You are on page 1of 15

Antonie van Leeuwenhoek

DOI 10.1007/s10482-015-0464-9

ORIGINAL PAPER

Comparative 16S rRNA signatures and multilocus sequence
analysis for the genus Salinicola and description
of Salinicola acroporae sp. nov., isolated from coral
Acropora digitifera
Rinchen T. Lepcha . Abhijit Poddar .
Peter Schumann . Subrata K. Das

Received: 7 February 2015 / Accepted: 24 April 2015
Ó Springer International Publishing Switzerland 2015

Abstract A novel Gram-negative, aerobic, motile the presence of genus specific sequence signatures.
marine bacterium, strain S4-41T, was isolated from Multilocus sequence analysis based on concatenated
mucus of the coral Acropora digitifera from the sequences of rRNAs (16S and 23S) and four protein
Andaman Sea. Heterotrophic growth was observed in coding housekeeping genes (atpA, gyrB, secA, rpoD)
0–25 % NaCl, at 15–45 °C and pH 4.5–9. In phylo- was found to be unnecessary for phylogenetic studies
genetic trees, strain S4-41T was grouped within the of the genus Salinicola.
genus Salinicola but formed a separate branch distant
from a cluster composed of Salinicola salarius M27T Keywords Salinicola acroporae sp. nov. 
and Salinicola socius SMB35T. DNA–DNA related- Halomonadaceae  16S rRNA signatures  Split
ness between strain S4-41T and these reference strains decomposition analysis  Multilocus sequence
were well below 70 %. Q-9 was the sole respiratory analysis  Polar lipid
quinone. The DNA G?C content was determined to be
63.6 mol%. Based on a polyphasic analysis, strain S4-
Abbreviations
41T is concluded to represent a novel species in the
NJ Neighbour joining
genus Salinicola for which the name Salinicola
ML Maximum likelihood
acroporae sp. nov. is proposed. The type strain is
MP Maximum parsimony
S4-41T (=JCM 30412T = LMG 28587T). Com-
parative 16S rRNA analysis of the genera Salinicola,
Kushneria, Chromohalobacter and Cobetia revealed

Introduction
Electronic supplementary material The online version of
this article (doi:10.1007/s10482-015-0464-9) contains supple-
mentary material, which is available to authorized users. The family Halomonadaceae was first proposed by
Franzmann et al. (1988) with two moderately halophilic
R. T. Lepcha  A. Poddar  S. K. Das (&)
and marine genera of gammaproteobacteria, Halomo-
Department of Biotechnology, Institute of Life Sciences,
Nalco Square, Bhubaneswar 751 023, India nas and Deleya. The family has now been expanded to
e-mail: subratkdas@hotmail.com; subrata@ils.res.in include 11 genera among which Halomonas is the
phylogenetically heterogeneous and largest genus
P. Schumann
with 82 validly named species, whereas the genera
Leibniz Institute DSMZ-German Collection of
Microorganisms and Cell Cultures, Inhoffenstrasse 7B, Aidingimonas, Carnimonas, Halotalea, Modicisal-
38124 Brunswick, Germany ibacter and Zymobacter are currently monophyletic

123
Antonie van Leeuwenhoek

(http://www.bacterio.net/halomonadaceae.html) (Parte Andaman Sea. The strain has been characterized
2014). Three previously described genera, i.e. Deleya, following the recommended minimal standards for the
Halovibrio and Volcaniella, were found to form a co- description of new taxa of the family Halomon-
herent monophyletic group with the genus Halomonas adaceae (Arahal et al. 2007). Based on phenotypic,
in 16S rRNA phylogeny and also exhibited similar genomic and chemotaxonomic observations, strain
phenotypic and chemotaxonomic features and so these S4-41T is concluded to represent a novel species of the
genera have been unified into the single genus Halo- genus Salinicola, for which the name Salinicola
monas to avoid taxonomic ambiguity (Dobson and acroporae sp. nov. is proposed.
Franzmann 1996; Mellado et al. 1995). Furthermore,
due to the poor taxonomic resolution in 16S rRNA gene
phylogeny in the description of members of the family Materials and methods
Halomonadaceae (de la Haba et al. 2010a), nearly full
length 23S rRNA has been used extensively for taxo- Isolation and maintenance of strains
nomic delineation of members belonging to this family.
More recently, a robust multilocus sequence analysis The coral A. digitifera was collected by diving at sea
scheme has been proposed by de la Haba et al. (2012), near North Bay island, Andaman (Coordinates:
in which intrageneric and intergeneric similarities 11°420 17.400 N; 92°450 01.500 E) in November 2010.
based on individual and concatenated gene sequences Collection of coral mucus and isolation of the strain
for the nine genera has been studied using four house- was performed according to methods described earlier
keeping genes (i.e. atpA, gyrB, rpoD and secA) and two (Kumari et al. 2014a). The culture was streaked on
rRNAs (16S and 23S). marine agar 2216 (MA; Difco) and stored at 4 °C for
The genus Salinicola is the 9th member introduced short term preservation, and for long term preservation
into the family Halomonadaceae, with Salinicola so- the culture was stored at -80 °C in 15 % glycerol. For
cius as the type species (Anańina et al. 2007). comparative polyphasic analyses under the same
Following its description, the phylogeny of the genus laboratory conditions, type strains of the genus
has been reanalysed several times using 16S rRNA Salinicola were obtained from the Leibnitz-Institut
and 23S rRNA sequence analysis. This has led to the DSMZ-Deutsche Sammlung von Mikroorganismen
transfer of the species Halomonas salaria and Chro- und Zellkulturen GmbH, Germany (S. salarius DSM
mohalobacter salarius to the genus Salinicola, as 18044T and S. socius DSM 19940T), BCCM/LMG
Salinicola salarius comb. nov. and Salinicola halo- Bacteria collection, Universiteit Gent, Belgium (S.
philus nom. nov., respectively (de la Haba et al. halophilus LMG 23626T) and the RIKEN Bio-Re-
2010b). At present the genus Salinicola contain four source Center (S. peritrichatus JCM 18795T). Strains
species that prefer moderate to extreme halophilic were maintained on MA at 30 °C and preserved as
conditions for growth, although S. salarius M27T described above.
(Kim et al. 2007) and Salinicola peritrichatus DY22T
(Huo et al. 2013) also exhibit growth at 0 % NaCl. All Phenotypic characterization
Salinicola strains are aerobic, Gram negative, motile
rods and have been reported from saline environments Cell morphology, motility and Gram stain character-
in different geographical locations, including seawater istics were examined by using a bright field confocal
(Kim et al. 2007), deep sea sediment (Huo et al. 2013), microscope (Leica, TCS SP5). Growth physiology at
salt mines (Anańina et al. 2007) and a solar saltern different pH (3.3-10; in steps of 0.5 pH unit),
(Aguilera et al. 2007). temperature (5–50 °C; in steps of 5 °C) was deter-
In this study, the phylogeny of the family Halomon- mined in SW10 medium (Ventosa et al. 1982). The
adaceae has been revisited with screening of genus requirement of NaCl for growth was determined in
specific 16S rRNA gene signatures and split decom- MM63 minimal media (Jiang et al. 2014) supplement-
position analysis using concatenated gene sequences ed with 0, 0.5, 2, 3, 5, 7.5, 10, 15, 20, 25 and 30 % w/v
of the six genetic loci proposed by de la Haba et al. NaCl. Anaerobic growth was tested on MA using the
(2012). Furthermore, strain S4-41T has been isolated BD GasPakTM EZ system (Becton–Dickinson).
from mucus of the coral Acropora digitifera from the Phenotypic characteristics such as indole, methyl

123
Antonie van Leeuwenhoek

red, Voges Proskauer’s test, H2S production, nitrate (2010a). Phylogenetic trees were constructed using the
reduction, citrate utilisation, activities of catalase, neighbour joining (NJ), maximum likelihood (ML)
oxidase, lysine decarboxylase, ornithine decarboxy- and maximum parsimony (MP) algorithms imple-
lase, arginine dihydrolase, urease, phenylalanine mented in MEGA 5 and significance of branch points
deaminase and hydrolysis of esculin, casein, DNA, was calculated by 1000 bootstrap re-samplings of the
gelatin, starch and Tween 20 and 80 were tested data (Felsenstein 1985). Furthermore, intragenus (be-
according to Mata et al. (2002). Utilisation of carbo- tween S4-41T and the members of the genus Salinico-
hydrates, alcohols, organic acids as sole source of la) and intergeneric (among the genera Salinicola,
carbon and energy were determined following the Chromohalobacter, Kushneria and Cobetia) 16S
recommendations of Arahal et al. (2007) in SW10 rRNA signatures were determined based on reference
medium at 30 °C where the final substrate concentra- base position and helix numbering according to E. coli
tion was 0.5 % (w/v). Apart from classical tests, 16S rRNA template information obtained from the
phenotypic characterisation was also performed using Comparative RNA Website (www.rna.icmb.utexas.
API 50CH, API 20 NE, API 20E, API ZYM edu) (Cannone et al. 2002).
(bioMérieux) and Biolog GNII microplates according Similarly, 23S rRNA and other protein coding
to manufacturers’ instruction with a minor modifica- genes of S4-41T were amplified following a protocol
tion. Cultures were suspended in basal medium (i.e. described earlier (de la Haba et al. 2012) except genus
the salt solution used in SW10 medium) for inocula- specific conserved primers were designed for rpoD,
tion of API strips. Phenol red was used as an indicator gyrB and atpA genes to obtain amplicons for S.
for API 50CH tests. For Biolog plates, the cultures acroporiae S4-41T, S. socius DSM 19940T and S.
were suspended in inoculation fluid adjusted with peritrichatus JCM 18795T. The amplicons were gel
sterile NaCl stock solution to make a final NaCl purified using a NucleoSpin Gel & PCR Clean-up kit
concentration of 8 %. (Macherey–Nagel, Germany) and sequenced using an
Susceptibility to different antimicrobials were eight capillary DNA analyser (model number 3500,
determined by the disc diffusion method on MA using Applied Biosystems) following the sequencing proto-
the following antimicrobial discs (lg/disc): ampicillin col of the manufacturer. Accession numbers for the
(10), chloramphenicol (30), erythromycin (15), genes and the sequences of primers used for different
nalidixic acid (30), rifampicin (30), tetracycline (30), phylogenetic studies are presented in Tables S1 and 1
vancomycin (30), kanamycin (30), streptomycin (10), respectively. The nucleotide sequences were com-
ciprofloxacin (5), spectinomycin (100), gentamycin pared with those in GenBank using the nucleotide
(120), sulfamethoxazole (23.75), trimethoprim (1.25), BLAST algorithm (Altschul et al. 1997) searching the
sulfamethoxazole/trimethoprim (23.75/1.25) Suscep- nucleotide collection (nr/nt) database and optimized
tibility to antimicrobials was recorded after 24 h of for highly similar sequences (megablast). Sequences
incubation and measuring the mean inhibition zone were aligned using the default parameters of the
diameter. Clustal program of MEGA5 (Tamura et al. 2011),
refined manually and trimmed to a common length.
16S rRNA gene based phylogeny and multilocus Pair-wise similarities for each gene of S4-41T and the
sequence analysis type strains of the genus Salinicola were determined
by using the ClustalW2 score matrix. Multilocus gene
Genomic DNA was isolated following the standard sequence based phylogeny was prepared using
protocol in Sambrook and Russell (2001) and used for SplitsTree (version 4.13.1) (Huson and Bryant 2006)
amplification of rRNAs and protein coding genes. following Split Decomposition Analysis with a neigh-
Amplification, sequencing and secondary structure bour net drawing and Jukes-Cantor correction.
based analysis of 16S rRNA were performed as
described by Poddar et al. (2014) where the 16S DNA G?C content and DNA–DNA hybridization
rRNA of Esherichia coli (accession no J01695) was studies
used as the reference secondary structure template.
The primer and PCR conditions for amplification of The DNA G?C content of strain S4-41T was deter-
16S rRNA were adapted from de la Haba et al. mined by a reverse phase HPLC method. For this,

123
Antonie van Leeuwenhoek

Table 1 Primers used for amplification and sequencing of different genes in this study
Gene Primer name Sequence Used for Strains Ref

16S 16F27 AGAGTTTGATCMTGGCTCAG Amplification S. acroporae S4-41T de la Haba
16R1488 CGGTTACCTTGTTAGGACTTCACC and et al.
sequencing (2010a)
gyrB gyrB216F GARGTBATCATGACSGTGCT Amplification S. acroporae S4-41T, S. de la Haba
gyrB1419R GCRTCSGTCATGATGATSAY and peritrichatus JCM 18795T et al.
sequencing (2012)
secA secA555F CTACCTGCGCGACAAYATGG Amplification S. acroporae S4-41T, S. de la Haba
secA1131R ACAGGCGGAARTARTTCTGG and peritrichatus JCM 18795T et al.
sequencing (2012)
23S 23SppioFw TTSGGGTTATAKGGTCAAG Amplification de la Haba
985R CCGGTCCTCTCGTACT et al.
(2010a)
992IRry97 TTCCCTCACRGTACT Sequencing S. acroporae S4-41T, S.
1020IRrmz98 TCTGGGYTGTTYCCCT peritrichatus JCM 18795T
1018Fw GGGGGTAGAGCACTGTTT
1037IRrm97 CTTACCCGACAAGGAATTTCG
1027VIR AAACCGACACAGGTRG
328IRvm97 TCCTAAGGTAGCGAAATTCCTTG
1042GPHI GTTTGGCACCTCGATGTCGRCTC
Sp 23S-1F GAGTGAAATAGATCCTGAAAC Sequencing S. peritrichatus JCM 18795T This study
Sp23S-1R TTA AGCTCGCCACTGAATATA
Sp23S-2F GTTACCAACCCGAGGCAAACT
Sp23S-2R TGTCAGCATTCGCACTCGTGA
Sp23S-3F CTATCTGCCGTGGGCGTTGGA
Sp23S-3R AGTACACGTTAGCTCAACGCC
gyrB gyrB salF GTCTCGGTGGTCAACGC Amplification S. socius DSM 19940T This study
gyrB salR GTAGAGCTCGGAGAGGC and
sequencing
atpA atpA SalF ATCATTGGTGACCGCCAGAT Amplification S. acroporae S4-41T; S. This study
atpA SalR GGAACGAACGCGGAGACG and peritrichatus JCM 18795T
sequencing
rpoD rpoD SalF TACATGCGCGAGATGGG Amplification S. acroporae S4-41T; S. socius This study
rpoD SalR ATCGCCTGACGAATCCACCA and DSM 19940T; S. peritrichatus
sequencing JCM 18795T

DNA was degraded enzymatically into nucleosides as For species delineation, dot blot DNA–DNA
described by Mesbah et al. (1989). The obtained hybridisation was performed with 40 ng of high
nucleoside mixture was then separated by HPLC quality DNA samples per dot (A260/A280 = 1.8–2.0)
(Shimadzu) using an analytical column (Kinetex XB- on Hybond-N? nylon membrane (GE Healthcare)
C18, 2.6 lm, 100 9 4.6 mm) equipped with a C18 following the standard procedure of high stringency
guard column. Non-methylated lambda phage DNA hybridisation (65 °C) described by Sambrook and
(Sigma) and three DNAs with known genome se- Russell (2001). The DNA probe for each strain was
quences (Bacillus subtilis DSM 402T, Xanthomonas labeled with [a-32P]-CTP (BRIT) using the NEBlot-
campestris pv. campestris DSM 3586T and Strepto- kit (New England Biolabs). Autoradiographs were
myces violaceoruber DSM 40783T) were used as digitized and densitometric analysis was performed
calibration references. using ImageLab 5.1 (BioRad) implemented with

123
Antonie van Leeuwenhoek

ChemiDoc XRS ? system (BioRad). Experiments 1.25), whereas the reference strains showed differential
were performed in duplicate and mean ± variance responses. Discrimination between strain S4-41T and
hybridisation values were considered. other type strains of the genus Salinicola can be
achieved based on differentiating physiological and
Fatty acid, polar lipids and quinone analysis phenotypic characteristics listed in Table 2. However,
all strains shared many phenotypic similarities suggest-
The cellular fatty acids of strain S4-41T and related ing their relatedness and placement in a single genus.
type strains were analysed simultaneously from Phenotypic similarities among strain S4-41T and the
stationary phase cells grown on MA plates at 30 °C members of the genus Salinicola are listed in Table S2.
for 3 days. Preparation of fatty acid methyl esters, gas
chromatographic separation, analysis and identifica- Analysis of 16S rRNA gene and determination
tion of peaks were performed by a method described of genus specific signatures
earlier (Kumari et al. 2014b). Polar lipids were
extracted from 200 mg freeze dried cells following Analysis of the phylogeny of the family Halomon-
the method described by Bligh and Dyer (1959), adaceae has been largely focused on the analysis of
separated by two dimensional TLC on silica gel 60 16S rRNA gene sequences following their clustering
F254 plate (Merck, Germany) and analyzed by spray- in NJ, MP and ML trees and determination of 19
ing with appropriate solvents (Poddar et al. 2014). family specific 16S rRNA signatures i.e. 18 residues
Solvent systems used in this study were taken from and one 6 bp stem (position 76–93) located in the 16S
Kumari et al. (2014a). Quinones were extracted from rRNA primary structure (Arahal et al. 2002; Dobson
200 mg freeze dried cells (Hiraishi et al. 1992) and and Franzmann 1996). In this study, we have deter-
analyzed by TLC on cellulose plates (Merck, Ger- mined the position of signature residues in the 16S
many) using n-hexane: methanol (9:1, v/v) as solvent. rRNA secondary structure to provide greater phylo-
The UV absorbing (254 nm) band was recovered from genetic insight. Out of 18 signatures, six residues were
the plate, dissolved in methanol and further analysed unpaired and occupied non-helix regions and 12
by reverse phase HPLC (Waters) using methanol: residues were base-paired and distributed in different
isopropanol (60:40, v/v) as eluant at a flow rate of helices (Table S3). A majority of the signatures were
1 ml/min and quinones were detected at 269 nm. confined in helix 1399 that may indicate some
evolutionary significance of this helix for this family.
Interestingly, for position 76–93, the genus Salinicola
Results and discussion contained a genus specific signature and hence
differed significantly from other genera of this family.
Morphological and phenotypic properties Based on our observation, we propose the members of
the family Halomonadaceae to contain the18 signa-
Strain S4-41T was observed to be non-sporulating, ture bases in their 16S rRNA gene primary structure
Gram negative, aerobic, motile, short rods of width described earlier or 15 signature positions in their 16S
0.3–0.6 lm and length 1.0–1.4 lm. The strain was rRNA gene secondary structure. Furthermore, the
observed to form cream, circular colonies having members of the genera Salinicola, Chromohalobacter,
diameters of 0.5- 1 mm after 2 day of incubation at Kushneria and Cobetia contain genus specific 16S
30 °C. Strain S4-41T cannot grow at 10 °C and above rRNA gene signatures distributed either unpaired or in
pH 9.0. The strain was found to be negative for nitrate different helices. The members of the genus Salinico-
reduction, Voges Proskauer test, indole production and la, Chromohalobacter, Kushneria and Cobetia can be
a-glucosidase activity. Strain S4-41T is positive for defined based on 31, 23, 26 and 28 signature locations
oxidase, esterase (C 4), esterase lipase (C 8) and lipase respectively (Table 3). Such genus specific 16S rRNA
(C 14) activities. The strain was found to be susceptible signatures will aid the taxonomic placement of
to (lg/disc) erythromycin (15), nalidixic acid (30), new species in their respective genus. However 16S
kanamycin (30), streptomycin (10), spectinomycin rRNA signatures for the monospecific genera Aidingi-
(100) and sulfamethoxazole/trimethoprim (23.75/ monas, Carnimonas, Halotalea, Modicisalibacter,

123
Antonie van Leeuwenhoek

Table 2 Characteristics features that differentiate Salinicola acroporae S4-41T from type strains of the genus Salinicola. All data
were obtained in this study unless indicated
Characteristics 1 2 3 4 5

Growth characteristics
At 10 °C - ? ? - ?
At 45 °C ? ? ? ? -
Above pH 9 - ? - - -
At 0 % NaCl ? ? ? - ?
At 25 % NaCl ? ? ? ? -
NaCl optimum 5–10 10–20 3–10 7.5–10 0.5–2
(%)
Biochemical tests (classical, API 20E, API 20NE)
Nitrate reduction - ? - ? ?
Oxidase ? ? - - -
Indole - - - - ?
production
Methyl red ? ? ? ? -
Voges Proskauer - ? - - ?
Enzymatic activity (API ZYM)
Esterase (C 4) 1 - 1 1 1
Esterase lipase 1 - 1 - 1
(C 8)
Lipase (C 14) 1 - - - -
a-Glucosidase - - - - 1
Acid production from (classical, API 50CH)
L-rhamnose - 1 - 1 1
D-mannitol 1 1 1 - -
Gentibiose - - 1 1 -
D-trehalose 1 1 - - 1
Hydrolysis of
Starch - - ? ? -
Tween 20 - - - ? ?
Tween 80 - - ? - -
Ubiquinone Q9 Q9 (major), Q8 Q9*2 Q9 (major), Q10, Q8 Q9*4
(minor)*1 (minor)*3
Polar lipids PG, PE,DPG, AL1- PG, PE,DPG, AL1- PG, PE, DPG, AL1- PG, PE,DPG, AL1-4, PG, PE,DPG, AL1-
6, L1-4 4, L1-3 3, L1-6 L1-5 4, L1-4
G?C content 63.6 58.8*1 63*2 63.6*3 59.6*4
(mol%)
Strains 1 Salinicola acroporae S4-41T; 2 Salinicola salarius DSM 18044T; 3 Salinicola socius DSM 19940T; 4 Salinicola halophilus
LMG 23626T; 5 Salinicola peritrichatus JCM 18795T
Data from *1Kim et al. 2007; *2Anańina et al. 2007; *3Aguilera et al. 2007; *4Huo et al. 2013
- negative, ? positive, R resistant, S sensitive, PG phosphatidylglycerol, DPG diphosphatidylglycerol, PE
phosphatidylethanolamine, AL aminolipid, L unknown lipid

Zymobacter were not identifiable; However, with Pair-wise 16S rRNA sequence similarity using a
increase in number of species in these genera, such global alignment algorithm (Myers and Miller 1988)
signatures may be identified later. implemented at the EzTaxon server (http://www.

123
Antonie van Leeuwenhoek

Table 3 16S rRNA signatures specific for the genus Salinicola, Chromohalobacter, Kushneria and Cobetia
Helix Position Salinicola Chromohalobacter Kushneria Cobetia

61 48 – – – U
70–98 CG – – –
74–96 AU – – –
75–95 CG – – –
79–90 GC – – –
76–93 GU – – –
72 G – – –
150 – – – C
122 126–235 – – GC GC
141–222 – CG – –
155–166 – – CG –
198 200–217 GC GC AU –
205 – C A –
240 – – U –
264 C – – –
278 G – – –
279 A – – –
316 317–336 UA – – –
369 379–384 CG CG – –
406 419–424 UG UG CG –
441 445–489 – – GC –
460–472 – CG – G(C/U)
462–470 – – – AU
453 A – G –
480 – C G –
546 G – –
576 – – G –
577 586–755 UA – – UA
588 591–648 – – – AU
592–647 – – – AU
593–646 GC UG – GC
596–644 CG CG –
602–636 – GU – GU
615–625 – – GC –
595 – – – C
647 – – – U
648 – – – U
655 662–743 GC – – –
821 824–876 AU
827 U U C
829 838–848 AA – CG –
839–847 CG CG – –
841 U – – –
843 U – – –
844 A – – –
834–852 – – CG –

123
Antonie van Leeuwenhoek

Table 3 continued
Helix Position Salinicola Chromohalobacter Kushneria Cobetia

885 895–904 – GC –
984 987–1218 – – GC
989–1216 – CG –
996 1000–1040 – UA – AU
1002–1038 – – – AU
1004 – – – G
1006 1006–1023 – – UA
1008–1021 – CG –
1009–1020 – GC –
1010–1019 – GC –
1011–1018 – AU –
1020 A
1025 1025–1036 – UG –
1113 1115–1185 – – CG CG
1118 1121–1152 – – CG UA
1134–1140 – – GC
1136 A U C A
1137 – – – A
1138 – – – U
1241 1242–1295 GC – GC –
1243–1194 CG – CG
1244–1293 – – – AU
1245–1292 – – – AU
1260 – – – A
1262 – A A U
1274 G A A –
1278 G – C –
1303 1308–1329 – – – UA
1350 1356–1366 AU CG – –

– No signature present

ezbiocloud.net/eztaxon) (Kim et al. 2012) revealed clustered in the radiation of the genus Salinicola but
that strain S4-41T showed 99 % similarity with S. distinctly separated from a cluster formed by S. sal-
salarius M27T, 98.6 % with S. socius SMB35T, 98 % arius M27T and S. socius SMB35T with 100 % boot-
with S. halophilus CG4.1T and 97.2 % with S. per- strap confidence (Fig. 1). Trees prepared with the NJ
itrichatus DY22T. The 16S rRNA gene sequence and ML algorithms were found to be nearly identical
contains 16S rRNA signatures identical to those of the although the ML tree has topological variations, an
members of the genus Salinicola (Table 3), confirm- observation which is in good agreement with the re-
ing it to be a member of this genus, although in- sults of de la Haba et al. (2012).
traspecies separation was confirmed by 48 species
specific signatures (Table S4). Helix 441 contained Multilocus gene sequence analysis
more than an average number of variations (seven out
of 48 signatures) indicating hypervariability of the The nearly full length 23S rRNA has been considered
helix. In the phylogenetic tree, strain S4-41T also as a good tool for taxonomic resolution in phylogenetic

123
Antonie van Leeuwenhoek

Fig. 1 16S rRNA based
neighbour-joining
phylogenetic tree showing
the phylogenetic
relationship of the strain S4-
41T with other related
Halomonadaceae taxa.
Bootstrap values expressed
as percentages of 1000
replications are given at
branch points. Accession
numbers are given in
parentheses. Bar 1
substitution per 100
nucleotide position. Filled
triangle branches were
recovered in Maximum
Likelihood tree; filled circle
branches were recovered in
Maximum Parsimony tree

studies of this family (Arahal et al. 2002; de la Haba sequence analysis and tested phylogenetic resolution
et al. 2010a) and has been used as a source of using split decomposition analysis of different gene
supplementary phylogenetic information to the 16S combinations. However, using the primer pairs pro-
rRNA gene. More recently, de la Haba et al. (2012) posed by de la Haba et al. (2012) for the amplification
have proposed inclusion of the multilocus sequence of housekeeping genes rpoD, gyrB and atpA, no
analysis methodology for taxonomic delineation of amplicons were obtained for S. acroporiae S4-41T, S.
members of the family Halomonadaceae by incorpo- socius DSM 19940T and S. peritrichatus JCM 18795T
rating sequences of four protein coding genes in which necessitated the design of genus specific con-
addition to 16S and 23S rRNA genes allowing robust served primers (Table 1). A similar observation was
phylogenetic study with enhanced resolution. We have made by de la Haba et al. (2012) when the authors
analysed the genus Salinicola following multilocus failed to detect rpoD and gyrB genes in S. socius DSM

123
Antonie van Leeuwenhoek

Fig. 2 Split tree based on concatenated sequences of rRNAs (16S and 23S) and four protein coding housekeeping genes

19940T. With the newly synthesized primers, ampli- have a significant genetic link with ungrouped
cons of sizes varying between 552–831, 564–771, and Halomonas and separated later in the phylogeny by
480 bp were obtained for rpoD, gyrB, atpA genes forming a closed cluster. Such resolution was not found
respectively. For the genera Salinicola, Kushneria and in the split tree generated with four protein coding
Chromohalobacter, split tree topologies prepared with genes only and hence supports the concept of using the
either the six gene concatenation (Fig. 2) or with four six gene multilocus sequence analysis.
protein coding genes only (Fig. 3) remained nearly In the phylogenetic group of Salinicola, strain
unaffected indicating these genetic markers have little S4-41T is clearly separated from a cluster composed of
significance for the phylogeny of these genera. How- S. salarius M27T and S. socius SMB35T and is
ever, for the genus Halomonas, the split tree generated distantly related to S. peritrichatus DY22T and S.
through six gene concatenations has significant resolu- halophilus CG4.1T. This confirms that in the genus
tion especially for delineation of Halomonas rRNA Salinicola, strain S4-41T has emerged from a lineage
group 1 from the ungrouped Halomonas (Fig. 2). that has later separated into two branches, one
Halomonas rRNA group 2 is a phylogenetically occupied by S4-41T and another one composed of S.
distinct cluster but the rRNA group 1 was found to salarius M27T and S. socius SMB35T. Both Figs. 2

123
Antonie van Leeuwenhoek

Fig. 3 Split tree based on concatenated sequences of four protein coding housekeeping genes

and 3 support this hypothesis and confirm that strain having 99.20 % similarity. Based on the atpA (369 bp)
S4-41T represents a novel species of this genus. and secA (540 bp) gene sequences, S4-41T is closely
Based on multilocus gene sequence analysis, the related to S. socius SMB35T having 93.77 and
intragenus similarity varies between 93 and 97 % 89.26 % similarity respectively. For the gyrB
(Table S5) and strain S4-41T is most closely related to (471 bp) and rpoD (288 bp) gene sequences, S.
S. salarius M27T with 96 % similarity. Similarly, peritrichatus DY22T was found to be the closest
based on partial shared lengths of 23S (2499 bp), atpA relative of strain S4-41T, having 90.23 and 86.11 %
(369 bp), gyrB (471 bp), rpoD (288 bp), secA similarity respectively.
(540 bp) gene sequences, the intragenus similarity
varies between 95–99, 90–96, 86–93, 80–90 and DNA G?C content and DNA–DNA hybridization
82–90 % respectively (Table S5). The intrageneric study
and intergeneric similarity (%) is in good agreement
with the data presented by de la Haba et al. (2012). The G?C content of the genus Salinicola has been
Based on 23S rRNA gene sequence analysis, S4-41T reported to range between 58 and 64 mol% (Table 2).
was found to be closely related to S. salarius M27T, Strain S4-41T has a G?C content of 63.6 mol%, a

123
Antonie van Leeuwenhoek

value close to the G?C value of S. halophilus LMG Table 4 Fatty acid profiles of Salinicola acroporae strain
23626T and S. socius DSM 19940T but higher that the S4-41T and the type strains of the genus Salinicola
G?C value of S. salarius DSM 18044T and S. Peak name 1 2 3 4 5
peritrichatus JCM 18795T.
Using DNA of strain S4-41T as labeled probe, the C10:0 – 1.1 tr 1.2 tr
mean DNA–DNA hybridization values were 30 ± C12:0 4.4 1.8 2.8 3.1 3.1
6 % with S. salarius DSM 18044T, 35 ± 1 % with S. C14:0 8.6 tr tr 1.1 tr
halophilus LMG 23626T, 25 ± 3 % with S. per- C16:0 35.4 26.1 23.9 21.2 21.6
itrichatus JCM 18795T and 19 ± 5 % with S. socius C17:0 1.1 tr tr tr tr
DSM 19940T. These hybridization values are sig- C18:0 tr 1.2 tr 3.9 1.3
nificantly lower than 70 %, the recommended value Iso-C15:0 tr tr – 1.0 tr
for bacterial species delineation (Wayne et al. 1987), Iso-C16:0 – tr 1.9 tr tr
suggesting S4-41T should be considered a novel Anteiso-C14:0 tr tr tr 1.7 tr
member of the genus Salinicola. Anteiso-C15:0 tr tr tr 2.5 tr
Anteiso-C17:0 tr tr tr 1.3 tr
Chemotaxonomic analysis C12:0 2OH – 1.5 2.1 1.7 1.3
C12:0 3OH tr 5.6 8.0 5.4 8.0
Comparative analysis of fatty acids among strain S4- C14:0 3OH/isoI-C16:1 7.0 – 2.4 1.8 tr
41T and type strains of the genus Salinicola are C14:1 x5c – tr – 1.1 –
presented in Table 4. All strains consistently contain C16:1 x7c/C16:1 x6c 2.5 1.3 3.1 5.6 3.1
C12:0, C16:0, C16:1 x7c/C16:1 x6c, C18:1x7c, cyclo- C18:1 x7c 1.7 5.0 17.1 22.5 10.8
C19:0x8c indicating that these fatty acids may be C18:1 x9c tr – – 1.1 Tr
considered as signature fatty acids for the genus C18:1 x7c 11-methyl tr tr tr 1.4 Tr
Salinicola. Compared to other type strains of the genus C19:1 x6c/x7c/19cy – tr 1.4 Tr tr
Salinicola, strain S4-41T contained lower amounts of C20:2 x6,9c tr tr tr 1.4 tr
C18:1 x7c and cyclo-C19:0x8c and higher amounts of Cyclo-C17:0 24.4 5.8 6.6 tr 8.4
C14:0, C14:0 3OH/isoI-C16:1 and cyclo-C17:0. More- Cyclo-C19:0 x8c 6.1 42.7 23.8 10.3 33.4
over, strain S4-41T contained no C12:0 2OH, which Cyclo-C19:0 x10c – – 1.4 – –
was consistently found to be present in the other C12:0 aldehyde 7.0 tr 2.4 1.8 tr
species. Q-9 was found to be the major respiratory
Fatty acids were extracted from stationary phase cells grown
quinone for the members of the genus Salinicola on marine agar at 30 °C for 3 days. All data in the table are
(Table 2). Strain S4-41T was found to contain Q-9 as from the present study. Fatty acids amounting to less than
sole respiratory quinone and so differed from S. 0.5 % of the total fatty acids not mentioned in this table
salarius M27T and S. halophilus CG4.1T that con- Strains 1 Salinicola acroporae S4-41T; 2 Salinicola salarius
tained Q-8 and Q-8, Q-10 respectively as minor DSM 18044T; 3 Salinicola socius DSM 19940T; 4 Salinicola
halophilus LMG 23626T; 5 Salinicola peritrichatus JCM
quinones.
18795T
Phosphatidylglycerol, diphosphatidylgylcerol and
tr trace (\1 %), – not detected
phosphatidylethanolamine were identified as the ma-
jor polar lipids of the members of the genus Salinicola
(Fig. 4). In addition, several unidentified aminolipids Conclusion
and unidentified lipids were found to vary among the
different species of the genus Salinicola. Hence, polar For the genera Salinicola, Chromohalobacter and
lipid profiles can be used as a taxonomic tool for the Kushneria, 16S rRNA gene based phylogenetic
separation of species of the genus Salinicola. The analysis has significant taxonomic resolution. The
distribution and number of unidentified aminolipids in description of intragenus and intergenus 16S rRNA
S4-41T was observed to be different from those of signatures is helpful and provides phylogenetic insight
other type strains, consistent with the conclusion that for the description of species of these genera.
the strain represents a novel species of the genus Multilocus sequence analysis has the potential of
Salinicola. addressing intragenus heterogeneity as evidenced

123
Antonie van Leeuwenhoek

Fig. 4 Polar lipid profile of
strain S4-41T and type
strains of the genus
Salinicola

from the study of the genus Halomonas, yet it is not a Cells are Gram negative, non-sporulating, motile,
requirement for the genus Salinicola considering the short rods of size 0.3–0.6 lm 9 1.0–1.4 lm and
lower number of species. With the incorporation of occur singly or in pairs. Does not grow anaerobically.
more new species in this family, it will likely become On marine agar, forms cream circular colonies of
essential to consider such multilocus sequence analy- diameter 0.5–1 mm after 2 days at 30 °C.
sis for robust taxonomic investigations. Polar lipid Heterotrophic growth occurs at 15–45 °C and pH
profiles were found to be is a good taxonomic tool for 4.5–9. Grows in the presence of 0–25 % NaCl.
species discrimination for the genus Salinicola. Optimum growth occurs in 5–10 % NaCl at 30 °C
Strain S4-41T has some phenotypic characteristics, and pH 5–6. Oxidase and catalase tests are positive but
G?C content and 16S rRNA signatures identical to negative for o-nitrophenyl-b-D-galactopyranosidase,
those of the members of the genus Salinicola. arginine dihydrolase, ornithine decarboxylase, lysine
However, it is phylogenetically distinct from the type decarboxylase, tryptophan deaminase, phenylalanime
species of the genus Salinicola as supported by species demaminase and nitrate reductase activity. Positive for
specific 16S rRNA signatures and extensive multilo- methyl red test and hydrolysis of DNA and negative
cus sequence analysis data. Combined with these, for Voges–Proskauer test, H2S production and hy-
phenotypic variations, polar lipids and fatty acid drolysis of gelatin, urea, esculin, starch, Tween 20,
composition, low level of genetic relatedness as Tween 40, Tween 80. As sole source of carbon and
evidenced from DNA–DNA hybridization results all energy, positive for utilisation and acid production
strongly support the proposal of a novel species of the from D-glucose, citrate, D-melibiose, amygdalin, L-
genus Salinicola for which the name Salinicola arabinose, D-mannose, D-mannitol, potassium glu-
acroporae sp. nov. is proposed. conate, malic acid, trisodium citrate, phenylacetic
acid and negative for utilisation and acid production
from inositol, D-sorbitol, D-saccharose. In APIZYM
Description of Salinicola acroporae sp. nov test, positive for activity of alkaline phosphatase,
leucine arylamidase, valine arylamidase, acid phos-
Salinicola acroporae (acro’po.rae. N.L. gen. n. phatase, napthol-AS-BI-phosphohydrolase, esterase
acroporae of Acropora, referring to the isolation of (C 4), esterase Lipase (C 8), Lipase (C 14) and
the type strain from the coral A. digitifera). negative for a-glucosidase, cystine arylamidase,

123
Antonie van Leeuwenhoek

trypsin, a-chymotrypsin, a-galactosidase, b-galactosi- C16:1x7c/C16:1 x6c, C18:1x7c and C17:0. The iso-
dase, b-glucuronidase, b-glucosidase, N-acetyl-b-glu- prenoid ubiquinone is Q-9. Polar lipids include
cosaminidase, a-mannosidase and a-fucosidase phosphatidylglycerol, diphosphatidylglycerol, phos-
activity. In API 50CH tests, acid is produced from phatidylethanolamine, six unidentified aminolipids
glycerol, erythritol, D-arabinose, L-arabinose, D-ribose, and four unidentified lipids. The DNA G?C content
D-xylose, D-galactose, D-glucose, D-fructose, D-man- of the type strain is 63.6 mol% (HPLC method).
nose, D-mannitol, D-cellobiose, D-maltose, D-lactose, The type strain, S4-41T (=JCM 30412T = LMG
D-melibiose, D-trehalose, D-lyxose, D-fucose and D- 28587T) was isolated from mucus of coral A. digitifera
arabitol and negative for acid production from L- from Andaman Sea. The GenBank/EMBL/DDBJ
xylose, D-adonitol, methyl-b-D-xylopyranoside, L-sor- accession numbers for the 16S rRNA, 23S rRNA,
bose, L-rhamnose, dulcitol, inositol, D-sorbitol, atpA, gyrB, rpoD and secA genes of strain S4-41T are
methyl-a-D-mannopyranoside, methyl-a-D-glucopy- KM200719, KP241690, KM280699, KM280696,
ranoside, N-acetylglucosamine, amygdalin, arbutin, KM280706 and KM280701, respectively.
esculin, salicin, D-sucrose, inulin, D-melezitose, D-
raffinose, starch, glycogen, xylitol, gentiobiose, D- Acknowledgments We are thankful to Prof. B. Schink
(Universitaet Konstanz, Germany) for etymological advice.
turanose, D-tagatose, L-fucose, L-arabitol, potassium We are grateful to Chief Conservator of Forests (Wild life),
gluconate, potassium 2-ketogluconate, potassium Andaman and Nicobar Islands, Port Blair officially allowing us
5-ketogluconate. In Biology GNII microplates, posi- to collect samples from the Andaman Sea. This work was
tive for oxidation of a-cyclodextrin, dextrin, glycogen, supported by the funding received from Ministry of Earth
Sciences, Government of India (MoES/11-MRDF/1/59/P/08) to
N-acetyl-D-galactosamine, N-acetyl-D-glucosamine,
SKD. DNA sequencing was performed by core sequencing
adonitol, D-arabitol, D-cellobiose, i-erythritol, a-D- facility at ILS. The authors, RL and AP acknowledge the
glucose, L-fucose, D-galactose, D-fructose, a-D-lactose, Department of Biotechnology, and Council of Scientific and
lactulose, maltose, D-mannitol, D-mannose, D-meli- Industrial Research (CSIR), Government of India, New Delhi,
respectively for providing the research fellowship.
biose, b-methyl-D-glucoside, D-psicose, sucrose, D-
trehalose, xylitol, mono-methyl-succinate, acetic acid,
cis-aconitic acid, citric acid, formic acid, D-galactonic
acid lactone, D-galacturonic acid, D-gluconic acid, D- References
glucosaminic acid, D-glucuronic acid, b-hydroxy bu-
tyric acid, c-hydroxy butyric acid, itaconic acid, a- Aguilera M, Cabrera A, Incerti C, Fuentes S, Russell NJ,
keto glutaric acid, D,L-lactic acid, malonic acid, quinic Ramos-Cormenzana A, Monteoliva-Sánchez M (2007)
Chromohalobacter salaries sp. nov, moderately halophilic
acid, D-saccharic acid, succinic acid, bromo succinic bacterium isolated from a solar saltern in Cabo deGata,
acid, succinamic acid, glucuronamide, L-alaninamide, Almeria, southern Spain. Int J Syst Evol Microbiol
D-alanine, L-alanine, L-alanyl-glycine, L-asparagine, L- 57:1238–1242
aspartic acid, L-glutamic acid, glycyl-L-aspartic acid, Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z,
Miller W, Lipman DJ (1997) Gapped BLAST and PSI-
L-serine, L-leucine, L-ornithine, L-phenylalanine, L-
BLAST: a new generation of protein database search pro-
proline, L-pyroglutamic acid, glycyl-L-glutamic acid, grams. Nucleic Acids Res 25:3389–3402
c-amino butyric acid, urocanic acid, inosine, uridine, Anańina LN, Plotnikova EG, Gavrish E, Demakov VA, Ev-
thymidine, putrescine,2,3-butanediol, glycerol, D,L-a– tushenko LI (2007) Salinicola socius gen. nov., sp. nov., a
moderately halophilic bacterium from a naphthalene-uti-
glycerol phosphate, glucose-6-phosphate and negative lizing microbial association. Microbiology 76:324–330
for oxidation of Tween 40, Tween 80, L-arabinose, Arahal DR, Ludwig W, Schleifer KH, Ventosa A (2002) Phy-
gentiobiose, m-inositol, D-raffinose, L-rhamnose, D- logeny of the family Halomonadaceae based on 23S and
sorbitol, turanose, methyl pyruvate, a-hydroxy butyric 16S rDNA sequence analyses. Int J Syst Evol Microbiol
52:241–249
acid, p-hydroxy phenylacetic acid, a-keto butyric acid, Arahal DR, Vreeland RH, Litchfield CD, Mormile MR, Tindall
a-keto valeric acid, propionic acid, sebacic acid, L- BJ, Oren A, Bejar V, Quesada E, Ventosa A (2007) Rec-
histidine, hydroxy-L-proline, L-threonine, D-serine, ommended minimal standards for describing new taxa of
D,L-carnitine, phenyethylamine, 2-aminoethanol and the family Halomonadaceae. Int J Syst Evol Microbiol
57:2436–2446
glucose-1-phosphate. The predominant fatty acids Bligh EG, Dyer WJ (1959) A rapid method of total lipid ex-
include C16:0, C14:0, cyclo-C17:0, C14:03OH/isoI- traction and purification. Can J Biochem Physiol
C16:1, C12:0 aldehyde, cyclo-C19:0x8c, C12:0, 37:911–917

123
Antonie van Leeuwenhoek

Cannone JJ, Subramanian S, Schnare MN, Collett JR, D’Souza database with phylotypes that represent uncultured species.
LM, Du Y, Feng B, Lin N, Madabusi LV, Müller KM, Int J Syst Evol Microbiol 62:716–721
Pande N, Shang Z, Yu N, Gutell RR (2002) The com- Kumari P, Poddar A, Das SK (2014a) Marinomonas fungiae sp.
parative RNA web (CRW) site: an online database of nov., isolated from the coral Fungia echinata from the
comparative sequence and structure information for ribo- Andaman Sea. Int J Syst Evol Microbiol 64:487–494
somal, intron, and other RNAs. BMC Bioinform 3:2 Kumari P, Poddar A, Schumann P, Das SK (2014b) Vibrio
de la Haba RR, Arahal DR, Márquez MC, Ventosa A (2010a) panuliri sp. nov., a marine bacterium isolated from spiny
Phylogenetic relationships within the family Halomon- lobster, Panulirus penicillatus and transfer of Vibrio pon-
adaceae based on comparative 23S and 16S rRNA gene ticus from Scophthalmi clade to the newly proposed Pon-
sequence analysis. Int J Syst Evol Microbiol 60:737–748 ticus clade. Res Microbiol 165:826–835
de la Haba RR, Sánchez-Porro C, Márquez MC, Ventosa A Mata JA, Martınez-Cánovas J, Quesada E, Béjar V (2002) A
(2010b) Taxonomic study of the genus Salinicola: transfer detailed phenotypic characterisation of the type strains of
of Halomonas salaria and Chromohalobacter salarius to Halomonas species. Syst Appl Microbiol 25:360–375
the genus Salinicola as Salinicola salarius comb. nov. and Mellado E, Moore ERB, Nieto JJ, Ventosa A (1995) Phyloge-
Salinicola halophilus nom. nov., respectively. Int J Syst netic inferences and taxonomic consequences of 16S ri-
Evol Microbiol 60:63–71 bosomal DNA sequence comparison of Chromohalobacter
de la Haba RR, Márquez MC, Papke RT, Ventosa A (2012) marismortui, Volcaniella eurihalina, and Deleya salina
Multilocus sequence analysis of the family Halomon- and reclassification of V. eurihalina as Halomonas euri-
adaceae. Int J Syst Evol Microbiol 62:520–538 halina comb. nov. Int J Syst Bacteriol 45:712–716
Dobson SJ, Franzmann PD (1996) Unification of the genera Mesbah M, Premachandran U, Whitman WB (1989) Precise
Deleya (Baumann et al.1983), Halomonas (Vreeland et al. measurement of the G?C content of deoxyribonucleic acid
1980), and Halovibrio (Fendrich 1988) and the species by high performance liquid chromatography. Int J Syst
Paracoccus halodenitrificans (Robinson and Gibbons Bacteriol 39:159–167
1952) into a single genus, Halomonas, and placement of Myers EW, Miller W (1988) Optimal alignments in linear space.
the genus Zymobacter in the family Halomonadaceae. Int J Comput Appl Biosci 4:11–17
Syst Bacteriol 46:550–558 Parte AC (2014) LPSN—list of prokaryotic names with standing
Felsenstein J (1985) Confidence limits on phylogenies: an ap- in nomenclature. Nucleic Acids Res 42(D1):D613–D616
proach using the bootstrap. Evolution 39:83–791 Poddar A, Lepcha RT, Das SK (2014) Taxonomic study of the
Franzmann PD, Wehmeyer U, Stackerbrandt E (1988) genus Tepidiphilus: transfer of Petrobacter succinatiman-
Halomonadaceae fam. nov., a new family of the class dens to the genus Tepidiphilus as Tepidiphilus succinati-
Proteobacteria to accommodate the genera Halomonas mandens comb. nov., emended description of the genus
and Deleya. Syst Appl Microbiol 11:16–19 Tepidiphilus and description of Tepidiphilus thermophilus
Hiraishi A, Shin YK, Sugiyama J (1992) Rapid profiling of sp. nov., isolated from a terrestrial hot spring. Int J Syst
bacterial quinones by two-dimensional thin-layer chro- Evol Microbiol 64:228–235
matography. Lett Appl Microbiol 14:170–173 Sambrook J, Russell DW (2001) Molecular cloning: a labora-
Huo YY, Meng FX, Xu L, Wang CS, Xu XW (2013) Salinicola tory manual, 3rd edn. Cold Spring Harbor Laboratory, Cold
peritrichatus sp. nov., isolated from deep-sea sediment. Spring Harbor
Antonie Van Leeuwenhoek 104:55–62 Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S
Huson DH, Bryant D (2006) Application of phylogenetic net- (2011) MEGA 5: molecular evolutionary genetics analysis
works in evolutionary studies. Mol Biol Evol 23:254–267 using maximum likelihood, evolutionary distance, and
Jiang J, Pan Y, Hu S, Zhang X, Hu B, Huang H, Hong S, Meng J, maximum parsimony methods. Mol Biol Evol
Li C, Wang K (2014) Halomonas songnenensis sp. nov., a 10:2731–2739
moderately halophilic bacterium isolated from saline and Ventosa A, Quesada E, Rodriguez-Valera F, Ruiz-Berraquero F,
alkaline soils. Int J Syst Evol Microbiol 64:1662–1669 Ramos-Cormenzana A (1982) Numerical taxonomy of
Kim KK, Jin L, Yang HC, Lee ST (2007) Halomonas gom- moderately halophilic Gram-negative rods. J Gen Micro-
seomensis sp. nov., Halomonas janggokensis sp. nov., biol 128:1959–1968
Halomonas salaria sp. nov. and Halomonas denitrificans Wayne LG, Brenner DJ, Colwell RR, Grimont PAD, Kandler O,
sp. nov., moderately halophilic bacteria isolated from sal- Krichevsky MI, Moore LH, Moore WEC, Murray RGE,
ine water. Int J Syst Evol Microbiol 57:675–681 Stackebrandt E, Starr MP, Truper HG (1987) International
Kim OS, Cho YJ, Lee K, Yoon SH, Kim M, Na H, Park SC, Jeon Committee on Systematic Bacteriology. Report of the ad
YS, Lee JH, Yi H, Won S, Chun J (2012) Introducing hoc committee on reconciliation of approaches to bacterial
EzTaxon-e: a prokaryotic 16S rRNA gene sequence systematics. Int J Syst Bacteriol 37:463–464

123