H., Hart, A.A., Voskuil, D.W.,
lation by calcium, calcineurin, and NFAT. Genes Dev. 17, 2205–2232. Schreiber, G.J., Peterse, J.L., Roberts, C., Marton, M.J., et al. (2002). A gene-
Huang, G.N., Zeng, W., Kim, J.Y., Yuan, J.P., Han, L., Muallem, S., and Worley, expression signature as a predictor of survival in breast cancer. N. Engl.
P.F. (2006). STIM1 carboxyl-terminus activates native SOC, I(crac) and TRPC1 J. Med. 347, 1999–2009.
channels. Nat. Cell Biol. 8, 1003–1010. Vanoevelen, J., Dode, L., Van Baelen, K., Fairclough, R.J., Missiaen, L.,
Huster, D., and Lutsenko, S. (2003). The distinct roles of the N-terminal Raeymaekers, L., and Wuytack, F. (2005). The secretory pathway Ca2+/Mn2+-
copper-binding sites in regulation of catalytic activity of the Wilson’s disease ATPase 2 is a Golgi-localized pump with high affinity for Ca2+ ions. J. Biol.
protein. J. Biol. Chem. 278, 32212–32218. Chem. 280, 22800–22808.

Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc. 97


Vig, M., and Kinet, J.P. (2007). The long and arduous road to CRAC. Cell Wu, S., Skolnick, J., and Zhang, Y. (2007). Ab initio modeling of small proteins
Calcium 42, 157–162. by iterative TASSER simulations. BMC Biol. 5, 17.
Vig, M., Beck, A., Billingsley, J.M., Lis, A., Parvez, S., Peinelt, C., Koomoa,
D.L., Soboloff, J., Gill, D.L., Fleig, A., et al. (2006). CRACM1 multimers form Xiang, M., Mohamalawari, D., and Rao, R. (2005). A novel isoform of the secre-
the ion-selective pore of the CRAC channel. Curr. Biol. 16, 2073–2079. tory pathway Ca2+,Mn(2+)-ATPase, hSPCA2, has unusual properties and is
expressed in the brain. J. Biol. Chem. 280, 11608–11614.
Wei, Y., Marchi, V., Wang, R., and Rao, R. (1999). An N-terminal EF hand-like
motif modulates ion transport by Pmr1, the yeast Golgi Ca(2+)/Mn(2+)- Yang, S., Zhang, J.J., and Huang, X.Y. (2009). Orai1 and STIM1 are critical for
ATPase. Biochemistry 38, 14534–14541. breast tumor cell migration and metastasis. Cancer Cell 15, 124–134.
Wei, Y., Chen, J., Rosas, G., Tompkins, D.A., Holt, P.A., and Rao, R. (2000).
Phenotypic screening of mutations in Pmr1, the yeast secretory pathway Yeromin, A.V., Zhang, S.L., Jiang, W., Yu, Y., Safrina, O., and Cahalan, M.D.
Ca2+/Mn2+-ATPase, reveals residues critical for ion selectivity and transport. (2006). Molecular identification of the CRAC channel by altered ion selectivity
J. Biol. Chem. 275, 23927–23932. in a mutant of Orai. Nature 443, 226–229.

98 Cell 143, 84–98, October 1, 2010 ª2010 Elsevier Inc.


Cell Surface- and Rho GTPase-Based
Auxin Signaling Controls Cellular
Interdigitation in Arabidopsis
Tongda Xu,1 Mingzhang Wen,1 Shingo Nagawa,1 Ying Fu,1 Jin-Gui Chen,2 Ming-Jing Wu,2
Catherine Perrot-Rechenmann,3 Jirı́ Friml,4 Alan M. Jones,2,5 and Zhenbiao Yang1,*
1Center for Plant Cell Biology, Department of Botany and Plant Sciences, University of California, Riverside, CA 92521, USA
2Department of Biology, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599, USA
3Institut des Sciences du Végétal, CNRS, UPR2355, 1 Avenue de la Terrasse, 91198 Gif sur Yvette Cedex, France
4Department of Plant Systems Biology, VIB, and Department of Molecular Genetics, Ghent University, Technologiepark 927,

9052 Gent, Belgium


5Department of Pharmacology, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599, USA

*Correspondence: yang@ucr.edu
DOI 10.1016/j.cell.2010.09.003

SUMMARY cytosolic Ca2+ increase, and proton secretion (Badescu and


Napier, 2006; Senn and Goldsmith, 1988; Shishova and Lind-
Auxin is a multifunctional hormone essential for plant berg, 2004; Vanneste and Friml, 2009). AUXIN BINDING
development and pattern formation. A nuclear auxin- PROTEIN1 (ABP1) has been proposed to be an auxin receptor
signaling system controlling auxin-induced gene that rapidly activates cell expansion (Badescu and Napier,
expression is well established, but cytoplasmic auxin 2006; Chen et al., 2001a, 2001b; Jones, 1994). ABP1 knockout
signaling, as in its coordination of cell polarization, causes lethality of early embryos due to their failure to polarize
(Chen et al., 2001b). Auxin is also implicated in the regulation
is unexplored. We found a cytoplasmic auxin-
of cell polarization including polar distribution of the auxin efflux
signaling mechanism that modulates the interdigi-
facilitator PIN (PINFORMED) proteins to the plasma membrane
tated growth of Arabidopsis leaf epidermal pavement (PM) and determination of root hair initiation sites in the root
cells (PCs), which develop interdigitated lobes and epidermal cells (Dhonukshe et al., 2008; Fischer et al., 2006;
indentations to form a puzzle-piece shape in a two- Paciorek et al., 2005). However, signaling events downstream
dimensional plane. PC interdigitation is compro- of ABP1 and those underlying the control of cell polarization by
mised in leaves deficient in either auxin biosynthesis auxin are unknown.
or its export mediated by PINFORMED 1 localized Coordinated spatial control of cell expansion or asymmetry
at the lobe tip. Auxin coordinately activates two across an entire field of cells in a tissue is important for pattern
Rho GTPases, ROP2 and ROP6, which promote the formation and morphogenesis. In animals, this type of spatial
formation of complementary lobes and indentations, coordination is required for cellular intercalation that drives
convergent extensions during early embryogenesis (Green and
respectively. Activation of these ROPs by auxin
Davidson, 2007; Heasman, 2006). In plants, PIN proteins are
occurs within 30 s and depends on AUXIN-BINDING
located to one cell end in a specific tissue to generate directional
PROTEIN 1. These findings reveal Rho GTPase- flow of auxin (Petrasek et al., 2006; Wisniewska et al., 2006). In
based auxin-signaling mechanisms, which modulate addition, spatial coordination among epidermal cells is important
the spatial coordination of cell expansion across for patterning of the epidermal tissues such as the positioning of
a field of cells. root hairs and the jigsaw-puzzle appearance of pavement cells
(PCs) in the leaf (Fischer et al., 2006; Fu et al., 2005, 2002). The
INTRODUCTION molecular mechanisms underlying the spatial coordination in
these plant systems are poorly understood.
Auxin regulation of plant growth and development requires We used Arabidopsis leaf epidermal PCs as a model system to
a nuclear signaling mechanism, which involves auxin stabilizing investigate the mechanisms for the cell-cell coordination of inter-
the interaction between the TIR1-family F box proteins and the digitated cell expansion (Fu et al., 2005, 2002; Settleman, 2005;
IAA/AUX transcriptional repressors, leading to IAA/AUX degra- Yang, 2008). The jigsaw-puzzle appearance results from interca-
dation and changes in gene expression (Leyser, 2006; Parry lary growth that produces interdigitated lobes and indentations
and Estelle, 2006; Dharmasiri et al., 2005a; Kepinski and Leyser, (Figure 1A). This cellular interdigitation resembles embryonic
2005; Mockaitis and Estelle, 2008; Tan et al., 2007). However, cell intercalation required for convergent extension in animal
this pathway cannot account for auxin-induced rapid cellular cells. Interestingly, these two distinct processes share common
responses occurring within minutes, such as cell expansion, mechanisms, including Rho GTPase signaling and its effect on

Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc. 99


Figure 1. Auxin Activation of PC Interdigitation Requires ROP2/4
(A) A schematic showing three stages of PC morphogenesis as described (Fu et al., 2005).
(B) Auxin increased interdigitation of WT PCs and suppresses the PC interdigitation defect in the yuc1 yuc2 yuc4 yuc6 (yuc 1/2/4/6) quadruple mutant but not in
the ROP2RNAi rop4-1. Seedlings were cultured in liquid MS with or without 20 nM NAA, and cotyledon PCs were imaged 4 days after stratification.
(C) Quantitative analysis of PC interdigitation. The degree of interdigitation in PCs shown in (B) was quantified by determining the density of lobes for each PC
(Figure S1A). Data are mean lobe number per mm2 ± SD (n > 400 cells from three individual plants). The yuc mutant had a significantly lower density of lobes than
Col-0 wild-type, and NAA significantly increased the mean density of lobes in Col-0 WT and the yuc mutant (t test, p < 0.001) but not in the ROP2RNAi rop4-1 line
(t test, p > 0.1). Nonbiased double blind analysis confirms all of the phenotypic differences between mutants and treatments (Figure S1B).
Also see Figure S1.

the cytoskseleton (Fu et al., 2005; Settleman, 2005; Yang, 2008). plasmic events including cytoskeletal organization, PIN protein
ROP2 and ROP4, two functionally-overlapping members of the targeting, and spatially coordinated cell expansion.
Rho GTPase family in Arabidopsis, promote lobe development
(Fu et al., 2005, 2002). ROP2, locally active at the lobe-forming RESULTS
site, promotes the formation of cortical diffuse F-actin and lobe
outgrowth via its effector RIC4 (Fu et al., 2005). In the lobe tips, Auxin Promotes and Is Required for PC Interdigitation
ROP2 suppresses well-ordered cortical microtubule (MT) arrays Given the widespread role of auxin in plant pattern formation, we
by inactivating another effector, RIC1 (Fu et al., 2005, 2002), thus evaluated its involvement in the interdigitated growth of PCs in
relieving MT-mediated outgrowth inhibition. In the opposing Arabidopsis. We first examined the effect of exogenous auxin
indenting zone, ROP6 activates RIC1 to promote well-ordered on the degree of PC interdigitation, which was measured by
MTs and to suppress ROP2 activation (Fu et al., 2005, 2009). the number of lobes per cell area in a two-dimensional plane of
What activates the ROP2 and ROP6 pathways and how these the leaf surface (Figure S1A available online). Treatments of
two pathways coordinate across cells to produce the cellular wild-type (WT) seedlings with the synthetic auxin naphthalene-
interdigitation remains unknown. 1-acetic acid (NAA) significantly increased PC interdigitation in
In this report, we demonstrate that auxin promotes interdigi- a dose-dependent manner with an effective NAA concentration
tated PC expansion by coordinately activating the antagonistic as low as 5 nM and optimal concentration around 20 nM (Figures
ROP2 and ROP6 pathways in an ABP1-dependent manner and 1B and 1C and Figure S1C).The requirement of endogenous
that ROP2 is required for the targeting of PIN1 to the lobing auxin for PC interdigitation was investigated using mutants
regions of the PM, which is crucial for the interdigitated PC defective in YUCCA gene family-dependent auxin biosynthesis
expansion. These findings establish a molecular framework (Cheng et al., 2006; Zhao et al., 2001). The cotyledon PCs of
underpinning cellular interdigitation as well as an auxin-signaling the yuc1 yuc2 yuc4 yuc6 quadruple mutant, which accumulates
mechanism that is downstream of ABP1 and required for cyto- a lower amount of auxin than the wild-type (Cheng et al., 2006),

100 Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc.


Figure 2. Auxin Rapidly Activates ROP2 and ROP6
in a Dosage-Dependent Manner
(A and C) Auxin dosage responses of ROP2 and ROP6
activation. Protoplasts from leaves of transgenic GFP-
ROP2 or -ROP6 seedlings were treated with the indicated
concentrations of NAA for 2 min (A), or treated with 100 nM
NAA for the indicated times (C). GTP-bound active
GFP-ROP2 or -ROP6 and total GFP-ROP2 or -ROP6
(GDP and GTP forms) were analyzed as described
in text. Results from one out of five independent experi-
ments with similar results are shown. ROP2 and ROP6
experiments were conducted in parallel under identical
conditions.
(B and D) Quantitative analysis of data from (A) and (C). The
relative ROP2 or ROP6 activity level was determined as
the amount of GTP-bound ROP2 or ROP6 divided by
the amount of total GFP-ROP2 or ROP6. The relative
ROP activity in different treatments was standardized to
that from mock-treated control, which was arbitrarily
defined as ‘‘1.’’ Data are mean activity levels from five
independent experiments ± SD. We tested the significance of difference in ROP activity level between ROP2 and ROP6 at various auxin levels using F-test. All
the p values are less than 0.001 except at 0 and 1 nM of auxin. We also compared mean values of ROP activity level using Tukey pairwise mean comparisons
and found that ROP2 activity significantly increased at lower auxin levels, stabilized at median auxin levels, and significantly decreased at high auxin levels. In
contrast, ROP6 activity significantly increased at low and median levels and stabilized at high auxin levels.
Also see Figure S2.

exhibited reduced interdigitation (Figures 1B and 1C). This yuc1 F-actin, a RIC4 signaling target, was also markedly reduced in
yuc2 yuc4 yuc6 PC phenotype resembled that of the ROP2RNAi the yuc quadruple-mutant PCs as in the ROP2RNAi rop4-1
rop4-1 line (Figures 1B and 1C), in which ROP2 and ROP4 PCs (Fu et al., 2005) (Figure S2C). Taken together, our results
expression is reduced (Fu et al., 2005). Interestingly, NAA treat- indicate that auxin is required for localized ROP2 activation in
ment rescued the interdigitation defect of the yuc quadruple the lobing region of PCs.
mutant but not that of the ROP2RNAi rop4-1 line (Figures 1B
and 1C; Figures S1C and S1D). These results suggest that auxin ABP1 Is Required for Auxin Promotion of PC
is a signal that induces lobe formation possibly by activating Interdigitation
ROP2 and ROP4. There are two well-characterized receptor families in Arabidop-
sis, ABP1 and TIR1 proteins. The TIR1-family of F box proteins
Auxin Activates the ROP2-RIC4 Pathway at the PM directly controls auxin-induced gene expression (Leyser, 2006;
To test whether auxin activates ROP2, we first determined the Mockaitis and Estelle, 2008) and is unlikely to mediate ROP2
effect of auxin on ROP2 activity using an effector binding-based activation and other responses that are rapidly induced by auxin
assay (Baxter-Burrell et al., 2002) to measure active GTP-bound within 30 s (Badescu and Napier, 2006), since the most rapid
GFP-ROP2 in protoplasts isolated from Arabidopsis leaves auxin-induced changes in mRNA expression occur within
stably expressing GFP-ROP2. We found that ROP2 activity 2-5 min after auxin treatments (Abel and Theologis, 1996).
doubled by addition of as low as 1 nM NAA and reached satura- ABP1 is partially localized to the outer surface of the PM by asso-
tion at 20–100 nM NAA (Figures 2A and 2B), which is consistent ciating with a GPI-anchored PM protein (Badescu and Napier,
with the concentrations of NAA for the induction of PC interdig- 2006; Jones, 1994; Shimomura, 2006; Steffens et al., 2001).
itation (Figures S1C and S1F). Time course analysis showed that Because null alleles of abp1 are embryo lethal (Chen et al.,
ROP2 activity doubled within 30 s after NAA treatment (Figure 2C 2001b), we isolated a weak allele, abp1-5, containing a point
and 2D). This is one of the most rapid auxin responses known to mutation (His94- > Tyr) in the auxin-binding pocket (Woo et al.,
date, which suggests that auxin perception directly leads to 2002) (Figure 3A). PCs of abp1-5 cotyledons showed a defect
ROP2 activation at the PM. similar to that observed in the yuc quadruple mutant (Figure 3B
Localization of GFP-RIC4 to the PM is a display of in vivo acti- and 3C; Figure 1B and 1C). This defect was rescued to WT
vation of ROP2, because RIC4 specifically binds the active form by transgenic expression of ABP1 (Figure S3A and S3B), con-
of PM-delimited ROPs (Fu et al., 2005; Hwang et al., 2005). In firming that the abp1-5 defect was due to the abp1-5 mutation.
wild-type PCs, GFP-RIC4 was preferentially localized to the The role of ABP1 in PC interdigitation was further confirmed
PM domains associated with initiating or growing lobes where by inducible expression of an ABP1 antisense RNA and a
ROP2 is activated. In the yuc quadruple mutant, GFP-RIC4 local- RNA encoding single-chain fragment variable 12 derived from
ization to these PM domains was reduced, with a corresponding anti-ABP1 mAb12 antibody (Braun et al., 2008) (Figures 3D
increase of its level in the cytoplasm (Figures S2A and S2B). and 3E and Figures S3C and S3D). Unlike PCs in the yuc
Treatment with 20 nM auxin increased PM-associated GFP- quadruple mutant, exogenous auxin did not induce lobe forma-
RIC4 in this mutant (Figures S2A and S2B), but not in the tion in PCs containing the abp1-5 mutation or expressing
rop2-1 rop4-1 double mutant (data not shown). Fine cortical ABP1 antisense RNA (Figures 3B–3E and Figure S1E). Thus,

Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc. 101


Figure 3. ABP1 Is Required for Auxin Perception that Promotes PC Interdigitation
(A) The abp1-5 mutation (His59- > Tyr) occurs within the auxin binding pocket (Woo et al., 2002). (Left) The crystal structure of maize ABP1 with bound NAA (PDB
1lrh). Maize ABP1 is a glycosylated homodimer that binds two NAA molecules (shown in red). Maize and Arabidopsis share 68% identity overall and 100% conser-
vation in the binding pocket. (Right) The auxin-binding pocket is highlighted to show how H59 (sphere format) interacts with the carboxic acid group of NAA shown
in red and with a zinc ion not shown (for clarity).
(B) Defect in PC interdigitation in the abp1-5 mutant was not rescued by auxin. Seedlings were cultured in liquid MS with or without 20 nM NAA, and cotyledon
PCs were imaged 4 days after stratification.
(C) PC interdigitation shown in (B) was quantitated as in Figure 1C (n > 400 cells from three individual plants). WT had significantly higher lobe intensity than abp1-5
(t test, p < 0.001). No significant difference was found between treatment with or without NAA (t test, p > 0.1).
(D) The defect in PC interdigitation in an inducible ABP1 antisense line was not rescued by auxin. An ABP1 antisense construct was expressed upon ethanol
treatment (Braun et al., 2008). Seedlings were cultured in liquid MS containing 0.5% ethanol with or without NAA, and cotyledon PCs were imaged 4 days after
stratification.Without ethanol treatment, the PCs in this line were similar to WT PCs (Figure S3C). Upon ethanol induction, ABP1 antisense PCs were similar to the
abp1-5 cells and were not altered by NAA.
(E) PC interdigitation in the antisense line shown in (C) was quantitated as in Figure 1C (n > 400 cells from three individual plants). WT had a significantly higher lobe
density than the ABP1 antisense line in the absence of NAA (t test, p < 0.001), which did not show significant difference with NAA treatment (t test, p > 0.1).
A double-blind analysis was performed and the results confirmed all of the phenotypic differences between mutants and treatments described in this figure (see
Figure S3E).

we hypothesize that ABP1 perceives the auxin signal required for (Figure S4C). Thus, ROP2 signaling is greatly compromised by
PC interdigitation. abp1-5. Furthermore, the defect in RIC4 localization in the
abp1-5 mutant could not be rescued by auxin (Figure S4A).
ABP1 Is Required for Auxin Activation Finally, both the analysis of GFP-RIC4 localization and measure-
of the ROP2-RIC4 Pathway ment of GTP-bound ROP2 showed that the rapid auxin activa-
We next tested whether ABP1 is required for the auxin activation tion of ROP2 in protoplasts was abolished by the abp1-5
of the ROP2 pathway. The abp1-5 mutation greatly reduced mutation and ABP1 antisense expression (Figures 4A and 4B
GFP-RIC4 localization to the lobe tip and PM (Figures S4A and and Figures S4D–S4F). Hence, ABP1 acts upstream of ROP2
S4B), as well as localized accumulation of diffuse cortical F-actin in the perception of auxin.

102 Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc.


Figure 4. Auxin Can Activate ROP2-RIC4 Pathway
through ABP1
(A) Measurement of GTP-bound GFP-ROP2 in protoplasts
isolated from a abp1-5 line stably expressing 35S::GFP-
ROP2 by coimmunoprecipitation assay described in
Figure 2. The seedlings expressing GFP and homozygous
for abp1-5 were pooled and used for protoplast isolation.
Auxin did not activate ROP2 in abp1-5 mutants compared
to in wild-type where auxin activates ROP2 within 30 s
(Figure 2C).
(B and C): Loss of auxin activation of ROP2 in the abp1-5
mutant and the induced ABP1 antisense line. GFP-RIC4
distribution to the PM in isolated protoplasts was used
to report ROP2 activation by auxin. (B) Representative
images of GFP-RIC4 distribution in protoplasts isolated
from different lines before and 5 min after auxin applica-
tion. The bright field images (left) show intact protoplasts
corresponding to the GFP-RIC4 fluorescent images at
time 0. See Figures S4D-S4F for representative images
from the complete time course analysis. (C) Quantitative
analysis of GFP-RIC4 distribution to the PM (as indicated
by relative GFP intensity in the PM standardized with the
cytosolic GFP intensity). Data are mean values from 10
protoplasts analyzed ± SD.
Also see Figure S4.

ROP2-Dependent Lobe-Localized PIN1 Is Required Auxin Also Activates the ROP6-RIC1 Pathway
for Interdigitation in an ABP1-Dependent Manner
The presence of ABP1 at the cell surface (Diekmann et al., 1995; PIN1-exported auxin in the lobing side is expected to
Jones and Herman, 1993; Leblanc et al., 1999) and ROP2 local- diffuse across the cell wall to the complementary side of the
ization to the lobe PM imply that the perception of extracellular neighboring cell, where the ROP6-RIC1 pathway operates (Fu
auxin leads to localized ROP2 activation. Thus, a mechanism et al., 2009). We speculated that PIN1-exported auxin could
for local accumulation of extracellular auxin is expected. In serve as a cross-cell signal to activate the ROP6-RIC1 pathway,
support of this notion, we found PIN1 preferentially localized to hence providing a mechanism for the cell-cell coordination of
the PM of PC lobe tips (Figure 5A). PCs of a PIN1 loss-of-function lobe outgrowth with indentation formation. Interestingly, the
mutant, pin1-1, showed a defect in interdigitation, and were long quadruple yuc and single abp1-5 mutants exhibited an additional
and narrow (Figure 5B and Figures S5A and S5B), resembling the cell shape phenotype observed in rop6-1 and ric1-1 (Fu et al.,
ROP2RNAi rop4-1 line (Fu et al., 2005). Another allele, pin1-5, 2005, 2009), specifically, wider neck regions (Figures 6A and 6B).
showed a similar phenotype (Figures S5E and S5F). GFP-RIC4 The wide neck phenotype suggests that auxin and ABP1 may
localization to the PM was compromised in the pin1-1 mutant also activate the ROP6-RIC1 pathway, which promotes indent-
with GFP-RIC4 diffusely distributed in the cytosol (Figures 5D ing. Thus we sought to test whether ABP1 perception of auxin
and 5E). Application of NAA failed to rescue the lobing defect activates the ROP6-RIC1 pathway.
in the pin1-1 mutant (Figures 5B and 5C and Figures S5A and ROP6 is required for RIC1 decoration of cortical MTs like
S5B), supporting a critical role for PIN1-mediated localized auxin beads on a string and for its function in promoting the ordering
export in lobe formation and localized ROP2 activation. This also of cortical MTs (Fu et al., 2009). If auxin is required for ROP6 acti-
implies a role for PIN1 in a positive feedback, i.e., PIN1 localiza- vation, one would expect that RIC1’s association with cortical
tion to the lobe tip may require ROP2 activation. Consistent with MTs is disrupted in the abp1-5 and the yuc quadruple mutant,
this implication, PIN1 localization to the PM was compromised in as in the rop6-1 null mutant (Fu et al., 2009). Indeed, RIC1 asso-
the ROP2RNAi rop4-1 line, the abp1-5 mutant, and the ABP1 ciation with cortical MTs was greatly abolished in both yuc
antisense line, which all showed greatly enhanced PIN1 internal- quadruple and abp1-5 single mutant PCs (Figure 6C and
ization and reduced localization to the lobe PM (Figure 5A, right Figure S6A). Consistent with the defect of RIC1 distribution,
panel and Figures S5G and S5H). Transient expression of a domi- the arrangement of cortical MTs in these mutants became mostly
nant negative ROP2 mutant protein also increased PIN1-GFP random, similar to that seen in rop6-1 and ric1-1 mutants
internalization, suggesting that PIN1 localization to the PM is (Figure S6B). This indicates that auxin and ABP1 are required
directly affected by ROP2 signaling, not indirectly through for the activation of the ROP6-RIC1 pathway.
ROP2/4-mediated cell shape changes (Figures S5C and S5D). We next tested whether auxin promoted RIC1 association with
Taken together, these results support the hypothesis that a cortical MTs. We previously showed that ROP2 inhibits RIC1
PIN1-dependent positive feedback loop is required for localized function by sequestering RIC1 from cortical MTs in PCs. To
ROP2 signaling and lobe outgrowth. This also implies a role for circumvent the possible complication of the ROP2 effect on
localized extracellular auxin in the regulation of interdigitation. RIC1 localization (Fu et al., 2005), we analyzed YFP-RIC1

Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc. 103


Figure 5. PIN1 Is Localized to the Lobe Tip and Is Essential for Auxin Promotion of PC Interdigitation
(A) Left: PIN1-GFP was preferentially localized to the tip of lobes in PC. Middle: Immunostaining of PIN1 in PCs. Arrows indicates the accumulation of PIN1 at
the lobe region. Right: Immunostaining of PIN1 in ROP2RNAi rop4-1 mutant. Arrows (yellow) indicates the accumulation of PIN1 at the lobe region was lost in
ROP2RNAi rop4-1. Arrowheads indicate internalized PIN1, which was greatly increased in the cytoplasm of ROP2RNAi rop4-1 cells. 75 cells from 3 repeats
are used for quantification (Figure S5H).
(B) PC shapes in wild-type (left) and pin1-1 mutant (middle). pin1-1 PCs were slender with few lobes, a phenotype similar to a rop2-1rop4-1 double knockout
mutant (data not shown). 20 nM NAA was unable to rescue pin1-1 phenotype in PCs (right).
(C) Quantitative data for (B). Lobe numbers per cell area in pin1-1 mutant and pin1-1 mutant treated with 20 nM NAA were quantified using double blind analysis as
described in Figure. S3. pin1-1 cells showed significantly reduced lobe formation compared to wide type (n = 400, t test p < 0.001), and 20 nM NAA did not rescue
this phenotype (n = 400, t test p > 0.1). Higher NAA concentrations had no effect on the pin1-1 phenotype either (Figures S5A and S5B).
(D) GFP-RIC4 distribution pattern in PCs of wild-type and pin1-1 mutant. GFP-RIC4 was localized to the cell cortex preferentially in lobe tips or lobe emergent
sites of wild-type PCs but was mostly diffuse in the cytosol in pin1-1 PCs.
(E) Quantitative analysis of the cortical GFP-RIC4 signal was performed as described in Figure. S2. Cortical signal of GFP-RIC4 dramatically decreased in pin1-1
mutant (n > 25, t test p < 0.001).
Also see Figure S5.

localization in the rop2-1 rop4-1 mutant, in which ROP2 function the number of YFP-RIC1 beads and their intensity greatly
is compromised. YFP-RIC1 appeared as beads lining cortical increased as rapidly as 4 min after NAA application (Figures 6E
MTs (Figures 6C and 6D) (Fu et al., 2005). Ten minutes after and 6F). In abp1-5, auxin failed to change the localization pattern
the application of 10 nM NAA, the number of YFP-RIC1 associ- of RIC1 (Figures 6D–6G), suggesting that ABP1 acts upstream of
ated MTs increased, and MTs became more ordered, especially ROP6. These results support the hypothesis that auxin activates
in the indented region of the PC (Figure 6D). Furthermore, both the ROP6-RIC1 pathway in an ABP1-dependent manner.

104 Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc.


Figure 6. Auxin Activates the ROP6-RIC1 Pathway through ABP1
(A) PCs in both yuc1/2/4/6 and abp1-5 have wider neck regions than WT, similar to both rop6-1 and ric1-1 mutants (Fu et al., 2009, 2005), but different from
ROP2RNAi rop4-1, which has a narrower neck (Fu et al., 2005).
(B) Quantitative analysis of PCs phenotype showed that both yuc1/2/4/6 (t test, p < 0.01) and abp1-5 (t test, p < 0.001) had significantly wider neck regions than
WT. Data are mean neck width ± SD (n > 400 cells).
(C) YFP-RIC1 formed dot-like structures along cortical MTs in WT cells (left) (Fu et al., 2005, 2009). In yuc1/2/4/6 and abp1-5 cells, YFP-RIC1 lost its association
with MTs as in rop6-1 (n > 25). In rop6-1 mutants, YFP-RIC1 was mostly shifted to lobe regions (indicated by arrowheads) where ROP2 was presumably activated.
This YFP-RIC1 localization pattern is different from that in the yuc1/2/4/6 and abp1-5 mutants, where YFP-RIC1 became diffusely localized to the cytosol because
ROP2 is inactivated in these mutants.
(D) Auxin enhanced YFP-RIC1 association with cortical MTs in a rop2-1 rop4-1 mutant, but not in the abp1-5 mutant. PCs transiently YFP-RIC1 were treated with
NAA (10 nM) and imaged by confocal microscopy before and 10 min after treatment. In rop2-1 rop4-1 PCs, YFP-RIC1 was associated with MTs in a beads-on-a-
string pattern. NAA enhanced this localization pattern as indicated by arrowheads. In abp1-5 cells, the weak YFP-RIC1 association with MTs did not show the dotted
pattern and was not altered by NAA treatment. At least 15 cells were tracked for each mutant and showed similar response to NAA. The scale bar represents 10 mm.
(E) A time-course analysis of YFP-RIC1 association with MTs. At 4 and 8 min after NAA treatment, YFP-RIC1 dots gradually increased in both intensity and
number by auxin treatment in rop2-1 rop4-1 but not abp1-5 cells.
(F and G). Quantitative analysis of YFP-RIC1 dot number and intensity shown in (D) and (E). (F) YFP-RIC1 association with MTs was measured by the number of
YFP-RIC1 dots unit length of MTs. Data are mean dot number per mm ± SD (n = 50). (G) Average intensity of YFP-RIC1 dots was measured from 0 min to 8 min.
The intensity at time 0 was standardized as 1. Data are relative mean intensity compared to time 0 ± SD (n = 100).
(H). Auxin failed to increase ROP6 activity in abp1-5 muants. GTP-bound GFP-ROP6 in protoplasts isolated from a abp1-5 line stably expressing 35S::GFP-
ROP6 was analyzed as described in Figure 2.
Also see Figure S6.

Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc. 105


Auxin Activates ROP6 Rapidly of plants. Although our work here focuses on the roles of this
To further confirm auxin activation of the ROP6-RIC1 pathway, auxin-signaling mechanism in PC interdigitation, it is likely that
we determined the effect of auxin on ROP6 activity. Indeed, similar ABP1-ROP signaling pathways may operate in other plant
auxin treatments increased the amount of active ROP6 in a cells and tissues because of widespread expression and func-
dosage-dependent manner (Figures 2A and 2B). The range of tions of ABP1 and ROPs in plants (Braun et al., 2008; Chen
NAA concentrations for ROP6 activation was similar to that for et al., 2001a, 2001b; Fu et al., 2005, 2002, 2009; Jones, 1994;
ROP2 activation, but the saturation of ROP6 activation required Jones and Herman, 1993; Jones et al., 1998).
higher NAA levels. Like ROP2, ROP6 was rapidly activated within Our findings here do not exclude the involvement of ROPs
30 s after 100 nM NAA treatment (Figures 2C and 2D), consistent in the regulation of TIR1/AFB-dependent auxin responses. In
with a role for ABP1 in the perception of auxin that activates fact, it was shown in tobacco and Arabidopsis protoplasts that
ROP6. ABP1-dependent ROP6 activation by auxin was further expression of dominant-negative or constitutively active forms
demonstrated by our finding that the auxin-dependent increase of the tobacco NtRac1 ROP affected auxin-induced gene
in ROP6 activity was abolished by the abp1-5 mutation expression (Tao et al., 2002), and thus ROP may also regulate
(Figure 6H). The activation of two antagonizing ROPs (ROP2 the nuclear pathway in addition to the cytoplasmic pathways.
and ROP6) by the same auxin perception system with a similar
auxin response range but distinct saturation kinetics may ABP1 May Be a Cell-Surface Auxin Receptor
provide a mechanism for the localized activation of ROP2 and that Activates ROP2 and ROP6 Signaling
ROP6 in the complementary lobing and indenting sides by Here, we show ABP1 is required for the rapid activation of PM-
uniformly applied auxin (see Discussion). localized ROP2 and ROP6 by auxin. ABP1 is partially associated
with the outer surface of the PM through its binding to a GPI-
DISCUSSION anchored protein (Shimomura, 2006), and the cell surface-asso-
ciated ABP1 mediates auxin activation of cell expansion (Chen
The findings here have several important implications. First, et al., 2001a; Jones et al., 1998). Hence we propose that ABP1
these results establish a cytoplasmic auxin-signaling mecha- may be a cell surface receptor of auxin that controls PC interdig-
nism that is distinct from the TIR1-based nuclear auxin-signaling itation. This is also consistent with our finding that PIN1-
pathway and provides a perspective of auxin action at the mediated auxin export is required for ROP2 activation. ABP1 is
cellular level. Second, our findings give insights into hormonal not a transmembrane protein and likely works with a trans-
signaling leading to changes in the cytoskeleton and vesicular membrane partner or coreceptor, whose identification will be
trafficking, which is crucial for hormone action in plants yet crucial for understanding how auxin is perceived at the cell
scarcely studied. Third, we show that ABP1 acts upstream of surface and how it leads to ROP activation in the cytoplamic
ROP GTPase signaling, which gives an unprecedented under- side of the PM.
standing of signaling events downstream of the auxin perception
by ABP1, whose mode of action has been long sought for. A Working Model for the Coordination of Interdigitated
Finally, our results suggest that the ABP1- and ROP-dependent Cell Growth and Beyond
auxin signaling plays a pivotal role in the spatial coordination of We propose a working model for the auxin signaling pathways
cell expansion within and between cells during interdigitated required for interdigitated growth (i.e., development of comple-
growth of PCs. Since auxin is a multifunctional hormone polarly mentary lobes and indentations) in PCs (Figure 7). In this paper,
transported out of cells, this auxin-signaling mechanism could we demonstrate that ABP1-mediated auxin perception activates
serve as a common mode of intracellular and intercellular coor- both of the ROP2 and ROP6 pathways, which were previously
dination of cell growth, morphogenesis and polarity in plants. shown to be locally activated at opposing sides of the cell wall
but mutually exclusive along the PM within a PC (Fu et al.,
An Auxin-Signaling Mechanism Regulates Cytoplasmic 2005, 2009; Yang, 2008). At the steady state, therefore, simulta-
Pathways neous activation of ROP2 and ROP6 by localized extracellular
The TIR1/AFB-dependent nuclear auxin-signaling system is auxin must occur at the opposing sites (lobe and indentation
essential for auxin-mediated growth, development, and pattern- bordered by the cell wall) but not at the same site. A key aspect
ing that rely changes in gene expression (Dharmasiri et al., of this working model is the existence of an auxin-ROP2-PIN1-
2005a, 2005b; Kepinski and Leyser, 2005; Mockaitis and Estelle, auxin positive feedback loop, which acts together with the
2008). Previous work hints toward the existence of other auxin- antagonizing ROP6 pathway to generate the presumed localized
signaling mechanisms (Badescu and Napier, 2006), and our extracellular auxin. Importantly, this working model can explain
findings here clearly establish a distinct auxin-signaling mecha- how extracellular auxin coordinates lobe and indentation devel-
nism that exists in the cell boundary/cytoplasm and is capable of opment at the steady state, once the interdigitation pattern has
responding to auxin in seconds. Complementary to the TIR1 been initiated (i.e., the cell region for lobe formation or indenta-
nuclear pathway impacting auxin-mediated gene expression, tion has already been established).
the ABP1/ROP-dependent pathways directly regulate cytoplam- Positive feedback loop initiated by a stochastic local change
sic events such as actin and microtubule organization and PIN in Rho GTPase signaling has been proposed to be a mechanism
protein trafficking. Thus, our findings shed light into the dark for the establishment of self-organizing cell polarity in yeast
box of the mechanism by which auxin modulates cytoskeletal and animal cells (Altschuler et al., 2008; Hazak et al., 2010;
reorganization and cell morphogenesis in multicellular tissues Paciorek et al., 2005; Van Keymeulen et al., 2006; Xu et al.,

106 Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc.


Figure 7. A Working Model for Auxin
Control of Interdigitated Cell Growth
(A) A model for coordination of two ROP signaling
pathways by localized extracellular auxin, which
results from a PIN1-mediated positive feedback
loop.
(B) A model for auxin control of interdigitated
growth through inter- and intra-cellular coordina-
tion of the ROP2 and ROP6 pathways. We surmise
that the PC intergditated growth is controlled by an
auxin-dependent self-organizing mechanism. In
this mechanism, localized extracellular auxin,
which is generated by self-activation via the
auxin/ROP2/PIN1/auxin feedback loop and
self-maintenance via the antagonizing ROP6
pathway, controls cell-cell coordination of lobing
and indentating by activating the complementary
ROP2 and ROP6 pathways in two adjacent cells,
which are mutually exclusive within each cell to
allow for the formation of alternating lobes and
indentations (Fu et al., 2005, 2009).

2003). In neutrophil and other animal cells, the perception of of a role for ROP signaling in the modulation of PIN polarization,
uniform concentrations of chemoattractants by a single receptor Interactor of Constitutively active ROP 1 (ICR1), a likely ROP
leads to establishment of the frontness and backness polarity effector protein, was recently found to regulate PIN polarization
by activating two antagonistic cytoskeleton-regulating Rho both in Arabidopsis embryonic and root cells (Hazak et al., 2010).
GTPase pathways (Hazak et al., 2010; Paciorek et al., 2005; Importantly, ABP1 is shown to affect PIN protein localization in
Van Keymeulen et al., 2006; Xu et al., 2003). Similarly, the root cells and other types (Robert et al., 2010 [this issue of
activation of the antagonistic ROP2 and ROP6 pathways by Cell]), providing strong argument for a general role of the
the ABP1 perception of uniform concentrations of auxin could ABP1-ROP signaling in the modulation of PIN polarization.
also explain how uniformly applied auxin leads to the establish- Therefore we anticipate that the elucidation of the ROP-based
ment of cell cortical regions that define lobe- or indentation- cytoplasmic auxin signaling pathways in various auxin-mediated
forming sites to initiate the interdigitation pattern (Figures 1 processes will likely be an exciting and fertile area of research in
and 7). Therefore the self-organization design principles for the cell and developmental biology in the coming years.
spatial coordination of cell growth and movement might be
conserved in both single and multicellular tissue across eukary- EXPERIMENTAL PROCEDURES
otic kingdoms.
Our working model may serve as a unifying mechanism for the Plant Materials and Growth Conditions
coordination of cell morphogenesis and polarity within various Arabidopsis plants were grown at 22 C on MS agar plates or in soil with 16 hr
plant tissues. Auxin appears to orchestrate PIN polarization in light/8 hr dark cycles unless indicated otherwise. The DR5::GUS line and the
yuc1 yuc2 yuc4 yuc6 quadruple mutant were kindly provided by Tom Guilfoyle
files of cells directing auxin flow (Paciorek et al., 2005; Sauer
and Yunde Zhao, respectively (Cheng et al., 2006; Hagen and Guilfoyle, 2002).
et al., 2006) and in coordinating hair positioning in root-hair- The double-mutant ROP2RNAi rop4-1 line was described previously (Fu et al.,
forming cells (Fischer et al., 2006). The position of root hair 2005). The pin1-1 and pin1-5 mutants are T-DNA insertional lines obtained
formation can be predicted by the polar localization of ROP2 in from ABRC (SALK, CS8065, and 097144, respectively) and their genotypes
the hair forming cells (Jones et al., 2002), and ROP2 polar local- were confirmed by PCR analysis.
ization is affected by auxin (Fischer et al., 2006; Yang, 2008), The abp1-5 allele contains a missense mutation of C/G in the 94 codon of
the coding sequence. Tilling mutant abp1-5 was backcrossed 6 times with
raising the possibility that the auxin-mediated ROP signaling
Col-0 and genotyped by restriction digestion of PCR fragments (see Supple-
may also underlie the coordination of polar cell growth among mental Information for details). For genetic complementation, abp1-5 was
root epidermal cells. transformed with the Arabidopsis wild-type ABP1 cDNA driven by the 35S
Our working model here could also be used to explain how promoter.
auxin may coordinate the polarization of PIN proteins to the Conditional plants for ABP1 expression were obtained by expressing either
same cell end among a file of cells that direct auxin flow, i.e., a full-length antisense construct or the recombinant single-chain fragment
auxin could activate a ROP2-like pathway that forms a positive variable 12 derived from the monoclonal anti-ABP1 antibody mAb12 under
the control of the ethanol inducible system as described (Braun et al., 2008;
feedback loop at the end of PIN localization as well as
David et al., 2007). Ethanol induction was obtained by exposure of siblings
a ROP6-like pathway that antagonizes with the ROP2-like to ethanol vapor generated from 500 ml of 5% ethanol in a microtube placed
pathway at the side lacking PIN localization. Auxin was shown at the bottom of sealed square plate.
to inhibit PIN internalization in root cells (Dhonukshe et al.,
2008; Paciorek et al., 2005), which is also in agreement with Confocal and Imprinting Analysis of Leaf Arabidopsis PC Shape
our finding in this report that PIN1 internalization is increased PC shape from Arabidopsis cotyledons was imaged directly on confocal
when ROP2 function is compromised in PCs. In further support microscopy (Leica SP2) or indirectly by an imprinting method (Mathur and

Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc. 107


Koncz, 1997). Since PCs are auto-fluorescent, their cell outlines can be SP2 confocal microscope. The earliest possible time for imaging was 2 min
imaged on confocal microscopy with the following settings: excitation after NAA application. Time-lapse images were taken every 2–3 min.
351 nm or 364 nm, 50% laser power and emission 400-600 nm. For some
treatments, the cotyledons were curved, so analyzing cell shapes by confocal
Quantitative Analysis of GFP-RIC4 and YFP-RIC1 Localization
microscopy was difficult. In this case, an agarose imprinting method was used
The images of GFP-RIC4 localization in both PCs and protoplasts were taken
(Mathur and Koncz, 1997), and .cell outlines imprinted on the agarose were
by Leica SP2, and image analysis were conducted by Metamorph 4.5 using
imaged on bright field microscopy (Nikon). Additional image analyses involved
region function. First we created a region along cell cortex. The average inten-
use of Metamorph 4.5. The images are edited by photoshop 7.0 by adjusting
sity of GFP for this was calculated by Metamorph. Then we created a region
figure sizes and resolution and adding labels.
just inside of the cell cortex, which included all cytoplasm signals, and the
average cytoplasmic signal was calculated. The average signals were then
Ballistics-Mediated Transient Expression in Leaf Epidermal Cells
used to calculate the ratio of PM/Cyto.
Subcellular localization of GFP-RIC4, YFP-RIC1 and F-actin was analyzed
YFP-RIC1 was transiently expressed in PCs using the ballistics-mediated
by use of transiently-expressed pBI221:GFP-RIC4, pUC:YFP-RIC1 and
method as described above. Four to five hours after bombardments, leaves
pBI221:GFP-mTalin constructs as described previously (Fu et al., 2005,
were treated with 10 nM NAA, and time-series YFP-RIC1 images are taken
2002). We used 0.8 mg pBI221:GFP-mTalin, 1 mg pBI221:GFP-RIC4 and 1 mg
using a Leica SP2 confocal microscope 2 min after treatement. The average
pUC:YFP-RIC1 for particle bombardment. GFP and YFP signal was detected
intensity of YFP-RIC1 dots along MT and the length of MT bundle were directly
5 hr after bombardment by use of a Leica SP2 microscope (GFP: 488 nm exci-
measured by the Metamorph software, and the number of YFP-RIC1 dots was
tation, 25% power; excitation 520–600 nm, gain at 600; YFP: 514 nm excita-
counted by eyeballing. YFP-RIC1 dots No./mm indicates the number of YFP-
tion, 25% power; excitation 530–600 nm, gain at 600). Cells at stage II showing
RIC1 dots divided by MT length.
similar medium levels of GFP (Fu et al., 2005, 2002) were chosen for GFP
marker analysis. For 3D reconstruction, optical sections in 1.0 mm increments
were imaged for each cell by use of the Leica software. Immunolocalization of PIN1, RIC1, and MT in PCs
Whole-mount immunostaining of Arabidopsis leaves was previously described
Naphthalene-1-Acetic Acid Treatments (Fu et al., 2005; Wasteneys et al., 1997). Fixed, shattered and permeabilized
Naphthalene-1-acetic acid (NAA) (Sigma, St. Louis, MO) was dissolved in leaves were incubated with primary antibody (anti-PIN1 1:200, anti-RIC1
DMSO as 0.5 M stock solutions, which were diluted to the indicated concen- 1:100, anti-aTubulin 1:200) overnight at 4 C (Paciorek et al., 2005), and
trations in liquid MS (for seedling treatments) or W5 media (for protoplast treat- then incubated with the second antibody (FITC conjugated anti-rabbit IgG
ments). Seeds were germinated in the liquid MS media containing NAA or NPA. 1:200, TRITC conjugated anti-mouse IgG 1:200) for 2 hr at 37 C. Stained
Each treatment was repeated at least three times with the corresponding cells were observed in Leica SP2 confocal microscope. Cells at stage II
controls. (Fu et al., 2005, 2002) were chosen for comparison between wild-type and
mutant cells.
Protoplast Preparation and PEG-Mediated Transient Expression
Protoplast preparation and PEG-mediated transient expression were
SUPPLEMENTAL INFORMATION
described previously (Sheen, 2001). The 2nd or 3rd pair of rosette leaves
from 2- or 3-week-old seedlings was used to prepare protoplasts. Protoplasts
Supplemental Information includes Extended Experimental Procedures and
were counted by use of a hemacytometer (Hausser scientific, Cat # 1483). An
six figures and can be found with this article online at doi:10.1016/j.cell.
amount of 105–106 protoplasts were used for ROP2 activity assay, and104–105
2010.09.003.
protoplasts were used for transient expression.

ROP2 and ROP6 Activity Assays in Protoplasts ACKNOWLEDGMENTS


Two different methods were used to analyze auxin activation of ROP2 in proto-
plasts. The first method involves a biochemical assay, in which GFP-tagged We are grateful to Veronica Grieneisen, Ben Scheres, Athanasius F. M. Marée,
active ROP2 or ROP6 was pulled down by use of MBP-RIC1. Protoplasts Paulien Hogeweg, Xuemei Chen, and G. Venugopala Reddy for their stimu-
were isolated from leaves of 2- or 3-week old 35S::GFP-ROP2 or –ROP6 trans- lating discussion and critical comments on this manuscript; and to Xinping
genic seedlings as described previously (Jones et al., 2002; Sheen, 2001). Cui for her assistance with the statistical analysis. We are grateful to Tom Guil-
Isolated protoplasts were treated with different concentrations of NAA, or foyle and Yunde Zhao for their generous supply of Arabidopsis mutant lines
with 100 nM for various times and frozen by liquid nitrogen. Total protein used in this work. This work is supported by grants from the U.S. National Insti-
was extracted from 105–106 treated protoplasts. Twenty micrograms of tute of General Medical Sciences to Z.Y. (GM081451) and to A.M.J.
MBP-RIC1-conjugated agarose beads were added to the protoplast extracts, (GM065989), by the National Science Foundation to A.M.J. (MCB-0718202)
and incubated at 4 C for 3 hr. The beads were washed three times at 4 C and the Department of Energy to A.M.J. (DE-FG02-05ER15671) and to Z.Y.
(5 min each). GTP-bound GFP-ROP2 or -ROP6 that was associated with (DE-FG02-04ER15555) and by the Research Foundation-Flanders (Odysseus)
the MBP-RIC1 beads was used for analysis by western blotting with an anti- to J.F.
GFP antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Prior to the pull-
down assay, a fraction of total proteins was analyzed by immunoblot assay Received: March 13, 2010
to determine total GFP-ROP2 or -ROP6 (GDP-bound and GTP-bound). The Revised: June 2, 2010
amount of GTP-bound ROPs was normalized to that of total ROPs. The Accepted: July 30, 2010
level of GTP-bound ROPs relative to the control (0 nM NAA at 0 min) was Published: September 30, 2010
calculated by dividing the amount of normalized GTP-bound ROP2 or ROP6
from each treatment by the normalized amount from the control, which is
REFERENCES
defined as ‘‘1.’’
In the second method, changes in GFP-RIC4 localization to the PM were
Abel, S., and Theologis, A. (1996). Early genes and auxin action. Plant Physiol.
monitored in isolated protoplasts. Protoplasts were isolated from leaves of
111, 9–17.
wild-type plants (Col 0) or mutants as described above. Two micrograms of
a 35S::GFP-RIC4 construct was introduced into 104-105 protoplasts by Altschuler, S.J., Angenent, S.B., Wang, Y., and Wu, L.F. (2008). On the spon-
PEG-mediated transformation. Typically, 70%–80% of the protoplasts were taneous emergence of cell polarity. Nature 454, 886–889.
transformed. Protoplasts were incubated at 23 C for 5 hr to overnight, treated Badescu, G.O., and Napier, R.M. (2006). Receptors for auxin: will it all end in
with NAA (1 mM final concentration), and imaged immediately by use of a Leica TIRs? Trends Plant Sci. 11, 217–223.

108 Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc.


Baxter-Burrell, A., Yang, Z., Springer, P.S., and Bailey-Serres, J. (2002). Rop- Jones, A.M., and Herman, E. (1993). KDEL-containing, auxin-binding protein
GAP4-dependent Rop GTPase rheostat control of Arabidopsis oxygen depri- is secreted to the plasma membrane and cell wall. Plant Physiol. 101,
vation tolerance. Science 296, 2026–2028. 595–606.
Braun, N., Wyzykowaska, J., Couch, D., David, K., Muller, P., Perrot-Rechen- Jones, A.M., Im, K.H., Savka, M.A., Wu, M.J., DeWitt, N.G., Shillito, R., and
mann, C., and Fleming, A.J. (2008). Conditional Repression of AUXIN BINDING Binns, A.N. (1998). Auxin-dependent cell expansion mediated by overex-
PROTEIN 1 Shows That It Is Required During Post-Embryonic Shoot Develop- pressed auxin-binding protein 1. Science 282, 1114–1117.
ment and Implicates ABP1 as a Co-ordinator of Cell Division and Cell Expan- Jones, M.A., Shen, J.J., Fu, Y., Li, H., Yang, Z., and Grierson, C.S. (2002). The
sion. Plant Cell 20, 2746–2762. Arabidopsis Rop2 GTPase is a positive regulator of both root hair initiation and
Chen, J.G., Shimomura, S., Sitbon, F., Sandberg, G., and Jones, A.M. (2001a). tip growth. Plant Cell 14, 763–776.
The role of auxin-binding protein 1 in the expansion of tobacco leaf cells. Plant Kepinski, S., and Leyser, O. (2005). The Arabidopsis F-box protein TIR1 is an
J. 28, 607–617. auxin receptor. Nature 435, 446–451.
Chen, J.G., Ullah, H., Young, J.C., Sussman, M.R., and Jones, A.M. (2001b). Leblanc, N., David, K., Grosclaude, J., Pradier, J.M., Barbier-Brygoo, H.,
ABP1 is required for organized cell elongation and division in Arabidopsis Labiau, S., and Perrot-Rechenmann, C. (1999). A novel immunological
embryogenesis. Genes Dev. 15, 902–911. approach establishes that the auxin-binding protein, Nt-abp1, is an element
Cheng, Y., Dai, X., and Zhao, Y. (2006). Auxin biosynthesis by the YUCCA flavin involved in auxin signaling at the plasma membrane. J. Biol. Chem. 274,
monooxygenases controls the formation of floral organs and vascular tissues 28314–28320.
in Arabidopsis. Genes Dev. 20, 1790–1799. Leyser, O. (2006). Dynamic integration of auxin transport and signalling. Curr.
David, K.M., Couch, D., Braun, N., Brown, S., Grosclaude, J., and Perrot- Biol. 16, R424–R433.
Rechenmann, C. (2007). The auxin-binding protein 1 is essential for the control Mathur, J., and Koncz, C. (1997). Method for preparation of epidermal imprints
of cell cycle. Plant J. 50, 197–206. using agarose. Biotechniques 22, 280–282.
Dharmasiri, N., Dharmasiri, S., and Estelle, M. (2005a). The F-box protein TIR1 Mockaitis, K., and Estelle, M. (2008). Auxin receptors and plant development:
is an auxin receptor. Nature 435, 441–445. A new signaling paradigm. Annu. Rev. Cell Dev. Biol. 24, 55–80.
Dharmasiri, N., Dharmasiri, S., Weijers, D., Lechner, E., Yamada, M., Paciorek, T., Zazimalova, E., Ruthardt, N., Petrasek, J., Stierhof, Y.D.,
Hobbie, L., Ehrismann, J.S., Jurgens, G., and Estelle, M. (2005b). Plant devel- Kleine-Vehn, J., Morris, D.A., Emans, N., Jurgens, G., Geldner, N., et al.
opment is regulated by a family of auxin receptor F box proteins. Dev. Cell 9, (2005). Auxin inhibits endocytosis and promotes its own efflux from cells.
109–119. Nature 435, 1251–1256.

Dhonukshe, P., Tanaka, H., Goh, T., Ebine, K., Mahonen, A.P., Prasad, K., Parry, G., and Estelle, M. (2006). Auxin receptors: a new role for F-box proteins.
Blilou, I., Geldner, N., Xu, J., Uemura, T., et al. (2008). Generation of cell polarity Curr. Opin. Cell Biol. 18, 152–156.
in plants links endocytosis, auxin distribution and cell fate decisions. Nature Petrasek, J., Mravec, J., Bouchard, R., Blakeslee, J.J., Abas, M., Seifertova,
456, 962–966. D., Wisniewska, J., Tadele, Z., Kubes, M., Covanova, M., et al. (2006). PIN
Diekmann, W., Venis, M.A., and Robinson, D.G. (1995). Auxins induce clus- proteins perform a rate-limiting function in cellular auxin efflux. Science 312,
tering of the auxin-binding protein at the surface of maize coleoptile proto- 914–918.
plasts. Proc. Natl. Acad. Sci. USA 92, 3425–3429. Robert, S., Kleine-Vehn, J., Barbez, E., Sauer, M., Paciorek, T., Baster, P.,
Vanneste, S., Zhang, J., Simon, S., Covanová, M., et al. (2010). ABP1 mediates
Fischer, U., Ikeda, Y., Ljung, K., Serralbo, O., Singh, M., Heidstra, R., Palme,
auxin inhibition of clathrin-dependent endocytosis in Arabidopsis. Cell 143,
K., Scheres, B., and Grebe, M. (2006). Vectorial information for Arabidopsis
this issue, 111–121.
planar polarity is mediated by combined AUX1, EIN2, and GNOM activity.
Curr. Biol. 16, 2143–2149. Sauer, M., Balla, J., Luschnig, C., Wisniewska, J., Reinohl, V., Friml, J., and
Benkova, E. (2006). Canalization of auxin flow by Aux/IAA-ARF-dependent
Fu, Y., Gu, Y., Zheng, Z., Wasteneys, G., and Yang, Z. (2005). Arabidopsis
feedback regulation of PIN polarity. Genes Dev. 20, 2902–2911.
interdigitating cell growth requires two antagonistic pathways with opposing
action on cell morphogenesis. Cell 120, 687–700. Senn, A.P., and Goldsmith, M.H. (1988). Regulation of Electrogenic Proton
Pumping by Auxin and Fusicoccin as Related to the Growth of Avena Coleop-
Fu, Y., Li, H., and Yang, Z. (2002). The ROP2 GTPase controls the formation of
tiles. Plant Physiol. 88, 131–138.
cortical fine F-actin and the early phase of directional cell expansion during
Arabidopsis organogenesis. Plant Cell 14, 777–794. Settleman, J. (2005). Intercalating Arabidopsis leaf cells: a jigsaw puzzle of
lobes, necks, ROPs, and RICs. Cell 120, 570–572.
Fu, Y., Xu, T., Zhu, L., Wen, M., and Yang, Z. (2009). A ROP GTPase signaling
pathway controls cortical microtubule ordering and cell expansion in Arabi- Sheen, J. (2001). Signal transduction in maize and Arabidopsis mesophyll
dopsis. Curr. Biol. 19, 1827–1832. protoplasts. Plant Physiol. 127, 1466–1475.
Shimomura, S. (2006). Identification of a Glycosylphosphatidylinositol-
Green, J.B., and Davidson, L.A. (2007). Convergent extension and the hexahe-
anchored Plasma Membrane Protein Interacting with the C-terminus of
dral cell. Nat. Cell Biol. 9, 1010–1015.
Auxin-binding Protein 1: A Photoaffinity Crosslinking Study. Plant Mol. Biol.
Hagen, G., and Guilfoyle, T. (2002). Auxin-responsive gene expression: genes, 60, 663–677.
promoters and regulatory factors. Plant Mol. Biol. 49, 373–385.
Shishova, M., and Lindberg, S. (2004). Auxin induces an increase of Ca2+
Hazak, O., Bloch, D., Poraty, L., Sternberg, H., Zhang, J., Friml, J., and concentration in the cytosol of wheat leaf protoplasts. J. Plant Physiol. 161,
Yalovsky, S. (2010). A rho scaffold integrates the secretory system with 937–945.
feedback mechanisms in regulation of auxin distribution. PLoS Biol. 8,
Steffens, B., Feckler, C., Palme, K., Christian, M., Bottger, M., and Luthen, H.
e1000282.
(2001). The auxin signal for protoplast swelling is perceived by extracellular
Heasman, J. (2006). Patterning the early Xenopus embryo. Development 133, ABP1. Plant J. 27, 591–599.
1205–1217.
Tan, X., Calderon-Villalobos, L.I., Sharon, M., Zheng, C., Robinson, C.V.,
Hwang, J.U., Gu, Y., Lee, Y.J., and Yang, Z. (2005). Oscillatory ROP GTPase Estelle, M., and Zheng, N. (2007). Mechanism of auxin perception by the
activation leads the oscillatory polarized growth of pollen tubes. Mol. Biol. TIR1 ubiquitin ligase. Nature 446, 640–645.
Cell 16, 5385–5399. Tao, L.Z., Cheung, A.Y., and Wu, H.M. (2002). Plant Rac-like GTPases are acti-
Jones, A.M. (1994). Auxin-binding proteins. Annu. Rev. Plant Physiol. Plant vated by auxin and mediate auxin-responsive gene expression. Plant Cell 14,
Mol. Biol. 45, 393. 2745–2760.

Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc. 109


Van Keymeulen, A., Wong, K., Knight, Z., Govaerts, C., Hahn, K., Shokat, K., Woo, E.J., Marshall, J., Bauly, J., Chen, J.G., Venis, M., Napier, R.M., and
and Bourne, H. (2006). To stabilize neutrophil polarity, PIP3 and Cdc42 Pickersgill, R.W. (2002). Crystal structure of auxin-binding protein 1 in complex
augment RhoA activity at the back as well as signals at the front. J. Cell Biol. with auxin. EMBO J. 21, 2877–2885.
174, 437–445. Xu, J., Wang, F., Van Keymeulen, A., Herzmark, P., Straight, A., Kelly, K.,
Vanneste, S., and Friml, J. (2009). Auxin: a trigger for change in plant develop- Takuwa, Y., Sugimoto, N., Mitchison, T., and Bourne, H. (2003). Divergent
ment. Cell 136, 1005–1016. Signals and Cytoskeletal Assemblies Regulate Self-Organizing Polarity in
Wasteneys, G.O., Willingale-Theune, J., and Menzel, D. (1997). Freeze shatter- Neutrophils. Cell 114, 201–214.
ing: a simple and effective method for permeabilizing higher plant cell walls. Yang, Z. (2008). Cell polarity signaling in Arabidopsis. Annu. Rev. Cell Dev.
J. Microsc. 188, 51–61. Biol. 24, 551–575.
Wisniewska, J., Xu, J., Seifertova, D., Brewer, P.B., Ruzicka, K., Blilou, I., Zhao, Y., Christensen, S.K., Fankhauser, C., Cashman, J.R., Cohen, J.D.,
Rouquie, D., Benkova, E., Scheres, B., and Friml, J. (2006). Polar PIN localiza- Weigel, D., and Chory, J. (2001). A role for flavin monooxygenase-like enzymes
tion directs auxin flow in plants. Science 312, 883. in auxin biosynthesis. Science 291, 306–309.

110 Cell 143, 99–110, October 1, 2010 ª2010 Elsevier Inc.


ABP1 Mediates Auxin
Inhibition of Clathrin-Dependent
Endocytosis in Arabidopsis
Stéphanie Robert,1,2,11 Jürgen Kleine-Vehn,1,2,11 Elke Barbez,1,2 Michael Sauer,1,2,12 Tomasz Paciorek,1,2 Pawel Baster,1,2

Steffen Vanneste,1,2 Jing Zhang,1,2 Sibu Simon,3 Milada Covanová, 3 Kenichiro Hayashi,4 Pankaj Dhonukshe,5

Zhenbiao Yang,6 Sebastian Y. Bednarek,7 Alan M. Jones,8 Christian Luschnig,9 Fernando Aniento,10 Eva Zazı́malová,3
and Jirı́ Friml1,2,*
1Department of Plant Systems Biology, VIB, 9052 Gent, Belgium
2Department of Plant Biotechnology and Genetics, Ghent University, 9052 Gent, Belgium
3Institute of Experimental Botany, ASCR, 165 02 Praha 6, Czech Republic
4Department of Biochemistry, Okayama University of Science, Okayama 700-0005, Japan
5Department of Biology, Utrecht University, 3584 CH Utrecht, The Netherlands
6Department of Botany and Plant Sciences and Center for Plant Cell Biology, Institute for Integrative Genome Biology, University of California,

Riverside, Riverside, CA 92521, USA


7Department of Biochemistry, University of Wisconsin, Madison, Madison, WI 53706-1544, USA
8Departments of Biology and Pharmacology, University of North Carolina, Chapel Hill, NC 27599, USA
9Institute for Applied Genetics and Cell Biology, University of Natural Resources and Applied Life Sciences, BOKU, 1190 Wien, Austria
10Departamento de Bioquı́mica y Biologı́a Molecular, Universidad de Valencia, 46100 Burjassot, Spain
11These authors contributed equally to this work
12Present address: Centro Nacional de Biotecnologı́a Consejo Superior de Investigaciones Cientı́ficas Departamento de Genética Molecular

de Plantas c/ Darwin n 3, Lab. 316 Campus de Cantoblanco, 28049 Madrid, Spain


*Correspondence: jiri.friml@psb.vib-ugent.be
DOI 10.1016/j.cell.2010.09.027

SUMMARY external stimuli (Santner and Estelle, 2009; Vanneste and Friml,
2009). Current models on auxin signaling and action focus on
Spatial distribution of the plant hormone auxin regu- the paradigm that auxin regulates the expression of subsets
lates multiple aspects of plant development. These of genes, thus eliciting different cellular and, consequently,
self-regulating auxin gradients are established by developmental responses. Nuclear auxin signaling involves the
the action of PIN auxin transporters, whose activity F box protein transport inhibitor response 1 (TIR1), which acts
is regulated by their constitutive cycling between as an auxin coreceptor (Kepinski and Leyser, 2005; Dharmasiri
et al., 2005a, 2005b; Tan et al., 2007), and downstream Aux/
the plasma membrane and endosomes. Here, we
IAA and ARF transcriptional regulators (Dharmasiri and Estelle,
show that auxin signaling by the auxin receptor
2004). This pathway controls a remarkable number of auxin-
AUXIN-BINDING PROTEIN 1 (ABP1) inhibits the cla- mediated processes, but some rapid cellular responses to auxin
thrin-mediated internalization of PIN proteins. ABP1 are not associated with TIR1-based signaling (Badescu and
acts as a positive factor in clathrin recruitment to Napier, 2006; Schenck et al., 2010).
the plasma membrane, thereby promoting endocy- Decades ago, the plant-specific protein AUXIN-BINDING
tosis. Auxin binding to ABP1 interferes with this PROTEIN 1 (ABP1) was proposed to be an auxin receptor (Hertel
action and leads to the inhibition of clathrin-mediated et al., 1972; Löbler and Klämbt, 1985). ABP1 in both monocot
endocytosis. Our study demonstrates that ABP1 and dicot plant species shows physiological affinities toward
mediates a nontranscriptional auxin signaling that natural and synthetic auxin ligands (Jones, 1994). ABP1, despite
regulates the evolutionarily conserved process of cla- carrying a KDEL-endoplasmic reticulum (ER) retention motif, is
secreted to some extent to the extracellular space where it is
thrin-mediated endocytosis and suggests that this
active (Jones and Herman, 1993; Tian et al., 1995; Henderson
signaling may be essential for the developmentally
et al., 1997). ABP1 is essential for embryogenesis (Chen et al.,
important feedback of auxin on its own transport. 2001) and postembryonic shoot and root development (Braun
et al., 2008; Tromas et al., 2009) and mediates auxin effect on
INTRODUCTION cell elongation, but the underlying mechanism remains unclear
(Jones et al., 1998; Leblanc et al., 1997).
The plant signaling molecule auxin is an important regulator of An important regulatory level in auxin action is its differential
plant developmental processes, including embryogenesis, distribution within tissues (Vanneste and Friml, 2009). Such auxin
organogenesis, tissue patterning, and growth responses to gradients result from local auxin biosynthesis and directional,

Cell 143, 111–121, October 1, 2010 ª2010 Elsevier Inc. 111


Figure 1. Auxin-Mediated Inhibition of
Endocytosis by Nontranscriptional, TIR1-
Independent Mechanism
(A–C) Time lapse showing BFA-induced increase
of PIN2-GFP endosomal signal and its intracel-
lular accumulation within minutes (A). NAA
treatment effectively and rapidly inhibits BFA-
induced PIN2-GFP internalization (B) also when
protein synthesis is inhibited by cycloheximide
(CHX) (C).
(D–H) BFA treatment for 90 min induces intracel-
lular accumulation of PIN1 (D). Auxins, such as
NAA (30 min pretreatment), inhibit BFA-induced
PIN1 internalization in the wild-type (E); in the
TIR1-mediated auxin signaling-deficient mutants,
such as overexpressors of stabilized IAA17
(HS::axr3-1; induced for 2 hr at 37 C) (F); in the
tir/afb quadruple mutant (G); and after MG132-
mediated inhibition of proteasome function (H).
See also Figure S1.
(I–M) Auxin treatments for 3 hr, such as NAA (J),
but not BFA alone (I), induce transcriptional auxin response monitored by DR5::GUS in the wild-type (J), but not in the HS::axr3-1 (K) and tir/afb quadruple
(L) mutants or after MG132 treatment (M). See also Figure S1.
Arrows mark PIN proteins internalized into BFA compartments. Arrowheads highlight PIN retention at the plasma membrane. Scale bar, 10 mm.

intercellular auxin transport (Petrásek and Friml, 2009) that or also vacuolar targeting for degradation, respectively (Sieberer
is triggered by a network of carrier proteins (Swarup et al., et al., 2000; Abas et al., 2006; Kleine-Vehn et al., 2008).
2008; Geisler et al., 2005; Petrásek et al., 2006; Vieten et al., We addressed the characteristics of the auxin signaling mech-
2007; Yang and Murphy, 2009). The directionality of auxin flow anism for inhibiting PIN internalization. It is experimentally estab-
depends on the polar plasma membrane distribution of PIN- lished that the auxin regulation based on nuclear signaling
FORMED (PIN) auxin efflux carriers (Wi sniewska et al., 2006). requires at least 10–15 min for execution (Badescu and Napier,
In addition to PIN phosphorylation that directs PIN polar target- 2006), whereas auxin inhibited the PIN2-GFP internalization
ing (Friml et al., 2004; Michniewicz et al., 2007), PIN activity can more rapidly (<5 min) (Figures 1A and 1B). This suggests that
be regulated by constitutive endocytic recycling from and to the this process does not involve auxin-dependent regulation of
plasma membrane (Geldner et al., 2001; Friml et al., 2002; gene expression. Consistently, chemical inhibition of transcrip-
Dhonukshe et al., 2007). Auxin itself inhibits the internalization tion (cordycepine or actinomycin D treatment) (Figure S1
of PIN proteins, increasing their levels and activity at the plasma available online) or de novo protein synthesis (cycloheximide
membrane (Paciorek et al., 2005). The molecular mechanism of treatment) (Figure 1C) does not prevent the auxin-mediated inhi-
this auxin effect remains unknown, but it has been proposed to bition of PIN internalization.
account for a feedback regulation of cellular auxin homeostasis
and for multiple auxin-mediated polarization processes (Leyser, Auxin Inhibits PIN Internalization by a TIR1-Independent
2006). Here, we show that auxin regulation of PIN internalization Pathway
involves the ABP1-mediated signaling pathway that targets cla- To elucidate the molecular mechanism by which auxin inhibits
thrin-mediated endocytosis at the plasma membrane. PIN internalization, we first tested the involvement of the TIR1-
mediated signaling by genetical or chemical interference with
RESULTS different steps of this pathway. We analyzed (1) the quadruple
tir1/afb mutant deficient in most of the TIR1/AFB auxin receptors
Auxin Inhibits PIN Internalization by a Rapid, function, (2) dominant lines conditionally expressing the stabi-
Nontranscriptional Mechanism lized transcriptional inhibitor IAA17 (HS::axr3-1), (3) stabilized
PIN proteins dynamically cycle between the endosomes and the mutations in other Aux/IAA-encoding genes (axr2-1, axr3-1,
plasma membrane (Geldner et al., 2001; Dhonukshe et al., 2007). shy2-2, and slr-1), and (4) silenced lines for multiple ARFs
Plasma membrane-localized PIN1 rapidly internalizes in (2X35S::miRNA160), as well as (5) seedlings treated with the pro-
response to the vesicle trafficking inhibitor brefeldin A (BFA) teasome inhibitor MG132 that interferes with auxin-mediated
(Geldner et al., 2001), and this intracellular PIN accumulation is degradation of Aux/IAA repressors (Figures 1D–1H and
inhibited by auxins (Paciorek et al., 2005). In addition, auxin Figure S1). These manipulations have all been shown to strongly
mediates with slower kinetics the degradation of PIN proteins inhibit TIR1-mediated transcriptional auxin responses (Timpte
(Sieberer et al., 2000; Abas et al., 2006). The auxin effects on et al., 1994; Fukaki et al., 2002; Tian et al., 2002; Knox et al.,
PIN internalization and PIN degradation involve distinct mecha- 2003; Dharmasiri et al., 2005b). Moreover, interference with the
nisms (Sieberer et al., 2000; Paciorek et al., 2005; Abas et al., TIR1 pathway can be visualized (Figures 1I–1M and Figure S1)
2006). These processes can be largely distinguished by BFA by monitoring the activity of the synthetic auxin-responsive
treatments at 25 and 50 mM that inhibit preferentially recycling promoter DR5, which is an indicator for TIR1-dependent gene

112 Cell 143, 111–121, October 1, 2010 ª2010 Elsevier Inc.


NAA[10] 5 min NAA[10] 15 min NAA[10] 30 min NAA[10] 60 min NAA[10] 120 min Figure 2. Auxin Effect on BFA-Induced PIN
BFA[25] BFA[25] BFA[25] BFA[25] BFA[25] BFA[25] Internalization
A B C D E F Kinetics of auxin effect on 25 mM BFA-induced PIN
internalization with different time points of auxin
anti-PIN1 + anti-PIN2

pretreatment (0, 5, 15, 30, 60, and 120 min) in the


V wild-type (A–F) and in the quadruple tir/afb mutant
(G–L). Note the comparable sensitivity of the
V quadruple tir/afb mutant and wild-type to auxin
V effect on PIN internalization. Auxin effect on PIN
V
protein internalization was immediate (within
minutes) but transient: prolonged auxin treatments
Col-0

Col-0

Col-0

Col-0
Col-0

Col-0

from 1 to 2 hr resulted in reduced inhibition of PIN


internalization (arrows). Scale bar, 10 mm. See also
G H I J K L Figure S2.
anti-PIN1 + anti-PIN2

V V
IAA inhibited the BFA-induced PIN inter-
V nalization (Figure 3H). In contrast, another
auxin analog, 5-fluoroindole-3-acetic

tir1/afb1,2,3
tir1/afb1,2,3

tir1/afb1,2,3

tir1/afb1,2,3

tir1/afb1,2,3

tir1/afb1,2,3

V
acid (5-F-IAA), activated DR5rev::GFP
already at 5 mM (Figure 3D and Figure S3)
but failed to inhibit PIN internalization,
even at 25 mM (Figure 3I). These nonover-
expression (Ulmasov et al., 1997). As expected, treatments with lapping effects of compounds structurally related to auxin
different auxins increased the DR5::GUS expression in the wild- suggest that auxin perception upstream of either regulation of
type root, but following interference with the TIR1 pathway, auxin gene expression or PIN internalization involves distinct auxin-
was ineffective in inducing DR5 activity (Figures 1I–1M). In binding sites, confirming independently that auxin utilizes
contrast, all of these manipulations did not interfere with the different signaling pathways for mediating these effects.
auxin inhibition of PIN internalization as monitored by BFA-
induced intracellular PIN1 accumulation (Figures 1D–1H and abp1 Knockdown Lines Have Decreased PIN
Figure S1). In addition, the kinetics of the auxin effect on endocy- Internalization
tosis in the quadruple tir1/afb mutant was indistinguishable from As the effect of auxin on PIN internalization is not mediated by
that of the wild-type (Figures 2A–2L and Figure S2). Together, TIR1-dependent signaling, we addressed the possible role of
these findings show that the auxin effect on PIN internalization the putative auxin receptor, ABP1 (Jones, 1994; Napier et al.,
does not require TIR1-mediated auxin signaling. 2002). To test the involvement of ABP1 in PIN1 internalization,
This conclusion is seemingly contradictory to a previous report we monitored PIN subcellular dynamics in conditional immuno-
that proposed TIR1 involvement in auxin effect on BFA-induced modulation and antisense abp1 knockdown lines (Braun et al.,
PIN internalization (Pan et al., 2009). However, given the experi- 2008; Tromas et al., 2009). Following downregulation of ABP1,
mental conditions used (BFA at 50 mM), the Pan et al. report the intracellular accumulation of PIN proteins in response to
primarily addressed the auxin effect on PIN vacuolar trafficking BFA treatment was diminished (Figures 4A–4D and data not
that, in terms of kinetics and molecular mechanisms involved, shown). Similarly, pulse-labeling and time-lapse monitoring intra-
is distinct from the regulation of PIN internalization (Figure S2 cellular fluorescence revealed that uptake of the endocytic tracer
and Figure S3). FM4-64 was clearly reduced in roots of both immunomodulated
and antisense abp1 knockdown lines as compared to the wild-
Auxin Effects on Transcription and PIN Internalization type (Figure S4 and data not shown). In addition, a genetic inter-
Involve Distinct Perception Mechanisms action between abp1 knockdown lines and pin mutants (pin1-1
To independently test whether auxin regulation of gene expres- or eir1-1) was demonstrated by the enhancement of the single
sion and inhibition of PIN internalization require independent mutant phenotypes (Figure S4). Thus, the ABP1 function is
signaling pathways, we tested a number of structural analogs required for PIN internalization and overall endocytosis, indicating
of the natural auxin indole-3-acetic acid (IAA) for both effects. that ABP1 plays a positive role in regulating endocytosis in plants.
As expected, most analogs tested affected both gene
expression and PIN internalization, albeit often at different effec- ABP1 Gain-of-Function Alleles Have Increased PIN
tive concentrations. Importantly, we also identified auxin-like Internalization
compounds that were specific for one or the other process Next, we tested the effect of ABP1 gain of function on PIN inter-
only. For example, a-(phenyl ethyl-2-one)-indole-3-acetic acid nalization. ABP1 is predominantly located in the lumen of the ER
(PEO-IAA) (Figure S3) did not induce the expression of due to a C-terminal ER retention signal (KDEL), but some ABP1 is
DR5rev::GFP reporter (Figure 3C) nor transcription of auxin- secreted and has been shown to be closely associated with the
inducible genes related to the TIR1-dependent signaling plasma membrane (Jones and Herman, 1993; Henderson et al.,
pathway (Figure S3). However, similar to classical auxins, PEO- 1997; Shimomura et al., 1999).

Cell 143, 111–121, October 1, 2010 ª2010 Elsevier Inc. 113


Untr. NAA[5] PEO[25] 5FIAA[5] PIN1-RFP localized largely to the plasma membrane, similarly
A B C D E to the control experiments (Figures 4E, 4F, and 4H). In contrast,
coexpression of PIN1-RFP with the secreted ABP1DKDEL-GFP
25
version resulted in a strong internalization of PIN1-RFP (Figures
4G and 4H), indicating that ABP1 exported from ER regulates
DR5rev::GFP

20
endocytosis.
15
When introduced into Arabidopsis seedlings, ABP1DKDEL-GFP
expression led to auxin-related phenotypes, such as three coty-
10
ledons, shorter roots, and reduced apical dominance, but
* frequently resulted into seedling lethality or sterile development
5 *
already in the T1 generation (Figure 4I and data not shown).
0 To further characterize the role of ABP1 gain of function in

5 FIAA[5]
Untr.

PEO[25]
NAA[5] PIN1 internalization, we monitored the subcellular dynamics
F BFA[25] G NAA[5]/BFA[25] of PIN1 proteins in the seedlings moderately expressing
ABP1DKDEL-GFP. In accordance with the transient BY-2 assays,
the ABP1DKDEL-GFP expression increased PIN1 internalization in
Arabidopsis root cells treated with 25 mM BFA for 30 min (Figures
4J–4L). In summary, ABP1 gain of function induces PIN internal-
ization, whereas reduced expression of ABP1 leads to reduced
PIN internalization. These results strongly suggest that ABP1
acts as a positive effector of endocytosis in plants.
anti-PIN1 + anti-PIN2

Auxin Negatively Regulates ABP1 Action on PIN


V Internalization
To study the potential role of ABP1 in mediating auxin inhibition
H PEO[5]/BFA[25] I 5FIAA[25]/BFA[25] of PIN internalization, we tested the auxin effect in BY-2 cells
coexpressing PIN1-RFP and ABP1DKDEL-GFP (Figure 5). Of
note, NAA treatment counteracted the positive effect of secreted
ABP1 on PIN internalization, leading to a preferential retention of
PIN proteins at the plasma membrane (Figure 5E). In contrast,
the structurally similar auxin analog 5-F-IAA, which promotes
auxin-dependent gene transcription but does not inhibit PIN1
endocytosis (Figure 3 and Figure S3), showed also no detectable
effect on ABP1-mediated PIN internalization (Figure 5F). This
observation is consistent with the reported weak affinity for
V 5-F-IAA of the plasma membrane-associated auxin-binding
site, which is likely related to ABP1 (Zazı́malová and Kutác ek,
1985). These results, as well as similarities between knockdown
Figure 3. Distinct Auxin Perception Mechanisms for the Regulation lines and auxin treatment, suggested a model in which auxin
of Transcription and Endocytosis
inhibits ABP1-mediated stimulation of PIN internalization.
(A–D) Activity of auxin-responsive promoter DR5rev::GFP (A) induced by treat-
ment with auxin analogs, such as NAA (B) and 5-F-IAA (D) at 5 mM for 3 hr, but
To test this scenario, we used the abp1-5 mutant allele (Xu
not by PEO-IAA even at concentrations up to 25 mM (C). et al., 2010) with a point mutation in the conserved auxin-binding
(E) Relative DR5rev::GFP signal of meristematic cells versus nonmeristematic pocket (Napier et al., 2002). Conversion of the conserved
cells. n = 3 independent experiments with at least 21 roots analyzed for each histidine to tyrosine (H94Y) weakens the Pi interaction between
assay. See also Figure S3. the side-chain ring and the indole ring and is, therefore, pre-
(F–I) BFA-induced internalization of PIN1 and PIN2 (F) inhibited by NAA (G) and
dicted to reduce the auxin-binding affinity without major steric
PEO-IAA (H) at 5 mM, but not by 5-F-IAA (all 30 min pretreated), even at
concentrations up to 25 mM (I).
hindrance or changes in domain structure (Woo et al., 2002). In
Arrows mark PIN proteins internalized into BFA compartments. Arrowheads contrast to ABP1 knockdown lines that showed an ‘‘auxin-like’’
mark the PIN retention at the plasma membrane. Scale bar, 10 mm. Error inhibitory effect on PIN internalization, the abp1-5 allele was
bars represent standard deviation. *p < 0.05. partially resistant to auxin with respect to its effect on PIN inter-
nalization. Auxins, such as NAA or IAA, in abp1-5 root cells were
much less effective in inhibiting BFA-induced internalization of
To investigate the potential role of ABP1 outside of the ER PIN proteins than the wild-type roots (Figures 5H–5L).
lumen, tobacco (Nicotiana tabacum; Bright Yellow 2 (BY-2)) Next, we deleted the KDEL ER retention signal in the abp1-5
suspension-cultured cells were transfected with PIN1 mutant sequence. Similarly to ABP1DKDEL-GFP, the overexpres-
(35S::PIN1-RFP) and the Arabidopsis ABP1 variant lacking sion of ABP1-5DKDEL induced the PIN1-RFP internalization in
the KDEL ER retention signal (35S::ABP1DKDEL-GFP). When the tobacco BY-2-cultured cells. But, in contrast to ABP1DKDEL-
full-length ABP1 protein was expressed (35S::ABP1-GFP), the GFP, the ABP1-5DKDEL-promoted PIN1 internalization was not

114 Cell 143, 111–121, October 1, 2010 ª2010 Elsevier Inc.


Figure 4. Positive ABP1 Role in PIN Internal-
A B C D ization
(A–D) Reduced BFA-induced PIN1 internalization in
inducible abp1 knockdown lines SS12S (B) and
SS12K (C) as compared to the induced wild-type
(A). Number of BFA compartments was reduced
after ABP1 downregulation in immunomodulation
(SS12S and SS12K) (D). Values in (D) represent
the relative mean surface area (pixels2) in compar-
ison with the wild-type for each individual experi-
ment. n > 3 independent experiments with a least
60 cells measured for each assay. See also
Figure S4.
(E–H) Cotransfection of tobacco BY-2 cells with
PIN1-RFP (0.05 mg) (in red) and ER marker HDEL-
E F G H GFP (0.05 mg) (E), full-length ABP1-GFP (0.5 mg)
(F), and ABP1 with deleted ER retention signal
(ABP1DKDEL-GFP) (0.05 mg) (G) (all in green). In
contrast to the full-length ABP1-GFP, the secreted
ABP1DKDEL-GFP induced pronounced PIN internal-