You are on page 1of 7

Egyptian Journal of Aquatic Research 43 (2017) 205–211

Contents lists available at ScienceDirect

Egyptian Journal of Aquatic Research


journal homepage: www.sciencedirect.com/locate/ejar

Full length article

Biosurfactant production by haloalkaliphilic Bacillus strains isolated from


Red Sea, Egypt
Khouloud M. Barakat a,⇑, Sahar W.M. Hassan a, Osama M. Darwesh b
a
Microbiology Lab., National Institute of Oceanography & Fisheries, Alexandria, Egypt
b
Department of Agriculture Microbiology, National Research Centre, Dokki, Cairo, Egypt

a r t i c l e i n f o a b s t r a c t

Article history: This study aimed to produce biosurfactant by extremophilic marine bacteria. Twenty-one oil-spilled sea-
Received 16 June 2017 water samples were collected from Shalateen, Red Sea, Egypt. Two promising morphologically distinct
Revised 4 September 2017 biosurfactant-producing marine bacteria, SH20 and SH24, were selected. They were grown on minimal
Accepted 6 September 2017
salt medium (MSM) and the biosurfactant production was evaluated and detected after 24 h using drop
Available online 21 September 2017
collapsing test, blood hemolysis, emulsification index and surface tension. SH20 and SH24 isolates
showed the highest emulsification index 57 and 56%, respectively, and have positive results for hemolysis
Keywords:
and drop collapse. The two isolates were identified using 16 S rRNA as Bacillus amyloliquefaciens SH20 and
Biosurfactant
Haloalkaliphiles
Bacillus thuringiensis SH24. Stability of biosurfactant production by both strains was observed at moder-
Bacillus sp ate temperature (30 °C), high alkalinity at pH (11) and high salt concentration (15%). An increase of emul-
SDS-PAGE sification index tended to be 60 and 69%, respectively, considering the two strains haloalkiphilic bacteria.
FTIR To study the stability mechanism for extremophilic biosurfactant producers, the protein profile was
GC–MS determined using SDS-PAGE electrophoresis showing some new detected proteins depends on their cul-
turing conditions. Partially purified biosurfactant from the most active strain B. amyloliquefaciens SH20
was chemically determined by FTIR and GC–MS analysis showed characteristic bands, revealed the pres-
ence of non-anionic didemnin surfactant.
Ó 2017 National Institute of Oceanography and Fisheries. Hosting by Elsevier B.V. This is an open access
article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Introduction as moistening, dispersing, emulsifiers and foaming agents. Also,


the biosurfactant are the best environmental compatibility at
Surface-active compounds are chemically synthesized and com- extreme salinity, temperatures and pH (Datta et al., 2011). There-
monly used in almost every sector of recent industry (Samadi et al., fore, hopefully future’s extremophilic microbial surfactants appear
2007). Environmental carefulness has expanded and led to alterna- to depend specifically on the use of plentiful and cheap substrates
tive biological surfactants as the most promising existing product for optimization of the operational cultivation conditions, since
(Henkel et al., 2012). Biosurfactants are classes of high values using they have particular adaptations to maintain stability in oppose
microbial activities which become important products that environments (Makkar et al., 2011). The beneficial effects of this
increase the demand of satisfy in wider applications (Sachdev field were paid attention for isolation and characterization of
and Cameotra, 2013). Biosurfactants are extracellular secondary extremophiles produced biosurfactants (Putri and Hertadi, 2015).
metabolites, their structure depend on carbon and nitrogen ratio Red Sea, the saltiest bodies of water in the world, has a wide salt
and influences on total production (Janek et al., 2013). The biosyn- preference diversity of slight (1.7–4.8%), moderate (4.8–20%) and
thesis of these molecules with active surface occurs by new path- extreme (20–30%) halophilic bacterial species having important
way or assembly from substrates (Syldatk et al., 1985). compounds including biosurfactants (Ollivier et al., 1994;
Over synthetic surfactants, biosurfactants have several advan- Kheiralla et al., 2013).
tages: simplicity of syntheses, lower toxicity, action specificity Thus, the present study intends to obtain haloalkali-bacterial
and widespread applicability (Kumar et al. 2008). They are used species from Shalateen, Red Sea, Egypt, and explore them as a sus-
tainable source for production of biosurfactants. Moreover, the two
strains SH20 and SH24 were screened for their biosurfactant
Peer review under responsibility of National Institute of Oceanography and
Fisheries. potentiality. Also, the mechanism of biosurfactant production sta-
⇑ Corresponding author. bility was studied by SDS-PAGE electrophoresis techniques. Finally,
E-mail address: kh2m2@yahoo.com (K.M. Barakat).

http://dx.doi.org/10.1016/j.ejar.2017.09.001
1687-4285/Ó 2017 National Institute of Oceanography and Fisheries. Hosting by Elsevier B.V.
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
206 K.M. Barakat et al. / Egyptian Journal of Aquatic Research 43 (2017) 205–211

characterization of the extracted biosurfactant product was chem- Emulsifying capacity


ically carried out using FTIR and GC–MS. Emulsification index (E24) of cell-free supernatant was deter-
mined by adding equal volume of paraffin oil to the culture sam-
ples (v/v), then vortexing at high speed (2 min) and allowed to
Materials and methods stand for 24 h. The percentage of E24 was calculated using the fol-
lowing equation (Techaoei et al., 2007).
Sampling and estimation of crude oil degrading marine bacteria
Height of emulsion formed ðcmÞ  100
Three hundred ml water samples were collected from 21 oil E24 ¼
Total height of solution ðcmÞ
contaminated sites (25 cm subsurface) at Shalateen, Red sea, Egypt
(Fig. 1). Study area was characterized by 3.9–4.0% salt content and
pH 8.0 – 8.2. Samples kept in sterile container were maintained at
Surface tension
4 °C and directly transferred to lab for further analysis.
Surface tension measurements mN/m (mille Neuton/meter)
Minimal salt medium (MSM) were prepared in filtered sea
were determined from cell-free culture obtained by centrifugation
water according to Santos et al. (2014) containing (g/l): magne-
(Bodour and Maier, 2002). The mean of three measurements was
sium sulfate 0.2, dipotassium phosphate 1.0, ammonium nitrate
recorded using surface tensiometer (TD 1 Lauda tensiometer,
1.0, ferric chloride 0.05, calcium chloride 0.02, and agar 20. Five
Germany).
hundred mL of water samples were applied in petri dishes and
swirled to ensure adequate mixing. One percent (v/v) of the sterile
filtered crude oil was added as the sole carbon source. Plates were Molecular identification of the potent biosurfactant producing marine
incubated for a period of 5–10 days at 25 °C. Isolates which pro- bacteria
duced clear zone of crude oil around colonies were counted, picked
up and purified for further tests. Genomic DNA was firstly extracted by lysozyme (20 mg/ml)
and proteinase K (1 mg/ml). Total genomic DNA was purified using
isopropanol buffer as described by Darwesh et al. (2014). Amplifi-
Screening for biosurfactant activities
cation reaction (PCR) of the 16 S rRNA genes was carried out using
extracted DNA and the two primers F: (50 d AGAGTTTGATCCTGGCT-
Different bacterial colonies were inoculated in 100 ml of MSM
CAG 30 ) and R: (50 d TACGGTTACCTTGTTACGACTT 30 ). The PCR
broth supplemented by 2 drops of crude oil (Dutta and
amplification included initial denaturation at 95 °C for 5 min, fol-
Harayama, 2001), and incubated under shaking condition
lowed by 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for
(150 rpm) at 25 °C for 24–72 h. Bacterial cultures with emulsifying
45 s for complete extension (Kheiralla et al., 2016). PCR product
properties of crude oil as evidence for biosurfactant producing
was purified by QIAquick Gel Extraction Kit (QIAGEN, USA) and
activity, represent as positive results. To confirm biosurfactant pro-
run on agarose gel for sequencing. Identification was achieved
duction by screened strains, further tests were carried out.
using the BLAST program (National Centre for Biotechnology Infor-
mation). The sequences were aligned using Jukes Cantor Model.
Drop collapsing test The phylogenetic reconstruction was done using the neighbour-
The shape of the drop on the oil surface was examined after joining (NJ) algorithm; with bootstrap values and submitted to
1 min addition of 5 mL cultural supernatant to 2 mL of mineral oil Gene Bank.
surface. Positive (+) biosurfactant producing cultures gave flat
drops, however, negative (-) were for those cultures with round
drops i.e. the lack of biosurfactant production (Youssef et al., 2004) Stability of biosurfactant activities

Biosurfactant stability of cultures growing on MSM at different


Blood haemolysis temperatures (30, 40, 45, 50, 60 °C) and by changing pH (5, 6, 7, 9,
Blood agar plates containing 5% (v/v) human blood were used and 11) were investigated. Salinity affecting on emulsification
for screening haemolytic activity of the selected isolates. Occur- activity was determined by adding different concentrations of NaCl
rence of definite clear zones around a colony were detected after (0, 3, 5, 10, 15, 20, 25, and 30%) on the same growing medium. All
24 h of incubation at room temperature (Carrillo et al., 1996). the tested and control cultures were incubated under shaking con-
dition at 150 rpm for three days. Emulsification activity was deter-
mined (El-Sersy, 2012).

Protein analyses for impacting of pH and salinity on SH20 and SH24


growth

SH20 and SH24 strains were grown into MSM and maintained
at pH 11, salinity 15% NaCl. Culture media were inoculated and
incubated at 30 °C for 3 days under shaking (150 rpm). For total
proteins extraction, centrifuged cells were suspended in 200 ml of
sample buffer then boiled for 10 min. After boiling, the mixture
was centrifuged (5000 rpm for 5 min) (Darwesh et al., 2015). Total
protein was separated by 10% sodium dodecyl sulphate polyacry-
lamide gel electrophoresis (SDS-PAGE) using mini-gel elec-
trophoresis (BioRad, USA). The molecular weight of protein
profile was estimated in comparison to standard markers (11–
245 kDa; Sigma, USA). Using Coomassie Brilliant Blue R-250 stain,
Fig. 1. Sampling sites at Shalateen, Red Sea, Egypt. the protein bands were easily visualized (Laemmli, 1970).
K.M. Barakat et al. / Egyptian Journal of Aquatic Research 43 (2017) 205–211 207

Biosurfactant extraction Screening for production of biosurfactant

The biosurfactant was extracted from cell-free broth after A total of eight bacterial strains were selected according to mor-
3 days of incubation and purified using acid precipitation method. phological characteristics from Shalateen oil contaminated sites
The supernatant was subjected to 6 N HCl to achieve a final pH of and screened for their capabilities for production of biosurfactant.
2.0 and allowing precipitating at 4 °C overnight. The freeze-dried As shown in Table 2 the marine isolates SH20 and SH24 exhibited
precipitate was further extracted under vacuum by chloroform: the highest emulsification index 57 ± 2.85 and 56 ± 2.5%, respec-
methanol (65:15) (Pruthi and Cameotra, 1997). tively, and showed positive results toward the drop collapse, as
well, haemolytic action. Both SH24 and SH20 isolates reduced sur-
face tension to value 57.7 ± 2.885 mN/m recording positive results
Chemical characterization of biosurfactant(s) toward biosurfactant activity (Fig. 2). El-Sersy (2012) found that B.
subtilis N10 exhibited E24 (70.3%), achieved the largest haemolytic
The obtained freeze-dried precipitate was subjected to Fourier zone, lowered the surface tension (27.3 ± 0.2 mN/m) and gave pos-
Transform Infra-Red (FTIR) (Perkin–Elmer Spectrum RX1, Shelton, itive results toward the drop collapse. After initial screening,
Connecticut). One mg of partially purified biosurfactant was Sarafin et al. (2014) found among eight halophilic bacteria; Kocuria
grounded with 100 mg of KBr then pressed for 30 s to translucent spp. and Halococcus sp. have positive biosurfactant activity by
pellets. GC–MS analysis of purified biosurfactant(s) was carried out E24 > 50% of the crude oil. Among twenty-three morphologically
using Agilent Technologies 7890 A GC System, 5975 C inert XL MSD distinct colonies, marine Virgibacillus salaries showed reduction in
Triple-Axis Mass Detector. GC- MS conditions include: 1 mL of sam- surface tension (30 mN/m) and E24 = 80%, confirmed by positive
ple was injected with an evaporation temperature of 250 °C, results of drop collapse, oil distribution, and blood hemolysis
1.8 bar, 2.5 mL/min, split 20:1. He, the carrier gas temperature (Elazzazya et al., 2015).
was gradient 50 °C/1 min, 40 °C/min gradient 300 °C/min,
300 °C/5 min. The components were identified by comparing their
Phylogeny of active isolates
retention times to those of authentic samples of Wiley 275 Library.
The genomic DNA and the amplified 16 S rRNA gene of potent
SH24 and SH20 strains were isolated, purified and represented
Results and discussion
on agarose gel. The size of PCR product was approximately
1000 bp. After sequencing, the obtained sequences were compared
Estimation of crude oil degrading marine bacteria
with those available in GenBank using BLAST program (NCBI web
page) and the similarity percentage of these isolates were 98% with
The current study aimed to explore the indigenous microflora
strains Bacillus amyloliquefaciens and Bacillus thuringiensis. The
from one of the saltiest water bodies, Red Sea, and investigate their
sequences of these strains were submitted to GenBank and
biosurfactant-production potentiality. Many researchers isolated
recorded under accession number KY362201 and KY362202 for
the biosurfactant-producing bacteria from hydrocarbon-polluted
B. amyloliquefaciens strain SH20 and B. thuringiensis strain SH24,
environments (Shoeb, 2006; Dhail, 2012; Putri and Hertad, 2015).
respectively. The phylogenetic relationship showed that these
The results presented in Table 1 showed the distribution of bacte-
strains were very close to the type of Bacillus genera deposited in
rial spp. exhibiting degradation capabilities of crude oil in the
water samples collected from Shalateen, oil contaminated sites.
The highest bacterial count was recorded in the stations D, Sh5, Table 2
and Sh20 (81, 80 and 62 CFU/ml, respectively), while, Sh8 and Characterization of biosurfactant activities.
Sh12 showed the lowest distribution of degrading bacterial Bacterial Emulsification Hemolysis Drop Surface tension
species. isolates index (%) collapse mN/m
SH18 35 ± 1.75   67.8 ± 3.04
SH5 40 ± 2   66.6 ± 3.03
Table 1
SH2 45 ± 2.25 +  60.5 ± 3.025
Counts of crude oil degrading marine bacteria collected
SH10 40 ± 2   63.2 ± 3.03
from different oil contaminated sites at Shalateen.
SH240 35 ± 1.75  + 61.9 ± 3.045
Stations Bacterial count (CFU/ml) SH20 57 ± 2.85 + + 57.7 ± 2.885
SH24 56 ± 2.5 + + 57.7 ± 2.885
Sh1 16 SH28 50 ± 2.5 +  59.3 ± 2.885
Sh2 21
Sh3 14
Sh4 19
Sh5 80
Sh6 26
Sh7 37
Sh8 1
Sh9 41
Sh10 19
Sh12 1
Sh14 13
Sh16 36
Sh18 16
Sh20 62
Sh24 10
Sh26 12
Sh28 40
Sh30 32
M 46
Fig. 2. Emulsion formation using paraffin oil and inoculated MSM (Test) compared
D 81
with Blank (paraffin oil and water) and Control (paraffin oil and uninoculated
MSM).
208 K.M. Barakat et al. / Egyptian Journal of Aquatic Research 43 (2017) 205–211

Fig. 3. Phylogenetic tree from the 16SrRNA sequence of B. amyloliquefaciens (a) and B. thuringiensis (b) and their related strains in Gene Bank.

culture collection center of NCBI (Fig. 3a & b). Many Bacillus spp. Effect of different temperatures
were reported for their biosurfactant activities and improving their The highest emulsification activity of SH24 and SH20 was
production (Wu et al., 2008; El-Sersy, 2012; Dhasayan et al., 2015; observed at 30 °C and the emulsification index was 57% and 60%
Bouassida et al., 2017). respectively, however stable production of biosurfactant is still
present from the range 40–60 °C, which indicates that the both iso-
lates are thermo-tolerant (Fig. 4b). Biosurfactant production
Factors affecting the emulsification activity greatly affected by the incubation temperature, was considered
thermally stable. El-Sersy (2012) observed that the temperatures
More attention has been focused on biosurfactant producing below or above 35 °C resulted in a low yield of biosurfactant pro-
bacteria under extreme conditions for commercial utilization and duction by B. subtilis. Dhail (2012) showed that the surface tension
usefulness to date (Demirjian and Varas, 2001), so the aim of this of culture broth of Pseudomonas sp. (MW2) was reduced at temper-
part is the production of biosurfactant by the marine SH24 and ature between 30 and 40 °C. Deng et al. (2016) reported that the
SH20 under extreme conditions (higher salt concentration, tem- biosurfactant activity produced by Achromobacter sp. HZ01 was
perature and pH) to test their stability. slightly affected by exposing to 40, 60 and 80 °C.

Effect of different salt concentrations Effect of pH


As shown in Fig. 4a, the emulsification activity for SH24 was Due to the enormous utilization of biosurfactant in detergent
stable (57%) using 15% NaCl then gradual decrease in the activity manufacture, the choice of alkaline biosurfactant from isolated
using 20–30% NaCl. Emulsification activity produced by SH20 bacteria was needed (Banat et al., 2000). The maximum emulsifica-
was gradually increased to 60% from 10 to 15% NaCl then tion activity for SH24 and SH20 was at the alkaline value (pH 11) to
decreased at 20–30%. This fact may be related to the salts concen- reach 60% and 69%, respectively, as shown in Fig. 4c. The emulsifi-
tration in marine environments ranges from <0.05% to >30% and cation activity was decreased by decreasing the pH value from
NaCl is a main element of seawater (Makkar and Cameotra, basic to an acidic region (pH 9–5); this may be due to partial pre-
1998). El-Sersy (2012) showed that the biosurfactant produced cipitation of the biosurfactant (Khopade et al., 2012). Similarly, El-
by Bacillus subtilis was stable at high concentration of electrolyte Sersy (2012) observed that the E24 of B. subtilis biosurfactant activ-
(up to 20%). Elazzazya et al. (2015) stated that Virgibacillus salaries ity was stable in pH range from 6 to 10, but decreased at acidic pH.
biosurfactant synthesis was obtained in the presence of 4% (w/v) of Also, Elazzazya et al. (2015) observed that the maximum biosurfac-
NaCl. Moderately halotolerant Pseudomonas aeruginosa and Bacillus tant production by V. salarius (KSA-T) strain was shown when pH
cereus strains isolated from oily polluted soil showed maximum increases to 9. It can be concluded that, a typical time course pro-
tolerance to NaCl at 8% for biosurfactant production (Fouda et al., file of maximum biosurfactants production by both strains was
2016). performed at pH 11, 30 °C and 15% (w/v) salinity. Hence, the most

Fig. 4. Effect of different NaCl% (a); temperature (b) and pH range (c) on the emulsification activity produced by SH24 and SH20.
K.M. Barakat et al. / Egyptian Journal of Aquatic Research 43 (2017) 205–211 209

promising SH20 strain showed higher biosurfactant activity com- Chemical analysis
pared with SH24 strain.
B. amyloliquefaciens SH20 was selected for chemical analysis of
the extracted biosurfactant due to its reputation as the most
Protein analyses for impacting of pH and salinity on bacterial growth
promising strain with the highest surfactant production, activity
and stability.
The two potent strains B. amyloliquefaciens and B. thuringiensis
The FTIR analysis shown in Fig. 6, revealed the presence of char-
were grown under stress of pH and salinity separately. After collec-
acteristic broad band at 3368.27 cm1 for NH stretching mode,
tion of bacterial cells from each condition, the protein profile was
indicating strong hydrogen bond. The week peak observed at
determined by SDS-PAGE electrophoresis and the results were
2961.59 cm1 was characteristic band of aliphatic chains (–CH3,
illustrated in Fig. 5 and Table 3. The obtained protein profile was
–CH2) stretching vibrations. Absorbance signals detected at
analyzed by GelAnalyzer2010a program. Results showed that
2360.88 and 2075.86 cm1 may be due to the presence of R2C =
slightly changing in protein profile between the control strains
N = N stretch. A strong band peak observed at 1635.87 cm1
and the cultures under stress of pH and salinity. This means that
was indicated by a definite linkage between the amides and con-
the two strains had metabolic system to maintain with extreme
sidered as a significant presence of the peptide group in the mole-
environmental conditions. These likely back to the source of isola-
cule. Moderate intensity peak in the region of 1121.34 cm1 was
tion at marine sites; this explains the ability of the two strains for
assigned by C@O extends vibrations of carboxylic acids, aldehydes
adaptation. Gel electrophoresis of biosurfactant-producing marine
and ketones. Extended vibrations observed at 595.94 cm1 may be
Vibrio sp. 3B-2 revealed that, in addition to two strong bands, there
alkene considering bacterial proteins. Similarly, Dhasayan et al.
were other miscellaneous protein bands (Hu et al., 2015).
(2015) showed that the overall FTIR spectrum absorbance bands
of the biosurfactant obtained from B. amyloliquefaciens MB-101
pH M consistent with the lipopeptide structures. According to the FTIR
C S C pH S
spectrum, the surfactant produced by B. licheniformisY-1was deter-
mined to be a cyclic lipopeptide (Liu et al., 2016). Based on FTIR
observation, the biosurfactant produced by B. subtilis A1 was of
natural lipopeptide (Parthipan et al., 2017).
The GC–MS analysis suggested the presence of one lipopeptide
based compound that had the biosurfactant properties. The peak
at the retention time of 31.46 (Fig. 7a) was confirmed by mass

SH24 SH20

Fig. 5. Protein profile for B. amyloliquefaciens SH20 and B. thuringiensis SH24 were Fig. 6. Functional group analysis of B. amyloliquefaciens SH20 yield biosurfactant by
grown under stress of pH and salinity, C: control; S: salinity; M: marker. FTIR spectroscopic analysis.

Table 3
Analysis for protein profile of B. amyloliquefaciens SH20 and B. thuringiensis SH24 by GelAnalyzer2010a program.

Protein Unit (kDa)


SH 24 SH20
Protein Profile Control Saline pH Control Saline pH
– 110 – 250 – –
– – 97 198 – –
85 – 87 147 – –
– 78 – 122 113 109
67 – 68 91 98 97
59 – – 80 79 79
50 49 51 62 66 64
– 44 – 55 56 55
41 41 42 44 47 46
38 38 39 40 41 41
37 37 37 39 38 39
36 36 36 37 37 37
35 – 35 36 36 36
– – – 35 – 35
– – – 28 – –
Bands No. 9 8 9 15 10 11
210 K.M. Barakat et al. / Egyptian Journal of Aquatic Research 43 (2017) 205–211

Fig. 7. GC–MS analysis of nonanoic surfactant didemnin B from haloalkaliphilic B. amyloliquefaciens SH20.

spectrum as non anoic surfactant didemnin B with the molecular Demirjian, F.M., Varas, C.S., 2001. Cassidy Enzymes from extremophiles. Curr. Opin.
Chem. Biol. 5, 144–151.
weight of 1111 g/mol and formula of C57H89N7O15 (Fig. 7b). A
Deng, M.-C., Li, J., Hong, Y.-H., Xu, X.-M., Chen, W.-X., Yuan, J.-P., Peng, J., Yi, M.,
report by Sarafin et al. (2014) showed the surface active non anoic Wang, J.-H., 2016. Characterization of a novel biosurfactant produced by marine
acid biosurfactant produced by Kocuria marina BS-15. Kiran et al. hydrocarbon-degrading bacterium Achromobacter sp. HZ01. J. Appl. Microbiol.
(2010a) studied the production of a new glycolipid biosurfactant 120, 889–899.
Dhail, S., 2012. Isolation of potent biosurfactant producing bacteria from oil
with a hydrophobic non anoic acid methyl ester obtained from spilled marine water and marine sediments. Afr. J. Biotechnol. 11 (103),
marine Nocardiopsis lucentensis MSA04. A new non anoic lipopep- 16751–16757.
tide biosurfactant was obtained from marine Brevibacterium Dhasayan, A., Selvin, J., Kiran, S., 2015. Biosurfactant production from marine
bacteria associated with sponge Callyspongia diffusa. 3. Biotech. 5 (4), 443–454.
aureum MSA13 (Kiran et al., 2010b). Structural features of the Dutta, T.K., Harayama, S., 2001. Biodegradation of n-alkylcycloalkanes and n-
purified biosurfactant from B. amyloliquefaciens MB-101 confirmed alkylbenzenes via new pathways in Alcanivorax sp. strain MBIC 4326. Appl.
its lipopeptide nature of biosurfactant (Dhasayan et al., 2015). Environ. Microbiol. 67, 1970–1974.
Elazzazya, A.M., Abdelmoneima, T.S., Almaghrabi, O.A., 2015. Isolation and
Bacillus sp. considered to be major producer of different lipopep- characterization of biosurfactant production under extreme environmental
tide biosurfactants which has gained its unique structure and conditions by alkali-halo-thermophilic bacteria from Saudi Arabia. Saudi J. Biol.
importance. Sci. 22 (4), 466–475.
El-Sersy, N., 2012. A Plackett-Burman design to optimize biosurfactant production
by marine Bacillus subtilis N10. Rom. Biotechnol. Lett. 17 (2), 7049–7064.
Conclusion Fouda, A., El-Gamal, M.S., Abdel-Shakour, E.H., Radwan, A.A., 2016. Optimization
and improvement of biosurfactant production for Pseudomonas aeruginosa 4.2
and Bacillus cereus 2.3 strains isolated from oily polluted soil sample. Int. J. Adv.
The above-mentioned studies emphasize the potential uses of Res. Biol. Sci. 3 (1), 76–87.
promising haloalkaliphilic marine bacteria for biosurfactant syn- Henkel, M., Müller, M.M., Kügler, J.H., Lovaglio, R.B., Contiero, J., Syldatk, C., 2012.
thesis. Moreover, it might be deduced that this biosurfactant keep Rhamnolipids as biosurfactants from renewable resources: concepts for next-
generation rhamnolipid production. Process Biochem. 47 (8), 1207–1226.
its stable activity over a wide range of temperatures, highly alka- Hu, X., Wang, C., Wang, P., 2015. Optimization and characterization of biosurfactant
linity and hyper salinity over 15%. Protein profile was analyzed production from marine Vibrio sp. strain 3B–2. Front. Microbiol. 6, 1–13.
showing slightly changing in protein content under stress of pH Kheiralla, Z.H., Ashour, S.M., Rushdy, A.A., Ahmed, H.A., 2013. Characterization of
biosurfactants produced by Halobacillus dabanensis and Pontibacillus
and salinity. The extreme properties of the biosurfactant refers to chungwhensi isolated from oil contaminated mangrove ecosystem in Egypt1.
its usefulness for industrial applications. Extensive genomics stud- Appl. Biochem. Microbiol. 49 (3), 263–269.
ies on the peptide moieties of biosurfactant will provide specific Kheiralla, Z.H., Hewedy, M.A., Mohammed, H.R., Darwesh, O.M., 2016. Isolation of
pigment producing actinomycetes from rhizosphere soil and application it in
function of the active surfactant for further improvement and wide
textiles dyeing. Res. J. Pharm. Biol. Chem. Sci. 7 (5), 2128–2136.
applications. Khopade, A., Biao, R., Liu, X., Mahadik, K., Zhang, L., Kokare, C., 2012. Production and
stability studies of the biosurfactant isolated from marine Nocardiopsis sp. B4.
Desalination 3, 198–204.
Kiran, G.S., Thomas, T.A., Selvin, J., 2010a. Production of a new glycolipid
References biosurfactant from marine Nocardiopsis lucentensis MSA04 in solid-state
cultivation. Colloids Surf. B 78, 8–16.
Banat, I.M., Makkar, R.S., Cameotra, S.S., 2000. Potential commercial applications of Kiran, G., Anto Thomas, T., Selvin, J., Sabarathnam, B., Lipton, A.P., 2010b.
microbial surfactants. Appl. Microbiol. Biotechnol. 53 (5), 495–508. Optimization and characterization of a new lipopeptide biosurfactant
Bodour, A.A., Maier, R.M., 2002. Biosurfactants: types, screening methods, and produced by marine Brevibacterium aureum MSA13 in solid state culture.
applications. In: Bitton, G. (Ed.), Encyclopedia of Environmental Microbiology. Bioresour. Technol. 101, 2389–2396.
first ed. John Wiley and Sons Inc., Hoboken, New Jersey, pp. 750–770. Kumar, A., Mody, K., Jha, B., 2008. Evaluation of biosurfactant/bioemulsifier
Bouassida, M., Fourati, N., Krichen, F., Zouari, R., Ellouz-Chaabouni, S., Ghribi, D., production by a marine bacterium. Bull. Environ. Contam. Toxicol. 79, 617–621.
2017. Potential application of Bacillus subtilis SPB1 lipopeptides in toothpaste Janek, T., Łukaszewicza, M., Krasowska, A., 2013. Identification and characterization
formulation. J. Adv. Res. 8 (4), 425–433. of biosurfactants produced by the Arctic bacterium Pseudomonas putida BD2.
Carrillo, P.G., Mardaraz, C., Pitta-Alvarez, S.I., Giulietti, A.M., 1996. Isolation and Colloids Surf. B 110, 379–386.
selection biosurfactant-producing bacteria. World J. Microbiol. Biotechnol. 12, Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the
82–84. head of bacteriophage T4. Nature 227 (5259), 680–685.
Darwesh, O.M., Moawad, H., Abd El-Rahim, W.M., Barakat, O.S., Sedik, M.Z., 2014. Liu, B., Liu, J., Ju, M., Li, X., Yu, Q., 2016. Purification and characterization of
Bioremediation of textile reactive blue (RB) azo dye residues in wastewater biosurfactant produced by Bacillus licheniformis Y-1 and its application in
using experimental prototype bioreactor. Res. J. Pharm. Biol. Chem. Sci. 5 (4), remediation of petroleum contaminated soil. Mar. Pollut. Bull. 107 (1), 46–51.
1203–1219. Makkar, R.S., Cameotra, S.S., 1998. Production of biosurfactant at mesophilic and
Darwesh, O.M., Moawad, H., Barakat, O.S., Abd El-Rahim, W.M., 2015. thermophilic conditions by a strain of Bacillus subtilis. J. Ind. Microbiol.
Bioremediation of textile reactive blue azo dye residues using Biotechnol. 20, 48–52.
nanobiotechnology approaches. Res. J. Pharm. Biolog. Chem. Sci. 6 (1), 1202– Makkar, S.R., Cameotra, S.S.C., Banat, I.M., 2011. Advances in utilization of
1211. renewable substrates for biosurfactant production. AMB Express. 1 (5), 1–19.
Datta, S., Sahoo, S., Dipa, B., 2011. Optimization of culture conditions for Ollivier, B., Caumette, P., Garcia, J.-L., Mah, R., 1994. Anaerobic bacteria from
biosurfactant production from Pseudomonas aeruginosa OCD1. J. Adv. Sci. Res. hypersaline environments. Microbiol. Rev. 58 (1), 27–38.
2 (3), 32–36.
K.M. Barakat et al. / Egyptian Journal of Aquatic Research 43 (2017) 205–211 211

Parthipan, P., Preetham, E., Machuca, L.L., Rahman, P.K.S.M., Murugan, K., Rajasekar, Sarafin, Y., Donio, M.B.S., Velmurugan, S., Michaelbabu, M., Citarasu, T., 2014.
A., 2017. Biosurfactant and degradative enzymes mediated crude oil Kocuriamarina BS-15 a biosurfactant producing halophilic bacteria isolated from
degradation by bacterium Bacillus subtilis A1. Front. Microbiol. 8, 1–14. solar salt works in India. Saudi J. Biol. Sci. 21 (6), 511–519.
Pruthi, V., Cameotra, S.S., 1997. Production of a biosurfactant exhibiting excellent Shoeb, E., 2006. Genetic Basis of Heavy Metal Tolerance in Bacteria (Ph.D. thesis).
emulsification and surface active properties by Serratia marcescens. World J. University of Karachi, Karachi, Pakistan.
Microbiol. Biotechnol. 13 (1), 133–135. Syldatk, C., Lang, S., Matulovic, U., Wagner, F., 1985. Production of four interfacial
Putri, M., Hertad, R., 2015. Effect of glycerol as carbon source for biosurfactant active rhamnolipids from n-alkanes or glycerol by resting cells of Pseudomonas
production by halophilic bacteria Pseudomonas stutzeri BK-AB12. Procedia species DSM 2874. Zeitschrift fur Naturforschung Section C: Biosci. 40, 61–67.
Chem. 16, 321–327. Techaoei, S., Leelapornpisid, P., Santiarwarn, D., Lumyong, S., 2007. Preliminary
Sachdev, D.P., Cameotra, S.S., 2013. Biosurfactants in agriculture. Appl. Microbiol. screening of biosurfactant producing microorganisms isolated from hot Spring
Biotechnol. 97 (3), 1005–1016. and garages in northern Thailand. KMITL Sci. Technol. J. 7 (S1), 38–43.
Samadi, N., Fazeli, M.R., Abadian, N., Akhavan, A., Tahzibi, A., Jamalifar, H., 2007. Wu, J.Y., Yeh, K.L., Lu, W.B., Lin, C.L., Chang, J.S., 2008. Rhamnolipid production with
Biosurfactant production by the strain isolated from contaminated soil. J. Biol. indigenous Pseudomonas aeruginosa EM1 isolated from oil-contaminated site.
Sci. 7, 1266–1269. Bioresour. Technol. 99, 1157–1164.
Santos, D.K.F., Brandao, Y.B., Rufino, R.D., Luna, J.M., Salgueiro, A.A., Santos, V.A., Youssef, N.H., Duncan, K.E., Nagle, D.P., Savage, K.N., Knapp, R.M., McInerney, M.J.,
Sarubbo, L., 2014. Optimization of cultural conditions for biosurfactant 2004. Comparison of methods to detect biosurfactant production by diverse
production from Candida lipolytica. Biocatal. Agric. Biotechnol. 3, 48–357. microorganisms. J. Microbiol. Meth. 56, 339–347.