1

Phytochemical and Biosynthetic
Studies of Lignans

with a Focus on Indonesian Medicinal Plants


























2
3



RIJKSUNIVERSITEIT GRONINGEN


Phytochemical and Biosynthetic Studies of Lignans
with a Focus on Indonesian Medicinal Plants





Proefschrift





ter verkrijging van het doctoraat in de
Wiskunde en Natuurwetenschappen
aan de Rijksuniversiteit Groningen
op gezag van de
Rector Magnificus, dr. F. Zwarts,
in het openbaar te verdedigen op
maandag 26 juni 2006
om 14.45 uur



door


Elfahmi

geboren op 25 april 1969
te Padang, Indonesië


4
Promotor : Prof. Dr. W.J. Quax
Copromotores : Dr. H.J. Woerdenbag
Dr. O. Kayser

Beoordelingscommissie: Prof. Dr. F.A.J. Muskiet
Prof. Dr. T.J. Schmidt
Prof. Dr. R. Verpoorte









































5
Paranimfen: M.K. Julsing
M. Chalid










































To
my parents, M. Yaman and Emma
my lovely wife, Yulia Helmi
my kids, Fathiya Mufidah, Nurul Rahimah and Ahmad Muzakki Imanullah
6






This research project was financially supported by the QUE Project Batch II, Department of Biology,
Institut Teknologi Bandung ITB, Indonesia, under contract No. 3028-IX/P3S-1/KON-QUE II/2000;
IBRD Loan No. 4193-IND, and partially by a scholarship from Universiy of Groningen, the
Netherlands.

The Graduate School for Drug Exploration (GUIDE) is gratefully acknowledged for supporting part of
the printing costs of the thesis.












Printing: Facilitair Bedrijf, University of Groningen, the Netherlands
















© 2006 by Elfahmi. All rights reserved. No part of this book may be reproduced or transmitted in any
forms or by any means without permission from the author.

ISBN: 90-902-0771-6
7
Contents


Chapter 1 Aims and scope of the thesis 9
Chapter 2 Jamu: The Indonesian traditional herbal medicine 13
Chapter 3 Lignans from cell suspension cultures of Phyllanthus niruri,
an Indonesian medicinal plant 35
Chapter 4 Lignan profile of Piper cubeba, an Indonesian medicinal plant 45
Chapter 5 Essential oil constituents of Piper cubeba from Indonesia 53
Chapter 6 Reduced coniferin and enhanced 6-methoxypodophyllotoxin production
in Linum flavum cell suspension cultures after treatment with Na
2
EDTA 61
Chapter 7 Cloning of glucosyltransferase genes from cell suspension
cultures of Linum flavum in E. coli 71
Chapter 8 Production of a cytotoxic arylnaphthalene lignan in genetically
transformed root cultures of Linum leonii 83
Summary and concluding remarks 93
Samenvatting (Dutch) 97
Ringkasan (Indonesian) 101
References 105
Curriculum vitae 123
Acknowledgements 125
8
9


Chapter 1




Aims and scope of the thesis
Cnap|cr 1
10
Aims and scope of the thesis
The use of plants, plant extracts and plant-derived chemicals in the treatment of diseases, in
supplementing foods and in making cosmetics is firmly rooted in the past and still developing. Many
drugs used in contemporary medicine have been derived from plants and were originally discovered
through the traditional use by indigenous people. Podophyllotoxin, vincristine, vinblastin, camptothecin,
taxol, artemisinin, aspirin, atropine, ephedrine, quinine, reserpin and digoxin are well known examples
of such drugs.
Progress in science and technology boosts the further development of medicinal plants as
valuable sources of drugs and drug leads. Modern analytical methods, biotechnology approaches,
genomics, proteomics and metabolomics are nowadays applied in medicinal plant research and
contribute to the advancement of the field. Quite frequently a relatively low yield of active components
and difficulties in standardization are bottlenecks in medicinal plant exploitation. Efforts have been
made worldwide to enhance the production of bioactive component using a biotechnology approach. In
this thesis we aim to study phytochemical and biosynthetic aspects of lignans in selected medicinal
plants used in Indonesia and in European Linum species.
In chapter 2, we review jamu, the traditional Indonesian medicine based on the popular use of
medicinal plants. Indonesia is one of the biggest biological diversities in the word. Indonesian people
have been using jamu to treat various diseases since long. An introduction to jamu, its present status in
Indonesia, legislative and regulatory aspects, economical perspective and rational therapy with jamu are
highlighted as well as ethical considerations that should be taken into account in the development of
medicinal plants. This review aims to give comprehensive information about the biological activity and
therapeutic value of the most commonly used medicinal plants (and plant constituents) in jamu. This
knowledge can be used to further develop jamu in Indonesia in a rational way.
In the chapter 3 we studied lignans from cell suspension cultures of Phyllanthus niruri, an
important medicinal plant in Indonesia. Feeding experiments using the biosynthetic precursors of
lignans, caffeic acid and ferulic acid, were carried out in order to enhance the lignan production and to
study their biosynthetic pathway. A phytochemical study of another important medicinal plant in
Indonesia, Piper cubeba, was conducted as well. A systematic profiling of lignans was made using TLC,
HPLC, GC and GC-MS of different parts of this plant (chapter 4). So far, only fruits from P. cubeba are
used medicinally and as a food supplement. To complete the phytochemical study we also analyzed the
essential oil composition of P. cubeba using GC and GC-MS (chapter 5). Lignans and the essential oil
are the main classes of secondary metabolites of P. cubeba.
The discovery of podophyllotoxin, the starting compound for the semisynthetic anticancer drugs
etoposide
®
, teniposide
®
and etophopos
®
stimulates the research of lignans including derivatives of
podophyllotoxin and its biosynthetic intermediates. In chapter 6 we present the enhancement of the
production of 6-methoxypodophyllotoxin in cell suspension cultures of Linum flavum using
ethylenediamine tetra acetate (EDTA) and other glucosyltransferase inhibitors. The enzyme
glucosyltransferase converts coniferyl alcohol to coniferin that accumulates in the cells in high amounts.
Coniferyl alcohol is a biosynthetic precursor of 6-methoxypodophyllotoxin and other lignans. We
carried out feeding experiment in order to inhibit the coniferin formation and to enhance the 6-
methoxypodophyllotoxin production. The lignan biosynthesis in cell suspension cultures of L. flavum
was also investigated at a genetic level. We tried to clone the glucosyltransferase in Escherichia coli and
to study the enzyme further in order to better understand the biosynthesis pathway of lignans (chapter 7).
The ultimate goal is to develop a tool to enhance the production of cytotoxic lignans.
The production of a cytotoxic lignan, justicidin B, using hairy roots cultures of genetically
modified Linum leonii (transformation by Agrobacterium rhizogenes) is described in chapter 8.
Justicidin B is an arylnaphthalene lignan which exerts cytotoxic, antiviral, fungicidal, antiprotozoal and
Ains and sccpc cf |nc |ncsis
11
antiplatelet properties. In addition to the production we also study the cytotoxic activity of justicidin B
against three chronic myeloid leukemia-derived LAMA-84, K-562 and SKW human cell lines.
This thesis covers a broad range of lignan studies including phytochemistry, biotechnology and
genetic engineering in order to better understand and to enhance the production of lignans. Subjects of
our study were two selected Indonesian plants used in jamu, and two European Linum species that
contain cytotoxic lignans.
Cnap|cr 1
12


13


Chapter 2




Jamu:
The Indonesian traditional herbal medicine























Elfahmi, Komar Ruslan, Rein Bos, Oliver Kayser, Herman J. Woerdenbag, Wim J. Quax

Submitted


Cnap|cr 2
14
Abstract
Jamu is the Indonesian traditional herbal medicine that has been practiced for many centuries in
the Indonesian community to maintain good health and to treat diseases. Although modern (western)
medicine is becoming increasingly important in Indonesia, jamu is still very popular in rural as well as
in urban areas. Based on its traditional use jamu is being developed to a rational form of therapy, from
herbal practitioners to drugs in pharma industries. Jamu has acquired a potential benefit, both
economically and clinically. We survey the most frequently used plants in jamu that in addition have
been investigated as to their constituents and pharmacological effects. Many isolated compounds have
potent biological activities. Examples are: curcumin (Curcuma longa) as anticancer, antihipertensive,
antidiabetes and immunostimulating agent; andrographolide (Andrographis paniculata) as anticancer,
antiviral and cardioprotective agent; 1'-acetoxychavicol (Alpinia galanga) as anticancer, antimicrobial,
antifungal and gastroprotective agent; lignans (Phyllanthus niruri) as antiviral and hepatoprotective
agent. The Indonesian government has divided the preparation of medicinal plants into three categories,
i.e. jamu, standardized herbal medicines and fitofarmaka. As the biological activity ascribed to jamu is
largely based on empirical data, more research is needed to scientifically prove efficacy and to assure
safety. In the further development of jamu, ethical issues such as intellectual property right, benefit
sharing, biodiversity and conservation should be considered. This paper aims to review the state-of-art
of jamu and to give comprehensive views that can be used for the further improvement of the utility of
jamu in curing illnesses and maintaining good health.






















]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
15
Introduction
Following the Amazon rain forests, Indonesia has the second biggest biodiversity in the world
expressed by a high number of indigenous medicinal plants. Based on this rich source the use of
medicinal plants is very important, and in the rural areas medicinal plants are even the first choice to
treat diseases. Most of the Indonesian people have ever used traditional herbal medicines which are
popularly known as jamu. Jamu is a word in Javanese tribe language, meaning the traditional medicine
from plants. Today, jamu has been adopted into Bahasa Indonesia with the similar meaning (Riswan and
Roemantyo, 2002). Nowadays jamu is being developed from traditional handling to industrial (larger
scale) production. Worldwide however, jamu is less known than, e.g., Traditional Chinese Medicine
(TCM), Japanese Kampo and Indian Ayuverda. Jamu gendong is a kind of traditional jamu sold without
label, and freshly prepared (not preserved) from plant material in warung, the ubiquitous stalls along the
streets in Indonesia (Limyati and Juniar, 1998, Suharmiati, 2003). Jamu gendong is instantly served to
whom orders this jamu. The sellers must bring the jamu from door to door. The word gendong itself
means to carry something on the back of a body. The fresh jamu is put inside each bottle in bamboo or
rattan basket. And they use a long wide shawl called selendang for carrying the basket on the back
(Risman and Roemantyo, 2002).
A scientific approach is essential to further develop the rational use of jamu. The Indonesian
government, industry and academia put considerable efforts on it. Various groups of secondary
metabolites are known to be active components in jamu, including alkaloids, flavonoids, steroids,
terpenoids, coumarins, and lignans. They contribute to the therapeutic effect as single active compounds
as well as in combination with others.
This article reviews the use of Indonesian medicinal plants in jamu including its history, current
status, economical prospective, development, scientific approach, and summarizes the potential
developments in the future. Both online and offline literature searches have been done to compile this
review. Pubmed (Medline) and ISI Web of Science were used to retrieve any online publications. About
5,000 species of medicinal plants have been retrieved from the Medicinal Herbs Index in Indonesia and
the plants that are most frequently used as constituents of jamu are discussed in this paper.

Indonesian medicinal plants
Biodiversity
Biodiversity is defined as the variety of all life forms on earth, along with the interactions
between them and their physical environment. As an archipelagic state with thousands of islands,
Indonesia is endowed with a rich and unique biodiversity. The area of Indonesian tropical forests covers
about 143 million hectares and is inhabited by about 80% of the world’s medicinal plants. It is estimated
that the Indonesian tropical forests inhabit 28,000 plant species. There are various reports concerning the
inventory of higher plant in Indonesia. The Indonesian Country Study on Biodiversity (ICSBD 1993)
puts the number of flowering plants species in Indonesia between 25,000 and 30,000. Some 40 million
Indonesians depend directly on the country’s biodiversity, and the Indonesian community makes use of
around 6,000 plant species. Data of the number of medicinal plants also vary. PT Eisei (1995) published
the Dictionary of Indonesian Medicinal Herbs containing more than 2,500 plants species which
potentially, while Zuhud et al. (2001) identified 1,845 species with medicinal potential in the forests of
Indonesia. These numbers are potentially to be updated due to the continuing inventory and
investigation of yet unidentified species. According to the National Agency of Drug and Food Control
(NADFC/BPOM), 283 plant species have been officially registered for their medicinal use; the larger
remaining part is used traditionally.
Cnap|cr 2
16
To facilitate the activities on the conservation and sustainable use of biodiversity, the Indonesian
Government, through the National Development Planning Agency (BAPPENAS), has launched the
Indonesian Biodiversity Strategy and Action Plan 2003-2020 (IBSAP). IBSAP is based on the
evaluation of the previous action plan from 1993 called BAPI (Biodiversity Action Plan for Indonesia),
formulated in collaboration between the Indonesian Government (BAPPENAS), the Ministry of
Environment, research institutes and non-governmental stakeholders with the support of the
international developments institutions.

Recent research development and research communities
Evaluation of jamu as a rational phytotherapy has to cover different research topics including
social, cultural, economic, and ethical aspects. Phytochemical studies including extraction, isolation and
characterization of secondary plant metabolites have been developed to date. Biological activity studies
have been conducted in vitro and in vivo, and even a few clinical studies are available.
To coordinate and to conduct research directed to the development of medicinal plants, many
institutions in Indonesia are engaged. They comprise governmental institutions such as the Ministry of
Health, Ministry of Forestry, Ministry of Environment, Ministry of Agriculture, the National
Development Planning Agency (BAPPENAS), the National Agency of Drug and Food Control
(NADFC or BPOM). The universities are actively involved through the related faculties or departments
from different areas like medicine, pharmacy, chemistry, biology, agriculture, forestry, marine,
environment and engineering. National research institutions such as the Indonesian Institute of Science
and the Herbarium Bogoriense, are involved as well as non-governmental institutions such as KEHATI
(Indonesian Biodiversity Foundation, WALHI, SKEPHI, and various industrial companies (Bermawie
et al., 2005).

Economical prospective
Since the 1980s, small size jamu producers have grown sufficiently to introduce larger scale and
modern production methods (Beer, 2001). The jamu producing industry now has an annual growth of
25-30%. According to Pramono (2002) there are about 810 companies active in Indonesian traditional
medicine of which 87 are classified as IOT (Industri Obat Tradisional, Traditional Medicine Industry)
and 723 as IKOT (Industri Kecil Obat Tradisional, Small Industry of Traditional Medicine). In 2005,
872 companies in this field have been registered at BPOM. In addition, 462 companies from foreign
countries also play a role in the production of Indonesian traditional medicine. About 20 local
companies are the major players. The examples of jamu products from these companies are shown in
Table 1. The industry revenues in 2000 was estimated to be 150 million USD. However, taking into
account the possibilities on the international market and the richness of the country regarding its natural
resources, this amount can potentially be increased (Pramono, 2002). In the period between January to
June 2005, the export of medicinal plants such as Amomum cardamomum, Cinnamomum burmani, Piper
spp. and many others used to make jamu reached an amount of 126.8 million USD (Ministry of Industry,
Republic of Indonesia).

Ethical considerations in the development of medicinal plants
Intellectual property right (IPR), indigenous knowledge, benefit sharing, efficacy and safety are
issues that must be considered in the further development of Indonesian medicinal plants. Jamu has been
handed over from generation to generation based on the traditional knowledge and experience of the
community. When new plant-derived therapeutics based on indigenous knowledge are being explored, it
is important that the companies return benefits to the native population and the local governments from
which the research material was obtained (King et al., 1996). When individuals or institutions from
]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
17
biotechnologically developed countries wish to obtain indigenous raw material from a
biotechnologically less developed country, an agreement for the procurement of such material may be
negotiated. In article 19.2 of the Rio Convention (1992) there is an agreement about the handling of
biotechnology and distribution of its benefits. It is mentioned that each contracting party shall take all
practicable measures to promote and advance priority access on a fair and equitable basis by contracting
parties, especially developing countries, to the results and benefits arising from biotechnologies based
upon genetic resources provided by those contracting parties. Such access shall be on mutually agreed
terms. Goodwill to maintain such a flow may be achieved through appropriate scientific and monetary
compensation, both in real time and in long-term sharing of the benefits of discovery (Soejarto, 1996).
Harvesting too much and/or cultivating too little may render medicinal plants into endangered species. It
is important to take into account that the individuals or institutions exploring the medicinal plant
material also have responsibilities for the conservation. Most of the current knowledge that jamu can
maintain health and/or can cure diseases comes from the people who have experienced success in curing
illness by taking jamu, it remains to be proved that jamu fulfills the generally accepted criteria of safety
and efficacy in order to protect the patients.

Jamu as a way of traditional healing
Rational phytotherapy with jamu and phytomedicine
Jamu, as traditional medicine arising from experiences of the past and embedded in the culture of
society cannot stand still but constantly changes and develops. Along with allopathic medicine it shares
issues in appropriate and rational use. These include qualification and licensing of the provider, proper
use of good quality products, good communication between traditional medicine providers and patients
and provision of scientific information and guidance to the public (WHO, 2002). Although
pharmacological effects of jamu constituents have been recorded, there is an apparent lack of records or
written data reporting the effectiveness of jamu, especially of jamu gendong. To assure the proper use of
such products, the Indonesian government has divided the medicinal plants in three categories based on
the way they are prepared and based on their efficacy; i.e. jamu, standardized herbal medicines, and
fitofarmaka (phytomedicines). All preparations have to meet basic safety criteria. The therapeutic effects
of jamu have to be supported by empirical data. The efficacy of standardized herbal medicines has to be
proved in pre-clinical trials and standardization on active ingredients is required. For fitofarmaka clinical
trials have to be available. The Indonesian government has launched the Centre for Development and
Application of Traditional Treatment (Sentra P3T) in 1995. The Centre’s activities include research,
testing, education, training and service of traditional treatment. Other programmes include selecting,
testing, certifying, registration/licensing, inventory, screening, clinical testing, utilization and evaluation
of traditional medicine, and compilation of laws applicable to traditional treatment.

Preparation of jamu
Original jamu (jamu gendong) exists in the form of a decoction and is sold by ladies carrying
jamu on their back. Jamu gendong is produced by household scale industries in a simple and traditional
way. Traditional jamu makers also care about hygiene, sanitation and chemical contaminations from
biological or non-biological sources. They try to protect raw materials and products from contamination,
although this is far from international industrial standards. The way of preparation is often different from
producer to producer, and production steps like selection of raw materials, sorting, grating, scraping,
crushing, mixing and cooking, followed by boiling of the plant material in a hygienic way can differ
significantly. From this background professional training was necessary to introduce certain standards
like standardization of the raw materials used in jamu according to the Materia Medika Indonesia
(MMI). Jamu makers have to be trained on hygienic production methods and for semi-modern
Cnap|cr 2
18
technologies. The most important aspect of the training is the introduction of scientific aspects of jamu.
From household scale industries jamu has been developed and is now produced by the industries called
IKOT and IOT. To prepare jamu, IKOT and IOT use the modern technologies and their activities are
based on a scientific approach. They have to follow the directions for good manufacturing production
(GMP). Today jamu made by the industry is not anymore only in the form of a decoction but also in the
form of a tablet, pill, powder, pastille, capsule, extract, cream, and ointment.

Legislative aspects of jamu and phytomedicines in Indonesia
The Indonesian government, through the Ministry of Health and BPOM, has regulated jamu and
phytomedicines (fitofarmaka). The regulations are aimed to develop herbal medicinal products, to
protect the people from unwanted (adverse) effects, and to watch over the quality including efficacy and
efficiency. Three types of Indonesian medicinal plants that mentioned before have been regulated by
BPOM through a regulation nr. HK.00.05.4.2411, 2004.
For the production of traditional medicine in Indonesia, the industries have to refer to good
manufacturing practice guidelines for traditional medicine, called CPOTB (Cara Pembuatan Obat
Tradisional yang Baik). CPOTB is regulated by the Ministry of Health (regulation nr.
659/MENKES/SK/X/1991). This regulation has been renewed by BPOM in 2005 with regulation nr.
HK.00.05.4.1380. CPOTB includes all aspects of production such as raw material, production process,
quality control, factory building, workers, management, instrument, sanitation, etc. CPOTB is also to be
applied in the industries to produce standardized herbal medicines and phytomedicine.
The traditional medicine industry (IOT and IKOT) as well as the products have to be registered
in the BPOM (246/MENKES/Per/V/90 and HK.00.05.41.1384, 2005). Using this regulation, the
production and distribution of traditional medicine could be controlled to fulfill the requirements
according CPOTB. There are several forms of traditional medicine such as powders, pills, capsules,
crude extracts, tablets, liquids. These products have to be produced according to the description
published in regulation number 661/MENKES/SK/VII/1994. To develop the traditional medicines, the
Indonesian government has established the Centre for Development of Traditional Medicine (Sentra
P3T). The Centre is supported by regulation number 0584/MENKES/SK/VI/1995.

19
Table 1. Examples of jamu products from the big jamu companies in Indonesia.

Industry
name
Jamu name Plant used Indications / use

Sariayu
Martha
Tilaar

Post Partum
Herbs

Calami rhizome, Zingiberis purpurei rhizome, Ligusticae acutilobumae
radix, Baeckeae folium, Curcumae domesticae rhizome, Parkiae semen,
Isorae fructus, Sappan lignum, Curcumae rhizome, Andrographidis herba,
Caryophylli flos

Relieves stomach pain after giving birth, eases excrements.
Vaginal inflammations, stimulates blood circulation and
improves appetite and digestion as well as strengthening and
promoting health
PT. Phapros Menstralax Ligustici rhizome, Paeomiae alba radix, Polygalae tenuifolia radix,
Rehmanniae preparata radix, Carthami tinctorius flos, Leonuri
heterophyclus herba, Angelicae sinensis radix, Concha ostrea gigas,
Albizziae julibrissin cortex, Moutan radicis cortex
Regulates endocrine gland secretion and period, promotes
ovulation, reduces menstrual clot
PT. Sido
Muncul
Sakit kencing Orthosiphonis folium, Ligustrinae lignum, Blumeae folium, Curcumae
rhizome, Imperatae rhizome
Disorders of the urinary tract
Beras kencur
Sido Muncul
Tamarindi pulpa extract, Zingiberis rhizome extract, Cinamomi cortex,
Kaempferiae rhizome extract, Oryza sativa
It reduces fatigue, refreshes the body, prevents hemorrhoids
and cold, raises stamina and immunity
Kuku Bima Ginseng radix extract, Eurycomae radix extract, Kaempferiae rhizome
extract, Zingeberis rhizome extract, Zingeberis aromaticae rhizome extract,
Phyllanti herba extract
It raises men’s stamina, libido, and makes them look young,
blood circulation, discharging feces, reduce the possibility of
atherosclerosis and diabetes
PT. Kimia
Farma
Fitogas Hypericum extract, Centellae folium extract, Curcumae domesticae
rhizome pulveratum, Curcumae xanthorrhizae rhizome extract.
Relieves digestive disorder symptoms
New Padibu Trigonella foenum graecum, Tribulus terrestris, Yohimbee extract, Talinum
paniculatum, Plantago mayor extract
Liver and kidney disturbance
Fitolac Sauropus folium extract Increases and accelerates breast milk production
PT.Deltomed
Laboratories
Srongpas
Ginseng
Retofracti fructus, Zingiberis zerumbeti rhizome, Elephantopi radix,
Eurycoma radix, Panax ginseng radix extract
Increases vitality, relieves backache, sore muscle, fatigue, and
general debility, improves appetite, and nourishes the kidneys
Antangin JRG Zingiberis rhizome, Panax ginseng extract, Blumeae folia, Menthae folia,
Alstoniae cortex, Myristicae semen
Effectively combats cold and alleviates its symptoms such as
fever, nausea, bloating, cold sweat, dizziness, and fatigue
PT. Jamu
Iboe Jaya
Hiperten Orthosiphonis folium, Phyllanthi herba, Plantaginis folium, Blumeae
folium, Centellae herba, Morindae fructus, Alstoniae cortex,
Andrographidis herba, Apii herba
Reduces symptoms of mild hypertension
Diabetin Tinosporae caulis, Andrographidis herba, Curcumae rhizome, Syzigii
semen
Diabetes mellitus
PT. Mustika
Ratu
Tonic tea plus
daun dewa dan
ginseng
Zingiberis aromaticae rhizome, Zingiberis rhizome, Panax ginseng radix,
Retrofracti fructus, Theae folium, Colae semen, Gynurae folium
Effective for general health maintenance of men and women,
good for improvement of stamina vitality and body immunity
so that will make the body fresh, fit and energetic
Jamu godog
bugar ayu
Usneae thalus, Zingiberis purpurei rhizome, Retrofracti fructus, Santali
lignum, Sappan lignum, Illicium verum, Kaempferiae rhizome, Curcumae
rhizome, Foenigraeci semen, Andrographidis herba, Centellae herba,
Curcumae domesticae rhizome
Slowing the ageing process, improving the blood circulation,
adding more energy and strengthen
Jamu Jago Encok Orthosiphonis folia, Zingiberis zerumbeti rhizome, Zingiberis rhizome Rheumatism

20
Sirnakarang Boesenbergiae rhizome, Curcumae domestica rhizome, Curcumae
rhizome, Orthosiphonis folia, Serycocalycis folia
Dissolves kidney stone
Pegal linu Curcumae rhizome, Eucalipty fructus, Retrofracti fructus, Zingiberis
zerumbeti rhizome, Zingiberis rhizome
To get rid of muscle pains, to improve their stamina and to
avoid lethargy or insomnia
Esha Eurycomae longifoliae radix, Retrofracti fructus, Piperis nigri fructus,
Phyllanthi herba, Zingiberis rhizome
Immunostimulating
PT. Jamu
Borobudur
Allus Piperis folium, Centella herba, Curcumae domesticae rhizome, Languatis
rhizome

Nyonya
Meneer
Jamu sakit
Maag
Euphorbiae thymifoliae herba, Kaempferia rhizome, Caricae folium,
Blumeae folium
Peptic ulcer
Jamu Akas
Jantung
Coriandri fructus, Parameriae cortex, Baeckeae folium, Foeniculi fructus,
Curcuma rhizome
Various coronary problems
Singkir angin Foeniculi fructus, Paederiae folium, Menthae arvensis, Zingiberis rhizome Common cold
PT. Air
Mancur
Jaket pegal linu Zingiberis purpurei rhizome, Zingiberis rhizome, Piperis nigri fructus,
Saccharum album, Zingiberis aromaticae rhizome, Languatis rhizome,
Peppermint powder, Foeniculi fructus, Glycyrrhizae radix, Curcumae
domesticae rhizome, Curcumae rhizome, Coptici fructus, Alyxiae cortex,
Boesenbergiae rhizome
Eliminates fatique, reliefs painful stiffness of the muscles and
joints after hard work, to freshen up and strengthen body
stamina
PT. Martha
Tilaar
Jamu postnatal
Innoshape
Sauropi folium, Zingiberis zerumbeti rhizome, Curcumae rhizome,
Elephantopi folium
Slims down and firms up the body, reducing cellulite, while
rejuvenating natural beauty
PT. Soho
Farmasi
Diapet NR Curcumae domesticae rhizome, Granati pericarpium extract, Psidii folium
extract, Coicis semen, Chebulae fructus extract
Anti diarrhea
PT. Bintang
Toedjoe
Encok Siler radix, Zingiberis rhizome, Anemarrhena rhizome, Notopterigium
rhizome, Pterospermum lignum
To get rid of muscle pains
Irex Max Yohimbe bark extract, peppermint oil, Retrofracti fructus, Eurycoma
longifolia extract, Ginseng extract
Improves vitality and sexual power
Diami Sausurea radix, Curcumae domesticae rhizome, Kaempferiae rhizome,
Agastachis herba, Amomi fructus, Atractylodes rhizome
Anti-diarrhoea
PT.
Konimex
Sentia Coptidis rhizhoma, Curcuma domesticate rhizome Stomach pain, diarrhoea
PT. Tenaga
Tani farma
Pil Binari Catechu, Gallae, Jatrophae curcas folium Inner care for woman's health
PT. Puspo
Internusa
Pacekap diabest Morindae fructus extract, Orthosiphonis folium extract, Syzygii polyanthi
extract, Andrographidis herba extract, Centellae herba extract, Curcumae
rhizome extract
Diabetes mellitus
Perusahaan
jamu Sido
Jodo
Diamanis Plantaginis folium, Swieteniae macrothyllae semen, Syzygii jambolani
cortex, Momordicae fructus, Murrayae folium, Ocimi bacillici folium,
Curcumae rhizome, Kaempferiae rhizome, Melaleucae fructus, Blumeae
folium, Caryophylli flos, Catharanthi radix, Alii cepae bulbus, Alstoniae
cortex, Andrographidis herba
Diabetes mellitus
]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
21
Biological activity of the most common plants in jamu
Biological activities of the most common plants in jamu as reported in the literature are
summarized in Table 2. In the following sections in more details are discussed.

Anticancer
Plants from the family Zingiberaceae are the most often used ingredient of jamu. Eleven
Curcuma species (Curcuma aeruginosa, C. aurantiaca, C. colorata, C. domestica (synonym: C. longa),
C. euchroma, C. mangga, C. petiolata, C. purpurascens, C. soloensis, C. xanthorrhizae, and C. zedoria)
have been used traditionally as a spice and to treat several illness such as appendicitis, asthma, itch,
rheumatism, abdominalgia, anemia, hypertension, diarrhea, and dysentery. Curcumin is a main phenolic
constituent of the genus especially in the rhizome of tumeric (Curcuma domestica). Although C.
domestica, that is also called C. longa, has not been used traditionally for anticancer purposes, recent
investigations show that this plant has promising effects in this area, mainly to be ascribed to curcumin
(Fig. 1). The mechanism of action of curcumin has been partly elucidated. Inducing apoptosis plays an
important role. Furthermore, it reduces the cell cycle progression thereby preventing cancerous cell
growth (Chattopadhay et al., 2004, Karunagaran et al., 2005). In vitro and in vivo, it suppressed
carcinogenesis of the liver, kidney, colon, and breast (Okazaki et al., 2005, Kirana et al., 2003).
Preclinical and clinical studies with curcumin in relation to its anticancer potential have been reviewed.
Human clinical trials indicated no dose-limiting toxicity up to 10 g/day taken orally. These studies
carried out so far suggest that curcumin has potential in the prevention and therapy of cancer (Aggarwal
et al., 2003, Sharma et al., 2005). For C. xanthorrhiza that is used traditionally as antibacterial,
anticancer and anti-inflammatory agent scientific proof has been given for its antiproliferative and
anticancer activities. These activities are largely attributed to the sesquiterpene compound xanthorrhizol
isolated from this plant. It significantly increased apoptosis in HeLa cells (Ismail et al., 2005).
Ginger (Zingiber officinale Rose) that contains the phenolic ketones gingerol and paradol has
been launched in Indonesia as fitofarmaka (phytomedicine) for malignancies (antineoplasma).
Anticancer activity of the ginger extract has been reported in vitro and in vivo. The strongest anticancer
activity has been shown for another Zingiberaceae species, Zingiber aromaticum (Kirana et al., 2003,
Manju and Nalini, 2005). It has been suggested that Z. aromaticum containing the sesquiterpene
zerumbone, also has the potential to be developed as fitofarmaka with anticancer properties. Panduratin,
a chalcone derivative isolated from Kaemferia pandurata rhizome has been reported to suppress
carcinogenesis in human colon cancer cell lines (Kirana et al., 2003, Yun et al., 2005). Pinostrobin, a
flavonoid from this plant showed cytotoxic activity against human mammary carcinoma cells
(Sukardiman et al., 2000). Ethyl trans-cinnamate and ethyl 4-methoxy-trans-cinnamate from galanga
root oil (Alpinia galanga) induced the activity of the detoxifying enzyme, glutathione S-transferase
(GST), a major mechanism for chemical carcinogen detoxification (Zheng et al., 1993). Another isolated
compound from this plant, l'-acetoxychavicol acetate has been found to suppress chemical- and virus-
induced tumor initiation and promotion. Although the mechanism is not fully understood, this
compound inhibits activation of NF-κB and NF-κB-regulated gene expression. This may explain its
ability to enhance apoptosis and to inhibit invasion (Ichikawa et al., 2005).
Isolated compounds from jamu showed antioxidative activity in vitro using H4IIE rat hepatoma
cells. Kaempferol and luteolin protected these cells against oxidative stress. The ability of kaempferol
and luteolin to inhibit oxidative DNA strand breaks supports their suggested role as protective agents
against diseases such as cancer (Steffan et al., 2005). Three anthraquinone glycosides (pulmatin,
chrysophanein and physcionin) isolated from Rheum palmatum roots exhibited moderate cytotoxic
activity against HeLa epitheloid cells and inhibited the growth of BT-20 human breast carcinoma cells
(Kubo et al., 1992). The in vitro cytotoxicity of the plumieride, an iridoid compound which was isolated
Cnap|cr 2
22
from methanol extract of the bark of Plumeria bicolor and several analogues was determined in
radiation-induced fibrosarcoma (RIF) tumor cells. The analogues gave stronger activity than plumieride
itself (Dobhal et al., 2004). An ethanol extract of the bark of Alstonia scholaris enhanced the anticancer
activity of berberine in the Ehrlich ascites carcinoma-bearing mice. This extract also showed cytotoxic
activity to HeLa cells. Compared to the active principle echitamine, present in Alstonia scholaris, the
extract was more powerful to kill HeLa cells. The cytotoxic activity of the extract depends on the season
of collection of the plant bark. The extract of bark collected in the summer season has the highest
activity (Jagetia and Baliga, 2004, 2005). Usually this plant to be used in jamu, is collected during the
dry season (also considered as the summer season). Andrographis paniculata that is called sambiloto by
local people in Indonesia has been intensively investigated for its anticancer activity. The diterpenoid
compounds 14-deoxyandrographolide and 14-deoxy-11,12-didehydroandrographolide isolated from
aerial parts of this plant showed marked activity against a human breast carcinoma cell lines (Tan et al.,
2005). The consumption of Ardisia compressa tea (aqueous extract) resulted in complete inhibition of
the chemically-induced hepatocarcinogenesis in Wistar rats (De Mejia and Ramirez, 2004).
Catharanthus roseus that has been used to treat cancer (Eisei, 1995) contains the clinically used
anticancer drugs vincristine, vinblastin and other vinca alkaloids (Cragg and Newman, 2005). A water
extract of Centella asiatica significantly reduced the multiplicity of neoplasms in the small intestine.
This result suggests that C. asiatica has a chemopreventive effect on colon tumorigenesis in male F344
rats (Bunpo et al., 2004). 2'-Hydroxycinnamaldehyde isolated from Cinnamomum cassia bark, strongly
inhibited the in vitro growth of a broad panel human cancer cells and the in vivo growth of the SW-620
human tumor xenograft (Lee et al., 1999). Coriandrum sativum was shown to act protectively against
the deleterious effects in lipid metabolism in experimental colon cancer (Chithra and Leelamma, 2000).
Ganopoly, an aqueous polysaccharide fraction extracted from the fruiting bodies of Ganoderma
lucidum has antitumor activity combined with immunomodulating activity. Ganopoly significantly
reduced the tumor weight in a dose-dependent manner, with inhibition rates of 32.3, 48.2, and 84.9% at
doses of 20, 50, and 100 mg/kg, respectively in mice. It may represent a novel promising
immunotherapeutic agent or a lead for cancer treatment (Gao et al., 2005). Immunomodulating effects
that may be useful in the treatment of cancer have been reported for ethanolic extracts of aerial parts of
Phyllanthus niruri (Ma’at, 2002). Combination of anticancer drugs such as paclitaxel with the herbal
extracts e.g. from Glycyrrhizae radix, Rhei rhizome, Scutellariae radix, Zizyphi fructus and Zingiberis
rhizome enhanced the paclitaxel sensitivity in HeLa cells via the inhibition of multidrug resistance.
These extract suppressed the growth of HeLa cells concentration dependently. The results concluded
that the combination of anticancer drugs with some herbal extracts contributes to the improvement of
clinical outcomes in cancer chemotherapy (Takara et al., 2005). Alkaloids and quassinoids from
Eurycoma longifolia, iridoids and lignans from Plumeira rubra showed cytotoxic activity to human
breast, colon, fibrosarcoma, lung, melanoma, KB, KB-V1 cancer cell lines and in murine lymphocytic
leukemia (Kardono et al., 1990, 1991).

Antiviral
Hundreds of medicinal plants used in jamu have been tested for antiviral activity in vitro and in
vivo. But the antiviral efficacy of such herbal medicine has seldom been tested in rigorous clinical trial.
The methanol extracts of plants used in jamu e.g Andrographis paniculata, Swietinia mahagoni and
Curcuma aeruginosa showed anti-HIV activity using HIV-I-infected MT-4 cells. With the dose range of
4.2 to 175 µg mL
-1
they inhibited the HIV-protease (Otaka et al., 1995). Methanol extracts of Melaleuca
leucadendron fruit and Annona muricata stembark collected in Indonesia have been reported to be
active against herpes simplex virus-1 in vitro. M. leucadendron significantly prolonged the development
of skin lesions and reduced the mortality (Padma et al., 1998, Nawawi et al., 1999). Aqueous extracts,
tannin, lignan and other isolated compounds from Phyllanthus species have been tested for their anti-
]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
23
HIV activity in vitro and in vivo. They inhibited the HIV-key enzymes e.g. integrase, reverse
transcriptase and protease (Calixto et al., 1998, Notka et al., 2004). The genus Phyllanthus has been
intensively studied clinically for its antiviral effects. A systematic review of 22 randomized clinical trial
showed that Phyllanthus species have positive effect on antiviral activity and show positive effects on
liver biochemistry in chronic hepatitis B virus infection (Liu et al., 2001, Calixto et al., 1998).
Andrographis paniculata was also clinically tested for its antiviral activity. A phase I clinical trial of
andrographolide from A. paniculata was conducted in 13 HIV positive patients and five HIV uninfected,
healthy volunteers. This trial concluded that andrographolide may inhibit HIV induced cell cycle
deregulation, leading to a rise in CD4 (+) lymphocyte levels in HIV-1 infected individuals (Calabrese et
al., 2000). Helicterins A-F (Fig. 1), dimeric (7.5',8.2')-neolignans with a bicyclo[2.2.2]octene C-
framework isolated from Helicteres isora showed a mild inhibitory activity against reverse transcriptase
from avian myeloblastosis virus (Tezuka et al., 2000).

Antimalaria and antiparasitic
Most of the plants mentioned here have been traditionally used as antimalarial agent in
Indonesia. Methanol extracts prepared from stem bark of Alstonia scholaris, A. macrophylla and A.
glaucescense have been assessed for antiplasmodial activity against multidrug-resistant K1 strain of
Plasmodium falciparum cultured in human erythrocytes. The active indole alkaloids from these extracts,
in contrast to chloroquine, had a significantly higher affinity to the K1 strain than to the T9-96 strain
(Keawpradub et al., 1999). 1,2-Dihydroxy-6,8-dimethoxy-xanthone, isolated from Andrographis
paniculata possessed in vitro activity against P. falciparum. In vivo it gave a reduction (62%) in
parasitemia after treating the Swiss Albino mice with P. berghei (Dua et al., 2004). The petroleum ether
extracts of the rind of Carica papaya and Citrus sinensis also showed antimalarial activity against strain
P. falciparum FCK 2 in vitro (Bhat and Surolia, 2001). Screening of plant extracts that are traditionally
used for the treatment of malaria on Java showed strong antimalarial and antibabesial activitiy. They
include Achillea millefolium, Baeckea frutenscens, Brucea javanica, Curcuma xanthorrhiza, Strychnos
lucida, Swietenia macrophylla and Phyllantus niruri (Trimurningsih et al., 2005, Subeki et al., 2005).
Antibabesial activity was also found for protoberberine alkaloids and 20-hydroxyecdysone from
Arcangelisia flava against Babesia gibsoni (Subeki et al., 2005). An in vitro study on traditionally used
malaria remedies in the Kenyah of the Apo Kayan, East Kalimantan (Indonesian Borneo) concluded that
plants such as Lansium domesticum and Carica papaya are more likely to be effective antimalarials.
These herbal remedies were found to have activity against chloroquine-resistant P. falciparum (Leaman
et al., 1995). Eurycomanone and 7-methoxy-β-carboline-1-propionic acid from Eurycoma longifolia,
triterpenoid lansioides from Lansium domesticum, and Azadirachta indica collected from Kalimantan
demonstrated significant antimalarial activity (Kardono et al., 1991, Omar et al., 2003).

Anti-inflammatory, antirheumatic, antipyretic and analgesic
The anti-inflammatory effects of extract of Morinda officinalis (noni or mengkudu) in vitro and
in vivo have been shown by inhibition of the production of nitric oxide, prostaglandin E-2 and tumor
necrosis factor-alpha in lipopolysaccharide-stimulated RAW 264.7 macrophages (Kim et al., 2005). The
inhibition of the prostaglandin E2 production has been also shown by Aloe vera gel. Another effect of A.
vera was the inhibition on reactive oxygen metabolites in the human colorectal mucosa. This finding
may have a therapeutic relevance in inflammatory bowel disease (Langmead et al., 2004). The aqueous
extract of tempe (fermented soja-beans) which is a popular food in Indonesia have been reported to have
anti-inflammatory, antioxidant and antithrombotic activity in an experimental photochemical
thrombogenesis model using rat femoral artery (Rilantono et al., 2000). Cinnamomom cortex that was
collected in Indonesia inhibited the rise in vascular permeability and edema induced by acetic acid,
Cnap|cr 2
24
carrageenin, serotonin and arachidonic acid. The effect was also shown on secondary lesions in the
development of adjuvant-induced arthritis (Kubo et al., 1996). Hydroxypanduratin A and panduratin A
isolated from Kaempferia pandurata rhizome showed significant topical anti-inflammatory activity in
the assay of TPA-induced ear edema in rats. The presence of these compounds may very well be related
to the uses of this plant in traditional medicine (Tuchinda et al., 2002). The lignans niranthin,
phyltetralin and nirtetralin isolated from aerial parts of Phyllanthus amarus exhibited marked anti-
inflammatory properties and suggest that these lignans are the main active principles responsible for the
traditional application of this plant for anti-inflammatory properties (Kassuya et al., 2005). Screening of
75 medicinal plants collected in Indonesia showed that many of them had the inhibitory effects on the
nitric oxide (NO) production in lipopolysaccharide-stimulated RAW264.7 macrophages as well as
antioxidant activity through the evaluation of free radical scavenging effect and reducing power (Choi
and Hwang, 2005). NO is widely recognized as an important messenger and effective molecule in a
variety of biological system. The NO production is inhibited by the nitric oxidase inhibitors that can be
used as therapeutic agents for inflammatory diseases (Tinker and Wallace, 2006). Chrubasik et al.
(2005) comprehensively reviewed on the effects of an ethanol extract of ginger (Zingiber officinale
rhizome) and its efficacy profiles in vitro, in vivo and in clinical studies. The ginger extracts showed a
pain relieving effects in which up to 0.3 g ginger/day for musculoskeletal pain in human were
administered. This review, however, suggested the further studies to prove the efficacy and to find an
optimum dosage of ginger preparations in the treatment of osteoarthritic pain. The ethanol extract of
ginger (Z. officinale) together with Alpinia galanga, Curcuma longa, Camellia sinensis and Uncaria
tomentosa had also a statistically significant effect on reducing symptoms of osteoarthritis of the knee of
patients (Altman and Marcussen, 2001, Ahmed et al., 2005).

Hepatoprotective
Herbal preparations containing Andrographis panuculata and Phyllanthus amarus for various
liver disorders have been proved to have antihepatotoxic activity (Ram, 2001). The ethanol extract and
isolated diterpenes andrographolide and neoandrographolide from the aerial parts of Andrographis
paniculata showed significant antihepatotoxic action in Plasmodium berghei K173-induced hepatic
damage in Mastomys natalensis (Chander et al., 1995). The ethanol extract of Carica papaya seeds
caused elevation of rat serum levels of acid phosphatase (ACP), alkaline phosphatase (ALP), and
aspartate amino transferase (AST). Also mild to severe metaplasia of hepatocytes was revealed in a
dose-related manner as well as proliferation of Kupfer cells and hepatic cells cirrhosis. These
biochemical and pathological changes indicated liver cell damage and malfunction (Udoh and Udoh,
2005). A hepatoprotective effect of ethanol extracts of turmeric together with sesquiterpenes and
curcuminoid containing fractions has been shown to be related to the suppression of alanin and aspartate
aminotransferase and lactate dehydrogenase level on D-galactosamin induced liver injury in rats
(Miyakoshi et al., 2004). The hepatoprotective effect of Alstonia scholaris bark on liver injuries induced
by the carbon tetrachloride (CCl
4
), β-D-galactosamine, acetaminophen and ethanol were investigated by
means of serum-biochemical and histopathological examinations. Ethanol extracts of A. scholaris bark
significantly lowered β-D-galactosamine induced serum transaminases elevation in the serum-
biochemical analysis in rats (Lin et al., 1996). (CCl
4
)-induced hepatotoxicity in the liver of rats, as
judged by the raised serum enzymes, glutamate oxaloacetate transaminase and glutamate pyruvate
transaminase, was prevented by pretreatment with the extracts of Phyllanthus niruri, demonstrating its
hepatoprotective action (Harish and Shivanandappa, 2006).



]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
25
Antidiabetic
Diabetes mellitus is recognized by chronic elevation of the glucose level in the blood and often
accompanied by symptoms of severe thirst, profuse urination, polyuria, weigh loss, and stupor.
Medicinal plants that are used clinically to treat diabetes have shown their antidiabetes activity in vitro,
in vivo and in clinical studies. The methanol and aqueous extracts derived from Alpinia galanga caused
highly significant reduction in the blood glucose levels of normal rabbits (Akhtar et al., 2002). The
glucosidic compounds 4'-O-methylpiceid and rhapontin, isolated from kelembak (Rheum palmatum)
roots that were collected from the market in Indonesia exhibited moderate α-glucosidase inhibitory
activity in vitro. The inhibition of α-glucosidase activity may be effective in controlling abnormal levels
of blood glucose in metabolic diseases such as diabetes (Kubo et al., 1991). Hypolipidemic effects have
been shown for aqueous extracts of cumin seeds (Cuminum cyminum) on alloxan-induced diabetic, triton
and cholesterol fed hyperlipemic rats. Hyperlipidemia is an associated complication of diabetes mellitus.
In this study, administering cumin extract to diabetic rats significantly reduced the blood glucose level.
The mechanism may be by potentiating the insulin effect or by increasing the pancreatic secretion of
insulin from the cells (Dhandapani et al., 2002). Guazuma ulmifolia leaves and Trigonella fonum
graceum seeds that are used clinically against diabetes mellitus have been studied for their
antihyperglycemic effect. Aqueous extract of these plants reduced hyperglycemic peak in the rabbits
(Alarcon-Aguilara et al., 1998). Ganoderma lucidum, the water and ethanol extracts of Piper betle and
dianex, a polyherbal formulation consisting of the aqueous extracts of Gymnema sylvestre leaves,
Eugenia jambolana seeds, Momordica charantia fruits, Azadirachta indica leaves, Cassia auriculata
flowers, Aegle marmelose fruits, Withania somnifera roots, and Curcuma longa rhizome had
hypoglycemic activity in normal and streptozotocin induced diabetic mice and rats (Yang et al. 2004,
Mutalik et al., 2005, Arambewela et al., 2005). Most of those plants are used in jamu. Preclinical
evaluation consisting of animal studies, acute and subacute toxicity testing and evaluation of the
antidiabetic effect of Eugenia jambolana seed powder in streptozotocin-diabetic rats was adequate for
approval to start phase 2 clinical trials to evaluate this seed powder as complementary therapy in type 2
diabetes. The study showed that E. jambolana possibly acts as a hypoglycemic agent by increasing
insulin levels. Toxicity studies showed no evidence of mortality or abnormality (Sridhar et al., 2005).
The total triterpenoid fraction from aerial parts of Centella asiatica, has been studied in the patients with
diabetic microangiopathy. It was shown that this fraction is useful in diabetic microangiopathy by
improving microcirculation and decreasing capillary permeability and protects against the deterioration
of microcirculation due to diabetic microangiopathy (Cesarone et al., 2001).

Antimicrobial and antifungal
Antibacterial and antifungal activities have been shown by aqueous extracts, andrographolide
and arabinogalactan proteins isolated from Andrographis paniculata and are comparable (in term of
growth inhibition of Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa and Candida albicans)
to some known antibiotics, streptomycin, gentamycin and nystatin (Singha et al., 2003). Extracts of
Alstonia scholaris, Anacardium occidentale (hexane), and Carica papaya seeds (methanol and
buthanol) have been reported to possess a broad spectrum of antibacterial activity (Bouttier et al., 2002,
Khan et al., 2003, Dawkins et al., 2003). The growth-inhibiting activity of cinnamaldehyde isolated from
Cinnamomum cassia toward human intestinal bacteria (Clostridium perfringens, Bacteroides fragilis
and Bifidobacterium bifidum) was shown using an impregnated paper disk method and compared with
that of tetracycline and chloramphenicol (Lee and Ahn, 1998). The essential oils of Coriandrum sativum
and Foeniculum vulgare were reported to possess antibacterial activity to Escherichia coli and Bacillus
megaterium in vitro (Lo Cantore et al., 2004). The essential oil from Cuminum cyminum and the isolated
compounds, p-mentha-1,4-dien-7-al, cumin aldehyde, γ-terpinene, and β-pinene, showed antibacterial
Cnap|cr 2
26
activity against the genera Clavibacter, Curtobacterium, Rhodococcus, Erwinia, Xanthomonas,
Ralstonia, and Agrobacterium (Iacobellis et al., 2005). The essential oils from Cymbopogon citratus, C.
nardus, and C. schoenanthus showed a fungistatic effect against superficial mycosis (Koba et al., 2003).
The essential oil of Cinnamomum burmanni (bark and leaves) and Tagetes erecta (leaves) that were
collected in Indonesia have been reported to exhibit antimicrobial activity against Bacillus subtilis and
Salmonella typhimurium and antifungal activity against Candida albicans in vitro (Sukandar et al., 1999,
Hartati et al., 1999). An ethyl acetate extract of Curcuma longa has been reported to have antibacterial
activity and the potential to restore the effectiveness of β-lactams against methicillin-resistant
Staphylococcus aureus (MRSA), and inhibit the MRSA invasion of human mucosal fibroblasts (Kim et
al., 2005). A study of Indonesian plants with ethnomedical uses showed that the methylene chloride and
methanol extracts of Terminalia catappa, Swietenia mahagoni, Phyllanthus acuminatus, Ipomoea spp.,
Tylophora asthmatica and Hyptis brevipes have the antibacterial activities against Eschericia coli,
Staphylococcus aureus, Xanthomonas campestris and Bacillus subtilis and the antifungal activities
against C. albicans, Pythium ultimum, Rhizoctonia solani and Sclerotium rolfsii (Goun et al., 2003). The
ethanol extracts from several plant species belonging to the Zingiberaceae family used in Kenyah
(Indonesian Borneo), especially Alpinia galanga, Curcuma zedoaria and Zingiberis purpureum, were
found to have pronounced inhibitory activities against a wide variety of human pathogenic fungi,
including strains resistant to the common antifungals amphotericin B and ketoconazole. As members of
the Zingiberaceae are generally regarded as safe for human consumption, these species are excellent
candidates for development as novel therapeutic (Ficker et al., 2003). 1'-Acetoxychavicol acetate, an
active compound from Alpinia galanga has antifungal activity against Trichophyton mentagrophytes, T.
rubrum, T. concentricum, Rhizopus stolonifer and Aspergillus niger with a concentration 14 mg mL
-1

(Janssen and Scheffer, 1985)

Gastroprotective
1S-1'-Acetoxychavicol acetate and 1S-1'-acetoxyeugenol acetate, isolated from Alpinia galanga
markedly inhibited the ethanol-induced gastric mucosal lesions in rats. The action of 1S-1'-
acetoxychavicol was attenuated by pretreatment with indomethacin and N-ethylmalcimide and
significantly increased the glutathione (GSH) levels of gastric mucosa in rats. GSH acts as antioxidant
and is important for maintaining the mucosal integrity in the stomach (Matsuda et al., 2003). A different
mechanism of hepatoprotective activity was shown by asiaticoside, an active triterpenoid constituent of
Centella asiatica and its extract. They were found to promote angiogenesis and stimulate blood vessel
formation and mucosal cell regeneration during the gastric ulcer healing stage that are important parts of
the wound healing. Angiogenesis in granulation tissues improves circulation to the wound site thus
providing oxygen and nutrients are essential for the healing process (Cheng et al., 2004). The effect of
an ethanolic extract of Aloe vera on acute gastric mucosal lesions induced by 0.6 M HCl and acid output
was studied in pylorus ligated and lumen perfused rats, respectively. Aloe vera is endowed with gastric
acid anti-secretory activity and could protect the gastric mucosa at low concentrations against injurious
agents (Yusuf et al., 2004). Morinda citrifolia (noni) inhibits gastric emptying in male rats via a
mechanism involving stimulation of cholecystokinin and its receptor activation. Cholecystokinin is a
peptide hormone of the gastrointestinal system responsible for stimulating the digestion of fat and
protein. It delays gastric emptying and inhibits gastric acid and plasma gastrin responses (Konturek et
al., 1994, Pu et al., 2004). Ethanol and water extract of Abrus cantoniensis, Saussurea lappa, Eugenia
caryophyllata, Magnolia officinalis and Ligusticum species strongly inhibited the growth of
Helicobacter pylori which is an important etiologic impetus leading usually to chronic active gastritis
and gastric ulcer (Li et al., 2005).


]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
27
Cardioprotective
A study on the edible plants common in Asian diets such as Ipomoea batatas, Piper betle,
Anacardium occidentale, Gynandropsis gynandra, Carica papaya, and Mentha arvensis extracts showed
that they exhibited more than 50% relaxing effect on aortic ring preparations. Piper betle and
Cymbopogon citratus showed comparable vasorelaxation on isolated perfuse mesenteric artery
preparation (Runnie et al., 2004). 14-deoxy-11,12-didehydroandrographolide from Andrographis
paniculata was shown to have bradycardia-inducing and β-adrenoceptor antagonistic properties in vivo
using anesthetized Sprague-Dawley rats (Zhang et al., 1998). A cardioprotective effect of Centella
asiatica on the antioxidant tissue defense system during doxorubicin induced cardiac damage in rats has
been reported. The water extracts of this plant resulted in significant reduction in the levels of lactate
dehydrogenase, creatine phosphokinase, glutamate oxaloacetate transaminase and glutamate pyruvate
transaminase. Increased activity in serum of these enzymes is a well-known diagnostic marker of
myocardial function. As active ingredients triterpenes (asiatic acid and asiaticoside) may be responsible
for the cardioprotective effect of C. asiatica extracts (Gnanapragasam et al., 2004). The cardioprotection
provided by ligustrazine is related to a reduction of TNF-alpha content by inhibition of free radical
production in isolated rat hearts. It was known that TNF-alpha can contribute to myocardial damage
during ischemia-reperfusion (Zhou et al., 2004). The studies of the antioxidative and cytoprotective
effects using H9c2 cardiac myoblasts showed that Phyllanthus urinaria have a protective activity
against doxorubicin cardiotoxicity. This protection was mediated through multiple pathways such as
enhancement of survival factor through elevation of glutathione, activation of catalase/superoxide
dismutase activity and inhibition of lipid peroxidation. This plant may serve as an alternative source of
antioxidants for prevention of doxorubicin cardiotoxicity (Chularojmontri et al., 2005).

Antihypertensive
The ethanol extracts of fresh matured fruits of Carica papaya markedly depressed the blood
pressure and heart rate in mineralocorticoid salt and in renal hypertensive rats when compared with the
normotensive controls. The extracts (20 mg/kg i.v.) decreased the blood pressure by about 20.1%, 50.7%
and 54.5% in normotensive, renal and deoxycortocosterone acetate-salts hypertensive rats, respectively.
The extract appeared to be more potent than hydrallazine (200µg/kg i.v.), a well known antihypertensive
(vasodilator) agent that decreased the blood pressure by about 10.7%, 22.8% and 26.4% in those three
types of hypertension (Eno et al., 2000). The total triterpenoid fraction of Centella asiatica, a venoactive
drug acting on the microcirculation and on capillary permeability, has been tested in three groups of
patients with venous hypertension. The improvement of signs and symptoms by extracts observed in
venous hypertensive patients correlated well with the improvement of the variation of capillary filtration
rate and ankle edema (De Sanctis et al., 2001). The vasodilatory effect of Curcuma herbs has been
studied. C. longa induced endothelium-independent vasodilatation. It was concluded that Curcuma herbs
have hypotensive and protective effects on the endothelium in spontaneously hypertensive rats, and its
mechanism is thought to be related to a radical scavenging effect and improvement of hemorheology
(Goto et al., 2005). A major constituent in the water decoction of Orthosiphon aristatus leaves,
methylripariochromene A (a benzochromene), exhibited a continuous decrease in systolic blood pressure
after subcutaneous administration in conscious stroke-prone spontaneously hypertensive rats. This plant
is popular as kumis kucing in Indonesia. Javanese people prescribe the leaves in their jamu, mainly for
treatment of hypertension (Matsubara et al., 1999).

Anti-asthma, antitussive and anti-allergic
A study of selected medicinal folklore plants that are traditionally used for asthma treatment in
Indonesia indicated that alcoholic extracts, from Plantago major leaves, from Eucalyptus globulus
Cnap|cr 2
28
leaves and fruits, from Cinnamomum massoiae cortex and from Vitex trifolia leaves and two hexane
extracts -Eucalyptus globulus leaves and Vitex trifolia leaves- inhibited IgE-dependent histamine release
from RBL-2H3 cells. This suggested that extracts contain active compounds which inhibit mast cell
degranulation, and may be used in the development of new drugs for treating asthma and/or allergic
disease (Ikawati et al., 2001). An ethanol extract of Alstonia scholaris leaves induced pronounced
bronchodilatory activity in anaesthetized rats with the probable involvement of prostaglandins (Channa
et al., 2005). Clinical studies with Andrographis paniculata suggested that this plant may be effective as
an early treatment of uncomplicated acute upper respiratory tract infection on the patients tested. The
ethanol extract of A. paniculata alone or in combination with the ethanol extract of A. senticocus appear
to be more effective than placebo (Poolsup et al., 2004). The active constituents of A. paniculata,
andrographolide and neoandrographolide, have been reported to have anti-allergic effect. This effect is
due to its mast cell stabilizing activity, the same as for the antiallergic drug, disodium cromoglycate.
Neoandrographolide was more potent than andrographolide in this study. All three compounds
demonstrated significant inhibition of passive cutaneous anaphylaxis (Gupta et al., 1998). An antitussive
effect of liquiritin apioside, liquritin and liquiritigenin, isolated from Glychirrhiza radix (licorice) has
been reported. The effect of liquiritin apioside may depend on both peripheral (modulation of ATP-
sensitive K
+
channels) and a central mechanism (modulation of serotonergic system) (Kamei et al.,
2005). An aqueous extract of Alpinia galanga rhizome was found to inhibit the release of β-
hexosaminidase, a marker of antigen-IgE-mediated degranulation in RBL-2H3 cells. Isolated
compounds, 1'S-1'-acetoxychavicol acetate and 1'S-1'-acetoxyeugenol acetate inhibited β-
hexosaminidase and a passive coetaneous anaphylaxis reactions in mice and the antigen-IgE-mediated
TNF-alpha and IL-4 production, both of which participate in the late phase of type I allergic reactions
(Matsuda et al., 2003).

Immunostimulating
An immunostimulating effect has been reported from pule (Alstonia scholaris) that is used in
South East Asia mainly as antimalarial and antidysentery agents, in BALB/c mice. The bark aqueous
extract stimulated non specific immune response, restored the reduction of phagocytic action induced by
prednisolone and protected the body from the opportunistic infection caused by Escherichia coli (Iwo et
al., 2000). This effect was also shown by curcumin from Curcuma longa in BALB/c mice (Antony et
al., 1999). A polysaccharide extract of Alpinia galanga rhizome showed a marked stimulating effect on
the reticulo-endothelial system (RES) and increased the number of peritoneal exudate cells, and spleen
cells of mice (Bendjeddou et al., 2003). Immunomodulating effects were also shown by a methanol
extract, andrographolide, 14-deoxyandrographolide and 14-deoxy-11,12-didehydroandrographolide
isolated from Andrograpis paniculata. They enhanced the proliferation and interleukin-2 (IL-2)
induction in human peripheral blood lymphocytes (Kumar et al., 2004). The different mechanism of
immunostimulating effect was shown by the hexane and aqueous extract of Carica papaya seeds and its
bioactive fractions. They significantly enhanced the phytohemagglutinin responsiveness of lymphocytes
and inhibited the classical complement-mediated hemolytic pathway (Mojica-Henshaw et al., 2003).

Central nervous system (CNS) activity
The essential oil from the fruits of Cuminum cyminum, that is used traditionally as a stimulant
exhibited anticonvulsant activity. This effect was shown in both pentylenetrazole- and maximal
electroshock-induced seizures in male NMRI mice (Sayyah et al., 2002). Recently, also antidepressant
effects have been reported for curcumin. This effect may be mediated by actions in the central
monoaminergic neurotransmitter systems (Xu et al., 2005). Glycyrrhizae radix, together with other
medicinal plants has been tested to the patients who were exhibiting tremor, a symptom of
]anu. Tnc |ndcncsian |radi|icna| ncroa| ncdicinc
29
antipsychotic-induced parkinsonism. The results concluded that the combination of those plants was
effective against tremor from parkinsonism (Ishikawa et al., 2000). Alstonia macrophylla has been
reported to have a CNS depressant activity. It caused a significant reduction in spontaneous activity, a
remarkable decrease in exploratory behavioral pattern, a reduction in muscle relaxant activity and also
significantly potentiated phenobarbital sodium-induced sleeping time (Chattopadhyay et al., 2004).

Other activities
Various other activities have been reported from the medicinal plants which are used in jamu.
Grosvenor et al. (1995) surveyed the medicinal plants in Riau Province, Indonesia. Out of one hundred
and fourteen species of flowering plants belonging to 51 families, and claimed to have medicinal uses,
50% were recorded to be used to combat fever, 33% for diarrhea and 31% for other gastrointestinal
problems. Unny et al. (2003) reviewed about 161 medicinal plants which are a potential source of new
contraceptive principles. The review contains the isolated compounds and the mechanism of actions.
Some of them are used in jamu, e.g, Foeniculum vulgare, Abrus precatorius, Muraya paniculata,
Punica granatum, Curcuma longa, and C. zedoria. They inhibited implantation and increased fetal loss
in mice and reduced secretory activity and weight of accessory sex glands. The aqueous extracts of
Carica papaya and Ananas comosus have been reported to possess diuretic activity. Both plant extracts
gave similar profiles of urinary electrolyte excretion to that of the hydrochlorothiazide. The analysis of
the urinary osmolality and electrolyte excretion per unit time, together with the plant salt contents, may
help to differentiate the mechanism by which these plants acts as diuretic. The results indicated that the
diuretic activity of Ananas comosus was intrinsic and not a result of the salt loading effect, whereas C.
papaya extracts may have resulted from a high salt content of this extracts. This activity correlated well
with the maximum volume, the highest osmolality, and the amount of electrolytes excreted during urine
collection (Sripanidkulchai et al., 2001). The methanol extracts of Areca catechu, Brucea sumatrana,
Allamanda cathartica, collected in Sumateran rainforests showed strong antinematodal activity against
Bursaphelenchus xylophilus (Alen et al., 2000).

Known risks and side effects of medicinal plants used in jamu
It is generally assumed by the public, and also even by some medical practitioners, that plant
drugs are harmless and therefore are preferable. Put in such general terms this clearly is not always true.
In fact various medicinal plants also induce side effects. Powerful herbal drugs like Digitalis, Strychnos,
Belladonna and Colchicum can even be highly dangerous. Between 1988 and 2002, 70 patients with a
diagnosis of digoxin intoxication at the National Cheng Kung Hospital, Hongkong have been studied.
The symptoms that were caused by digoxin overdose included nausea, vomiting, anorexia, weakness,
syncope, dizziness and a change in consciousness (Chen et al., 2004). Digitalis may induce the toxicity
of licorice (the root of Glycyrrhiza glabra) by drug interaction via licorice-associated electrolyte
imbalance, particularly in elderly. Licorice itself may be a cause for exogenously induced hypertension,
hypokalemia, hypernatremia, or suppression of the renin-aldosterone system (Harada et al., 2002).
Deadly nightshade (Atropa belladonna) intoxication has been infrequently reported in both children and
adults. Caksen et al. (2003) showed that meaningless speech, lethargy, coma, and absence of tachycardia
were ominous signs in deadly nightshade intoxication in childhood. Huntley et al. (2005) have reviewed
the adverse effect of Echinacea species reported between 1950 an 2002. Some adverse effects such as
headache, dizziness, tiredness, occasional nausea and abdominal pain have been suffered by people after
taking Echinacea.
Data from clinical trials suggest that the most commonly experienced adverse effects of Panax
ginseng are headache, sleep and gastrointestinal disorder. The possibility of more serious adverse effects
even was found in combination products containing ginseng as one of the constituents (Coon and Ernst,
Cnap|cr 2
30
2002). Kava-kava (Piper methysticum) may cause tiredness, low energy, headache, gastrointestinal
symptoms. A 50-year-old woman was seen with papules and plaques on the face and later on her dorsal
and ventral thorax and arms after taking a kava product for 3 weeks (Stevinson et al., 2002). Although
ginger (Zingiberis officinale) shows a very broad range pharmacological effect, there are still
undesirable effects such as causing heartburn. In the quantities exceeding 6 g dried ginger may act as a
gastric irritant. Inhalation of dust from ginger may produce IGE-mediated allergy (Chrubasik et al.,
2005).
The risk of herbal medicines producing an adverse reaction depends not only on the medicine
and its dosage but also on consumer-related parameters, such as age, genetics, concomitant diseases and
co-medication (herb-herb and herb-drug interactions). Reports of herbal medicinal products affected by
contamination, adulteration or substitution of botanical material have repeatedly caused concern. Asian
herbal medicinal products including jamu are most often implicated (Ernst and Pittler, 2002). One report
was found that mentioned the microbial contamination of raw material and end product of jamu gendong
(Limyati and Juniar, 1998). Agranulocytosis and citrobacterial infection have been found after using
jamu containing phenylbutazone (Paul et al., 2005). A study of 23 commercial jamu showed the
occurrence natural aflatoxins that exhibit carcinogenic, teratogenic and mutagenic properties (Ali et al.,
2005). A side effect of Morinda citrifolia in a 45-year-old patient who has highly elevated transaminases
and lactate dehydrogenase has been reported. This gave rise to the suspicion of herbal toxicity, which
was confirmed by taking a liver biopsy (Millonig et al., 2005).

Conclusion
The in vitro, in vivo and clinical studies on medicinal plants that are used in jamu have
scientifically proved their claimed biological activities in part. Species belonging to the family
Zingiberaceae such as Curcuma, Zingiber, Kaempferia, are the most frequently used plants in jamu.
These species have also been studied intensively for their secondary metabolites and biological activity.
Curcumin and panduratin are typical examples of bioactive secondary metabolites from these plants. As
members of the Zingiberaceae are generally regarded as safe for human consumption, these species are
excellent candidates for development as novel therapeutic. BPOM has done systematic and
comprehensive research on 9 priority medicinal plants in Indonesia, i.e. ginger (Zingiber officinale) and
king of bitter (Andrographis paniculata) as antineoplasma; turmeric (Curcuma domestica), Java
turmeric (C. xanthorrhiza) and Guazuma ulmifolia, as antihyperlipidemic, Java noni (Morinda citrifolia)
and Syzygium polyanthum, as antidiabetic and Piper retrofractum as androgenic. Other medicinal plants
have been launched as fitofarmaka such as Phyllanthus niruri as immunostimulating, C. xanthorrhiza as
antirheumatic, Psidium guajava and C. domestica as antidiarrhea (Bermawie et al., 2005). Based on the
literature search, we conclude that there are many more medicinal plants that have potential to be
developed as fitofarmaka or as sources of new therapeutic agents. Although the commonly used plants
in jamu have been investigated scientifically for their biological activities, the jamu makers or the
industries still have to standardize the formulae of jamu in order to assure the efficacy and safety.
Jamu has the potential to develop because it is economically prospective and used to maintain
the health and to cure diseases. Compared to Traditional Chinese Medicine (TCM), jamu still needs
considerable efforts to reach optimum beneficiary. The scientific study of the common plants should be
continued. Exploration of medicinal plants which are the indigenous knowledge of the Indonesian
community should also consider ethical issues, such as efficacy, safety, IPR, benefit sharing and
biodiversity conservation.




31
Table 2. Survey of studies of medicinal plants used in jamu.

Plant name Plant
part
Extracts or
products
Compound(s) or group of
compounds
Test system (and dose) Results Traditional use of plant

Curcuma
domestica



Curcuma
xanthorrhiza

rhizome




rhizome


Ethanol




Ethanol

Curcumin




Xanthorrhizol


Clinical (180 mg per day)

Clinical (120 mg per day)


In vitro IC
50
= 40 µM
In vitro and in vivo EC
50
=
6.16 µg/ml

Inhibition of DNA polymerase II and induction
apoptosis (Sharma et al., 2005)
Improvement of the morning stiffness and joint
swelling in arthritis patiens (Chattopaday et al.,
2004)
Inhibition of HIV-I integrase (De Clercq, 2000)
Induction apoptosis (Ismail et al., 2005)

Appendicitis, metritis,
tonsillitis, asthma,
chancre, rheumatism,
anemia, diarrhea,
hypertension, scabies,
dysentry, hemorrhoid,
Anorexia, malaria,
gastritic, anthelmenthic
Zingiber
officinalle

Zingiber
aromatica
rhizome Ethanol


Ethanol
Gingerol, paradol


Zerumbone
In vitro, in vivo, IC
50
=
40.6 µg/ml

In vitro, in vivo, IC
50
=
20.2 µg/ml
Induction of apoptosis (Kirana et al., 2003)


Induction of apoptosis (Kirana et al., 2003)
Headache, rheumatism,
anorexia, cholera,
antiemeti, anorexia,
influenza, anemia,
malaria, anthelmentic,
cough, vertigo
Kaemferia
pandurata
rhizome Hexane

Chloroform
Pinostrobin

Hidroxypanduratin A,
panduratin A
In vitro 10-100 µg/ml

In vitro, topical, IC
50
= 84
and 12 µg/ear
In vitro IC
50
= 5.6 µM and
18.7 µM
In vitro MIC = 2-4 µg/ml

Inhibition of DNA topoisomerase I in human tumour
cell (Sukardiman et al., 2000)
Inhibition of TPA induced ear edema formation
(Tuchinda et al., 2002)
Inhibition of HIV-1 protease activity (Cheenpracha
et al., 2006)
Antibacterial activity against Prevotella intermedia,
P. loescheii, Streptococcus matans (Park. Et al.,
2005)
Dry cough, fungi,
diphtheria, gonorrhoea,
spice
Alpinia
galanga
rhizome Oil

Aqueous
acetone
Ethyl- and ethyl 4-
methoxy-trans-cinnamate
l'-Acetoxychavicol and
1S-1'-acetoxyeugenol
acetate

In vitro 20 mg per 2 days

In vivo 2 mg/kg BW

In vitro IC
50
= 15 and 19
µM
Induction of glutatione S-transferase (GST) (Zheng
et al., 1993)
Induction of apoptosis (Ichikawa et al., 2005)
Increase of the glutathione (GSH) levels of gastric
mucosa in rats (Matsuda et al., 2003)
Inhibition of β-hexosaminidase, as a marker of
antigen-IgE-mediated degranulation (Matsuda et al.
2003)
Stomatic, anorexia,
dermatosis, anaesthetic,
malaria, gastritis
Rheum
palmatum
root Methanol Pulmatin and
chrysophanein physcionin
4'-O-methylpiceid and
rhapontin
In vitro IC
50
= 1.5 µg/ml
2.5 µg/ml
In vitro IC
50
= 280 µg/ml
and 600 µg/ml
Inhibition of the growth HeLa epithelioid and BT-20
human breast carcinoma cells (Kubo et al., 1992)
Inhibition of α-glucosidase activity (Kubo et al.,
1991)

Astringent, stomach-ache,
tonic

32
Cymbopogon
citratus
leaves Oil

d-Limonene, geraniol

Geranial, neral, myrcene,
β-pinene
In vitro 20 mg per 2 days

In vivo 500 mg/kg BW
Induction of glutatione S-transferase (GST)
(Zheng et al., 1993)
Suppression of parasitemia till 86.6%
(Tchoumbougnang et al., 2005)
Dysuria, diaphoretic,
edeme, cold, rheumatism,
gastritis, enteritis
Plumeria
bicolor
bark Methanol Plumieride In vitro, IC
50
= 49.5 µg/ml Inhibition of the growth RIF tumor cell lines (Dobhal
et al., 2004)
Dysuria, malaria, syphilis,
purgative, fever, edema
Alstonia
scholaris
stem
bark
Ethanol



Aqueous,
ethanol
Echitamine



Alkaloid
In vivo 180 mg/kg body
weight
In vitro, ED
50
=2.5 µg/ml

In vivo 50 - 100 mg/kg
BW
Increase of the killing effect of berberine against
tumour (Jagetia and Baliga, 2004)
Cytotoxic effect in HeLa cell (Jagetia and Baliga,
2005)
Stimulation of non specific immune respone (Iwo et
al., 2000)

Fever, dermatosis,
anorexia, nephritis,
malaria, hypertensive,
depurative
Cuminum
cyminum
seed


fruit
Ethanol


--


Essential oil
In vivo, 160 mg/g diet


In vivo ED
50
= 0.12 ml/kg
Increase of GST activity, inhibit
hepatocarcinogenesis (Aruna and Sivaramakrishnan,
1998)
Exhibition of anticonvulsant activity in both PTZ-
and MES-induced seizures (Sayyah et al., 2002)
Stimulant, stomachic,
gastric ulcer
Andrographis
paniculata
aerial
part





roots

leaves
Ethanol






Chloroform
Ethanol
14-Deoxyandrographolide
14-Deoxy-11,12-
didehydroandrographolide
Andrographolide



Xanthone

Andrograpanin
In vitro ED
50
= 2.8 µg/ml
1.5 µg/ml

Clinical 5 mg/kg
bodyweight (BW)
In vivo 1.5 mg/kg BW

In vitro IC
50
= 4µg/ml
In vivo 30 mg/kg
In vitro 3 µM
Exhibition of the cytotoxic activity against human T-
47D cell line (Tan et al., 2005)

Inhibition of HIV induced cell cycle dysregulation
(Calabrese et al., 2000)
Reduction of the plasma glucose level in
streptozotocin-induced diabetic rats (Yu et al., 2003)
Antiplasmodial activity against Plasmodium
falciparum (Dua et al., 2004)
Enhancement of chemokine stromal cell-derived
factor-1 alpha (SDF-1 alpha) induced chemotaxis (Ji
at al., 2005)
Tonsillitis, chancre,
antidote for poisoning,
typhus, fever, diabetes,
tonic, dysentery, ear
diseases, eczema,
appendicitis, cold,
diphtheria, depurative,
epilepsy, gonorrhoea,
syphilis, dandruff
Arcangelisia
flava
whole
part
Berberine In vitro, 25 µM Inhibition of the growth of human HepG2 cells (Chi
et al., 1994)

Jaundice, stomachic,
anthelmentic
Ardisia
compressa
leaves Aqueous Phenolic compounds In vivo, IC
50
= 47 µg/ml Inhibition of hepatocarcinogenesis (De Mejia et al.,
2004)

Fever, diarrhoea, cough
Phyllanthus
species
whole
plant
Aqueous Alkaloids, flavonoids,
lignans and terpenoids,
tanins
Elargic acid, lignans,
quercetin, lupeol
Clinical 1.5 g per day


In vitro and in vivo IC
50
=
1.3 µg/ml
Antihepatitis B virus (Liu et al., 2000)

Anti-HIV activity (Notka et al., 2004)
Antiplasmodial activity against P. falciparum (Tona
et al., 2004)
Wound, asthma, epilepsy,
malaria, constipation,
hypertensive, menstrual
disorder, tetanus,
diarrhoea, convulsant

33
Piper
sarmentosum
Piper caba

Piper longum

Piper nigrum

berries




Methanol

Aqueous
acetone
Ethanol

Sarmentine,
1-piperettyl pyrrolidine
Piperine, piperanine,
pipernonaline
Alkaloid piperine

Isobutyleicosatrienamide,
trachyone, pergumidiene
In vitro IC
50
=18.9 µg/ml
6.5 µg/ml
In vivo 25 mg/kg BW

In vitro IC
50
= 7.0 µM

In vitro MIC = 70, 60, 58
µM

Antiplasmodial activity against P. falciparum
(Rukachaisirikul et al., 2004)
Inhibition of ethanol- and indomethacin-induced
gastric lesions (Morikawa et al., 2004)
Inhibition of monoamine oxidase and antidepressant
like activity (Lee et al., 2005)
Inhibition of the growth of B. subtilis, B. sphaericus,
S. aureus Klebsiella aerogenes and
Chromobacterium violaceum (Reddy et al., 2004)
Cough, asthma



Diaphoretic, edema
Hypertensive, diaphoretic,
dyspnea
Glycyrrhiza
glabra
root Ethanol Isoliquiritigenin

Liquiritin apioside,
liquritin and liquiritigenin
In vitro 1 µg/ml

In vivo 30 mg/kg BW
Inhibition of reductase activity and platelet
aggregation (Tawata et al., 1992)
Antitussive (Kamei et al., 2005)
Rheumatic
Eurycoma
lancifolia
root Methanol Eurycomanone
7-methoxy-β-carboline-1-
propionic acid
In vitro IC
50
=1.9 µg/ml
IC
50
=2.1 µg/ml
Antiplasmodial activity (Kardono et al., 1991) Fever, depurative,
dysentery, aphtha, tonic,
anorexia
Anacardium
occidentale
stem
bark

Aqueous

Hexane
--

Stigmast-4-en-3-ol and
stigmast-4-en-3-one
Anacardic acid
In vivo 800 mg/kg BW

In vivo 1.5mg/kg BW

In vitro MIC = 6.25 µg/ml
Inhibition of the fresh egg albumin-induced acute
inflammation (Ojewole et al., 2004)
Hypoglycaemic activity in normal, healty dogs
(Alexander-Lindo et al., 2004)
Inhibition of β-lactamase (Bouttier et al., 2002)
Purgative, aphtha,
dermatosis
Abelmoschus
moschatus
aerial
parts
Buthanol Flavonoid myricetin In vivo EC
50
= 0.1 µM Reduction of the plasma glucose level in
streptozotocin-induced diabetic rats (Liu et al., 2005)
Convulsant, stomachic,
aphrodisiac, itch

Aloe vera

leaves

Ethanol

--

In vivo 200 mg/kg BW

Reduction the plasma glucose level in
streptozotocin-induced diabetic rats (Rajasekaran et
al., 2004)

Hemorrhoid, anthelmen-
tic, diabetes, cough,
gonorrhea, tuberculosis
Centella
asiatica
aerial
part
Aqueous Asiaticoside
Polysacharide
In vivo 10 mg/kg BW
In vitro 100 µg/ml

Enhancement of gastric ulcer healing (Cheng et al.,
2004)
Enhancement of proliferation on T and B
lymphocytes (Wang et al., 2005)
Stomachic, anorexia,
wound, chancre, bronchi-
tis, dysentery, cough
Orthoshipon
aristatus
leaves Aqueous Pimarane-type diterpenes,
neoorthosiphols A and B
Methylripariochromene A
In vitro IC
50
15.2 and 60.1
nmol/ml
In vivo IC
50
= 23.8 µg/ml
Inhibition of the contractile respons in rat thoracic
aorta smooth muscle (Ohashi et al., 2000)
Decrease of systolic blood pressure in conscious
stroke-prone spontaneously hypertensive rats
(Ohashi et al., 2000)
Laxative, hemorrhoid,
dysentery, diarrhea, colitis
Menstrual disorder,
stomachic,
cholecystopathy
Coriandrum
sativum
fruit Essential oil Terpenoids In vitro MIC 0.87 mg/ml Inhibition of the growth of Escherichia coli, Bacillus
megaterium, Pseudomonas, Erwinia, Xanthomonas,
Agrobacterium (Lo Cantore et al., 2004)
Stomach-ache, vertigo,
emetic, stomachic,
aphtha, menstrual
disorder

Cnap|cr 2
34
H
3
CO
HO OH
OCH
3
O O
O
O
HO
HO
HO
O
O
HO
HO
OR
1
R
3
O
OR
2
O
CO
2
CH
3
O
O
O
COOR
4
OR
2
OR
1
O
CO
2
CH
3
HO
HO
HO
HO
OH
HO
OH
OH
O
COOR
3
CO
2
CH
3
OH
OH
HO
HO
HOH
2
C
O
O
O
O
O
O
HO
OH
OH
HO
OH
OH
OH
OH
OH
O
O
H
3
CO
OCH
3
R
2
O
R
1
O
BzO
BzO
OAc
OH
O N
H
N CH
3
HOH
2
C
CO
2
CH
3
HO
3
1
2
4. R
1
= R
2
= R
3
= H
5. R
1
= R
2
= H, R
3
= CH
3
11. R
1
= R
2
= CH
3
, R
3
= R
4
= X
12. R
1
= H, R
2
= CH
3
, R
3
= R
4
= X
13. R
1
= R
2
= R
3
= CH
3
, R
4
= X
14. R
1
= R
2
= CH
3
, R
3
= X, R
4
= CH
3
15. R
1
= H, R
2
= CH
3
, R
3
= R
4
= X
16. R
1
= CH
3
, R
2
= H, R
3
= X, R
4
= CH
3
X =
6
7 8. R
1
= OH, R
2
= Ac
9. R
1
= Ac, R
2
= OH
+
10

Fig. 1. Chemical structure of several active compounds from plants used in jamu; andrographolide (1), 14-
deoxyandrographolide (2) (Andrographiis paniculata), curcumin (3) (Curcuma domestica), hydroxypanduratin A (4),
panduratin A (5) (Kaempferia pandurata), asiaticoside (6) (Centela asiatica), methylripariochromene A (7), orthosiphol A
and B (8 and 9) (Orthoshipon aristatus), echitamine (10) (Alstonia scholaris), helicterins A-F (11-16) (Helicteres isora).

35


Chapter 3





Lignans from cell suspension cultures of Phyllanthus niruri, an
Indonesian medicinal plant

















Elfahmi, Sieb Batterman, Albert Koulman, Thomas Hackl,

Rein Bos, Oliver Kayser, Herman J.
Woerdenbag, Wim J. Quax
This chapter is based on Journal of Natural Products, 2006, 69, 55-58
Cnap|cr 3
36
Abstract
Cell suspension cultures of Phyllanthus niruri L. were used to study the lignan profiles and
biosynthesis. Suspension cultures yielded two lignans: the new dihydrocubebin-dimethylether (1) and
urinatetralin (2), a new lignan from P. niruri, but reported earlier from P. urinaria. This is the first
report of cell suspension cultures of P. niruri that successfully produce lignans. Feeding 0.5 mM ferulic
acid or 0.5 mM caffeic acid, being early precursors of lignan biosynthesis, resulted in an increase up to
0.7 mg g
-1
DW of 1 (control value 0.1 mg g
-1
DW) and up to 0.3 mg g
-1
DW of 2 (control value 0.2 mg
g
-1
DW). Comparison of the lignan profiles of cell suspensions, callus cultures, aerial plant parts, roots
and seeds showed significant differences.






























|ignans frcn cc|| suspcnsicn cu||urcs cf Pnu||an|nus niruri
37
Introduction
Phyllanthus niruri L. (Euphorbiaceae) is a small plant widely distributed in tropical and
subtropical regions in Central and South America and Asia (including India and Indonesia). Whole
plants have been used in traditional medicine for treatment of jaundice, asthma, hepatitis and malaria
and because of diuretic, antiviral, and hypoglycemic properties (Eisei, 1995, Mehrota et al., 1990,
Calixto et al., 1998). To scientifically support the traditional use, several pharmacological studies have
been carried out with plant extracts and with isolated compounds. P. niruri extract shows potential
therapeutic actions in the management of hepatitis B (Mehrota et al., 1990, Calixto et al., 1998). Its
antiviral activity extends to HIV-1 RT inhibition (Ogata et al., 1992, Naik and Juvekar, 2003). Its role in
urolithiasis is related to the inhibition of calcium oxalate endocytosis by renal tubular cells (Campos and
Schor, 1999, Freitas et al., 2002). In vitro antiplasmodial activity of this plant extract has been described
(Tona et al., 2001). P. niruri extract also showed inhibitory activities against angiotensin converting
enzyme (ACE) and rat lens aldose reductase (AR), which play a significant role in the reduction of
aldose to alditol under abnormal conditions such as diabetes (Shimizu et al., 1989). Immunomodulating
effects in treatment of cancer by influencing the function and activity of the immune system (Ma’at,
2002) and lipid lowering activity (Khanna, 2002) have been reported. An extract of the callus culture of
P. niruri showed analgesic activity (Santos et al., 1994)
The aerial parts of P. niruri have been reported to contain alkaloids, flavonoids, phenols,
coumarins, tannins, terpenoids and lignans. Several of these isolated compounds have been tested for
their pharmacological activities (Ishimaru et al., 1992, Calixto et al., 1998, Huang et al., 2003, Naik and
Juvekar, 2003). Lignans from this plant have been studied most intensively; 17 different lignans have
been found so far (Fig. 1). Several of these lignans were tested for cytotoxicity and other biological
activities in vitro. Phyllanthin and hypophyllanthin were protective against carbon tetrachloride- and
galactosamine-induced cytotoxicity in primary cultured rat hepatocytes (Syamasundar et al., 1985). 3,4-
methylenedioxybenzyl-3',4'-dimethoxybenzylbutyrolactone has been reported to possess antitumor
activity (Satyanarayana and Venkateswarlu, 1991). Nirtetralin and niranthin were tested against human
hepatitis B virus in vitro (Huang et al., 2003).
The aims of this study were to establish the cell suspension cultures of P. niruri, to study the
production and biosynthesis of lignans and to compare the lignan profile of cell suspensions with callus
cultures, aerial plant parts, roots and seeds.
Cnap|cr 3
38
OR
4
OR
3
R
1
O
R
2
O
OCH
3
OCH
3
OR
4
OR
3
R
1
O
R
2
O
OCH
3
OCH
3
R
3
H
3
CO
OCH
3
OCH
3
R
1
O
R
2
O
OR
4
OR
5
R
3
OCH
3
OCH
3
H
3
CO
H
3
CO OCH
3
O
O
OCH
3
OCH
3
H
3
CO
H
3
CO
OH
OCH
3
H
3
CO
H
3
CO
OCH
3
OCH
3
H
3
CO
H
3
CO
O
O
OCH
3
OCH
3
OCH
3
OCH
3
O
O
OCH
3
OCH
3
H
3
CO
H
3
CO
OH
OCH
3
H
3
CO
H
3
CO
3. R
1
= R
2
= CH
3
R
3
= R
4
= CH
3
4. R
1
= R
2
= CH
3
R
3
= H, R
4
= CH
3
5. R
1
+ R
2
= CH
2
R
3
= R
4
= H
6. R
1
+ R
2
= CH
2
R
3
= R
4
= COCH
3
7. R
1
+ R
2
= CH
2
R
3
= H
8. R
1
= R
2
= CH
3
R
3
= H
9. R
1
= R
2
= R
3
= H
10. R
1
+ R
2
= CH
2
R
3
= OH
11. R
1
= R
2
= CH
3
R
3
= H R
4
= R
5
= CH
3
12. R
1
+ R
2
= CH
2
R
3
= OCH
3
R
4
= R
5
= CH
3
13. R
1
= R
2
= CH
3
R
3
= H R
4
+ R
5
= CH
2
14. R
1
+ R
2
= CH
2
R
3
= H R
4
= R
5
= CH
3
15
16 17
18
19


Fig. 1. Lignans from Phyllanthus niruri : phyllanthin (3), niranthin (7), phyltetralin (11), nirtetralin (12), hypophyllanthin
(15), seco-isolarisiresinol trimethyl ether (4), 2,3-demethoxy-seco-isolintetralin (5), 2,3-demethoxy-seco-isolintetralin
diacetate (6), linnanthin (8), demethylendioxy-niranthin (9), hydroxyniranthin (10), seco-4-hydroxylintetralin (17), (3,4-
methylendioxybenzyl)-(3
1
,4
1
-dimethoxybenzyl)-butyrolactone (18), lintetralin (13), isolintetralin (14), nirphyllin (16), and
phylnirurin (19).

Material and methods
General experimental procedures
NMR spectra were recorded on Bruker WM 400 (400 MHz) and Bruker DRX 500 (500 MHz)
spectrometers in CDCl
3
. TMS were used as an internal standard. GC analysis was performed on a
Hewlett-Packard 5890 Series II gas chromatograph equipped with a 7673 injector and a Hewlett-
Packard 3365 Series II Chemstation, under the following conditions: column, WCOT fused-silica CP-Sil
5 CB (15 m x 0.31 mm i.d.; film thickness 0.25 µm; Chrompack, Middelburg, The Netherlands); oven
temperature program, 150-320°C at 15°C min
-1
and maintained at 320°C for 5 min; injector temperature,
260°C; detector (FID) temperature, 300°C; helium was used as carrier gas; inlet pressure, 5 psi; linear
gas velocity, 32 cm s-1; split ratio, 20:1; injected volume, 2.0 µL. Gas chromatography-Mass
|ignans frcn cc|| suspcnsicn cu||urcs cf Pnu||an|nus niruri
39
spectrometry (GC-MS) analysis was performed on a Shimadzu QP5000 GC-MS system equipped with a
17A GC, an AOC-20i autoinjector, and the GC-MS solution software 1.10. The GC conditions were the
same as for GC analysis. MS conditions: ionization energy, 70 eV; ion source temperature, 250°C;
interface temperature, 280°C; scan speed, 2 scans s
-1
; mass range, 34-600 u. The HPLC system consisted
of a Spectra-Physics (model SP 8810) liquid pressure pump, a Rheodyne high pressure valve equipped
with a 100 µL sample loop and a Lichrospher RP-18 column (250 x 4 mm i.d., Merck, Damstradt,
Germany). The mobile phase consisted of C
2
H
3
N: H
2
O (45:55; v/v) containing 0.1 % H
3
PO
4
at a flow of
1.0 mL min
-1
and a Shimadzu photodiode array UV-Vis SPD-M6A detector (Shimadzu, ‘s-
Hertogenbosch, The Netherlands) at 290 nm. Analytical thin layer chromatography (TLC) was
performed using silica gel 60-F254 (5 x 10 cm, 0.25 mm thickness, Merck, Darmstadt, Germany) and
toluene: acetone (50:1) as the eluent. The elution length was 8 cm in a saturated chamber. The bands
were detected by 254 nm UV light.

Plant material, solvents and chemicals
Phyllanthus niruri L. (Euphorbiaceae) was collected from a wild habitat in Bandung, West Java,
Indonesia, and authenticated at the Department of Biology, Institut Teknologi Bandung (Indonesia),
based on the Flora of Java (Backer and Van den Brink, 1968) A voucher specimen (HBG10PN12) is
deposited in the Herbarium Bandungense. The age of the plant material was 0.5 – 1 year. All solvents
and chemicals were purchased from Sigma-Aldrich (Zwijndrecht, The Netherlands). All media and
supplements used to grow the callus and the suspension culture were obtained from Duchefa (Haarlem,
the Netherlands).

Cell suspension cultures of P. niruri
Seeds of P. niruri were grown in a plant container under an L/D regime (16/8 h: 3,000 lux) at
25°C. Small plants developed after 3-4 weeks. The leaves were sterilized by dipping them into a 3% w/v
NaOCl solution for 3 min, followed by bathing in sterile H
2
O for 10 min. They were rinsed three times
with sterile twice-deionized H
2
O. The sterile leaves were cut into slices and callus induction was
obtained using media with different compositions. These media were modifications of the Murashige
and Skoog medium (Murahige and Skoog, 1962) or the Gamborg’s B5 medium (Gamborg et al., 1968).
Murashige and Skoog (MS) medium was supplemented with 1.0 mg L
-1
indole-3-acetic acid and 1.0 mg
L
-1
6-benzylaminopurin. Gamborg’s B5 (B5) was supplemented with 4 mg L
-1
u-naphtalene acetic acid.
The so-called MS-B5, a combination of the macro nutrients of MS and the micro nutrients of B5
medium, was also used. It was supplemented with 3 mg L
-1
u-naphtalene acetic acid. All media were
supplemented with 4 % (w/w) sucrose and solidified with 0.9% agar. The callus cultures were grown
under an L/D regime (16/8 h: 3,000 lux) at 26°C. Callus developed after 6 weeks. Friable callus
appeared as clumps, varying in color from dark brown to yellow.
Cell suspension cultures were initiated by transferring callus clumps into 100 mL sterile conical
flasks with 50 mL of liquid medium of the same composition as described above but without agar.
Cultures were incubated on a rotary shaker (175 rpm) at 26°C under an L/D regime (16/8 h: 3,000 lux,
daylight L 36W/10, OSRAM, Germany). After 1 month, 50 mL of cell suspension cultures were
transferred into a 500 mL conical flask, with fresh medium yielding a total volume of 300 mL.
Subcultures were prepared every 3 weeks by adding 100 mL of a full-grown cell suspension culture to
200 mL of fresh medium.

Feeding experiment
Caffeic and ferulic acid were added to reach three different final concentrations: 0.1, 0.5 and 1
mM. These compounds were dissolved using 0.2 mL of 96% EtOH and transferred to a sterile 500 mL
Cnap|cr 3
40
Erlenmeyer flask containing the cell suspension cultures of P. niruri after inoculation into fresh medium
(at the start of growth cycle). Suspension-grown cells were harvested each 2 days during the growth
cycle of 21 days. Samples of about 10 mL were taken aseptically and transferred into a calibrated
conical tube and centrifuged for 5 min at 1,500 g. To monitor the viability and growth of the cell
cultures, medium pH and conductance were routinely measured in the supernatant. Cells were filtered
using a Büchner funnel. FW was determined and the cells were put overnight into the freezer and then
freeze-dried. DW was also determined. Lignans were analyzed by GC and GC-MS.

Analysis
Lignan profiling was performed according to Koulman et al. (2001). Dried and powdered
material (100 mg) was weighed in a Sovirel tube. MeOH (2 mL, 80%) was added and the mixture was
sonicated for 1 h. CH
2
Cl
2
(4 mL) and distilled water (4 mL) were added. The tube was closed, vortexed
and centrifuged at 1,500 g for 5 min. The aqueous layer was discarded and 2 mL of the organic layer
was transferred into a 2 mL micro tube. The CH
2
Cl
2
was evaporated gently using a flow of nitrogen and
the residue was redissolved in 200 µL of MeOH. The tube was centrifuged at 15,000 g for 5 min in an
Eppendorf 5414 centrifuge, and part of the liquid was transferred into a 0.8 mL crimp neck vial (Art.
No. 98819, Alltech/Applied Science B.V. Breda, The Netherlands) and sealed immediately. For
quantitative determination of 1 and 2, calibration curves were prepared using MeOH solutions with
concentrations ranging from 2.5 to 25 µg mL
-1
. Each concentration was done in triplicate. Regression
equations were y = 143229 x – 264 (R
2
= 0.9902) and y = 123516 x – 218 (R
2
= 0.9885) for 1 and 2. The
limit of detection (LOD) was established as the amount of analyte that provided a signal-to-noise ratio of
3. LOD were 0.12 µg for 1 and 0.25 for 2. The limit of quantification (LLOQ) was defined as the lowest
calibration standard that could be quantified with an accuracy of 90-110% and a precision of 15%.
LLOQ was 2.5 µg for both 1 and 2.

Extraction and isolation
For the isolation of lignans, three-weeks-old suspension cultures were harvested and filtered
through miracloth (Lot B43936, Calbiochem, Behring diagnostics, La Jolla, CA). A total of 500 g of
fresh cells were extracted (3x) using 1 L of 80% MeOH each time. To disrupt cells, mixtures were
sonicated for 1 h. The MeOH extracts were combined and the volume was reduced to 100 mL under
reduced pressure. The remaining extract was partitioned (3x) between 250 mL of H
2
O and 250 mL of
CH
2
Cl
2
. All organic phases were combined and concentrated. The resulting extract was fractionated on a
column (75 x 2.5 cm) filled with silica gel 60 (70-230 mesh, Merck, Darmstadt, Germany). Fractions
were eluted by subsequent use of the following eluents: n-hexane: CH
2
Cl
2
(9:1, 500 mL), CH
2
Cl
2
(500
mL), and CH
2
Cl
2
: MeOH (25:1, 500 mL). Fractions of 20 mL each were collected and were profiled by
TLC and GC-MS. Fractions with corresponding profiles were combined and concentrated. This resulted
in a total of 16 fractions. The lignan-containing fraction was further separated by preparative TLC on
preparative silica gel plates (20x20 cm, 1 mm thickness, Merck, Darmstadt, Germany) using toluene:
acetone (50:1) as eluent. The elution length was 18 cm in a saturated chamber. Bands were detected by
254 nm UV light. Three bands were scraped off and analyzed by GC and GC-MS. R
f
values were 0.28,
0.31 and 0.43, respectively.
For further purification of the lignans obtained by preparative TLC, semipreparative HPLC was
used. Eluting substances were collected in glass tubes according to their retention times. Organic
solvents were evaporated and the aqueous residue was partitioned with CH
2
Cl
2
. The CH
2
Cl
2
fraction
yielded pure compound 1 (3.0 mg) and 2 (2.5 mg).
|ignans frcn cc|| suspcnsicn cu||urcs cf Pnu||an|nus niruri
41
Dihydrocubebin-dimethylether (1) was obtained as an amorphous solid:
1
H and
13
C NMR data,
see Table 1; MS (EI, 70 eV) m/z (rel. int.): 386 [M]
+
(2), 354(3), 322 (2), 187 (19), 135 (100), 77 (29), 45
(56); HRMS: m/z = 386.1723 [M
+
] (calc. for C
22
H
26
O
6
: 386.1729).
Urinatetralin (2) was obtained as an amorphous solid:
1
H and
13
C NMR data, see Table 1; MS
(EI, 70 eV) m/z (rel. int.): 384 [M]
+
(5), 352(6), 320 (7), 185 (12), 135 (26), 77 (8), 45 (100)

Results and discussion
From the various medium compositions tested, the B5 medium resulted in the best growth of
callus and cell suspension cultures of P. niruri. This medium was used in all experiments. Cell
suspension cultures of P. niruri had a growth cycle of 21 days. During this time, conductivity decreased
from 3.2 ± 0.01 mS on day 1 to 1.5 ± 0.02 mS on day 15 and slightly increased to 2.0 mS on day 21.
This indicates that cell lysis occurred between day 15 and 21. During the growth cycle, a slow increase
in pH of the growth medium was observed. Fresh weight (FW) increased from 105.2 ± 3.2 g L
-1
to 202.8
± 19.2 g L
-1
and dry weight (DW) increased from 6.0 ± 1.1 g L
-1
to 12.9 ± 0.1 g L
-1
.
We found qualitatively and quantitatively different lignan profiles comparing seeds, roots, aerial
plant parts, callus and suspension cultures as determined by GC-MS. All lignans found in aerial plant
parts (phyllantin, 3,4-methylenedioxybenzyl-3',4'-dimethoxybenzylbutyrolactone, niranthin,
phyltetralin, seco-isolarisiresinol trimethylether, nirtetralin, lintetralin, isolintetralin, hypophyllantin,
seco-4-hydroxylintetralin), seed (phyllantin, niranthin and nirtetralin), root (demethylenedioxyniranthin,
lintetralin and isolintetralin) and callus culture (3,4-methylenedioxybenzyl-3',4'-
dimethoxybenzylbutyrolactone) have been described previously in P. niruri (Row and Srinivasalu, 1964,
Anjaneyulu et al., 1973, Satyanarayana and Venkateswarlu, 1991, Calixto et al., 1998). None of these
lignans was present in cell suspension cultures. However, four other lignans were found in cell
suspension cultures. Compound 1 was a lignan that was not found in the plants before and compound 2
has been reported earlier as new compound from P. urinaria (Chang et al., 2003). Two more compounds
with MS fragmentation patterns resembling lignans were found. These last two compounds could not be
separated. Compounds 1 and 2 were purified by preparative HPLC and their structures determined and
confirmed (Fig. 2). This is another example that plant cell cultures do not always accumulate, either
qualitatively or quantitatively, the same compounds found in the plant from which they are established.
Compound 2 was identified as urinatetralin that was confirmed by comparison of NMR and MS
spectra with published data (Chang et al., 2003). The relative configuration derived from the 1H NMR
coupling constants was in agreement with the (7R*,8S*,8S*) configuration of 2 from P. urinaria
(Chang et al., 2003).
Compound 1 was a white amorphous solid with a molecular formula of C
22
H
26
O
6
, as shown by
HRMS ([M
+
]: m/z 386.1723). The molecular mass of 1 is two mass units higher than that of compound
2. Fragments at m/z 354 and 322 correspond to the loss of two molecules of MeOH [M-HOCH
3
], as
shown by HRMS. The base peak at m/z 135 corresponded to a methylenedioxy benzyl fragment
(C
8
H
7
O
2
), typical for lignan structures. These data indicated an urinatetralin-like structure for 1, i.e.
lacking the carbocylic ring at C-2 and C-7'. The
1
H NMR data exhibited two methylenedioxy groups at
oH 5.92 (4H, s), two methoxy groups at oH 3.28 (6H, s) and six aromatic protons (oH 6.5 – 6.7) as two
ABM spin systems. Due to the symmetry of the molecule only one set of signals is observed. The
structure for 1 was further supported by H,H-COSY, HMQC and HMBC spectroscopic analysis. This
compound, called dihydrocubebin-dimethylether, is a new natural product but has been synthesized from
dihydrocubebin (Anjaneyulu et al., 1981). Although the relative configuration could not be determined
unambigously, a (8S*,8'S*) configuration is assumed from a common biogenesis of 1 and 2. This is the
first report of cell suspension cultures of P. niruri that successfully produce lignans.

Cnap|cr 3
42
O
O
O
O
OCH
3
OCH
3
O
O
O
O
OCH
3
OCH
3
1
2
1
2
3
4
5
6
7
7'
1'
2'
5'
6'
3'
4'
8
8'
9
9'
1
2
3
4
5
6 7
7'
1'
2'
3'
4'
5'
6'
8
8'
9
9'

Fig. 2. Lignans from cell suspension cultures of P. niruri: dihydrocubebin-dimethylether (1) and urinatetralin (2).

Table 1.
1
H and
13
C NMR data of dihydrocubebin-dimethylether (1) and urinatetralin (2) (500 MHz, TMS, CDCl
3
).

Position 1 2

1
H (J/Hz)
13
C
1
H (J/Hz)
13
C
1 134.9 s 130.1 s
2 6.7 d (7.8) 121.8 d 133.4 s
3 108.1 d 6.21 s 109.5 d
4 145.6 s 145.8
1
s
5 6.59 d (1.3) 147.5 d 145.8
1
s
6 6.56 dd (7.9, 1.6) 109.5 d 6.56 s 108.0 d
7 3.26 m, 3.30 m 35.1 t 2.78 m 33.8 t
8 2.02 m 40.8 d 2.13 m 36.4 d
9 2.55 dd (13.9, 8.0) 72.7 t 3.40 dd (6.5, 9.3) 75.5 t
2.65 dd (13.5, 5.9) 3.45 dd (4.0, 9.3)
1' 134.9 s 139.4 s
2' 6.59 d (1.3) 109.5 d 6.55 d (1.7) 108.6 d
3' 147.5 s 146.4 s
4' 145.6 s 147.9 s
5' 6.7 d (7.8) 108.1 d 6.74 d (7.9) 107.6 d
6'

6.56 dd (7.85, 1.55) 121.8 d 6.64 dd (7.9, 1.7) 122.6 s
7' 3.26 m, 3.30 m 35.1 t 3.93 d (10.8) 47.7 d
8' 2.02 m 40.8 d 1.78 ddt (10.8, 10.8, 3.2) 45.1 d
9' 2.55 dd (13.9, 8.0) 72.7 t 3.10 dd (9.6, 3.4) 71.2 t
2.65 dd (13.5, 5.9) 3.36 m
9-O Me 3.28 s 58.8 q 3.35 s 59.0 q
9'-O Me 3.28 s 58.8 q 3.26 s 59.1 q
4,5-OCH
2
O- 5.92 s 100.7 t 5.83 s 99.8 t
3',4'-OCH
2
O- 5.92 s 100.7 t 5.93 s 100.2 t
1
signals coincide.
Feeding of early precursors of lignans to cell suspension cultures, 0.5 mM caffeic acid or 0.5
mM ferulic acid, enhanced the production of 1 and 2. While feeding 0.1 mM of either compounds had
no effect, 1 mM appeared to be toxic for cell suspension cultures (causing growth inhibition). In the
control cells, 1 reached a maximum at 0.46 mg g
-1
DW on day 1 after inoculation, decreased to 0.18 mg
|ignans frcn cc|| suspcnsicn cu||urcs cf Pnu||an|nus niruri
43
g
-1
DW on day 5 then increased on day 7 and further decreased to 0.05 mg g
-1
DW on day 21. By
feeding 0.5 mM of caffeic acid, 1 increased to 0.67 mg g
-1
DW on day 12 (7-fold compared to control
cells). Feeding 0.5 mM of ferulic acid caused an increase of the amount of 1 to 5.0 mg g
-1
DW on day 7,
and maximum enhancement was reached on day 7 (2-fold compared to control cells) (Fig. 3).
In control cells, the amount of 2 increased from 0.09 mg g
-1
DW on day 1 after inoculation to
0.20 mg g
-1
DW on day 7 then decreased until day 14, and from day 14 to 21, the content remained
constant. By feeding of 0.5 mM caffeic acid, the amount of 2 increased to 0.3 mg g
-1
DW on day 7, and
a maximal enhancement was found on day 5 (2.5-fold compared to control cells). Feeding of 0.5 mM
ferulic acid caused an increase of the amount of 2 to 0.22 mg g
-1
DW on day 7, and maximal
enhancement was shown on day 5 (2 fold compared to control cells) (Fig. 4). Addition of 0.5 mM
caffeic acid or 0.5 mM ferulic acid did not inhibit growth of cell suspension cultures of P. niruri. By
adding 0.5 mM caffeic acid, the conductivity decreased from 3.5 ± 0.05 mS to 1.9 ± 0.01 mS, FW
increased from 117.0 ± 7.0 g L
-1
to 208.1 ± 7.4 g L
-1
and DW increased from 7.5 ± 0.3 g L
-1
to 15.6 ±
0.9 g L
-1
. Adding 0.5 mM ferulic acid, conductivity decreased from 3.4 ± 0.01 mS to 1.8 ± 0.01 mS, FW
increased from 118.7 ± 6.1 g L
-1
to 203.2 ± 3.8 g L
-1
and DW increased 8.0 ± 0.05 g L
1
to 15.9 ± 2.2
g L
-1
. These data show that after feeding caffeic and ferulic acid in concentrations of 0.5 mM, cell
suspension cultures grew with a rate comparable to control cultures.

0
0.2
0.4
0.6
0.8
0 2 4 6 8 10 12 14 16 18 20 22
Days
D
i
h
y
d
r
o
c
u
b
e
b
i
n

d
i
m
e
t
h
y
l
e
t
h
e
r

(
m
g

g
-
1

D
W
)

Fig. 3. Dihydrocubebin-dimethylether (1) accumulation of P. niruri cell suspension cultures after feeding of 0.5 mM caffeic
acid (.), 0.5 mM ferulic acid (A) and in control cultures (·). Individual values expressed as means ± standard deviation in mg
g
-1
DW are averages of three independent experiments.
Cnap|cr 3
44
0
0.1
0.2
0.3
0.4
0 2 4 6 8 10 12 14 16 18 20 22
Days
U
r
i
n
a
t
e
t
r
a
l
i
n

(
m
g

g
-
1

D
W
)

Fig. 4. Urinatetralin (2) accumulation of P. niruri cell suspension cultures after feeding of 0.5 mM caffeic acid (.), 0.5 mM
ferulic acid (A) and in control cultures (·). Individual values expressed as means ± standard deviation in mg g
-1
DW are
averages of three independent experiments.

Feeding caffeic and ferulic acid increased the concentration of compounds 1 and 2 in P. niruri
cell suspensions. This may be due to the incorporation of these precursors into the secondary metabolite
biosynthetic pathway. Studies with labeled precursors may confirm this. Caffeic and ferulic acid have
the necessary phenolic groups required for the oxidative coupling mechanism. Other compounds lacking
a phenolic group, such as 3,4-dimethoxy and 3,4,5-trimethoxycinammic acid, are not converted into
lignans (Jackson and Dewick, 1984). Caffeic acid enhanced the formation of urinatetralin and cubebin
dimethyleter better than ferulic acid. This may have been caused by the different oxygenation pattern of
the compounds. Caffeic acid, with its 3',4'-dihydroxy substitution pattern, is apparently more easily
incorporated than ferulic acid that has a 4'-hydroxy-3'-methoxy substitution pattern. The coupling of
phenylpropanoid monomers leading to urinatetralin and dihydrocubebin-dimethylether in P. niruri cell
suspension cultures appears to involve two precursors with a 4'-hydroxy-3'-methoxy substitution pattern
or 3', 4'-dihydroxy substitution pattern. These compounds can be replaced by a 3', 4'-methylenedioxy
substitution pattern. This agrees with the incorporation of labeled ferulic acid into podophyllotoxin and
deoxypodophyllotoxin in L. album (Seidel et al., 2002).
Accumulation of 2 on days 2-7 was followed by accumulation of 1 on days 5-12 after feeding 0.5
mM caffeic acid. This suggests that 1 is a precursor for 2 in cell suspension cultures of P. niruri
following cyclization involving C-2 and C-7'. This reaction has also been shown by cyclization of the
quinone methide as an intermediate to desoxypodophyllotoxin (Kamil and Dewick, 1986).

Acknowledgements
The research was supported by the QUE Project Batch II, Department of Biology Institut
Teknologi Bandung ITB, Indonesia, under the contract No. 3028-IX/P3S-1/KON-QUE II/2000, IBRD
Loan No. 4193 – IND. We are grateful to Drs. Djuandi, Department of Biology, Institut Teknologi
Bandung, for collecting plant materials.

45


Chapter 4





Lignan profile of Piper cubeba, an Indonesian medicinal plant



























Elfahmi, Komar Ruslan, Sieb Batterman,

Rein Bos, Oliver Kayser, Herman J. Woerdenbag, Wim J.
Quax

Submitted
Cnap|cr 4
46
Abstract
The lignan profiles of aerial part of Piper cubeba L. (Piperaceae) was determined using GC, GC-
MS and HPLC. The number of lignans found in the leaves was 15, followed by berries and the stalks
with respectively 13 and 5 lignans. This is the first investigation of lignans from the leaves and the stalks
of P. cubeba. Cubebin, hinokinin, yatein, isoyatein are common lignans in the genus Piper and appeared
as major components in all part of P. cubeba investigated.
|ignan prcfi|c cf Pipcr cuocoa
47
Introduction
Piper cubeba L. (Piperaceae) inhabits Java, Sumatra, Southern Borneo, and other isles in the
Indian Ocean. The berries of P. cubeba are commonly known as cubeb (in Indonesia known as kemukus)
and used in Indonesian traditional medicine to treat gonorrhea, dysentery, syphilis, abdominal pain,
diarrhea, enteritis and asthma (Eisai, 1995, Satroamidjojo, 2001). Phytochemical and biological
investigations have been carried out in order to prove its traditional use. In comparison to other species
of genus Piper, P. cubeba has received less attention so far. Only three groups of secondary metabolites
have been reported from the berries of P. cubeba, i.e. alkaloids, lignans and terpenoids (essential oil).
The lignans and the essential oil have been more intensively investigated, since P. cubeba accumulates
both groups of compounds in relatively high amounts. Economically, P. cubeba is important as a source
of pepper (the dried berries) for the worldwide spice market (Usia et al., 2005). Piperine is an abundant
alkaloid in the berries of this species (Parmar et al., 1997).
Twenty four lignans have so far been reported from P. cubeba (Fig. 1) (Prabhu and
Mulchandani, 1985, Badheka et al., 1986, 1987, Koul et al., 1996, Parmar et al., 1997, Usia et al,. 2005).
Lignans are an important group of secondary metabolites that are also assumed to contribute to the
biological activity. Some of these lignans showed inhibitory activity against cytochrome P450 enzymes
that are involved in the metabolism of all currently used drugs (Usia et al., 2005a, 2005b). Yatein,
hinokinin, cubebin, dihydrocubebin have been reported to have antifeedant activity against a number of
stored product insects. This activity is comparable to podophyllotoxin (Harmatha and Nawrot, 2002).
Hinokinin has been reported to have anti-inflammatory and analgesic effect. Because of the structural
relationship, hinokinin can be synthesized using cubebin as precursor (Da Silva et al. 2005). Cubebin
has been shown to possess anti-inflamatory, analgesic and trypanocidal activities (Borsato et al., 2000,
Bastos et al., 2001, De Souza et al., 2005). Yatein is also an interesting lignan due to its biological
activity and its function as a biosynthetic precursor of deoxypodophyllotoxin and podophyllotoxin that
are well known for their anticancer properties. Methanol and water extract of P. cubeba berries have
been shown to display an inhibitory effect against the hepatitis C virus (Hussein et al., 2000). Anti-
inflammatory, antioxidant, anti-allergic and analgesic activities of P. cubeba have been studied using
chemically-induced edema and arthritis in vivo (Choi and Hwang, 2003 and 2005).
In this study we made a lignan profile of aerial parts of P. cubeba using GC, GC-MS and HPLC
and compared the data from berries, stalks and leaves.

Materials and methods
Plant material, solvents and chemicals
Piper cubeba L. (Piperaceae) was collected in April 2002 from Jatiroto, Temanggung, Central
Java, Indonesia, and authenticated at the Department of Biology, Institut Teknologi Bandung
(Indonesia), based on the Flora of Java (Backer and Van de Brink, 1968). A voucher specimen
(HBG10PC01) is deposited at the Herbarium Bandungense, Indonesia. The collected plant material was
air-dried. All solvents and chemicals were purchased from Sigma-Aldrich (Zwijndrecht, The
Netherlands).

Extraction and isolation
One gram of dried plant material (either berries, leaves or stalks) was grinded together with
quartz (Merck, Darmstadt, Germany) and extracted under sonification (1 h) using 2 mL of 80% MeOH.
The resulting extract was fractionated using 4.0 mL of CH
2
Cl
2
and 4 mL of water, shaken for 5 s and
centrifuged at 1,500 g for 5 min. For the determination of lignans, 2.0 mL of CH
2
Cl
2
phase were taken
and evaporated to dryness. The residue was redissolved in 1.0 mL methanol and centrifuged. These
Cnap|cr 4
48
samples were ready to be analyzed by GC, GC-MS, HPLC. The isolation of lignans was achieved by
preparative thin layer chromatography (TLC) using silica gel F254 plate (Merck, Germany) and toluene
: acetone (85 : 15 v/v) as eluent. Bands corresponding to lignans were scraped off and extracted with 2
mL MeOH. The methanolic solutions were submitted to further analysis. The most abundant lignans,
cubebin, hinokinin and yatein, were isolated as >95% pure compounds (as checked by GC and HPLC)
and used for quantitative purposes.

Analysis of lignans using GC, GC-MS, HPLC, TLC
Gas chromatography (GC) analysis was performed on a Hewlett-Packard 5890 Series II gas
chromatograph equipped with a 7673 injector and a Hewlett Packard 3365 Series II Chemstation, under
the following conditions: column, WCOT fused-silica CP-Sil 5 CB (15 m x 0.31 mm i.d.; film thickness
0.25 µm; Chrompack, Middelburg, The Netherlands); oven temperature program, 150-320
°
C at 15
°
C
min
-1
and maintained at 320
°
C for 5 min; injector temperature, 260
°
C; detector (FID) temperature,
300
°
C; helium was used as carrier gas; inlet pressure, 5 psi; linear gas velocity, 32 cm s
-1
; split ratio,
20:1; injected volume, 2.0 µL.
GC-MS analysis was performed on a Shimadzu QP5000 GC-MS system equipped with a 17A
GC, an AOC-20i autoinjector, and the GCMS solution software 1.10. GC conditions: WCOT fused
silica CPsil 5 CB lowbleed/MS, CP7810, film thickness 0.10 µm; 15 m x 0.25 mm ID (Varian
Middelburg, The Netherlands). Temperature program: 150°C – 320 °C at 15 °C min
-1
. Injector
temperature: 275°C; inlet pressure: 75 kPa; column flow: 2.1 mL min
-1
: linear velocity: 75.5 cm sec
-1
;
split ratio: 20:1; total flow: 46.2 mL min
-1
; carrier flow (He): 46.2 mL min
-1
; injection volume: 2 µL;
temperature program 35 min at 90 °C, 90-170 °C at 4 °C min
-1
. MS conditions: ionization energy, 70
eV; ion source temperature, 250°C; interface temperature, 250°C; scan speed, 2 scans s
-1
; mass range,
34-600 u
HPLC analysis was performed using a Shimadzu-VP system (Shimadzu, ‘s-Hertogenbosch, The
Netherlands) consisting of a LC-10AT vp pump, a Kontron 360 auto sampler, a SPD-M10A vp DAD
detector (200 – 340 nm, band with: 4 nm) , a FCV-10AL vp low pressure gradient mixer, a SCL-10A vp
system controller, a FIAtron systems CH-30 column heater (USA), and CLASS-VP software, version
6.12SP4. ProFill 25 mm syringe HPLC filters, nature, PTFE, pore size 0.45 µm, part nr. AF223471-
13208 (Alltech/Applied Science Group, Breda) were used, together with 2 mL autosampler vials, cat. nr.
151123; Brown Chromatography Supplies). As crimp seals, 11 mm with rubber/PTFE septa (cat. nr.
151216; Brown Chromatography Supplies) were used.
The column was a Luna C18(2), 250 x 4.6 mm, 5µm, 00G-4252-E0, nr.: 279423-28, together
with a Phenomenex guard cartridge C18 (ODS, 4x3 mm), AJ0-4287. (Phenomenex, Bester, the
Netherlands). The injection volume was 20 µL with a flow rate of 1 mL min
-1
using a time program of
30 minutes consisting of 5 min 95% solvent A (5 mM ammonium formate (0.05% formic acid) :
acetonitrile = 800 : 156 (w/w)) and 5% solvent B (acetonitrile : MeOH (0.05% formic acid) : 5 mM
ammonium formate (0.05% formic acid) = 585 : 40 : 200 (w/w)), followed by a gradient to 100%
solvent B in 19 min, 2 min 100% solvent B, a gradient back to 5 % solvent B in 2 min and remaining on
this final concentration for another 2 min, based on a method described by Walsky and Obach (2004)
Analytical thin layer chromatography (TLC) was performed using silica gel 60-F254 (5 x 10 cm,
0.25 mm thickness, Merck, Darmstadt, Germany) and toluene: acetone (85:15) as the eluent. The elution
length was 8 cm in a saturated chamber. The bands were detected by UV light at 254 nm.



|ignan prcfi|c cf Pipcr cuocoa
49
O
H
3
CO
OCH
3
OCH
3
R
3
O
R
2
O
R
1
O
O
H
3
CO
OCH
3
OCH
3
R
3
O
R
2
O
R
1
OH
O
O
O
O
OR
3
OR
2
R
1
R
3
O
R
2
O
R
1
O
O
OH
OR
4
O
O
O
O
O
OC
2
H
5
O
O
O
O
O
OC
2
H
5
O
O
O
OH
O
O
O
O
O
O
O
O
O
O
O
O
O
O
H
3
CO
HO
CH
3
O
OH
OH
O
O
OCH
3
O
R
3
O
R
2
O
R
1
O
O
O
H
3
CO
H
3
CO
O
O
O
O
O
O
O
O
O
O
1. R
1
= OCH
3
, R
2
= R
3
= CH
3
2. R
1
= H, R
2
+ R
3
= CH
2

3. R
1
= H, R
2
+ R
3
= CH
2
4. R
1
= H, R
2
= R
3
= CH
3
5. R
1
= OCH
3
, R
2
= R
3
= CH
3
6. R
1
= H, R
2
+ R
3
= CH
2
7. R
1
= OCH
3
, R
2
+R
3
= CH
2
13. R
1
= OCH
3
, R
2
= R
3
= CH
3
14. R
1
= H, R
2
+ R
3
= CH
2
15
17. R
1
= H, R
2
+ R
3
= CH
2
, R
4
= H
18. R
1
= H, R
2
+ R
3
= CH
2
, R
4
= Ac
19. R
1
= OCH
3
, R
2
= R
3
= CH
3
, R
4
= H
20
21
16
22
23
9. R
1
= H, R
2
+ R
3
= CH
2
10. R
1
= OCH
3
, R
2
= R
3
= CH
3
11. R
1
= OCH
3
, R
2
+ R
3
= CH
2
12. R
1
= H
3
, R
2
= R
3
= CH
3
8
24


Fig. 1. Survey of lignans from Piper cubeba reported in the literature; cubebininolide (1), cubebinone (2), yatein (3),
thujaplicatin trimethylether (4), cubebinin (5), clusin (6), 5-methoxyclusin (7), cubebin (8), hinokinin (9), isoyatein (10), 5'-
methoxyhinokinin (11), 2-(3'',4''-methylenedioxy-benzyl)-3-(3',4'-dimethoxybenzyl) butyrolactone (12), aschantin (13),
sesamin (14), kadsurin A (15), piperenone (16) dihydrocubebin (17), hemiarensin (18), dihydroclusin (19), β-O-ethylcubebin
(20), α-O-ethylcubebin (21), heterotropan (22), magnosalin (23), 4-hydroxycubebinone (24).

Results and discussion
The extraction methods applied and the further isolation conditions assured that most lignans
were exhaustively extracted from the plant material. The simple isolation of lignans using preparative
TLC provided satisfactory results. On the chromatogram eleven bands from the leaves extract and seven
bands from the fruit extract, all clearly separated, corresponded to lignans. The major lignans could be
isolated up to 95% pure, although some lignans co-existed with others in the same bands. The isolated
Cnap|cr 4
50
lignans were used to identify lignan peaks in the GC, GC-MS and HPLC chromatograms. Mass spectra
of the analyzed lignans were compared to earlier published data (see Table 2). Different parts of P.
cubeba (leaves, berries, stalks) showed different lignan profiles (see Table 2) and identification took
place based on comparison of the mass fragmentation patterns. Thirteen lignans were detected in the
berries, fifteen in the leaves and only five lignans in the stalks. The stereochemsitry of these compounds
surveyed in Fig. 1 was taken from the literature. Mass spectral data can not be used to determine the
stereochemistry of the isolated compounds.
The structures of the lignans found in P. cubeba show a broad variation. All types of lignan
structures that are commonly distinguished could be identified. Furanofuran lignans such as cubebin,
hinokinin, yatein, isoyatein that are common lignans found in the genus Piper also appeared as major
lignans in all parts of P. cubeba. Neolignans with an unusual structure such as kadsurin A and
piperenone that have also been reported from P. cubeba (Koul et al., 1996) could not be identified in our
material. Yatein was the most abundant lignan found in the berries at concentrations 2.0 times higher
than hinokinin and 1.3 times higher than cubebin. Hinokinin was the most abundant lignan in the leaves
and the seeds (see Table 1).
For the quantitative determination of cubebin, hinokinin and yatein, calibration curves were
prepared using MeOH solutions of the isolated lignans at concentrations ranging from 2.5 to 25 µg mL
-1
.
Each concentration was prepared in triplicate. Regression equations were y = 123516 x – 218 (R
2
=
0.9885), y = 117773x - 6397.4 (R
2
= 0.997) and y = 111833x - 558.67 (R
2
= 0.995) for cubebin,
hinokinin and yatein, respectively. The limit of detection (LOD) was established as the amount of
analyte that provided a signal-to-noise ratio of 3. LOD were 0.1 µg for cubebin, and 0.2 for hinokinin
and 0.25 for yatein. The limit of quantification (LLOQ) was defined as the lowest calibration standard
that could be quantified with an accuracy of 90-110% and a precision of 15%. LLOQ was 0.3 µg for
cubebin, 0.9 µg for hinokinin and 0.1 µg for yatein
So far, phytochemical and pharmacological studies have only been done with the berries of P.
cubeba that are used in traditional medicine, including jamu. Based on the present inventory of lignans
in the aerial parts of the plant we conclude that in addition to the berries also the leaves may be used for
medical purposes. This knowledge can be used for the further development of (rationally designed)
phytomedicines from P. cubeba. It might be attractive from an economical point of view to harvest the
leaves earlier, in a stage in which the plant has not yet developed flowers and later berries. This may be
of economical benefit. It should however be taken into account that the concentrations of the major
lignans in the leaves are considerably lower than in the berries.

Table 1. Concentration of major lignans in Piper cubeba berries, leaves, and stalks (means from three independent
determinations).

Concentration (mg DW
-1
) Compound
Berries (± SD) Leaves (± SD) Stalks (± SD)
Yatein 23.9 ± 4.9 2.4 ± 0.1 0.2 ± 0.0
Hinokinin 18.9 ± 5.6 3.7 ± 0.4 0.6 ± 0.0
Cubebin 12.3 ± 1.9 2.8 ± 0.3 0.4 ± 0.0

51
Table 2. Occurrence of lignan in Piper cubeba berries, leaves, and stalks.

* Mass spectra data are taken from the literature and compared to the fragmentation patterns of thelignans found in our study
**nd = not detected
***na = not available
Plant part Compound (nr. compare Fig. 1) Mass spectrum m/z (rel. int.)*
Berry Leaf Stalk
Reference
Ashantin (13) 400 (27), 370 (4), 219 (8), 182 (51), 181 (100), 167 (10), 151 (15), 135 (67) + + nd** Parmar et al., 1997
Clusin (6) 402 (3), 358 (5), 248 (2), 182 (14), 181 (9), 136 (30), 135 (15) + + nd Prabhu et al., 1985
Cubebin (8) 356 (13), 203 (10), 161 (11), 136 (51), 135 (100), 131 (15) + + + Prabhu et al., 1985
Cubebinin (5) 448 (41.5), 430 (24.5), 249 (32), 182 (13.6), 181 (100) + nd nd Prabhu et al., 1985
Cubebininolide (1) 446 (64), 265 (4.5), 238 (1.5), 223 (3.6), 219 (3), 182 (60), 181 (100) + + + Badheka et al., 1986
Cubebinone (2) 430 (24), 249 (2), 248 (3), 235 (2), 222 (2), 207 (12), 203 (3), 194 (3), 182 (49), 181
(100), 166 (51), 165 (70)
+ + nd Badheka et al., 1986
Dihydroclusin (19) 404 (41), 386 (10), 250 (2.7), 225 (3.6), 182 (100), 181 (98), 136 (16), 135 (56) nd nd nd Prabhu et al., 1985
Dihydrocubebin (17) 358 (9), 204 (7), 187 (7), 136 (29), 135 (100) nd + nd Prabhu et al., 1985
α-O-Ethylcubebin (21) 384 (14), 339 (7), 338 (21), 203 (21), 173 (10), 161 (41), 148 (12), 136 (28), 135 (6) + + nd Badheka et al., 1987
β-O-Ethylcubebin (20) 384 (16), 339 (7), 338 (31), 203 (54), 173 (22), 162 (8), 161 (12), 145 (12), 136 (23),
135 (100)
+ + nd Badheka et al., 1987
Hemiarensin (18) 400 (50), 382 (1), 340 (7), 322 (3), 204 (15), 192 (9), 187 (25), 179 (6), 161 (12),
136 (33), 135 (100)
nd + nd Badheka et al., 1987
Heterotropan (22) na*** nd nd nd Badheka et al., 1987
4-Hydroxycubebinone (24) na nd nd nd Usia et al., 2005
Hinokinin (9) 354 (13), 284 (7), 162 (7), 136 (36), 135 (100), + + + Badheka et al., 1987
Isoyatein (10) 400 (71), 219 (2), 207 (4), 206 (4), 194 (1), 192 (1), 181 (100), 136 (17), 135 (94) + + + Badheka et al., 1986
Kadusrin A (15) 372 (3), 210 (82), 179 (28), 165 (15), 162 (50), 151 (100), 138 (11), 135 (13) nd nd nd Koul et al., 1996
Magnosalin (23) na nd nd nd Badheka et al., 1987
5'-Methoxyhinokinin (11) 384 (56), 249 (2), 225 (6), 222 (4), 166 (59), 165 (100), 136 (21), 135 (53) + + nd Badheka et al., 1987
5-Methoxyclusin (7) na nd nd nd Usia et al., 2005
2-(3',4'-Methylenedioxybenzyl) -3-(3',4'-
dimethoxybenzyl)-butyrolactone (12)
370 (8), 235 (3), 182 (10), 15 (19), 151 (35), 135 (100) + + nd Badheka et al. 1986
Piperenone (16) 388 (100), 347 (40), 210 (6), 179 (12), 178 (72), 166 (8), 152 (8), 151 (67), 138 (9) nd nd nd Koul et al., 1996
Sesamin (14) na nd nd nd Parmar et al., 1985
Di-O-methyl thujaplicatin methylether
(4)
400 (88), 265 (3), 264 (2), 251 (5), 238 (3), 219 (2), 182 (38), 181 (100), 177 (11),
167 (8), 165 (3), 152 (16), 152 (41)
+ + nd Badheka et al., 1986
Yatein (3) 400 (26), 182 (100), 181 (77), 151 (31), 135 (88) + + + Badheka et al., 1986
Cnap|cr 4
52
Aknowledgment
The research was supported by the QUE Project Batch II. Department of Biology, Institut
Teknologi Bandung ITB, Indonesia, under contract No. 3028-IX/P3S-1/KON-QUE II/2000; IBRD Loan
No. 4193-IND. We are grateful to Drs. Djuandi, Department of Biology, Institut Teknologi Bandung, for
collecting and identifying the plant material.

53


Chapter 5




Essential oil constituents of Piper cubeba from Indonesia
























Elfami, Rein Bos, Komar Ruslan, Herman J. Woerdenbag, Oliver Kayser, and Wim J. Quax

Submitted
Cnap|cr 5
54
Abstract
The chemical composition of the essential oil of ripe berries (11.8 % v/w) and leaves (0.9 % v/w)
of Piper cubeba L. Fils. (Piperaceae) was investigated by GC and GC-MS. Sabinene (9.1%), þ-elemene
(9.4%), caryophyllene (3.1%), epi-cubebol (4.3%), and cubebol (5.6%) were the main components of
the berries oil. Trans-sabinene hydrate (8.2%), E-caryophyllene (5.0%), epi-cubebol (4.2%), v-cadinene
(16.6%), and cubebol (4.8%) were the main components of the leaves oil. No large qualitative
differences were found in the composition between berries and leaves oil, although the berries contained
a considerable amount of constituents in traces (<0.05%) that were not found in the leaves. The principal
difference was of a quantitative nature.
|sscn|ia| ci| cf Pipcr cuocoa
55
Introduction
The genus Piper belongs to the Piperaceae, a family with more than 700 species throughout the
tropical and subtropical regions of the world. Piper cubeba (in Indonesia known as kemukus), is a plant
native to Java and Borneo that produces spicy berries (cubeb berries). It is now also cultivated in several
other tropical areas, including East Africa. In Indonesia P. cubeba is valued as a medicinal plant (Eisei
1995, Sastroamidjojo, 2001). Many species of the genus Piper are used in traditional herbal medicine,
and have shown antifungal, insecticidal, anthelminthic and antitumor activities. They are also used for
the treatment of cough, bronchitis, intestinal diseases, rheumatism (Sumathykutty et al., 1999). A
number of polyhydroxy cyclohexanes have been isolated from Piper cubeba and shown to display tumor
inhibitory, antileukemic and antibiotic activities (Taneja et al., 1991). Essential oil investigations of a
number of Piper species have been reported, but only one gives a detailed overview of the essential oil
of cubeb berries (Martins et al., 1998, Sumathykutty et al., 1999, Jirovetz et al., 2002, Orav et al., 2004,
Oyedeji et al., 2005). The aim of the present study was to investigate of the essential oil composition of
P. cubeba berries and leaves from Indonesia.

Materials and methods
Plant material
Piper cubeba L. (Piperaceae) was collected in April 2002 from Jatiroto, Temanggung, Central
Java, Indonesia, and authenticated at the Department of Biology, Institut Teknologi Bandung
(Indonesia), based on the Flora of Java (Backer and Van de Brink, 1968). A voucher specimen
(HBG10PC01) is deposited at the Herbarium Bandungense. The collected material was air-dried.

Isolation procedure
The essential oil sample was isolated from 20.0 g of air-dried and freshly ground (1 mm) leaves
and fruit material by hydrodistillation for 4 h in 300 mL
-1
water, according to the determination of the
essential oil content in vegetable drugs, using the apparatus described in the Nederlandse Farmacopee,
6
th
ed., 2
nd
printing (Anonymous, 1966). Xylene (100 µL) was used as the collection liquid, and the
essential oil was stored at -20° C until analyzed. The essential oil was diluted 50 times with cyclohexane
prior to GC and GC-MS analysis.
In addition, the oil was separated into two fractions with hydrocarbons and oxygen-containing
compounds, respectively, by eluting 250 µL of oil on a Bakerbond SPE column, filled with 1 g of silica
gel (7086-07, J.T. Baker, Deventer, The Netherlands), with subsequently 5 mL
-1
n-hexane and 5 mL
-1

diethyl ether. After gentle evaporation of the solvents of both fractions, 50 µL of each residue were
diluted with 950 µL cyclohexane and injected to GC and GC-MS analysis.

Gas chromatography
GC analysis was performed on a Hewlett-Packard 5890 Series II gas chromatograph equipped
with a 7673 injector and a Hewlett Packard 3365 Series II Chemstation, under the following conditions:
column, WCOT fused-silica (J & W) DB-5 (30 m x 0.26 mm; film thickness 0.25 µm); oven
temperature programme, 60°-290°C at 3°C min
-1
; injector temperature, 250°C; detector (FID)
temperature, 300°C; carrier gas, He; inlet pressure, 18 psi; linear gas velocity, 31.8 cm s
-1
; split ratio,
56:1; injected volume, 1.0 µL.


Cnap|cr 5
56
Gas chromatography-mass spectrometry
A Shimadzu GCMS QP5000 system was used equipped with a GC-17A gas chromatograph, an
AOC-20i auto injector, and GCMS solution version 1.10 software. The GC conditions were: column,
WCOT fused-silica (J & W) DB-5 (30 m x 0.26 mm; film thickness 0.25 µm); oven temperature
programme, 60°-240°C at 3°C min
-1
; injector temperature, 275°C; carrier gas, He; inlet pressure, 75
pKa; linear gas velocity, 81.4 cm s
-1
; column flow, 2.5 mL min
-1
; total flow, 56.7 mL min
-1
; split ratio,
21:1; injected volume, 1.0 µL. MS conditions: ionization energy, 70 eV; ion source temperature, 250°C;
interface temperature, 250°C; scan speed, 3 scans s
-1
; mass range, 34-350 u.
The identity of the components was assigned by comparison of their retention indices, relative to
C
9
-C
22
n-alkanes, and mass spectral databases and from the literature (Adams, 2001, Joulain and König,
1998).

The percentages of the components were calculated from the GC peak areas, using the
normalization method.

Results and discussion
Hydrodistillation of the berries of Piper cubeba yielded 11.8% (w/w) and the leaves 0.9% (v/w)
oil. In total 105 components could be identified in the berries, dealing with 63.1% of the oil. In the
leaves oil, 63 components could be identified, accounting for 78.0% of the oil. As far as we know, this is
the first time the essential oil composition of P. cubeba leaves has been investigated.
Comparing the composition of the berries and the leaves oil, no big differences were found for
the monoterpene and sesquiterpene hydrocarbon fractions, as well as for the oxygenated monoterpene
and sesquiterpene fractions (see Table 1). The total amount of monoterpenes was comparable in both
oils (17.2% and 17.0%, for berries and leaves, respectively). The main monoterpenes in the berries oil
were u-thujene (2.5%), u-pinene (1.8%), sabinene (9.1%), and limonene (2.3%), while u-pinene (3.2%),
sabinene (3.8%), þ-pinene (3.8%) and limonene (3.4%) were the principal monoterpenes in the leaves
oil. In the oxygenated monoterpene fractions (3.6% and 10.6%, respectively, for the berries and leaves
oil), trans-sabinene hydrate was the main component (2.5% and 8.2%, respectively). u-Copaene (3.8%),
þ-elemene (9.4%), E-caryophyllene (2.5%), caryophyllene (3.1%), were the main sesquiterpenes
(26.8%) in the berries oil, where E-caryophyllene (5.0%), and v-cadinene (16.6%) were the main
sesquiterpenes (31.0%) in the leaves oil. Remarkable is the high content of v-cadinene in the leaves oil,
whereas it was present in the berries oil in only small amounts (0.1%). From the oxygenated
sesquiterpenes (15.5% and 18.6%, respectively in berries and leaves), epi-cubebol (4.6% and 4.2%) and
cubebol (5.6% and 4.8%), were the main components in both oils. Other major components were guaiol
(2.9%) in the berries oil, and v-cadinol (2.7%) and u-cadinol (1.9%) in the leaves oil.
Two sesquiterpenes in a relatively low concentration (0.05%) with retention indices of 1566
(compound I) and 1570 (compound II) were detected, but could not be identified. Comparing the mass
fragmentation patterns of compound I, m/z(%): 41(70); 55(29); 69(3); 77(11); 91(74); 105(58); 117(9);
133(100); 145(3); 157(2); 187(1); 202(M+, 12), and compound II, m/z(%): 41(67); 55(29); 65(10);
77(14); 91(87); 105(62); 117(10); 133(100); 187(2); 202(M
+
, 14), we conclude that these two
sesquiterpenes are isomers. Also seven sesquiterpene epoxides with retention indices between 1600 and
1700 were detected, but could not be identified either.
From the literature only three older and more limited studies concerning the essential oil
composition of P. cubeba berries are known. In a commercial sample from Indonesia (without further
specifications), the main components were copaene (10.4%), þ-cubebene (11.0%), and cubebol with
10.0%, where cubenol and epi-cubenol were present with 3.5% (Lawrence, 1980). In the P. cubeba
berries oil (16.8%) from Sri Lanka the main components were cubebol (31%), u-cubebene (5.1%) and u-
copaene (8.1%) (Violon et al., 1991). In P. cubeba berries oil (14.5%) from India the main compounds
|sscn|ia| ci| cf Pipcr cuocoa
57
were cubebol (23.6%), u-pinene (18.2%), þ-elemene (7.3%), þ-cubebene (5.6%), and o-cadinene (4.7%)
(Sumathykutty et al., 1999).
Comparing the results of our present study with those from the three older reports, we come to
the following conclusions. Cubebol is one of the main components in the berries oil, but the amount
seems to depend on the origin of the material. Indonesian samples contained about 10%, the Indian and
Sri Lankese samples considerably more. We identified cubebol together with epi-cubebol. The other
studies do not discriminate between the two epimers. Less abundant in our samples, compared with the
previous studies, were u-cubebene, u-copaene, and þ-cubebene.
Lawrence (1980) found cubenol in the berries oil from India. We did not find this compound, but
detected 1,10-di-epi-cubenol (trace), and epi-cubenol (0.3%) in the berries oil from Indonesia. These
differences may be used as a tool for the characterization of P. cubeba oils from different origin,
although further systematic studies are needed to prove this.

Acknowledgements
The research was supported by the QUE Project Batch II, Department of Biology, Institut
Teknologi Bandung ITB, Indonesia, under contract No. 3028-IX/P3S-1/KON-QUE II/2000; IBRD Loan
No. 4193-IND. We are grateful to Drs. Djuandi, Department of Biology, Institut Teknologi Bandung, for
collecting plant materials.

Cnap|cr 5
58
Table 1. Composition of the essential oil from of the berries and leaves oil of Piper cubeba.


Nr. Compound RI
a
Berries Leaves
% %
1 Tricyclene 920 tr
b
tr
2 -Thujene 924 2.5 0.7
3 -Pinene 930 1.8 3.2
4 Camphene 944 tr 0.3
5 5-Methyl-3-heptanone 944 tr
6 Benzaldehyde 960 tr
7 Sabinene 970 9.1 3.8
8 -Pinene 973 0.2 3.8
9 6-Methyl-5-hepten-2-one 979 tr
10 -Myrcene 990 0.2 0.5
11 n-Decane 1000 tr
12 -Phellandrene 1002 0.4
13 2-Octanol 1002 tr
14 -Phellandrene 1004 0.4 0.2
15
3
-Carene 1013 tr
16 -Terpinene 1013 tr 0.1
17 para-Cymene 1019 0.1 0.4
19 Limonene 1026 2.3 3.4
20 1,8-Cineole 1029 0.3
21 -Phellandrene 1032 tr 0.1
22 2-Ethyl-4-pentenal 1034 tr
23 E--Ocimene 1036 0.1 0.3
24 -Terpinene 1055 0.1 0.2
25 cis-Sabinene hydrate 1062 0.4 0.3
26 Terpinolene 1083 tr tr
27 meta-Cymene 1084 tr tr
28 Nonanone-2 1091 tr
29 trans-Sabinene hydrate 1093 2.5 8.2
30 Linalool 1096 0.2 1.2
31 n-Undecane 1100 tr
32 Camphor 1138 tr
33 Verbenol 1140 tr
34 Isoborneol 1149 tr
35 Sabina ketone 1156 tr
36 E-2-Nonenal 1161 tr
37 trans--Terpineol 1162 tr 0.2
38 Borneol 1162 tr
39 Umbellulone 1171 tr
40 Terpinen-4-ol 1177 0.1
41 Cryptone 1177 tr
42 -Terpineol 1189 0.1 0.7
43 Methyl salicylate 1190 tr
44 cis-Piperitol 1195 tr
45 Nerol 1223 tr
46 Thymol methyl ether 1235 tr
47 Geraniol 1252 tr
48 2-Undecanone 1291 tr 0.7

|sscn|ia| ci| cf Pipcr cuocoa
59

Nr. Compound RI
a
Berries Leaves
% %
49 2-Methyl undecanal 1306 tr
b
0.1
50 E,E-2,4-Decadienal 1314 tr
51 -Elemene 1332 0.1
52 -Cubebene 1351 1.5 0.8
53 Cycloisosativene 1361 0.2
54 -Copaene 1372 3.8 0.9
55 -Bourbonene 1379 tr tr
56 -Elemene 1387 9.4 1.4
57 -Cubebene 1387 tr 0.2
58 -cis Bergamotene 1404 tr
59 E-Caryophyllene 1414 2.5 5.0
60 - trans-Bergamotene 1431 0.2
61 cis-Muurola-3,5-diene 1438 tr
62 Humulene 1447 0.9 1.5
63 Caryophyllene 1455 3.1 0.1
64 allo-Aromadendrene 1456 0.2
65 -Cadinene 1468 0.2 0.3
66 -Muurolene 1472 1.7 0.3
67 E--Farnesene 1479 0.2 0.1
68 Germacrene-D 1482 0.1
69 cis-Muurola-4(14)-5-diene 1484 0.3 0.3
70 epi-Cubebol 1489 4.6 4.2
71 -Muurolene 1494 0.6 1.2
72 -Himachalene 1497 0.2 0.1
73 Z-- Bisabolene 1504 0.3 0.1
74 -Cadinene 1508 0.1 16.6
75 Cubebol 1516 5.6 4.8
76 -Cadinene 1523 tr 0.1
77 cis-calamenene 1524 0.3
78 E--Bisabolene 1527 1.2 0.5
79 Cadina-1,4-diene 1531 tr 0.4
80 trans-Calamenene 1532 0.1
81 -Cadinene 1537 tr
82 -Calacorene 1540 tr 0.1
83 -Gurjunene epoxide 1542 tr
84 Elemol 1547 tr
85 cis-Muurol-5-en-4-beta--ol 1549 tr 0.1
86 E-Nerolidol 1558 0.1
1.5
87 Germacrene B 1558 0.1
88 Ledol 1560 0.2
89 þ-Calacorene 1563 0.1 0.4
90 Spathulenol 1574 0.1 0.1
91
1-Hydroxy-1,7-dimethyl-4-
isopropyl-2,7 cyclodecadiene 1576 0.2 1.0
92 epi-Globulol 1580 0.5 0.4
93 Globulol 1583 0.1
94 Viridiflorol 1591 tr 0.1
95 Guaiol 1596 2.8 0.1


Cnap|cr 5
60


Nr. Compound RI
a
Berries Leaves
% %
96 (iso)-Aromadendrene epoxide 1612 tr
b

97 1,10-di-epi Cubenol 1614 tr
98 epi-Cubenol 1620 0.3 0.7
99 -Cadinol 1634 0.3 2.7
100 -epi-Muurolol 1638 0.3 0.5
101 -Cadinol 1640 0.1 0.2
102 -Cadinol 1646 0.2 1.9
103 -Eudesmol 1649 tr
104 Selin-11-en-4-alpha-ol 1653 tr 0.1
105 -Bisabolol 1671 tr
106 -Bisabolol 1681 0.1 0.2
107 E,E-Farnesol 1715 tr
108 Z,E-Farnesol 1738 tr

Total amount identified (%) 63.1 78.0
Essential oil (%, v/w) 11.8 0.9
Grouped components
Monoterpene hydrocarbons 17.2 17.0
Oxygen-containing monoterpenes 3.6 10.6
Sesquiterpene hydrocarbons 26.8 31.0
Oxygen-containing sesquiterpenes 15.5 18.6
Others 0.8

a
Retention Index relative to C
9
-C
18
n-alkanes on the DB-5 column;
b
tr = trace (<0.05%)







61


Chapter 6




Reduced coniferin and enhanced 6-methoxypodophyllotoxin
production in Linum flavum cell suspension cultures after
treatment with Na
2
EDTA























Elfahmi, Sieb Batterman, Albert Koulman, Henricus L. Hoge, Rein Bos, Oliver Kayser, Herman J.
Woerdenbag, Wim J. Quax

Submitted
Cnap|cr 6
62
Abstract
Treatment of cell suspension cultures of Linum flavum L. with Na
2
EDTA reduced the coniferin
and enhanced the 6-methoxypodophyllotoxin (6-MPT) production in a concentration-dependent way, in
a range of 0.1 - 5 mM. On day 14 after treatment with Na
2
EDTA, an inhibition of the coniferin
production up to 88% was found (content in control cultures 120.7 mg g
-1
DW). The maximum
enhancement of the 6-MPT production was 320% on day 7 after treatment with 5 mM Na
2
EDTA
(control value 0.16 mg g
-1
DW).
The reduction in coniferin accumulation in the suspension cultures was correlated with an
inhibition of coniferyl alcohol glucosyltransferase (CAGT) activity as determined in cell homogenates.
On day 14 after treatment with 2 and 5 mM Na
2
EDTA the

CAGT activity was inhibited up to > 89 %
(control value 8.8 µkat g
-1
). The inhibitory effect of Na
2
EDTA on CAGT was also shown in a partially
purified enzyme preparation. Several metal ions such as Fe
3+
, Cu
2+
, Zn
2+
, Li
+
, and the elicitors nigeran
and salicylic acid had no significant effect on the production of coniferin and 6-MPT.
|ffcc| cf Na2|DTA cn cc|| suspcnsicn cu||urcs cf |inun f|atun
63
Introduction
Podophyllotoxin and podophyllotoxin-derived lignans possess cytotoxic and antiviral activities.
Teniposide and etoposide are semi-synthetic derivatives of podophyllotoxin that are clinically used as
anticancer drugs (Moraes et al., 2002). Podophyllotoxin is also the starting compound for the
rheumatoid arthritis drug CPH 82 (Reumacon) (Svensson and Pettersson, 2003). For the production of
semi-synthetic podophyllotoxin derivatives on an industrial scale, podophyllotoxin is isolated from the
rhizomes of Podophyllum plants from wild habitats, which are counted as endangered species (Smollny
et al., 1998).
The use of biotechnological approaches to improve the production of podophyllotoxin or related
lignans with plant cell and organ cultures, including the biotransformation of suitable precursors and the
modification of biosynthetic pathways, is considered to be suitable and economically attractive (Giri and
Narasu, 2000). Several investigations to enhance the production of podophyllotoxin-derived lignans by
manipulation of cell and organ cultures have been carried out (Van Uden et al., 1990a, 1991a,
Woerdenbag et al., 1990, Berim et al., 2005, Petersen and Alfermann, 2001). The production of
podophyllotoxin, 6-methoxypodophyllotoxin (6-MPT) and its glucoside could be enhanced in cell
cultures of Podophyllum hexandrum Royle (Woerdenbag et al., 1990), Linum flavum L. (Van Uden et
al., 1990a, 1992, Molog et al., 2001) Callitris drummondii F. Mueller (Van Uden et al., 1990b), Linum
album Kotschy (Seidel et al., 2002), and Linum nodiflorum (Berim et al., 2005).
Based on the close chemical resemblance with podophyllotoxin (see Fig. 1), 6-MPT is
considered also as an interesting starting compound for the preparation of new semi-synthetic
derivatives with antitumor properties. Cell cultures of L. flavum produce 6-MPT and its glucoside. The
cytotoxicity of 6-MPT in vitro against tumor cell lines was comparable with that of podophyllotoxin
(Middel et al., 1995).
Coniferyl alcohol is an early precursor of both lignins and lignans. The glucosylation of coniferyl
alcohol yields coniferin that is accumulated endogenously in L. flavum cultures up to 12 % on a dry
weight basis (Van Uden et al., 1991b). This reaction is catalysed by coniferyl alcohol
glucosyltransferase (CAGT, EC number: 2.4.1.111). Lignans are formed through radical-mediated
dimerisation of two coniferyl alcohol units. Blocking the branch leading to the formation of coniferin by
inhibiting CAGT could result in an enhanced production of lignans, such as 6-MPT in the cell
suspension cultures of L. flavum. High coniferin contents in the cell suspension culture correspond with
low 6-MPT levels, as was demonstrated in feeding experiment with cell cultures of P. hexandrum (Van
Uden et al., 1990a). It is known that Na
2
EDTA (Ibrahim and Grisebach, 1976) and metal ions such as
Cu
2+
, Zn
2+
, Li
+
and Fe
2+
(Schmid and Grisebach, 1982, Wunder and William, 1999, Reed et al., 1993)
are able to inhibit the glucosyltransferase activity. Addition of one of these compounds may interfere
with CAGT.
The aim of this paper is to explore the effect of Na
2
EDTA and several inorganic salts on the
production of coniferin and 6-MPT in cell suspension cultures of L. flavum. This effect is compared to
that of the elicitors salicylic acid and nigeran. These compounds enhance various biosynthetic pathways,
but so far there is little evidence of their effect on the lignan biosynthesis (Guan and Scandalios, 1995,
Chong et al., 1999).
Cnap|cr 6
64
Materials and methods

Plant material and culture conditions
Cell suspensions of Linum flavum L. (Linaceae) leaves have been initiated and are maintained at
the Department of Pharmaceutical Biology, University of Groningen. The cell suspensions are cultured
routinely every two weeks by transferring 100 mL of fully grown suspension aseptically into 200 mL of
fresh liquid medium. The medium is a MS (Murashige and Skoog 1962) containing 0.2 mg of indole-3-
acetic acid (IAA) and 0.2 mg of 6-benzylaminopurine (BAP), purchased from Duchefa (Haarlem, the
Netherlands). The cell suspensions were incubated on a rotary shaker (175 rpm) at 26°C under a
day/night regime (16/8 h: 3,000 lux, day light L 36W/10, OSRAM, Germany).

Treatment of cell suspensions
Disodium ethylenediamine tetra acetate (Na
2
EDTA) was purchased from Duchefa, copper (II)
sulphate pentahydrate, zinc chloride, and lithium chloride from Merck (Darmstadt, Germany), iron (II)
sulphate pentahydrate, salicylic acid from Sigma-Aldrich (Zwijndrecht, the Netherlands), and nigeran
from Sigma, St. Louis (USA).
These compounds were added to the culture media used for the cell suspension cultures of L.
flavum yielding the following final concentrations: Na
2
EDTA : 0.01, 0.5, 1, 2 and 5 mM, Cu
2+
, Zn
2+

and Li
+
: 0.1, 1 and 5 mM, Fe
2+
: 0.01, 0.1 and 1 mM, salicylic acid: 0.1, 0.5, 1 and 5 mM; nigeran 20
mg L
-1
. Suspension-grown cells were harvested each 2 days during the growth cycle of 14 days. Samples
of about 10 mL were taken aseptically and transferred into a calibrated conical tube and centrifuged for
5 min at 1,500 g. In order to monitor the viability and growth of the cell cultures, the medium pH and
the conductance were routinely measured in the supernatant. The cells were filtered using Buchner
funnel. Fresh weight (FW) was determined and the cells put overnight in the freezer and subsequently
freeze dried. Dry weight (DW) was also determined. Coniferin and 6-MPT contents were subsequently
analyzed by HPLC.

Extraction
About 100 mg, accurately weighed of freeze dried and powdered cell material were extracted by
ultrasonification in 2 mL methanol (80%; v/v) for 1 h. Dichloromethane (4.0 mL) and water (4.0 mL)
were added. The mixture was vortexed and centrifuged (5 min; 1,500 g). For the determination of the 6-
MPT concentration, 2.0 mL of the dichloromethane phase were taken and evaporated to dryness. The
residue was redissolved in 1.0 mL methanol and centrifuged. For the determination of coniferin 50 µL
water phase were diluted with water until 1.0 mL and centrifuged (2 min; 10,000 g).

Treatment of aqueous phase with β ββ β-glucosidase
To confirm the coniferin production, the water phase was submitted to enzymatic hydrolysis. A
3.5% (w/v) solution of β-glucosidase (Sigma G-0395) was prepared in 0.1 M phosphate buffer, pH 5.0.
To 2.0 mL samples of the water phase 0.5 mL was added, followed by incubation for 5 h at 37°C. The
aglucone formed was extracted with 2.0 mL dichloromethane. Of the dichloromethane phase 1.5 mL
were taken and evaporated to dryness. The residue was redissolved in 1.0 mL methanol and centrifuged
(2 min; 10,000 g). Coniferyl alcohol was determined by HPLC.



|ffcc| cf Na2|DTA cn cc|| suspcnsicn cu||urcs cf |inun f|atun
65
Protein purification
Cells were harvested on day 1 after subculturing and stored at -20°C overnight. Frozen cells were
suspended in an equal volume of the homogenisation buffer that consisted of 0.2 M Tris-HCl, pH 7.5,
5% polyvinylpyrrolidone, 0.2 % DOWEX

- 1*2 – 100, 0.1 % DTT (w/w) and 10% ethylenglycol. The
mixture was homogenised using an ultraturrax (Janke & Kunkel, IKA-WERK, Staufen, Germany). The
homogenate was filtered through Miracloth
®
and clarified by centrifugation for 20 min at 20,000 g.
Proteins dissolved in the supernatant were then fractionated by (NH
4
)
2
SO
4
precipitation. The fraction
obtained between 40 and 80% saturation was desalted on a HiPrep 26/10 desalting column (Amersham
Biosciences, Uppsala, Sweden) previously equilibrated with 0.02 M Tris-HCl buffer, pH 7.5. The
protein eluting from the desalting column was applied to a HiTrap DEAE FF column (Amersham
Biosciences, Uppsala, Sweden) which had been equilibrated with 0.02 M Tris-HCl buffer, pH 7.5. The
protein was eluted first with 100 mL of 0.02 M Tris-HCl buffer, followed by a linear gradient from 0.02
to 0.2 M Tris-HCl buffer and finally with 100 mL of 0.4 M Tris-HCl buffer, all at pH 7.5. Fractions of 5
mL each were collected at a flow rate of 1 mL min
-1
and assayed directly for CAGT activity. Fractions
containing the highest activity were combined and concentrated by vivaspin 6 mL concentrator
(Vivasciences, Hannover, Germany). The combined fractions with the highest CAGT activity resulting
from the desalting column (the third step of the purification procedure, see Table 2) were exposed to
Na
2
EDTA. The Na
2
EDTA was added to 5 mL of the partially purified CAGT yielding final
concentrations of 0.1, 0.5, 1, 2 and 5 mM. The mixtures were incubated at 4°C for one day. 200 µL (3x)
of the mixture were taken and submitted for CAGT assay.

CAGT assay
The enzyme assay for CAGT was developed from the methods used by Ibrahim et al. (1976) and
Schmid et al. (1982). Cells were treated with Na
2
EDTA in the range of 0.1-5 mM and harvested at
different time points during the growth cycle and stored at -20°C overnight. Frozen cells, 2-3 g, were
suspended in homogenisation buffer and the mixture was homogenised using an ultraturrax. The
homogenate was centrifuged (3,000 g; 25 min, 2°C). The supernatant was separated from the pellet. The
assay buffer was prepared containing 0.2 M Tris-HCl pH 7.5, DTT 0.1 %. The standard assay mixture
consisted of 0.32 µmol coniferyl alcohol in 40 µL ethyleneglycol monomethylether, 0.32 µmol uridine
diphosphate (UDP)-glucose in 40 µL assay buffer, 200 µL protein homogenate or partially purified
CAGT and assay buffer in a total volume of 320 µL. The reaction was started by the addition of protein
and vortexed for 5 s immediately followed by incubation for 30 min at 30°C. The reaction was stopped
by adding 2.0 mL dichloromethane followed by vortexing the mixture for 20 s and centrifugation (5
min; 1,500 g). The dichloromethane and water layers were used for HPLC analysis of coniferyl alcohol
and coniferin, respectively. Protein was determinated using the Bradford assay (Bradford, 1976).

Analysis of coniferin, coniferyl alcohol and 6-MPT
Coniferin, coniferyl alcohol and 6-MPT were analyzed by HPLC. The HPLC system consisted of
an ISCO Model 2350 pump, a Shimadzu photodiode array detector (Shimadzu, ‘s-Hertogenbosch, the
Netherlands), UV absorbance at 230 and 290 nm and LiChrocart RP-18 column (250 x 4.6 mm i.d.)
(Merck, Darmstadt, Germany). The mobile phase for coniferyl alcohol and 6-MPT analysis was
acetonitrile (LAB-SCAN Analytical-sciences, Dublin, Ireland) / water (40:60 v/v; 0.1% phosphoric
acid) and for coniferin, methanol/water (30:70; 0.1 % phosphoric acid). Calibration curves were made
using coniferyl alcohol (Sigma), coniferin and 6-MPT, which were isolated from L. flavum cell
suspension cultures as published previously (van Uden et al., 1991b, 1992). For the statistical evaluation
of the data the Sudent’s t-test was used. A P-value <0.05 was considered as significant.
Cnap|cr 6
66
O
O
OH
O
OMe
OMe
MeO
R
CH
2
OH
OCH
3
OR
1. R = H
2. R = OMe
3. R = H
4. R = Glucose


Fig. 1. Chemical structures of podophyllotoxin (1), 6-methoxypodophyllotoxin (2), coniferyl alcohol (3) and coniferin (4).

Results and discussion
The effect of Na
2
EDTA on the growthy of L. flavum cell suspension cultures was determined on
the basis of dry weight accumulation as shown in Fig. 2. The growth period of the cultures was 14 days.
From day 1 after inoculation the cells grew until day 8. The stationary phase was reached between day 8
and 12. At the end of the period (day 14) the cell suspension was refreshed. There was no significant
effect of Na
2
EDTA on the growth of the cell suspensions or on the viability parameters at concentrations
of 0.1, 0.5 and 1 mM (dry weight and conductivity). At a concentration of 2 and 5 mM, Na
2
EDTA
inhibited cell growth up to 22% and 59% respectively (maximal effect) on day 8.
In Fig. 3 the effect of treatment with Na
2
EDTA on the coniferin production in L. flavum cells is
shown. Untreated cells (control) contained up to 12.0 % coniferin on a dry weigh basis on day 14 of the
growth cycle. After treatment with Na
2
EDTA, the coniferin production was reduced in a concentration
dependent way by 18-88% (Fig. 5) on day 14, although it should be noted that the higher concentrations
of Na
2
EDTA (2 and 5 mM) also inhibited the cell growth.
To confirm the coniferin production, the water phase that contained coniferin was submitted to
enzymatic hydrolysis using β-glucosidase. This enzyme catalyses the hydrolysis of monolignol
glucosidases, that lead to the release of the corresponding alcohols (Dharmawardhana et al., 1995). The
coniferyl alcohol formed fully correlated with the coniferin content as found after hydrolysis.
The accumulation of 6-MPT was enhanced 1.2, 1.9 and 3.2 fold at a concentration of Na
2
EDTA
of 1, 2 and 5 mM respectively on day 7 in the cell suspensions of L. flavum (Fig. 4, Fig. 5). Adding 0.1
mM and 0.5 mM Na
2
EDTA did not enhance the 6-MPT production.

|ffcc| cf Na2|DTA cn cc|| suspcnsicn cu||urcs cf |inun f|atun
67
0
5
10
15
20
25
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Days
D
r
y

w
e
i
g
h
t

(
g

L
-
1
)

Fig. 2. Growth of L. flavum cell suspension cultures after treatment with Na
2
EDTA 5 mM (ø), 2 mM (.), 1 mM (»), 0.5 mM
(·), 0.1 mM (±) and without Na
2
EDTA as a control (A). Individual values expressed in g L
-1
are averages of three
independent experiments as means ± standard deviation.

0
20
40
60
80
100
120
140
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Days
c
o
n
i
f
e
r
i
n

(
m
g

g
-
1

D
W
)

Fig. 3. Coniferin production in L. flavum cell suspension cultures after treatment with Na
2
EDTA 5 mM (ø), 2 mM (.), 1 mM
(»), 0.5 mM (·), 0.1 mM (±) and without Na
2
EDTA as a control (A). Individual values expressed in mg g
-1
of dry weight are
averages of three independent experiments as means ± standard deviation.


Cnap|cr 6
68
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
1 2 3 4 5 6 7 8 9 10 11 12 13 14
Days
6
-
M
P
T

(
m
g

g
-
1

D
W
)

Fig. 4. 6-MPT production in L. flavum cell suspension cultures after treatment with Na
2
EDTA 5 mM (ø), 2 mM (.), 1 mM
(»), 0.5 mM (·), 0.1 mM (±) and without Na
2
EDTA as a control (A). Individual values expressed in mg g
-1
of dry weight are
averages of three independent experiments as means ± standard deviation.
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
0.1 0.5 1 2 5
Na2EDTA (mM)
%

I
n
h
i
b
i
t
i
o
n

o
f

c
o
n
i
f
e
r
i
n


-50%
0%
50%
100%
150%
200%
250%
300%
350%
%

E
n
h
a
n
c
e
m
e
n
t

o
f

6
-
M
P
T

Fig. 5. Inhibition of the coniferin production on day 14 (control = 120.7 mg g
-1
dry weight) (.) and enhancement of the 6-
MPT production on the day 7 (control = 0.16 mg g
-1
dry weight) (ø) in L. flavum cell suspension cultures after treatment with
Na
2
EDTA.

In the concentrations used, none of the metal ions (Cu
2+
, Zn
2+
, Li
+
and Fe
3+
) inhibited the
coniferin or enhanced the 6-MPT production in the cell suspension cultures of L. flavum. In contras,
these salts inhibited the growth of the cultures. Nigeran had no effect on the growth of the cell cultures,
neither on the production of 6-MPT nor coniferin. Salicylic acid was lethal to the cell cultures at
|ffcc| cf Na2|DTA cn cc|| suspcnsicn cu||urcs cf |inun f|atun
69
concentrations of 2 and 5 mM. The concentrations of 0.1 and 0.5 mM salicylic acid had no effect on the
growth of the cell cultures and neither on the production of 6-MPT nor coniferin.
The highest CAGT activity in cell suspension cultures was found on day 1 after inoculation.
Untreated cells (control) had an activity 13.7 µkat g
-1
. The activity was reduced by 30–57 % 1 day after
inoculation with 0.1–5 mM Na
2
EDTA. On day 6 the control cells had a CAGT activity of 2.5 µkat
g
-1
and the concurrent inhibition of Na
2
EDTA 0.1–5 mM was 12–52%. A significant decrease of the
enzyme activity was found on day 13 and 14 after inoculation. Enzyme activity of untreated cell was 6.6
(day 13) and 8.8 µkat g
-1
(day 14) and the inhibition by Na
2
EDTA 0.1–5 mM was 4-79% and 14-89%,
respectively (Table 1).

Table 1. CAGT activity in L. flavum cell suspension cultures on various days and the percentage inhibition after
treatment with Na
2
EDTA. Each percentage is calculated on its respective control. Individual values expressed in µkat g
-1

of protein are averages of three independent experiments as means ± standard deviation.
a
P<0.05,
b
P<0.01 (compared to
control values, Student’s t-test).

CAGT activity (µkat g
-1
) ± (SD) and % inhibition
Day 1 Day 6 Day 13 Day 14

Na
2
EDTA
(mM)
Activity Inhibition
(%)
Activity Inhibition
(%)
Activity Inhibition
(%)
Activity Inhibition
(%)
0 13.7(±1.3) 0 2.5 (±0.3) 0 6.6 (±1.0) 0 8.8 (±0.5) 0
0.l 9.6 (±2.4) 30 2.2 (±0.4) 12 6.0 (±2.5) 4 8.5 (±0.4) 14
0.5 10.8 (±2.5) 22 1.9 (± 0.5) 24 2.5 (±0.4) 62
a
4.8 (±1.8) 46
a

1 7.5 (±1.6) 46
a
1.0 (±0.3) 60
b
1.9 (±0.3) 72
b
3.9 (±0.3) 56
b

2 5.2 (±1.3) 62
a
1.1 (±0.1) 56
b
1.3 (±0.1) 80
b
3.1 (±0.2) 65
b

5 5.9 (±1.0) 57
a
1.2 (±0.4) 52
a
1.4 (±0.0) 79
b
1.0 (±0.1) 89
b



For CAGT purification, the enzyme was extracted from 1 day-old cell suspension cultures (when
the highest CAGT activity was found). The purification procedure, summarized in Table 2, ultimately
resulted in a 41.2-fold enhancement of the CAGT activity, 13.1 % recovery of total activity and a
product with a specific activity of 256 µkat g
-1
of protein. The amount of protein obtained however, was
insufficient to carry out incubation experiments with Na
2
EDTA. Therefore the fraction originating from
the desalting step (see Table 2; no. 3, 11.4-fold purified) was used. 5 mM of Na
2
EDTA inhibited the
CAGT activity in this partially purified enzyme preparation, up to 53%.

Table 2. Subsequent preparation steps of the partially purified CAGT preparation.

Steps Fraction Protein
(mg)
Total activity
(µkat)
Specific activity
(µkat g
-1
protein)
Purification
(fold)
Yield
(%)
1 Crude extract 302.4 1.52 5 1 100
2 Ammonium sulphate
precipitation
28 1.12 40 8 73
3 Desalting 4.4 0.25 56.8 11.4 16.4
4 HiTrap DEAE FF 0.8 0.20 256 41.2 13.1


CAGT is a glucosyltransferase that converts coniferyl alcohol into coniferin. In order to enhance
the 6-MPT production in L. flavum cell suspension cultures, the formation of coniferin was blocked by
inhibition of CAGT using several potential glucosyltransferase inhibitors. Na
2
EDTA inhibited the
production of coniferin in the cell suspension cultures of L. flavum in a concentration-dependent way, in
a range of 0.1-5 mM. The results were confirmed by hydrolysis of the coniferin-containing water layer
Cnap|cr 6
70
of the cell extract by enzymatic hydrolysis using þ-glucosidase. Coniferin was completely converted into
coniferyl alcohol and the concentration of the formed coniferyl alcohol related to the original coniferin
concentration.
There was a correlation between the coniferin and the 6-MPT production in L. flavum cell
suspension cultures. Higher coniferin contents corresponded with lower 6-MPT levels. This supports our
hypothesis that blocking the branch leading to the formation of lignins by inhibition of
glucosyltransferase may result in an enhanced production of lignans. By inhibiting the coniferin
production, coniferyl alcohol accumulates and is available as a substrate to produce of 6-MPT and other
lignans.
The high 6-MPT content on day 6-9 of the growth cycle (Fig. 4), correlates with the low CAGT
content as measured on day 6 (Table 1). This is in agreement with earlier observations (Van Uden et al.
1991b), showing that a maximum coniferyl alcohol content in L. flavum cell suspension cultures was
preceded by a maximal activity of the enzyme þ-glucosidase.
At the beginning of the growth cycle of the control cell suspension cultures no clear relationship
existed between CAGT activity and coniferin content. However, after day 6 it appeared that a low
activity of CAGT related to a low coniferin content. CAGT activity then increased until day 14, with a
simultaneous increase of the coniferin accumulation.
The highest CAGT activity in cell suspensions was found on day 1. Then it declined to a lower
level on day 6 and re-increased on day 13 and 14. This is probably affected by þ-glucosidase that
converts coniferin into coniferyl alcohol. The reaction catalyzed by þ-glucosidase is opposite to that of
CAGT. In L. flavum cell suspension cultures, þ-glucosidase activity increased to a maximal value on
day 4 of the growth cycle and declined to lowest activity on day 14 (Van Uden et al., 1991b). A high
CAGT activity apparently relates to a low þ-glucosidase activity.
Reduction of the CAGT activity correlated with a reduction of the coniferin production in the
cell suspensions. The coniferin production and CAGT activity were reduced to >88% at the end of a
growth cycle after treatment with 5 mM Na
2
EDTA, while control values of the coniferin production
were at their maximum at this time point. These results strongly suggest that Na
2
EDTA inhibits CAGT
activity thereby inhibiting the conversion of coniferyl alcohol into coniferin in L. flavum cell suspension
cultures. Our hypothesis that Na
2
EDTA (0.5 mM) is an inhibitor of CAGT activity is further supported
by the inhibitory effect on CAGT activity in an 11.4-fold purified enzyme preparation. The effect, in
terms of percentage inhibition, however, is less pronounced than in the cell suspensions. This difference
may be due to a toxic effect of Na
2
EDTA on the cell suspension cultures.
In conclusion, Na
2
EDTA appears to be an inhibitor of CAGT activity both in vivo and in situ.
Because of a lack of information about the structure and the function of the CAGT it is not yet clear
which mechanism underlies the inhibition by EDTA. If CAGT needs a metal ion as a co-factor for its
activity, it can be understood that the Na
2
EDTA complexes with the metal ion, thereby reducing the
enzyme activity. Further studies directed to the purification, structure and function determination of the
enzyme are in progress.

Acknowledgement
The research was supported by the QUE Project Batch II, Department of Biology Institut
Teknologi Bandung ITB, Indonesia, under the contract No. 3028-IX/P3S-1/KON-QUE II/2000, IBRD
LOAN No. 4193 – IND.


71


Chapter 7





Cloning of glucosyltransferase genes from cell suspension
cultures of Linum flavum in E. coli



Cnap|cr 7
72
Abstract
Glucosyltransferases (GTs) from cell suspension cultures of Linum flavum were successfully
cloned in E. coli. Total RNA was isolated from the cell suspension cultures at day 1 of subculturing,
when the highest activity of GTs was reached. With degenerate primers designed on a conserved region
from plant glucosyltransferases, RT-PCR was used to amplify specific cDNA fragments. The sequences
of these cDNA fragments showed strong similarity with those encoding for GTs in various other plant
species, previously deposited in the databases. Using primer extension and inverse PCR the full length
gene was amplified from genomic DNA extracted from Linum flavum cells. Based on phylogenetic
analysis, one of the cloned GTs belongs to Group D, Family 1 of glucosyltransferases that are active for
phenylpropanoid compounds. This is the first time that a gene involved in the lignan biosynthesis from
L. flavum is cloned.


























Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. coli
73
Introduction
Podophyllotoxin, an aryltetraline lignan with antiviral and antineoplastic activities, is used as a
precursor for the semi-synthesis of established cancer therapeutics, i.e. etoposide
®
, teniposide
®
and
etopophos
®
. The use of plants as a source of podophyllotoxin is limited due to difficulties in the (large
scale) cultivation of the endangered Podophyllum hexandrum (Gordaliza et al., 2004). There is a need to
find alternative sources for podophyllotoxin. Biotechnological and enzymatic approaches have been
considered as a potential solution for the problem. Petersen and Alfermann (2001) described the state of
the art of the use of plant cells and organ cultures as a strategy in this respect. In vitro production of
podophyllotoxin and 6-methoxypodophyllotoxin and related lignans has been shown in cell cultures of
Podophyllum and Linum species (Woerdenbag et al., 1990, Empt et al., 2000, Chattopaday et al., 2002,
Berim et al., 2005). An understanding of the metabolic pathway of lignans and the cloning of the
corresponding genes may allow genetic modifications leading to a higher production of lignans. In this
respect the branch of lignan and lignin biosynthesis after the common early pathway opens an
interesting possibility. Reducing the lignin biosynthesis may lead to a channelling of precursors towards
the synthesis of lignans (Gordaliza et al., 2004).
Cell suspension cultures of Linum flavum (family Linaceae) accumulate high amounts of
coniferin that is synthesized from coniferyl alcohol by glucosyltransferases (GTs). Coniferyl alcohol is a
precursor of coniferin and lignans through different biosynthetic branches (see Fig. 1) (Van Uden et al.,
1991). Inhibition of the coniferin production by inhibition of GTs could lead to the accumulation of
coniferyl alcohol that subsequently leads to an increase in the production of cytotoxic lignans. GTs are a
large group of enzymes that catalyze the transfer of a sugar moiety from an activated donor onto
saccharide or non-saccharide acceptors. These enzymes play a key role in the biosynthesis of natural
products and in recent years the information on GTs of small molecules has increased enormously.
Many recombinants GTs have been characterized from different plant species (Vogt and Jones
2000, Bowles et al., 2005). From the genome sequence of Arabidopsis thaliana, more than 110 GTs
have been identified and based on a phylogenetic tree, they were grouped into 12 distinct classes (Li et
al., 2001, Bowles et al., 2005). Several important natural products have been used as the substrate for
classification such as curcumin (Kaminaga et al. 2004), phenylpropanoids (Taguchi et al., 2001, Chong
et al., 2002), dihydroxyphenylalanine (DOPA) (Sasaki et al., 2005), steroidal alkaloids (Kohara et al.,
2005) anthocyanins (Imayama, et al., 2004, Lorenc-Kukula et al., 2004), coumarins and flavonoids
(Taguchi et al., 2001). Glucosylation has biological significance influencing toxicity, bioavailability,
solubility, adsorption, and metabolism of compounds. It also enables the storage of potent toxic and
deterrent chemicals at high concentration in vacuoles (Lorenc-Kukula et al., 2004, Bowles et al., 2005).
The detection of coniferin in L. flavum cells cultures (Van Uden et al., 1991) indicates the
presence of one or more GTs are involved in its synthesis from coniferyl alcohol. Based on conserved
regions we have designed PCR primers for the amplification of GT genes of group D of family 1 from
mRNA isolated from lignan synthesizing L. flavum cells. The conserved region, called the PSPG box, is
highly characteristic and present in all GTs involved in natural product biosynthesis. This domain may
also define the active site of GTs of animals and microorganisms. The PSPG box is considered to
represent the nucleotide diphosphate binding site. In this study we report the isolation of
glucosyltransferase cDNAs from cell suspension cultures of L. flavum, and the cloning of the
corresponding genes in E. coli.

Cnap|cr 7
74
O
H
3
CO
HO
OCH
3
OCH
3
O
CH
3
O OH
H
3
CO
O
OCH
3
OCH
3
O
O
O
H
3
CO
OH
(B)
O
OCH
3
OCH
3
O
O
O
H
3
CO
O
H
3
CO
HO
OH
OCH
3
O
OH
O
OCH
3
OCH
3
O
O
O
H
3
CO
O
H
3
CO
HO
OCH
3
OCH
3
O
OCH
3
H
3
CO
(A)
D6H
OH O
H
2
N
O
H
3
CO
HO
OH
OCH
3
O
POMT
O
OCH
3
OCH
3
O
O
O
H
3
CO
OH
(B)
CH
2
OH
OH
OCH
3
O
OCH
3
OCH
3
O
O
O
H
3
CO
CH
2
OH
OGluc
OCH
3
CAGT
Glud
PhenPro's
Phenylalanine
Coniferyl alcohol Coniferin
Matairesinol
Yatein
Deoxypodophyllotoxin Podophyllotoxin
Peltatin
7'-Hydroxymatairesinol
Anhydropodorhizol
Peltatin methyl ether
L7H
6-Methoxypodophyllotoxin
(c)


Fig. 1. Biosynthesis of lignans according to (a) Van Uden et al. (1997) and Molog et al. (2001) (b) Jackson and Dewick
(1984) (c) Xia at. Al. (2000). The enzyme abbreviations are phenylpropanoid enzymes (PhenPro’s), glucosidase (Glud),
coniferyl alcohol glucosyltransferase (CAGT) deoxypodohyllotoxin 6-dehydrogenase (D6H), peltatin SAM-dependent O-
methyltransferase (POMT), putative lignan 7-hydroxylase (L7H).






Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. coli
75
Materials and methods
Plant material and culture conditions
Cell suspensions of Linum flavum L. (Linaceae) leaves have been initiated and are maintained at
the Department of Pharmaceutical Biology, University of Groningen. The cell suspensions are cultured
routinely every two weeks by transferring 100 mL of a fully grown suspension aseptically into 200 mL
of fresh liquid medium. The medium contains MS medium (Murashige and Skoog,1962), 0.2 mg of
indole-3-acetic acid (IAA) and 0.2 mg of 6-benzylaminopurine (BAP), purchased from Duchefa,
Haarlem, the Netherlands. The cell suspensions were incubated on a rotary shaker (175 rpm) at 26
°
C
under a day/night regime (16/8 h: 3,000 lux, day light L 36W/10, OSRAM, Germany).

Isolation of plant RNA, DNA and cDNA construction
One day old cell suspension cultures were harvested, filtered and the remaining cell material was
put directly into liquid nitrogen and grinded. 500 mg of powdered cell material were used for total RNA
isolation using nucleospin
®
RNA plant isolation kits (Macherey-Nagel, GmbH & Co., Düren, Germany).
cDNA was constructed from 2 µg total RNA using Omniscript
®
RT (Qiagen GmbH, Hilden, Germany).
Genomic DNA was isolated from 30 g of powdered cell material using the cetyltrimethyl
ammoniumbromide (CTAB) method. 30 mL of extraction buffer containing 350 mM sorbitol, 100 mM
Tris HCl pH 7.5, 5 mM EDTA and 20 mM sodium bisulfide (added just before use) were added to the
cell frozen material, mixed until thawn and resuspended. The mixture was centrifuged for 5 min at 3000
x g. The supernatant was separated and the pellet was resuspended using extraction buffer (3.5 mL) and
nucleus lysis buffer (5 mL). The nucleus lysis buffer contained 200 mM Tris HCl pH 7.5, 50 mM
EDTA, 2 M sodium chloride and 2% (w/v) CTAB. To the suspension, 5% sarkosyl was added and the
mixture was incubated at 65
o
C for 1 h. The mixture was extracted using 8 mL chloroform :
isoamylalcohol (24:1) and rotated for 30 min. The upper layer was separated, 5 mL of isopropanol were
added and mixed thoroughly for 5 min at room temperature and subsequently centrifuged for 10 min
(3000 x g). The pellet was washed using 70% ethanol and dissolved by 1 mL TE buffer with 1 µL
RNAse, then incubated at 65
o
C for 10 min.

PCR amplification
Alignment of 106 sequences of GTs from various other plant species deposited in the NCBI
database using MegAlign was performed to identify regions of conserved amino acid sequences. The
region between position 254 and 298 and the region between 342 and 386 (44 amino acids) were found
to be the most conserved. The following two degenerated primers were designed for amplification of GT
fragment from L. flavum cDNA: Pgt-1f: 5′-GGNWTRMSRNVVDNNNTGGGCHCCGCA-3′ and Pgt-
1r: 5′-TGCCGATGGTGNCNTGGCCHTT NTTRGCNGANCA-3′. PCR amplification of cDNA was
performed using a Mastercycler® gradient thermocycler (Eppendorf) in 50 µL containing 50 ng cDNA,
200 µM dNTP and 1.25 units of Taq polymerase (Fermentas GMBH, St. Leon-Rot, Germany). The PCR
program was denaturation at 95
o
C for 30 s, annealing at 60
o
C for 40 s, and extension at 72
o
C for 2 min.
The PCR product was cloned into the pGEM-T easy
®
vector system I (Promega, Madison, USA) and the
sequences were determined with a Megabase Sequencer (a Alf

Express II using ThermoSequenase
fluorescent primer cycle kit,

Amersham Pharmacia, Sweden).




Cnap|cr 7
76
Rapid amplification of the cDNA ends (RACE)
The amplification of the 3′- and the 5′-ends of two coniferyl alcohol glucosyltransferase (CAGT)
candidates was performed using 3′ and the 5′ RACE kits (Invitrogen, Carlsbad, Canada). Two sets of
primers were designed (Table 1) based on the sequences found in the first PCR round. Pgt-2r (1-3) and
Pgt-3f (1-3) were used for the amplification of the 3′- and 5′ ends of CAGT-A, respectively. Pgt-4r (1-3)
and Pgt-5f (1-3) were used for the amplification of the 3′- and 5′ ends of CAGT-B, respectively. The
applied touchdown PCR program was initial denaturation at 95
o
C for 3 min, one cycle; denaturation at
95
o
C for 40 s, annealing at 68
o
C for 40 s, extension at 72
o
C for 3 min, 95
o
C for 40 s, 42
o
C for 2 min,
and extension at 72
o
C for 3 min, 5 cycles; 94
o
C for 40 s, 72
o
C for 3 min, 5 cycles; 94
o
C for 40 s, 72
o
C
for 3 min, 25 cycles; 95
o
C for 40 s, 68
o
C for 2 min, and extension at 72
o
C for 3 min and the last
extension 72
o
C for 5 min. PCR products were cloned into pGEM-T easy
®
. The sequences were
determined.

Inverse PCR (iPCR)
10 µg of genomic DNA were digested using HaeIII in total volume of 100 µL, then concentrated
using sodium acetate precipitation. HaeIII was inactivated by heating at 60
o
C for 10 min. 10 µL were
ligated using T4 DNA ligase and purified using a QIA quick
®
gel extraction kit (Qiagen GmbH, Hilden,
Germany). Two sets of primers were designed based on the first PCR products. They were Pgt-3f3, Pgt-
2r3 for CAGT-A and Pgt-5f3, Pgt-4r3 for CAGT B. The applied PCR program was initial denaturation
at 94
o
C for 5 min, 10 cycles; denaturation at 94
o
C for 15 s, annealing at 60
o
C for 40 s, and extension at
72
o
C for 3 min, 25 cycles; at 94
o
C for 15 s, 60
o
C for 30 s, 72
o
C, plus 5 min at 72
o
C per cycle, the last
extension at 72
o
C for 7 min. PCR products were cloned into pGEM-T easy
®
. The sequences were
determined. The second series of iPCR was done based on the obtained sequences. Genomic DNA was
digested using DpnI, and ligated. The primers were Pgt-6f, Pgt-6r for CAGT-A and Pgt-5f2, Pgt-8r for
CAGT B. The last iPCR series was done using the restriction enzyme MseI, and the primers Pgt-6f, Pgt-
7r for CAGT-A and Pgt-9f, Pgt-8r for CAGT B. All PCR products were cloned into pGEM-Teasy
®
and
the sequences determined. (All restriction enzymes were purchased from New Englands Biolabs.)

Table 1. The nucleotide sequences of primers used to amplify the sequence of glucosyltransferases.

Primer Nucleotide sequence Length (bp)
5′ 3′
Pgt-2r1 TAAAGGCCAAGTCACCATCGGCACACCCCGCCGT 35
Pgt-2r2 ACACGCTCTCCAGCGTCGAGTTCCACCCGCAAT 34
Pgt-2r3 ACTCCAACGCATCCATGGCGAAGAATCCTCA 30
Pgt-3f1 TGAGAGTTAAAGTGGGCACCGCAGCTGAGGA 32
Pgt-3f2 CGCCATGGATGCGTTGGAGGGTTCGTGACTCATTGC 36
Pgt-3f3 TGGAACTCGACGCTGGAAGGGGTGAC 27
Pgt-4r1 AGCAAACAATGGCCAGGGCACCATCGGCACCCCGT 35
Pgt-4r2 CAGCGTCGAGTTCCACCCGCAATGAGTCACGAACC 35
Pgt-4r3 TATTGGCGCACAAGGCAGTGGGAGGATTCGTGT 33
Pgt-5f1 ACACGAATCCTCCCACTGCCTTGTGCGCCAATA 34
Pgt-5f2 AGTCGAGGTATTGGCGCACAAGGCAGTGGGAGGA 34
Pgt-5f3 TGGAACTCGACGCTGGAGAGCGTGTGGAAC 30
Pgt-6r GTATTACCAACCCTCTCCCTTCCGTTCTCTCCTCAA 36
Pgt-6f ATGGTGACATGGCCGCTTCAGGCGGATCAA 30
Pgt-7r GATGGAGGAAGCAGAGGAGAGAAGCTA 28
Pgt-8r TGACATTCGCCGGACTTACAGAATTTCACT 30
Pgt-9f TTGTACGCGGAGCAGCAGTGCAATGCGTTTCA 32

Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. coli
77
Results and discussion
The total RNA isolation of the cell suspension cultures of Linum flavum provided high amounts
of RNA. Checking the product by gel electroforesis yielded two intensive bands with the size of 1900
and 4700 bp respectively, probably representing ribosomal RNA. The PCR product of cDNA, using
primers that were designed based on the conserved region of the amino acids, called PSPG box, was 130
bp in length. Sequences of 12 randomly picked clones of this products showed homology with GTs. On
the basis of the sequence they were divided into 3 different candidate groups and called CAGT A, B and
C. The use of the 3′ and the 5′ RACE methods to find the full lengths of CAGT A, B and C did not
provide the expected fragments. Due to these problems, iPCR amplifications were done to find the full
length. This method is a normal PCR that has the primers oriented in the reverse direction of the usual
orientation. iPCR permits the amplification of the regions that flank any DNA segment of known
sequence, either upstream or downstream or both (Ochman et al., 1988). Restriction enzymes that were
used to digest genomic DNA should not cut the internal known sequence. The first iPCR products
extended to 400 bp of CAGT A and 350 bp of CAGT B both at the 5′ end. No extension was found for
CAGT C. These sequenced were extended using a second round of iPCR to 774 for CAGT A and
CAGT B 563 of CAGT B, both the extensions are to the 5′. After the third iPCR the full length of both
CAGT was found with additional upstream and downstream sequences. Start and stop codons were
determined. From the alignment with known GT sequences it can be concluded that CAGT A and
CAGT B do not harbour any intron sequences.
It has been suggested that GTs are highly regiospecific (or regioselective) rather than substrate
specific, e.g. uridine 5

-diphosphoglucose 5-O- and 6-glucosyltransferases. Both GTs catalyze the
transfer of glucose not only to the hydroxyl groups of betanidin but also to those of flavonoids, i.e.
flavonols, anthocyanidins and flavones (Vogt et al., 1997). This was also shown by UGT72E2 from
Arabidopsis thaliana that has broad substrate recognition. It showed activity towards coniferyl alcohol,
sinapyl alcohol, coniferyl aldehyde and sinapyl aldehyde, in contrast to UGT72E1 that is highly specific
to coniferyl aldehyde and sinapyl aldehyde (Lim et al., 2005). Phylogentic analysis (Fig. 4) using
MegAlign software from DNASTAR showed that CAGT A belongs to group E of glucosyltransferase
family 1. Most of GTs from this group have substrate specificity on phenylpropanoid compounds. It
indicates that CAGT A may be active to phenylpropanoid compounds. Based on the enrichment of
mRNA and the phylogenetic analysis, we conclude that CAGT A may be coniferyl alcohol
glucosyltransferase. Expression experiments are needed to confirm this.




















Cnap|cr 7
78
1 atggagcact cacagcagct tcacgtcgtc tttctcccgt acatggcgca cggccacatg
m e h s q q l h v v f l p y m a h g h m 20
61 acccccttcg ccgacatggc aagactcttc gcccgccacg gcgccaagtc gaccatcatc
t p f a d m a r l f a r h g a k s t i i 40
121 accactcccc tcaacgcccc tttcttctcc ggcaagatcc tcgccgacgt tcaacaacta
t t p l n a p f f s g k i l a d v q q l 60
181 ggccttcaaa tccgaatcca catcgtcgac ttcccttccg ccgccgccgg cctccccgaa
g l q i r i h i v d f p s a a a g l p e 80
241 ggctgtgaga acgtccgctc cgctatccaa tcccctgacg ccggccacga catcttcttc
g c e n v r s a i q s p d a g h d i f f 100
301 aaattcataa cctccatgga ccatttccag cgcccggtgg aggagctcct ccagcagtgg
k f i t s m d h f q r p v e e l l q q w 120
361 cggcggactg catcgtcgcc gacttcgtct tccactgggc tgaccgaatc agcccgccgg
r r t a s s p t s s s t g l t e s a r r 140
421 ctcggcatcc cgaggctcta cttcaacggg atggggacgc tcgccatgtg ttgtacaatt
l g i p r l y f n g m g t l a m c c t i 160
481 gcctcaaacg ctaccagcct cacaaaaacc gtggactccg attccgagcc acgttctcgt
a s n a t s l t k t v d s d s e p r s r 180
541 cccccggggc cggggctttg gcagacggaa agaatacccg ggtttcacgc cggcgaggct
p p g p g l w q t e r i p g f h a g e a 200
601 gtcgagttca acaagcagct gcagcggatg gaggaagcag aggagagaag ctacggaact
v e f n k q l q r m e e a e e r s y g t 220
661 ctggtgaaca gcttcctcga gctcgaacct gggtatccgg agtatttcag gaaagtgatg
l v n s f l e l e p g y p e y f r k v m 240
721 gggagaaggg cgtggttcgt cggtcctctg ttgctctgca acaaggacct gcaacaagga
g r r a w f v g p l l l c n k d l q q g 260
781 cggggaaggg gaatctgccg ccattgttgt acacgaatgc ctaaatggct cgactcgaag
r g r g i c r h c c t r m p k w l d s k 280
841 aaactggcca attcagtcat ctacatatgc ttcggcagcg aggctgtctt ctctgctgcg
k l a n s v i y i c f g s e a v f s a a 300
901 cagttaaacg agatcgctgc agctctggcg gaatcggagc agagcttcat ctgggtagtg
q l n e i a a a l a e s e q s f i w v v 320
961 aaggaagaat cgctgccgga agggtttgag gagagaacgg aagggagagg gttggtaata
k e e s l p e g f e e r t e g r g l v i 340
1021 cggggatggg caccccagct gaggattctt cgccatggat gcgttggagg gttcgtgact
r g w a p q l r i l r h g c v g g f v t 360
1081 cattgcgggt ggaactcgac gctggaaggg gtgacggcgg gggtgccgat ggtgacatgg
h c g w n s t l e g v t a g v p m v t w 380
1141 ccgcttcagg cggatcaatt cgcaaacgag aagttggtga cggaggttct gaagatcggg
p l q a d q f a n e k l v t e v l k i g 400
1201 gtcggagtcg gagctgagga atggtcgacg ggcgagagga ggatcgtggt gggaagggaa
v g v g a e e w s t g e r r i v v g r e 420
1261 ggtataaaga gtgcggtaag ccgggtgatg gttggtgcag agggtggaga gatgaggggc
g i k s a v s r v m v g a e g g e m r g 440
1321 agagttaagg agcttgcaga aagggctgcc atggcgatgg attaa
r v k e l a e r a a m a m d - 460

Fig. 2. Nucleotide and deduced amino acid sequences of CAGT A of Linum flavum cell suspension cultures. The nucleotide
sequence is numbered on the left. The amino acid sequence is given in the single-letter code and is numbered on the right.










Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. coli
79
1 atgaaccaga cagttcatct agctttcgtc ccggctcccg gaatcggcca tctcgtctcc
m n q t v h l a f v p a p g i g h l v s 20
61 acaatcgaat tcgcccgccg cttgctccgc cgcgacacca ccatctccgt cctcatcctc
t i e f a r r l l r r d t t i s v l i l 40
121 ctcatcaagt tcccgccgcc gttcggcgac gacatcgaca gcttcgtcaa atcaatttcc
l i k f p p p f g d d i d s f v k s i s 60
181 ggcgaggacg atgaagatca ccgccgcgtc gaattcgtca ctctccccca actactcccc
g e d d e d h r r v e f v t l p q l l p 80
241 cctgcttcct cctcctccgc tggagattct tccaaatcgc cggaggcttt cgtcacacag
p a s s s s a g d s s k s p e a f v t q 100
301 gccgctagtc aaagaagcaa ttgtaaaccc tgctctgccc cggtcaccgg tctggtcgtt
a a s q r s n c k p c s a p v t g l v v 120
361 gacttgttct gtacttccat gatcgacgtc gccgacgagc taggaatccc ttcctacatc
d l f c t s m i d v a d e l g i p s y i 140
421 ttcttcactt cctcaattgc gtttctaggg ttcatgctct acctcccgac ccgccacgac
f f t s s i a f l g f m l y l p t r h d 160
481 cgggtcggat ctgtattcga gctgaccgac gacccggtgc cggtgcccag ctactccgac
r v g s v f e l t d d p v p v p s y s d 180
541 ccgtttcctt ctcgggtcct gccgtccgtc ttcctcaaca agcacggcgg gtacacgacg
p f p s r v l p s v f l n k h g g y t t 200
601 atgatgaacc acggccggag attctcggaa gctaagggca taatcgtcaa ttcatttgcc
m m n h g r r f s e a k g i i v n s f a 220
661 gagctggagc cgtacgcttt gaaatcactg atctcctcct cgtttactct gccgccgccg
e l e p y a l k s l i s s s f t l p p p 240
721 ccggtctacg ccccgattct ggatttgaag gctcaggggc aagtgaaatt ctgtaagtcc
p v y a p i l d l k a q g q v k f c k s 260
781 ggcgaatgtc aggagatcgt gaggtggctg gacggtcagc cggaggagtc ggtgatcttc
g e c q e i v r w l d g q p e e s v i f 280
841 ctctgcttcg ggagcatggg agctttcgag aaggatcaat tgagggaaat cgctacaggg
l c f g s m g a f e k d q l r e i a t g 300
901 ctggagcgga gtggctgccg gttcctctgg tcgatccgga aacctcctcc ggcggaagag
l e r s g c r f l w s i r k p p p a e e 320
961 ttctcgatgc cggcggatta tggagggagt tacggggaga tcttgccgga agggtttgag
f s m p a d y g g s y g e i l p e g f e 340
1021 gacaggacga gagggttggg tttgatctgc aaatggcgcc gcaagtcgag agtcgaggta
d r t r g l g l i c k w r r k s r v e v 360
1081 ttggcgcaca aggcagtggg aggattcgtg tcgcattgcg ggtggaactc gacgctggag
l a h k a v g g f v s h c g w n s t l e 380
1141 agcgtgtgga acggggtgcc gatggtggcg tggcctgttg tacgctggat gcagcagtgc
s v w n g v p m v a w p v v r w m q q c 400
1201 aatgcgtttc agctggctga gtggagctgg tgtgctggct gggtggatgc tgagtgctgg
n a f q l a e w s w c a g w v d a e c w 420
1261 actaccggat taagatgggc ggagtatgaa gaagcaggag acggcgtgag tgaggagttg
t t g l r w a e y e e a g d g v s e e l 440
1321 tttactggcg gagtgagatt gagaaggcct gtaaaatgtg tgatggatag gggaagcgcg
f t g g v r l r r p v k c v m d r g s a 460
1381 gtgaggaaga gggcgaagga gatgggctga
v r k r a k e m g - 469

Fig. 3. Nucleotide and deduced amino acid sequences of CAGT B of Linum flavum cell suspension cultures. The nucleotide
sequence is numbered on the left. The amino acid sequence is given in the single-letter code and is numbered on the right.






Cnap|cr 7
80













AB070753 Vigna angularis
AB176523 Nicotiana tabacum
AY345975 Stevia rebaudiana
AC013430 Arabidopsis thaliana
AC006551 Arabidopsis thaliana
AB191249 Dianthus caryophyllus (chalcon)
AB017060 Arabidopsis thaliana
AC008153 Arabidopsis thaliana
AB025604 Arabidopsis thaliana
AC006922 Arabidopsis thaliana
AC005851 Arabidopsis thaliana
AB047095 Vitis vinifera (flavonoid)
AY695816. Fragaria x ananas (flavonoid)
AC009917 Arabidopsis thaliana
NM_190981 Oryza sativa
NM_196703 Oryza sativa
AF331854 Zea mays
AF503433 Sorghum bicolor
AF303396 Phaseolus vulgaris
AC011664 Arabidopsis thaliana
AC004165 Arabidopsis thaliana
AC004165.2 Arabidopsis thaliana
AP003232 Oryza sativa
AY663786. Fragaria x ananas
DQ289587. Fragaria x ananas
AB072918 Nicotiana tabacum
AY345976. Stevia rebaudiana
AB025634 Arabidopsis thaliana
CAGT B Linum flavum
AL049862 Arabidopsis thaliana
AY345983 Stevia rebaudiana
AC016662 Arabidopsis thaliana
AB182387 Solanum aculeatissimum
AP000373 Arabidopsis thaliana
AF190634 Nicotiana tabacum (salicylic acid)
AJ889012 Lycopersicum esculentum (phenolic)
AY345982 Stevia rebaudiana
AC002396 Arabidopsis thaliana
AC002333 Arabidopsis thaliana
AC006533 Arabidopsis thaliana
AC007153 Arabidopsis thaliana
AF287143 Brassica napus (sinapate)
AM231594 Brassica napus (hydroxycinnamate)
AC005106 Arabidopsis thaliana
AF346431 Nicotiana tabacum (phenylpropanoid)
U32644 Nicotiana tabacum (salicylate)
AF346432 Nicotiana tabacum (phenylpropanoid)
U32643 Nicotiana tabacum (salicylate)
AL021961 Arabisopsis thaliana
CAGT A Linum flavum
AC006282 Arabidopsis thaliana
AC005167 Arabidopsis thaliana
AC005489 Arabidopsis thaliana
XM_450574 Oryza sativa (betanidin)
AB018115 Arabidopsis thaliana
AL035602 Arabidopsis thaliana
AB192315 Ipomoea purpurea (antochyanin)
AC006340 Arabidopsis thaliana
Group A
Group B
Group C
Group D
Group E
Group F
Group G
Group H
Group I
Group J
Group L
Group K
Fig. 4. Phylogenetic analysis of CAGT A, B and other plant glucosyltransferases. Grouping is based on phylogenetic analysis
of Arabidopsis thaliana which showed 12 distinct groups. Each glucosyltransferase contains accession number, plant name
and substrate (in the bracket, if any).
Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. coli
81
Acknowledgement
The research was supported by the QUE Project Batch II, Department of Biology Institut
Teknologi Bandung ITB, Indonesia, under the contract No. 3028-IX/P3S-1/KON-QUE II/2000, IBRD
LOAN No. 4193 – IND.

82

83


Chapter 8





Production of a cytotoxic arylnaphthalene lignan using
genetically transformed root cultures of Linum leonii









Nikolay Vasilev, Elfahmi, Rein Bos, Oliver Kayser, Georgi Momekov, Spiro Konstantinov, Herman J.
Woerdenbag, Wim J. Quax, Iliana Ionkova

This chapter is based on Journal of Natural Products, in press (2006)
Cnap|cr 8
84
Abstract
Callus and hairy roots cultures of Linum leonii F.W. Schulz. were established. The genetic
transformation in hairy roots was proven by PCR analysis, which showed integration of rol A and rol C
genes into the plant genome. Callus and hairy roots accumulated the arylnaphthalene lignan justicidin B
as a major constituent. Hairy roots produced 5-fold higher yields of justicidin B (10.8 mg g
-1
DW)
compared to callus. Justicidin B demonstrated strong cytotoxicity to the chronic leukemic cell lines
LAMA-8, K-562 and SKW-3 with IC
50
values of 1.1, 6.1 and 1.6 µM, respectively. Apoptotic properties
of justicidin B were reported for the first time.
|ignan prcduc|icn cf gcnc|ica||u |ransfcrncd rcc| cu||urcs cf |inun |ccnii
85
Introduction
Justicidin B is an arylnaphthalene lignan which exerts cytotoxic (Joseph et al., 1988, MacRae et
al., 1989), antiviral (Gertsch et al., 2003), fungicidal, antiprotozoal (Chen et al. 1996) and antiplatelet
properties (Baba et al., 1996). Several tumor types including sarcomas and breast, prostate, and lung
carcinomas grow in or preferentially metastasize the skeleton where they proliferate, and induce
significant bone remodelling, bone destruction, and cancer pain (Mohagheghzadeh et al., 2002). Thus,
justicidin B may have significant clinical utility as a lead compound in the management of bone cancer
and osteoclastogenesis, due to its cytotoxic and bone resorption inhibitory properties. The potent bone
resorption inhibitor justicidin B was used as a lead compound for design of new antirheumatic drugs
(Sabino et al., 2002).
Justicidin B was first isolated from Justicia spp. (Acanthaceae) and Haplophyllum spp.
(Rutaceae) (Okigawa et al., 1970, Pettit and Schaufelberger, 1988). Justicidin B has further been isolated
from different Phyllanthus species (Euphorbiaceae) (Bachmann et al., 1993). It was shown that cell
cultures of Linum austriacum produce justicidin B, which is the first report on the existence of
arylnaphthalene lignans in a species of the Linaceae (Mohagheghzadeh et al., 2002). Since there is a
growing interest in justicidin B due to its various pharmacological effects, the sustainable
biotechnological supply of this valuable lignan would be a feasible alternative.
Our preliminary experiments exhibited that justicidin B is the main cytotoxic principle in the
methanolic extract of callus of Linum leonii F.W. Schulz. (Linaceae) (Vasilev and Ionkova, 2005).
Therefore, we decided to establish hairy roots from this species in hope of produce justicidin B in high
yields. This paper describes the isolation, structure elucidation and cytotoxic evaluation of the major
lignan produced by conventional and genetically transformed cultures of L. leonii.


H
3
CO
H
3
CO
O
O
O
O
1'
2 '
3 '
4'
5 '
6 '
7'
7
1
2
2
3
4
5
8 '
8


Fig. 1. Chemical structure of justicidin B.


Material and methods
General experimental procedures
NMR spectra measurements were carried out on a Bruker WM 400 (400 MHz) and a Bruker
DRX 500 (500 MHz) spectrometer in CDCl
3
. TMS was used as an internal standard. GC analysis was
performed on a Hewlett Packard 5890 series II gas chromatograph equipped with a 7673 autosampler,
and a Hewlett Packard 3365 Chemstation software A10.02 under the following conditions: column:
WCOT fused silica CPsil 5 CB lowbleed/MS, # CP7810; 15 m x 0.25 mm ID; film thickness 0.10 µm;
(Varian Middelburg, The Netherlands); temperature program: 150°C – 320°C at 15°C min
-1
injector
temperature 250ºC; detector (FID) temperature 300ºC; carrier gas: helium; inlet pressure 125 kPa; linear
gas velocity 40 cm s
-1
; split ratio 100:1; injected volume 1 µL. GC-MS analysis was performed on a
Cnap|cr 8
86
Shimadzu QP5000 GC-MS system equipped with a 17A GC, an AOC-20i autoinjector, and the GC-MS
solution software 1.10. GC conditions: WCOT fused silica CPsil 5 CB lowbleed/MS, # CP7810, film
thickness 0.10 µm; 15 m x 0.25 mm ID (Varian Middelburg, The Netherlands). Temperature program:
150°C – 320°C at 15 °C min
-1
. Injector temp.: 275°C; inlet pressure: 75 kPa; column flow: 2.1 mL min
-
1
: linear velocity: 75.5 cm sec
-1
; split ratio: 20:1; total flow: 46.2 mL min
-1
; carrier flow (He): 46.2 mL
min
-1
; injection volume: 2 µL. temperature program 35 min at 90°C, 90-170 °C at 4°C min
-1
. MS
conditions: ionization energy, 70 eV; ion source temperature, 250°C; interface temperature, 250°C; scan
speed, 2 scans s
-1
; mass range, 34-600 u

Plant material
The seeds of Linum leonii F.W. Schulz. (Linaceae) were a kind gift (No 1636; No com.
253/1999) from the botanical garden Nancy (France). Callus cultures were initiated and grown as
described previously (Vasilev and Ionkova, 2005). Hairy roots were induced by direct incubation of
segments from sterile grown plants with Agrobacterium rhizogenes strain ATCC 15834 cultured in
YMB medium in the presence of 20 µM acetosyringone for 2 days in the dark, which increased
susceptibility toward infection. The fast growing hairy roots were further maintained under permanent
dark on a rotary shaker (80 rpm) and refreshed by a new medium every two weeks. Hairy root cultures
were maintained at 25 ± 1 °C as described in Mohagheghzadeh et al. (2002).

DNA analysis
DNA isolation was conducted from the dry plant material of the intake plant, calli and hairy
roots according to a protocol for rapid isolation from dry and fresh samples (Khanuja et al., 1999). The
isolation of DNA of A. rhizogenes ATCC 15834 was performed following the instructions of Qiaprep
spin miniprep kit from Qiagen (Westburg, BV, Leusden, The Netherlands). The integration of rol A and
rol C genes from A. rhizogenes into the plant genome, which is the genetic evidence for hairy roots
transformation, was proven by PCR reaction. Therefore the following specific primers were designed
(Nader et al., 2004): for rol A gene, nucleotide positions 21-42 (5’-CGTTGTCGGAAT-
GGCCCAGACC-3’) and 268-246 (5’-CGTAGGTCTGAATAT-TCCGGTCC-3’), totally 248 bp; for rol
C gene, positions 51-70 (5’-TGTGA-CAAGCAGCGATGAGC-3’) and 550-531 (5’-
GATTGCAAACTTGCACTCGC-3’), a fragment of 490 bp totally. Vir D2 gene is not involved in the
plant genome during the transformation. The specific primers for the detection of vir D2 are: primer A
(5’-ATGCCCGATCGAGCTCAAGT-3’) and primer E (5’-CCTGACCCAAACATCTCG-
GCTGCCCA-3’), ending in a fragment of 338 bp (Hass et al., 1995). All PCR reactions were performed
in a Mastercycler® gradient thermocycler (Eppendorf) with recombinant taq DNA polymerase
(Fermentas GMBH, St. Leon-Rot, Germany). The PCR program was 5 min at 95°C, 35 cycles of 30 s at
95°C, 40 s at 50°C, 2 min at 72°C and a final step of 5 min at 72°C.

Extraction, isolation and quantification
Air-dried plant material from hairy roots (10 g) was extracted with 80% MeOH (200 mL for 1 h
sonification at 25ºC). The extract was separated with 3 x 200 mL dichloromethane. Dichloromethane
layers were filtered (Na
2
SO
4
was used as a drying agent), combined, concentrated under reduced
pressure at 50ºC, dried and kept at -20ºC. The initial amount of hairy roots yielded 780 mg dry
dichloromethane extract. The dichloromethane extract was subjected to preparative TLC separation
using silica gel 60 F254 (Merck): 10 x 20 cm, 2 mm, toluene: acetone 10:1, development length: 9 cm
and ì = 254 nm. The most abundant fraction (R
f
= 0.45) was pooled and evaporated to dryness
consequently. The residue was further purified by recrystallisation in cold MeOH to yield 3.1 mg
justicidin B. Quantitative determination of justicidin B in callus and hairy roots was performed by GC
|ignan prcduc|icn cf gcnc|ica||u |ransfcrncd rcc| cu||urcs cf |inun |ccnii
87
analysis as described by Koulman et al. (2001). Cinchonidine was used as an internal standard. The
response factor (RF) was calculated using 3 concentration ratios (3:1, 1:1, 1:3) between justicidin B and
cinchonidine; RF=1.80 (CV=1.11%, n=5). The limit of detection (LOD) was established as the amount
of analyte that provided a signal-to-noise ratio of 3. LOD was 0.1 µg mL
-1
. The limit of quantification
(LLOQ) was defined as the lowest calibration standard that could be quantified with an accuracy of 90-
110% and a precision of 15%. LLOQ of justicidin B was 1 µg mL
-1
. Intraday (n=6) and interday (n=5)
coefficients of variations (CV) were determined. Intra-day CV from callus and hairy roots
determinations are 7.4 and 4.9% respectively, and inter-day variations for callus and hairy roots analyses
are 1.8 and 3.4% respectively.

Leukemic cell lines and culture conditions
The three leukemic cell lines LAMA-84, K-562 and SKW-3 were supplied from the German
Collection of Microorganisms and Cell Cultures (DSMZ). The culture conditions are as previously
described (Vasilev et al., 2005).

Cytotoxicity assay
The MTT-dye reduction assay was carried out as described by Mossmann (1983) with some
modifications (Konstantinov, 1999). The clinically applied epipodophyllotoxin derivative etoposide was
used as reference cytotoxic drug. Briefly, 100 µL aliquots of cell suspension (1×10
5
cells mL
-1
) were
seeded in 96-well microplates. Following 24 h incubation at 37°C the cells were exposed to the newly
isolated lignan or to etoposide for 72 h. After the incubation period MTT solution (10 mg mL
-1
in PBS)
was added (10 µL/well) and the plates were further incubated for 4 h at 37°C. Thereafter the formazan
crystals formed were dissolved through addition of 100 µL/well 5% formic acid in 2-propanol (Merck)
and the absorption of the samples was measured with an ELISA reader (Uniscan Titertec) at 580 nm.
100 µL RPMI 1640 medium (Sigma), 10 µL MTT stock and 100 µL 5% formic acid in 2-propanol
served as a blank solution. The results were expressed as survival fraction (% of untreated control). All
values were expressed as the mean ± SD (n=8). The data processing included the Student`s t-test with P
≤ 0.05 taken as significance level, using Microsoft EXCEL and OriginPlot software for PC.

Apoptosis assay
The DNA extraction and horizontal gel electrophoresis procedures were performed as previously
described (Vasilev et al., 2005). About 5×10
6
SKW-3 cells – treated with justicidin B (at 0.25 or 0.5
µM) and untreated controls, were washed in PBS and spun at 1,800 x g for 5 min. The cell pellets were
resuspended in 0.25 mL PBS and lysed through addition of 0.5 mL buffer containing 0.5% Triton X-
100, 20 mM Tris-HCl and 1mM EDTA (pH = 7.4). Samples were incubated at 0°C (on ice) for 5 min
and thereafter spun at 11,000 x g for 20 min. The supernatants were transferred into 2 mL ‘safe lock’
test tubes and then 0.937 mL 2-propanol as well as 0.187 mL 6 M solution of NaCl was added to each
sample. The tubes were gently agitated and incubated at –20°C for 12 h in order to allow precipitation of
the hydrophilic DNA. The samples were centrifuged for 20 min at 11,000 g, the supernatants were
decanted and DNA was washed in 1 mL ice cold 70% ethanol and then air dried. The isolated DNA was
redissolved in 20 µL distilled water and analyzed by gel electrophoresis in 0.8% agarose gel. Finally
DNA was stained with ethidium bromide and visualized using an UV transilluminator and photographed
with a fixed digital camera (Bio Doc ITTM system).


Cnap|cr 8
88
Results and discussion
Callus cultures were developed as previously described (Vasilev et al., 2005). The genetically
modified cultures demonstrated typical hairy roots phenotype: intensive branching, hormone autotrophy
and lack of geotropism. The most vigorous growth was observed when the bacterial growth stopped and
there was no further necessity of antibiotic.
To our knowledge, no reports on the induction of hairy roots from L. leonii have been published
till now. We performed DNA analysis in order to confirm the hairy roots transformation. The TL region
in plasmid T-DNA of the agropine-type strain A. rhizogenes 15834 contains 18 open reading frames
including several loci called rol (root loci). The products encoded by rol A and rol C genes were found
to have a synergistic effect on root induction and induce increased sensitivity to auxin (Slightom et al.,
1996, Day et al., 1999). PCR analysis showed that hairy roots from L. leonii contain rol C and rol A
genes (Fig. 2, lanes 3 and 4) corresponding to the positive controls obtained by DNA from A. rhizogenes
ATCC 15834 (lanes 7 and 6). Untransformed callus served as a negative control (lane 2). Vir D2 was
not detected in the hairy roots (lane 5), thus showing that T-DNA is incorporated in the plant genome
and it is not a residual bacterial contamination.













Fig. 2. PCR analysis of L. leonii roots transformed by A. rhizogenes ATCC15834. Lane 1 – DNA marker; lane 2 –
untransformed L. leonii plantlets; lanes 3 and 4 – DNA from L. leonii hairy roots in which rol C of 490 bp and rol A of 248
bp integration was positive; lane 5 – DNA from hairy roots not expressing vir D2; lanes 6, 7 and 8 – positives controls of A.
rhizogenes DNA showing roal A, rol C, and vir D2 (338 bp) respectively.

We undertook isolation and identification of the main component in hairy roots of L. leonii by
preparative TLC and subsequent recrystallisation in cold MeOH. This isolate was analyzed by means of
GC-MS and NMR. The EI-MS of the isolated compound showed a m/e value of 364 and mass
fragmentation, that is consistent with the data for an arylnaphthalene lignan (Okigawa et al., 1970).
Further NMR experiments were performed in order to distinguish between justicidin B and isojusticidin
B as these two isomers have no different MS fragmentation pattern. A closer look at the
1
H NMR
spectrum showed that the proton signals at o 7.12 ppm and o 7.05 ppm appeared as singlets, which is
indicative for 4,5-substitution (Okigawa et al., 1970). Therefore the resonance signals at o 7.12 ppm and
o 7.05 ppm were assigned to H-6 and H-3 respectively, due to the shielding effect of the piperonyl group
on H-3. Thus the isolated compound was unambiguously identified as justicidin B. The
1
H NMR data is
in full agreement with a previous report of justicidin B (Pettit and Schaufelberger, 1988).
Callus and hairy roots of L. leonii retained the capability to produce justicidin B. This finding
supports the hypothesis that arylnaphthalene lignans are characteristic of the section Linum. Hairy roots
accumulated 5 times higher amounts of justicidin B (10.8 mg g
-1
DW) than the conventional cultures of
callus (Table 1). The content of justicidin B in L. leonii hairy roots after 14 days period is very close to
1 2 3 4 5 6 7 8
500 bp
100 bp
|ignan prcduc|icn cf gcnc|ica||u |ransfcrncd rcc| cu||urcs cf |inun |ccnii
89
justicidin B levels produced for 30 days in normal root cultures and transformed roots of L. austriacum:
12.5 and 16.9 mg g
-1
DW, respectively (Mohagheghzadeh et al., 2002). However, hairy roots from L.
leonii produced lower amount of justicidin B, compared to the highest yields in intact plants: 3-4 % in P.
piscatorum (Gertsch et al., 2003). Therefore further optimization of hairy roots cultures is needed to
compete with the levels of justicidin B produced by intact plant.

Table 1. Content of justicidin B in cell cultures.

Variation
(CV %)
Culture type
Justicidin B
(mg g
-1
DW) Intraday
(n=6)
Interday
(n=5)
Callus 2.01 7.4 1.8
Hairy roots 10.8 4.9 3.4

In addition to the current data, we underwent further cytotoxicity examination of justicidin B on
three chronic myeloid leukemia-derived cell lines, LAMA-84, K-562 and SKW-3, that show a lower
responsiveness to cytotoxic drugs due to the strong expression of the fusion oncoprotein BCR-ABL (a
non-receptor tyrosine kinase). The IC
50
values of screened leukemic cell lines were determined (Table
2). As evident from the presented results (Fig. 3) both compounds caused concentration-dependent
cytotoxic effects in the panel of human tumor cell lines under investigation. Justicidin B proved to be
slightly less active in respect to relative potency. At the higher concentrations (10 µM), however, it
inhibited the proliferation of malignant cells at the same extend as the referent drug etoposide.
The electrophoretic analysis of DNA, isolated from the cytosolic fraction of SKW-3 after 24 h
treatment cells with 0.5 and 0.25 µM justicidin B evoked oligonucleosomal DNA fragmentation (Fig. 4).
The observed DNA laddering is a consequence of the action of specific nucleases which degrade the
higher order chromatin structure during the apoptotic process. Therefore it is firmly established that the
primary cytotoxic effect of justicidin B is mediated by activation of the programmed cell death
pathways.
Hairy roots of L. leonii demonstrated a high biosynthetic capacity. The major active constituent
justicidin B can be easily isolated in reasonable amounts from the genetically transformed root cultures.
To our knowledge this is the first report of justicidin B isolated from the hairy roots of L. leonii as well
as the first report on the apoptotic properties of this valuable arylnaphthalene lignan. Therefore
optimization of L. leonii hairy roots is worthy of further consideration as an alternative production
system of justicidin B, which is used as a template for the development of potential new therapeutic
agents.

Table 2. Relative potency of justicidin B and etoposide.

IC
50
value (µM) Cell line

Cell type
Justicidin B Etoposide
LAMA-84 chronic myeoid leukemia 1.1 0.8
K-562 pre-B-cell lymphoma 6.1 1.9
SKW-3 chronic lymphoid leukemia 1.6 0.8






Cnap|cr 8
90












A
0 5 10 15 20
0
20
40
60
80
100
%

o
f

u
n
t
r
e
a
t
e
d

c
o
n
t
r
o
l
concentration (µM)

B


0 5 10 15 20
0
20
40
60
80
100
%

o
f

u
n
t
r
e
a
t
e
d

c
o
n
t
r
o
l
concentration (µM)

C

Fig. 3. Concentration response curves for justicidin B (ø) and etoposide (A) following 72 h treatment of LAMA-84 (A), K-
562 (B) and SKW-3 (C), as assessed by the MTT-dye reduction assay. Each data point represents the arithmetic mean of at
least 8 independent experiments. The error bars indicate the corresponding standard deviation.


0 5 10 15 20
0
20
40
60
80
100
%

o
f

u
n
t
r
e
a
t
e
d

c
o
n
t
r
o
l
concentration (µM)
|ignan prcduc|icn cf gcnc|ica||u |ransfcrncd rcc| cu||urcs cf |inun |ccnii
91
1 2 3


Fig. 4. Imaging of DNA laddering induced by justicidin B treatment. DNA was extracted from the cytosolic fraction of
untreated 5×10
6
SKW-3 cells (1) or following 24 h exposure to justicidin B at 0.25 µM (2) or 0.5 µM (3).

Acknowledgements
The authors thank T. Hackl, Institut für Organische Chemie, Universität Hamburg, for recording
NMR spectra. The financial support by the Huygens Program for N. Vasilev is gratefully acknowledged.

92


93


Summary and concluding remarks

94
Summary and concluding remarks
In this thesis phytochemical and biosynthetic studies of lignans are described. The focus is on the
Indonesian medicinal plants Phyllanthus niruri and Piper cubeba and on two Linum species, Linum
flavum and L. leonii, native to European countries.
Both Indonesian plants are used in jamu. Jamu is the Indonesian traditional herbal medicine,
practised for many centuries in the Indonesian community to maintain good health and to treat diseases.
The manufacturing of jamu is shifting more and more from household scale to the bigger industries. As
the economical and clinical value of jamu nowadays increases in Indonesia, there is a need for further
scientific proof and well conducted research. Jamu has to be developed in order to assure its efficacy
and safety.
Chapter 2 reviews the research carried out on jamu and jamu plants, covering a broad range of
aspects including phytochemistry, pharmacology, toxicologicy and clinical studies. In addition, ethical
issues such intellectual property right (IPR), benefit sharing, and conservation are addressed.
Phyllanthus niruri is an important medicinal plant for jamu. All parts of the plant are used,
among others to treat gonorrhea, syphilis, nephralgia, diarrhea, fever, and tetanus. The leaves serve to
treat epilepsy, malaria, constipation, hypertension, and menstrual disorders. Lignans seem to be an
important group of secondary metabolites, responsible for the biological activity of P. niruri. We
initiated cell cultures of P. niruri that were able to produce lignans. The lignan profiles of cell
suspensions, callus cultures, aerial plant parts, roots and seeds were compared and significant
differences, both qualitatively and quantitatively, were found (chapter 3). Two compounds that were not
found in P. niruri before were isolated from the cell suspension cultures: a new dihydrocubebin-
dimethylether and urinatetralin, a new lignan from P. niruri, but reported earlier from P. urinaria.
Feeding 0.5 mM of ferulic acid or 0.5 mM of caffeic acid, being early precursors of lignan biosynthesis,
resulted in an increase up to 0.7 mg g
-1
DW of the dihydrocubebin-dimethylether (control value 0.1 mg
g
-1
DW) and up to 0.3 mg g
-1
DW of urinatetralin (control value 0.2 mg g
-1
DW) in the suspension
cultures.
Lignans are also found in another important medicinal plant for jamu, Piper cubeba. The berries
of this plant are used to treat gonorrhea, dysentery, syphilis, abdominal pain, diarrhea, enteritis and
asthma. The lignan profile of berries (the particular plant part used in jamu), leaves and stalks were
investigated and compared using gas chromatography (GC), gas chromatography coupled to mass
spectrometry (GC-MS), and high pressure liquid chromatography (HPLC) (chapter 4). Thirteen lignans
were identified in the berries, fifteen in the leaves and five in the stalks.
Our further phytochemical investigation of P. cubeba berries and leaves focused on the essential
oil composition (chapter 5). The essential oil of the berries is commonly used as a constituent of
cosmetics as well as for medicinal purposes. Antimicrobial, antiherpes simplex, antifungal,
cardiovascular, and gastroprotective are mentioned in the latter context. Hydrodistillation of the berries
of P. cubeba yielded 11.8% (w/w) and the leaves 0.9% (v/w) oil. In total 105 components could be
identified (GC, GC-MS) in the berries, dealing with 63.1% of the oil. In the leaves, 63 components
could be identified, corresponding with 78.0% of the oil. The total amount of monoterpenes was
comparable in both oils (17.2% and 17.0%, for berries and leaves, respectively). The main
monoterpenes in the berries and leaves oil were u-thujene, u-pinene, sabinene, and limonene. In the
oxygenated monoterpene fractions trans-sabinene hydrate was the main component. u-Copaene, þ-
elemene, E-caryophyllene, and caryophyllene were the main sesquiterpenes in the berries oil. E-
caryophyllene, and v-cadinene were the main sesquiterpenes in the leaves oil.
Based on the similarity of the lignan and essential oil profiles we conclude that, in addition to the
berries, also the leaves may be used for medicinal purposes. This knowledge can be used for the further
development of (rationally designed) phytomedicines from P. cubeba.
Sunnaru and ccnc|uding rcnar|s
95
Studies on the lignan biosynthesis were performed with the European plant, Linum flavum. L.
flavum cell cultures accumulate a high amount of coniferin (12% on a dry weight basis). Cell suspension
cultures of leaves from this plant were treated with glucosyltransferase inhibitors in order to enhance the
production of the lignan 6-methoxypodophyllotoxin (6-MPT) and to reduce the coniferin production
(chapter 6). These two compounds originate from the common precursor coniferyl alcohol by different
biosynthetic branches. Enzymatic transformation of this substrate by coniferyl alcohol
glucosyltransferase (CAGT) yields coniferin. It was hypothized that by inhibiting this step more
precursor would be available for the biosynthetic branch leading to the formation of lignans. Na
2
EDTA
inhibited the production of coniferin up to 88% and on the other hand enhanced of the 6-MPT
production up to 0.6 mg g
-1
DW, 3.2-fold more than in untreated cultures. The inhibition of the coniferin
production related to an inhibition of the CAGT activity, as shown in cell homogenates incubated with
coniferyl alcohol. This indicates that Na
2
EDTA inhibits CAGT and therefore reduces the production of
coniferin. The mechanism of inhibition is not clear as yet. To further study the role of CAGT in the
biosynthesis of lignans, we partially purified this enzyme from cell suspension cultures of L. flavum. A
complete purification of CAGT, however, appeared to be impossible because of its unstable nature.
We tried to clone the CAGT from cell suspension cultures of L. flavum in Escherichia coli
(chapter 7). The total RNA isolation revealed that the quality of RNA was sufficient to synthesize the
cDNA. A forward and a reverse degenerated primer were designed based on the most conserved region
of 100 glucosyltransferases from various species. These glucosyltransferases were aligned using
MegAline software from DNASTAR Inc. The conserved region, called the PSPG box, is highly
characteristic and present in all GTs involved in natural product biosynthesis. This domain may also
define the active site of GTs of animals and microorganisms. The PSPG box is considered to represent
the nucleotide diphosphate binding site. Several GT-encoding genes are suitable candidates to be
inserted into a variety of plants with the aim of improving food, crop quality as well understanding the
biosynthesis of valuable natural products for medicine.
Three different potential GTs were cloned from cell suspension cultures of L. flavum in E. coli.
The gene sequence of three different products was elucidated. Two of them were complete sequences
(ORF): CAGT A and CAGT B. We were able to find the conserved region (PSPG box) for the third one.
Alignment of CAGT A and B with the sequences from the plant GTs obtained from databases showed
50% and 40% homology, repectively. The conserved region (PSPG box) of CAGT A and B showed
80% and 89% homology respectively. Phylogenetic analysis revealed that CAGT A and B belong to the
same subfamily together with other phenylpropanoid glucosyltransferases. Although the expression of
these GTs is not yet finished, it may be concluded that at least one of the two CAGT is involved in the
biosynthetic step from coniferyl alcohol to coniferin in L. flavum cell suspension cultures.
In chapter 8, we describe the production of justicidin B, a cytotoxic aryltetraline lignan in cell
and hairy root cultures of Linum leonii. The hairy root cultures were obatained by genetic transformation
using the agropine-type strain Agrobacterium rhizogenes 15834. The products encoded by rol A and rol
C genes were found to have a synergistic effect on root induction and to induce increased sensitivity to
auxin. The transformation of these genes from A. rhizogenes into the hairy root was checked by PCR
(polymerase chain reaction). Proof of transformation was given by the PCR products showing that rol A
and rol C genes were present in the hairy roots of L. leonii. Genetically modified hairy roots produced 5-
fold higher yields of justicidin B (10.8 mg g
-1
DW) compared to untreated callus. This suggests that this
technique may be used to enhance the accumulation of justicidin B. In addition to the production, we
investigated the cytotoxic effect of justicidin B in three chronic human myeloid leukemia-derived cell
lines (LAMA-84, K-562 and SKW-3), that show a lower responsiveness to cytotoxic drugs due to a
strong expression of the fusion oncoprotein BCR-ABL (a non-receptor tyrosine kinase). IC
50
values of
justicidin B were 1.1, 6.1 and 1.5 µM for the chronic myeloid leukemia (LAMA-84), pre-B-cell

96
lymphoma (K-562) and chronic lymphoid leukemia (SKW) cell lines respectively. These IC
50
were
comparable to the anticancer drug etoposide (a semi-syntehetic lignan derivative).
We conclude that the phytochemical studies of the two selected Indonesian medicinal plants as
well as the production of lignans in cell suspension cultures provide further scientific approach for the
development of jamu. Furthermore the genetic engineering studies of two Linum species contribute to
medicinal plant research with respect to a better understanding of the lignan biosynthesis. The
biotechnology approach may also be applied to use medicinal plants as a source for drugs discovery.

97
Samenvatting (Dutch)
Aspecten betreffende fytochemie en biosynthese van lignanen, met de nadruk op Indonesische
medicinale planten
Het gebruik van planten, plantenextracten en uit planten geïsoleerde verbindingen voor het
behandelen van ziekten, als voedingssupplement en voor cosmetica is diep geworteld in het verleden en
nog steeds in ontwikkeling. Veel geneesmiddelen die in de hedendaagse gezondheidszorg worden
toegepast zijn gebaseerd op planten en ontdekt op basis van het traditionele (medicinale) gebruik door
inheemse bevolkingsgroepen. Podofyllotoxine, vincristine, vinblastine, camptothecine, taxol,
artemisinine, aspirine, atropine, efedrine, kinine, reserpine en digoxine zijn bekende voorbeelden van
zulke geneesmiddelen.
Ontwikkelingen in wetenschap en techniek geven een verdere impuls aan de exploratie van
medicinale planten als bron voor nieuwe geneesmiddelen. Moderne analysetechnieken,
biotechnologische benaderingen, genomics, proteomics en metabolomics worden toegepast in het
onderzoek met medicinale planten en dragen bij aan de vooruitgang van dit vakgebied. Dikwijls echter
vormen de relatief lage gehaltes van biologisch actieve verbindingen (zogenaamde ‘secundaire
metabolieten’) en problemen bij het standaardiseren een knelpunt in de exploitatie van medicinale
planten. Wereldwijd zijn pogingen ondernomen om de productie van biologisch actieve verbindingen te
verhogen met behulp van biotechnologie. In dit proefschrift worden aspecten betreffende fytochemie en
biosynthese van lignanen onderzocht die aanwezig zijn in twee medicinale planten uit Indonesië,
Phyllanthus niruri L. (Euphorbiaceae) en Piper cubeba L. (Piperaceae), en in twee Linum-soorten die
inheems zijn in Europa, Linum flavum L. en Linum leonii F.W. Schulz. (Linaceae).
De beide Indonesische planten worden in jamu gebruikt. Jamu is de traditionele Indonesische
geneeskunde en is gebaseerd op het volksgebruik van medicinale planten. Hoofdstuk 2 geeft een
uitgebreid overzicht van jamu. De Indonesische bevolking gebruikt jamu al eeuwenlang om een goede
gezondheid te behouden en om ziekten te behandelen. Wij bespreken de relatie van jamu met de
biodiversiteit van Indonesië (die één der grootste ter wereld is), de positie van jamu in de huidige
Indonesische samenleving, wet- en regelgeving, de bereiding van jamu (die meer en meer verschuift van
kleinschalige huisvlijt naar groter industrieel), economische vooruitzichten, rationele farmacotherapie
met deze middelen en ethische overwegingen die in beschouwing moeten worden genomen bij het
ontwikkelen van geneesmiddelen uit traditionele bronnen. Wij geven uitgebreide informatie over de
biologische activiteit, de therapeutische waarde van planten en bestanddelen uit planten die het meest
frequent in jamu worden toegepast, bespreken klinisch onderzoek dat beschikbaar is en besteden
aandacht aan toxicologische aspecten. Aangezien de economische en klinische betekenis van jamu in
Indonesië stijgt, is een verdere wetenschappelijke onderbouwing nodig. Op basis van kennis verkregen
uit goed opgezet onderzoek kan jamu in Indonesië verder worden ontwikkeld en kan de veiligheid en
effectiviteit van deze middelen worden gewaarborgd.
In Hoofdstuk 3 bestuderen wij lignanen in celcultures van Phyllanthus niruri, in Indonesië
bekend als meniran. P. niruri is een belangrijke plant in jamu. Alle delen van de plant worden gebruikt,
ondermeer om gonorroe, syfilis, nefralgie, diarree, koorts en tetanus te behandelen. De bladeren worden
toegepast bij epilepsie, malaria, obstipatie, hypertensie en menstruatieproblemen. Lignanen vormen een
belangrijke groep van secundaire metabolieten in deze plant en worden verantwoordelijk gehouden voor
de biologische activiteit. Wij hebben celcultures opgezet van de bladeren van de plant. In zowel
callusweefsel als in celsuspensies waren lignanen aanwezig. Er waren kwalitatieve en kwantitatieve
verschillen tussen de lignanen in bovengrondse delen van de plant, wortels en zaden. Uit de
celsuspensiecultures isoleerden wij twee lignanen die niet in de plant zelf voorkomen: een nieuwe
dimethylether van cubebine en urinatetraline, dat eerder in P. urinaria werd gevonden. Koffiezuur en

98
ferulazuur, vroege voorlopers in de biosynthese van lignanen, werden aan het groeimedium van de
celsuspensiecultures toegevoegd (‘precursor feeding’) met als doel de lignaanproductie in de cellen te
verhogen. Normale celsuspensiecultures (controle) produceerden 0,1 mg g
-1
drooggewicht cubebine
dimethylether en 0,2 mg g
-1
urinatetraline. In een concentratie van 0,5 mM gaven zowel koffiezuur als
ferulazuur een verhoging van de productie van het cubebine dimethylether als van urinatetraline in de
cellen (tot respectievelijk 0,7 mg g
-1
en 0,3 mg g
-1
).
Lignanen zijn ook aanwezig in Piper cubeba, een andere belangrijke jamu-plant en bekend als
kemukus. De bessen van P. cubeba worden gebruikt ter behandeling van gonorroe, dysenterie, syfilis,
buikpijn, diarree, enteritis, en astma. Hoofdstuk 4 beschrijft de lignaanprofielen van verschillende delen
van van de plant: bessen, bladeren en takjes. Als methoden werden dunnelaagchromatografie (TLC),
hogedruk-vloeistofchromatografie (HPLC), gaschromatografie (GC) en gaschromatografie gekoppeld
aan massaspectrometrie (GC-MS) gebruikt. In de bladeren vonden wij vijftien lignanen, in de bessen
dertien en in de takjes vijf. Cubebine, hinokinine, yateine, en isoyateine zijn algemeen voorkomende
lignanen in het geslacht Piper en bleken ook de belangrijkste bestandelen te zijn in de bovengrondse
delen van P. cubeba die wij onderzochten.
Om een completer fytochemisch beeld van P. cubeba te krijgen bestudeerden wij de
samenstelling van de vluchtige olie van bessen en bladeren van deze plant met behulp van GC en GC-
MS (Hoofdstuk 5). Liganen en vluchtige olie (met mono- en sesquiterpenen en fenylpropaanderivaten)
vormen de belangrijkste groepen secundaire metabolieten in P. cubeba. De vluchtige olie uit de bessen
wordt gebruikt in cosmetica en voor medische doeleinden. De werking is antimicrobieel, antiviraal (bij
herpes simplex), antischimmel, cardiovasculair en maagbeschermend. Stoomdestillatie van de bessen
leverde 11,8% en van de bladeren 0,9% olie op. In totaal werden in de bessenolie 105 bestanddelen
geïdentificeerd, overeenkomend met 63,1% van de olie. In de bladolie werden 63 bestanddelen
geïdentificeerd, overeenkomend met 78,0% van de olie. De hoeveelheid monoterpenen was
vergelijkbaar in beide oliën (17,2% en 17,0% voor respectievelijk bessen en bladeren). De belangrijkste
monoterpenen waren u-thujeen, u-pineen, sabineen en limoneen. In de geoxygeneerde
monoterpeenfractie was trans-sabineenhydraat het hoofdbestanddeel. u-Copaeen, þ-elemeen, E-
caryofylleen en caryofylleen waren de belangrijkste sesquiterpenen in de bessenolie; E-caryofylleen en
v-cadineen de belangrijkste in de bladolie. Op basis van de overeenkomstige profielen van lignanen en
vluchtige olie van bessen en bladeren concluderen wij dat ook de bessen voor medicinale doeleinden
bruikbaar zouden kunnen zijn. Deze kennis kan worden gebruikt voor de verdere ontwikkeling van
fytotherapeutica op basis van P. cubeba.
Biosynthesestudies van lignanen werden uitgevoerd met een Europese plant, Linum flavum (gele
vlas). Het gebruik van podofyllotoxine als uitgangsstof voor de semi-synthetische cytostatica etoposide,
teniposide en etophos, stimuleert het onderzoek naar lignanen, inclusief podofyllotoxinederivaten en
tussenproducten uit de biosynthese. In Hoofdstuk 6 beschrijven wij de verhoogde productie van 6-
methoxypodofyllotoxine (6-MPT) in celsuspensiecultures van blaadjes van L. flavum onder invloed van
ethyleendiaminetetraacetaat (EDTA) en andere glucosyltransferaseremmers. Het enzym coniferylalcohol
glycosyltransferase (CAGT) zet coniferylalcohol (een fenylpropaanderivaat en vroege voorloper in de
biosynthese van lignanen) om in coniferine. Celcultures van de L. flavum accumuleren grote
hoeveelheden coniferine (tot 12%, berekend op drooggewicht). De hypothese is dat door remming van
de vorming van coniferine er meer coniferylalcohol beschikbaar komt, waardoor de productie van 6-
MPT wordt verhoogd. Na toevoeging van EDTA werd de productie van coniferine tot 88% van de
controlewaarde geremd, terwijl de 6-MPT productie met een factor 3,2 toenam, tot 0,6 mg g
-1

drooggewicht. De remming van de coniferineproductie correleerde met remming van de CAGT-
activiteit in celhomogenaten van L. flavum die werden geïncubeerd met coniferylalcohol. Het
mechanisme achter de enzymremming is nog niet opgehelderd. Om de rol van CAGT in de
lignaanbiosyntehse verder te bestuderen hebben we het enzym gedeeltelijk gezuiverd uit
Sancnta||ing (Du|cn)
99
celsuspensiecultures van L. flavum. Een totale zuivering bleek, vanwege de instabiliteit van CAGT, niet
mogelijk.
De biosynthese van lignanen werd ook op genetisch niveau onderzocht. Wij trachtten CAGT uit
celsuspensiecultures van L. flavum te kloneren en tot expressie te brengen in de bacterie Escherichia coli
(Hoofdstuk 7). De kwaliteit van het geïsoleerde RNA was voldoende om cDNA te maken. Op basis van
de meest geconserveerde gebieden van het DNA dat codeert voor honderd glycosyltransferases in
verschillende plantensoorten, werden primers ontworpen (‘forward en reverse degenerated primers’).
Het geconserveerde gebied, ‘PSPG box’ genaamd, is zeer karakteristiek en aanwezig in alle
glycosyltransferases uit biosyntheseroutes van natuurstoffen. De PSPG box is waarschijnlijk de
nuceotidedifosfaat-bindingsplaats. Verschillende genen die coderen voor glycosyltransferases kunnen
worden ingebouwd in planten, met als doel de kwaliteit ervan als voedingsmiddel of als landbouwgewas
te verbeteren. Daarnaast kan op deze manier meer kennis worden vergaard over de biosynthese van
medicinaal toegepaste natuurstoffen. Het uiteindelijke doel is het ontwikkelen van een efficiënt systeem
voor de productie van cytotoxische lignanen.
Er werden drie verschillende glycosyltransferases uit celsuspensiecultures van L. flavum in E.
coli gekloneerd en de sequentie werd opgehelderd. Twee producten waren complete sequenties: CAGT
A en CAGT B. Van het derde product konden wij alleen het geconserveerde gebied (PSPG box)
aantonen. Vergelijking (‘alignment’) van CAGT A en B met sequenties van glycosyltransferases uit
planten die beschikbaar waren in databases, gaf respectievelijk 50% en 40% homologie. De
geconserveerde gebieden van CATG A en B vertoonden 80% en 89% homologie. Fylogenetische
analyse van de resultaten bracht aan het licht dat CAGT A en B tot dezelfde subfamilie behoren, samen
met andere fenylpropanoïd glycosyltransferases. Hoewel de expressie van deze glycosyltransferases nog
niet helemaal afgerond is, concluderen wij dat minstens één van de twee CAGT’s betrokken is bij de
biosynthesestap van coniferylalcohol naar coniferine in L. flavum celcultures.
In Hoofdstuk 8 beschrijven wij de productie van justicidine B in celcultures en in hairy-
rootcultures van Linum leonii. Justicine is een arylnaftaleen-lignaan met cytotoxische, antivirale,
fungicide, antiprotozoaire en bloedplaatjesaggregatieremmende eigenschappen. De hairy-rootcultures
werden verkregen door genetische modificatie van L. leonii met behulp van Agrobacterium rhizogenes-
stam 15834 (agropinetype). De producten waarvoor de rol A en rol C genen coderen hadden een
synergistisch effect op de wortelinductie en verhoogden de gevoeligheid voor het plantenhormoon
auxine. Met behulp van de PCR-techniek (polymerase chain reaction) werd bewezen dat de
transformatie van de rol A en rol C genen uit A. rhizogenes in de hairy-rootcultures L. leonii geslaagd
was. Genetisch gemodificeerde hairy-rootcultures produceerden vijfmaal hogere gehaltes aan justicidine
B (10,8 mg g
-1
drooggewicht) dan normaal callusweefsel. Daarnaast hebben wij de cyotoxische werking
van justicidine B bestudeerd tegen drie humane chronische myeloïde leukemie cellijnen, LAMA-84, K-
562 en SKW. Deze cellijnen zijn minder gevoelig voor cytostatica vanwege een hoge expressie van het
eiwit BCR-ABL (‘fusion oncoprotein’; een non-receptor tyrosinekinase). De IC
50
-waarden (continue
incubatie in de MTT-assay) van justicidine bedroegen 1,1 µM (LAMA-84), 6,1 µM (K-562) en 1,5 µM
(SKW) en waren vergelijkbaar met die van het referentiecytostaticum etoposide.
Wij concluderen dat het fytochemische onderzoek van de twee Indonesische planten en het
onderzoek naar de productie van liganen in celsuspensiecultures de verdere ontwikkeling van jamu
wetenschappelijke ondersteunen. Het moleculair-biologisch en genetisch onderzoek dat met twee
Europese Linum-soorten is uitgevoerd draagt bij aan een beter begrip van de lignaanbiosynthese. De
biotechnologische benadering kan ook worden toegepast om medicinale planten te gebruiken als bron
voor geneesmiddelontwikkeling.

100





101
Ringkasan (Indonesian)
Studi fitokimia dan biosintesis lignan, dengan fokus pada tumbuhan obat Indonesia
Penggunaan tumbuh-tumbuhan, ekstrak dan senyawa kimia dari tumbuhan serta turunannya,
dalam pengobatan berbagai penyakit, makanan tabahan dan bahan baku kosmetik telah berlangsung
sejak lama dan terus berkembang sampai sekarang. Banyak obat modern diturunkan dari tumbuhan yang
pada awalnya ditemukan melalui penggunaannya secara tradisional. Beberapa contoh diantaranya: obat
anti kanker (podophyllotoxin, vincristine, vinblastin, taxol), anti malaria (quinine dan artemisinin), obat
penguat jantung (digoxin), dan obat demam (aspirin). Perkembangan ilmu pengetahuan dan teknologi
menstimulasi pengembangan tumbuhan obat sebagai sumber yang berguna untuk penemuan obat.
Metoda analitik modern, pendeketan bioteknologi, metabolomik, proteomik dan genomik sekarang
sudah diaplikasikan dalam penelitian tumbuhan obat dan memberikan kontribusi yang besar dalam
pengembangan tumbuhan obat. Pendekatan ini sudah digunakan diseluruh dunia untuk mengatasi
permasaalahan yang sering muncul dalam pengembangan tumbuhan obat. Permasaalah tersebut
diantaranya rendahnya kandungan senyawa berkhasiat dari tumbuhan obat dan standardisasinya.
Pada tesis ini dimuat studi tentang aspek fitokimia dan bioteknologi terhadap senyawa aktif
lignan dari dua tumbuhan obat yang digunakan di Indonesia yaitu Phyllanthus niruri L (Euphorbiaceae)
dan Piper cubeba L(Piperaceae) dan dua tumbuhan obat dari Eropa yaitu Linum flavum L dan Linum
leoni F.W. Schulz (Linaceae). Kedua tumbuhan Indonesia tersebut digunakan sebagai komponen jamu.
Jamu adalah obat tradisional di Indonesia yang dibuat dari tumbuhan dan digunakan oleh masyarakat
Indonesia semenjak beberapa abad yang lalu untuk memelihara kesehatan dan mengobati penyakit.
Produksi jamu telah berkembang dari skala industri rumah tangga ke skala industri yang lebih besar.
Karena nilai klinis dan ekonomis dari jamu sekarang terus meningkat di Indonesia, maka dibutuhkan
bukti-bukti ilmiah dan penelitian lanjut terhadap tumbuhan obat. Jamu harus dikembangkan untuk
menjamin aktifitas farmakologi dan keamanannya. Tinjauan pustaka tentang penelitian-penelitian yang
dilakukan terhadap tumbuhan yang digunakan untuk memproduksi jamu, secara komprehensif dimuat
pada Bab 2. Tinjauan ini mencakup berbagai aspek termasuk fitokimia, farmakologi, toksikologi dan uji
klinis serta berbagai isu etika seperti hak kekayaan intelektual, pembagian keuntungan dan konservasi.
Phyllanthus niruri (meniran) adalah salah satu tumbuhan obat yang sering digunakan untuk
jamu. Seluruh bagian dari tumbuhan ini digunakan untuk mengobati gonore, sifilis, nefralgia, diare,
demam dan tetanus. Daun meniran digunakan untuk mengobati epilepsi, malaria, konstipasi, hipertensi
dan kelainan menstruasi. Senyawa lignan adalah metabolit sekunder yang penting pada tumbuhan ini,
yang betanggung jawab terhadap aktivitas biologinya. Kultur sel dari P. niruri menghasilkan senyawa
lignan. Terdapat perbedaan yang signifikan secara kuanlitatif dan kuantitatif antara profil senyawa
lignan dari kultur sel, kultur kalus, tumbuhan asli, akar dan biji dari P. niruri. Dua senyawa lignan yang
tidak ditemukan sebelumnya dari tumbuhan ini berhasil diisolasi dan dimurnikan. Satu diantaranya
adalah senyawa baru yaitu cubebin dimetilleter dan senyawa baru untuk P. niruri tetapi telah dilaporkan
sebelumnya dari tumbuhan lain, P. urinaria, yaitu urinatetralin (lihat Bab 3). Penambahan dua senyawa-
antara untuk biosintesis lignan pada kultur sel P. niruri dapat menstimulasi peningkatan produksi
cubebin dimetileter hingga 0,7 mg g
-1
berat kering (kontrol sel hanya 0,1 mg g
-1
berat kering) dan
urinatetralin hingga 0,3 mg g
-1
berat kering (control sel hanya 0,2 mg g
-1
berat kering). Dua senyawa-
antara tersebut adalah asam ferulat (0,5 mM) dan asam kafeat (0,5 mM).
Lignan juga ditemukan dari tumbuhan obat lainnya yang digunakan untuk jamu, yaitu Piper
cubeba. Biji dari tumbuhan ini digunakan untuk mengobati gonore, disentri, sifilis, sakit pada perut,
diare, enteritis dan asma. Profil senyawa lignan dari biji, daun dan batang P. cubeba dibuat dan
dibandingkan dengan menggunakan khromatografi gas (GC), khromatografi gas-spektrometer masa
(GC-MS) dan khromatografi cair tegangan tinggi (HPLC) (Bab 4). Tiga belas lignan ditemukan pada

102
biji, lima belas pada daun dan lima pada batang. Pada Bab 5 dimuat hasil penelitian terhadap komposisi
minyak atsiri dari P. cubeba. Minyak atsiri biasanya digunakan sebagai bahan pembuat kosmetik serta
untuk tujuan pengobatan. Beberapa aktifitas farmakologi dari minyak atsiri adalah sebagai antimikroba,
anti herpes simplex, antijamur, obat jantung, proteksi lambung. Destilasi air dari biji P. cubeba
menghasilkan minyak atsiri sebanyak 11,8% dan dari daun 0,9%. Dari biji dapat diidentifikasi 105
komponen, sebesar 63,1% dari minyak atsiri, sedangkan dari daun 63 komponen dengan jumlah 78,0%
dari minyak atsiri. Jumlah total monoterpen dari minyak yang diperoleh dari biji dan daun hampir sama,
yaitu 17,2% dan 17,%. Monoterpen utama dari biji dan daun adalah u-thujene, u-pinene, sabinene, and
limonene. Trans-sabinenhidrat adalah komponen utama dari fraksi monoterpen teroksigenasi. u-
Copaene, þ-elemene, E-caryophyllene, and caryophyllene adalah sesquiterpen utama dari minyak atisiri
biji, sedangkan E-caryophyllene, and v-cadinene adalah sesquiterpen utama dari daun. Berdasarkan hasil
penelitian terhadap lignan dan minyak atsiri dari P. cubeba dapat disimpulkan bahwa selain dari biji,
daun dari tumbuhan ini juga dapat dimanfaatkan untuk tujuan pengobatan. Kesimpulan ini dapat
dijadikan dasar untuk pengembangan lebih lanjut sehingga P. cubeba bisa dijadikan untuk pengobatan
rasional (fitofarmaka).
Studi terhadap biosintesis lignan dilakukan dengan menggunakan tumbuhan Eropa, Linum
flavum L. Penggunaan podofilotoksin sebagai bahan dasar untuk produksi obat antikanker etoposide,
teniposide dan etopophos menstimulasi penelitian terhadap lignan, termasuk turunan podofilotoksin
lainnya dan produk antara dari biosintesis lignan. Pada Bab 6 ditulis studi tentang peningkatan produksi
6-metoksipodofilotoksin (6-MPT) dan penurunan produksi coniferin pada kultur suspensi sel dari L.
flavum dengan menggunakan natrium etilendiamina tetraasetat (Na
2
EDTA) dan senyawa penghambat
enzim glucosylrasnferase lainnya. Enzim coniferil alkohol glucosyltransferase (CAGT) menjadi katalis
pembentukan senyawa coniferin dengan menggunakan coniferil alkohol sebagai substrat. Produksi
coniferin pada kultur suspensi sel L. flavum sangat besar yaitu 12% dari berat kering. Coniferil alkohol
juga digunakan untuk pembentukan senyawa 6-MPT melalui jalur biosintesis yang berbeda dengan
coniferin. Aktivitas CAGT yang dihambat akan mengurangi produksi coniferin, sehingga jumlah
coniferil alkohol meningkat. Sebaliknya, akumulasi coniferil alkohol ini bisa digunakan sebagai bahan
antara untuk produksi senyawa 6-MPT. Na
2
EDTA menghambat produksi coniferin sampai 88% dan di
sisi lain meningkatkan produksi 6-MPT sampai 0,56 mg g
-1
berat kering, lebih dari tiga kali lipat
dibanding kultur control. Pengurangan produksi coniferin berkorelasi dengan berkurangnya aktivitas
CAGT, seperti terlihat pada aktivitas ekstrak sel terhadap coniferil alkohol. Ini menunjukkan bahwa
Na
2
EDTA menghambat CAGT dan oleh karena itu mengurangi produksi coniferin. Mekanisme
penghambatan terhadap CAGT masih belum jelas. Untuk studi lebih lanjut terhadap peran CAGT dalam
biosintesis lignan telah dilakukan pemurnian parsial enzim ini dari kultur suspensi sel L. flavum.
Pemurnian sampai pada tingkat 100% sangat sulit karena ketidakstabilan enzim.
Penelitian lanjutan untuk memahami fungsi enzim CAGT adalah cloning CAGT dari kultur
suspensi sel L. flavum pada Escherichia coli (Bab 7). Hasil isolasi total RNA menunjukkan kualitas
yang cukup untuk sintesis cDNA. Satu forward dan satu reverse degenerated primer didisain
berdasarkan daerah lestari seratus glucosyltransferase dari berbagai spesies tumbuhan. Glcosyltransferas
ini di analisis menggunkan perangkat lunak MegAline dari DNASTAR Inc. Daerah lestari, yang dikenal
dengan kotak PSPG, sangat khas dan ada di semua glucosyltransferase yang berperan dalam biosintesis
bahan alam. Daerah ini juga didefenisikan sebagai sisi aktif enzim glucosyltransferase dari hewan dan
mikroorganisme. Kotak PSPG dipercayai sebagai representasi dari sisi yang berikatan dengan nukleotida
difosfat. Beberapa gen pengkode glucosyltransferase adalah kandidat yang cocok untuk disisipkan
kedalam tanaman untuk tujuan peningkatan kualitas makanan, hasil pertanian dan untuk memahami
biosintesis bahan alam yang berguna sebagai obat.
Tiga glucosyltransferase telah berhasil di kloning dari kultur suspensi sel L. flavum pada E. coli.
Dua diantaranya telah memiliki urutan nukleotida lengkap (ORF) yaitu CAGT A dan CAGT B.
Ring|asan (|ndcncsian)
103
Sedangkan urutan lengkap dari CAGT C belum berhasil diidentifikasi. Penjajaran CAGT A dan CAGT
B dengan beberapa glucosyltransferase dari berbagai tumbuhan berdasarkan basis data, menunjukkan
50% dan 40% homolog berturut-turut. Sedangkan kotak PSPG box dari CAGT A dan B menunjukkan
80% dan 89% homolog, berturut-turut. Analisis filogenetik menunjukkan bahwa CAGT A dan B
tergolong ke dalam subfamili yang sama dengan fenilpropanoid glucosyltransferase yang lain.
Walaupun ekspresi dari kedua gen ini belum berhasil dilakukan, dapat disimpulkan bahwa sekurangnya
satu dari dua CAGT berperan dalam tahap biosintesis dari coniferil alkohol untuk pembentukan
coniferin pada kultur suspensi sel L. flavum.
Pada Bab 8 dijelaskan produksi justicidin B, sebuah senyawa sitotoksik ariltetralin lignan pada
kultur sel dan akar rambut dari Linum leonii. Kultur akar rambut dihasilkan dari transformasi genetik
menggunakan Agrobacterium rhizogenes 15834 strain (tipe agropin). Produk yang dikode oleh gen rol A
dan rol C mempunyai efek sinergis pada induksi akar dan meningkatkan sensitifitas auxin. Keberhasilan
transformasi gen ini dari A. rhizogenes pada kultur akar rambut diperiksa dengan PCR. Pada produk
PCR ditunjukkan bahwa gen rol A dan rol C ditemukan pada kultur akar rambut L. Leoni. Akar rambut
yang dimodifikasi secara genetik menghasilkan produksi justicidin B (10 mg g
-1
berat kering) lima kali
lipat lebih tinggi bila dibandingkan dengan kalus kontrol. Hasil ini menunjukkan bahwa teknik ini dapat
digunakan untuk meningkatkan akumulasi justicidin B. Di samping itu, penelitian terhadap efek
sitotoksik justicidin B terhadap tiga sel LAMA-84, K-562 dan SKW yang diturunkan dari leukimia
kronis dari manusia, yang menunjukkan respon yang lebih rendah terhadap obat sitotoksik karena
ekspresi yang tinggi dari protein BCR-ABL (tirosin kinase non reseptor). IC
50
dari justicidin B adalah
1,2, 6,1 dan 1,5 µM untuk sel LAMA-84, K-562 dan leukimia limfoid kronis (SKW), berturut-turut.
Nilai IC
50
sebanding dengan obat antikanker etoposide.
Dapat disimpulkan bahwa studi fitokimia dari dua tumbuhan obat Indonesia, juga produksi
lignan pada kultur suspensi sel pada tesis ini memberikan pendekatan ilmiah lanjut untuk pengembangan
jamu. Sedangkan studi rekayasa genetik pada dua spesies Linum memberikan kontribusi untuk
penelitian tumbuhan obat, khususnya dalam memahami biosintesis lignan sebagai salah satu golongan
metabolit sekunder penting untuk aktifitas farmakologi. Pendekatan bioteknologi dapat pula
diaplikasikan dalam upaya menggunakan tumbuhan obat sebagai sumber penemuan obat baru.

104











105
References
Adams, R.P., Identification of Essential Oil Components by Gas Chromatography/Mass Spectroscopy,
Allured Publishing Corporation, Carol Stream, Illinois, 2001
Aggarwal, B.B., Kumar, A., Bharti, A.C., 2003. Anticancer potential of curcumin: preclinical and
clinical studies. Anticancer Research, 23, 363-398
Ahmed, S., Anuntiyo, J., Malemud, C.J., Haqqi, T.M., 2005. Biological basis for the use of botanicals in
osteoarthritis and rheumatoid arthritis: A review. Evidence-Based Complementary and Alternative
Medicine, 2, 301-308
Akhtar, M.S., Khan, M.A., Malik, M.T., 2002. Hypoglycaemic activity of Alpinia galanga rhizoma and
its extracts in rabbits. Fitoterapia, 73, 623-628
Alarcon-Aguilara, F.J., Roman-Ramos, R., Perez-Gutierrez, S., Aguilar-Contreras, A., Contreras-Weber,
C.C., Flores-Saenz, J.L., 1998. Study of the anti-hyperglycemic effect of plants used as
antidiabetics. Journal of Ethnopharmacology, 61, 101-110
Alen, Y., Nakajima, S., Nitoda, T., Baba, N., Kanzaki, H., Kawazu, K., 2000. Antinematodal activity of
some tropical rainforest plants against the pinewood nematode, Bursaphelenchus xylophilus.
Zeitschrift für Naturforschung C (A Journal of Biosciences), 55, 295-299
Alexander-Lindo, R.L., Morrison, E.Y.S., Nair, M.G., 2004. Hypoglycaemic effect of stigmast-4-en-3-
one and its corresponding alcohol from the bark of Anacardium occidentale (Cashew).
Phytotherapy Research, 18, 403-407
Ali, N., Hashim, N.H., Saad, B., Safan, K., Nakajima, M., Yoshizawa, T., 2005. Evaluation of a method
to determine the natural occurrence of aflatoxins in commercial traditional herbal medicines from
Malaysia and Indonesia. Food and Chemical Toxicology, 43, 1763-1772
Altman, R.D., Marcussen, K.C., 2001. Effects of a ginger extract on knee pain in patients with
osteoarthritis. Arthritis and Rheumatism, 44, 2531-2538
Anjaneyulu, A.S.R., Ramaiah, P.A., Ramachandra, L., Venkateswarlu, R., 1981. New Lignans from the
heartwood of Cleistanthus collinus. Tetrahedron, 37, 3641-3652
Anjaneyulu, A.S.R., Rao, K.J., Row, L.R., Subrahmanyam, 1973. Crystalline constituents of
Euphorbiaceae, 12. Isolation and structural elucidation of 3 new lignans from leaves of
Phyllanthus niruri Linn. Tetrahedron, 29, 1291-1298
Anonymous, Nederlandse Farmacopee, 6
th
ed., 2
nd
printing, 1966 Staatsuitgeverij, ‘s-Gravenhage, p. 72
Antony, S., Kuttan, R., Kuttan, G., 1999. Immunomodulatory activity of curcumin. Immunological
Investigations, 28, 291-303
Arambewela, L.S.R., Arawwawala, L.D.A.M., Ratnasooriya, W.D., 2005. Antidiabetic activities of
aqueous and ethanolic extracts of Piper betle leaves in rats. Journal of Ethnopharmacology, 102,
239-245
Aruna, K., Sivaramakrishnan, V.M., 1998. Anticarcinogenic effects of some Indian plant-products. Food
and Chemical Toxicology, 953-956

106
Baba, A., Kawamura, N., Makino, H., Ohta, Y., Taketomi, S., Sohda, T., 1996. Studies on disease-
modifying antirheumatic drugs: synthesis of novel quinoline and quinazoline derivatives and their
anti-inflammatory effect. Journal of Medicinal Chemistry, 39, 5176-5182
Bachmann, T.L., Ghlia, F., Thorssell, K.G.B., 1993. Lignans and lactones from Phyllanthus anisolobus.
Phytochemistry, 32, 189-191
Backer, C.A., Van den Brink, R.C.B., 1968. Flora of Java, NVP Noordhoff, Groningen, p.168-170
Backer, C.A., Van den Brink, R.C.B., 1968. Flora of Java. NVP Noordhoff, Groningen, p. 466-469
Badheka, L.P., Prabhu, B.R., Mulchandani, N.B., 1986. Dibenzylbutyrolactone lignans from Piper
cubeba. Phytochemistry, 25, 487-489
Badheka, L.P., Prabhu, B.R., Mulchandani, N.B., 1987. Lignans of Piper cubeba. Phytochemistry, 26,
2033-2036
Bastos, J.K., Carvalho, J.C.T., de Souza, G.H.B., Pedrazzi, A.H.P., Sarti, S.J., 2001. Anti-inflammatory
activity of cubebin, a lignan from the leaves of Zanthoxyllum naranjillo Griseb. Journal of
Ethnopharmacology, 75, 279-282
Beers, S.J., 2001. Jamu, the ancient Indonesian art of herbal healing. Periplus Editions (HK) Ltd.
Bendjeddou, D., Lalaoui, K., Satta, D., 2003. Immuno stimulating activity of the hot water-soluble
polysaccharide extracts of Anacyclus pyrethrum, Alpinia galanga and Citrullus colocynthis.
Journal of Ethnopharmacology, 88, 155-160
Berim, A., Spring, O., Conrad, J., Maitrejean, M., Boland, W., Petersen, M., 2005. Enhancement of
lignan biosynthesis in suspension cultures of Linum nodiflorum by coronalon, indanoyl-isoleucine
and methyl jasmonate. Planta, 222, 769-776
Bermawie, N., Hernani, Suwijo, P., Kardono, L.B.S., 2005. Approaches for sustainable utilization of
biodiversity of medicinal and aromatic plants in Indonesia.
http://www.ics.trieste.it//Documents/Downloads/df3204.pdf
Bhat, G.P., Surolia, N., 2001. In vitro antimalarial activity of extracts of three plants used in the
traditional medicine of India. American Journal of Tropical Medicine and Hygiene, 65, 304-308
Borsato, M.L.C., Grael, C.F.F., Souza, G.E.P., Lopes, N.P., 2000. Analgesic activity of the lignans from
Lychnophora ericoides. Phytochemistry, 55, 809-813
Bouttier, S., Fourniat, J., Garofalo, C., Gleye, C., Laurens, A., Hocquemiller, R., 2002. β-lactamase
inhibitors from Anacardium occidentale. Pharmaceutical Biology, 40, 231-234
Bowles, D., Isayenkova, J., Lim, E.K., Poppenberger, B., 2005. Glycosyltransferases: managers of small
molecules. Current Opinion in Plant Biology, 2005, 8, 254-263
Bradford, M.M., 1976. A rapid and sensitive methode for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72, 248-254
Bunpo, P., Kataoka, K., Arimochi, H., Nakayama, H., Kuwahara, T., Bando, Y., Izumi, K.,
Vinitketkumnuen, U., Ohnishi, Y., 2004. Inhibitory effects of Centella asiatica on azoxymethane-
induced aberrant crypt focus formation and carcinogenesis in the intestines of F344 rats. Food and
Chemical Toxicology, 42, 1987-1997
Caksen, H., Odabas, D., Akbayram, S., Cesur, Y., Arslan, S., Uner, A., Oner, A.F., 2003. Deadly
nightshade (Atropa belladonna) intoxication: an analysis of 49 children. Human & Experimental
Toxicology, 22, 665-668
Rcfcrcnccs
107
Calabrese, C., Berman, S.H., Babish, J.G., Ma, X.F., Shinto, L., Dorr, M., Wells, K., Wenner, C. A.,
Standish, L.J., 2000. A phase I trial of andrographolide in HIV positive patients and normal
volunteers. Phytotherapy Research, 14, 333-338
Calixto, J.B., Santos, A.R.S., Filho, V.C., Yunes, R.A., 1998. A review of the plants of the genus
Phyllanthus: Their chemistry, pharmacology and their therapeutic potential. Medical Research
Review, 18, 225-258
Campos, A.H., Schor, N., 1999. Phyllanthus niruri inhibits calcium oxalate endocytosis by renal tubular
cells: its role in urolithiasis. Nephron, 81, 393-397
Cesarone, M.R., Incandela, L., De Sanctis, M.T., Belcaro, G., Bavera, P., Bucci, M., Ippolito, E., 2001.
Evaluation of treatment of diabetic microangiopathy with total triterpenic fraction of Centella
asiatica: A clinical prospective randomized trial with a microcirculatory model. Angiology, 62,
S49-S54
Chander, R., Srivastava,V., Tandon, J.S., Kapoor, N.K., 1995. Antihepatotoxic activity of diterpenes of
Andrographis paniculata (Kal-Megh) against Plasmodium berghei-induced hepatic damage in
Mastomys natalensis. International Journal of Pharmacognosy, 33, 135-138
Chang, C.C., Lien, Y.C., Liu, K.C.S., Lee, S.S., 2003. Lignans from Phyllanthus urinaria.
Phytochemistry, 63, 825-833
Channa, S., Dar, A., Ahmed, S., Atta’ur Rahman, 2005. Evaluation of Alstonia scholaris leaves for
broncho-vasodilatory activity. Journal of Ethnopharmacology, 97, 469-476
Chattopaday, S., Srivastava, A.K., Bhojwani, S.S., Bisaria, V.S., 2002. Production of podophyllotoxin
by plant cell cultures of Podophyllum hexandrum in bioreactor. Journal of Bioscience &
Bioengineering, 93, 215-220
Chattopadhyay, D., Arunachalam, G., Ghosh, L., Mandal, A.B., 2004. CNS activity of Alstonia
macrophylla leaves extracts: an ethnomedicine of Onge of Bay Islands. Fitoterapia, 75, 673-682
Chattopadhyay, I., Biswas, K., Bandyopadhyay, U., Banerje, R.K., 2004. Turmeric and curcumin:
biological actions and medicinal applications. Current Science, 87, 44-53
Cheenpracha, S., Karalai, C., Ponglimanont, C., Subhadhirasakul, S., Tewtrakul, S., 2006. Anti-HIV-1
protease activity of compounds from Boesenbergia pandurata. Bioorganic & Medicinal
Chemistry, 14, 1710-1714
Chen, C.C., Hsin, W.C., Ko, F.N., Huang, Y.L., Ou, J.C., Teng, C.M., 1996. Antiplatelet
arylnaphthalide lignans from Justicia procumbens. Jornal of Natural Products, 59,1149-1150
Chen, J.Y., Liu, P.Y., Chen, J.H., Lin, L.J., 2004. Safety of transvenous temporary cardiac pacing in
patients with accidential digoxin overdose and symptomatic bradycardia. Cardiology, 102, 152-
155
Cheng, C.L., Guo, J.S., Luk, J., Koo, M.W.L., 2004. The healing effects of Centella extract and
asiaticoside on acetic acid induced gastric ulcers in rats. Life sciences, 74, 2237-2249
Chi, C.W., Chang, Y.F., Chao, T.W., Chiang, S.H., Peng, F.K., Lui, W.Y., Liu, T.Y., 1994. Flow-
cytometric analysis of the effect of berberine on the expression of glucocorticoid receptors in
human hepatoma hepg2 cells. Life Sciences, 26, 2099-2107
Chithra, V., Leelamma, S., 2000. Coriandrum sativum - effect on lipid metabolism in 1,2-dimethyl
hydrazine induced colon cancer. Journal of Ethnopharmacology, 71, 457-463

108
Choi, E.M., Hwang, J.K., 2003. Investigations of anti-inflammatory and antinociceptive activities of
Piper cubeba, Physalis angulata and Rosa hybrida. Journal of Ethnopharmacology, 89, 171-175
Choi, E.M., Hwang, J.K., 2005. Effect of some medicinal plants on plasma antioxidant system and lipid
levels in rats. Phytotherapy Research, 19, 382-386
Choi, E.M., Hwang, J.K., 2005. Screening of Indonesian medicinal plants for inhibitor activity on nitric
oxide production of RAW264.7 cells and antioxidant activity. Fitoterapia, 76, 194-203
Chong, J., Baltz, R., Fritig, B., Saindrenan, P., 1999. An early salicylic acid-, pathogen- and elicitor-
inducible tobacco glucosyltransferase: role in compartmentalization of phenolics and H
2
O
2

metabolism. FEBS Letter, 458, 204-208
Chong, J., Baltz, R., Schmitt, C., Beffa, R., Fritig, B., Saindrenan, P., 2002. Downregulation of a
pathogen-responsive tobacco UDP-Glc: phenypropanoid glucosyltransferase reduces scopoletin
glucoside accumulation, enhance oxidative stress, and weakens virus resistance. Plant Cell, 14,
1093-1107
Chrubasik, S., Pittler, M.H., Roufogalis, B.D., 2005. Zingiberis rhizoma: A comprehensive review on
the ginger effect and efficacy profiles. Phytomedicine, 12, 684-701
Chularojmontri, L., Wattanapitayakul, S.K., Herunsalee, A., Charuchongkolwongse, S., Niumsakul, S.,
Srichairat, S., 2005. Antioxidative and cardioprotective effects of Phyllanthus urinaria L. on
doxorubicin-induced cardiotoxicity. Biological & Pharmaceutical Bulletin, 28, 1165-1171
Coon, J.T., Ernst, E., 2002. Panax ginseng: A systematic review of adverse effect and drug interactions.
Drug Safety, 25, 323-344
Coutinho, P.M., Deleury, E., Davies, G.J., Henrissat, B., 2003. An evolving hierarchical family
classification for glycosyltransferases. Journal of Molecular Biology, 328, 307-317
Cragg, G.M., Newman, D.J., 2005. Plants as a source of anti-cancer agents. Journal of
Ethnopharmacology, 100, 72-79
Da Silva, R., De Souza, G.H.B., Da Silva, A.A., De Souza, V.A., Pereira, A.C., Royo, V.D., Silva,
M.L.A.E., Donate, P.M., Araujo, A.L.S.D., Carvalho, J.C.T., Bastos, J.K., 2005. Synthesis and
biological activity evaluation of lignan lactones derived from (-)-cubebin. Bioorganic & Medicinal
Chemistry Letters, 15, 1033-1037
Dawkins, G., Hewitt, H., Wint, Y., Obiefuna, P.C.M., Wint, B., 2003. Antibacterial effects of Carica
papaya fruit on common wound organisms. West India Medical Journal, 52, 290-292
Day, S.H., Chiu, N.Y., Won, S.J., Lin, C.N., 1999. Cytotoxic lignans of Justicia ciliate. Journal of
Natural Products, 62, 1056-1058
De Clercq, E., 2000. Current lead natural products for the chemotherapy of human immunodefiency
virus (HIV) infection. Medicinal Research Review, 20, 323-349
De Mejia, E.G., Ramirez-Mares, M.V., Arce-Popoca, E., Wallig, M., Villa-Trevino, S. 2004. Inhibition
of liver carcinogenesis in Wistar rats by consumption of an aqueous extract from leaves of Ardisia
compressa. Food and Chemical Toxicology, 42, 509-516
De Sanctis, M.T., Belcaro, G., Incandela, L., Cesarone, M.R., Griffin, M., Ippolito, E., Cacchio, M.,
2001. Treatment of edema and increased capillary filtration in venous hypertension with total
triterpenic fraction of Centella asiatica: A clinical, prospective, placebo-controlled, randomized,
dose-ranging trial. Angiology, 52, S55-S59
Rcfcrcnccs
109
De Souza, V.A., Da Silva, R., Pereira, A.C., Royo, V.D., Saraiva, J., Montanheiro, M., De Souza,
G.H.B., Da Silva, A.A., Grando, M.D., Donate, P.M., Bastos, J.K., Albuquerque, S., Silva,
M.L.A.E., 2005. Trypanocidal activity of (-)-cubebin derivatives against free amastigote forms of
Trypanosoma cruzi. Bioorganic & Medicinal Chemistry Letters. 15, 303-307
Dhandapani, S., Subramanian, R., Rajagopal, S., Namasivayam, N., 2002. Hypolipidemic effect of
Cuminum cyminum L. on alloxan-induced diabetic rats. Pharmacological Research, 46, 251-255
Dharmawardhana, D.P., Ellis, B.E., Carlson, J.E., 1995. A β-glucosidase from lodgepole pine xylem
specific for the lignin precursor coniferin. Plant Physiology, 107, 331-339
Dobhal, M.P., Li, G.L., Gryshuk, A., Graham, A., Bhatanager, A.K., Khaja, S.D., Joshi, Y.C., Sharma,
M.C., Oseroff, A., Pandey, R.K., 2004. Structural modifications of plumieride isolated from
Plumeria bicolor and the effect of these modifications on in vitro anticancer activity. Journal of
Organic Chemistry, 69, 6165-6172
Dua, V.K., Qjha, V.P., Roy, R., Joshi, B.C., Valecha, N., Devi, C.U., Bhatnagar, M.C., Sharma, V.P.,
Subbatao, S.K., 2004. Anti-malarial activity of some xanthones isolated from the roots of
Andrographis paniculata. Journal of Ethnopharmacology, 95, 247-251
Eisei Indonesia PT., Medicinal Herb Index in Indonesia, 1995. 2nd ed.; PT Eisei Indonesia, Jakarta
Empt, U., Alferman, A.W., Pras, N., Petersen, M., 2000. The use of plant cell cultures for the production
of podophyllotoxin and related lignans. Journal of Applied Botany, 74, 145-150
Eno, A.E., Owo, O.I., Itam, E.H., Konya, R.S., 2000. Blood pressure depression by the fruit juice of
Carica papaya (L.) in renal and DOCA-induced hypertension in the rat. Phytotherapy Research,
14, 235-239
Ernst, E., Pittler, M.H., 2002. Risks associated with herbal medicinal products. Wiener Medizinische
Wochenschrift 152, 183-189
Ficker, C.E., Smith, M.L., Susiarti, S., Leaman, D.J., Irawati, C., Arnason, J.T., 2003. Inhibition of
human pathogenic fungi by members of Zingiberaceae used by the Kenyah (Indonesian Borneo).
Journal of Ethnopharmacology, 85, 289-293
Flavor & Fragrance Library Shimadzu Benelux, ‘s-Hertogenbosch.The Netherlands.
Freitas, A.M., Schor, N., Boim, M.A., 2002. The effect of Phyllanthus niruri on urinary inhibitors of
calcium oxalate crystallization and other factors associated with renal stone formation. B. J. U
International, 89, 829-834
Gamborg, O.L., Miller, R.A., Oijama, V., 1968. Nutrient requirements of suspension cultures of soybean
root cells. Experimental Cell Research, 50, 151-158
Gao, Y.H., Gao, H., Chan, E., Tang, W.B., Xu, A.L., Yang, H.Y., Huang, M., Lan, J., Li, X.T., Duan,
W., Xu, C.J., Zhou, S.F., 2005. Antitumor activity and underlying mechanisms of ganopoly, the
refined polysaccharides extracted from Ganoderma lucidum, in mice. Immunology Investigations,
34, 171-198
Gertsch, J., Tobler, R.T., Brun, R., Sticher, O., Heilmann, J., 2003. Antifungal, antiprotozoal, cytotoxic
and piscicidal properties of Justicidin B and a new arylnaphthalide lignan from Phyllanthus
piscatorum. Planta Medica, 69, 420-424
Giri, A., Narasu, M.L., 2000. Production of podophyllotoxin from Podophyllum hexandrum : a potential
natural product for clinically useful anticancer drug. Cytotechnology, 34, 17-26

110
Gnanapragasam, A., Ebenezar, K.K., Sathish, V., Govindaraju, P., Devaki, T., 2004. Protective effect of
Centella asiatica on antioxidant tissue defense system against adriamycin induced cardiomyopathy
in rats. Life Sciences, 76, 585-597
Gordaliza, M., Garcia, P.A., Miguel del Corral, J.M., Castro, M.A., Gomez-Zurita, M.A., 2004.
Podophyllotoxin: distribution, sources, applications and new cytotoxic derivatives. Toxicon, 44,
441-459
Goto, H., Sasaki, Y., Fushimi, H., Shibahara, N., Shimada, Y., Komatsu, K., 2005. Effect of Curcuma
herbs on vasomotion and hemorheology in spontaneously hypertensive rat. American Journal of
Chinese Medicine, 33, 449-457
Goun, E., Cunningham, G., Chu, D., Nguyen, C., Miles, D., 2003. Antibacterial and antifungal activity
of Indonesian ethnomedical plants. Fitoterapia, 74, 592-596
Grosvenor, P.W., Gothard, P.K., McWilliam, N.C., Supriono, A., Gray, D.O., 1995. Medicinal-plants
from Riau province, Sumatra, Indonesia .1. Uses. Journal of Ethnopharmacology, 45, 75-95
Guan, L., Scandalios, J.G., 1995. Developmentally related responses of maize catalase genes to salicylic
acid. Proceeding of National Academic Sciences, 92, 5930-5934
Gupta, P.P., Tandon, J.S., Patnaik, G.K., 1998. Anti-allergic activity of andrographolides isolated from
Andrographis paniculata (Burm F) Wall. Pharmaceutical Biology, 36, 72-74
Harada, T., Ohtaki, E., Misu, K., Sumiyoshi, T., Hososda, S., 2002. Congestive heart failure caused by
digitalis toxicity in an elderly man taking a licorice-containing Chinese herbal laxative. Cardiology
, 98, 218
Harish, R., Shivanandappa, T., 2006. Antioxidant activity and hepatoprotective potential of Phyllanthus
niruri. Food Chemistry, 95, 180-185
Harmatha, J., Nawrot, J., 2002. Insect feeding deterrent activity of lignans and related phenylpropanoids
with a methylenedioxyphenyl (Piperonyl) structure moiety. Entomologia Experimentalis et
Applicata, 104, 51-60
Hartati, M.S.W., Wahyuono, S., Khasanah, N., 1999. Identification of antimicrobial compound in
volatile oil of the tagetes leaves (Tagetes erecta L. fam. Compositae) (in Indonesian). Indonesian
Journal of Pharmacy, 10, 40-47
Hass, J.H., Moore, L.W., Ream, W., Manulis, S., 1995. Universal PCR primers for detection of
phytophatogenic Agrobacterium strains. Applied Environmental Microbiology. 61, 2879-2884
Huang, R.L., Huang, Y.L., Ou, J.C., Chen, C., Hsu, F.L., Chang, C.M., 2003. Screening of 25
compounds isolated from Phyllanthus species for anti-human hepatitis B virus in vitro.
Phytotherapy Research, 17, 449-453
Huang, Y.L., Chen, C.C., Ou, J.C., 1992. Isolintetralin : a new lignan from Phyllanthus niruri. Planta
Medica, 58, 473-474
Huntley, A. L., Coon, J. T., Ernst, E., 2005. The safety of herbal medicinal products derived from
Echinacea species: A systematic review. Drug Safety, 28, 387-400
Hussein, G., Miyashiro, H., Nakamura, N., Hattori, M., Kakiuchi, N., Shimotohno, K., 2000. Inhibitory
effects of Sudanese medicinal plant extracts on hepatitis C virus (HCV) protease. Phytotherapy
research, 14, 510-516
Rcfcrcnccs
111
Iacobellis, N.S., Lo Cantore, P., Capasso, F., Senatore, F., 2005. Antibacterial activity of Cuminum
cyminum L. and Carum carvi L. essential oils. Journal of Agricultural and Food Chemistry, 53, 57-
61
Ibrahim, R.K., Grisebach, H., 1976. Purification and properties of UDP-glucose: coniferyl alcohol
glucosyltransferase from suspension cultures of Paul’s Scarlet Rose. Archives of Biochemistry
and Biophysics, 176, 700-708
Ichikawa, H., Takada, Y., Murakami, A., Aggarwal, B.B., 2005. Identification of a novel blocker of I
kappa B alpha kinase that enhances cellular apoptosis and inhibits cellular invasion through
suppression of NF-kappa B-regulated gene products. Journal of Immunology, 174, 7383-7392
Ikawati, Z., Wahyuono, S., Maeyama, K., 2001. Screening of several Indonesian medicinal plants for
their inhibitory effect on histamine release from RBL-2H3 cells. Journal of Ethnopharmacology.
75, 249-256
Imayama, T., Yoshihara, N., Fukuchi-Mizutani, M., Tanaka, Y., Ino, I., Yabuya, T., 2004. Isolation and
characterization of a cDNA clone of UDP-glucose: anthocyanin 5-O-glucosyltransferase in Iris
hollandica. Plant Cell, 167, 1243-1248
Ishikawa, T., Funahashi, T., Kudo,J., 2000. Effectiveness of the Kampo kami-shoyo-san (TJ-24) for
tremor of antipsychotic-induced parkinsonism. Psychiatry and Clinical Neurosciences, 54, 579-582
Ishimaru, K., Yoshimatsu, K., Yamakawa, T., Kamada, H., Shimomura, K., 1992. Phenolic Constituents
in Tissue-Cultures of Phyllanthus niruri. Phytochemistry 1992, 31, 2015-2018
Ismail, N., Pihie, A.H.L., Nallapan M., 2005. Xanthorrhizol induces apoptosis via the up-regulation of
Bax and p53 in Hela cells. Anticancer Reasearch, 25, 2221-2227
Iwo, M.I., Soemardji, A.A., Retnoningrum, D.S., Sukrasno, Mar’u, U.U., 2000. Immunostimulating
effect of Pule (Alstonia scholaris L. R.Br., Apocynaceae) bark extracts. Clinical Hemorheology
and Microcirculation, 23, 177-183
Jackson, D.E., Dewick, P.M., 1984. Biosynthesis of Podophyllum Lignans .1. Cinnamic acid precursors
of podophyllotoxin in Podophyllum hexandrum. Phytochemistry, 23, 1029-1035
Jagetia, G.C., Baliga, M.S. 2005. The effect of seasonal variation on the antineoplastic activity of
Alstonia scholaris R. Br. in HeLa cells. Journal of Ethnopharmacology, 96, 37-42
Jagetia, G.C., Baliga, M.S., 2004. Effect of Alstonia scholaris in enhancing the anticancer activity of
berberine in the Ehrlich ascites carcinoma-bearing mice. Journal of Medical Food, 7, 235-244
Janssen, A.M., Scheffer, J.J.C., 1985. Acetoxychavicol acetate, an antifungal component of Alpinia
galanga. Planta Medica, 6, 507-511
Ji, L.L., Wang, Z., Dong, F., Zhang, W.B., Wang, Z.T., 2005. Andrograpanin, a compound isolated from
anti-inflammatory traditional Chinese medicine Andrographis paniculata, enhances chemokine
SDF-1 alpha-induced leukocytes chemotaxis. Journal of Cellular Biochemistry, 95, 970-978
Jirovetz, L., Buchbauer, G., Ngassoum, M.B., Geissler, M., 2002. Aroma compound analysis of Piper
nigrum and Piper guineense essential oils from Cameroon using solid-phase microextraction-gas
chromatography, solid-phase microextraction-gas chromatography-mass spectrometry and
olfactometry. Journal of Chromatography A, 976, 265-275
Jitoe, A., Masuda, T., Tengah, I.G.P., Suprapta, D.N., Gara, I.W., Nakatani, N., 1992. Antioxidant
activity of tropical ginger extracts and analysis of the contained curcuminoids. Journal of
Agricultural and Food Chemistry, 40, 1337-1340

112
Joseph, H., Gleye, J., Moulis, C., Mensah, L.J., Roussakis, C., Gratas, C., 1988. Justicidin B, a cytotoxic
principle from Justicia pectoralis. Journal of Natural Products, 51, 599-600.
Joulain, D., König, W.A., The Atlas of Spectral Data of Sesquiterpene Hydrocarbons. E.B-Verlag,
Hamburg, 1998.
Kamei, J., Saitoh, A., Asano, T., Nakamura, R., Ichiki, H., Iiduka, A., Kubo, M., 2005. Pharmacokinetic
and pharmacodynamic profiles of the antitussive principles of Glycyrrhizae radix (licorice), a main
component of the Kampo preparation Bakumondo-to (Mai-men-dong-tang). European Journal of
Pharmacology, 507, 163-168
Kamil, W.D., Dewick, P.M., 1986. Biosynthesis of Podophyllum lignans .4. Biosynthetic relationship of
aryltetralin lactone lignans to dibenzylbutyrolactone lignans. Phytochemistry, 25, 2093-2102
Kaminaga, Y., Sahin, F.P., Mizukami, H., 2004. Molecular cloning and characterization of a
glucosyltransferase catalyzing glucosylation of curcumin in cultured Catharanthus roseus cells.
FEBS Letters, 567, 197-202
Kardono, L.B.S., Angerhofer, C.K., Tsauri, S., Padmawinata, K., Pezzuto, J.M., Kinghorn, A.D., 1991.
Cytotoxic and antimalarial constituents of the roots of Eurycoma longifolia. Journal of Natural
Products, 54, 1360-1367
Kardono, L.B.S., Tsauri, S., Padmawinata, K., Pezzuto, J.M., Kinghorn, A.D., 1990. Studies on
Indonesian Medicinal-Plants 2. Cytotoxic constituents of the bark of Plumeria rubra collected in
Indonesia. Journal of Natural Products, 53, 1447-1455
Karunagaran, D., Rashmi, R., Kumar, T.R.S., 2005. Induction of apoptosis by curcumin and its
implications for cancer therapy. Current Cancer Drug Target, 5, 117-129
Kassuya, U.A.L., Leite, D.F.P., De Melo, L.V., Rehder, V.L.G., Calixto, J.B., 2005. Anti-inflammatory
properties of extracts, fractions and lignans isolated from Phyllanthus amarus. Planta Medica,
71,721-726
Keawpradub, N., Kirby, G.C., Steele, J.C.P., Houghton, P.J., 1999. Antiplasmodial activity of extracts
and alkaloids of three Alstonia species from Thailand. Planta Medica, 65, 690-694
Khan, M.R., Omoloso, A.D., Kihara, M., 2003. Antibacterial activity of Alstonia scholaris and Leea
tetramera. Fitoterapia, 74, 736-740
Khanna, A.K., Rizvi, R., Chander, R.J., 2002. Lipid lowering activity of Phyllanthus niruri in
hyperlipernic rats. Journal of Ethnopharmacology, 82, 19-22
Khanuja, S.P.S., Shasany, A.K., Darokar, M.P., Kumar, S.J., 1999. Rapid isolation of DNA from dry
and fresh samples of plants producing large amounts of secondary metabolites and essential oils.
Plant Molecular Biology Reporter, 17, 1-7
Kim, I.T., Park, H.J., Nam, J.H., Park, Y.M., Won, J.H., Choi, J., Choe, B.K., Lee, K.T., 2005. In vitro
and in vivo anti-inflammatory and antinociceptive effects of the methanol extract of the roots of
Morinda officinalis. Journal of Pharmacy and Pharmacology, 57, 607-615
Kim, K.J., Yu, H.H., Cha, J.D., Seo, S.J., Choi, N.Y., You, Y.O., 2005. Antibacterial activity of
Curcuma longa L. against methicillin-resistant Staphylococcus aureus. Phytotherapy Research, 19,
599-604
King, S.R., Carlson, T.J., Moran, K., 1996. Biological diversity, indigenous knowledge, drug discovery
and intellectual property rights: creating reciprocity and maintaining relationships. Journal of
Ethnopharmacology, 51, 45-57
Rcfcrcnccs
113
Kirana C., Record, I.R., McIntosh, G.H., Jones, G.P., 2003. Screening for antitumor activity of 11
species oh Indonesian Zingiberaceae using human MCF-7 and HT-29 cancer cells. Pharmaceutical
Biology, 41, 271-276
Koba, K., Sanda, K., Raynaud, C., Mandin, D., Millet, J., Chaumont, J.P., 2003. Antimicrobial activity
of essential oils of Cymbopogon citratus L. (DC) Stapf., C. nardus L. rendle and C. schoenanthus
L. Spreng. Journal de Mycologie Medicale, 13, 175-180
Kohara, A., Nakajima, C., Hashimoto, K., Ikenaga,T., Tanaka, H., Shoyama, Y., Yoshida, S., Muranaka,
T., 2005. A novel glucosyltransferase involved in steroid saponin biosynthesis in Solanum
aculeatissimum. Plant Molecular Biology, 57, 2, 225-239
Konstantinov, S.M., Eibl, H., Berger, M.R., 1999. BCR-ABL influences the antileukaemic efficacy of
alkylphosphocholines. British Journal of Haematology, 107, 365-374
Konturek, J.W., Thor, P., Maczka, M., Stoll, R., Domschke, W., Konturek, S.J., 1994. Role of
cholecystokinin in the control of gastric emptying and secretory response to a fatty meal in normal
subjects and duodenal ulcer patients. Scandinavian Journal of Gastroenterology, 29, 583-590
Koul, J.L., Koul, S.K., Taneja, S.C., Dhar, K.L., 1996. Oxygenated cyclohexanes from Piper cubeba.
Phytochemistry, 41, 1097-1099
Koulman, A., Bos, R., Medarde, M., Pras, N., Quax, W.J., 2001. A fast and simple GC-MS method for
lignan profiling in Anthriscus sylvestris and biosynthetically related plant species. Planta Medica,
67, 858-862
Kubo, I., Murai, Y., Soediro, I., Soetarno, S., Sastrodihardjo, S., 1992. Cytotoxic Anthraquinones from
Rheum palmatum. Phytochemistry, 31, 1063-1065
Kubo, I., Murai, Y., Soediro, I., Soetarno, S., Sastrodihardjo, S., 1991. Efficient isolation of glycosidase
inhibitory stilbene glycosides from Rheum palmatum. Journal of Natural Products, 54, 1115-1118
Kubo, M., Ma, S.P., Wu, J.X., Matsuda, H., 1996. Anti-inflammatory activities of 70% methanolic
extract from Cinnamomi cortex. Biological & Pharmaceutical Bulletin, 19, 1041-1045
Kumar, R.A., Sridevi, K., Kumar, N.V., Nanduri, S., Rajagopal, S., 2004. Anticancer and
immunostimulatory compounds from Andrographis paniculata. Journal of Ethnopharmacology,
92, 291-295
Langmead, L., Makins, R.J., Rampton, D.S., 2004. Anti-inflammatory effects of Aloe vera gel in human
colorectal mucosa in vitro. Alimentary Pharmacology & Therapeutics, 19, 521-527
Lawrence, B.M., 1980. New trends in essential oils. Perfumer & Flavorist, 5, 27-32
Leaman, D.J., Arnason, J.T., Yusuf, R., Roemantyo, H.S., Soedjito, H., Angerhofer, C.K., Pezzuto, J.M.,
1995. Malaria remedies of the Kenyah of the Apo Kayan, East Kalimantan, Indonesian Borneo: A
quantitative assessment of local consensus as an indicator of biological efficacy. Journal of
Ethnopharmacology, 49, 1-16
Lee, C.W., Hong, D.H., Han, S.B., Park, S.H., Kim, H.K., Kwon, B.M., Kim, H.M., 1999. Inhibition of
human tumor growth by 2 '-hydroxy- and 2 '-benzoyloxycinnamaldehydes. Planta Medica, 65,
263-266
Lee, S.A., Hong, S.S., Han, X.H., Hwang, J.S., Oh, G.J., Lee, K.S., Lee, M.K., Hwang, B.Y., Ro, J.S.,
2005. Piperine from the fruits of Piper longum with inhibitory effect on monoamine oxidase and
antidepressant-like activity. Chemical & Phamaceutical Bulletin, 53, 832-835

114
Lee, H.S., Ahn, Y.J., 1998. Growth-inhibiting effects of Cinnamomum cassia bark-derived materials on
human intestinal bacteria. Journal of Agricultural and Food Chemistry, 46, 8-12
Li, Y., Baldauf, S., Lim, E.K., Bowles, D.J., 2001. Phylogenetic analysis of the UDP-glycosyltransferase
multigene family of Arabidopsis thaliana. Journal of Biological Chemistry, 276, 4338-4343
Li, Y., Xu, C., Zhang, Q.A., Liu, J.Y., Tan, R.X., 2005. In vitro anti-Helicobacter pylori action of 30
Chinese herbal medicines used to treat ulcer diseases. Journal of Ethnopharmacology, 98, 329-333
Lim, E.K., Jackson, R.G., Bowles, D.J., 2005. Identification and characterisation of Arabidopsis
glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde. FEBS
Letters, 579, 2802-2806
Limyati, D.A., Juniar, B.L.L., 1998. Jamu gendong, a kind of traditional medicine in Indonesia: the
microbial contamination of its material and end products. Journal of Ethnopharmacology, 63, 201-
208
Lin, S.C., Lin, C.C., Lin, Y.H., Supriyatna, S., Pan, S.L., 1996. The protective effect of Alstonia
scholaris R Br on hepatotoxin-induced acute liver damage. American Journal of Chinese
Medicine, 24, 153-164
Liu, I.M., Liou, S.S., Lan, T.W., Hsu, F.L., Cheng, J.T., 2005. Myricetin as the active principle of
Abelmoschus moschatus to lower plasma glucose in streptozotocin-induced diabetic rats. Planta
Medica, 71, 617-621
Liu, J., Lin, H., McIntosh, H., 2001. Genus Phyllanthus for chronic hepatitis B virus infection: a
systematic review. Journal of Viral Hepatitis, 8, 358-366
Lo Cantore, P., Iacobellis, N.S., De Marco, A., Capasso, F., Senatore, F., 2004. Antibacterial activity of
Coriandrum sativum L. and Foeniculum vulgare Miller var. vulgare (Miller) essential oils. Journal
of Agricultural and Food Chemistry, 52, 7862-7866
Lohezic-Le Devehat, F., Bakhtiar, A., Bezivin, C., Amoros, M., Boustie, J., 2002. Antiviral and
cytotoxic activities of some Indonesian plant. Fitoterapia, 73, 400-405
Lorenc-Kukula, K., Korobczak, A., Aksamit-Stachurska, A., Kostyn, K., Lukaszewicz, M., Szopa, J.,
2004. Glucosyltransferase: The gene arrangement and enzyme function. Cellular & Molecular
Biology Letters, 9, 935-946
Ma’at, S. 2002. Protective and immunomodulating effect of phyllanthus niruri's extract in the treatment
of cancer. International Journal of Cancer, 100 (S13), 72
MacRae, W.D., Hudson, J.B., Towers, G.H., 1989. The antiviral action of lignans. Planta Medica, 55,
531-535
Manju, V., Nalini, N., 2005. Chemopreventive efficacy of ginger, a naturally occurring anticarcinogen
during the initiation, post-initiation stages of 1,2 dimethylhydrazine-induced colon cancer. Clinica
Chimica Acta, 358, 60-67
Martins, A.P., Salgueiro, L., Vila, R., Tomi, F., Canigueral, S., Casanova, J., Proença da Cuhna, A.,
Adzett, T., 1998. Essential oils from four Piper species. Phytochemistry, 49, 2019-2023
Matsubara, T., Bohgaki, T., Watarai, M., Suzuki, H., Ohashi, K., Shibuya, H., 1999. Antihypertensive
actions of methylripariochromene A from Orthosiphon aristatus, an Indonesian traditional
medicinal plant. Biological & Pharmaceutical Bulletin, 22, 1083-1088
Rcfcrcnccs
115
Matsuda, H., Morikawa, T., Managi, H., Yoshikawa, M., 2003. Antiallergic principles from Alpinia
galanga: Structural requirements of phenylpropanoids for inhibition of degranulation and release
of TNF-alpha and IL-4 in RBL-2H3 cells. Bioorganic & Medicinal Chemistry Letters, 13, 3197-
3202
Matsuda, H., Pongpiriyadacha, Y., Morikawa, T., Ochi, M., Yoshikawa, M., 2003. Gastroprotective
effects of phenylpropanoids from the rhizomas of Alpinia galanga in rats: structural requirements
and mode of action. European Journal of Pharmacology, 471, 59-67
Mehrotra, R., Rawat, S., Kulshreshtha, D.K., Patnaik, G.K., Dhawan, B.N., 1990. In vitro studies on the
effect of certain natural products against hepatitis B virus. Indian Journal of Medicinal Research,
92, 133-138
Middel, O., Woerdenbag, H.J., Van Uden, W., Van Oeveren, A., Jansen, J.F.G.A., Feringa, B.L.,
Konings, A.W.T., Pras, N., Kellogg, R.M., 1995. Synthesis and cytotoxicity of novel lignans.
Jornal of Medicinal Chemistry, 38, 2112-2117
Millonig, G., Stadlmann, S., Vogel, W., 2005. Herbal hepatotoxicity: Acute hepatitis caused by a Noni
preparation (Morinda citrifolia). European Journal of Gastroenterology and Hepatology, 17, 445-
447
Miyakoshi, M., Yamaguchi, Y., Takagaki, R., Mizutani, K., Kambara, T., Ikeda, T., Zaman, M. S.,
Kakihara, H., Takenaka, A., Igarashi, K., 2004. Hepatoprotective effect of sesquiterpenes in
turmeric. Biofactors, 21, 167-170
Mohagheghzadeh, A., Schmidt, T.J., Alfermann, A.W., 2002. Arylnaphthalene lignans from in vitro
cultures of Linum austriacum. Journal of Natural Products, 65, 69-71
Mojica-Henshaw, M.P., Francisco, A.D., De Guzman, F., Tigno, X.T., 2003. Possible
immunomodulatory actions of Carica papaya seed extract. Clinical Hemorheology and
Microcirculation, 29, 219-229
Molog, G., Empt, U., Kuhlman, S., Van Uden, W., Pras, N., Alferman, A.W., Petersen, M., 2001.
Deoxypodophyllotoxin 6-hydroxylase, a cytochrome P450 monooxygenase from cell cultures of
Linum flavum involved in the biosynthesis of cytotoxic lignans. Planta, 214, 288-294
Moraes, R.M., Bedir, E., Barret, H., Burandt Jr., C., Canel, C., Khan, I.A., 2002. Evaluation of
Podophyllum peltatum; accessions for podophyllotoxin production. Planta Medica, 68, 341-344
Morikawa, T., Matsuda, H., Yamaguchi, I., Pongpiriyadacha, Y., Yoshikawa, M., 2004. New amides
and gastroprotective constituents from the fruit of Piper chaba. Planta Medica, 70, 152-159
Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to
proliferation and cytotoxicity assays. Journal of Immunology Methods, 65, 55-63.
MS Library NIST107, National Institute of Standard and Technology.
Murashige, T., Skoog, F., 1962. A Revised medium for rapid growth and bio assays with tobacco tissue
cultures. Physiologia Plantarum, 15, 473-497
Mutalik, S., Chetana, M., Sulochana, B., Devi, P.U., Udupa, N., 2005. Effect of Dianex, a herbal
formulation on experimentally induced diabetes mellitus. Phytotherapy Research, 19, 409-415
Nader, B.L., Cardoso, Taketa, A.T., Iturriaga, G., Pereda-Miranda, R., Villarreal, M.L., 2004. Genetic
transformation of Glaphimia glauca by Agrobacterium rhizogenes and the production of
norfriedelanes. Planta Medica, 70, 1174-1179

116
Naik, A.D., Juvekar, A.R., 2003. Effects of alkaloidal extract of Phyllanthus niruri on HIV replication.
Indian Journal of Medical Sciences, 57, 387-393
Nawawi, A., Nakamura, N., Hattori, M., Kurokawa, M., Shiraki, K., 1999. Inhibitory effects of
Indonesian medicinal plants on the infection of herpes simplex virus type 1. Phytotherapy
Research, 13, 37-41
Notka, F., Meier, G., Wagner, R., 2004. Concerted inhibitory activities of Phyllanthus amarus on HIV
replication in vitro and ex vivo. Antiviral Research, 64, 93-102
Ochman, H., Gerber, A.S., Hartl, D.L., 1988. Genetic applications of an inverse polymerase chain
reaction. Genetics, 120, 621-623
Ogata, T., Higuchi, H., Mochida, S., Matsumoto, H., Kato, A., Endo, T., Kaji, A., Kaji, H., 1992. HIV-1
reverse transcriptase inhibitor from Phyllanthus niruri. AIDS Research and Human Retroviruses,
11, 1937-1944
Ohashi, K., Bohgaki, T., Matsubara, T., Shibuya, H., 2000. Indonesian medicinal plants. XXIII.
Chemical structures of two new migrated pimarane-type diterpenes, neoorthosiphols A and B, and
suppressive effects on rat thoracic aorta of chemical constituents isolated from the leaves of
Orthosiphon aristatus (Lamiaceae). Chemical & Pharmaceutical Bulletin, 48, 433-435
Ojewole, J.A.O., 2004. Potentiation of the anti-inflammatory effect of Anacardium occidentale (Linn.)
stem-bark aqueous extract by grapefruit juice. Methods and Findings in Experimental and Clinical
Phamacology, 26, 183-188
Okazaki, Y., Iqbal, M. Okada, S., 2005. Suppressive effects of dietary curcumin on the increased
activity of renal ornithine decarboxylase in mice treated with a renal carcinogen, ferric
nitrilotriacetate. Biochimica et Biophysica Acta, 1740, 357-366
Okigawa, M., Maeda, T., Kawano, N., 1970. The isolation and structure of three new lignans from
Justicia procumbens Linn. Var. Leucantha Honda. Tetrahedron, 26, 4301–4305
Omar, S., Zhang, J., MacKinnon, S., Leaman, D., Durst, T., Philogene, B.J.R., Arnason, J.T., Sanchez-
Vindas, P.E., Poveda, L., Tamez, P.A., Pezzuto, J.M., 2003. Traditionally-used antimalarials from
the Meliaceae. Current Topics in Medicinal Chemistry, 3, 137-139
Orav, A., Stylova, I., Kailas, T., Müürisepp, M., 2004. Effect of storage on the essential oil composition
of Piper nigrum L. fruits of different ripening states. Journal of Agricultural and Food Chemistry.
52, 2582-2586
Otaka, T., Mori, H., Morimoto, M., Ueba, N., Sutardjo, S., Kusumoto, I.T., Hattori, M., Namba, T.,
1995. Screening of Indonesian plant-extracts for anti-human-immunodeficiency-virus type-1
(HIV-1) activity. Phytotherapy research, 9, 6-10
Oyedeji, A.O., Adeniyi, B.A., Ajayi, O., König, W.A., 2005. Essential oil composition of Piper
guineense and its antimicrobial activity. Another chemotype from Nigeria. Phytotherapy
Research, 19, 362-364
Padma, P., Pramod, N.P., Thyagarajan, S.P., Khosa, R.L., 1998. Effect of the extract of Annona
muricata and Petunia nyctaginiflora on herpes simplex virus. Journal of Ethnopharmacology, 61,
81-83
Park, K.M., Cho, J.H., Sohn, J.H., Lee, S.H., Hwang, J.K., 2005. Antibacterial activity of panduratin A
isolated from Kaempferia pandurata against Porphyromonas gingivalis. Food Science and
Biotechnology, 14, 286-289
Rcfcrcnccs
117
Parmar, V.S., Jain, S.C., Bisht, K.S., Jain, R., Taneja, P., Jha, A., Tyagi, O.D., Prasad, A.K., Wengel, J.,
Olsen, C.E., Boll, P.M., 1997. Phytochemistry of the genus Piper. Phytochemistry, 46, 597-673
Paul, J., Duncan, J.R., Sharp, P., Norris, A., Siddiq, M.A., Bacon, C., Weighill, J., 2005.
Agranulocytosis and citrobacter infection associated with jamu, a herbal remedy containing
phenylbutazone. Clinical Infectious Diseases. 40, 1859-1860
Petersen, M., Alfermann, A.W., 2001. The production of cytotoxic lignans by plant cell cultures.
Applied Microbiology & Biotechnology, 55, 135-142
Pettit, G.R., Schaufelberger, D.E., 1988. Isolation and structure of the cytostatic lignan glycoside
phyllanthostatin A. Journal of Natural Products, 51, 1104-1112
Poolsup, N., Suthisisang, C., Prathanturarug, S., Asawamekin, A., Chanchareon, U., 2004. Andrographis
paniculata in the symptomatic treatment of uncomplicated upper respiratory tract infection:
systematic review of randomized controlled trials. Journal of Clinical Pharmacy and Therapeutics,
29, 37-45
Prabhu, B.R., Mulchandani, N.B., 1985. Lignans from Piper cubeba. Phytochemistry, 24, 329-331
Pramono, E., 2002. The traditional use of traditional knowledge and medicinal plants in Indonesia.
Multi-Stakeholder dialoque on trade, intellectual property and biological resources in Asia, BRAC
Centre for Development Management, Rajendrapur, Bangladesh
Pu, H.F., Huang, W.J., Tseng, W.M., Wang, S.W., Liu, Y.W., Doong, M.L., Wang, P.S., 2004. Effects
of juice from Morinda citrifolia (Noni) on gastric emptying in male rats. Chinese Journal of
Physiolgy, 47, 169-174
Rajasekaran, S., Sivagnanam, K., Ravi, K., Subramanian, S., 2004. Hypoglycemic effect of Aloe vera
gel on streptozotocin-induced diabetes in experimental rats. Journal of Medicinal Food, 7, 61-66
Ram, V.J., 2001. Herbal preparations as a source of hepatoprotective agents. Drug News & Perspective,
14, 353-363
Reddy, S.V., Srinivas, P.V., Praveen, B., Kishore, K.H., Raju, B.C., Murthy, U.S., Rao, J.M., 2004.
Antibacterial constituents from the berries of Piper nigrum. Phytomedicine, 11, 697-700
Reed, D.W., Davin, L., Jain, J.C., Deluca, V., Nelson, L., Underhill, E.W., 1993. Purification and
properties of UDP-glucose thiohydroxymate glucosyltransferase from Brasica napus L. seedling.
Archives Biochemistry and Biophysics, 305, 526-532
Rilantono, L.I., Yuwono, H.S., Hugrahadi, T., 2000. Dietary antioxidative potential in arteries. Clinical
Hemorheology and Microcirculation, 23, 113-117
Riswan, S., Roemantyo, H.S., 2002. Jamu as traditional medicine in Java, Indonesia. South Pacific
Study, 23, 2-10
Row, L.R., Srinivasulu, C., 1964. New Lignans from Phyllanthus niruri Linn. Tetrahedron Letters, 24,
1557-1567
Rukachaisirikul, T., Siriwattanakit, P., Sukcharoenphol, K., Wongvein, C., Ruttanaweang, P.,
Wongwattanavuch, P., Suksamrarn, A., 2004. Chemical constituents and bioactivity of Piper
sarmentosum. Journal of Ethnopharmacology, 93, 173-176
Runnie, I., Salleh, M.N., Mohamed, S., Head, R.J., Abeywardena, M.Y., 2004. Vasorelaxation induced
by common edible tropical plant extracts in isolated rat aorta and mesenteric vascular bed. Journal
of Ethnopharmacology, 92, 311-316

118
Sabino, M.A.C., Ghilardi, J.R., Jongen, J.L.M., Keyser, C.P., Luger, N.M.. Mach, D.B., Peters C.M.,
Rogers, S.D., Schwei, M.J., De Felipe, C., Mantyh, P.W., 2002. Studies on disease-modifying
antirheumatic drugs: synthesis of novel quinoline and quinazoline derivatives and their anti-
inflammatory effect. Cancer Research, 62, 7343–7349
Santos, A.R., Filho, V.C., Niero, R., Vianna, A.M., Moreno, F.N., Campos, M.M., Yunes, R.A., Calixto,
J.B., 1994. Analgesic effects of callus culture extracts from selected species of Phyllanthus in
Mice. Journal of Pharmacy and Pharmacology, 46, 755-759
Sasaki, N., Wada, K., Koda, T., Kasahara, K., Adachi, T., Ozeki, Y., 2005. Isolation and
characterization of cDNAs encoding an enzyme with glucosyltransferase activity for cyclo-DOPA
from four o’clocks and feather cockscombs. Plant and Cell Physiology, 46, 666-670
Satroamidjojo, 2001. Obat Asli Indonesia, Dian Rakyat, Jakarta
Satyanarayana, P., Venkateswarlu, 1991. Isolation, structure and synthesis of new diarylbutane lignans
from Phyllanthus niruri - synthesis of 5'-desmethoxy niranthin and an antitumor extractive.
Tetrahedron, 47, 8931-8940
Satyanarayana, P., Subrahmanyam, P., Viswanatham, K.N., 1988. New seco- and hydroxyl-lignans from
Phyllanthus niruri. Journal of Natural Products, 51, 44-49
Sayyah, M., Mahboubi, A., Kamalinejad, M., 2002. Anticonvulsant effect of the fruit essential oil of
Cuminum cyminum in mice. Pharmaceutical Biology, 40, 478-4809
Schmid, G., Grisebach, H., 1982. Enzymatic synthesis of lignin precursor: purification and properties of
UDP-glucose: coniferyl alcohol glucosyltransferase from cambial sap of spruce (Picea abies L.).
European Journal of Biochemistry, 123, 362-370
Seidel, V., Windhövel, J., Eaton, G., Alfermann, A.W., Arroo, R.R.J., Medarde, M., Petersen, M.,
Woolley, J.G. 2002. Biosynthesis of podophyllotoxin in Linum album cell cultures. Planta, 215,
1031-1039
Sharma, R.A., Gescher, A.J., Steward, W.P., 2005. Curcumin: The story so far. European Journal of
Cancer, 41, 1955-1968
Sheena, N., Ajith, T.A., Janardhanan, K.K., 2003. Anti-inflammatory and anti-nociceptive activities of
Ganoderma lucidum occurring in South India. Pharmaceutical Biology, 41, 301-304
Shibuya, H., Kitagawa, I., 1996. Chemical study of Indonesian medicinal plants. Yakugaku Zasshi-
Journal of the Pharmaceutical Society of Japan, 116, 911-927
Shimizu, M., Horie, S., Terashima, S., Ueno, H., Hayashi, T., Arisawa, M., Suzuki, S., Yshizaki, M.,
Morita, N., 1989. Studies on aldose reductase inhibitors from natural-products. 2. Active
components of a Paraguayan crude drug para-parai mi, Phyllanthus-niruri. Chemical &
Pharmaceutical Bulletin, 37, 2531-2532
Singha, P.K., Roy, S., Dey, S., 2003. Antimicrobial activity of Andrographis paniculata. Fitoterapia, 74,
692-694
Singh, B., Agrawal, P.K., Thakur, R.S., 1989. A new lignan and a new neolignan from Phyllanthus
niruri. Journal of Natural Products, 52, 48-51
Slightom, J.L., Durand-Tardif, M., Jouanin, L., Tepfer, D., 1986. Nucleotide sequence analysis of TL-
DNA of Agrobacterium rhizogenes agropine type plasmid. Identification of open reading frames.
Journal of Biology and Chemistry, 261, 108–121
Rcfcrcnccs
119
Smollny, T., Wichers, H. J., Kalenberg, S., Shahsavari, A., Petersen, M., Alfermann, A.W., 1998.
Accumulation of podophyllotoxin and related lignans in cell suspension cultures of Linum album.
Phytochemistry, 48, 975-979
Soedjarto, 1996. Biodiversity prospecting and benefit-sharing: perspectives from the field. Journal of
Ethnopharmacology, 51, 1-15
Sripanidkulchai, B., Wongpanich, V., Laupattarakasem, P., Suwansaksri, J., Jirakulsomchok, D., 2001.
Diuretic effects of selected Thai indigenous medicinal plants in rats. Journal of
Ethnopharmacology, 75, 185-190
Sridhar, S.B., Sheetal, U.D., Pai, M.R.S.M., Shastri, M.S., 2005. Preclinical evaluation of the
antidiabetic effect of Eugenia jambolana seed powder in streptozotocin-diabetic rats. Brazilian
Journal of Medical an Biological Research, 38, 463-468
Steffan, R., Watjen, W., Michels, G., Niering, P., Wray, V., Ebel, R., Edrada, R., Kahl, R., Proksch, P.,
2005. Polyphenols from plants used in traditional Indonesian medicine (Jamu): uptake and
antioxidative effects in rat H4IIE hepatoma cells. Journal of Pharmacy and Pharmacology, 57,
233-240
Stevinson, C., Huntley, A., Ernst, E., 2002. A systematic review of the safety of kava extract in the
treatment of anxiety. Drug Safety, 25: 251-261
Subeki, Matsura, H., Takahashi, K., Yamasaki, M., Yamato, O., Maede, Y., Katakura, K., Suzuki, M.,
Trimurningsih, Chairul, Yoshihara,T., 2005. Antibabesial activity of protoberberine alkaloids and
20-hydroxyecdysone from Arcangelisia flava against Babesia gibsoni in culture. Journal of
Veterinary Medical Science, 66, 871-874
Subeki, S., Matsuura, H., Takahashi, K., Yamasaki, M., Yamato, O., Maede, Y., Katakura, K.,
Kobayashi, S., Trimurningsih,, Chairul, Yoshihara T., 2005. Anti-babesial and anti-plasmodial
compounds from Phyllanthus niruri. Journal of Natural Products, 68, 537-539
Suharmiati, 2003. Menguak tabir dan potensi jamu gendong. Agromedia Pustaka, Jakarta
Sukandar, E.Y., Suganda, A.G., Muslikhati., 1999. The effect of the volatile oil of bark and leaves of
Cinnamomum burmanni against bacteria and fungi (in Indonesian). Indonesian Journal of
Pharmacy, 10, 31-39
Sukardiman, Darwanto, A., Tanjung, M., Darmadi, M.A., 2000. Cytotoxic mechanism of flavonoid from
temu kunci (Kaempferia pandurata) in cell culture of human mammary carcinoma. Clinical
Hemorheology and Microcirculation, 23, 185-190
Sumathykutty, M.A., Rao, J.M., Padmakumari, K.P., Narayanan, C.S., 1999. Essential oil constituents
of some Piper species. Flavour and Fragrance Journal, 14, 279-282
Svensson, B., Pettersson, H., 2003. Reumacon (CPH82) showed similar x-ray progression and clinical
effects as methotrexate in a two year comparative study on patients with early rheumatoid arthritis.
Scandinavian Journal of Rheumatology, 32, 83-88
Syamasundar, K.V., Singh, B., Thakur, R.S., Husain, A., Kiso, Y., Hikino, H., 1985. Series on liver-
protective drugs .19. Antihepatotoxic principles of Phyllanthus niruri herbs. Journal of
Ethnopharmacology, 14, 41-44



120
Taguchi, G., Yazawa, T., Hayashida, N., Okazaki, M., 2001. Molecular cloning and heterologous
expression of novel glucosyltransferase fro tobacco cultured cells that have broad substrate
specificity and are induced by salicylic acid and auxin. European Journal of Biochemsitry, 268,
4086-4094
Takara, K., Horibe, S., Obata, Y., Yoshikawa, E., Ohnishi, N., Yokoyama, T., 2005. Effects of 19 herbal
extracts on the sensitivity to paclitaxel or 5-fluorouracil in HeLa cells. Biological &
Pharmaceutical Bulletin, 28, 138-142
Tan, M.L., Kuroyanagi, M., Sulaiman, S.F., Najimudin, N., Muhammad, T.S.T., 2005. Cytotoxic
activities of major diterpenoid constituents of Andrographis paniculata in a panel of human tumor
cell lines. Pharmaceutical Biology, 43, 501-508
Taneja, S.C., Koul, S.K., Pushpangadan, P., Dhar, K.L., Daniewski, W.M., Schilf, W., 1991.
Oxygenated cyclohexanes from Piper species. Phytochemistry, 30, 871-874
Tawata, M., Aida, K., Noguchi, T., Ozaki, Y., Kume, S., Sasaki, H., Chin, M., Onaya, T., 1992.
Antiplatetlet action of isoliquiritigenin, An aldose reductase inhibitor in licorice. European Journal
of Pharmacology, 212, 87-92
Tchoumbougnang, F., Zollo, P.H.A., Dagne, E., Mekonnen, Y., 2005. In vivo antimalarial activity of
essential oils from Cymbopogon citratus and Ocimum gratissimum on mice infected with
Plasmodium berghei. Planta Medica, 71, 20-23
Tezuka, Y., Terazono, M., Kusumoto, T.I., Hatanaka, Y., Kadota, S., Hattori, M., Namba, T., Kikuchi,
T., Tanaka, K., Supriyatna, S., 2000. Helicterins A-F, six new dimeric (7.5 ',8.2 ')-neolignans from
the Indonesian medicinal plant Helicteres isora. Helvetica Chimica Acta, 2908-2919
Tinker, A.C., Wallace, A.V., 2006. Selective inhibitors of inducible nitric oxide synthase: potential
agents for the treatment of inflammatory diseases. Current Topic of Medicinal chemistry, 6, 77-92
Tona, L., Cimanga, R.K., Mesia, K., Musuamba, C.T., De Bruyne, T., Apers, S., Hernans, N., Van
Miert, S., Pieters, L., Totte, J., Vlietinck, A.J., 2004. In vitro antiplasmodial activity of extracts and
fractions from seven medicinal plants used in the Democratic Republic of Congo. Journal of
Ethnopharmacology, 93, 27-32
Tona, L., Mesia, K., Ngimbi, N.P., Chrimwami, B., Okond’ahoka, Cimanga, K., de Bruyne, T., Apers,
S., Hermans, N., Totte, J., Pieters, L., Vlietinck, A.J., 2001. In-vivo antimalarial activity of Cassia
occidentalis, Morinda morindoides and Phyllanthus niruri. Annals of Tropical Medicine and
Parasitology, 95, 47-57
Trimurningsih, Subeki, Matsuura, H., Takahashi, K., Yamasaki, M., Yamato, O., Maede, Y., Katakura,
K., Suzuki, M., Kobayashi, S., Chainul, Yoshihara, T., 2005. Evaluation of the inhibitory activities
of the extracts of Indonesian traditional medicinal plants against Plasmodium falciparum and
Babesia gibsoni. Journal of Veterinary Medical Sciences, 67, 829-831
Tuchinda, P., Reutrakul, V., Claeson, P., Pongprayoon, U., Sematong, T., Santisuk, T., Taylor, W.C.,
2002. Anti-inflammatory cyclohexenyl chalcone derivatives in Boesenbergia pandurata.
Phytochemistry, 59, 169-173
Udoh, F.V., Udoh, P.B., 2005. Hepatotoxicity of the methanol extract of Carica papaya (paw-paw)
seeds in Wistar rats. Pharmaceutical Biology, 43, 349-352
United Nations, Convention on Biological Diversity, Rio de Janeiro, 1992
Rcfcrcnccs
121
Unny, R., Chauhan, A.K., Joshi, Y.C., Dobhal, M.P., Gupta, R.S., 2003. A review on potentiality of
medicinal plants as the source of new contraceptive principles. Phytomedicine, 10, 233-260
Usia, T., Watabe, T., Kadota, S., Tezuka, Y., 2005. Potent cyp3A4 inhibitory constituents of Piper
cubeba. Journal of Natural Products, 68, 64-68
Usia, T., Watabe, T., Kadota, S., Tezuka, Y., 2005. Metabolite-cytochrome P450 complex formation by
methylenedioxyphenyl lignans of Piper cubeba: mechanism-based inhibition. Life Sciences, 76,
2381-2391
Van Uden, W., Pras, N., Malingré, T.M., 1990a On the improvement of the podophyllotoxin production
by phenylpropanoid precursor feeding to cell cultures of Podophyllum hexandrum Royle. Plant
Cell Tissue and Organ Culture, 23, 217-224
Van Uden, W., Pras, N., Malingré, T.M., 1990b. The accumulation of podophyllotoxin-β-D-glucoside
by cell suspension cultures derived from the conifer Callitris drummondii. Plant Cell Reports, 9,
257-269
Van Uden, W., Homan, B., Woerdenbag, H.J., Pras, N., Malingré, T.M., Wichers, H.J., Harkes, M.,
1992. Isolation, purification, and cytotoxicity of 6-methoxypodophyllotoxin, a lignan from root
cultures of Linum flavum L. Journal of Natural Products, 55, 102-110
Van Uden, W., Pras, N., Homan, B., Malingré, T.M., 1991a. Improvement of 5-
methoxypodophyllotoxin using a new selected root culture of Linum flavum L. Plant Cell Tissue
and Organ Culture, 27, 115-121
Van Uden, W., Pras, N., Batterman, S., Visser, J.F., Malingré, T.M., 1991b. The accumulation and
isolation of coniferin from a high-producing cell suspension of Linum flavum L. Planta 183: 25-30
Van Uden, W., Bos, J.A., Boeke, G.M., Woerdenbag, H.J., Pras, N., 1997. The large scale isolation of
deoxypodophyllotoxin from rhizomas of Antriscus sylvestris followed by its bioconversion into 5-
methoxypodophyllotoxin β-D-glucoside by cell cultures of Linum flavum. Journal of Natural
Products, 60, 401-403
Vasilev, N.P., Ionkova, I., 2005. Cytotoxic activity of extracts from Linum cell cultures. Fitoterapia, 76,
50-53
Vasilev, N., Momekov, G., Zaharieva, M., Konstantinov, S., Bremner, P., Heinrich, M., Ionkova, I.,
2005. Cytotoxic activity of a podophyllotoxin-like lignan from Linum tauricum Willd. Neoplasma,
52, 425-429
Violon, C., Simeray, J., Leger, D., Chaumont, J. P., 1991 Plantes Med. Phytother. 1991, 25, 118-122
Vogt, T., Jones, P., 2000. Glycosyltransferases in plant natural products synthesis: characterization of a
supergene family. Trends in Plant Science, 5, 380-386
Vogt, T., Zimmermann, E., Grimm, R., Meyer, M., Strack, D., 1997. Are the caracteristics of betanidin
glucosyltransferases from cell suspension cultures of Dorotheanthus bellidiformis indicative of
their phylogenetic relationship with flavonoid glucosyltransferases?. Planta, 2003, 349-361
Walsky, R.L., Obach, R.S., 2004. Validated assays for human cytochrome P450 activities. Drug
Metabolism and Disposition, 32, 647-660
Wang, X.S., Liu, L., Fang, J.N., 2005. Immunological activities and structure of pectin from Centella
asiatica. Carbohydrate Polymers, 60, 95-101
WHO strategy for traditional medicine 2002-2005, Provisional Agenda, Regional Committee, p. 1-8

122
Woerdenbag, H.J., Van Uden, W., Frijlink, H.W., Lerk, C.F., Pras, N., Malingré, T.M., 1990. Increased
podophyllotoxin production in Podophyllum hexandrum cell suspension cultures after feeding
coniferyl alcohol as a þ-cyclodextrin complex. Plant Cell Reports, 9, 97-100
Wunder, D., William, H.B., 1999. Action of agent on glucosyltransferase from Streptococcus mutans in
solution and adsorbed to experimental pellicle. Archives Oral Biology, 44, 203-214
Xu, Y., Ku, B.S., Yao, H.Y., Lin, Y.H., Ma, X., Zhang, Y.H., Li, X.J., 2005. Antidepressant effects of
curcumin in the forced swim test and olfactory bulbectomy models of depression in rats.
Pharmacology Biochemistry and Behavior, 82, 200-206
Yang, B.K., Wilson, M.A., Cho, K.Y., Song, C.H., 2004. Hypoglycemic effect of exo- and endo-
biopolymers produced by submerged mycelial culture of Ganoderma lucidum in streptozotocin-
induced diabetic rats. Journal of Microbiology and Biotechnology, 14, 972-977
Yu, B.C., Hung, C.R., Chen, W.C., Cheng, J.T., 2003. Antihyperglycemic effect of andrographolide in
streptozotocin-induced diabetic rats. Planta Medica, 69, 1075-1079
Yun, J.M., Kwon, H.J., Mukhtar, H., Hwang, J.K., 2005. Induction of apoptosis by panduratin a isolated
from Kaempferia pandurata in human colon cancer HT-29 cells. Planta Medica, 701, 501-507
Yusuf, S., Agunu, A., Diana, M., 2004. The effect of Aloe vera A. Berger (Liliaceae) on gastric acid
secretion and acute gastric mucosal injury in rats. Journal of Ethnopharmacology, 93, 33-37
Zhang, C.Y., Kuroyangi, M., Tan, B.K., 1998. Cardiovascular activity of 14-deoxy-11,12-
didehydroandrographolide in the anaesthetised rat and isolated right atria. Pharmacological
Research, 38, 413-417
Zhang, C.Y., Tan, B.K.H., 1996. Hypotensive activity of aqueous extract of Andrographis paniculata in
rats. Clinical and Experimental Pharmacology and Physiology, 23, 675-678
Zheng, G.Q., Kenney, P.M., Lam, L.K.T., 1993. Potential anticarcinogenic natural products isolated
from lemongrass oil and galanga root oil. Journal of Agricultural and Food Chemistry, 41, 153-
156
Zhou, Y., Hu, C.P., Deng, P.Y., Deng, H.W., Yuan-Jian, L., 2004. The protective effects of ligustrazine
on ischemia reperfusion and DPPH free radical induced myocardial injury in isolated rat hearts.
Planta Medica, 70, 818-822
Zuhud, E.A.M., Aziz, S., Ghulamahdi, M., Andarwulan, N., Darusman, L.K., 2001. Dukungan teknologi
pengembangan obat asli Indonesia dari segi budaya, pelestarian dan pasca panen. Paper
presented at the workshop on agribusiness development based on biopharmaca, 13-15 November
2001, Departemen Pertanian, Jakarta, Indonesia

123
Curriculum Vitae
Elfahmi was born on 25 April 1969 in Ampang Pulai, a village 56 km South of Padang, West
Sumatera, Indonesia. He finished the primary and elementary school in the village where he was born.
In 1989, he moved from Ampang Pulai to Padang when he passed the university entrance examination,
for the Department of Pharmacy, Andalas University. He obtained his doctorandus degree in 1993 and
became a pharmacist (apoteker) in 1995. Immediately after completing his study in Padang, he received
a grant from the Indonesian government through the University Research and Undergraduate Education
(URGE) project for his master degree. He obtained his master degree from the Department of Pharmacy
(since 2006 named School of Pharmacy), Institut Teknologi Bandung (ITB) in 1997. He started his PhD
study in June 2001 at the Department of Pharmaceutical Biology, University of Groningen with the
research topic plant biotechnology. His PhD study was financially supported by the Quality for
Undergraduate Education (QUE) project of the Department of Biology, ITB, and partly by the
University of Groningen. In July 2006, he will continue his work at the School of Pharmacy, ITB, as a
lecturer and researcher. During his study in Groningen he got a chance to attend scientific meetings in
several countries to present his results and to publish his research output as listed below.

List of publications
1. Elfahmi, Batterman, S., Koulman, A., Hackl, T.,

Bos, R., Kayser, O., Woerdenbag, H.J., Quax, W.J.,
2006. Lignans from cell suspension cultures of Phyllanthus niruri, an Indonesian medicinal plants.
Journal of Natural Products, 2006, 55-58
2. Vasilev, N., Elfahmi, Bos, R., Kayser, O., Momekov, G., Konstantinov, S., Ionkova, I., 2006.
Production of cytotoxic arylnaphthalene lignan from genetically transformed root cultures of Linum
leonii. Journal of Natural Products (in press)
3. Elfahmi, Ruslan, K., Bos, R., Kayser, O., Woerdenbag, H.J., Quax, W.J. Jamu: The Indonesian
traditional herbal medicine (submitted)
4. Elfahmi, Ruslan, K., Batterman, S., Bos, R., Kayser, O., Woerdenbag, H.J., Quax, W.J. Lignan
profile of Piper cubeba, an Indonesian medicinal plant (submitted)
5. Elfami, Rein Bos, Komar Ruslan, Herman J. Woerdenbag, Oliver Kayser, and Wim J. Quax.
Essential oil constituents of Piper cubeba from Indonesia (submitted)
6. Elfahmi, Sieb Batterman, Albert Koulman, Henricus L. Hoge, Rein Bos, Oliver Kayser, Herman J.
Woerdenbag, Wim J. Quax. Reduced coniferin and enhanced 6-methoxypodophyllotoxin production
in Linum flavum cell suspension cultures after treatment with Na
2
EDTA (submitted)

124

125
Acknowledgements
Alhamdulillah, finally this thesis is finished. This could not happen without the support from
many people, especially from the members of the Pharmaceutical Biology group, University of
Groningen. Their support does not only include the scientific and academic aspects, but also the social
life during the years of my stay in the nice small city (fietsstad), Groningen. I would like to express my
gratitude to all of you.
I would like to thank the QUE Project of the Department of Biology, Institut Teknology
Bandung (ITB) for financial support during my PhD study, especially to Dr. Agus Dana Perdana and Dr.
Taufikurrahan, the directors of the project. My research was also partially supported by University of
Groningen through a scholarship.
I wish to thank my promotor Prof. Dr. Wim J. Quax who gave me a chance to do research for my
doctoral degree in his department, for his support and approval of this thesis. Together with Dr. Niesko
Pras, you introduced me to the scientific atmosphere in your country. Although it was only for short
time being supervised by Niesko, I appreciate it so much.
I would like to express my sincere appreciation to my copromotors, Dr. Herman Woerdenbag
and Dr. Oliver Kayser, for patience and guidance during my PhD period. Herman, you have always tried
to help me to find the solution for a problem I had. I know that you left the lab long time ago, but your
knowledge in practical manners still helps me a lot. Fast in answers, immediately in responding emails,
excellent in English, fast in correcting manuscript are things that I will never forget. It was nice when I
tried to send you an email in Dutch, you replied in Indonesian. Good luck with your Indonesian course,
and then we can continue talking in such way.
Working together in the lab with colleagues has stimulated me to finish my study. Therefore,
many thanks I want to address to my colleagues especially to my roommate Mattijs Julsing for
friendship, help and nice discussions. Sometime we had a quite hard discussion, even people thought
that we were fighting, but actually we were sharing ideas. I really enjoyed it, my best friend, Mattijs.
Albert Koulman, I remember that you sent me much literature before I started my study here, followed
by a lot of help and discussion concerning the research project. It is pity that you will not be here when I
defend my thesis. My thanks also go to other colleagues, Monique (ex-roommate), Almer, Charles,
Lidia, Johanna, Michiel, Asia, Agata, Ana, Ykelin, Henco, Ronald D., Ronald M., Robert, Linda, Helga,
Geeske, Nickolay, Carlos, Mariana, Melloney, Mags, and Peter. I want to thank my paranimfen Mattijs
and M. Chalid for helping me to arrange my deffence and subsequent party.
I greatly appreciate the important assistance from Rein Bos, Sieb Battermann, Janita
Zwinderman and Freeke van Putten. Rein’s expertise in analytical instruments (GC, GC-MS, HPLC)
helped me a lot. You are hand van de meester and more than that, you also supervised me in many
things. Sieb, you have prepared and maintained the plant cell culture that I have used for my research
project. You also introduced me to some nice Gronings words. Janita, I thank you for helping me to
arrange administration stuffs. Freeke, you helped me to prepare samples to be analysed. I appreciate it.
I would also like to thank Prof. Jacques Hille, Dr. Paul Dijkwel and Drs. Marcel G. Sturee who
gave me an opportunity to do work at the Department of Plant Molecular Biology in Haren. Paul and
Marcel your expertise in plant genetics improved my knowledge in this field that I just entered. I am
glad that I have good results on this topic although the work has to be continued to yield a nice
publication.
I am grateful to the members of the reading committee, Prof. Dr. F.A.J. Muskiet, Prof. Dr. T.J.
Schmidt and Prof. Dr. R. Verpoorte, for the evaluation of the manuscript and for their valuable
comments.



126
I want to thank my colleagues as well as my neighbours in Groningen, Heni Rachmawati,
Ikhlasul Amal and their family for many things. My thanks also go to all members of deGromiest (the
Indonesian Moslim Society in Groningen) for friendship. My family felt at home being together with
you all. It was nice to have routine gathering, discussion, tadarus, sharing ideas. I hope it can be kept
and developed further. To all members of PPI (Persatuan Pelajar Indonesia, Indonesian student society
in Groningen), I thanks you for your moral support.
My warmest gratitude goes to my colleagues in several cities in the Netherlands, Deden,
Iskandar, Zul, Zayd, Gun, Indra, Hasyim, Didin, Lukman, Satria, Iman, Billi and Oka for many helps
and kind friendship. Your houses were “my hotels” when I travelled to your city.
I would like to thank Martin and Sanneke Broekhuijsen for hospitality and friendship. My wife
learned Dutch from you and you learned Indonesian from her. It was nice time to have dinners at your
house. Martin, you are a good cooker of lekkere dingen. Also to Henk and Aaf Euverman, I enjoyed to
stay in your house before my family came. Unfortunately I miss the contact with you. Tante Ice, Tante
Caroline, Mbak Nanie, Pak Ahmad, Mbak Ellis, Wak Asyiah, I thank you for your moral support and we
keep in contact.
My best gratitude goes to my parents and my brothers Da Manto, Da Piyan, Ef and my sister Uni
Etimurni for support in many ways, praying and a lot of other things you spent to help me. You have
stimulated me to develop my career.
Finally I come to address my appreciation to my wife, Yulia Helmi. It is difficult to find words to
express my gratitude for you. I was happy to live in Groningen with you and our children, although we
were far from our home country. My children, Fathiya Mufidah, Nurul Rahimah and Ahmad Muzakki
Imanullah have made me enjoy the life. Unfortunately you will not be here when I defend my thesis, a
moment when family and colleagues come together. You have to go back to work and that was our best
decision. I am sure that you will enjoy it as well
I am very sorry that I am not able to mention all people who have given a contribution to this
thesis. I am sure that some people will be missing to be mentioned. I would like to thank all of you.

Thank you very much
Dank u wel
Terima kasih



2

RIJKSUNIVERSITEIT GRONINGEN

Phytochemical and Biosynthetic Studies of Lignans
with a Focus on Indonesian Medicinal Plants

Proefschrift

ter verkrijging van het doctoraat in de Wiskunde en Natuurwetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. F. Zwarts, in het openbaar te verdedigen op maandag 26 juni 2006 om 14.45 uur

door Elfahmi geboren op 25 april 1969 te Padang, Indonesië

3

T. Dr. Kayser Beoordelingscommissie: Prof. Dr. Quax Copromotores : Dr. F. Schmidt Prof. W. Woerdenbag Dr. Dr. H.Promotor : Prof. R. Verpoorte 4 . Muskiet Prof.J.J. O.J.A. Dr.J.

K. Yaman and Emma my lovely wife. Yulia Helmi my kids. Fathiya Mufidah. Nurul Rahimah and Ahmad Muzakki Imanullah 5 . Julsing M. M. Chalid To my parents.Paranimfen: M.

Department of Biology. under contract No. the Netherlands. All rights reserved. the Netherlands © 2006 by Elfahmi. 4193-IND.This research project was financially supported by the QUE Project Batch II. No part of this book may be reproduced or transmitted in any forms or by any means without permission from the author. IBRD Loan No. and partially by a scholarship from Universiy of Groningen. University of Groningen. Indonesia. 3028-IX/P3S-1/KON-QUE II/2000. ISBN: 90-902-0771-6 6 . Printing: Facilitair Bedrijf. Institut Teknologi Bandung ITB. The Graduate School for Drug Exploration (GUIDE) is gratefully acknowledged for supporting part of the printing costs of the thesis.

coli Production of a cytotoxic arylnaphthalene lignan in genetically transformed root cultures of Linum leonii 9 13 35 45 53 61 71 83 93 97 101 105 123 125 Summary and concluding remarks Samenvatting (Dutch) Ringkasan (Indonesian) References Curriculum vitae Acknowledgements 7 . an Indonesian medicinal plant Essential oil constituents of Piper cubeba from Indonesia Reduced coniferin and enhanced 6-methoxypodophyllotoxin production in Linum flavum cell suspension cultures after treatment with Na2EDTA Cloning of glucosyltransferase genes from cell suspension cultures of Linum flavum in E.Contents Chapter 1 Chapter 2 Chapter 3 Chapter 4 Chapter 5 Chapter 6 Chapter 7 Chapter 8 Aims and scope of the thesis Jamu: The Indonesian traditional herbal medicine Lignans from cell suspension cultures of Phyllanthus niruri. an Indonesian medicinal plant Lignan profile of Piper cubeba.

8 .

Chapter 1 Aims and scope of the thesis 9 .

Indonesia is one of the biggest biological diversities in the word. proteomics and metabolomics are nowadays applied in medicinal plant research and contribute to the advancement of the field. in supplementing foods and in making cosmetics is firmly rooted in the past and still developing. Piper cubeba. caffeic acid and ferulic acid. Feeding experiments using the biosynthetic precursors of lignans. antiviral. Many drugs used in contemporary medicine have been derived from plants and were originally discovered through the traditional use by indigenous people. Podophyllotoxin. In the chapter 3 we studied lignans from cell suspension cultures of Phyllanthus niruri. Coniferyl alcohol is a biosynthetic precursor of 6-methoxypodophyllotoxin and other lignans. GC and GC-MS of different parts of this plant (chapter 4). cubeba are used medicinally and as a food supplement. Indonesian people have been using jamu to treat various diseases since long. The production of a cytotoxic lignan. An introduction to jamu. was conducted as well. This knowledge can be used to further develop jamu in Indonesia in a rational way. A systematic profiling of lignans was made using TLC. its present status in Indonesia. economical perspective and rational therapy with jamu are highlighted as well as ethical considerations that should be taken into account in the development of medicinal plants. In chapter 2. ephedrine. taxol. A phytochemical study of another important medicinal plant in Indonesia. aspirin. We carried out feeding experiment in order to inhibit the coniferin formation and to enhance the 6methoxypodophyllotoxin production. HPLC. The ultimate goal is to develop a tool to enhance the production of cytotoxic lignans. We tried to clone the glucosyltransferase in Escherichia coli and to study the enzyme further in order to better understand the biosynthesis pathway of lignans (chapter 7). legislative and regulatory aspects. cubeba. The lignan biosynthesis in cell suspension cultures of L. reserpin and digoxin are well known examples of such drugs. So far. the starting compound for the semisynthetic anticancer drugs etoposide®. vinblastin. plant extracts and plant-derived chemicals in the treatment of diseases. genomics. In chapter 6 we present the enhancement of the production of 6-methoxypodophyllotoxin in cell suspension cultures of Linum flavum using ethylenediamine tetra acetate (EDTA) and other glucosyltransferase inhibitors. Quite frequently a relatively low yield of active components and difficulties in standardization are bottlenecks in medicinal plant exploitation. Modern analytical methods. The discovery of podophyllotoxin. fungicidal. Justicidin B is an arylnaphthalene lignan which exerts cytotoxic. To complete the phytochemical study we also analyzed the essential oil composition of P. an important medicinal plant in Indonesia. flavum was also investigated at a genetic level. vincristine. we review jamu. cubeba using GC and GC-MS (chapter 5). were carried out in order to enhance the lignan production and to study their biosynthetic pathway. atropine. Efforts have been made worldwide to enhance the production of bioactive component using a biotechnology approach. quinine. The enzyme glucosyltransferase converts coniferyl alcohol to coniferin that accumulates in the cells in high amounts. antiprotozoal and 10 . artemisinin. biotechnology approaches. teniposide® and etophopos® stimulates the research of lignans including derivatives of podophyllotoxin and its biosynthetic intermediates. justicidin B.Aims and scope of the thesis The use of plants. In this thesis we aim to study phytochemical and biosynthetic aspects of lignans in selected medicinal plants used in Indonesia and in European Linum species. Lignans and the essential oil are the main classes of secondary metabolites of P. camptothecin. only fruits from P. Progress in science and technology boosts the further development of medicinal plants as valuable sources of drugs and drug leads. This review aims to give comprehensive information about the biological activity and therapeutic value of the most commonly used medicinal plants (and plant constituents) in jamu. using hairy roots cultures of genetically modified Linum leonii (transformation by Agrobacterium rhizogenes) is described in chapter 8. the traditional Indonesian medicine based on the popular use of medicinal plants.

and two European Linum species that contain cytotoxic lignans. K-562 and SKW human cell lines. 11 . In addition to the production we also study the cytotoxic activity of justicidin B against three chronic myeloid leukemia-derived LAMA-84. Subjects of our study were two selected Indonesian plants used in jamu.antiplatelet properties. biotechnology and genetic engineering in order to better understand and to enhance the production of lignans. This thesis covers a broad range of lignan studies including phytochemistry.

12 .

Woerdenbag.Chapter 2 Jamu: The Indonesian traditional herbal medicine Elfahmi. Oliver Kayser. Wim J. Komar Ruslan. Quax Submitted 13 . Rein Bos. Herman J.

As the biological activity ascribed to jamu is largely based on empirical data. from herbal practitioners to drugs in pharma industries. i.e. antimicrobial. antidiabetes and immunostimulating agent. standardized herbal medicines and fitofarmaka. Jamu has acquired a potential benefit. In the further development of jamu. antihipertensive. Based on its traditional use jamu is being developed to a rational form of therapy. benefit sharing. antifungal and gastroprotective agent. antiviral and cardioprotective agent. The Indonesian government has divided the preparation of medicinal plants into three categories. Although modern (western) medicine is becoming increasingly important in Indonesia. 1'-acetoxychavicol (Alpinia galanga) as anticancer. Examples are: curcumin (Curcuma longa) as anticancer. jamu. Many isolated compounds have potent biological activities. both economically and clinically.Abstract Jamu is the Indonesian traditional herbal medicine that has been practiced for many centuries in the Indonesian community to maintain good health and to treat diseases. ethical issues such as intellectual property right. We survey the most frequently used plants in jamu that in addition have been investigated as to their constituents and pharmacological effects. 14 . more research is needed to scientifically prove efficacy and to assure safety. biodiversity and conservation should be considered. jamu is still very popular in rural as well as in urban areas. andrographolide (Andrographis paniculata) as anticancer. lignans (Phyllanthus niruri) as antiviral and hepatoprotective agent. This paper aims to review the state-of-art of jamu and to give comprehensive views that can be used for the further improvement of the utility of jamu in curing illnesses and maintaining good health.

This article reviews the use of Indonesian medicinal plants in jamu including its history. and in the rural areas medicinal plants are even the first choice to treat diseases. The Indonesian government. and the Indonesian community makes use of around 6. And they use a long wide shawl called selendang for carrying the basket on the back (Risman and Roemantyo. current status.. Most of the Indonesian people have ever used traditional herbal medicines which are popularly known as jamu. The Indonesian Country Study on Biodiversity (ICSBD 1993) puts the number of flowering plants species in Indonesia between 25. 1998. Jamu is a word in Javanese tribe language. As an archipelagic state with thousands of islands. coumarins. meaning the traditional medicine from plants.845 species with medicinal potential in the forests of Indonesia. Pubmed (Medline) and ISI Web of Science were used to retrieve any online publications. The word gendong itself means to carry something on the back of a body. flavonoids. steroids. and summarizes the potential developments in the future. including alkaloids. According to the National Agency of Drug and Food Control (NADFC/BPOM). About 5. Both online and offline literature searches have been done to compile this review. Today. and freshly prepared (not preserved) from plant material in warung.g. (2001) identified 1. 2002). along with the interactions between them and their physical environment. They contribute to the therapeutic effect as single active compounds as well as in combination with others.000 plant species. Worldwide however. jamu is less known than. terpenoids. e. Nowadays jamu is being developed from traditional handling to industrial (larger scale) production.Introduction Following the Amazon rain forests. A scientific approach is essential to further develop the rational use of jamu. development. 2002). 2003). Indonesia is endowed with a rich and unique biodiversity. The fresh jamu is put inside each bottle in bamboo or rattan basket. These numbers are potentially to be updated due to the continuing inventory and investigation of yet unidentified species.000 species of medicinal plants have been retrieved from the Medicinal Herbs Index in Indonesia and the plants that are most frequently used as constituents of jamu are discussed in this paper. Indonesia has the second biggest biodiversity in the world expressed by a high number of indigenous medicinal plants. The sellers must bring the jamu from door to door. Traditional Chinese Medicine (TCM).000 plant species. the larger remaining part is used traditionally. Data of the number of medicinal plants also vary. The area of Indonesian tropical forests covers about 143 million hectares and is inhabited by about 80% of the world’s medicinal plants. the ubiquitous stalls along the streets in Indonesia (Limyati and Juniar. Jamu gendong is a kind of traditional jamu sold without label. Japanese Kampo and Indian Ayuverda. jamu has been adopted into Bahasa Indonesia with the similar meaning (Riswan and Roemantyo. economical prospective. scientific approach. and lignans.000.500 plants species which potentially. It is estimated that the Indonesian tropical forests inhabit 28. 283 plant species have been officially registered for their medicinal use. Indonesian medicinal plants Biodiversity Biodiversity is defined as the variety of all life forms on earth. Some 40 million Indonesians depend directly on the country’s biodiversity. industry and academia put considerable efforts on it. Jamu gendong is instantly served to whom orders this jamu. There are various reports concerning the inventory of higher plant in Indonesia.000 and 30. Various groups of secondary metabolites are known to be active components in jamu. Based on this rich source the use of medicinal plants is very important. 15 . Suharmiati. PT Eisei (1995) published the Dictionary of Indonesian Medicinal Herbs containing more than 2. while Zuhud et al.

The universities are actively involved through the related faculties or departments from different areas like medicine. Republic of Indonesia). The examples of jamu products from these companies are shown in Table 1. In addition. and even a few clinical studies are available. biology. 2002). the export of medicinal plants such as Amomum cardamomum. The jamu producing industry now has an annual growth of 25-30%.. When new plant-derived therapeutics based on indigenous knowledge are being explored. 2001). IBSAP is based on the evaluation of the previous action plan from 1993 called BAPI (Biodiversity Action Plan for Indonesia). small size jamu producers have grown sufficiently to introduce larger scale and modern production methods (Beer. WALHI. the Indonesian Government. In the period between January to June 2005. research institutes and non-governmental stakeholders with the support of the international developments institutions. However. environment and engineering. Recent research development and research communities Evaluation of jamu as a rational phytotherapy has to cover different research topics including social. isolation and characterization of secondary plant metabolites have been developed to date. Phytochemical studies including extraction. According to Pramono (2002) there are about 810 companies active in Indonesian traditional medicine of which 87 are classified as IOT (Industri Obat Tradisional. Traditional Medicine Industry) and 723 as IKOT (Industri Kecil Obat Tradisional. marine. taking into account the possibilities on the international market and the richness of the country regarding its natural resources. When individuals or institutions from 16 . 2005). pharmacy. the National Development Planning Agency (BAPPENAS). efficacy and safety are issues that must be considered in the further development of Indonesian medicinal plants. Piper spp. this amount can potentially be increased (Pramono. In 2005. Ministry of Environment. Cinnamomum burmani. Ministry of Forestry.To facilitate the activities on the conservation and sustainable use of biodiversity. formulated in collaboration between the Indonesian Government (BAPPENAS). About 20 local companies are the major players. SKEPHI. has launched the Indonesian Biodiversity Strategy and Action Plan 2003-2020 (IBSAP). it is important that the companies return benefits to the native population and the local governments from which the research material was obtained (King et al. the National Agency of Drug and Food Control (NADFC or BPOM). The industry revenues in 2000 was estimated to be 150 million USD. chemistry. indigenous knowledge. Ministry of Agriculture. Ethical considerations in the development of medicinal plants Intellectual property right (IPR). They comprise governmental institutions such as the Ministry of Health. Biological activity studies have been conducted in vitro and in vivo. and ethical aspects. agriculture. National research institutions such as the Indonesian Institute of Science and the Herbarium Bogoriense. To coordinate and to conduct research directed to the development of medicinal plants. forestry. 1996). cultural. and various industrial companies (Bermawie et al. are involved as well as non-governmental institutions such as KEHATI (Indonesian Biodiversity Foundation . Economical prospective Since the 1980s. 462 companies from foreign countries also play a role in the production of Indonesian traditional medicine.. 872 companies in this field have been registered at BPOM. and many others used to make jamu reached an amount of 126. through the National Development Planning Agency (BAPPENAS). Jamu has been handed over from generation to generation based on the traditional knowledge and experience of the community. many institutions in Indonesia are engaged.8 million USD (Ministry of Industry. Small Industry of Traditional Medicine). benefit sharing. the Ministry of Environment. economic.

and compilation of laws applicable to traditional treatment. From this background professional training was necessary to introduce certain standards like standardization of the raw materials used in jamu according to the Materia Medika Indonesia (MMI). jamu. there is an apparent lack of records or written data reporting the effectiveness of jamu. the Indonesian government has divided the medicinal plants in three categories based on the way they are prepared and based on their efficacy. although this is far from international industrial standards. They try to protect raw materials and products from contamination. The way of preparation is often different from producer to producer. utilization and evaluation of traditional medicine. mixing and cooking. To assure the proper use of such products. The Indonesian government has launched the Centre for Development and Application of Traditional Treatment (Sentra P3T) in 1995. The Centre’s activities include research. sorting.biotechnologically developed countries wish to obtain indigenous raw material from a biotechnologically less developed country. All preparations have to meet basic safety criteria. both in real time and in long-term sharing of the benefits of discovery (Soejarto. it remains to be proved that jamu fulfills the generally accepted criteria of safety and efficacy in order to protect the patients. education. grating. These include qualification and licensing of the provider. an agreement for the procurement of such material may be negotiated. Other programmes include selecting. especially of jamu gendong. It is important to take into account that the individuals or institutions exploring the medicinal plant material also have responsibilities for the conservation. screening. training and service of traditional treatment. Most of the current knowledge that jamu can maintain health and/or can cure diseases comes from the people who have experienced success in curing illness by taking jamu. clinical testing. 1996). Goodwill to maintain such a flow may be achieved through appropriate scientific and monetary compensation. Although pharmacological effects of jamu constituents have been recorded. and production steps like selection of raw materials.2 of the Rio Convention (1992) there is an agreement about the handling of biotechnology and distribution of its benefits. registration/licensing. Jamu as a way of traditional healing Rational phytotherapy with jamu and phytomedicine Jamu. The efficacy of standardized herbal medicines has to be proved in pre-clinical trials and standardization on active ingredients is required. Traditional jamu makers also care about hygiene. certifying. Harvesting too much and/or cultivating too little may render medicinal plants into endangered species. sanitation and chemical contaminations from biological or non-biological sources. inventory. good communication between traditional medicine providers and patients and provision of scientific information and guidance to the public (WHO. Such access shall be on mutually agreed terms. followed by boiling of the plant material in a hygienic way can differ significantly. standardized herbal medicines. especially developing countries. crushing. It is mentioned that each contracting party shall take all practicable measures to promote and advance priority access on a fair and equitable basis by contracting parties. testing. and fitofarmaka (phytomedicines). to the results and benefits arising from biotechnologies based upon genetic resources provided by those contracting parties. 2002). The therapeutic effects of jamu have to be supported by empirical data.e. i. scraping. Jamu gendong is produced by household scale industries in a simple and traditional way. In article 19. Along with allopathic medicine it shares issues in appropriate and rational use. Preparation of jamu Original jamu (jamu gendong) exists in the form of a decoction and is sold by ladies carrying jamu on their back. testing. For fitofarmaka clinical trials have to be available. as traditional medicine arising from experiences of the past and embedded in the culture of society cannot stand still but constantly changes and develops. proper use of good quality products. Jamu makers have to be trained on hygienic production methods and for semi-modern 17 .

HK. sanitation. HK.05. Three types of Indonesian medicinal plants that mentioned before have been regulated by BPOM through a regulation nr. The traditional medicine industry (IOT and IKOT) as well as the products have to be registered in the BPOM (246/MENKES/Per/V/90 and HK. For the production of traditional medicine in Indonesia. to protect the people from unwanted (adverse) effects. pill. etc. 2005). CPOTB is also to be applied in the industries to produce standardized herbal medicines and phytomedicine. factory building.00.4. the production and distribution of traditional medicine could be controlled to fulfill the requirements according CPOTB. They have to follow the directions for good manufacturing production (GMP). capsule. The most important aspect of the training is the introduction of scientific aspects of jamu. workers. called CPOTB (Cara Pembuatan Obat Tradisional yang Baik). CPOTB includes all aspects of production such as raw material. pastille. 659/MENKES/SK/X/1991). liquids. quality control. Legislative aspects of jamu and phytomedicines in Indonesia The Indonesian government. cream. and to watch over the quality including efficacy and efficiency. IKOT and IOT use the modern technologies and their activities are based on a scientific approach.00.00. extract.1384. CPOTB is regulated by the Ministry of Health (regulation nr. instrument.41. crude extracts. production process.technologies. the industries have to refer to good manufacturing practice guidelines for traditional medicine. the Indonesian government has established the Centre for Development of Traditional Medicine (Sentra P3T).2411. capsules. The Centre is supported by regulation number 0584/MENKES/SK/VI/1995. 18 . has regulated jamu and phytomedicines (fitofarmaka).05. Today jamu made by the industry is not anymore only in the form of a decoction but also in the form of a tablet. To prepare jamu. powder. 2004. tablets. This regulation has been renewed by BPOM in 2005 with regulation nr. through the Ministry of Health and BPOM. The regulations are aimed to develop herbal medicinal products. pills.4. management. To develop the traditional medicines. and ointment. These products have to be produced according to the description published in regulation number 661/MENKES/SK/VII/1994.1380. Using this regulation. From household scale industries jamu has been developed and is now produced by the industries called IKOT and IOT.05. There are several forms of traditional medicine such as powders.

Morindae fructus. Mustika Ratu Tonic tea plus daun dewa dan ginseng Jamu godog bugar ayu Encok Jamu Jago 19 . Talinum paniculatum. Albizziae julibrissin cortex. Moutan radicis cortex Orthosiphonis folium. Blumeae folium. Tribulus terrestris. Phyllanthi herba. Retrofracti fructus. Phyllanti herba extract Hypericum extract. Concha ostrea gigas. Eurycomae radix extract. improving the blood circulation. and nourishes the kidneys Effectively combats cold and alleviates its symptoms such as fever. Retrofracti fructus. dizziness. prevents hemorrhoids and cold. Andrographidis herba. Zingiberis rhizome extract. Alstoniae cortex. promotes ovulation. Andrographidis herba. Industry name Sariayu Martha Tilaar PT. and makes them look young. Syzigii semen Zingiberis aromaticae rhizome. Myristicae semen Orthosiphonis folium. Panax ginseng radix extract Zingiberis rhizome. eases excrements. Leonuri heterophyclus herba. Curcumae rhizome. Polygalae tenuifolia radix. and general debility. Trigonella foenum graecum. adding more energy and strengthen Rheumatism PT. reduce the possibility of atherosclerosis and diabetes Relieves digestive disorder symptoms Liver and kidney disturbance Increases and accelerates breast milk production Increases vitality. Imperatae rhizome Tamarindi pulpa extract. Ligusticae acutilobumae radix. Theae folium. Andrographidis herba. Apii herba Tinosporae caulis. Andrographidis herba. Isorae fructus. Kaempferiae rhizome extract. Panax ginseng extract. blood circulation. libido. Sido Muncul Sakit kencing Beras kencur Sido Muncul Kuku Bima Fitogas New Padibu Fitolac Srongpas Ginseng Antangin JRG Hiperten Diabetin PT. Gynurae folium Usneae thalus. Centellae herba. Zingeberis aromaticae rhizome extract. stimulates blood circulation and improves appetite and digestion as well as strengthening and promoting health Regulates endocrine gland secretion and period. Curcumae domesticae rhizome. Zingiberis purpurei rhizome. refreshes the body. Elephantopi radix. reduces menstrual clot Disorders of the urinary tract It reduces fatigue. Yohimbee extract. Sappan lignum. Curcumae rhizome. Carthami tinctorius flos. Caryophylli flos Ligustici rhizome. Zingiberis purpurei rhizome. Blumeae folium. discharging feces. Vaginal inflammations. Angelicae sinensis radix.Table 1. Panax ginseng radix. Kaempferiae rhizome. Ligustrinae lignum. Eurycoma radix. Curcumae domesticae rhizome pulveratum. Zingiberis rhizome Indications / use Relieves stomach pain after giving birth. Phapros Jamu name Post Partum Herbs Menstralax Plant used Calami rhizome. Jamu Iboe Jaya PT. sore muscle. Colae semen. Blumeae folia.Deltomed Laboratories PT. Curcumae domesticae rhizome Orthosiphonis folia. cold sweat. Examples of jamu products from the big jamu companies in Indonesia. Centellae herba. Curcumae xanthorrhizae rhizome extract. Santali lignum. Zingiberis rhizome. Illicium verum. and fatigue Reduces symptoms of mild hypertension Diabetes mellitus Effective for general health maintenance of men and women. relieves backache. Rehmanniae preparata radix. fit and energetic Slowing the ageing process. Sappan lignum. improves appetite. Cinamomi cortex. Centellae folium extract. Curcumae rhizome. bloating. Kaempferiae rhizome extract. Menthae folia. Foenigraeci semen. Baeckeae folium. Zingiberis zerumbeti rhizome. Alstoniae cortex. Curcumae rhizome. raises stamina and immunity It raises men’s stamina. Parkiae semen. Zingeberis rhizome extract. Kimia Farma PT. Oryza sativa Ginseng radix extract. Plantago mayor extract Sauropus folium extract Retofracti fructus. Paeomiae alba radix. nausea. Plantaginis folium. Zingiberis zerumbeti rhizome. good for improvement of stamina vitality and body immunity so that will make the body fresh. fatigue.

Chebulae fructus extract Siler radix. Curcumae domesticae rhizome. Catharanthi radix. Menthae arvensis. Curcumae rhizome. Amomi fructus. Atractylodes rhizome Coptidis rhizhoma. Anemarrhena rhizome. Zingiberis zerumbeti rhizome. Air Mancur PT. Curcumae domesticae rhizome. Baeckeae folium. Agastachis herba. Murrayae folium. Jamu Borobudur Nyonya Meneer Allus Jamu sakit Maag Jamu Akas Jantung Singkir angin Jaket pegal linu PT. Swieteniae macrothyllae semen. Coptici fructus. Blumeae folium Coriandri fructus. Tenaga Tani farma PT. Peppermint powder. Piperis nigri fructus. Syzygii polyanthi extract. Curcumae rhizome. Jatrophae curcas folium Morindae fructus extract. reducing cellulite. Serycocalycis folia Curcumae rhizome. while rejuvenating natural beauty Anti diarrhea To get rid of muscle pains Improves vitality and sexual power Anti-diarrhoea Stomach pain. Retrofracti fructus. Languatis rhizome. Elephantopi folium Curcumae domesticae rhizome. to freshen up and strengthen body stamina Slims down and firms up the body. Bintang Toedjoe Jamu postnatal Innoshape Diapet NR Encok Irex Max Diami PT. Zingiberis aromaticae rhizome. Foeniculi fructus. to improve their stamina and to avoid lethargy or insomnia Immunostimulating Peptic ulcer Various coronary problems Common cold Eliminates fatique. Zingiberis rhizome Zingiberis purpurei rhizome. Orthosiphonis folia. Alstoniae cortex. Curcumae rhizome. Languatis rhizome Euphorbiae thymifoliae herba. Paederiae folium. Curcumae domesticae rhizome. Curcumae rhizome extract Plantaginis folium. Kaempferia rhizome. Konimex PT. Momordicae fructus. Andrographidis herba Dissolves kidney stone To get rid of muscle pains. Granati pericarpium extract.Sirnakarang Pegal linu Esha PT. Zingiberis rhizome. Saccharum album. Syzygii jambolani cortex. diarrhoea Inner care for woman's health Diabetes mellitus Diabetes mellitus 20 . Curcumae rhizome. Eucalipty fructus. Soho Farmasi PT. Boesenbergiae rhizome Sauropi folium. Alii cepae bulbus. Melaleucae fructus. Pterospermum lignum Yohimbe bark extract. Alyxiae cortex. reliefs painful stiffness of the muscles and joints after hard work. Andrographidis herba extract. Kaempferiae rhizome. Centella herba. Notopterigium rhizome. Zingiberis rhizome. Parameriae cortex. peppermint oil. Martha Tilaar PT. Phyllanthi herba. Gallae. Eurycoma longifolia extract. Caryophylli flos. Ginseng extract Sausurea radix. Curcuma rhizome Foeniculi fructus. Glycyrrhizae radix. Zingiberis zerumbeti rhizome. Curcuma domesticate rhizome Catechu. Piperis nigri fructus. Orthosiphonis folium extract. Curcumae domestica rhizome. Zingiberis rhizome Piperis folium. Psidii folium extract. Blumeae folium. Retrofracti fructus. Kaempferiae rhizome. Centellae herba extract. Retrofracti fructus. Caricae folium. Ocimi bacillici folium. Foeniculi fructus. Coicis semen. Puspo Internusa Perusahaan jamu Sido Jodo Sentia Pil Binari Pacekap diabest Diamanis Boesenbergiae rhizome. Zingiberis rhizome Eurycomae longifoliae radix.

C.. Ginger (Zingiber officinale Rose) that contains the phenolic ketones gingerol and paradol has been launched in Indonesia as fitofarmaka (phytomedicine) for malignancies (antineoplasma). Three anthraquinone glycosides (pulmatin. Eleven Curcuma species (Curcuma aeruginosa. C. The strongest anticancer activity has been shown for another Zingiberaceae species. 2005). Furthermore. C. glutathione S-transferase (GST). 2005. Zingiber aromaticum (Kirana et al. This may explain its ability to enhance apoptosis and to inhibit invasion (Ichikawa et al. Anticancer activity of the ginger extract has been reported in vitro and in vivo. this compound inhibits activation of NF-κB and NF-κB-regulated gene expression. hypertension. a chalcone derivative isolated from Kaemferia pandurata rhizome has been reported to suppress carcinogenesis in human colon cancer cell lines (Kirana et al.. Isolated compounds from jamu showed antioxidative activity in vitro using H4IIE rat hepatoma cells. itch.. it reduces the cell cycle progression thereby preventing cancerous cell growth (Chattopadhay et al. aurantiaca. kidney. Anticancer Plants from the family Zingiberaceae are the most often used ingredient of jamu. aromaticum containing the sesquiterpene zerumbone. diarrhea. colorata. euchroma.Biological activity of the most common plants in jamu Biological activities of the most common plants in jamu as reported in the literature are summarized in Table 2. 2000). Panduratin. Curcumin is a main phenolic constituent of the genus especially in the rhizome of tumeric (Curcuma domestica). Sharma et al. a flavonoid from this plant showed cytotoxic activity against human mammary carcinoma cells (Sukardiman et al. Although the mechanism is not fully understood.. Yun et al. It has been suggested that Z. domestica. C. Pinostrobin. C. Preclinical and clinical studies with curcumin in relation to its anticancer potential have been reviewed. 2005). abdominalgia. In the following sections in more details are discussed.. Kirana et al. xanthorrhiza that is used traditionally as antibacterial. an iridoid compound which was isolated 21 . In vitro and in vivo. anemia. mangga. recent investigations show that this plant has promising effects in this area.. 2003.and virusinduced tumor initiation and promotion. Human clinical trials indicated no dose-limiting toxicity up to 10 g/day taken orally.. 2005). purpurascens. For C. 2003). 1). chrysophanein and physcionin) isolated from Rheum palmatum roots exhibited moderate cytotoxic activity against HeLa epitheloid cells and inhibited the growth of BT-20 human breast carcinoma cells (Kubo et al. Karunagaran et al. Another isolated compound from this plant. zedoria) have been used traditionally as a spice and to treat several illness such as appendicitis. The mechanism of action of curcumin has been partly elucidated. xanthorrhizae. 2005). 2004.. 1992). The ability of kaempferol and luteolin to inhibit oxidative DNA strand breaks supports their suggested role as protective agents against diseases such as cancer (Steffan et al. colon.. 2005). and breast (Okazaki et al. it suppressed carcinogenesis of the liver. C. soloensis. also has the potential to be developed as fitofarmaka with anticancer properties. Kaempferol and luteolin protected these cells against oxidative stress. that is also called C. rheumatism.. anticancer and anti-inflammatory agent scientific proof has been given for its antiproliferative and anticancer activities. and dysentery.. 2005). C. Although C. Manju and Nalini.. It significantly increased apoptosis in HeLa cells (Ismail et al. longa. domestica (synonym: C. asthma. longa). These studies carried out so far suggest that curcumin has potential in the prevention and therapy of cancer (Aggarwal et al. a major mechanism for chemical carcinogen detoxification (Zheng et al. petiolata. 2003. l'-acetoxychavicol acetate has been found to suppress chemical. 1993). C.. The in vitro cytotoxicity of the plumieride. 2003. These activities are largely attributed to the sesquiterpene compound xanthorrhizol isolated from this plant. has not been used traditionally for anticancer purposes. and C. Inducing apoptosis plays an important role. mainly to be ascribed to curcumin (Fig. 2005). Ethyl trans-cinnamate and ethyl 4-methoxy-trans-cinnamate from galanga root oil (Alpinia galanga) induced the activity of the detoxifying enzyme.. C..

Methanol extracts of Melaleuca leucadendron fruit and Annona muricata stembark collected in Indonesia have been reported to be active against herpes simplex virus-1 in vitro. Scutellariae radix. Compared to the active principle echitamine. Nawawi et al. 1999). The consumption of Ardisia compressa tea (aqueous extract) resulted in complete inhibition of the chemically-induced hepatocarcinogenesis in Wistar rats (De Mejia and Ramirez.. 1999). the extract was more powerful to kill HeLa cells. 2004). 2005). Swietinia mahagoni and Curcuma aeruginosa showed anti-HIV activity using HIV-I-infected MT-4 cells. Ganopoly significantly reduced the tumor weight in a dose-dependent manner. KB-V1 cancer cell lines and in murine lymphocytic leukemia (Kardono et al.. It may represent a novel promising immunotherapeutic agent or a lead for cancer treatment (Gao et al.12-didehydroandrographolide isolated from aerial parts of this plant showed marked activity against a human breast carcinoma cell lines (Tan et al.. A water extract of Centella asiatica significantly reduced the multiplicity of neoplasms in the small intestine.. vinblastin and other vinca alkaloids (Cragg and Newman. 2004.3. The results concluded that the combination of anticancer drugs with some herbal extracts contributes to the improvement of clinical outcomes in cancer chemotherapy (Takara et al. 2'-Hydroxycinnamaldehyde isolated from Cinnamomum cassia bark. 1995) contains the clinically used anticancer drugs vincristine. Aqueous extracts. 2005). Ganopoly. Combination of anticancer drugs such as paclitaxel with the herbal extracts e. 50. from Glycyrrhizae radix. an aqueous polysaccharide fraction extracted from the fruiting bodies of Ganoderma lucidum has antitumor activity combined with immunomodulating activity. This extract also showed cytotoxic activity to HeLa cells.2. The cytotoxic activity of the extract depends on the season of collection of the plant bark. melanoma. The extract of bark collected in the summer season has the highest activity (Jagetia and Baliga. leucadendron significantly prolonged the development of skin lesions and reduced the mortality (Padma et al. KB. lung. asiatica has a chemopreventive effect on colon tumorigenesis in male F344 rats (Bunpo et al. 2004). Rhei rhizome. Coriandrum sativum was shown to act protectively against the deleterious effects in lipid metabolism in experimental colon cancer (Chithra and Leelamma. strongly inhibited the in vitro growth of a broad panel human cancer cells and the in vivo growth of the SW-620 human tumor xenograft (Lee et al. 1991). colon. 2005).. iridoids and lignans from Plumeira rubra showed cytotoxic activity to human breast. An ethanol extract of the bark of Alstonia scholaris enhanced the anticancer activity of berberine in the Ehrlich ascites carcinoma-bearing mice. The analogues gave stronger activity than plumieride itself (Dobhal et al. 2005)... tannin.2 to 175 µg mL-1 they inhibited the HIV-protease (Otaka et al. and 100 mg/kg. lignan and other isolated compounds from Phyllanthus species have been tested for their anti22 . and 84.g Andrographis paniculata. Alkaloids and quassinoids from Eurycoma longifolia. Zizyphi fructus and Zingiberis rhizome enhanced the paclitaxel sensitivity in HeLa cells via the inhibition of multidrug resistance.9% at doses of 20. 2002).. The methanol extracts of plants used in jamu e. 2005). Usually this plant to be used in jamu. With the dose range of 4. 1998. The diterpenoid compounds 14-deoxyandrographolide and 14-deoxy-11..from methanol extract of the bark of Plumeria bicolor and several analogues was determined in radiation-induced fibrosarcoma (RIF) tumor cells. with inhibition rates of 32. 1990. 2004). M. This result suggests that C..g. 1995). present in Alstonia scholaris. is collected during the dry season (also considered as the summer season). respectively in mice. Catharanthus roseus that has been used to treat cancer (Eisei. 2000). Immunomodulating effects that may be useful in the treatment of cancer have been reported for ethanolic extracts of aerial parts of Phyllanthus niruri (Ma’at. Andrographis paniculata that is called sambiloto by local people in Indonesia has been intensively investigated for its anticancer activity. fibrosarcoma. These extract suppressed the growth of HeLa cells concentration dependently. But the antiviral efficacy of such herbal medicine has seldom been tested in rigorous clinical trial. Antiviral Hundreds of medicinal plants used in jamu have been tested for antiviral activity in vitro and in vivo. 48.

. antipyretic and analgesic The anti-inflammatory effects of extract of Morinda officinalis (noni or mengkudu) in vitro and in vivo have been shown by inhibition of the production of nitric oxide.. 2000).. falciparum. Omar et al. 2001. Eurycomanone and 7-methoxy-β-carboline-1-propionic acid from Eurycoma longifolia.. 2005. macrophylla and A. Anti-inflammatory. Notka et al..HIV activity in vitro and in vivo. 1999). A. The petroleum ether extracts of the rind of Carica papaya and Citrus sinensis also showed antimalarial activity against strain P..8-dimethoxy-xanthone. antirheumatic. Andrographis paniculata was also clinically tested for its antiviral activity. 2003). 2004). They inhibited the HIV-key enzymes e. Another effect of A..7 macrophages (Kim et al. healthy volunteers. They include Achillea millefolium. isolated from Andrographis paniculata possessed in vitro activity against P. An in vitro study on traditionally used malaria remedies in the Kenyah of the Apo Kayan. reverse transcriptase and protease (Calixto et al. Strychnos lucida. antioxidant and antithrombotic activity in an experimental photochemical thrombogenesis model using rat femoral artery (Rilantono et al. 2001).. The genus Phyllanthus has been intensively studied clinically for its antiviral effects.g. and Azadirachta indica collected from Kalimantan demonstrated significant antimalarial activity (Kardono et al.. 2004). 1. Helicterins A-F (Fig.. 2000).2]octene Cframework isolated from Helicteres isora showed a mild inhibitory activity against reverse transcriptase from avian myeloblastosis virus (Tezuka et al. Baeckea frutenscens. had a significantly higher affinity to the K1 strain than to the T9-96 strain (Keawpradub et al.. 2005). 1995). The inhibition of the prostaglandin E2 production has been also shown by Aloe vera gel. glaucescense have been assessed for antiplasmodial activity against multidrug-resistant K1 strain of Plasmodium falciparum cultured in human erythrocytes. Antibabesial activity was also found for protoberberine alkaloids and 20-hydroxyecdysone from Arcangelisia flava against Babesia gibsoni (Subeki et al. Antimalaria and antiparasitic Most of the plants mentioned here have been traditionally used as antimalarial agent in Indonesia..8. Calixto et al. This finding may have a therapeutic relevance in inflammatory bowel disease (Langmead et al. 1991. A phase I clinical trial of andrographolide from A. paniculata was conducted in 13 HIV positive patients and five HIV uninfected. Methanol extracts prepared from stem bark of Alstonia scholaris.5'. These herbal remedies were found to have activity against chloroquine-resistant P. vera was the inhibition on reactive oxygen metabolites in the human colorectal mucosa. in contrast to chloroquine. This trial concluded that andrographolide may inhibit HIV induced cell cycle deregulation. The active indole alkaloids from these extracts.. Screening of plant extracts that are traditionally used for the treatment of malaria on Java showed strong antimalarial and antibabesial activitiy. 23 .2')-neolignans with a bicyclo[2. falciparum (Leaman et al. In vivo it gave a reduction (62%) in parasitemia after treating the Swiss Albino mice with P. 1). leading to a rise in CD4 (+) lymphocyte levels in HIV-1 infected individuals (Calabrese et al. Cinnamomom cortex that was collected in Indonesia inhibited the rise in vascular permeability and edema induced by acetic acid. 1998). Swietenia macrophylla and Phyllantus niruri (Trimurningsih et al. dimeric (7. integrase. East Kalimantan (Indonesian Borneo) concluded that plants such as Lansium domesticum and Carica papaya are more likely to be effective antimalarials.. 2004). triterpenoid lansioides from Lansium domesticum. Curcuma xanthorrhiza. Brucea javanica. A systematic review of 22 randomized clinical trial showed that Phyllanthus species have positive effect on antiviral activity and show positive effects on liver biochemistry in chronic hepatitis B virus infection (Liu et al. Subeki et al.. 1998. falciparum FCK 2 in vitro (Bhat and Surolia. 2005).2.2-Dihydroxy-6.. prostaglandin E-2 and tumor necrosis factor-alpha in lipopolysaccharide-stimulated RAW 264.. berghei (Dua et al. The aqueous extract of tempe (fermented soja-beans) which is a popular food in Indonesia have been reported to have anti-inflammatory. 2000). 2005).

2006). Screening of 75 medicinal plants collected in Indonesia showed that many of them had the inhibitory effects on the nitric oxide (NO) production in lipopolysaccharide-stimulated RAW264. Camellia sinensis and Uncaria tomentosa had also a statistically significant effect on reducing symptoms of osteoarthritis of the knee of patients (Altman and Marcussen. The presence of these compounds may very well be related to the uses of this plant in traditional medicine (Tuchinda et al. Hydroxypanduratin A and panduratin A isolated from Kaempferia pandurata rhizome showed significant topical anti-inflammatory activity in the assay of TPA-induced ear edema in rats. The ginger extracts showed a pain relieving effects in which up to 0. 2001). NO is widely recognized as an important messenger and effective molecule in a variety of biological system. A hepatoprotective effect of ethanol extracts of turmeric together with sesquiterpenes and curcuminoid containing fractions has been shown to be related to the suppression of alanin and aspartate aminotransferase and lactate dehydrogenase level on D-galactosamin induced liver injury in rats (Miyakoshi et al. 1995). phyltetralin and nirtetralin isolated from aerial parts of Phyllanthus amarus exhibited marked antiinflammatory properties and suggest that these lignans are the main active principles responsible for the traditional application of this plant for anti-inflammatory properties (Kassuya et al.3 g ginger/day for musculoskeletal pain in human were administered. Ethanol extracts of A.. These biochemical and pathological changes indicated liver cell damage and malfunction (Udoh and Udoh. 1996). 24 . The ethanol extract of ginger (Z. Chrubasik et al. 2005). The effect was also shown on secondary lesions in the development of adjuvant-induced arthritis (Kubo et al. Also mild to severe metaplasia of hepatocytes was revealed in a dose-related manner as well as proliferation of Kupfer cells and hepatic cells cirrhosis.. Curcuma longa. 2002). 2005).carrageenin. acetaminophen and ethanol were investigated by means of serum-biochemical and histopathological examinations. 2005).. Hepatoprotective Herbal preparations containing Andrographis panuculata and Phyllanthus amarus for various liver disorders have been proved to have antihepatotoxic activity (Ram. (CCl4)-induced hepatotoxicity in the liver of rats. in vivo and in clinical studies. officinale) together with Alpinia galanga. The hepatoprotective effect of Alstonia scholaris bark on liver injuries induced by the carbon tetrachloride (CCl4). β-D-galactosamine. Ahmed et al.. 1996). (2005) comprehensively reviewed on the effects of an ethanol extract of ginger (Zingiber officinale rhizome) and its efficacy profiles in vitro..7 macrophages as well as antioxidant activity through the evaluation of free radical scavenging effect and reducing power (Choi and Hwang.. and aspartate amino transferase (AST). however. demonstrating its hepatoprotective action (Harish and Shivanandappa. 2004). suggested the further studies to prove the efficacy and to find an optimum dosage of ginger preparations in the treatment of osteoarthritic pain. 2001. This review. glutamate oxaloacetate transaminase and glutamate pyruvate transaminase. The ethanol extract and isolated diterpenes andrographolide and neoandrographolide from the aerial parts of Andrographis paniculata showed significant antihepatotoxic action in Plasmodium berghei K173-induced hepatic damage in Mastomys natalensis (Chander et al. alkaline phosphatase (ALP). serotonin and arachidonic acid. 2005). The lignans niranthin. The ethanol extract of Carica papaya seeds caused elevation of rat serum levels of acid phosphatase (ACP). 2006). was prevented by pretreatment with the extracts of Phyllanthus niruri. scholaris bark significantly lowered β-D-galactosamine induced serum transaminases elevation in the serumbiochemical analysis in rats (Lin et al.. The NO production is inhibited by the nitric oxidase inhibitors that can be used as therapeutic agents for inflammatory diseases (Tinker and Wallace. as judged by the raised serum enzymes.

The glucosidic compounds 4'-O-methylpiceid and rhapontin. In this study. Aegle marmelose fruits. 2001). Hyperlipidemia is an associated complication of diabetes mellitus.Antidiabetic Diabetes mellitus is recognized by chronic elevation of the glucose level in the blood and often accompanied by symptoms of severe thirst.. isolated from kelembak (Rheum palmatum) roots that were collected from the market in Indonesia exhibited moderate α-glucosidase inhibitory activity in vitro. Momordica charantia fruits. and Carica papaya seeds (methanol and buthanol) have been reported to possess a broad spectrum of antibacterial activity (Bouttier et al. p-mentha-1. Dawkins et al. 2004). streptomycin.. 1998). and β-pinene..4-dien-7-al. triton and cholesterol fed hyperlipemic rats. 2005). The growth-inhibiting activity of cinnamaldehyde isolated from Cinnamomum cassia toward human intestinal bacteria (Clostridium perfringens. 2002).. 2005. Hypolipidemic effects have been shown for aqueous extracts of cumin seeds (Cuminum cyminum) on alloxan-induced diabetic. Bacteroides fragilis and Bifidobacterium bifidum) was shown using an impregnated paper disk method and compared with that of tetracycline and chloramphenicol (Lee and Ahn. profuse urination. Guazuma ulmifolia leaves and Trigonella fonum graceum seeds that are used clinically against diabetes mellitus have been studied for their antihyperglycemic effect.. andrographolide and arabinogalactan proteins isolated from Andrographis paniculata and are comparable (in term of growth inhibition of Bacillus subtilis.. Ganoderma lucidum... Extracts of Alstonia scholaris. Cassia auriculata flowers.. 1998). The total triterpenoid fraction from aerial parts of Centella asiatica. Khan et al. jambolana possibly acts as a hypoglycemic agent by increasing insulin levels. 2002. The essential oil from Cuminum cyminum and the isolated compounds. administering cumin extract to diabetic rats significantly reduced the blood glucose level. Medicinal plants that are used clinically to treat diabetes have shown their antidiabetes activity in vitro. Azadirachta indica leaves. showed antibacterial 25 . acute and subacute toxicity testing and evaluation of the antidiabetic effect of Eugenia jambolana seed powder in streptozotocin-diabetic rats was adequate for approval to start phase 2 clinical trials to evaluate this seed powder as complementary therapy in type 2 diabetes. polyuria. γ-terpinene. 1991). Antimicrobial and antifungal Antibacterial and antifungal activities have been shown by aqueous extracts. 2005). and Curcuma longa rhizome had hypoglycemic activity in normal and streptozotocin induced diabetic mice and rats (Yang et al. The study showed that E. It was shown that this fraction is useful in diabetic microangiopathy by improving microcirculation and decreasing capillary permeability and protects against the deterioration of microcirculation due to diabetic microangiopathy (Cesarone et al. The mechanism may be by potentiating the insulin effect or by increasing the pancreatic secretion of insulin from the cells (Dhandapani et al.. 2003).. Most of those plants are used in jamu. the water and ethanol extracts of Piper betle and dianex. The methanol and aqueous extracts derived from Alpinia galanga caused highly significant reduction in the blood glucose levels of normal rabbits (Akhtar et al. Anacardium occidentale (hexane). Withania somnifera roots. Pseudomonas aeruginosa and Candida albicans) to some known antibiotics. Mutalik et al. 2003. has been studied in the patients with diabetic microangiopathy.. The essential oils of Coriandrum sativum and Foeniculum vulgare were reported to possess antibacterial activity to Escherichia coli and Bacillus megaterium in vitro (Lo Cantore et al. 2002). Arambewela et al. 2004. Escherichia coli. in vivo and in clinical studies. Preclinical evaluation consisting of animal studies. a polyherbal formulation consisting of the aqueous extracts of Gymnema sylvestre leaves. Eugenia jambolana seeds. 2003). Aqueous extract of these plants reduced hyperglycemic peak in the rabbits (Alarcon-Aguilara et al. cumin aldehyde. The inhibition of α-glucosidase activity may be effective in controlling abnormal levels of blood glucose in metabolic diseases such as diabetes (Kubo et al. and stupor. Toxicity studies showed no evidence of mortality or abnormality (Sridhar et al. weigh loss.. gentamycin and nystatin (Singha et al.

26 . Erwinia. and Agrobacterium (Iacobellis et al.. Rhizopus stolonifer and Aspergillus niger with a concentration 14 mg mL-1 (Janssen and Scheffer. Angiogenesis in granulation tissues improves circulation to the wound site thus providing oxygen and nutrients are essential for the healing process (Cheng et al. 2005). 1'-Acetoxychavicol acetate. Aloe vera is endowed with gastric acid anti-secretory activity and could protect the gastric mucosa at low concentrations against injurious agents (Yusuf et al. Morinda citrifolia (noni) inhibits gastric emptying in male rats via a mechanism involving stimulation of cholecystokinin and its receptor activation.. Staphylococcus aureus. Saussurea lappa... and C. albicans. They were found to promote angiogenesis and stimulate blood vessel formation and mucosal cell regeneration during the gastric ulcer healing stage that are important parts of the wound healing.. isolated from Alpinia galanga markedly inhibited the ethanol-induced gastric mucosal lesions in rats. an active triterpenoid constituent of Centella asiatica and its extract. Hartati et al. an active compound from Alpinia galanga has antifungal activity against Trichophyton mentagrophytes. including strains resistant to the common antifungals amphotericin B and ketoconazole. 1999). T.activity against the genera Clavibacter. Pu et al. concentricum.. 2003).6 M HCl and acid output was studied in pylorus ligated and lumen perfused rats. 2003). 1999. 2004). Xanthomonas campestris and Bacillus subtilis and the antifungal activities against C. 1994. Rhodococcus. GSH acts as antioxidant and is important for maintaining the mucosal integrity in the stomach (Matsuda et al. Cholecystokinin is a peptide hormone of the gastrointestinal system responsible for stimulating the digestion of fat and protein. A study of Indonesian plants with ethnomedical uses showed that the methylene chloride and methanol extracts of Terminalia catappa. respectively. Ipomoea spp. 2005). C. It delays gastric emptying and inhibits gastric acid and plasma gastrin responses (Konturek et al. T.. these species are excellent candidates for development as novel therapeutic (Ficker et al.. schoenanthus showed a fungistatic effect against superficial mycosis (Koba et al. 2003).. Pythium ultimum.. and inhibit the MRSA invasion of human mucosal fibroblasts (Kim et al. Swietenia mahagoni. Ralstonia. were found to have pronounced inhibitory activities against a wide variety of human pathogenic fungi. The ethanol extracts from several plant species belonging to the Zingiberaceae family used in Kenyah (Indonesian Borneo). 2005). 2004). Rhizoctonia solani and Sclerotium rolfsii (Goun et al. As members of the Zingiberaceae are generally regarded as safe for human consumption. Ethanol and water extract of Abrus cantoniensis.. nardus. Phyllanthus acuminatus. especially Alpinia galanga. The essential oils from Cymbopogon citratus. Xanthomonas. Eugenia caryophyllata. The essential oil of Cinnamomum burmanni (bark and leaves) and Tagetes erecta (leaves) that were collected in Indonesia have been reported to exhibit antimicrobial activity against Bacillus subtilis and Salmonella typhimurium and antifungal activity against Candida albicans in vitro (Sukandar et al. Tylophora asthmatica and Hyptis brevipes have the antibacterial activities against Eschericia coli. The action of 1S-1'acetoxychavicol was attenuated by pretreatment with indomethacin and N-ethylmalcimide and significantly increased the glutathione (GSH) levels of gastric mucosa in rats. Curtobacterium... rubrum.. 2004). An ethyl acetate extract of Curcuma longa has been reported to have antibacterial activity and the potential to restore the effectiveness of β-lactams against methicillin-resistant Staphylococcus aureus (MRSA). A different mechanism of hepatoprotective activity was shown by asiaticoside. Magnolia officinalis and Ligusticum species strongly inhibited the growth of Helicobacter pylori which is an important etiologic impetus leading usually to chronic active gastritis and gastric ulcer (Li et al. 2003). The effect of an ethanolic extract of Aloe vera on acute gastric mucosal lesions induced by 0. 1985) Gastroprotective 1S-1'-Acetoxychavicol acetate and 1S-1'-acetoxyeugenol acetate. Curcuma zedoaria and Zingiberis purpureum.

This plant may serve as an alternative source of antioxidants for prevention of doxorubicin cardiotoxicity (Chularojmontri et al.) decreased the blood pressure by about 20. Antihypertensive The ethanol extracts of fresh matured fruits of Carica papaya markedly depressed the blood pressure and heart rate in mineralocorticoid salt and in renal hypertensive rats when compared with the normotensive controls. longa induced endothelium-independent vasodilatation.v. 14-deoxy-11. renal and deoxycortocosterone acetate-salts hypertensive rats... 1998). The studies of the antioxidative and cytoprotective effects using H9c2 cardiac myoblasts showed that Phyllanthus urinaria have a protective activity against doxorubicin cardiotoxicity. 50.). and Mentha arvensis extracts showed that they exhibited more than 50% relaxing effect on aortic ring preparations. Gynandropsis gynandra. antitussive and anti-allergic A study of selected medicinal folklore plants that are traditionally used for asthma treatment in Indonesia indicated that alcoholic extracts. A major constituent in the water decoction of Orthosiphon aristatus leaves. The water extracts of this plant resulted in significant reduction in the levels of lactate dehydrogenase. This plant is popular as kumis kucing in Indonesia. Piper betle. asiatica extracts (Gnanapragasam et al. The cardioprotection provided by ligustrazine is related to a reduction of TNF-alpha content by inhibition of free radical production in isolated rat hearts. and its mechanism is thought to be related to a radical scavenging effect and improvement of hemorheology (Goto et al.12-didehydroandrographolide from Andrographis paniculata was shown to have bradycardia-inducing and β-adrenoceptor antagonistic properties in vivo using anesthetized Sprague-Dawley rats (Zhang et al.Cardioprotective A study on the edible plants common in Asian diets such as Ipomoea batatas..5% in normotensive. exhibited a continuous decrease in systolic blood pressure after subcutaneous administration in conscious stroke-prone spontaneously hypertensive rats. C. It was concluded that Curcuma herbs have hypotensive and protective effects on the endothelium in spontaneously hypertensive rats. from Plantago major leaves. 2005).. Piper betle and Cymbopogon citratus showed comparable vasorelaxation on isolated perfuse mesenteric artery preparation (Runnie et al. The extract appeared to be more potent than hydrallazine (200µg/kg i. mainly for treatment of hypertension (Matsubara et al. from Eucalyptus globulus 27 .v. activation of catalase/superoxide dismutase activity and inhibition of lipid peroxidation. 1999). A cardioprotective effect of Centella asiatica on the antioxidant tissue defense system during doxorubicin induced cardiac damage in rats has been reported. 22.1%.7%. has been tested in three groups of patients with venous hypertension. Anacardium occidentale. This protection was mediated through multiple pathways such as enhancement of survival factor through elevation of glutathione. methylripariochromene A (a benzochromene). 2005). 2004). Increased activity in serum of these enzymes is a well-known diagnostic marker of myocardial function. 2000).8% and 26.. 2004). Anti-asthma... creatine phosphokinase..7% and 54. The vasodilatory effect of Curcuma herbs has been studied. The improvement of signs and symptoms by extracts observed in venous hypertensive patients correlated well with the improvement of the variation of capillary filtration rate and ankle edema (De Sanctis et al. respectively. The total triterpenoid fraction of Centella asiatica. glutamate oxaloacetate transaminase and glutamate pyruvate transaminase. It was known that TNF-alpha can contribute to myocardial damage during ischemia-reperfusion (Zhou et al.4% in those three types of hypertension (Eno et al. 2004). Javanese people prescribe the leaves in their jamu.. 2001). The extracts (20 mg/kg i. a venoactive drug acting on the microcirculation and on capillary permeability. a well known antihypertensive (vasodilator) agent that decreased the blood pressure by about 10. Carica papaya. As active ingredients triterpenes (asiatic acid and asiaticoside) may be responsible for the cardioprotective effect of C.

. Central nervous system (CNS) activity The essential oil from the fruits of Cuminum cyminum. in BALB/c mice. An aqueous extract of Alpinia galanga rhizome was found to inhibit the release of βhexosaminidase. restored the reduction of phagocytic action induced by prednisolone and protected the body from the opportunistic infection caused by Escherichia coli (Iwo et al... isolated from Glychirrhiza radix (licorice) has been reported.. 2002). This suggested that extracts contain active compounds which inhibit mast cell degranulation. andrographolide.12-didehydroandrographolide isolated from Andrograpis paniculata. that is used traditionally as a stimulant exhibited anticonvulsant activity. 1998). The ethanol extract of A. The different mechanism of immunostimulating effect was shown by the hexane and aqueous extract of Carica papaya seeds and its bioactive fractions. The effect of liquiritin apioside may depend on both peripheral (modulation of ATPsensitive K+ channels) and a central mechanism (modulation of serotonergic system) (Kamei et al.. 2003). paniculata. The active constituents of A. Clinical studies with Andrographis paniculata suggested that this plant may be effective as an early treatment of uncomplicated acute upper respiratory tract infection on the patients tested. from Cinnamomum massoiae cortex and from Vitex trifolia leaves and two hexane extracts -Eucalyptus globulus leaves and Vitex trifolia leaves. Immunomodulating effects were also shown by a methanol extract. 2004). A polysaccharide extract of Alpinia galanga rhizome showed a marked stimulating effect on the reticulo-endothelial system (RES) and increased the number of peritoneal exudate cells. 2003).. the same as for the antiallergic drug. paniculata alone or in combination with the ethanol extract of A.and maximal electroshock-induced seizures in male NMRI mice (Sayyah et al. 2003).leaves and fruits... disodium cromoglycate. Neoandrographolide was more potent than andrographolide in this study. and spleen cells of mice (Bendjeddou et al. senticocus appear to be more effective than placebo (Poolsup et al. An ethanol extract of Alstonia scholaris leaves induced pronounced bronchodilatory activity in anaesthetized rats with the probable involvement of prostaglandins (Channa et al. Isolated compounds. This effect was shown in both pentylenetrazole.inhibited IgE-dependent histamine release from RBL-2H3 cells.. a marker of antigen-IgE-mediated degranulation in RBL-2H3 cells. 1'S-1'-acetoxychavicol acetate and 1'S-1'-acetoxyeugenol acetate inhibited βhexosaminidase and a passive coetaneous anaphylaxis reactions in mice and the antigen-IgE-mediated TNF-alpha and IL-4 production. also antidepressant effects have been reported for curcumin. liquritin and liquiritigenin. 2005). a symptom of 28 . This effect was also shown by curcumin from Curcuma longa in BALB/c mice (Antony et al. 2005). They enhanced the proliferation and interleukin-2 (IL-2) induction in human peripheral blood lymphocytes (Kumar et al.. This effect is due to its mast cell stabilizing activity. both of which participate in the late phase of type I allergic reactions (Matsuda et al. They significantly enhanced the phytohemagglutinin responsiveness of lymphocytes and inhibited the classical complement-mediated hemolytic pathway (Mojica-Henshaw et al. 2004).. All three compounds demonstrated significant inhibition of passive cutaneous anaphylaxis (Gupta et al. Immunostimulating An immunostimulating effect has been reported from pule (Alstonia scholaris) that is used in South East Asia mainly as antimalarial and antidysentery agents. and may be used in the development of new drugs for treating asthma and/or allergic disease (Ikawati et al. have been reported to have anti-allergic effect. together with other medicinal plants has been tested to the patients who were exhibiting tremor. Glycyrrhizae radix. This effect may be mediated by actions in the central monoaminergic neurotransmitter systems (Xu et al. 2005). Recently. An antitussive effect of liquiritin apioside. andrographolide and neoandrographolide. The bark aqueous extract stimulated non specific immune response. 14-deoxyandrographolide and 14-deoxy-11... 1999). 2001). 2000).

Brucea sumatrana.g. together with the plant salt contents. and absence of tachycardia were ominous signs in deadly nightshade intoxication in childhood. whereas C. Powerful herbal drugs like Digitalis. Alstonia macrophylla has been reported to have a CNS depressant activity. Abrus precatorius. The symptoms that were caused by digoxin overdose included nausea. (2003) reviewed about 161 medicinal plants which are a potential source of new contraceptive principles. 2004). that plant drugs are harmless and therefore are preferable. tiredness. Indonesia. The possibility of more serious adverse effects even was found in combination products containing ginseng as one of the constituents (Coon and Ernst. Foeniculum vulgare. a reduction in muscle relaxant activity and also significantly potentiated phenobarbital sodium-induced sleeping time (Chattopadhyay et al. Known risks and side effects of medicinal plants used in jamu It is generally assumed by the public. dizziness. anorexia. Belladonna and Colchicum can even be highly dangerous. This activity correlated well with the maximum volume. 50% were recorded to be used to combat fever. a remarkable decrease in exploratory behavioral pattern. Muraya paniculata. Punica granatum. coma. 29 . Unny et al. The results indicated that the diuretic activity of Ananas comosus was intrinsic and not a result of the salt loading effect. (2003) showed that meaningless speech. The results concluded that the combination of those plants was effective against tremor from parkinsonism (Ishikawa et al. Data from clinical trials suggest that the most commonly experienced adverse effects of Panax ginseng are headache. Other activities Various other activities have been reported from the medicinal plants which are used in jamu. Grosvenor et al. 2000). 70 patients with a diagnosis of digoxin intoxication at the National Cheng Kung Hospital. (2005) have reviewed the adverse effect of Echinacea species reported between 1950 an 2002. 2000). 2004). dizziness and a change in consciousness (Chen et al. and C. and claimed to have medicinal uses. lethargy. Some adverse effects such as headache. weakness. 2002). hypokalemia.antipsychotic-induced parkinsonism. vomiting. Put in such general terms this clearly is not always true.. and also even by some medical practitioners. hypernatremia. The review contains the isolated compounds and the mechanism of actions. In fact various medicinal plants also induce side effects. Curcuma longa.. syncope. It caused a significant reduction in spontaneous activity. sleep and gastrointestinal disorder. Strychnos... Digitalis may induce the toxicity of licorice (the root of Glycyrrhiza glabra) by drug interaction via licorice-associated electrolyte imbalance. Out of one hundred and fourteen species of flowering plants belonging to 51 families. and the amount of electrolytes excreted during urine collection (Sripanidkulchai et al. Some of them are used in jamu. Hongkong have been studied. collected in Sumateran rainforests showed strong antinematodal activity against Bursaphelenchus xylophilus (Alen et al. the highest osmolality. or suppression of the renin-aldosterone system (Harada et al. e. The methanol extracts of Areca catechu. Allamanda cathartica. occasional nausea and abdominal pain have been suffered by people after taking Echinacea. particularly in elderly.. papaya extracts may have resulted from a high salt content of this extracts. may help to differentiate the mechanism by which these plants acts as diuretic. Huntley et al. Licorice itself may be a cause for exogenously induced hypertension. Between 1988 and 2002. 2001). 33% for diarrhea and 31% for other gastrointestinal problems. The analysis of the urinary osmolality and electrolyte excretion per unit time. Caksen et al. zedoria. (1995) surveyed the medicinal plants in Riau Province.. Both plant extracts gave similar profiles of urinary electrolyte excretion to that of the hydrochlorothiazide. They inhibited implantation and increased fetal loss in mice and reduced secretory activity and weight of accessory sex glands. The aqueous extracts of Carica papaya and Ananas comosus have been reported to possess diuretic activity. Deadly nightshade (Atropa belladonna) intoxication has been infrequently reported in both children and adults.

xanthorrhiza) and Guazuma ulmifolia. Compared to Traditional Chinese Medicine (TCM)... Java turmeric (C. Psidium guajava and C. headache.. as antidiabetic and Piper retrofractum as androgenic. Kava-kava (Piper methysticum) may cause tiredness. In the quantities exceeding 6 g dried ginger may act as a gastric irritant. these species are excellent candidates for development as novel therapeutic. 2005). 30 . A study of 23 commercial jamu showed the occurrence natural aflatoxins that exhibit carcinogenic. Agranulocytosis and citrobacterial infection have been found after using jamu containing phenylbutazone (Paul et al. such as efficacy. safety. A 50-year-old woman was seen with papules and plaques on the face and later on her dorsal and ventral thorax and arms after taking a kava product for 3 weeks (Stevinson et al.e. Although the commonly used plants in jamu have been investigated scientifically for their biological activities. The risk of herbal medicines producing an adverse reaction depends not only on the medicine and its dosage but also on consumer-related parameters. domestica as antidiarrhea (Bermawie et al.. adulteration or substitution of botanical material have repeatedly caused concern. 1998). the jamu makers or the industries still have to standardize the formulae of jamu in order to assure the efficacy and safety. Reports of herbal medicinal products affected by contamination. Zingiber. Java noni (Morinda citrifolia) and Syzygium polyanthum. Exploration of medicinal plants which are the indigenous knowledge of the Indonesian community should also consider ethical issues. concomitant diseases and co-medication (herb-herb and herb-drug interactions). Kaempferia. 2002). 2005). Inhalation of dust from ginger may produce IGE-mediated allergy (Chrubasik et al. jamu still needs considerable efforts to reach optimum beneficiary. low energy. such as age. 2005). teratogenic and mutagenic properties (Ali et al. 2002). xanthorrhiza as antirheumatic. turmeric (Curcuma domestica). As members of the Zingiberaceae are generally regarded as safe for human consumption. Asian herbal medicinal products including jamu are most often implicated (Ernst and Pittler. This gave rise to the suspicion of herbal toxicity. gastrointestinal symptoms. genetics. Curcumin and panduratin are typical examples of bioactive secondary metabolites from these plants. ginger (Zingiber officinale) and king of bitter (Andrographis paniculata) as antineoplasma. One report was found that mentioned the microbial contamination of raw material and end product of jamu gendong (Limyati and Juniar. benefit sharing and biodiversity conservation. Jamu has the potential to develop because it is economically prospective and used to maintain the health and to cure diseases. The scientific study of the common plants should be continued. which was confirmed by taking a liver biopsy (Millonig et al. Although ginger (Zingiberis officinale) shows a very broad range pharmacological effect. Conclusion The in vitro. IPR. Species belonging to the family Zingiberaceae such as Curcuma. A side effect of Morinda citrifolia in a 45-year-old patient who has highly elevated transaminases and lactate dehydrogenase has been reported. are the most frequently used plants in jamu.2002). as antihyperlipidemic. These species have also been studied intensively for their secondary metabolites and biological activity.. 2005). in vivo and clinical studies on medicinal plants that are used in jamu have scientifically proved their claimed biological activities in part. C. Based on the literature search.. Other medicinal plants have been launched as fitofarmaka such as Phyllanthus niruri as immunostimulating. 2005). BPOM has done systematic and comprehensive research on 9 priority medicinal plants in Indonesia. there are still undesirable effects such as causing heartburn. i. we conclude that there are many more medicinal plants that have potential to be developed as fitofarmaka or as sources of new therapeutic agents.

dermatosis. dysentry.16 µg/ml In vitro... diarrhea....5 µg/ml In vitro IC50 = 280 µg/ml and 600 µg/ml Results Inhibition of DNA polymerase II and induction apoptosis (Sharma et al. in vivo. 2002) Inhibition of HIV-1 protease activity (Cheenpracha et al. influenza. tonic 31 . vertigo Dry cough. asthma. anorexia. cholera. loescheii. 2005) Induction of apoptosis (Kirana et al. stomach-ache.. Plant name Curcuma domestica Plant part rhizome Extracts or products Ethanol Compound(s) or group of compounds Curcumin Test system (and dose) Clinical (180 mg per day) Clinical (120 mg per day) rhizome rhizome Ethanol Ethanol Ethanol rhizome Hexane Chloroform Xanthorrhizol Gingerol. Et al. anemia. malaria. 2000) Inhibition of TPA induced ear edema formation (Tuchinda et al.. as a marker of antigen-IgE-mediated degranulation (Matsuda et al. malaria. hypertension.2 µg/ml In vitro 10-100 µg/ml In vitro..Table 2. 2005) Increase of the glutathione (GSH) levels of gastric mucosa in rats (Matsuda et al.. hemorrhoid.and ethyl 4methoxy-trans-cinnamate l'-Acetoxychavicol and 1S-1'-acetoxyeugenol acetate Stomatic. 2003) Inhibition of β-hexosaminidase. IC50 = 84 and 12 µg/ear In vitro IC50 = 5. gastritic. anaesthetic. Streptococcus matans (Park. topical. 2006) Antibacterial activity against Prevotella intermedia. anorexia.7 µM In vitro MIC = 2-4 µg/ml In vitro 20 mg per 2 days In vivo 2 mg/kg BW In vitro IC50 = 15 and 19 µM In vitro IC50 = 1. cough. scabies. 2000) Induction apoptosis (Ismail et al. P. rheumatism. spice Curcuma xanthorrhiza Zingiber officinalle Zingiber aromatica Kaemferia pandurata Alpinia galanga rhizome Oil Aqueous acetone Ethyl.6 µM and 18. rheumatism. gonorrhoea. in vivo. 2005) Induction of glutatione S-transferase (GST) (Zheng et al. 2003) Inhibition of DNA topoisomerase I in human tumour cell (Sukardiman et al.. fungi. antiemeti. anorexia. metritis. Anorexia.. 1992) Inhibition of α-glucosidase activity (Kubo et al.. 2004) Inhibition of HIV-I integrase (De Clercq. panduratin A In vitro IC50 = 40 µM In vitro and in vivo EC50 = 6. malaria. 2003) Inhibition of the growth HeLa epithelioid and BT-20 human breast carcinoma cells (Kubo et al. anthelmentic. 1993) Induction of apoptosis (Ichikawa et al. paradol Zerumbone Pinostrobin Hidroxypanduratin A. 2003) Induction of apoptosis (Kirana et al.6 µg/ml In vitro. 2005) Improvement of the morning stiffness and joint swelling in arthritis patiens (Chattopaday et al. IC50 = 20. gastritis Rheum palmatum root Methanol Pulmatin and chrysophanein physcionin 4'-O-methylpiceid and rhapontin Astringent. Survey of studies of medicinal plants used in jamu.5 µg/ml 2. tonsillitis. diphtheria. anemia. IC50 = 40. chancre... 1991) Traditional use of plant Appendicitis. anthelmenthic Headache.

stomachic. dermatosis..100 mg/kg BW In vivo. malaria. 1994) Inhibition of hepatocarcinogenesis (De Mejia et al. lignans.. menstrual disorder. depurative.5 µg/ml Clinical 5 mg/kg bodyweight (BW) In vivo 1. asthma. dysentery.5 g per day In vitro and in vivo IC50 = 1.. 2000) Increase of GST activity. IC50 = 49. antidote for poisoning.3 µg/ml roots leaves Arcangelisia flava Ardisia compressa Phyllanthus species whole part leaves whole plant Chloroform Ethanol Xanthone Andrograpanin Berberine Tonsillitis. anthelmentic Fever. diabetes. 2002) Exhibition of the cytotoxic activity against human T47D cell line (Tan et al.. gastritis. cold. 25 µM In vivo. 2004) Dysuria. 2005) Inhibition of the growth of human HepG2 cells (Chi et al. 2000) Reduction of the plasma glucose level in streptozotocin-induced diabetic rats (Yu et al.8 µg/ml 1.12didehydroandrographolide Andrographolide Stimulant..5 µg/ml In vivo 180 mg/kg body weight In vitro. 2005) Stimulation of non specific immune respone (Iwo et al. constipation. 160 mg/g diet bark stem bark Methanol Ethanol Aqueous. 2004) Cytotoxic effect in HeLa cell (Jagetia and Baliga.12 ml/kg In vitro ED50= 2.. 2004) Antihepatitis B virus (Liu et al. β-pinene Plumieride Echitamine In vitro 20 mg per 2 days In vivo 500 mg/kg BW In vitro. hypertensive. stomachic. quercetin. malaria. ED50=2. tetanus.Cymbopogon citratus Plumeria bicolor Alstonia scholaris leaves Oil d-Limonene.6% (Tchoumbougnang et al. epilepsy. diarrhoea.. falciparum (Tona et al. 2003) Antiplasmodial activity against Plasmodium falciparum (Dua et al. 2005) Inhibition of HIV induced cell cycle dysregulation (Calabrese et al. 2004) Antiplasmodial activity against P. 2004) Increase of the killing effect of berberine against tumour (Jagetia and Baliga.. tonic. hypertensive. malaria. gonorrhoea..5 µg/ml In vivo 50 . 2005) Inhibition of the growth RIF tumor cell lines (Dobhal et al. depurative Essential oil 14-Deoxyandrographolide 14-Deoxy-11. 1993) Suppression of parasitemia till 86. geraniol Geranial. cold. fever. fever. 2004) Enhancement of chemokine stromal cell-derived factor-1 alpha (SDF-1 alpha) induced chemotaxis (Ji at al. lignans and terpenoids. diaphoretic. nephritis. myrcene.. typhus. 1998) Exhibition of anticonvulsant activity in both PTZand MES-induced seizures (Sayyah et al. epilepsy. convulsant Aqueous Aqueous Phenolic compounds Alkaloids. edema Fever. ethanol Cuminum cyminum seed fruit Andrographis paniculata aerial part Ethanol -Ethanol Alkaloid Induction of glutatione S-transferase (GST) (Zheng et al. 2000) Anti-HIV activity (Notka et al. diarrhoea. flavonoids. tanins Elargic acid. cough Wound. dandruff Jaundice. edeme. purgative. anorexia. syphilis. syphilis. enteritis Dysuria.5 mg/kg BW In vitro IC50 = 4µg/ml In vivo 30 mg/kg In vitro 3 µM In vitro. IC50 = 47 µg/ml Clinical 1. inhibit hepatocarcinogenesis (Aruna and Sivaramakrishnan.. chancre. rheumatism. eczema.. lupeol 32 .. ear diseases.. diphtheria.. gastric ulcer In vivo ED50 = 0. neral. appendicitis.

2004) Inhibition of ethanol. cough.8 µg/ml In vitro MIC 0. healty dogs (Alexander-Lindo et al. itch Hemorrhoid. 2004) Enhancement of proliferation on T and B lymphocytes (Wang et al... aphtha. wound. asthma Diaphoretic. aphrodisiac...9 µg/ml IC50 =2. aureus Klebsiella aerogenes and Chromobacterium violaceum (Reddy et al. 2005) Inhibition of the contractile respons in rat thoracic aorta smooth muscle (Ohashi et al.Piper sarmentosum Piper caba Piper longum Piper nigrum Glycyrrhiza glabra Eurycoma lancifolia Anacardium occidentale berries Methanol Aqueous acetone Ethanol Sarmentine.87 mg/ml root Ethanol Isoliquiritigenin Liquiritin apioside. 2000) Decrease of systolic blood pressure in conscious stroke-prone spontaneously hypertensive rats (Ohashi et al. 2004) Hypoglycaemic activity in normal. 2004) Inhibition of monoamine oxidase and antidepressant like activity (Lee et al. stomachic. dysentery. B. 2004) Cough. Agrobacterium (Lo Cantore et al. piperanine. tonic..1 nmol/ml In vivo IC50 = 23.9 µg/ml 6. S.. dermatosis Abelmoschus moschatus Aloe vera Centella asiatica Orthoshipon aristatus aerial parts leaves aerial part leaves Convulsant..2 and 60. 2002) Reduction of the plasma glucose level in streptozotocin-induced diabetic rats (Liu et al.. 1992) Antitussive (Kamei et al. anorexia Purgative. trachyone. 2005) Reduction the plasma glucose level in streptozotocin-induced diabetic rats (Rajasekaran et al.. gonorrhea. dysentery. neoorthosiphols A and B Methylripariochromene A Terpenoids Antiplasmodial activity against P. 2000) Inhibition of the growth of Escherichia coli. stomachic. 1991) Inhibition of the fresh egg albumin-induced acute inflammation (Ojewole et al. subtilis. aphtha. 2004) Inhibition of reductase activity and platelet aggregation (Tawata et al. 60. tuberculosis Stomachic. emetic. Pseudomonas. stomachic. Xanthomonas. edema Hypertensive. falciparum (Rukachaisirikul et al. anthelmentic. cholecystopathy Stomach-ache.. dysentery. Bacillus megaterium. aphtha. 2004) Inhibition of β-lactamase (Bouttier et al. 58 µM In vitro 1 µg/ml In vivo 30 mg/kg BW In vitro IC50 =1. cough Laxative. liquritin and liquiritigenin Eurycomanone 7-methoxy-β-carboline-1propionic acid -Stigmast-4-en-3-ol and stigmast-4-en-3-one Anacardic acid Flavonoid myricetin -Asiaticoside Polysacharide Pimarane-type diterpenes.1 µM In vivo 200 mg/kg BW In vivo 10 mg/kg BW In vitro 100 µg/ml In vitro IC50 15.5mg/kg BW In vitro MIC = 6.. diarrhea. menstrual disorder Aqueous Coriandrum sativum fruit Essential oil 33 .. 2004) Enhancement of gastric ulcer healing (Cheng et al. Erwinia.5 µg/ml In vivo 25 mg/kg BW In vitro IC50 = 7. dyspnea Rheumatic root stem bark Methanol Aqueous Hexane Buthanol Ethanol Aqueous Fever. pipernonaline Alkaloid piperine Isobutyleicosatrienamide. colitis Menstrual disorder. hemorrhoid. 1-piperettyl pyrrolidine Piperine. sphaericus. diabetes..1 µg/ml In vivo 800 mg/kg BW In vivo 1.. chancre. bronchitis. anorexia.0 µM In vitro MIC = 70. vertigo. 2005) Inhibition of the growth of B. pergumidiene In vitro IC50 =18.and indomethacin-induced gastric lesions (Morikawa et al.. diaphoretic.25 µg/ml In vivo EC50 = 0.. depurative.. 2005) Antiplasmodial activity (Kardono et al.

R1 = Ac. R2 = Ac 9. asiaticoside (6) (Centela asiatica). methylripariochromene A (7).O HO O O O O H3CO HO O OCH3 OH 3 HO HO 1 R3O OR1 HO HO 2 HO O O O OH OH 6 OH O O OH OH OH OH OR2 HO HO HOH 2C O HO 4. R3 = CH 3 O R2O H3 CO O OCH3 7 R1O BzO BzO O OH OAc HOH2C CO 2CH3 + N CH3 N H HO 8. R4 = X 14. R 3 = X. R 1 = H. R2 = H. R1 = R 2 = H. R1 = R 2 = CH3. R3 = X. orthosiphol A and B (8 and 9) (Orthoshipon aristatus). 34 . R1 = R 2 = CH3. R 3 = R4 = X 12. R 1 = CH3. R2 = OH CO2CH3 O O CO 2 CH3 O O HO O O OR1 HO OH OH OR 2 OH COOR4 10 HO HO HO COOR3 11. R2 = CH 3. echitamine (10) (Alstonia scholaris). 14deoxyandrographolide (2) (Andrographiis paniculata). R4 = CH3 15. panduratin A (5) (Kaempferia pandurata). andrographolide (1). helicterins A-F (11-16) (Helicteres isora). R1 = R 2 = R3 = CH3. R1 = R 2 = R3 = H 5. R2 = CH3. curcumin (3) (Curcuma domestica). R4 = CH3 X= OH CO 2CH3 OH Fig. R3 = R4 = X 16. R1 = H. R 1 = OH. 1. R3 = R4 = X 13. hydroxypanduratin A (4). Chemical structure of several active compounds from plants used in jamu.

Thomas Hackl. an Indonesian medicinal plant Elfahmi. Woerdenbag.Chapter 3 Lignans from cell suspension cultures of Phyllanthus niruri. Albert Koulman. Sieb Batterman. 69. Quax This chapter is based on Journal of Natural Products. Rein Bos. Oliver Kayser. 2006. 55-58 35 . Wim J. Herman J.

resulted in an increase up to 0. roots and seeds showed significant differences.5 mM ferulic acid or 0. urinaria. niruri that successfully produce lignans. aerial plant parts. but reported earlier from P.Abstract Cell suspension cultures of Phyllanthus niruri L. Feeding 0. callus cultures. Suspension cultures yielded two lignans: the new dihydrocubebin-dimethylether (1) and urinatetralin (2).7 mg g-1 DW of 1 (control value 0.5 mM caffeic acid. 36 . were used to study the lignan profiles and biosynthesis.2 mg g-1 DW). a new lignan from P. Comparison of the lignan profiles of cell suspensions.3 mg g-1 DW of 2 (control value 0. being early precursors of lignan biosynthesis. niruri. This is the first report of cell suspension cultures of P.1 mg g-1 DW) and up to 0.

1989). flavonoids. 37 . hepatitis and malaria and because of diuretic... Nirtetralin and niranthin were tested against human hepatitis B virus in vitro (Huang et al. 1990. Calixto et al... Freitas et al.Introduction Phyllanthus niruri L. Several of these lignans were tested for cytotoxicity and other biological activities in vitro. 2002) have been reported. roots and seeds. 1).. 2002). Mehrota et al. 1999. 2003).. An extract of the callus culture of P. Calixto et al. coumarins. to study the production and biosynthesis of lignans and to compare the lignan profile of cell suspensions with callus cultures. Naik and Juvekar. 1994) The aerial parts of P. In vitro antiplasmodial activity of this plant extract has been described (Tona et al. 2003).. 1992. 1992. 1998. niruri showed analgesic activity (Santos et al. niruri extract shows potential therapeutic actions in the management of hepatitis B (Mehrota et al.. Whole plants have been used in traditional medicine for treatment of jaundice. 1998). 1985).. 1991).. P. niruri. 1998). Several of these isolated compounds have been tested for their pharmacological activities (Ishimaru et al. and hypoglycemic properties (Eisei. terpenoids and lignans. several pharmacological studies have been carried out with plant extracts and with isolated compounds. Its role in urolithiasis is related to the inhibition of calcium oxalate endocytosis by renal tubular cells (Campos and Schor. Huang et al. antiviral. Calixto et al. asthma. Phyllanthin and hypophyllanthin were protective against carbon tetrachloride. 1990.. aerial plant parts. 3. 2003. P. Lignans from this plant have been studied most intensively. Immunomodulating effects in treatment of cancer by influencing the function and activity of the immune system (Ma’at.4methylenedioxybenzyl-3 .. phenols. 2002) and lipid lowering activity (Khanna. Naik and Juvekar. (Euphorbiaceae) is a small plant widely distributed in tropical and subtropical regions in Central and South America and Asia (including India and Indonesia). 2001). The aims of this study were to establish the cell suspension cultures of P.and galactosamine-induced cytotoxicity in primary cultured rat hepatocytes (Syamasundar et al.4 -dimethoxybenzylbutyrolactone has been reported to possess antitumor activity (Satyanarayana and Venkateswarlu. niruri have been reported to contain alkaloids.. tannins. niruri extract also showed inhibitory activities against angiotensin converting enzyme (ACE) and rat lens aldose reductase (AR). 1995. 17 different lignans have been found so far (Fig.. 2003). To scientifically support the traditional use. Its antiviral activity extends to HIV-1 RT inhibition (Ogata et al. which play a significant role in the reduction of aldose to alditol under abnormal conditions such as diabetes (Shimizu et al.

demethylendioxy-niranthin (9). film thickness 0. helium was used as carrier gas. detector (FID) temperature.d. R1 = R2 = R3 = H 10. 260°C. 300°C. nirtetralin (12). and phylnirurin (19). R1 + R2 = CH2 H3CO H3CO R3 = H R4 = R5 = CH3 R3 = OCH3 R4 = R5 = CH3 R3 = H R4 + R5 = CH2 R3 = H R4 = R5 = CH3 OCH3 H3CO H3CO OCH3 OCH3 OCH3 OCH3 OCH3 OCH3 O O H3CO OH OCH3 O O 15 16 O O OCH3 OCH3 H3CO H3CO H3CO OCH3 OH 17 OCH3 OCH3 OCH3 OCH3 H3CO 18 19 Fig. linear gas velocity. R1 = R2 = CH3 14. 6. niranthin (7). Material and methods General experimental procedures NMR spectra were recorded on Bruker WM 400 (400 MHz) and Bruker DRX 500 (500 MHz) spectrometers in CDCl3. R1 + R2 = CH2 13. TMS were used as an internal standard. hypophyllanthin (15). WCOT fused-silica CP-Sil 5 CB (15 m x 0. linnanthin (8).3-demethoxy-seco-isolintetralin (5). R4 = CH3 R3 = R4 = H R3 = R4 = COCH3 7. seco-4-hydroxylintetralin (17). 32 cm s-1. 2. The Netherlands). 1. seco-isolarisiresinol trimethyl ether (4).25 µm.. under the following conditions: column. R1 = R2 = CH3 12. Lignans from Phyllanthus niruri : phyllanthin (3).4methylendioxybenzyl)-(31. hydroxyniranthin (10). injector temperature. R1 + R2 = CH2 R3 = OH H3CO H3CO H3CO 11. Chrompack. Middelburg. 5 psi. nirphyllin (16). 2. Gas chromatography-Mass 38 . 2.31 mm i. isolintetralin (14).41-dimethoxybenzyl)-butyrolactone (18). R1 = R2 = CH3 R1 = R2 = CH3 R1 + R2 = CH2 R1 + R2 = CH2 R3 = R4 = CH3 R3 = H. inlet pressure. 20:1.R1 O R2 O OR3 OR4 R1 O R2 O H3CO OR3 OR4 R3 R1 O R2 O R3 OCH3 OCH3 OCH3 OCH3 OCH3 OCH3 OR4 OR5 3. R1 + R2 = CH2 R3 = H 8. lintetralin (13). GC analysis was performed on a Hewlett-Packard 5890 Series II gas chromatograph equipped with a 7673 injector and a HewlettPackard 3365 Series II Chemstation.0 µL.3-demethoxy-seco-isolintetralin diacetate (6). 5. (3. split ratio. oven temperature program. injected volume. phyltetralin (11). 150-320°C at 15°C min-1 and maintained at 320°C for 5 min. R1 = R2 = CH3 R3 = H 9. 4.

d. Institut Teknologi Bandung (Indonesia). ‘sHertogenbosch. varying in color from dark brown to yellow. with fresh medium yielding a total volume of 300 mL. Cell suspension cultures of P. The bands were detected by 254 nm UV light. Merck. (Euphorbiaceae) was collected from a wild habitat in Bandung.1. MS conditions: ionization energy. The Netherlands) at 290 nm. The age of the plant material was 0. based on the Flora of Java (Backer and Van den Brink. The sterile leaves were cut into slices and callus induction was obtained using media with different compositions. These media were modifications of the Murashige and Skoog medium (Murahige and Skoog.5 – 1 year. Damstradt. Germany). 34-600 u. The leaves were sterilized by dipping them into a 3% w/v NaOCl solution for 3 min. 1962) or the Gamborg’s B5 medium (Gamborg et al.. Murashige and Skoog (MS) medium was supplemented with 1. The callus cultures were grown under an L/D regime (16/8 h: 3. 280°C. The mobile phase consisted of C2H3N: H2O (45:55. daylight L 36W/10.10. Plant material. the Netherlands). 1968) A voucher specimen (HBG10PN12) is deposited in the Herbarium Bandungense. interface temperature. After 1 month. scan speed.000 lux. a combination of the macro nutrients of MS and the micro nutrients of B5 medium. Callus developed after 6 weeks. Cell suspension cultures were initiated by transferring callus clumps into 100 mL sterile conical flasks with 50 mL of liquid medium of the same composition as described above but without agar. It was supplemented with 3 mg L-1 -naphtalene acetic acid. West Java. The Netherlands).1 % H3PO4 at a flow of 1. Germany). Cultures were incubated on a rotary shaker (175 rpm) at 26°C under an L/D regime (16/8 h: 3. Gamborg’s B5 (B5) was supplemented with 4 mg L-1 -naphtalene acetic acid. followed by bathing in sterile H2O for 10 min. The GC conditions were the same as for GC analysis.2 mL of 96% EtOH and transferred to a sterile 500 mL 39 . and authenticated at the Department of Biology. Friable callus appeared as clumps. Small plants developed after 3-4 weeks. Darmstadt. an AOC-20i autoinjector. All solvents and chemicals were purchased from Sigma-Aldrich (Zwijndrecht. v/v) containing 0. Analytical thin layer chromatography (TLC) was performed using silica gel 60-F254 (5 x 10 cm. niruri Seeds of P. Subcultures were prepared every 3 weeks by adding 100 mL of a full-grown cell suspension culture to 200 mL of fresh medium. ion source temperature. Indonesia. niruri were grown in a plant container under an L/D regime (16/8 h: 3. mass range.000 lux) at 26°C.0 mg L-1 6-benzylaminopurin. solvents and chemicals Phyllanthus niruri L. 0. The so-called MS-B5. and the GC-MS solution software 1.5 and 1 mM. These compounds were dissolved using 0. They were rinsed three times with sterile twice-deionized H2O. Feeding experiment Caffeic and ferulic acid were added to reach three different final concentrations: 0.25 mm thickness. was also used. 1968). OSRAM.9% agar. All media and supplements used to grow the callus and the suspension culture were obtained from Duchefa (Haarlem. 250°C. The HPLC system consisted of a Spectra-Physics (model SP 8810) liquid pressure pump.000 lux) at 25°C. 0. a Rheodyne high pressure valve equipped with a 100 µL sample loop and a Lichrospher RP-18 column (250 x 4 mm i.0 mL min-1 and a Shimadzu photodiode array UV-Vis SPD-M6A detector (Shimadzu. Germany) and toluene: acetone (50:1) as the eluent. 50 mL of cell suspension cultures were transferred into a 500 mL conical flask. All media were supplemented with 4 % (w/w) sucrose and solidified with 0. 2 scans s-1.. Merck. 70 eV.spectrometry (GC-MS) analysis was performed on a Shimadzu QP5000 GC-MS system equipped with a 17A GC.0 mg L-1 indole-3-acetic acid and 1. The elution length was 8 cm in a saturated chamber.

The limit of detection (LOD) was established as the amount of analyte that provided a signal-to-noise ratio of 3. Breda. The limit of quantification (LLOQ) was defined as the lowest calibration standard that could be quantified with an accuracy of 90-110% and a precision of 15%.5 µg for both 1 and 2. The CH2Cl2 fraction yielded pure compound 1 (3. The remaining extract was partitioned (3x) between 250 mL of H2O and 250 mL of CH2Cl2. Germany).500 g for 5 min. FW was determined and the cells were put overnight into the freezer and then freeze-dried.500 g. LLOQ was 2.5 to 25 µg mL-1.8 mL crimp neck vial (Art. and CH2Cl2: MeOH (25:1.5 cm) filled with silica gel 60 (70-230 mesh. Rf values were 0.31 and 0. Germany) using toluene: acetone (50:1) as eluent.25 for 2. The CH2Cl2 was evaporated gently using a flow of nitrogen and the residue was redissolved in 200 µL of MeOH. Samples of about 10 mL were taken aseptically and transferred into a calibrated conical tube and centrifuged for 5 min at 1. vortexed and centrifuged at 1. For quantitative determination of 1 and 2. The MeOH extracts were combined and the volume was reduced to 100 mL under reduced pressure. The resulting extract was fractionated on a column (75 x 2. semipreparative HPLC was used. niruri after inoculation into fresh medium (at the start of growth cycle). 500 mL). All organic phases were combined and concentrated. Dried and powdered material (100 mg) was weighed in a Sovirel tube. The elution length was 18 cm in a saturated chamber. 500 mL). 98819. Merck. Lignans were analyzed by GC and GC-MS. The aqueous layer was discarded and 2 mL of the organic layer was transferred into a 2 mL micro tube. Behring diagnostics. Organic solvents were evaporated and the aqueous residue was partitioned with CH2Cl2. Each concentration was done in triplicate.V.5 mg). Bands were detected by 254 nm UV light. LOD were 0. A total of 500 g of fresh cells were extracted (3x) using 1 L of 80% MeOH each time. mixtures were sonicated for 1 h.12 µg for 1 and 0. Eluting substances were collected in glass tubes according to their retention times. Fractions were eluted by subsequent use of the following eluents: n-hexane: CH2Cl2 (9:1. 40 . (2001).0 mg) and 2 (2. To monitor the viability and growth of the cell cultures. 80%) was added and the mixture was sonicated for 1 h. CH2Cl2 (4 mL) and distilled water (4 mL) were added. The tube was centrifuged at 15. Fractions of 20 mL each were collected and were profiled by TLC and GC-MS. Cells were filtered using a Büchner funnel. Alltech/Applied Science B. Darmstadt. MeOH (2 mL. To disrupt cells. Merck.9902) and y = 123516 x – 218 (R2 = 0. DW was also determined.28.9885) for 1 and 2. Calbiochem. Fractions with corresponding profiles were combined and concentrated. The lignan-containing fraction was further separated by preparative TLC on preparative silica gel plates (20x20 cm. Suspension-grown cells were harvested each 2 days during the growth cycle of 21 days. La Jolla.Erlenmeyer flask containing the cell suspension cultures of P.000 g for 5 min in an Eppendorf 5414 centrifuge. three-weeks-old suspension cultures were harvested and filtered through miracloth (Lot B43936. 1 mm thickness. No. Extraction and isolation For the isolation of lignans. For further purification of the lignans obtained by preparative TLC. This resulted in a total of 16 fractions. The Netherlands) and sealed immediately. Regression equations were y = 143229 x – 264 (R2 = 0. 0. respectively. The tube was closed. Three bands were scraped off and analyzed by GC and GC-MS. Analysis Lignan profiling was performed according to Koulman et al.43. medium pH and conductance were routinely measured in the supernatant. CH2Cl2 (500 mL). Darmstadt. CA). and part of the liquid was transferred into a 0. calibration curves were prepared using MeOH solutions with concentrations ranging from 2.

2 ± 3.4 dimethoxybenzylbutyrolactone) have been described previously in P. Although the relative configuration could not be determined unambigously. 320 (7). This medium was used in all experiments.. urinaria (Chang et al. urinaria (Chang et al. 1981)..9 ± 0. MS (EI. for C22H26O6: 386. Anjaneyulu et al. These last two compounds could not be separated. Two more compounds with MS fragmentation patterns resembling lignans were found.7) as two ABM spin systems..): 384 [M]+(5). Fragments at m/z 354 and 322 correspond to the loss of two molecules of MeOH [M-HOCH3]. conductivity decreased from 3.. a (8S*. seed (phyllantin.8 ± 19. HRMS: m/z = 386. see Table 1. Compound 2 was identified as urinatetralin that was confirmed by comparison of NMR and MS spectra with published data (Chang et al. called dihydrocubebin-dimethylether. Fresh weight (FW) increased from 105.8 S*) configuration of 2 from P. These data indicated an urinatetralin-like structure for 1. Compounds 1 and 2 were purified by preparative HPLC and their structures determined and confirmed (Fig. Due to the symmetry of the molecule only one set of signals is observed.H-COSY. 45 (56). None of these lignans was present in cell suspension cultures.2 g L-1 to 202. either qualitatively or quantitatively. 135 (26).1729). s) and six aromatic protons ( H 6.1 g L-1 to 12. This compound. Satyanarayana and Venkateswarlu. The structure for 1 was further supported by H. 41 . seco-isolarisiresinol trimethylether. four other lignans were found in cell suspension cultures..28 (6H. root (demethylenedioxyniranthin. see Table 1. typical for lignan structures. 135 (100). 2003). as shown by HRMS. Compound 1 was a white amorphous solid with a molecular formula of C22H26O6.0 ± 1. int.4 -dimethoxybenzylbutyrolactone. roots.): 386 [M]+(2).. phyltetralin. During the growth cycle. The 1H NMR data exhibited two methylenedioxy groups at H 5. 3. niruri that successfully produce lignans. 1964. 352(6). The molecular mass of 1 is two mass units higher than that of compound 2. int. 70 eV) m/z (rel. 1973. 2003). two methoxy groups at H 3. the B5 medium resulted in the best growth of callus and cell suspension cultures of P.0 mS on day 21. a slow increase in pH of the growth medium was observed. The relative configuration derived from the 1H NMR coupling constants was in agreement with the (7 R*. The base peak at m/z 135 corresponded to a methylenedioxy benzyl fragment (C8H7O2). We found qualitatively and quantitatively different lignan profiles comparing seeds. lintetralin. 187 (19). i.4-methylenedioxybenzyl-3 .92 (4H. niruri. 2). Urinatetralin (2) was obtained as an amorphous solid: 1H and 13C NMR data. hypophyllantin.01 mS on day 1 to 1.8'S*) configuration is assumed from a common biogenesis of 1 and 2.2 g L-1 and dry weight (DW) increased from 6. isolintetralin.8S*. niruri (Row and Srinivasalu. Compound 1 was a lignan that was not found in the plants before and compound 2 has been reported earlier as new compound from P. nirtetralin. lacking the carbocylic ring at C-2 and C-7 .5 – 6. This indicates that cell lysis occurred between day 15 and 21. 185 (12). Cell suspension cultures of P. lintetralin and isolintetralin) and callus culture (3. the same compounds found in the plant from which they are established. aerial plant parts. 354(3). However. This is the first report of cell suspension cultures of P. 322 (2).5 ± 0. niranthin and nirtetralin). 1991.1723 [M+] (calc. All lignans found in aerial plant niranthin.2 ± 0. as shown by HRMS ([M+]: m/z 386. During this time. 77 (8). 45 (100) Results and discussion From the various medium compositions tested.02 mS on day 15 and slightly increased to 2. 70 eV) m/z (rel. MS (EI. 2003). seco-4-hydroxylintetralin). 1998).e. niruri had a growth cycle of 21 days. parts (phyllantin. callus and suspension cultures as determined by GC-MS.Dihydrocubebin-dimethylether (1) was obtained as an amorphous solid: 1H and 13C NMR data. Calixto et al. 77 (29).1 g L-1. This is another example that plant cell cultures do not always accumulate.1723).4-methylenedioxybenzyl-3 . is a new natural product but has been synthesized from dihydrocubebin (Anjaneyulu et al. s). HMQC and HMBC spectroscopic analysis.

O 3 2 1 6 5 6' 5' 7 8 9 OCH3 OCH3 9' O 5 6 1 7 8 9 OCH3 OCH3 9' O 4 7' 1' 8' 2' 3' O 4 3 2 7' 1' 8' 2' 3' 6' 5' 4' O O 4' O O 1 2 Fig. 1 1 2 C 134. TMS.93 d (10.8 q 100.5.93 s Feeding of early precursors of lignans to cell suspension cultures. 8.35 s 3.2 t 59.21 s 6.92 s 5.9 s 107.56 dd (7.1 mM of either compounds had no effect. CDCl3).3) 6.81 s 145.5 s 145.6 s 47.59 d (1.13 m 3.4 s 108.6 d 146.8 t 100. 9.1 t 40.9 s 121.5 d 145. decreased to 0.26 s 5.1 d 145. 1 reached a maximum at 0.56 s 2.2) 3.85.30 m 2.3) 6.55 dd (13.81 s 108. niruri: dihydrocubebin-dimethylether (1) and urinatetralin (2). 1.5 d 109.7) 3. 9.8) 1.5 d 35.30 m 2. enhanced the production of 1 and 2.18 mg 42 .26 m. 0.5 mM ferulic acid.1 d 71.8) 6.8) 6.5.8 q 58.8 d 72. Table 1.0) 2.6 s 108.5 t 139. 1 mM appeared to be toxic for cell suspension cultures (causing growth inhibition). 2.7 d (7. 3.8 d 72.8 t 36.6.45 dd (4.83 s 5.0 d 33.02 m 2.4) 3.9.4 s 147.28 s 5. 3.92 s 6.3) 6.02 m 2.9) 6.6 s 147.4'-OCH2O1 signals coincide.9) 6.59 d (1.8.7 t 100.9) 3. 3.78 ddt (10. 10.9 s 109. 3.1 t 40.56 dd (7.9.7) C 130.7 d (7.9.65 dd (13.7 t 134.1 s 133.55) 3.0 q 59. 5.8 d 108.74 d (7.7 t 58.7 t 13 1 H (J/Hz) H (J/Hz) 6. 1.9.7 d 45. Lignans from cell suspension cultures of P.8 d 35.65 dd (13.28 s 3. 1.5 mM caffeic acid or 0.64 dd (7.40 dd (6.0. 8.1 q 99.55 d (1.6) 3. While feeding 0. Position 1 2 3 4 5 6 7 8 9 1' 2' 3' 4' 5' 6' 7' 8' 9' 9-O Me 9'-O Me 4. 5.8.4 s 109. 1H and 13C NMR data of dihydrocubebin-dimethylether (1) and urinatetralin (2) (500 MHz. In the control cells.5.5-OCH2O3'.10 dd (9.78 m 2.4 d 75.5 d 147.6 d 122.46 mg g-1 DW on day 1 after inoculation.0) 2.3) 3.1 d 121.26 m.2 t 13 6.36 m 3.55 dd (13.

67 mg g-1 DW on day 12 (7-fold compared to control cells).8 ± 0. 1 increased to 0. and maximum enhancement was reached on day 7 (2-fold compared to control cells) (Fig.9 g L-1. conductivity decreased from 3.01 mS to 1.5 mM of caffeic acid.2 ± 3. FW increased from 118. 0.0 mg g-1 DW on day 7. and from day 14 to 21. niruri cell suspension cultures after feeding of 0. cell suspension cultures grew with a rate comparable to control cultures. niruri.5 mM caffeic acid.g-1 DW on day 5 then increased on day 7 and further decreased to 0.5 ± 0. and a maximal enhancement was found on day 5 (2.0 ± 0.4 ± 0.6 ± 0. Feeding of 0. and maximal enhancement was shown on day 5 (2 fold compared to control cells) (Fig.05 g L1 to 15. Individual values expressed as means ± standard deviation in mg g-1 DW are averages of three independent experiments.01 mS.7 ± 6.5 mM ferulic acid.8 g L-1 and DW increased 8. 3).09 mg g-1 DW on day 1 after inoculation to 0.5 ± 0. the amount of 2 increased to 0.0 ± 7.9 ± 2. 0.5 mM ferulic acid caused an increase of the amount of 2 to 0.20 mg g-1 DW on day 7 then decreased until day 14.5 mM.5 mM of ferulic acid caused an increase of the amount of 1 to 5.9 ± 0. Feeding 0.2 g L-1. 43 . FW increased from 117. Adding 0. the amount of 2 increased from 0.5 mM caffeic acid. the content remained constant. By feeding of 0.5 mM ferulic acid did not inhibit growth of cell suspension cultures of P. Dihydrocubebin-dimethylether (1) accumulation of P.5 mM ferulic acid ( ) and in control cultures ( ).22 mg g-1 DW on day 7.3 mg g-1 DW on day 7. 4).5 mM caffeic acid or 0.01 mS. By feeding 0.05 mg g-1 DW on day 21.5-fold compared to control cells).3 g L-1 to 15.1 g L-1 to 203. These data show that after feeding caffeic and ferulic acid in concentrations of 0.6 0.2 0 0 2 4 6 8 10 12 14 16 18 20 22 Days Fig. Addition of 0. In control cells.0 g L-1 to 208. the conductivity decreased from 3. By adding 0.5 mM caffeic acid ( ).05 mS to 1.4 g L-1 and DW increased from 7.8 Dihydrocubebin dimethylether (mg g-1 DW) 0.1 ± 7.4 0. 3.

We are grateful to Drs.4-dimethoxy and 3.5 mM ferulic acid ( ) and in control cultures ( ).3 Urinatetralin (mg g-1 DW) 0. 3028-IX/P3S-1/KON-QUE II/2000. Accumulation of 2 on days 2-7 was followed by accumulation of 1 on days 5-12 after feeding 0.5 mM caffeic acid ( ).. niruri following cyclization involving C-2 and C-7 . Acknowledgements The research was supported by the QUE Project Batch II. 1986). such as 3. 1984).4.4 0. Other compounds lacking a phenolic group. Department of Biology. Urinatetralin (2) accumulation of P. These compounds can be replaced by a 3 . niruri cell suspensions. This agrees with the incorporation of labeled ferulic acid into podophyllotoxin and deoxypodophyllotoxin in L. The coupling of phenylpropanoid monomers leading to urinatetralin and dihydrocubebin-dimethylether in P.2 0. are not converted into lignans (Jackson and Dewick.5 mM caffeic acid.5-trimethoxycinammic acid. Caffeic and ferulic acid have the necessary phenolic groups required for the oxidative coupling mechanism. Studies with labeled precursors may confirm this. with its 3 . Individual values expressed as means ± standard deviation in mg g-1 DW are averages of three independent experiments. niruri cell suspension cultures after feeding of 0. IBRD Loan No. This suggests that 1 is a precursor for 2 in cell suspension cultures of P. Institut Teknologi Bandung. 4 -dihydroxy substitution pattern. This may have been caused by the different oxygenation pattern of the compounds. 44 . Feeding caffeic and ferulic acid increased the concentration of compounds 1 and 2 in P. 4. Caffeic acid enhanced the formation of urinatetralin and cubebin dimethyleter better than ferulic acid. Department of Biology Institut Teknologi Bandung ITB.1 0 0 2 4 6 8 10 12 14 16 18 20 22 Days Fig. niruri cell suspension cultures appears to involve two precursors with a 4 -hydroxy-3 -methoxy substitution pattern or 3 .4 -dihydroxy substitution pattern. 0.0. for collecting plant materials. This reaction has also been shown by cyclization of the quinone methide as an intermediate to desoxypodophyllotoxin (Kamil and Dewick. 4 -methylenedioxy substitution pattern. 4193 – IND. 2002). album (Seidel et al. is apparently more easily incorporated than ferulic acid that has a 4 -hydroxy-3 -methoxy substitution pattern. Indonesia. Djuandi. Caffeic acid. This may be due to the incorporation of these precursors into the secondary metabolite biosynthetic pathway. under the contract No.

Herman J. an Indonesian medicinal plant Elfahmi. Wim J. Sieb Batterman.Chapter 4 Lignan profile of Piper cubeba. Rein Bos. Quax Submitted 45 . Komar Ruslan. Oliver Kayser. Woerdenbag.

hinokinin. cubeba investigated. (Piperaceae) was determined using GC. This is the first investigation of lignans from the leaves and the stalks of P. isoyatein are common lignans in the genus Piper and appeared as major components in all part of P.Abstract The lignan profiles of aerial part of Piper cubeba L. Cubebin. cubeba. yatein. The number of lignans found in the leaves was 15. 46 . followed by berries and the stalks with respectively 13 and 5 lignans. GCMS and HPLC.

For the determination of lignans.0 mL of CH2Cl2 and 4 mL of water. since P. 2003 and 2005).0 mL methanol and centrifuged.0 mL of CH2Cl2 phase were taken and evaporated to dryness.. dihydrocubebin have been reported to have antifeedant activity against a number of stored product insects. 1968). Institut Teknologi Bandung (Indonesia). P. stalks and leaves. 1996.. Bastos et al. 1987. cubeba (Fig. The residue was redissolved in 1. Usia et al. analgesic and trypanocidal activities (Borsato et al. 2001. Antiinflammatory. hinokinin can be synthesized using cubebin as precursor (Da Silva et al. Temanggung. Germany) and extracted under sonification (1 h) using 2 mL of 80% MeOH. Some of these lignans showed inhibitory activity against cytochrome P450 enzymes that are involved in the metabolism of all currently used drugs (Usia et al. Koul et al. alkaloids. De Souza et al.. cubeba has received less attention so far.. The lignans and the essential oil have been more intensively investigated. These 47 . 2. diarrhea. 2005b). and authenticated at the Department of Biology. cubeba using GC. 2002). Sumatra. 2001). Badheka et al. Yatein is also an interesting lignan due to its biological activity and its function as a biosynthetic precursor of deoxypodophyllotoxin and podophyllotoxin that are well known for their anticancer properties. 1995. cubebin. (Piperaceae) was collected in April 2002 from Jatiroto. (Piperaceae) inhabits Java.. 2000). shaken for 5 s and centrifuged at 1. Methanol and water extract of P. In comparison to other species of genus Piper.. All solvents and chemicals were purchased from Sigma-Aldrich (Zwijndrecht. 1997). Piperine is an abundant alkaloid in the berries of this species (Parmar et al. Hinokinin has been reported to have anti-inflammatory and analgesic effect. i. The collected plant material was air-dried.. Phytochemical and biological investigations have been carried out in order to prove its traditional use. solvents and chemicals Piper cubeba L. This activity is comparable to podophyllotoxin (Harmatha and Nawrot. Southern Borneo. GC-MS and HPLC and compared the data from berries. cubeba have been studied using chemically-induced edema and arthritis in vivo (Choi and Hwang. abdominal pain. 1997.. Materials and methods Plant material. cubeba. Because of the structural relationship. 2005a. cubeba accumulates both groups of compounds in relatively high amounts. hinokinin. based on the Flora of Java (Backer and Van de Brink. 2005). Yatein. 1986. cubeba berries have been shown to display an inhibitory effect against the hepatitis C virus (Hussein et al. Satroamidjojo. Economically. Central Java.. 1985. Lignans are an important group of secondary metabolites that are also assumed to contribute to the biological activity. Only three groups of secondary metabolites have been reported from the berries of P. cubeba is important as a source of pepper (the dried berries) for the worldwide spice market (Usia et al. Twenty four lignans have so far been reported from P.e. 2005). Indonesia.500 g for 5 min. The resulting extract was fractionated using 4. In this study we made a lignan profile of aerial parts of P. The Netherlands).Introduction Piper cubeba L.. leaves or stalks) was grinded together with quartz (Merck. 1) (Prabhu and Mulchandani. 2000. Indonesia. syphilis. antioxidant. Darmstadt. anti-allergic and analgesic activities of P. A voucher specimen (HBG10PC01) is deposited at the Herbarium Bandungense. Parmar et al. Extraction and isolation One gram of dried plant material (either berries. P. lignans and terpenoids (essential oil). enteritis and asthma (Eisai. Cubebin has been shown to possess anti-inflamatory. 2005). dysentery. 2005). cubeba are commonly known as cubeb (in Indonesia known as kemukus) and used in Indonesian traditional medicine to treat gonorrhea. and other isles in the Indian Ocean. The berries of P..

The elution length was 8 cm in a saturated chamber.05% formic acid) : 5 mM ammonium formate (0. scan speed. film thickness 0. Germany) and toluene : acetone (85 : 15 v/v) as eluent. Chrompack. ‘s-Hertogenbosch. HPLC. The column was a Luna C18(2). interface temperature. cubebin. WCOT fused-silica CP-Sil 5 CB (15 m x 0. GC conditions: WCOT fused silica CPsil 5 CB lowbleed/MS. temperature program 35 min at 90 °C. 15 m x 0. PTFE. GC-MS analysis was performed on a Shimadzu QP5000 GC-MS system equipped with a 17A GC. ProFill 25 mm syringe HPLC filters. 250°C. inlet pressure.05% formic acid) : acetonitrile = 800 : 156 (w/w)) and 5% solvent B (acetonitrile : MeOH (0. GC-MS.10. 260°C. nr. a SPD-M10A vp DAD detector (200 – 340 nm. Brown Chromatography Supplies). Germany) and toluene: acetone (85:15) as the eluent. 2. a Kontron 360 auto sampler. ion source temperature. 70 eV. version 6. a gradient back to 5 % solvent B in 2 min and remaining on this final concentration for another 2 min. pore size 0. 11 mm with rubber/PTFE septa (cat. 20:1. a FIAtron systems CH-30 column heater (USA). 151123.10 m. carrier flow (He): 46. linear gas velocity. 151216. column flow: 2.12SP4. 34-600 u HPLC analysis was performed using a Shimadzu-VP system (Shimadzu. The Netherlands). injected volume. 250 x 4. Merck. 150-320°C at 15°C min-1 and maintained at 320°C for 5 min.. 0. a SCL-10A vp system controller. Bester. TLC Gas chromatography (GC) analysis was performed on a Hewlett-Packard 5890 Series II gas chromatograph equipped with a 7673 injector and a Hewlett Packard 3365 Series II Chemstation.2 mL min-1. Temperature program: 150°C – 320 °C at 15 °C min-1. a FCV-10AL vp low pressure gradient mixer.25 mm ID (Varian Middelburg. CP7810. The Netherlands). an AOC-20i autoinjector. under the following conditions: column. detector (FID) temperature. Middelburg. and CLASS-VP software. inlet pressure: 75 kPa.: 279423-28.d. the Netherlands). The Netherlands) consisting of a LC-10AT vp pump. 300°C. 48 . cat. band with: 4 nm) . Brown Chromatography Supplies) were used.45 µm. Bands corresponding to lignans were scraped off and extracted with 2 mL MeOH. helium was used as carrier gas. hinokinin and yatein. total flow: 46. 32 cm s-1. split ratio. film thickness 0. The bands were detected by UV light at 254 nm. Injector temperature: 275°C.6 mm.31 mm i. and the GCMS solution software 1. The methanolic solutions were submitted to further analysis. nr. AF22347113208 (Alltech/Applied Science Group. oven temperature program. The most abundant lignans.25 mm thickness. followed by a gradient to 100% solvent B in 19 min. 5 psi.2 mL min-1. The injection volume was 20 L with a flow rate of 1 mL min-1 using a time program of 30 minutes consisting of 5 min 95% solvent A (5 mM ammonium formate (0. 2 scans s-1. together with 2 mL autosampler vials. Breda) were used. part nr. split ratio: 20:1. MS conditions: ionization energy. (Phenomenex. HPLC. 90-170 °C at 4 °C min-1. 5µm. were isolated as >95% pure compounds (as checked by GC and HPLC) and used for quantitative purposes. together with a Phenomenex guard cartridge C18 (ODS.0 µL. 00G-4252-E0. GC-MS. 4x3 mm). 2 min 100% solvent B. 250°C. nature.05% formic acid) = 585 : 40 : 200 (w/w)). mass range. nr. AJ0-4287.samples were ready to be analyzed by GC.1 mL min-1: linear velocity: 75. The isolation of lignans was achieved by preparative thin layer chromatography (TLC) using silica gel F254 plate (Merck.5 cm sec-1. based on a method described by Walsky and Obach (2004) Analytical thin layer chromatography (TLC) was performed using silica gel 60-F254 (5 x 10 cm. Analysis of lignans using GC. injector temperature.25 µm. injection volume: 2 µL. As crimp seals. Darmstadt.

cubebin (8). R4= Ac 19. R2 + R3 = CH2 10. 4-hydroxycubebinone (24). R1 = H. hinokinin (9). sesamin (14). isoyatein (10). Results and discussion The extraction methods applied and the further isolation conditions assured that most lignans were exhaustively extracted from the plant material. kadsurin A (15). α-O-ethylcubebin (21). yatein (3). On the chromatogram eleven bands from the leaves extract and seven bands from the fruit extract. β-O-ethylcubebin (20). R1 = H. The simple isolation of lignans using preparative TLC provided satisfactory results. R2= R3= CH3 6. clusin (6). R1= OCH3. R4= H O O OR4 OH O O O O OC2H5 O O 20 O 21 H3CO O O HO CH3O O O 22 O O O O 23 O O O OH OH O 24 OCH3 Fig. all clearly separated.4''-methylenedioxy-benzyl)-3-(3'. R2= R3= CH3 O O O O O 15 O O OC2H5 O O O H3CO H3CO 16 O O O O O O 13.R3O O R2O R1 H3CO O OCH3 OCH3 R3O O R2O R1 H3CO OH OCH3 OCH3 O O O OH O R3O O R2O R1 O O O 8 O 1. R1 = OCH3. R2 + R3 = CH2 4. corresponded to lignans. R1 = OCH3. 2-(3''. R1 = H. 1. R1 = H3. R4= H 18. R2 + R3 = CH2 3. heterotropan (22). hemiarensin (18). 5-methoxyclusin (7). aschantin (13). R1 = H. R2+ R3= CH2 R3O R2O R1 O O 17. although some lignans co-existed with others in the same bands. R2 = R3 = CH3 OR3 OR2 O R1 5. cubebininolide (1). 5'methoxyhinokinin (11). dihydroclusin (19). R2 + R3 = CH2 7. R2+ R3= CH2 12. R2= R3= CH3. R1 = OCH3. R1 = H. R1= OCH3. R1 = H. R2= R3= CH3 14. R2+R3= CH2 9. R1 = H. R1= H. Survey of lignans from Piper cubeba reported in the literature. R2+ R3= CH2. R2+ R3= CH2. R1 = OCH3. The isolated 49 . magnosalin (23). R1 = OCH3. thujaplicatin trimethylether (4).4'-dimethoxybenzyl) butyrolactone (12). cubebinone (2). R2 = R3 = CH3 2. R2= R3= CH3 11. cubebinin (5). piperenone (16) dihydrocubebin (17). The major lignans could be isolated up to 95% pure.

6397. The stereochemsitry of these compounds surveyed in Fig. It might be attractive from an economical point of view to harvest the leaves earlier.4 (R2 = 0. Thirteen lignans were detected in the berries.3 ± 1.6 12.2 for hinokinin and 0.558. Different parts of P. 0.67 (R2 = 0. Furanofuran lignans such as cubebin.lignans were used to identify lignan peaks in the GC. LLOQ was 0. It should however be taken into account that the concentrations of the major lignans in the leaves are considerably lower than in the berries.3 Berries (± SD) 23. Mass spectra of the analyzed lignans were compared to earlier published data (see Table 2). The limit of quantification (LLOQ) was defined as the lowest calibration standard that could be quantified with an accuracy of 90-110% and a precision of 15%.0 0.2 ± 0. Yatein was the most abundant lignan found in the berries at concentrations 2. cubeba (leaves. GC-MS and HPLC chromatograms.3 times higher than cubebin.9885). Each concentration was prepared in triplicate.997) and y = 111833x . isoyatein that are common lignans found in the genus Piper also appeared as major lignans in all parts of P. hinokinin and yatein..9 ± 5. leaves. hinokinin and yatein.4 2. y = 117773x . in a stage in which the plant has not yet developed flowers and later berries. The limit of detection (LOD) was established as the amount of analyte that provided a signal-to-noise ratio of 3.9 18. respectively. calibration curves were prepared using MeOH solutions of the isolated lignans at concentrations ranging from 2.4 ± 0. and 0.0 times higher than hinokinin and 1.25 for yatein. Concentration of major lignans in Piper cubeba berries.1 µg for cubebin. Table 1. For the quantitative determination of cubebin. LOD were 0. Neolignans with an unusual structure such as kadsurin A and piperenone that have also been reported from P. cubeba. cubeba.1 µg for yatein So far. and stalks (means from three independent determinations). All types of lignan structures that are commonly distinguished could be identified. berries. 1 was taken from the literature. Mass spectral data can not be used to determine the stereochemistry of the isolated compounds.0 50 . This knowledge can be used for the further development of (rationally designed) phytomedicines from P. yatein. phytochemical and pharmacological studies have only been done with the berries of P.9 µg for hinokinin and 0. fifteen in the leaves and only five lignans in the stalks.0 0. 1996) could not be identified in our material.9 Stalks (± SD) 0.8 ± 0. Based on the present inventory of lignans in the aerial parts of the plant we conclude that in addition to the berries also the leaves may be used for medical purposes. cubeba that are used in traditional medicine.9 ± 4.1 3.6 ± 0. Hinokinin was the most abundant lignan in the leaves and the seeds (see Table 1).4 ± 0. Compound Yatein Hinokinin Cubebin Concentration (mg DW-1) Leaves (± SD) 2. cubeba show a broad variation.3 µg for cubebin.5 to 25 µg mL-1. Regression equations were y = 123516 x – 218 (R2 = 0. The structures of the lignans found in P. including jamu.7 ± 0. cubeba (Koul et al. hinokinin.995) for cubebin. stalks) showed different lignan profiles (see Table 2) and identification took place based on comparison of the mass fragmentation patterns. This may be of economical benefit.

5). 207 (12). 136 (21). 173 (22). 162 (8). 1996 Parmar et al. 136 (29).. 182 (13. 135 (56) 358 (9). 219 (2).. 187 (7).. 135 (94) 372 (3). 136 (17). 135 (67) 402 (3). 161 (41). 1985 Prabhu et al. 1986 Prabhu et al. 167 (10). 181 (100). 194 (1). 135 (100). 181 (98). 136 (23). 173 (10). 161 (12). 248 (3). 265 (4. 1986 Koul et al. 162 (7). 151 (100). 386 (10). 249 (2). 152 (8). 225 (6). 1) Ashantin (13) Clusin (6) Cubebin (8) Cubebinin (5) Cubebininolide (1) Cubebinone (2) Dihydroclusin (19) Dihydrocubebin (17) α-O-Ethylcubebin (21) β-O-Ethylcubebin (20) Hemiarensin (18) Mass spectrum m/z (rel. 136 (16). 1986 Badheka et al. 152 (16). 135 (100) 384 (14)... 207 (4). 181 (100).5).7). 136 (51)....6). 219 (3). 181 (77). 210 (82). 135 (13) na 384 (56). 1987 Badheka et al.)* 400 (27). Occurrence of lignan in Piper cubeba berries.... 135 (53) na 370 (8). 181 (100). 165 (15). 238 (3). 181 (100). 1987 Badheka et al.. 219 (8). 131 (15) 448 (41. 1987 Badheka et al. 135 (100) Plant part Berry Leaf + + + + + + + nd + + + + nd nd + + nd nd nd + + nd nd + nd + nd nd + + nd + + + + nd nd + + nd nd + nd + nd nd + + Reference Parmar et al. 382 (1). 194 (3). 222 (2). 148 (12). 1987 Usia et al. 203 (54). 1987 Badheka et al. 136 (36). 161 (11). 182 (51). 206 (4). 15 (19).. 182 (14). 178 (72). 151 (15). 370 (4). 2005 Badheka et al... 145 (12). 179 (28). 1987 Usia et al. 223 (3. 138 (11).. 235 (2). 204 (7). 161 (12). 151 (31). 249 (32). 248 (2). Compound (nr. 166 (59). 238 (1. 192 (1). 1996 Badheka et al. 400 (71). 179 (12). 152 (41) Yatein (3) 400 (26). 340 (7).6). 181 (9)... 1986 Badheka et al. 2005 Badheka et al.. 203 (21). 182 (100). 136 (30). 1997 Prabhu et al. 1985 Badheka et al. 265 (3).. 204 (15). 1987 Badheka et al. 165 (70) 404 (41). 135 (15) 356 (13).. 182 (10). 136 (28). 250 (2. 192 (9).. 203 (3). int. 322 (3). 203 (10).4'-Methylenedioxybenzyl) -3-(3'. 1985 Prabhu et al. 1986 Koul et al.5). compare Fig. 136 (33). and stalks. 166 (51). 182 (49). 339 (7). 181 (100) 446 (64). 225 (3. 182 (100).4'dimethoxybenzyl)-butyrolactone (12) Piperenone (16) 388 (100). 251 (5). 138 (9) Sesamin (14) na Di-O-methyl thujaplicatin methylether 400 (88). leaves. 347 (40). 135 (6) 384 (16). 182 (38). 1985 Badheka et al. 135 (100) na*** na 354 (13). 430 (24. 210 (6). 358 (5).. 187 (25). 179 (6). 1985 Prabhu et al. 339 (7). 182 (60). 151 (67). 135 (100) 400 (50). 162 (50). 151 (35).Table 2.6). 222 (4). 1985 Badheka et al. 181 (100) 430 (24). 177 (11). 284 (7). 235 (3). 165 (3). 1986 Stalk nd** nd + nd + nd nd nd nd nd nd nd nd + + nd nd nd nd nd nd nd nd + Heterotropan (22) 4-Hydroxycubebinone (24) Hinokinin (9) Isoyatein (10) Kadusrin A (15) Magnosalin (23) 5'-Methoxyhinokinin (11) 5-Methoxyclusin (7) 2-(3'. 135 (88) * Mass spectra data are taken from the literature and compared to the fragmentation patterns of thelignans found in our study **nd = not detected ***na = not available 51 . 165 (100).5). 338 (31). 264 (2). 135 (100). (4) 167 (8). 338 (21). 219 (2). 166 (8). 249 (2).

under contract No. Department of Biology. IBRD Loan No. Institut Teknologi Bandung. Djuandi. Indonesia.Aknowledgment The research was supported by the QUE Project Batch II. 4193-IND. Department of Biology. 3028-IX/P3S-1/KON-QUE II/2000. for collecting and identifying the plant material. 52 . We are grateful to Drs. Institut Teknologi Bandung ITB.

and Wim J.Chapter 5 Essential oil constituents of Piper cubeba from Indonesia Elfami. Woerdenbag. Komar Ruslan. Oliver Kayser. Rein Bos. Herman J. Quax Submitted 53 .

4%).3%). epi-cubebol (4.2%). epi-cubebol (4. and cubebol (5. The principal difference was of a quantitative nature. -elemene (9.6%) were the main components of the berries oil.0%). -cadinene (16. Fils.8 % v/w) and leaves (0.2%). E-caryophyllene (5.1%). and cubebol (4.9 % v/w) of Piper cubeba L. caryophyllene (3. 54 . No large qualitative differences were found in the composition between berries and leaves oil. Sabinene (9. (Piperaceae) was investigated by GC and GC-MS.8%) were the main components of the leaves oil.05%) that were not found in the leaves. Trans-sabinene hydrate (8.1%).6%). although the berries contained a considerable amount of constituents in traces (<0.! Abstract The chemical composition of the essential oil of ripe berries (11.

In addition. It is now also cultivated in several other tropical areas. Xylene (100 µL) was used as the collection liquid. intestinal diseases. rheumatism (Sumathykutty et al. antileukemic and antibiotic activities (Taneja et al. Central Java." Introduction The genus Piper belongs to the Piperaceae. 55 . Materials and methods Plant material Piper cubeba L. Jirovetz et al. Baker. (Piperaceae) was collected in April 2002 from Jatiroto. Deventer. The aim of the present study was to investigate of the essential oil composition of P. insecticidal. detector (FID) temperature. using the apparatus described in the Nederlandse Farmacopee. a family with more than 700 species throughout the tropical and subtropical regions of the world. film thickness 0.. Gas chromatography GC analysis was performed on a Hewlett-Packard 5890 Series II gas chromatograph equipped with a 7673 injector and a Hewlett Packard 3365 Series II Chemstation. inlet pressure. Oyedeji et al. oven temperature programme. 250°C. 1968). Temanggung. 1. and authenticated at the Department of Biology.8 cm s-1. 1999. J.0 g of air-dried and freshly ground (1 mm) leaves and fruit material by hydrodistillation for 4 h in 300 mL-1 water. and have shown antifungal. Many species of the genus Piper are used in traditional herbal medicine. 2nd printing (Anonymous. The Netherlands).. bronchitis. and the essential oil was stored at -20° C until analyzed.. carrier gas. He. 300°C. 2005). Isolation procedure The essential oil sample was isolated from 20. but only one gives a detailed overview of the essential oil of cubeb berries (Martins et al. 1998. Sumathykutty et al. under the following conditions: column. based on the Flora of Java (Backer and Van de Brink. 50 µL of each residue were diluted with 950 µL cyclohexane and injected to GC and GC-MS analysis.. Piper cubeba (in Indonesia known as kemukus). A number of polyhydroxy cyclohexanes have been isolated from Piper cubeba and shown to display tumor inhibitory. filled with 1 g of silica gel (7086-07.25 µm). respectively. 2002. They are also used for the treatment of cough. Sastroamidjojo. Essential oil investigations of a number of Piper species have been reported.T. 56:1. injector temperature.. the oil was separated into two fractions with hydrocarbons and oxygen-containing compounds. including East Africa. is a plant native to Java and Borneo that produces spicy berries (cubeb berries).26 mm. Institut Teknologi Bandung (Indonesia). Orav et al. 6th ed. In Indonesia P. A voucher specimen (HBG10PC01) is deposited at the Herbarium Bandungense. cubeba berries and leaves from Indonesia.0 µL. 1966). The collected material was air-dried... After gentle evaporation of the solvents of both fractions. anthelminthic and antitumor activities. 31. 2001). injected volume. cubeba is valued as a medicinal plant (Eisei 1995. with subsequently 5 mL-1 n-hexane and 5 mL-1 diethyl ether. by eluting 250 µL of oil on a Bakerbond SPE column. Indonesia. split ratio. 18 psi.. linear gas velocity. 1999). 1991). according to the determination of the essential oil content in vegetable drugs. 60°-290°C at 3°C min-1. WCOT fused-silica (J & W) DB-5 (30 m x 0. 2004. The essential oil was diluted 50 times with cyclohexane prior to GC and GC-MS analysis.

for berries and leaves. were the main sesquiterpenes (26. and -cadinol (2. 77(11).1%) (Violon et al.5 mL min-1. for the berries and leaves oil).7%) and -cadinol (1. Results and discussion Hydrodistillation of the berries of Piper cubeba yielded 11. split ratio. 55(29). epi-cubebol (4. injected volume.4%).25 µm).2%). oven temperature programme. 187(2). whereas it was present in the berries oil in only small amounts (0.5% and 18.9%) in the leaves oil.10 software. Comparing the composition of the berries and the leaves oil. 2001. total flow. and GCMS solution version 1. In the oxygenated monoterpene fractions (3. but could not be identified. caryophyllene (3.1%). 55(29). The percentages of the components were calculated from the GC peak areas. scan speed. 1991).5% (Lawrence. 34-350 u. E-caryophyllene (2.6% and 4.8%) and limonene (3.1%). mass range. -pinene (1.9% (v/w) oil. 250°C. dealing with 63. respectively.0%. -Copaene (3. In the P. Remarkable is the high content of -cadinene in the leaves oil. column flow.8%). 2.! Gas chromatography-mass spectrometry A Shimadzu GCMS QP5000 system was used equipped with a GC-17A gas chromatograph. In the leaves oil.5% and 8. 117(10). cubeba berries are known. MS conditions: ionization energy. -cubebene (5. and mass spectral databases and from the literature (Adams.8%). From the oxygenated sesquiterpenes (15. 81. cubeba leaves has been investigated. From the literature only three older and more limited studies concerning the essential oil composition of P. Also seven sesquiterpene epoxides with retention indices between 1600 and 1700 were detected.8% (w/w) and the leaves 0.8%). film thickness 0.4%) were the principal monoterpenes in the leaves oil. As far as we know. -elemene (9. 1980). ion source temperature. respectively). 1. -cubebene (11. no big differences were found for the monoterpene and sesquiterpene hydrocarbon fractions. 275°C. 12). 63 components could be identified. In a commercial sample from Indonesia (without further specifications).. where cubenol and epi-cubenol were present with 3. inlet pressure. and limonene (2. were the main components in both oils. In total 105 components could be identified in the berries. Two sesquiterpenes in a relatively low concentration (0.0%). 91(74). 105(62).1%). 105(58). 202(M+. respectively).0%) in the leaves oil.3%).2%) and cubebol (5. Comparing the mass fragmentation patterns of compound I.5%) from India the main compounds 56 . 133(100). this is the first time the essential oil composition of P.0%). m/z(%): 41(67).0 µL. and compound II.4%). carrier gas. 60°-240°C at 3°C min-1. cubeba berries oil (16. 77(14). but could not be identified either. WCOT fused-silica (J & W) DB-5 (30 m x 0. while -pinene (3.7 mL min-1.0% of the oil. 157(2). cubeba berries oil (14. we conclude that these two sesquiterpenes are isomers. 145(3). relative to C9-C22 n-alkanes. injector temperature. He. and -cadinene (16. 250°C. 133(100). The total amount of monoterpenes was comparable in both oils (17. and cubebol with 10. Joulain and König. trans-sabinene hydrate was the main component (2. 1998). m/z(%): 41(70).6%. 187(1). 91(87). sabinene (9.8%).6% and 10.8%) from Sri Lanka the main components were cubebol (31%).6%.0%. 14). 75 pKa. 3 scans s-1. The identity of the components was assigned by comparison of their retention indices. 70 eV.2% and 17.05%) with retention indices of 1566 (compound I) and 1570 (compound II) were detected. In P. 65(10).4 cm s-1. sabinene (3. 202(M+.5%). interface temperature. respectively in berries and leaves).5%).1% of the oil. The GC conditions were: column. using the normalization method. 69(3). the main components were copaene (10. 56. 21:1. accounting for 78. an AOC-20i auto injector.1%) and copaene (8. Other major components were guaiol (2.6% and 4. 117(9). as well as for the oxygenated monoterpene and sesquiterpene fractions (see Table 1).2%.26 mm. where E-caryophyllene (5.6%) were the main sesquiterpenes (31. The main monoterpenes in the berries oil were -thujene (2.8%) in the berries oil. linear gas velocity.9%) in the berries oil. -pinene (3.

Department of Biology. Less abundant in our samples. -elemene (7. These differences may be used as a tool for the characterization of P.3%). 3028-IX/P3S-1/KON-QUE II/2000. and -cubebene. Comparing the results of our present study with those from the three older reports. The other studies do not discriminate between the two epimers. -copaene. Indonesian samples contained about 10%. although further systematic studies are needed to prove this. Institut Teknologi Bandung. We did not find this compound. Lawrence (1980) found cubenol in the berries oil from India. but detected 1. but the amount seems to depend on the origin of the material. for collecting plant materials. -cubebene (5. -pinene (18.. Djuandi. were -cubebene.10-di-epi-cubenol (trace). We identified cubebol together with epi-cubebol. 1999).6%). 57 . the Indian and Sri Lankese samples considerably more. Department of Biology. We are grateful to Drs. and -cadinene (4. Acknowledgements The research was supported by the QUE Project Batch II. under contract No. and epi-cubenol (0." were cubebol (23. cubeba oils from different origin. 4193-IND. we come to the following conclusions.3%) in the berries oil from Indonesia. Cubebol is one of the main components in the berries oil. Institut Teknologi Bandung ITB. Indonesia.2%).7%) (Sumathykutty et al.6%). IBRD Loan No. compared with the previous studies.

4 tr 0.4 tr tr tr 2.5 0.8 0.2 1.3 tr tr 8.2 tr 0.1 2.1 0.1 0.5 0.4 3.3 0.1 0.2 tr tr tr tr tr tr tr tr tr 0.2 0.-Ocimene -Terpinene cis-Sabinene hydrate Terpinolene meta-Cymene Nonanone-2 trans-Sabinene hydrate Linalool n-Undecane Camphor Verbenol Isoborneol Sabina ketone E-2-Nonenal trans.7 0.2 0.8 tr tr tr 9.1 0.3 0.3 3.5 1.1 0.4 0.7 58 .1 tr 0.2 0.8-Cineole -Phellandrene 2-Ethyl-4-pentenal E.1 tr tr tr tr tr tr Leaves % tr 0.2 0.4 tr tr 0.3 tr tr 0.8 3.2 0.7 3.-Terpineol Borneol Umbellulone Terpinen-4-ol Cryptone -Terpineol Methyl salicylate cis-Piperitol Nerol Thymol methyl ether Geraniol 2-Undecanone Berries % trb 2. Composition of the essential oil from of the berries and leaves oil of Piper cubeba.2 tr 0. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Compound Tricyclene -Thujene -Pinene Camphene 5-Methyl-3-heptanone Benzaldehyde Sabinene -Pinene 6-Methyl-5-hepten-2-one -Myrcene n-Decane -Phellandrene 2-Octanol -Phellandrene 3 -Carene -Terpinene para-Cymene Limonene 1. RIa 920 924 930 944 944 960 970 973 979 990 1000 1002 1002 1004 1013 1013 1019 1026 1029 1032 1034 1036 1055 1062 1083 1084 1091 1093 1096 1100 1138 1140 1149 1156 1161 1162 1162 1171 1177 1177 1189 1190 1195 1223 1235 1252 1291 Nr.! Table 1.

1 0.5-diene Humulene Caryophyllene allo-Aromadendrene -Cadinene -Muurolene E." Nr.2 0.E-2.1 0.9 tr 1.2 0.2 tr 0.1 0.1 tr 2.1 5.4 0.trans-Bergamotene cis-Muurola-3.5 0.1 0.3 0.4 0.5 0.4-diene trans-Calamenene -Cadinene -Calacorene -Gurjunene epoxide Elemol cis-Muurol-5-en-4-beta--ol E-Nerolidol Germacrene B Ledol -Calacorene Spathulenol 1-Hydroxy-1.2 1.1 1.1 0.2 3.6 tr 1.3 0.Bisabolene -Cadinene Cubebol -Cadinene cis-calamenene E.7-dimethyl-4isopropyl-2.-Bisabolene Cadina-1.1 0.1 0.6 0.5 0.5 0.4-Decadienal -Elemene -Cubebene Cycloisosativene -Copaene -Bourbonene -Elemene -Cubebene -cis Bergamotene E-Caryophyllene .5 0.1 0.2 5.2 0.4 0.8 0.3 4.6 4.1 1.1 0.3 0.8 Leaves % 0.4 0.2 0.1 16..8 0.2 tr tr tr tr tr tr 0.6 0.9 3.1 0.1 0.1 59 .2 1.7 0. 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 Compound 2-Methyl undecanal E.7 cyclodecadiene epi-Globulol Globulol Viridiflorol Guaiol RIa 1306 1314 1332 1351 1361 1372 1379 1387 1387 1404 1414 1431 1438 1447 1455 1456 1468 1472 1479 1482 1484 1489 1494 1497 1504 1508 1516 1523 1524 1527 1531 1532 1537 1540 1542 1547 1549 1558 1558 1560 1563 1574 1576 1580 1583 1591 1596 Berries % trb tr 0.1 0.2 0.4 tr tr 2.-Farnesene Germacrene-D cis-Muurola-4(14)-5-diene epi-Cubebol -Muurolene -Himachalene Z.8 tr 9.1 0.2 0.1 1.3 0.5 0.1 0.3 4.0 1.0 0.

2 tr tr tr 0.3 0.3 0.8 17.2 3.6 31. v/w) Grouped components Monoterpene hydrocarbons Oxygen-containing monoterpenes Sesquiterpene hydrocarbons Oxygen-containing sesquiterpenes Others a Retention Index relative to C9-C18 n-alkanes on the DB-5 column.10-di-epi Cubenol epi-Cubenol -Cadinol -epi-Muurolol -Cadinol -Cadinol -Eudesmol Selin-11-en-4-alpha-ol -Bisabolol -Bisabolol E.1 tr tr 78.E-Farnesol RIa 1612 1614 1620 1634 1638 1640 1646 1649 1653 1671 1681 1715 1738 63.0 18.5 0.8 15.5 Berries % trb tr 0.6 26.3 0.1 0. 96 97 98 99 100 101 102 103 104 105 106 107 108 Compound (iso)-Aromadendrene epoxide 1.0 10.7 2.1 0.! Nr. btr = trace (<0.05%) 60 .E-Farnesol Z.2 1.9 0.8 Leaves % 0.6 0.7 0.1 11.0 0.2 Total amount identified (%) Essential oil (%.9 17.

Quax Submitted 61 . Hoge. Oliver Kayser. Rein Bos. Herman J. Wim J. Sieb Batterman. Woerdenbag. Albert Koulman. Henricus L.Chapter 6 Reduced coniferin and enhanced 6-methoxypodophyllotoxin production in Linum flavum cell suspension cultures after treatment with Na2EDTA Elfahmi.

On day 14 after treatment with 2 and 5 mM Na2EDTA the CAGT activity was inhibited up to > 89 % (control value 8. in a range of 0. On day 14 after treatment with Na2EDTA. Zn2+.16 mg g-1 DW). Li+. Cu2+. an inhibition of the coniferin production up to 88% was found (content in control cultures 120.1 . The maximum enhancement of the 6-MPT production was 320% on day 7 after treatment with 5 mM Na2EDTA (control value 0.# Abstract Treatment of cell suspension cultures of Linum flavum L.5 mM. 62 . and the elicitors nigeran and salicylic acid had no significant effect on the production of coniferin and 6-MPT. with Na2EDTA reduced the coniferin and enhanced the 6-methoxypodophyllotoxin (6-MPT) production in a concentration-dependent way. The reduction in coniferin accumulation in the suspension cultures was correlated with an inhibition of coniferyl alcohol glucosyltransferase (CAGT) activity as determined in cell homogenates. Several metal ions such as Fe3+.8 µkat g-1). The inhibitory effect of Na2EDTA on CAGT was also shown in a partially purified enzyme preparation.7 mg g-1 DW).

6-methoxypodophyllotoxin (6-MPT) and its glucoside could be enhanced in cell cultures of Podophyllum hexandrum Royle (Woerdenbag et al.. For the production of semi-synthetic podophyllotoxin derivatives on an industrial scale. This effect is compared to that of the elicitors salicylic acid and nigeran.. Li+ and Fe2+ (Schmid and Grisebach. Linum flavum L. 1990b). Coniferyl alcohol is an early precursor of both lignins and lignans. The glucosylation of coniferyl alcohol yields coniferin that is accumulated endogenously in L. flavum produce 6-MPT and its glucoside. 63 .. 6-MPT is considered also as an interesting starting compound for the preparation of new semi-synthetic derivatives with antitumor properties. 1999). 1995).. 1990.." $ "% & Introduction Podophyllotoxin and podophyllotoxin-derived lignans possess cytotoxic and antiviral activities. Reed et al. 2002). 1991b). The cytotoxicity of 6-MPT in vitro against tumor cell lines was comparable with that of podophyllotoxin (Middel et al. 1990a. It is known that Na2EDTA (Ibrahim and Grisebach. The use of biotechnological approaches to improve the production of podophyllotoxin or related lignans with plant cell and organ cultures. These compounds enhance various biosynthetic pathways.111). is considered to be suitable and economically attractive (Giri and Narasu. Zn2+ . 2000). Cell cultures of L. Woerdenbag et al. 1991a. 1990).. 1982.4.. 1992. Berim et al. Petersen and Alfermann. Chong et al. and Linum nodiflorum (Berim et al. Several investigations to enhance the production of podophyllotoxin-derived lignans by manipulation of cell and organ cultures have been carried out (Van Uden et al. EC number: 2.. Linum album Kotschy (Seidel et al. 2002)... 1998). High coniferin contents in the cell suspension culture correspond with low 6-MPT levels.1. Blocking the branch leading to the formation of coniferin by inhibiting CAGT could result in an enhanced production of lignans. as was demonstrated in feeding experiment with cell cultures of P. Lignans are formed through radical-mediated dimerisation of two coniferyl alcohol units. The aim of this paper is to explore the effect of Na2EDTA and several inorganic salts on the production of coniferin and 6-MPT in cell suspension cultures of L. Wunder and William. Podophyllotoxin is also the starting compound for the rheumatoid arthritis drug CPH 82 (Reumacon) (Svensson and Pettersson. (Van Uden et al. hexandrum (Van Uden et al. flavum.. 2005). but so far there is little evidence of their effect on the lignan biosynthesis (Guan and Scandalios. 2001). Addition of one of these compounds may interfere with CAGT. such as 6-MPT in the cell suspension cultures of L. 1976) and metal ions such as Cu2+. including the biotransformation of suitable precursors and the modification of biosynthetic pathways. 2005. 1). 1993) are able to inhibit the glucosyltransferase activity. 1990a. podophyllotoxin is isolated from the rhizomes of Podophyllum plants from wild habitats. Molog et al. The production of podophyllotoxin. 2003).. flavum cultures up to 12 % on a dry weight basis (Van Uden et al. 2001) Callitris drummondii F.. flavum.. Teniposide and etoposide are semi-synthetic derivatives of podophyllotoxin that are clinically used as anticancer drugs (Moraes et al. 1990a). Mueller (Van Uden et al. Based on the close chemical resemblance with podophyllotoxin (see Fig. which are counted as endangered species (Smollny et al. 1995. 1999... This reaction is catalysed by coniferyl alcohol glucosyltransferase (CAGT.

Suspension-grown cells were harvested each 2 days during the growth cycle of 14 days.5. pH 5.0 mL) were added. The cells were filtered using Buchner funnel. 0.500 g). 1. 2 and 5 mM. The cell suspensions are cultured routinely every two weeks by transferring 100 mL of fully grown suspension aseptically into 200 mL of fresh liquid medium.1. followed by incubation for 5 h at 37°C. Coniferin and 6-MPT contents were subsequently analyzed by HPLC. Louis (USA).0. iron (II) sulphate pentahydrate. and lithium chloride from Merck (Darmstadt. Germany). the Netherlands).0 mL dichloromethane. Germany). Samples of about 10 mL were taken aseptically and transferred into a calibrated conical tube and centrifuged for 5 min at 1. nigeran 20 mg L-1. The aglucone formed was extracted with 2. The mixture was vortexed and centrifuged (5 min. flavum yielding the following final concentrations: Na2EDTA : 0. 10. Extraction About 100 mg.0 mL) and water (4. 64 . OSRAM. v/v) for 1 h. A 3.01. the water phase was submitted to enzymatic hydrolysis.5 mL was added. copper (II) sulphate pentahydrate.# Materials and methods Plant material and culture conditions Cell suspensions of Linum flavum L. Zn2+ and Li+: 0. St. salicylic acid: 0.01.1 and 1 mM. 0. the medium pH and the conductance were routinely measured in the supernatant. In order to monitor the viability and growth of the cell cultures. 1 and 5 mM. (Linaceae) leaves have been initiated and are maintained at the Department of Pharmaceutical Biology. The residue was redissolved in 1.5% (w/v) solution of β-glucosidase (Sigma G-0395) was prepared in 0.500 g. To 2. 0. 2. and nigeran from Sigma.0 mL and centrifuged (2 min. For the determination of coniferin 50 µL water phase were diluted with water until 1. Treatment of aqueous phase with β-glucosidase To confirm the coniferin production. Fresh weight (FW) was determined and the cells put overnight in the freezer and subsequently freeze dried.0 mL samples of the water phase 0.5. accurately weighed of freeze dried and powdered cell material were extracted by ultrasonification in 2 mL methanol (80%.2 mg of 6-benzylaminopurine (BAP). These compounds were added to the culture media used for the cell suspension cultures of L.000 g). 1. Of the dichloromethane phase 1. 1 and 5 mM. the Netherlands). day light L 36W/10. The medium is a MS (Murashige and Skoog 1962) containing 0.0 mL methanol and centrifuged (2 min.2 mg of indole-3acetic acid (IAA) and 0. Treatment of cell suspensions Disodium ethylenediamine tetra acetate (Na2EDTA) was purchased from Duchefa.000 lux. Dry weight (DW) was also determined.0 mL of the dichloromethane phase were taken and evaporated to dryness. 10.1. salicylic acid from Sigma-Aldrich (Zwijndrecht. The cell suspensions were incubated on a rotary shaker (175 rpm) at 26°C under a day/night regime (16/8 h: 3.000 g). For the determination of the 6MPT concentration.1 M phosphate buffer. The residue was redissolved in 1. Fe2+: 0. purchased from Duchefa (Haarlem.5 mL were taken and evaporated to dryness. Dichloromethane (4. zinc chloride. University of Groningen. Coniferyl alcohol was determined by HPLC.0 mL methanol and centrifuged. Cu2+.

all at pH 7. Staufen. A P-value <0. coniferin and 6-MPT.32 µmol uridine diphosphate (UDP)-glucose in 40 µL assay buffer. (1982). Sweden) which had been equilibrated with 0. The fraction obtained between 40 and 80% saturation was desalted on a HiPrep 26/10 desalting column (Amersham Biosciences. 0.02 to 0.d. Darmstadt.5. coniferyl alcohol and 6-MPT were analyzed by HPLC. CAGT assay The enzyme assay for CAGT was developed from the methods used by Ibrahim et al. 1. pH 7. Sweden) previously equilibrated with 0. Fractions containing the highest activity were combined and concentrated by vivaspin 6 mL concentrator (Vivasciences. The homogenate was centrifuged (3. 0.2 M Tris-HCl. The standard assay mixture consisted of 0.02 M Tris-HCl buffer.0 mL dichloromethane followed by vortexing the mixture for 20 s and centrifugation (5 min. The HPLC system consisted of an ISCO Model 2350 pump. The protein was eluted first with 100 mL of 0.32 µmol coniferyl alcohol in 40 µL ethyleneglycol monomethylether.1.2 % DOWEX . Cells were treated with Na2EDTA in the range of 0. 1991b.000 g.4 M Tris-HCl buffer. 2°C). The mixture was homogenised using an ultraturrax (Janke & Kunkel.1-5 mM and harvested at different time points during the growth cycle and stored at -20°C overnight. a Shimadzu photodiode array detector (Shimadzu.5. 200 µL (3x) of the mixture were taken and submitted for CAGT assay.6 mm i." Protein purification $ "% & Cells were harvested on day 1 after subculturing and stored at -20°C overnight. Protein was determinated using the Bradford assay (Bradford. the Netherlands). Frozen cells were suspended in an equal volume of the homogenisation buffer that consisted of 0. The reaction was started by the addition of protein and vortexed for 5 s immediately followed by incubation for 30 min at 30°C. The dichloromethane and water layers were used for HPLC analysis of coniferyl alcohol and coniferin. coniferyl alcohol and 6-MPT Coniferin. Germany). flavum cell suspension cultures as published previously (van Uden et al.1*2 – 100. Dublin. UV absorbance at 230 and 290 nm and LiChrocart RP-18 column (250 x 4. Ireland) / water (40:60 v/v. DTT 0. respectively. were suspended in homogenisation buffer and the mixture was homogenised using an ultraturrax. followed by a linear gradient from 0. 200 µL protein homogenate or partially purified CAGT and assay buffer in a total volume of 320 µL. 0.2 M Tris-HCl buffer and finally with 100 mL of 0.1 %. Frozen cells.1 % DTT (w/w) and 10% ethylenglycol.. The combined fractions with the highest CAGT activity resulting from the desalting column (the third step of the purification procedure. Hannover. The mobile phase for coniferyl alcohol and 6-MPT analysis was acetonitrile (LAB-SCAN Analytical-sciences.1% phosphoric acid) and for coniferin.1 % phosphoric acid). ‘s-Hertogenbosch.) (Merck.5. The homogenate was filtered through Miracloth® and clarified by centrifugation for 20 min at 20. 0. Analysis of coniferin. The supernatant was separated from the pellet. pH 7. 2-3 g. 65 . The reaction was stopped by adding 2. The Na2EDTA was added to 5 mL of the partially purified CAGT yielding final concentrations of 0. Proteins dissolved in the supernatant were then fractionated by (NH4)2SO4 precipitation. Germany). pH 7. which were isolated from L. IKA-WERK. 0. Germany). 1976). Calibration curves were made using coniferyl alcohol (Sigma). The mixtures were incubated at 4°C for one day.5. 2 and 5 mM. methanol/water (30:70.2 M Tris-HCl pH 7. The assay buffer was prepared containing 0. 1992). Uppsala. For the statistical evaluation of the data the Sudent’s t-test was used.500 g).5. 0. see Table 2) were exposed to Na2EDTA.000 g.02 M Tris-HCl buffer. 25 min. Uppsala.02 M Tris-HCl buffer. (1976) and Schmid et al. 1. Fractions of 5 mL each were collected at a flow rate of 1 mL min-1 and assayed directly for CAGT activity.5.05 was considered as significant. The protein eluting from the desalting column was applied to a HiTrap DEAE FF column (Amersham Biosciences. 5% polyvinylpyrrolidone.

66 . Adding 0. Chemical structures of podophyllotoxin (1). although it should be noted that the higher concentrations of Na2EDTA (2 and 5 mM) also inhibited the cell growth. 2. 3 the effect of treatment with Na2EDTA on the coniferin production in L..9 and 3. 5). Fig. Results and discussion The effect of Na2EDTA on the growthy of L. R = Glucose OCH3 OH CH2OH 1.5 mM Na2EDTA did not enhance the 6-MPT production. Na2EDTA inhibited cell growth up to 22% and 59% respectively (maximal effect) on day 8. From day 1 after inoculation the cells grew until day 8. At the end of the period (day 14) the cell suspension was refreshed.1 mM and 0. 4. The accumulation of 6-MPT was enhanced 1. 1. the water phase that contained coniferin was submitted to enzymatic hydrolysis using β-glucosidase. R = H 2. There was no significant effect of Na2EDTA on the growth of the cell suspensions or on the viability parameters at concentrations of 0.5 and 1 mM (dry weight and conductivity). 1995). 1. 5) on day 14.2 fold at a concentration of Na2EDTA of 1.2. The growth period of the cultures was 14 days. R = OMe Fig.# R O O O MeO OMe OMe OR 3. After treatment with Na2EDTA. The coniferyl alcohol formed fully correlated with the coniferin content as found after hydrolysis. In Fig.1. The stationary phase was reached between day 8 and 12. 6-methoxypodophyllotoxin (2). At a concentration of 2 and 5 mM. coniferyl alcohol (3) and coniferin (4). To confirm the coniferin production. flavum cell suspension cultures was determined on the basis of dry weight accumulation as shown in Fig. the coniferin production was reduced in a concentration dependent way by 18-88% (Fig. flavum cells is shown. 0. Untreated cells (control) contained up to 12. 2 and 5 mM respectively on day 7 in the cell suspensions of L. R = H 4. that lead to the release of the corresponding alcohols (Dharmawardhana et al.0 % coniferin on a dry weigh basis on day 14 of the growth cycle. This enzyme catalyses the hydrolysis of monolignol glucosidases. flavum (Fig.

" 25 $ "% & 20 Dry weight (g L-1) 15 10 5 0 1 2 3 4 5 6 7 Days 8 9 10 11 12 13 14 Fig. Growth of L. 2 mM ( ). 1 mM ( ). 0.1 mM ( ) and without Na2EDTA as a control ( ). 0.5 mM ( ). 140 120 coniferin (mg g DW) 100 80 60 40 20 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Days Fig. 2. Individual values expressed in g L-1 are averages of three independent experiments as means ± standard deviation. flavum cell suspension cultures after treatment with Na2EDTA 5 mM ( ). 1 mM ( ). Coniferin production in L. -1 67 . 2 mM ( ). flavum cell suspension cultures after treatment with Na2EDTA 5 mM ( ).5 mM ( ). 0. 3. 0.1 mM ( ) and without Na2EDTA as a control ( ). Individual values expressed in mg g-1 of dry weight are averages of three independent experiments as means ± standard deviation.

4 0. 4.1 0 1 2 3 4 5 6 7 8 Days 9 10 11 12 13 14 Fig. Individual values expressed in mg g-1 of dry weight are averages of three independent experiments as means ± standard deviation. Salicylic acid was lethal to the cell cultures at 68 . 6-MPT production in L.# 0. Inhibition of the coniferin production on day 14 (control = 120. 0.1 0. 5. flavum cell suspension cultures after treatment with Na2EDTA. flavum.16 mg g-1 dry weight) ( ) in L.8 0. flavum cell suspension cultures after treatment with Na2EDTA 5 mM ( ).3 0. 0% 10% 20% % Inhibition of coniferin 30% 40% 50% 60% 70% 80% 90% 100% 0. 1 mM ( ).7 mg g-1 dry weight) ( ) and enhancement of the 6MPT production on the day 7 (control = 0. Zn2+.2 0. none of the metal ions (Cu2+.5 0.1 mM ( ) and without Na2EDTA as a control ( ). Nigeran had no effect on the growth of the cell cultures. these salts inhibited the growth of the cultures. In contras.7 6-MPT (mg g-1 DW) 0. Li+ and Fe3+) inhibited the coniferin or enhanced the 6-MPT production in the cell suspension cultures of L. neither on the production of 6-MPT nor coniferin. 0.6 0.5 1 Na2EDTA (mM) 2 5 350% 300% % Enhancement of 6-MPT 250% 200% 150% 100% 50% 0% -50% Fig. In the concentrations used. 2 mM ( ).5 mM ( ).

4 0. 11.3) 57a 5.4 (±0. bP<0.6) 62a 5.3 (±0.3) 60 1. flavum in a concentration-dependent way.01 (compared to control values.7(±1. The amount of protein obtained however.52 1.0) 79 Na2EDTA (mM) 0 0.5 (±1.9 (± 0. On day 6 the control cells had a CAGT activity of 2.1-5 mM. respectively (Table 1)." $ "% & concentrations of 2 and 5 mM.4 28 4.2) 65 b 1. Table 2.4) 14 a 4. The activity was reduced by 30–57 % 1 day after inoculation with 0.1) 56 1.1–5 mM was 12–52%. CAGT activity in L. Student’s t-test). summarized in Table 2.5) 0 8. Therefore the fraction originating from the desalting step (see Table 2.5) 22 46a 7.8 µkat g-1 (day 14) and the inhibition by Na2EDTA 0.1 CAGT is a glucosyltransferase that converts coniferyl alcohol into coniferin.9 (±1.20 Specific activity (µkat g-1 protein) 5 40 56. Each percentage is calculated on its respective control.0) 0 2.4) 12 6. ultimately resulted in a 41.8 Total activity (µkat) 1.1 % recovery of total activity and a product with a specific activity of 256 µkat g-1 of protein. The results were confirmed by hydrolysis of the coniferin-containing water layer 69 . 5 mM of Na2EDTA inhibited the CAGT activity in this partially purified enzyme preparation.8 (±2. The purification procedure.2 (±0. The highest CAGT activity in cell suspension cultures was found on day 1 after inoculation.l 0. Na2EDTA inhibited the production of coniferin in the cell suspension cultures of L.4) 10.7 µkat g-1.5 (±0. Subsequent preparation steps of the partially purified CAGT preparation.3) 0 6.5) 4 a 1.2 (±1.0 (±0.0 (±2.9 (±0.8) 46 b 3. The concentrations of 0. in a range of 0. In order to enhance the 6-MPT production in L.0) Day 14 Activity Inhibition (%) 8.6 (±2.8 256 Purification (fold) 1 8 11.5 (±0.2-fold enhancement of the CAGT activity.8 (±0.4 41.5 mM salicylic acid had no effect on the growth of the cell cultures and neither on the production of 6-MPT nor coniferin.1) 89 For CAGT purification.4-fold purified) was used.1–5 mM was 4-79% and 14-89%.5 µkat g-1 and the concurrent inhibition of Na2EDTA 0. Individual values expressed in µkat g-1 of protein are averages of three independent experiments as means ± standard deviation.5 1 2 5 Day 1 Activity Inhibition (%) 0 13. was insufficient to carry out incubation experiments with Na2EDTA.1–5 mM Na2EDTA. A significant decrease of the enzyme activity was found on day 13 and 14 after inoculation.5 (±0.5) 24 2.6 (day 13) and 8. flavum cell suspension cultures. no.1 (±0.6 (±1.25 0.2 (±0.1 and 0. CAGT activity (µkat g-1) ± (SD) and % inhibition Day 6 Day 13 Activity Inhibition Activity Inhibition (%) (%) 2. Enzyme activity of untreated cell was 6.1) 80 a b 1. flavum cell suspension cultures on various days and the percentage inhibition after treatment with Na2EDTA. 13. the enzyme was extracted from 1 day-old cell suspension cultures (when the highest CAGT activity was found).3) 72 b b 1.9 (±0. Table 1.3) 56 b 3.3) 30 9.0 (±0.4) 52 1.05.8 (±1. Untreated cells (control) had an activity 13.12 0. Steps 1 2 3 4 Fraction Crude extract Ammonium sulphate precipitation Desalting HiTrap DEAE FF Protein (mg) 302. the formation of coniferin was blocked by inhibition of CAGT using several potential glucosyltransferase inhibitors. 3.4 13.4) 62 b b 1.2 Yield (%) 100 73 16. aP<0. up to 53%.1 (±0.

however. This is in agreement with earlier observations (Van Uden et al. 4193 – IND. in terms of percentage inhibition. 3028-IX/P3S-1/KON-QUE II/2000. At the beginning of the growth cycle of the control cell suspension cultures no clear relationship existed between CAGT activity and coniferin content. The highest CAGT activity in cell suspensions was found on day 1. showing that a maximum coniferyl alcohol content in L. If CAGT needs a metal ion as a co-factor for its activity. Indonesia. The high 6-MPT content on day 6-9 of the growth cycle (Fig. There was a correlation between the coniferin and the 6-MPT production in L. Our hypothesis that Na2EDTA (0. 4). -glucosidase activity increased to a maximal value on day 4 of the growth cycle and declined to lowest activity on day 14 (Van Uden et al. Because of a lack of information about the structure and the function of the CAGT it is not yet clear which mechanism underlies the inhibition by EDTA. it can be understood that the Na2EDTA complexes with the metal ion. Higher coniferin contents corresponded with lower 6-MPT levels.5 mM) is an inhibitor of CAGT activity is further supported by the inhibitory effect on CAGT activity in an 11. By inhibiting the coniferin production. correlates with the low CAGT content as measured on day 6 (Table 1). The coniferin production and CAGT activity were reduced to >88% at the end of a growth cycle after treatment with 5 mM Na2EDTA. The effect. flavum cell suspension cultures. 1991b). Further studies directed to the purification. structure and function determination of the enzyme are in progress. In conclusion. Na2EDTA appears to be an inhibitor of CAGT activity both in vivo and in situ. thereby reducing the enzyme activity. while control values of the coniferin production were at their maximum at this time point. 1991b). Then it declined to a lower level on day 6 and re-increased on day 13 and 14. This is probably affected by -glucosidase that converts coniferin into coniferyl alcohol. after day 6 it appeared that a low activity of CAGT related to a low coniferin content. The reaction catalyzed by -glucosidase is opposite to that of CAGT. IBRD LOAN No. Acknowledgement The research was supported by the QUE Project Batch II. is less pronounced than in the cell suspensions.. These results strongly suggest that Na2EDTA inhibits CAGT activity thereby inhibiting the conversion of coniferyl alcohol into coniferin in L. Department of Biology Institut Teknologi Bandung ITB. Coniferin was completely converted into coniferyl alcohol and the concentration of the formed coniferyl alcohol related to the original coniferin concentration. under the contract No. This supports our hypothesis that blocking the branch leading to the formation of lignins by inhibition of glucosyltransferase may result in an enhanced production of lignans.4-fold purified enzyme preparation. CAGT activity then increased until day 14. However. A high CAGT activity apparently relates to a low -glucosidase activity. flavum cell suspension cultures.# of the cell extract by enzymatic hydrolysis using -glucosidase. with a simultaneous increase of the coniferin accumulation. This difference may be due to a toxic effect of Na2EDTA on the cell suspension cultures. flavum cell suspension cultures was preceded by a maximal activity of the enzyme -glucosidase. 70 . In L. flavum cell suspension cultures. coniferyl alcohol accumulates and is available as a substrate to produce of 6-MPT and other lignans. Reduction of the CAGT activity correlated with a reduction of the coniferin production in the cell suspensions.

Chapter 7 Cloning of glucosyltransferase genes from cell suspension cultures of Linum flavum in E. coli 71 .

flavum is cloned. 72 . Total RNA was isolated from the cell suspension cultures at day 1 of subculturing. when the highest activity of GTs was reached. With degenerate primers designed on a conserved region from plant glucosyltransferases. one of the cloned GTs belongs to Group D. Based on phylogenetic analysis. coli. RT-PCR was used to amplify specific cDNA fragments.' Abstract Glucosyltransferases (GTs) from cell suspension cultures of Linum flavum were successfully cloned in E. previously deposited in the databases. Family 1 of glucosyltransferases that are active for phenylpropanoid compounds. This is the first time that a gene involved in the lignan biosynthesis from L. The sequences of these cDNA fragments showed strong similarity with those encoding for GTs in various other plant species. Using primer extension and inverse PCR the full length gene was amplified from genomic DNA extracted from Linum flavum cells.

e. 2004). 2005) anthocyanins (Imayama. 2004.. phenylpropanoids (Taguchi et al. et al. 2005). The detection of coniferin in L. Petersen and Alfermann (2001) described the state of the art of the use of plant cells and organ cultures as a strategy in this respect. i.. 2001).. 1) (Van Uden et al... 2002). dihydroxyphenylalanine (DOPA) (Sasaki et al. Cell suspension cultures of Linum flavum (family Linaceae) accumulate high amounts of coniferin that is synthesized from coniferyl alcohol by glucosyltransferases (GTs). It also enables the storage of potent toxic and deterrent chemicals at high concentration in vacuoles (Lorenc-Kukula et al. flavum cells. 1990. 2005). 2000. Glucosylation has biological significance influencing toxicity. These enzymes play a key role in the biosynthesis of natural products and in recent years the information on GTs of small molecules has increased enormously. 2004). Berim et al... Inhibition of the coniferin production by inhibition of GTs could lead to the accumulation of coniferyl alcohol that subsequently leads to an increase in the production of cytotoxic lignans. Chong et al. coli Introduction Podophyllotoxin. 2004). 2004). Bowles et al. Many recombinants GTs have been characterized from different plant species (Vogt and Jones 2000. coumarins and flavonoids (Taguchi et al. Biotechnological and enzymatic approaches have been considered as a potential solution for the problem.. solubility. 2005).. etoposide®. 2002. bioavailability. flavum cells cultures (Van Uden et al. called the PSPG box. adsorption. 1991) indicates the presence of one or more GTs are involved in its synthesis from coniferyl alcohol. steroidal alkaloids (Kohara et al. they were grouped into 12 distinct classes (Li et al. From the genome sequence of Arabidopsis thaliana. In vitro production of podophyllotoxin and 6-methoxypodophyllotoxin and related lignans has been shown in cell cultures of Podophyllum and Linum species (Woerdenbag et al.Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. In this study we report the isolation of glucosyltransferase cDNAs from cell suspension cultures of L. flavum... 73 .. In this respect the branch of lignan and lignin biosynthesis after the common early pathway opens an interesting possibility.. teniposide® and etopophos®.. Coniferyl alcohol is a precursor of coniferin and lignans through different biosynthetic branches (see Fig.. Bowles et al. The PSPG box is considered to represent the nucleotide diphosphate binding site. coli. 2004. This domain may also define the active site of GTs of animals and microorganisms. The conserved region. Several important natural products have been used as the substrate for classification such as curcumin (Kaminaga et al. more than 110 GTs have been identified and based on a phylogenetic tree.. Empt et al. 2005). 2005). and metabolism of compounds. 2001. An understanding of the metabolic pathway of lignans and the cloning of the corresponding genes may allow genetic modifications leading to a higher production of lignans.. is used as a precursor for the semi-synthesis of established cancer therapeutics. 2001. Reducing the lignin biosynthesis may lead to a channelling of precursors towards the synthesis of lignans (Gordaliza et al. Chattopaday et al.. 1991).. The use of plants as a source of podophyllotoxin is limited due to difficulties in the (large scale) cultivation of the endangered Podophyllum hexandrum (Gordaliza et al. There is a need to find alternative sources for podophyllotoxin.. and the cloning of the corresponding genes in E. Bowles et al. Lorenc-Kukula et al. Based on conserved regions we have designed PCR primers for the amplification of GT genes of group D of family 1 from mRNA isolated from lignan synthesizing L. GTs are a large group of enzymes that catalyze the transfer of a sugar moiety from an activated donor onto saccharide or non-saccharide acceptors. an aryltetraline lignan with antiviral and antineoplastic activities. is highly characteristic and present in all GTs involved in natural product biosynthesis.

putative lignan 7-hydroxylase (L7H). (1997) and Molog et al. glucosidase (Glud). peltatin SAM-dependent Omethyltransferase (POMT). (2001) (b) Jackson and Dewick (1984) (c) Xia at. (2000). The enzyme abbreviations are phenylpropanoid enzymes (PhenPro’s). coniferyl alcohol glucosyltransferase (CAGT) deoxypodohyllotoxin 6-dehydrogenase (D6H). Biosynthesis of lignans according to (a) Van Uden et al. Al. 1. 74 .' O H2 N OH CH2OH CH2OH Glud PhenPro's Phenylalanine OH H3CO O HO O OCH3 OH OH OCH3 CAGT Coniferin (B) OCH3 OGluc Coniferyl alcohol H3CO O HO O OCH3 O O O O 7'-Hydroxymatairesinol O O Matairesinol OH H3CO Anhydropodorhizol OH O O OCH3 OCH3 O O O O (c) H3CO Yatein OH O O O H3CO OCH3 OCH3 H3CO O OCH3 OCH3 D6H (A) H3CO Peltatin OCH3 H3CO OCH3 OCH3 (B) O O O O OCH3 OCH3 POMT O HO O OCH3 OCH3 Podophyllotoxin Deoxypodophyllotoxin CH3O H3CO HO OH O O OCH3 OCH3 L7H H3CO Peltatin methyl ether H3CO 6-Methoxypodophyllotoxin Fig.

500 mg of powdered cell material were used for total RNA isolation using nucleospin® RNA plant isolation kits (Macherey-Nagel. The cell suspensions are cultured routinely every two weeks by transferring 100 mL of a fully grown suspension aseptically into 200 mL of fresh liquid medium.2 mg of indole-3-acetic acid (IAA) and 0.2 mg of 6-benzylaminopurine (BAP). (Linaceae) leaves have been initiated and are maintained at the Department of Pharmaceutical Biology. Düren.1962). 30 mL of extraction buffer containing 350 mM sorbitol. Germany). Amersham Pharmacia. 0. 50 mM EDTA. The medium contains MS medium (Murashige and Skoog. PCR amplification Alignment of 106 sequences of GTs from various other plant species deposited in the NCBI database using MegAlign was performed to identify regions of conserved amino acid sequences. mixed until thawn and resuspended. Genomic DNA was isolated from 30 g of powdered cell material using the cetyltrimethyl ammoniumbromide (CTAB) method. The cell suspensions were incubated on a rotary shaker (175 rpm) at 26°C under a day/night regime (16/8 h: 3.5. PCR amplification of cDNA was performed using a Mastercycler® gradient thermocycler (Eppendorf) in 50 µL containing 50 ng cDNA. 2 M sodium chloride and 2% (w/v) CTAB. coli Materials and methods Plant material and culture conditions Cell suspensions of Linum flavum L. Madison. Germany). 5% sarkosyl was added and the mixture was incubated at 65oC for 1 h. To the suspension.Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. The region between position 254 and 298 and the region between 342 and 386 (44 amino acids) were found to be the most conserved. Sweden). flavum cDNA: Pgt-1f: 5′-GGNWTRMSRNVVDNNNTGGGCHCCGCA-3′ and Pgt1r: 5′-TGCCGATGGTGNCNTGGCCHTT NTTRGCNGANCA-3′. cDNA was constructed from 2 µg total RNA using Omniscript® RT (Qiagen GmbH. University of Groningen. St. 5 mL of isopropanol were added and mixed thoroughly for 5 min at room temperature and subsequently centrifuged for 10 min (3000 x g). then incubated at 65oC for 10 min. DNA and cDNA construction One day old cell suspension cultures were harvested.000 lux. USA) and the sequences were determined with a Megabase Sequencer (a Alf Express II using ThermoSequenase fluorescent primer cycle kit. day light L 36W/10.5 mL) and nucleus lysis buffer (5 mL). 100 mM Tris HCl pH 7. OSRAM. Germany). filtered and the remaining cell material was put directly into liquid nitrogen and grinded. The upper layer was separated. The pellet was washed using 70% ethanol and dissolved by 1 mL TE buffer with 1 µL RNAse. Germany). The PCR product was cloned into the pGEM-T easy® vector system I (Promega. 75 . 200 µM dNTP and 1. the Netherlands. and extension at 72oC for 2 min. The mixture was extracted using 8 mL chloroform : isoamylalcohol (24:1) and rotated for 30 min.5. 5 mM EDTA and 20 mM sodium bisulfide (added just before use) were added to the cell frozen material.. Leon-Rot. Hilden. Isolation of plant RNA. The mixture was centrifuged for 5 min at 3000 x g. The PCR program was denaturation at 95oC for 30 s. GmbH & Co. Haarlem. purchased from Duchefa. annealing at 60oC for 40 s. The nucleus lysis buffer contained 200 mM Tris HCl pH 7. The supernatant was separated and the pellet was resuspended using extraction buffer (3. The following two degenerated primers were designed for amplification of GT fragment from L.25 units of Taq polymerase (Fermentas GMBH.

Hilden. 72oC for 3 min. Primer Pgt-2r1 Pgt-2r2 Pgt-2r3 Pgt-3f1 Pgt-3f2 Pgt-3f3 Pgt-4r1 Pgt-4r2 Pgt-4r3 Pgt-5f1 Pgt-5f2 Pgt-5f3 Pgt-6r Pgt-6f Pgt-7r Pgt-8r Pgt-9f Nucleotide sequence 5′ 3′ TAAAGGCCAAGTCACCATCGGCACACCCCGCCGT ACACGCTCTCCAGCGTCGAGTTCCACCCGCAAT ACTCCAACGCATCCATGGCGAAGAATCCTCA TGAGAGTTAAAGTGGGCACCGCAGCTGAGGA CGCCATGGATGCGTTGGAGGGTTCGTGACTCATTGC TGGAACTCGACGCTGGAAGGGGTGAC AGCAAACAATGGCCAGGGCACCATCGGCACCCCGT CAGCGTCGAGTTCCACCCGCAATGAGTCACGAACC TATTGGCGCACAAGGCAGTGGGAGGATTCGTGT ACACGAATCCTCCCACTGCCTTGTGCGCCAATA AGTCGAGGTATTGGCGCACAAGGCAGTGGGAGGA TGGAACTCGACGCTGGAGAGCGTGTGGAAC GTATTACCAACCCTCTCCCTTCCGTTCTCTCCTCAA ATGGTGACATGGCCGCTTCAGGCGGATCAA GATGGAGGAAGCAGAGGAGAGAAGCTA TGACATTCGCCGGACTTACAGAATTTCACT TTGTACGCGGAGCAGCAGTGCAATGCGTTTCA Length (bp) 35 34 30 32 36 27 35 35 33 34 34 30 36 30 28 30 32 76 . Two sets of primers were designed (Table 1) based on the sequences found in the first PCR round. Pgt2r3 for CAGT-A and Pgt-5f3. 72oC. The applied PCR program was initial denaturation at 94oC for 5 min. The last iPCR series was done using the restriction enzyme MseI. Carlsbad. The applied touchdown PCR program was initial denaturation at 95oC for 3 min. 94oC for 40 s. 10 µL were ligated using T4 DNA ligase and purified using a QIA quick® gel extraction kit (Qiagen GmbH. Canada). 68oC for 2 min. 5 cycles. The second series of iPCR was done based on the obtained sequences. Germany). 42oC for 2 min.' Rapid amplification of the cDNA ends (RACE) The amplification of the 3′.) Table 1. the last extension at 72oC for 7 min. Pgt-4r (1-3) and Pgt-5f (1-3) were used for the amplification of the 3′. and extension at 72oC for 3 min. Pgt-8r for CAGT B. and extension at 72oC for 3 min. Two sets of primers were designed based on the first PCR products. 5 cycles.and the 5′-ends of two coniferyl alcohol glucosyltransferase (CAGT) candidates was performed using 3′ and the 5′ RACE kits (Invitrogen. Inverse PCR (iPCR) 10 µg of genomic DNA were digested using HaeIII in total volume of 100 µL. PCR products were cloned into pGEM-T easy®. at 94oC for 15 s. 25 cycles. The nucleotide sequences of primers used to amplify the sequence of glucosyltransferases. 72oC for 3 min. The sequences were determined. Genomic DNA was digested using DpnI. and the primers Pgt-6f. The sequences were determined. Pgt-2r (1-3) and Pgt-3f (1-3) were used for the amplification of the 3′.and 5′ ends of CAGT-A. annealing at 60oC for 40 s. All PCR products were cloned into pGEM-Teasy® and the sequences determined. They were Pgt-3f3. (All restriction enzymes were purchased from New Englands Biolabs. Pgt7r for CAGT-A and Pgt-9f. annealing at 68oC for 40 s. 60oC for 30 s. PCR products were cloned into pGEM-T easy®. Pgt-4r3 for CAGT B. Pgt-6r for CAGT-A and Pgt-5f2. 94oC for 40 s. extension at 72oC for 3 min. plus 5 min at 72oC per cycle. and extension at 72oC for 3 min and the last extension 72oC for 5 min. Pgt-8r for CAGT B.and 5′ ends of CAGT-B. 25 cycles. denaturation at 95oC for 40 s. denaturation at 94oC for 15 s. 10 cycles. then concentrated using sodium acetate precipitation. 95oC for 40 s. The primers were Pgt-6f. 95oC for 40 s. and ligated. respectively. respectively. HaeIII was inactivated by heating at 60oC for 10 min. one cycle.

Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. The first iPCR products extended to 400 bp of CAGT A and 350 bp of CAGT B both at the 5′ end. Restriction enzymes that were used to digest genomic DNA should not cut the internal known sequence. On the basis of the sequence they were divided into 3 different candidate groups and called CAGT A.. No extension was found for CAGT C. Most of GTs from this group have substrate specificity on phenylpropanoid compounds. was 130 bp in length. After the third iPCR the full length of both CAGT was found with additional upstream and downstream sequences. It indicates that CAGT A may be active to phenylpropanoid compounds. 1988). B and C did not provide the expected fragments.and 6-glucosyltransferases. flavonols. Based on the enrichment of mRNA and the phylogenetic analysis. 2005). sinapyl alcohol. called PSPG box.g. Both GTs catalyze the transfer of glucose not only to the hydroxyl groups of betanidin but also to those of flavonoids. coli Results and discussion The total RNA isolation of the cell suspension cultures of Linum flavum provided high amounts of RNA. either upstream or downstream or both (Ochman et al. both the extensions are to the 5′. B and C. The PCR product of cDNA.e. Checking the product by gel electroforesis yielded two intensive bands with the size of 1900 and 4700 bp respectively. 77 . It has been suggested that GTs are highly regiospecific (or regioselective) rather than substrate specific. using primers that were designed based on the conserved region of the amino acids. Phylogentic analysis (Fig. we conclude that CAGT A may be coniferyl alcohol glucosyltransferase. uridine 5′-diphosphoglucose 5-O. This method is a normal PCR that has the primers oriented in the reverse direction of the usual orientation. i.. iPCR permits the amplification of the regions that flank any DNA segment of known sequence. 1997). This was also shown by UGT72E2 from Arabidopsis thaliana that has broad substrate recognition. Sequences of 12 randomly picked clones of this products showed homology with GTs. e.. 4) using MegAlign software from DNASTAR showed that CAGT A belongs to group E of glucosyltransferase family 1. The use of the 3′ and the 5′ RACE methods to find the full lengths of CAGT A. Expression experiments are needed to confirm this. anthocyanidins and flavones (Vogt et al. iPCR amplifications were done to find the full length. Start and stop codons were determined. These sequenced were extended using a second round of iPCR to 774 for CAGT A and CAGT B 563 of CAGT B. in contrast to UGT72E1 that is highly specific to coniferyl aldehyde and sinapyl aldehyde (Lim et al. coniferyl aldehyde and sinapyl aldehyde. It showed activity towards coniferyl alcohol. Due to these problems. probably representing ribosomal RNA. From the alignment with known GT sequences it can be concluded that CAGT A and CAGT B do not harbour any intron sequences.

'
1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 atggagcact m e h acccccttcg t p f accactcccc t t p ggccttcaaa g l q ggctgtgaga g c e aaattcataa k f i cggcggactg r r t ctcggcatcc l g i gcctcaaacg a s n cccccggggc p p g gtcgagttca v e f ctggtgaaca l v n gggagaaggg g r r cggggaaggg r g r aaactggcca k l a cagttaaacg q l n aaggaagaat k e e cggggatggg r g w cattgcgggt h c g ccgcttcagg p l q gtcggagtcg v g v ggtataaaga g i k agagttaagg r v k cacagcagct s q q ccgacatggc a d m tcaacgcccc l n a tccgaatcca i r i acgtccgctc n v r cctccatgga t s m catcgtcgcc a s s cgaggctcta p r l ctaccagcct a t s cggggctttg p g l acaagcagct n k q gcttcctcga s f l cgtggttcgt a w f gaatctgccg g i c attcagtcat n s v agatcgctgc e i a cgctgccgga s l p caccccagct a p q ggaactcgac w n s cggatcaatt a d q gagctgagga g a e gtgcggtaag s a v agcttgcaga e l a tcacgtcgtc l h v v aagactcttc a r l f tttcttctcc p f f s catcgtcgac h i v d cgctatccaa s a i q ccatttccag d h f q gacttcgtct p t s s cttcaacggg y f n g cacaaaaacc l t k t gcagacggaa w q t e gcagcggatg l q r m gctcgaacct e l e p cggtcctctg v g p l ccattgttgt r h c c ctacatatgc i y i c agctctggcg a a l a agggtttgag e g f e gaggattctt l r i l gctggaaggg t l e g cgcaaacgag f a n e atggtcgacg e w s t ccgggtgatg s r v m aagggctgcc e r a a tttctcccgt f l p gcccgccacg a r h ggcaagatcc g k i ttcccttccg f p s tcccctgacg s p d cgcccggtgg r p v tccactgggc s t g atggggacgc m g t gtggactccg v d s agaatacccg r i p gaggaagcag e e a gggtatccgg g y p ttgctctgca l l c acacgaatgc t r m ttcggcagcg f g s gaatcggagc e s e gagagaacgg e r t cgccatggat r h g gtgacggcgg v t a aagttggtga k l v ggcgagagga g e r gttggtgcag v g a atggcgatgg m a m acatggcgca y m a gcgccaagtc g a k tcgccgacgt l a d ccgccgccgg a a a ccggccacga a g h aggagctcct e e l tgaccgaatc l t e tcgccatgtg l a m attccgagcc d s e ggtttcacgc g f h aggagagaag e e r agtatttcag e y f acaaggacct n k d ctaaatggct p k w aggctgtctt e a v agagcttcat q s f aagggagagg e g r gcgttggagg c v g gggtgccgat g v p cggaggttct t e v ggatcgtggt r i v agggtggaga e g g attaa d cggccacatg h g h m gaccatcatc s t i i tcaacaacta v q q l cctccccgaa g l p e catcttcttc d i f f ccagcagtgg l q q w agcccgccgg s a r r ttgtacaatt c c t i acgttctcgt p r s r cggcgaggct a g e a ctacggaact s y g t gaaagtgatg r k v m gcaacaagga l q q g cgactcgaag l d s k ctctgctgcg f s a a ctgggtagtg i w v v gttggtaata g l v i gttcgtgact g f v t ggtgacatgg m v t w gaagatcggg l k i g gggaagggaa v g r e gatgaggggc e m r g

20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460

Fig. 2. Nucleotide and deduced amino acid sequences of CAGT A of Linum flavum cell suspension cultures. The nucleotide sequence is numbered on the left. The amino acid sequence is given in the single-letter code and is numbered on the right.

78

Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. coli
1 61 121 181 241 301 361 421 481 541 601 661 721 781 841 901 961 1021 1081 1141 1201 1261 1321 1381 atgaaccaga m n q acaatcgaat t i e ctcatcaagt l i k ggcgaggacg g e d cctgcttcct p a s gccgctagtc a a s gacttgttct d l f ttcttcactt f f t cgggtcggat r v g ccgtttcctt p f p atgatgaacc m m n gagctggagc e l e ccggtctacg p v y ggcgaatgtc g e c ctctgcttcg l c f ctggagcgga l e r ttctcgatgc f s m gacaggacga d r t ttggcgcaca l a h agcgtgtgga s v w aatgcgtttc n a f actaccggat t t g tttactggcg f t g gtgaggaaga v r k cagttcatct t v h tcgcccgccg f a r tcccgccgcc f p p atgaagatca d e d cctcctccgc s s s aaagaagcaa q r s gtacttccat c t s cctcaattgc s s i ctgtattcga s v f ctcgggtcct s r v acggccggag h g r cgtacgcttt p y a ccccgattct a p i aggagatcgt q e i ggagcatggg g s m gtggctgccg s g c cggcggatta p a d gagggttggg r g l aggcagtggg k a v acggggtgcc n g v agctggctga q l a taagatgggc l r w gagtgagatt g v r gggcgaagga r a k agctttcgtc l a f v cttgctccgc r l l r gttcggcgac p f g d ccgccgcgtc h r r v tggagattct a g d s ttgtaaaccc n c k p gatcgacgtc m i d v gtttctaggg a f l g gctgaccgac e l t d gccgtccgtc l p s v attctcggaa r f s e gaaatcactg l k s l ggatttgaag l d l k gaggtggctg v r w l agctttcgag g a f e gttcctctgg r f l w tggagggagt y g g s tttgatctgc g l i c aggattcgtg g g f v gatggtggcg p m v a gtggagctgg e w s w ggagtatgaa a e y e gagaaggcct l r r p gatgggctga e m g ccggctcccg p a p cgcgacacca r d t gacatcgaca d i d gaattcgtca e f v tccaaatcgc s k s tgctctgccc c s a gccgacgagc a d e ttcatgctct f m l gacccggtgc d p v ttcctcaaca f l n gctaagggca a k g atctcctcct i s s gctcaggggc a q g gacggtcagc d g q aaggatcaat k d q tcgatccgga s i r tacggggaga y g e aaatggcgcc k w r tcgcattgcg s h c tggcctgttg w p v tgtgctggct c a g gaagcaggag e a g gtaaaatgtg v k c gaatcggcca g i g ccatctccgt t i s gcttcgtcaa s f v ctctccccca t l p cggaggcttt p e a cggtcaccgg p v t taggaatccc l g i acctcccgac y l p cggtgcccag p v p agcacggcgg k h g taatcgtcaa i i v cgtttactct s f t aagtgaaatt q v k cggaggagtc p e e tgagggaaat l r e aacctcctcc k p p tcttgccgga i l p gcaagtcgag r k s ggtggaactc g w n tacgctggat v r w gggtggatgc w v d acggcgtgag d g v tgatggatag v m d tctcgtctcc h l v s cctcatcctc v l i l atcaatttcc k s i s actactcccc q l l p cgtcacacag f v t q tctggtcgtt g l v v ttcctacatc p s y i ccgccacgac t r h d ctactccgac s y s d gtacacgacg g y t t ttcatttgcc n s f a gccgccgccg l p p p ctgtaagtcc f c k s ggtgatcttc s v i f cgctacaggg i a t g ggcggaagag p a e e agggtttgag e g f e agtcgaggta r v e v gacgctggag s t l e gcagcagtgc m q q c tgagtgctgg a e c w tgaggagttg s e e l gggaagcgcg r g s a

20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 469

Fig. 3. Nucleotide and deduced amino acid sequences of CAGT B of Linum flavum cell suspension cultures. The nucleotide sequence is numbered on the left. The amino acid sequence is given in the single-letter code and is numbered on the right.

79

'

AB070753 Vigna angularis AB176523 Nicotiana tabacum AY345975 Stevia rebaudiana AC013430 Arabidopsis thaliana AC006551 Arabidopsis thaliana AB191249 Dianthus caryophyllus (chalcon) AB017060 Arabidopsis thaliana AC008153 Arabidopsis thaliana AB025604 Arabidopsis thaliana AC006922 Arabidopsis thaliana AC005851 Arabidopsis thaliana AB047095 Vitis vinifera (flavonoid) AY695816. Fragaria x ananas (flavonoid) AC009917 Arabidopsis thaliana NM_190981 Oryza sativa NM_196703 Oryza sativa AF331854 Zea mays AF503433 Sorghum bicolor AF303396 Phaseolus vulgaris AC011664 Arabidopsis thaliana AC004165 Arabidopsis thaliana AC004165.2 Arabidopsis thaliana AP003232 Oryza sativa AY663786. Fragaria x ananas DQ289587. Fragaria x ananas AB072918 Nicotiana tabacum AY345976. Stevia rebaudiana AB025634 Arabidopsis thaliana AL049862 Arabidopsis thaliana AY345983 Stevia rebaudiana AC016662 Arabidopsis thaliana AB182387 Solanum aculeatissimum AP000373 Arabidopsis thaliana AF190634 Nicotiana tabacum (salicylic acid) AJ889012 Lycopersicum esculentum (phenolic) AY345982 Stevia rebaudiana AC002396 Arabidopsis thaliana AC002333 Arabidopsis thaliana AC006533 Arabidopsis thaliana AC007153 Arabidopsis thaliana AF287143 Brassica napus (sinapate) AM231594 Brassica napus (hydroxycinnamate) AC005106 Arabidopsis thaliana AF346431 Nicotiana tabacum (phenylpropanoid) U32644 Nicotiana tabacum (salicylate) AF346432 Nicotiana tabacum (phenylpropanoid) U32643 Nicotiana tabacum (salicylate) AL021961 Arabisopsis thaliana AC006282 Arabidopsis thaliana AC005167 Arabidopsis thaliana AC005489 Arabidopsis thaliana XM_450574 Oryza sativa (betanidin) AB018115 Arabidopsis thaliana AL035602 Arabidopsis thaliana AB192315 Ipomoea purpurea (antochyanin) AC006340 Arabidopsis thaliana

Group G

Group H Group K Group F

Group I

Group J

Group E

CAGT B Linum flavum

Group B

Group L

Group D

CAGT A Linum flavum

Group C Group A

Fig. 4. Phylogenetic analysis of CAGT A, B and other plant glucosyltransferases. Grouping is based on phylogenetic analysis of Arabidopsis thaliana which showed 12 distinct groups. Each glucosyltransferase contains accession number, plant name and substrate (in the bracket, if any).

80

3028-IX/P3S-1/KON-QUE II/2000.Cloning of glucosyltransferase genes from Linum flavum cell suspension cultures in E. Indonesia. under the contract No. IBRD LOAN No. coli Acknowledgement The research was supported by the QUE Project Batch II. Department of Biology Institut Teknologi Bandung ITB. 4193 – IND. 81 .

82 .

Iliana Ionkova This chapter is based on Journal of Natural Products. Oliver Kayser. Georgi Momekov. Woerdenbag. in press (2006) 83 . Wim J. Quax. Spiro Konstantinov.Chapter 8 Production of a cytotoxic arylnaphthalene lignan genetically transformed root cultures of Linum leonii using Nikolay Vasilev. Rein Bos. Elfahmi. Herman J.

The genetic transformation in hairy roots was proven by PCR analysis. K-562 and SKW-3 with IC50 values of 1.8 mg g-1 DW) compared to callus.1. respectively. which showed integration of rol A and rol C genes into the plant genome. Schulz. 84 .6 M. Callus and hairy roots accumulated the arylnaphthalene lignan justicidin B as a major constituent. Justicidin B demonstrated strong cytotoxicity to the chronic leukemic cell lines LAMA-8.1 and 1. Hairy roots produced 5-fold higher yields of justicidin B (10. 6.( Abstract Callus and hairy roots cultures of Linum leonii F.W. Apoptotic properties of justicidin B were reported for the first time. were established.

1996). Our preliminary experiments exhibited that justicidin B is the main cytotoxic principle in the methanolic extract of callus of Linum leonii F. Several tumor types including sarcomas and breast. (Rutaceae) (Okigawa et al.. 2002). MacRae et al. fungicidal. Chemical structure of justicidin B. Schulz. (Varian Middelburg. The Netherlands). and lung carcinomas grow in or preferentially metastasize the skeleton where they proliferate. GC-MS analysis was performed on a 85 . This paper describes the isolation... detector (FID) temperature 300ºC. due to its cytotoxic and bone resorption inhibitory properties. It was shown that cell cultures of Linum austriacum produce justicidin B. GC analysis was performed on a Hewlett Packard 5890 series II gas chromatograph equipped with a 7673 autosampler. Therefore. 1. split ratio 100:1. Material and methods General experimental procedures NMR spectra measurements were carried out on a Bruker WM 400 (400 MHz) and a Bruker DRX 500 (500 MHz) spectrometer in CDCl3.10 m. antiviral (Gertsch et al. 2002). (Acanthaceae) and Haplophyllum spp. structure elucidation and cytotoxic evaluation of the major lignan produced by conventional and genetically transformed cultures of L. leonii. TMS was used as an internal standard.Introduction Justicidin B is an arylnaphthalene lignan which exerts cytotoxic (Joseph et al. 1988..25 mm ID. The potent bone resorption inhibitor justicidin B was used as a lead compound for design of new antirheumatic drugs (Sabino et al. and a Hewlett Packard 3365 Chemstation software A10. 2005). justicidin B may have significant clinical utility as a lead compound in the management of bone cancer and osteoclastogenesis. injected volume 1 L.W. # CP7810. carrier gas: helium.02 under the following conditions: column: WCOT fused silica CPsil 5 CB lowbleed/MS. Justicidin B has further been isolated from different Phyllanthus species (Euphorbiaceae) (Bachmann et al. 2003). 1989). and induce significant bone remodelling. antiprotozoal (Chen et al. the sustainable biotechnological supply of this valuable lignan would be a feasible alternative. 1996) and antiplatelet properties (Baba et al. Thus.. which is the first report on the existence of arylnaphthalene lignans in a species of the Linaceae (Mohagheghzadeh et al. 15 m x 0. Since there is a growing interest in justicidin B due to its various pharmacological effects. 5 7 7' 2 2 1' 8' 2' 3' 4' H3CO 4 H3CO 3 1 8 O O 6' 5' O O Fig. and cancer pain (Mohagheghzadeh et al... film thickness 0. inlet pressure 125 kPa. 1988). (Linaceae) (Vasilev and Ionkova. linear gas velocity 40 cm s-1. we decided to establish hairy roots from this species in hope of produce justicidin B in high yields. Pettit and Schaufelberger. Justicidin B was first isolated from Justicia spp.. bone destruction. temperature program: 150°C – 320°C at 15°C min-1 injector temperature 250ºC. 2002). 1970. prostate. 1993)..

which is the genetic evidence for hairy roots transformation. column flow: 2. Hairy root cultures were maintained at 25 ± 1 °C as described in Mohagheghzadeh et al. for rol C gene. ion source temperature. The Netherlands). Schulz. an AOC-20i autoinjector. toluene: acetone 10:1. scan speed. interface temperature. The fast growing hairy roots were further maintained under permanent dark on a rotary shaker (80 rpm) and refreshed by a new medium every two weeks. carrier flow (He): 46. 1995). and the GC-MS solution software 1. No com. The most abundant fraction (Rf = 0. ending in a fragment of 338 bp (Hass et al. # CP7810. 1999). development length: 9 cm and = 254 nm.1 mg justicidin B.2 mL min-1.W. (2002). calli and hairy roots according to a protocol for rapid isolation from dry and fresh samples (Khanuja et al. The residue was further purified by recrystallisation in cold MeOH to yield 3. concentrated under reduced pressure at 50ºC. Extraction. total flow: 46. MS conditions: ionization energy. isolation and quantification Air-dried plant material from hairy roots (10 g) was extracted with 80% MeOH (200 mL for 1 h sonification at 25ºC).. 35 cycles of 30 s at 95°C. St. 2 min at 72°C and a final step of 5 min at 72°C.5 cm sec-1 . All PCR reactions were performed in a Mastercycler® gradient thermocycler (Eppendorf) with recombinant taq DNA polymerase (Fermentas GMBH. The dichloromethane extract was subjected to preparative TLC separation using silica gel 60 F254 (Merck): 10 x 20 cm. totally 248 bp. combined. a fragment of 490 bp totally. 90-170 °C at 4°C min-1. injection volume: 2 µL. 253/1999) from the botanical garden Nancy (France). Leusden. temperature program 35 min at 90°C. The integration of rol A and rol C genes from A. nucleotide positions 21-42 (5’-CGTTGTCGGAATGGCCCAGACC-3’) and 268-246 (5’-CGTAGGTCTGAATAT-TCCGGTCC-3’). Temperature program: 150°C – 320°C at 15 °C min-1. (Linaceae) were a kind gift (No 1636. split ratio: 20:1. rhizogenes ATCC 15834 was performed following the instructions of Qiaprep spin miniprep kit from Qiagen (Westburg. Callus cultures were initiated and grown as described previously (Vasilev and Ionkova. positions 51-70 (5’-TGTGA-CAAGCAGCGATGAGC-3’) and 550-531 (5’GATTGCAAACTTGCACTCGC-3’). mass range. 2004): for rol A gene.10.2 mL min-1. Quantitative determination of justicidin B in callus and hairy roots was performed by GC 86 .10 m. 40 s at 50°C.: 275°C. Injector temp..25 mm ID (Varian Middelburg. Vir D2 gene is not involved in the plant genome during the transformation. 2 mm. Hairy roots were induced by direct incubation of segments from sterile grown plants with Agrobacterium rhizogenes strain ATCC 15834 cultured in YMB medium in the presence of 20 M acetosyringone for 2 days in the dark.1 mL min1 : linear velocity: 75. The Netherlands). Germany). DNA analysis DNA isolation was conducted from the dry plant material of the intake plant. 15 m x 0. Leon-Rot. inlet pressure: 75 kPa. The isolation of DNA of A. The specific primers for the detection of vir D2 are: primer A (5’-ATGCCCGATCGAGCTCAAGT-3’) and primer E (5’-CCTGACCCAAACATCTCGGCTGCCCA-3’). rhizogenes into the plant genome. The initial amount of hairy roots yielded 780 mg dry dichloromethane extract. The extract was separated with 3 x 200 mL dichloromethane. which increased susceptibility toward infection. film thickness 0.( Shimadzu QP5000 GC-MS system equipped with a 17A GC. 34-600 u Plant material The seeds of Linum leonii F. was proven by PCR reaction. 2005).. dried and kept at -20ºC. The PCR program was 5 min at 95°C. Dichloromethane layers were filtered (Na2SO4 was used as a drying agent). GC conditions: WCOT fused silica CPsil 5 CB lowbleed/MS. 250°C. BV. 2 scans s-1. Therefore the following specific primers were designed (Nader et al. 250°C. 70 eV.45) was pooled and evaporated to dryness consequently.

(2001). Thereafter the formazan crystals formed were dissolved through addition of 100 L/well 5% formic acid in 2-propanol (Merck) and the absorption of the samples was measured with an ELISA reader (Uniscan Titertec) at 580 nm. 87 . using Microsoft EXCEL and OriginPlot software for PC. Cytotoxicity assay The MTT-dye reduction assay was carried out as described by Mossmann (1983) with some modifications (Konstantinov.4 and 4. 1:1.5% Triton X100. The isolated DNA was redissolved in 20 L distilled water and analyzed by gel electrophoresis in 0. Intraday (n=6) and interday (n=5) coefficients of variations (CV) were determined.5 M) and untreated controls. The culture conditions are as previously described (Vasilev et al. About 5×106 SKW-3 cells – treated with justicidin B (at 0. The response factor (RF) was calculated using 3 concentration ratios (3:1. 10 L MTT stock and 100 L 5% formic acid in 2-propanol served as a blank solution. LLOQ of justicidin B was 1 µg mL-1. Leukemic cell lines and culture conditions The three leukemic cell lines LAMA-84.11%. 1:3) between justicidin B and cinchonidine. Cinchonidine was used as an internal standard.187 mL 6 M solution of NaCl was added to each sample. 2005). The clinically applied epipodophyllotoxin derivative etoposide was used as reference cytotoxic drug. Briefly.000 x g for 20 min..25 or 0.analysis as described by Koulman et al.25 mL PBS and lysed through addition of 0. The data processing included the Student` t-test with P s ≤ 0.8 and 3.8% agarose gel. The tubes were gently agitated and incubated at –20°C for 12 h in order to allow precipitation of the hydrophilic DNA. 100 L RPMI 1640 medium (Sigma). RF=1.4% respectively. Intra-day CV from callus and hairy roots determinations are 7. The cell pellets were resuspended in 0. 100 µL aliquots of cell suspension (1×105 cells mL-1) were seeded in 96-well microplates. Finally DNA was stained with ethidium bromide and visualized using an UV transilluminator and photographed with a fixed digital camera (Bio Doc ITTM system). The limit of detection (LOD) was established as the amount of analyte that provided a signal-to-noise ratio of 3. 1999).05 taken as significance level. the supernatants were decanted and DNA was washed in 1 mL ice cold 70% ethanol and then air dried. and inter-day variations for callus and hairy roots analyses are 1. n=5). K-562 and SKW-3 were supplied from the German Collection of Microorganisms and Cell Cultures (DSMZ). LOD was 0. Apoptosis assay The DNA extraction and horizontal gel electrophoresis procedures were performed as previously described (Vasilev et al.000 g.937 mL 2-propanol as well as 0. 2005).. All values were expressed as the mean ± SD (n=8). were washed in PBS and spun at 1. 20 mM Tris-HCl and 1mM EDTA (pH = 7. The supernatants were transferred into 2 mL ‘safe lock’ test tubes and then 0.5 mL buffer containing 0. The results were expressed as survival fraction (% of untreated control). Following 24 h incubation at 37°C the cells were exposed to the newly isolated lignan or to etoposide for 72 h. After the incubation period MTT solution (10 mg mL-1 in PBS) was added (10 L/well) and the plates were further incubated for 4 h at 37°C.800 x g for 5 min.4).80 (CV=1. The samples were centrifuged for 20 min at 11.9% respectively.1 µg mL-1. The limit of quantification (LLOQ) was defined as the lowest calibration standard that could be quantified with an accuracy of 90110% and a precision of 15%. Samples were incubated at 0°C (on ice) for 5 min and thereafter spun at 11.

lane 5 – DNA from hairy roots not expressing vir D2. lanes 6. lane 2 – untransformed L. This isolate was analyzed by means of GC-MS and NMR. We performed DNA analysis in order to confirm the hairy roots transformation. Thus the isolated compound was unambiguously identified as justicidin B. rhizogenes DNA showing roal A. 1970). Therefore the resonance signals at 7..05 ppm were assigned to H-6 and H-3 respectively. PCR analysis showed that hairy roots from L.. 2. lanes 3 and 4) corresponding to the positive controls obtained by DNA from A. no reports on the induction of hairy roots from L. The products encoded by rol A and rol C genes were found to have a synergistic effect on root induction and induce increased sensitivity to auxin (Slightom et al.( Results and discussion Callus cultures were developed as previously described (Vasilev et al. The genetically modified cultures demonstrated typical hairy roots phenotype: intensive branching. The TL region in plasmid T-DNA of the agropine-type strain A. Hairy roots accumulated 5 times higher amounts of justicidin B (10. Day et al. leonii hairy roots in which rol C of 490 bp and rol A of 248 bp integration was positive. 2. A closer look at the 1H NMR spectrum showed that the proton signals at 7. that is consistent with the data for an arylnaphthalene lignan (Okigawa et al. 1 500 bp 2 3 4 5 6 7 8 100 bp Fig. leonii contain rol C and rol A genes (Fig. The most vigorous growth was observed when the bacterial growth stopped and there was no further necessity of antibiotic.05 ppm appeared as singlets. and vir D2 (338 bp) respectively. 1970).5-substitution (Okigawa et al. thus showing that T-DNA is incorporated in the plant genome and it is not a residual bacterial contamination.12 ppm and 7. which is indicative for 4. Vir D2 was not detected in the hairy roots (lane 5). lanes 3 and 4 – DNA from L. To our knowledge. 1996. 7 and 8 – positives controls of A. 2005). leonii roots transformed by A. hormone autotrophy and lack of geotropism. 1999). due to the shielding effect of the piperonyl group on H-3. The EI-MS of the isolated compound showed a m/e value of 364 and mass fragmentation.8 mg g-1 DW) than the conventional cultures of callus (Table 1). leonii by preparative TLC and subsequent recrystallisation in cold MeOH. We undertook isolation and identification of the main component in hairy roots of L. leonii hairy roots after 14 days period is very close to 88 . Lane 1 – DNA marker. rhizogenes 15834 contains 18 open reading frames including several loci called rol (root loci). Untransformed callus served as a negative control (lane 2). Further NMR experiments were performed in order to distinguish between justicidin B and isojusticidin B as these two isomers have no different MS fragmentation pattern. 1988). rol C.. rhizogenes ATCC 15834 (lanes 7 and 6).. The 1H NMR data is in full agreement with a previous report of justicidin B (Pettit and Schaufelberger. rhizogenes ATCC15834. PCR analysis of L. leonii have been published till now. This finding supports the hypothesis that arylnaphthalene lignans are characteristic of the section Linum. leonii plantlets.. leonii retained the capability to produce justicidin B.12 ppm and 7. The content of justicidin B in L. Callus and hairy roots of L.

5 and 0. Table 1. respectively (Mohagheghzadeh et al. Therefore it is firmly established that the primary cytotoxic effect of justicidin B is mediated by activation of the programmed cell death pathways.6 Etoposide 0.. Therefore optimization of L. Justicidin B proved to be slightly less active in respect to relative potency.5 and 16. leonii as well as the first report on the apoptotic properties of this valuable arylnaphthalene lignan. leonii demonstrated a high biosynthetic capacity.4 4. which is used as a template for the development of potential new therapeutic agents.9 mg g-1 DW. austriacum: 12. LAMA-84. Hairy roots of L. leonii hairy roots is worthy of further consideration as an alternative production system of justicidin B. Content of justicidin B in cell cultures.1 1. it inhibited the proliferation of malignant cells at the same extend as the referent drug etoposide. piscatorum (Gertsch et al. Therefore further optimization of hairy roots cultures is needed to compete with the levels of justicidin B produced by intact plant.justicidin B levels produced for 30 days in normal root cultures and transformed roots of L. The electrophoretic analysis of DNA. At the higher concentrations (10 µM). K-562 and SKW-3. however. hairy roots from L.8 Interday (n=5) 1.01 10. The observed DNA laddering is a consequence of the action of specific nucleases which degrade the higher order chromatin structure during the apoptotic process. However. The IC50 values of screened leukemic cell lines were determined (Table 2). As evident from the presented results (Fig. Table 2.4 In addition to the current data.8 1.8 89 . we underwent further cytotoxicity examination of justicidin B on three chronic myeloid leukemia-derived cell lines. 2002). To our knowledge this is the first report of justicidin B isolated from the hairy roots of L. leonii produced lower amount of justicidin B. The major active constituent justicidin B can be easily isolated in reasonable amounts from the genetically transformed root cultures.9 0. Cell line LAMA-84 K-562 SKW-3 Cell type chronic myeoid leukemia pre-B-cell lymphoma chronic lymphoid leukemia IC50 value (µM) Justicidin B 1. Variation (CV %) Intraday (n=6) 7. Relative potency of justicidin B and etoposide. 3) both compounds caused concentration-dependent cytotoxic effects in the panel of human tumor cell lines under investigation.1 6.9 Culture type Callus Hairy roots Justicidin B (mg g-1 DW) 2. 2003). 4). isolated from the cytosolic fraction of SKW-3 after 24 h treatment cells with 0.8 3. that show a lower responsiveness to cytotoxic drugs due to the strong expression of the fusion oncoprotein BCR-ABL (a non-receptor tyrosine kinase). compared to the highest yields in intact plants: 3-4 % in P..25 M justicidin B evoked oligonucleosomal DNA fragmentation (Fig.

as assessed by the MTT-dye reduction assay. Concentration response curves for justicidin B ( ) and etoposide ( ) following 72 h treatment of LAMA-84 (A).( 100 % of untreated control 80 60 40 20 0 0 5 10 15 20 concentration ( µM) A 100 %o u tre te co tro f n a d n l 80 60 40 20 0 0 5 10 15 20 concentration ( µM) B 100 %o u tre te co tro f n a d n l 80 60 40 20 0 0 5 10 15 20 concentration ( µM) C Fig. 90 . K562 (B) and SKW-3 (C). The error bars indicate the corresponding standard deviation. 3. Each data point represents the arithmetic mean of at least 8 independent experiments.

for recording NMR spectra. Universität Hamburg. Imaging of DNA laddering induced by justicidin B treatment. Acknowledgements The authors thank T.5 µM (3). 4. The financial support by the Huygens Program for N. Hackl. Vasilev is gratefully acknowledged. DNA was extracted from the cytosolic fraction of untreated 5×106 SKW-3 cells (1) or following 24 h exposure to justicidin B at 0.25 µM (2) or 0. 91 . Institut für Organische Chemie.1 2 3 Fig.

92 .

Summary and concluding remarks 93 .

roots and seeds were compared and significant differences. Hydrodistillation of the berries of P. syphilis. Lignans seem to be an important group of secondary metabolites.1% of the oil. and caryophyllene were the main sesquiterpenes in the berries oil. diarrhea. leonii. corresponding with 78.2 mg g-1 DW) in the suspension cultures. sabinene. constipation. Piper cubeba. GC-MS) in the berries.2% and 17. nephralgia. E-caryophyllene. leaves and stalks were investigated and compared using gas chromatography (GC). The focus is on the Indonesian medicinal plants Phyllanthus niruri and Piper cubeba and on two Linum species. aerial plant parts. 63 components could be identified.9% (v/w) oil. -Copaene. 94 . The lignan profile of berries (the particular plant part used in jamu). among others to treat gonorrhea. malaria. The lignan profiles of cell suspensions. Linum flavum and L. and limonene. The leaves serve to treat epilepsy. Lignans are also found in another important medicinal plant for jamu. As the economical and clinical value of jamu nowadays increases in Indonesia. but reported earlier from P. and -cadinene were the main sesquiterpenes in the leaves oil.5 mM of caffeic acid. Jamu is the Indonesian traditional herbal medicine. and menstrual disorders. hypertension. Ecaryophyllene. cubeba. and high pressure liquid chromatography (HPLC) (chapter 4).Summary and concluding remarks In this thesis phytochemical and biosynthetic studies of lignans are described. both qualitatively and quantitatively. dysentery.8% (w/w) and the leaves 0. All parts of the plant are used. ethical issues such intellectual property right (IPR). Chapter 2 reviews the research carried out on jamu and jamu plants. In the leaves. a new lignan from P.0%. This knowledge can be used for the further development of (rationally designed) phytomedicines from P. Thirteen lignans were identified in the berries. -pinene. cubeba yielded 11. and tetanus. for berries and leaves. practised for many centuries in the Indonesian community to maintain good health and to treat diseases. were found (chapter 3). In addition. resulted in an increase up to 0. responsible for the biological activity of P. and gastroprotective are mentioned in the latter context. In total 105 components could be identified (GC. Feeding 0. Both Indonesian plants are used in jamu. The main monoterpenes in the berries and leaves oil were -thujene. dealing with 63.5 mM of ferulic acid or 0.3 mg g-1 DW of urinatetralin (control value 0. covering a broad range of aspects including phytochemistry. elemene. in addition to the berries. antifungal. Jamu has to be developed in order to assure its efficacy and safety. diarrhea. native to European countries. also the leaves may be used for medicinal purposes. being early precursors of lignan biosynthesis. In the oxygenated monoterpene fractions trans-sabinene hydrate was the main component. benefit sharing. The total amount of monoterpenes was comparable in both oils (17. niruri before were isolated from the cell suspension cultures: a new dihydrocubebindimethylether and urinatetralin.0% of the oil. Two compounds that were not found in P. antiherpes simplex. Based on the similarity of the lignan and essential oil profiles we conclude that. niruri. The essential oil of the berries is commonly used as a constituent of cosmetics as well as for medicinal purposes. fifteen in the leaves and five in the stalks. abdominal pain.1 mg g-1 DW) and up to 0. respectively).7 mg g-1 DW of the dihydrocubebin-dimethylether (control value 0. Our further phytochemical investigation of P. and conservation are addressed. urinaria. Antimicrobial. The berries of this plant are used to treat gonorrhea. syphilis. enteritis and asthma. cardiovascular. The manufacturing of jamu is shifting more and more from household scale to the bigger industries. Phyllanthus niruri is an important medicinal plant for jamu. gas chromatography coupled to mass spectrometry (GC-MS). cubeba berries and leaves focused on the essential oil composition (chapter 5). there is a need for further scientific proof and well conducted research. fever. We initiated cell cultures of P. toxicologicy and clinical studies. pharmacology. callus cultures. niruri. niruri that were able to produce lignans.

leonii. as shown in cell homogenates incubated with coniferyl alcohol. it may be concluded that at least one of the two CAGT is involved in the biosynthetic step from coniferyl alcohol to coniferin in L. Several GT-encoding genes are suitable candidates to be inserted into a variety of plants with the aim of improving food. we investigated the cytotoxic effect of justicidin B in three chronic human myeloid leukemia-derived cell lines (LAMA-84.5 µM for the chronic myeloid leukemia (LAMA-84). flavum in E. appeared to be impossible because of its unstable nature.2-fold more than in untreated cultures. flavum in Escherichia coli (chapter 7). These glucosyltransferases were aligned using MegAline software from DNASTAR Inc. It was hypothized that by inhibiting this step more precursor would be available for the biosynthetic branch leading to the formation of lignans. The total RNA isolation revealed that the quality of RNA was sufficient to synthesize the cDNA. We tried to clone the CAGT from cell suspension cultures of L. we partially purified this enzyme from cell suspension cultures of L.1 and 1. however.1. Proof of transformation was given by the PCR products showing that rol A and rol C genes were present in the hairy roots of L. K-562 and SKW-3). Although the expression of these GTs is not yet finished. Phylogenetic analysis revealed that CAGT A and B belong to the same subfamily together with other phenylpropanoid glucosyltransferases. We were able to find the conserved region (PSPG box) for the third one. The PSPG box is considered to represent the nucleotide diphosphate binding site. In chapter 8. we describe the production of justicidin B. Two of them were complete sequences (ORF): CAGT A and CAGT B.6 mg g-1 DW. Genetically modified hairy roots produced 5fold higher yields of justicidin B (10. Three different potential GTs were cloned from cell suspension cultures of L. The hairy root cultures were obatained by genetic transformation using the agropine-type strain Agrobacterium rhizogenes 15834. A complete purification of CAGT. Linum flavum. The gene sequence of three different products was elucidated. These two compounds originate from the common precursor coniferyl alcohol by different biosynthetic branches. a cytotoxic aryltetraline lignan in cell and hairy root cultures of Linum leonii. The mechanism of inhibition is not clear as yet. called the PSPG box. flavum cell cultures accumulate a high amount of coniferin (12% on a dry weight basis). 3. coli. Enzymatic transformation of this substrate by coniferyl alcohol glucosyltransferase (CAGT) yields coniferin. Alignment of CAGT A and B with the sequences from the plant GTs obtained from databases showed 50% and 40% homology. rhizogenes into the hairy root was checked by PCR (polymerase chain reaction). is highly characteristic and present in all GTs involved in natural product biosynthesis. The products encoded by rol A and rol C genes were found to have a synergistic effect on root induction and to induce increased sensitivity to auxin. In addition to the production. This indicates that Na2EDTA inhibits CAGT and therefore reduces the production of coniferin. The conserved region. IC50 values of justicidin B were 1. crop quality as well understanding the biosynthesis of valuable natural products for medicine. flavum cell suspension cultures. repectively. Cell suspension cultures of leaves from this plant were treated with glucosyltransferase inhibitors in order to enhance the production of the lignan 6-methoxypodophyllotoxin (6-MPT) and to reduce the coniferin production (chapter 6). To further study the role of CAGT in the biosynthesis of lignans.8 mg g-1 DW) compared to untreated callus. 6. The inhibition of the coniferin production related to an inhibition of the CAGT activity. This domain may also define the active site of GTs of animals and microorganisms. flavum. The transformation of these genes from A. Na2EDTA inhibited the production of coniferin up to 88% and on the other hand enhanced of the 6-MPT production up to 0. The conserved region (PSPG box) of CAGT A and B showed 80% and 89% homology respectively. L. This suggests that this technique may be used to enhance the accumulation of justicidin B. that show a lower responsiveness to cytotoxic drugs due to a strong expression of the fusion oncoprotein BCR-ABL (a non-receptor tyrosine kinase).) * Studies on the lignan biosynthesis were performed with the European plant. A forward and a reverse degenerated primer were designed based on the most conserved region of 100 glucosyltransferases from various species. pre-B-cell 95 .

The biotechnology approach may also be applied to use medicinal plants as a source for drugs discovery. Furthermore the genetic engineering studies of two Linum species contribute to medicinal plant research with respect to a better understanding of the lignan biosynthesis. These IC50 were comparable to the anticancer drug etoposide (a semi-syntehetic lignan derivative).lymphoma (K-562) and chronic lymphoid leukemia (SKW) cell lines respectively. We conclude that the phytochemical studies of the two selected Indonesian medicinal plants as well as the production of lignans in cell suspension cultures provide further scientific approach for the development of jamu. 96 .

In dit proefschrift worden aspecten betreffende fytochemie en biosynthese van lignanen onderzocht die aanwezig zijn in twee medicinale planten uit Indonesië. diarree. en Linum leonii F. Wereldwijd zijn pogingen ondernomen om de productie van biologisch actieve verbindingen te verhogen met behulp van biotechnologie. taxol. (Euphorbiaceae) en Piper cubeba L.en regelgeving. hypertensie en menstruatieproblemen. Podofyllotoxine. P. Lignanen vormen een belangrijke groep van secundaire metabolieten in deze plant en worden verantwoordelijk gehouden voor de biologische activiteit. syfilis. Wij hebben celcultures opgezet van de bladeren van de plant. wortels en zaden. rationele farmacotherapie met deze middelen en ethische overwegingen die in beschouwing moeten worden genomen bij het ontwikkelen van geneesmiddelen uit traditionele bronnen. (Linaceae). De Indonesische bevolking gebruikt jamu al eeuwenlang om een goede gezondheid te behouden en om ziekten te behandelen. camptothecine. plantenextracten en uit planten geïsoleerde verbindingen voor het behandelen van ziekten. Hoofdstuk 2 geeft een uitgebreid overzicht van jamu. kinine. Moderne analysetechnieken. niruri is een belangrijke plant in jamu. In zowel callusweefsel als in celsuspensies waren lignanen aanwezig. wet. In Hoofdstuk 3 bestuderen wij lignanen in celcultures van Phyllanthus niruri. ondermeer om gonorroe.W. als voedingssupplement en voor cosmetica is diep geworteld in het verleden en nog steeds in ontwikkeling. Linum flavum L. reserpine en digoxine zijn bekende voorbeelden van zulke geneesmiddelen. (Piperaceae). Schulz. is een verdere wetenschappelijke onderbouwing nodig. Wij bespreken de relatie van jamu met de biodiversiteit van Indonesië (die één der grootste ter wereld is). urinaria werd gevonden. De beide Indonesische planten worden in jamu gebruikt. vinblastine. obstipatie. atropine. Jamu is de traditionele Indonesische geneeskunde en is gebaseerd op het volksgebruik van medicinale planten. aspirine. in Indonesië bekend als meniran.Samenvatting (Dutch) Aspecten betreffende fytochemie en biosynthese van lignanen. malaria. Op basis van kennis verkregen uit goed opgezet onderzoek kan jamu in Indonesië verder worden ontwikkeld en kan de veiligheid en effectiviteit van deze middelen worden gewaarborgd. Aangezien de economische en klinische betekenis van jamu in Indonesië stijgt. Veel geneesmiddelen die in de hedendaagse gezondheidszorg worden toegepast zijn gebaseerd op planten en ontdekt op basis van het traditionele (medicinale) gebruik door inheemse bevolkingsgroepen. De bladeren worden toegepast bij epilepsie. koorts en tetanus te behandelen. Alle delen van de plant worden gebruikt. Er waren kwalitatieve en kwantitatieve verschillen tussen de lignanen in bovengrondse delen van de plant. Koffiezuur en 97 . genomics. Phyllanthus niruri L. dat eerder in P. Uit de celsuspensiecultures isoleerden wij twee lignanen die niet in de plant zelf voorkomen: een nieuwe dimethylether van cubebine en urinatetraline. met de nadruk op Indonesische medicinale planten Het gebruik van planten. efedrine. Ontwikkelingen in wetenschap en techniek geven een verdere impuls aan de exploratie van medicinale planten als bron voor nieuwe geneesmiddelen. de therapeutische waarde van planten en bestanddelen uit planten die het meest frequent in jamu worden toegepast. bespreken klinisch onderzoek dat beschikbaar is en besteden aandacht aan toxicologische aspecten. de positie van jamu in de huidige Indonesische samenleving. biotechnologische benaderingen. en in twee Linum-soorten die inheems zijn in Europa. economische vooruitzichten. de bereiding van jamu (die meer en meer verschuift van kleinschalige huisvlijt naar groter industrieel). vincristine. Dikwijls echter vormen de relatief lage gehaltes van biologisch actieve verbindingen (zogenaamde ‘secundaire metabolieten’) en problemen bij het standaardiseren een knelpunt in de exploitatie van medicinale planten. Wij geven uitgebreide informatie over de biologische activiteit. nefralgie. proteomics en metabolomics worden toegepast in het onderzoek met medicinale planten en dragen bij aan de vooruitgang van dit vakgebied. artemisinine.

antischimmel. -elemeen.2 toenam.8% en van de bladeren 0.1 mg g-1 drooggewicht cubebine dimethylether en 0.5 mM gaven zowel koffiezuur als ferulazuur een verhoging van de productie van het cubebine dimethylether als van urinatetraline in de cellen (tot respectievelijk 0. werden aan het groeimedium van de celsuspensiecultures toegevoegd (‘precursor feeding’) met als doel de lignaanproductie in de cellen te verhogen. sabineen en limoneen.3 mg g-1).6 mg g-1 drooggewicht. In een concentratie van 0. overeenkomend met 78. cubeba worden gebruikt ter behandeling van gonorroe. In Hoofdstuk 6 beschrijven wij de verhoogde productie van 6methoxypodofyllotoxine (6-MPT) in celsuspensiecultures van blaadjes van L.9% olie op. Na toevoeging van EDTA werd de productie van coniferine tot 88% van de controlewaarde geremd. terwijl de 6-MPT productie met een factor 3. Hoofdstuk 4 beschrijft de lignaanprofielen van verschillende delen van van de plant: bessen. Normale celsuspensiecultures (controle) produceerden 0. flavum onder invloed van ethyleendiaminetetraacetaat (EDTA) en andere glucosyltransferaseremmers. diarree. berekend op drooggewicht). teniposide en etophos. -pineen. In de bladeren vonden wij vijftien lignanen. De belangrijkste -thujeen. Het enzym coniferylalcohol glycosyltransferase (CAGT) zet coniferylalcohol (een fenylpropaanderivaat en vroege voorloper in de biosynthese van lignanen) om in coniferine. een andere belangrijke jamu-plant en bekend als kemukus. dysenterie.0% van de olie. In de bladolie werden 63 bestanddelen geïdentificeerd. Om de rol van CAGT in de lignaanbiosyntehse verder te bestuderen hebben we het enzym gedeeltelijk gezuiverd uit 98 . De hoeveelheid monoterpenen was vergelijkbaar in beide oliën (17. Linum flavum (gele vlas). Cubebine. Het gebruik van podofyllotoxine als uitgangsstof voor de semi-synthetische cytostatica etoposide. In totaal werden in de bessenolie 105 bestanddelen geïdentificeerd. -Copaeen. De werking is antimicrobieel. cubeba te krijgen bestudeerden wij de samenstelling van de vluchtige olie van bessen en bladeren van deze plant met behulp van GC en GCMS (Hoofdstuk 5). tot 0. Het mechanisme achter de enzymremming is nog niet opgehelderd. flavum accumuleren grote hoeveelheden coniferine (tot 12%. Stoomdestillatie van de bessen leverde 11. In de geoxygeneerde monoterpenen waren monoterpeenfractie was trans-sabineenhydraat het hoofdbestanddeel.2 mg g-1 urinatetraline. cubeba die wij onderzochten. Lignanen zijn ook aanwezig in Piper cubeba. en isoyateine zijn algemeen voorkomende lignanen in het geslacht Piper en bleken ook de belangrijkste bestandelen te zijn in de bovengrondse delen van P. cardiovasculair en maagbeschermend.1% van de olie. antiviraal (bij herpes simplex). bladeren en takjes. waardoor de productie van 6MPT wordt verhoogd. Deze kennis kan worden gebruikt voor de verdere ontwikkeling van fytotherapeutica op basis van P.en sesquiterpenen en fenylpropaanderivaten) vormen de belangrijkste groepen secundaire metabolieten in P. cubeba. Liganen en vluchtige olie (met mono. Op basis van de overeenkomstige profielen van lignanen en vluchtige olie van bessen en bladeren concluderen wij dat ook de bessen voor medicinale doeleinden bruikbaar zouden kunnen zijn. enteritis. syfilis. Biosynthesestudies van lignanen werden uitgevoerd met een Europese plant. flavum die werden geïncubeerd met coniferylalcohol. hinokinine. De hypothese is dat door remming van de vorming van coniferine er meer coniferylalcohol beschikbaar komt. vroege voorlopers in de biosynthese van lignanen. cubeba. inclusief podofyllotoxinederivaten en tussenproducten uit de biosynthese. Om een completer fytochemisch beeld van P.2% en 17. yateine. De remming van de coniferineproductie correleerde met remming van de CAGTactiviteit in celhomogenaten van L.0% voor respectievelijk bessen en bladeren). stimuleert het onderzoek naar lignanen. buikpijn. Celcultures van de L. hogedruk-vloeistofchromatografie (HPLC). Als methoden werden dunnelaagchromatografie (TLC). in de bessen dertien en in de takjes vijf.7 mg g-1 en 0. Ecaryofylleen en caryofylleen waren de belangrijkste sesquiterpenen in de bessenolie.ferulazuur. gaschromatografie (GC) en gaschromatografie gekoppeld aan massaspectrometrie (GC-MS) gebruikt. E-caryofylleen en -cadineen de belangrijkste in de bladolie. De bessen van P. overeenkomend met 63. en astma. De vluchtige olie uit de bessen wordt gebruikt in cosmetica en voor medische doeleinden.

‘PSPG box’ genaamd. Vergelijking (‘alignment’) van CAGT A en B met sequenties van glycosyltransferases uit planten die beschikbaar waren in databases. samen met andere fenylpropanoïd glycosyltransferases. Het geconserveerde gebied. vanwege de instabiliteit van CAGT. coli gekloneerd en de sequentie werd opgehelderd. In Hoofdstuk 8 beschrijven wij de productie van justicidine B in celcultures en in hairyrootcultures van Linum leonii. leonii met behulp van Agrobacterium rhizogenesstam 15834 (agropinetype). rhizogenes in de hairy-rootcultures L. fungicide. leonii geslaagd was. Van het derde product konden wij alleen het geconserveerde gebied (PSPG box) aantonen. Het uiteindelijke doel is het ontwikkelen van een efficiënt systeem voor de productie van cytotoxische lignanen.5 M (SKW) en waren vergelijkbaar met die van het referentiecytostaticum etoposide. 6.1 M (LAMA-84). met als doel de kwaliteit ervan als voedingsmiddel of als landbouwgewas te verbeteren. Fylogenetische analyse van de resultaten bracht aan het licht dat CAGT A en B tot dezelfde subfamilie behoren. flavum celcultures. De producten waarvoor de rol A en rol C genen coderen hadden een synergistisch effect op de wortelinductie en verhoogden de gevoeligheid voor het plantenhormoon auxine. Daarnaast kan op deze manier meer kennis worden vergaard over de biosynthese van medicinaal toegepaste natuurstoffen. werden primers ontworpen (‘forward en reverse degenerated primers’).8 mg g-1 drooggewicht) dan normaal callusweefsel. Twee producten waren complete sequenties: CAGT A en CAGT B. Hoewel de expressie van deze glycosyltransferases nog niet helemaal afgerond is. De biosynthese van lignanen werd ook op genetisch niveau onderzocht. Een totale zuivering bleek. is zeer karakteristiek en aanwezig in alle glycosyltransferases uit biosyntheseroutes van natuurstoffen. concluderen wij dat minstens één van de twee CAGT’s betrokken is bij de biosynthesestap van coniferylalcohol naar coniferine in L. celsuspensiecultures van L. De geconserveerde gebieden van CATG A en B vertoonden 80% en 89% homologie. Op basis van de meest geconserveerde gebieden van het DNA dat codeert voor honderd glycosyltransferases in verschillende plantensoorten. Verschillende genen die coderen voor glycosyltransferases kunnen worden ingebouwd in planten. Met behulp van de PCR-techniek (polymerase chain reaction) werd bewezen dat de transformatie van de rol A en rol C genen uit A. De hairy-rootcultures werden verkregen door genetische modificatie van L. De PSPG box is waarschijnlijk de nuceotidedifosfaat-bindingsplaats. LAMA-84. Genetisch gemodificeerde hairy-rootcultures produceerden vijfmaal hogere gehaltes aan justicidine B (10. K562 en SKW. 99 . Er werden drie verschillende glycosyltransferases uit celsuspensiecultures van L. Het moleculair-biologisch en genetisch onderzoek dat met twee Europese Linum-soorten is uitgevoerd draagt bij aan een beter begrip van de lignaanbiosynthese. Deze cellijnen zijn minder gevoelig voor cytostatica vanwege een hoge expressie van het eiwit BCR-ABL (‘fusion oncoprotein’. Justicine is een arylnaftaleen-lignaan met cytotoxische. flavum. Wij concluderen dat het fytochemische onderzoek van de twee Indonesische planten en het onderzoek naar de productie van liganen in celsuspensiecultures de verdere ontwikkeling van jamu wetenschappelijke ondersteunen. Wij trachtten CAGT uit celsuspensiecultures van L. Daarnaast hebben wij de cyotoxische werking van justicidine B bestudeerd tegen drie humane chronische myeloïde leukemie cellijnen. De biotechnologische benadering kan ook worden toegepast om medicinale planten te gebruiken als bron voor geneesmiddelontwikkeling. flavum te kloneren en tot expressie te brengen in de bacterie Escherichia coli (Hoofdstuk 7). antiprotozoaire en bloedplaatjesaggregatieremmende eigenschappen. antivirale. een non-receptor tyrosinekinase).1 M (K-562) en 1. flavum in E. gaf respectievelijk 50% en 40% homologie. niet mogelijk.) & + % . De IC50-waarden (continue incubatie in de MTT-assay) van justicidine bedroegen 1. De kwaliteit van het geïsoleerde RNA was voldoende om cDNA te maken.

100 .

Beberapa contoh diantaranya: obat anti kanker (podophyllotoxin.2 mg g-1 berat kering). urinaria. yaitu Piper cubeba. dengan fokus pada tumbuhan obat Indonesia Penggunaan tumbuh-tumbuhan. Banyak obat modern diturunkan dari tumbuhan yang pada awalnya ditemukan melalui penggunaannya secara tradisional. diare. Kultur sel dari P. tumbuhan asli. Produksi jamu telah berkembang dari skala industri rumah tangga ke skala industri yang lebih besar. malaria. taxol). enteritis dan asma. hipertensi dan kelainan menstruasi. niruri dapat menstimulasi peningkatan produksi cubebin dimetileter hingga 0. yang betanggung jawab terhadap aktivitas biologinya. Satu diantaranya adalah senyawa baru yaitu cubebin dimetilleter dan senyawa baru untuk P. Penambahan dua senyawaantara untuk biosintesis lignan pada kultur sel P. disentri. pendeketan bioteknologi. konstipasi. makanan tabahan dan bahan baku kosmetik telah berlangsung sejak lama dan terus berkembang sampai sekarang. Biji dari tumbuhan ini digunakan untuk mengobati gonore. toksikologi dan uji klinis serta berbagai isu etika seperti hak kekayaan intelektual. sifilis. farmakologi. Phyllanthus niruri (meniran) adalah salah satu tumbuhan obat yang sering digunakan untuk jamu. Pada tesis ini dimuat studi tentang aspek fitokimia dan bioteknologi terhadap senyawa aktif lignan dari dua tumbuhan obat yang digunakan di Indonesia yaitu Phyllanthus niruri L (Euphorbiaceae) dan Piper cubeba L(Piperaceae) dan dua tumbuhan obat dari Eropa yaitu Linum flavum L dan Linum leoni F. Jamu adalah obat tradisional di Indonesia yang dibuat dari tumbuhan dan digunakan oleh masyarakat Indonesia semenjak beberapa abad yang lalu untuk memelihara kesehatan dan mengobati penyakit. kultur kalus. nefralgia. niruri menghasilkan senyawa lignan. Perkembangan ilmu pengetahuan dan teknologi menstimulasi pengembangan tumbuhan obat sebagai sumber yang berguna untuk penemuan obat. akar dan biji dari P. Tiga belas lignan ditemukan pada 101 . Tinjauan ini mencakup berbagai aspek termasuk fitokimia.1 mg g-1 berat kering) dan urinatetralin hingga 0. dalam pengobatan berbagai penyakit.5 mM). metabolomik. proteomik dan genomik sekarang sudah diaplikasikan dalam penelitian tumbuhan obat dan memberikan kontribusi yang besar dalam pengembangan tumbuhan obat.Ringkasan (Indonesian) Studi fitokimia dan biosintesis lignan. Pendekatan ini sudah digunakan diseluruh dunia untuk mengatasi permasaalahan yang sering muncul dalam pengembangan tumbuhan obat. ekstrak dan senyawa kimia dari tumbuhan serta turunannya. yaitu urinatetralin (lihat Bab 3).5 mM) dan asam kafeat (0. vinblastin. Karena nilai klinis dan ekonomis dari jamu sekarang terus meningkat di Indonesia. diare. maka dibutuhkan bukti-bukti ilmiah dan penelitian lanjut terhadap tumbuhan obat. cubeba dibuat dan dibandingkan dengan menggunakan khromatografi gas (GC). Dua senyawaantara tersebut adalah asam ferulat (0. Senyawa lignan adalah metabolit sekunder yang penting pada tumbuhan ini. P. Jamu harus dikembangkan untuk menjamin aktifitas farmakologi dan keamanannya. Permasaalah tersebut diantaranya rendahnya kandungan senyawa berkhasiat dari tumbuhan obat dan standardisasinya.W. Daun meniran digunakan untuk mengobati epilepsi. obat penguat jantung (digoxin). khromatografi gas-spektrometer masa (GC-MS) dan khromatografi cair tegangan tinggi (HPLC) (Bab 4). niruri tetapi telah dilaporkan sebelumnya dari tumbuhan lain. demam dan tetanus. Schulz (Linaceae). Seluruh bagian dari tumbuhan ini digunakan untuk mengobati gonore. Metoda analitik modern. dan obat demam (aspirin).7 mg g-1 berat kering (kontrol sel hanya 0. niruri. Dua senyawa lignan yang tidak ditemukan sebelumnya dari tumbuhan ini berhasil diisolasi dan dimurnikan. secara komprehensif dimuat pada Bab 2. vincristine.3 mg g-1 berat kering (control sel hanya 0. daun dan batang P. Profil senyawa lignan dari biji. Tinjauan pustaka tentang penelitian-penelitian yang dilakukan terhadap tumbuhan yang digunakan untuk memproduksi jamu. sakit pada perut. pembagian keuntungan dan konservasi. Lignan juga ditemukan dari tumbuhan obat lainnya yang digunakan untuk jamu. Kedua tumbuhan Indonesia tersebut digunakan sebagai komponen jamu. Terdapat perbedaan yang signifikan secara kuanlitatif dan kuantitatif antara profil senyawa lignan dari kultur sel. anti malaria (quinine dan artemisinin). sifilis.

Penelitian lanjutan untuk memahami fungsi enzim CAGT adalah cloning CAGT dari kultur suspensi sel L. flavum. seperti terlihat pada aktivitas ekstrak sel terhadap coniferil alkohol. Copaene. Beberapa gen pengkode glucosyltransferase adalah kandidat yang cocok untuk disisipkan kedalam tanaman untuk tujuan peningkatan kualitas makanan. Studi terhadap biosintesis lignan dilakukan dengan menggunakan tumbuhan Eropa. flavum dengan menggunakan natrium etilendiamina tetraasetat (Na2EDTA) dan senyawa penghambat enzim glucosylrasnferase lainnya.2% dan 17. Pada Bab 5 dimuat hasil penelitian terhadap komposisi minyak atsiri dari P. Jumlah total monoterpen dari minyak yang diperoleh dari biji dan daun hampir sama. Monoterpen utama dari biji dan daun adalah -thujene. Aktivitas CAGT yang dihambat akan mengurangi produksi coniferin. E-caryophyllene. and -cadinene adalah sesquiterpen utama dari daun. proteksi lambung.56 mg g-1 berat kering. Tiga glucosyltransferase telah berhasil di kloning dari kultur suspensi sel L.9%. Kesimpulan ini dapat dijadikan dasar untuk pengembangan lebih lanjut sehingga P. flavum pada E. Pengurangan produksi coniferin berkorelasi dengan berkurangnya aktivitas CAGT. Minyak atsiri biasanya digunakan sebagai bahan pembuat kosmetik serta untuk tujuan pengobatan. Berdasarkan hasil penelitian terhadap lignan dan minyak atsiri dari P. anti herpes simplex. Beberapa aktifitas farmakologi dari minyak atsiri adalah sebagai antimikroba. Mekanisme penghambatan terhadap CAGT masih belum jelas. Glcosyltransferas ini di analisis menggunkan perangkat lunak MegAline dari DNASTAR Inc.%. lebih dari tiga kali lipat dibanding kultur control. Kotak PSPG dipercayai sebagai representasi dari sisi yang berikatan dengan nukleotida difosfat. Daerah lestari. flavum pada Escherichia coli (Bab 7). Destilasi air dari biji P. sedangkan dari daun 63 komponen dengan jumlah 78. Coniferil alkohol juga digunakan untuk pembentukan senyawa 6-MPT melalui jalur biosintesis yang berbeda dengan coniferin. sedangkan E-caryophyllene. obat jantung.biji. cubeba. lima belas pada daun dan lima pada batang. Produksi coniferin pada kultur suspensi sel L. -elemene. -pinene. teniposide dan etopophos menstimulasi penelitian terhadap lignan. sehingga jumlah coniferil alkohol meningkat. daun dari tumbuhan ini juga dapat dimanfaatkan untuk tujuan pengobatan. yaitu 17. cubeba bisa dijadikan untuk pengobatan rasional (fitofarmaka). and caryophyllene adalah sesquiterpen utama dari minyak atisiri biji. hasil pertanian dan untuk memahami biosintesis bahan alam yang berguna sebagai obat.0% dari minyak atsiri. Satu forward dan satu reverse degenerated primer didisain berdasarkan daerah lestari seratus glucosyltransferase dari berbagai spesies tumbuhan. Daerah ini juga didefenisikan sebagai sisi aktif enzim glucosyltransferase dari hewan dan mikroorganisme. Hasil isolasi total RNA menunjukkan kualitas yang cukup untuk sintesis cDNA. sebesar 63. termasuk turunan podofilotoksin lainnya dan produk antara dari biosintesis lignan. 102 . Pada Bab 6 ditulis studi tentang peningkatan produksi 6-metoksipodofilotoksin (6-MPT) dan penurunan produksi coniferin pada kultur suspensi sel dari L. Linum flavum L. Penggunaan podofilotoksin sebagai bahan dasar untuk produksi obat antikanker etoposide. akumulasi coniferil alkohol ini bisa digunakan sebagai bahan antara untuk produksi senyawa 6-MPT. and limonene. Dari biji dapat diidentifikasi 105 komponen. sabinene.1% dari minyak atsiri. Na2EDTA menghambat produksi coniferin sampai 88% dan di sisi lain meningkatkan produksi 6-MPT sampai 0. Pemurnian sampai pada tingkat 100% sangat sulit karena ketidakstabilan enzim. Dua diantaranya telah memiliki urutan nukleotida lengkap (ORF) yaitu CAGT A dan CAGT B. Ini menunjukkan bahwa Na2EDTA menghambat CAGT dan oleh karena itu mengurangi produksi coniferin.8% dan dari daun 0. Trans-sabinenhidrat adalah komponen utama dari fraksi monoterpen teroksigenasi. yang dikenal dengan kotak PSPG. antijamur. Sebaliknya. sangat khas dan ada di semua glucosyltransferase yang berperan dalam biosintesis bahan alam. cubeba dapat disimpulkan bahwa selain dari biji. cubeba menghasilkan minyak atsiri sebanyak 11. Enzim coniferil alkohol glucosyltransferase (CAGT) menjadi katalis pembentukan senyawa coniferin dengan menggunakan coniferil alkohol sebagai substrat. Untuk studi lebih lanjut terhadap peran CAGT dalam biosintesis lignan telah dilakukan pemurnian parsial enzim ini dari kultur suspensi sel L. coli. flavum sangat besar yaitu 12% dari berat kering.

sebuah senyawa sitotoksik ariltetralin lignan pada kultur sel dan akar rambut dari Linum leonii.5 µM untuk sel LAMA-84. Sedangkan studi rekayasa genetik pada dua spesies Linum memberikan kontribusi untuk penelitian tumbuhan obat. Pendekatan bioteknologi dapat pula diaplikasikan dalam upaya menggunakan tumbuhan obat sebagai sumber penemuan obat baru. Sedangkan kotak PSPG box dari CAGT A dan B menunjukkan 80% dan 89% homolog. Pada Bab 8 dijelaskan produksi justicidin B. yang menunjukkan respon yang lebih rendah terhadap obat sitotoksik karena ekspresi yang tinggi dari protein BCR-ABL (tirosin kinase non reseptor). Walaupun ekspresi dari kedua gen ini belum berhasil dilakukan. dapat disimpulkan bahwa sekurangnya satu dari dua CAGT berperan dalam tahap biosintesis dari coniferil alkohol untuk pembentukan coniferin pada kultur suspensi sel L. Dapat disimpulkan bahwa studi fitokimia dari dua tumbuhan obat Indonesia. Nilai IC50 sebanding dengan obat antikanker etoposide. K-562 dan leukimia limfoid kronis (SKW). flavum.2. berturut-turut. Penjajaran CAGT A dan CAGT B dengan beberapa glucosyltransferase dari berbagai tumbuhan berdasarkan basis data. Kultur akar rambut dihasilkan dari transformasi genetik menggunakan Agrobacterium rhizogenes 15834 strain (tipe agropin). K-562 dan SKW yang diturunkan dari leukimia kronis dari manusia. juga produksi lignan pada kultur suspensi sel pada tesis ini memberikan pendekatan ilmiah lanjut untuk pengembangan jamu. Di samping itu. penelitian terhadap efek sitotoksik justicidin B terhadap tiga sel LAMA-84. 6. Sedangkan urutan lengkap dari CAGT C belum berhasil diidentifikasi. Leoni.- * + . Akar rambut yang dimodifikasi secara genetik menghasilkan produksi justicidin B (10 mg g-1 berat kering) lima kali lipat lebih tinggi bila dibandingkan dengan kalus kontrol. rhizogenes pada kultur akar rambut diperiksa dengan PCR. Pada produk PCR ditunjukkan bahwa gen rol A dan rol C ditemukan pada kultur akar rambut L. IC50 dari justicidin B adalah 1. 103 . Analisis filogenetik menunjukkan bahwa CAGT A dan B tergolong ke dalam subfamili yang sama dengan fenilpropanoid glucosyltransferase yang lain. berturut-turut.1 dan 1. Keberhasilan transformasi gen ini dari A. Produk yang dikode oleh gen rol A dan rol C mempunyai efek sinergis pada induksi akar dan meningkatkan sensitifitas auxin. khususnya dalam memahami biosintesis lignan sebagai salah satu golongan metabolit sekunder penting untuk aktifitas farmakologi. menunjukkan 50% dan 40% homolog berturut-turut. Hasil ini menunjukkan bahwa teknik ini dapat digunakan untuk meningkatkan akumulasi justicidin B.

104 .

. 101-110 Alen. A... 6th ed. E.J. G.. J.. Venkateswarlu. S. 623-628 Alarcon-Aguilara.R. 43. Antinematodal activity of some tropical rainforest plants against the pinewood nematode. M.. R. Study of the anti-hyperglycemic effect of plants used as antidiabetics. Kumar. Tetrahedron. L. Contreras-Weber. Saad..L. Flores-Saenz. Bursaphelenchus xylophilus. 2005.. Hypoglycaemic activity of Alpinia galanga rhizoma and its extracts in rabbits. Nitoda. 1973. Morrison. 102. L.M..S. 403-407 Ali. 37.L. 2. T. 2003.C.S. Ramaiah. Bharti. T. B. Biological basis for the use of botanicals in osteoarthritis and rheumatoid arthritis: A review. L.. Kanzaki. Journal of Ethnopharmacology. 1998. 29.. 2002..B. 73.. Safan. M.. Nair. 28.. S. K. Tetrahedron.J... P. A.. Kuttan. 61. 363-398 Ahmed. 1966 Staatsuitgeverij. p.A.S. Zeitschrift für Naturforschung C (A Journal of Biosciences). R.. K.S. B. 72 Antony. S. 1291-1298 Anonymous. 239-245 Aruna. 1763-1772 Altman.R. Haqqi. Identification of Essential Oil Components by Gas Chromatography/Mass Spectroscopy. Sivaramakrishnan. 291-303 Arambewela. Crystalline constituents of Euphorbiaceae. 23. 2nd printing. Arawwawala.C. R. ‘s-Gravenhage. Malik.. A.References Adams. F. Phytotherapy Research. Ramachandra.A. Nederlandse Farmacopee.. Y.H. Illinois. Anticancer potential of curcumin: preclinical and clinical studies. Isolation and structural elucidation of 3 new lignans from leaves of Phyllanthus niruri Linn. Nakajima.. 1981. Baba. 18. Anuntiyo.. Evaluation of a method to determine the natural occurrence of aflatoxins in commercial traditional herbal medicines from Malaysia and Indonesia. Hypoglycaemic effect of stigmast-4-en-3one and its corresponding alcohol from the bark of Anacardium occidentale (Cashew)...D. Kawazu. Food and Chemical Toxicology. 2005.M. Roman-Ramos. Carol Stream. Perez-Gutierrez. 2004. R. Antidiabetic activities of aqueous and ethanolic extracts of Piper betle leaves in rats. C. Aguilar-Contreras.T.A. M.G.... K. M. C. Marcussen. J. M. Nakajima.S. Malemud. 44. Immunomodulatory activity of curcumin. N. 2001... T. 2000. N. Immunological Investigations. N.R.. 3641-3652 Anjaneyulu.. 12. Ratnasooriya. A.. 953-956 105 . 1998. Kuttan.. Journal of Ethnopharmacology. 2001 Aggarwal. Anticarcinogenic effects of some Indian plant-products... 2531-2538 Anjaneyulu... 2005. K.J. Effects of a ginger extract on knee pain in patients with osteoarthritis. Allured Publishing Corporation. S. Fitoterapia. L. 1999. V.Y. A... R.. 55. New Lignans from the heartwood of Cleistanthus collinus. Khan. Yoshizawa.. 301-308 Akhtar. W.D.. Row... Evidence-Based Complementary and Alternative Medicine. Anticancer Research.C. 295-299 Alexander-Lindo. R. Food and Chemical Toxicology.. Hashim.D.. Subrahmanyam.M. H.. Rao. K.R.. Arthritis and Rheumatism.P..

Baba, A., Kawamura, N., Makino, H., Ohta, Y., Taketomi, S., Sohda, T., 1996. Studies on diseasemodifying antirheumatic drugs: synthesis of novel quinoline and quinazoline derivatives and their anti-inflammatory effect. Journal of Medicinal Chemistry, 39, 5176-5182 Bachmann, T.L., Ghlia, F., Thorssell, K.G.B., 1993. Lignans and lactones from Phyllanthus anisolobus. Phytochemistry, 32, 189-191 Backer, C.A., Van den Brink, R.C.B., 1968. Flora of Java, NVP Noordhoff, Groningen, p.168-170 Backer, C.A., Van den Brink, R.C.B., 1968. Flora of Java. NVP Noordhoff, Groningen, p. 466-469 Badheka, L.P., Prabhu, B.R., Mulchandani, N.B., 1986. Dibenzylbutyrolactone lignans from Piper cubeba. Phytochemistry, 25, 487-489 Badheka, L.P., Prabhu, B.R., Mulchandani, N.B., 1987. Lignans of Piper cubeba. Phytochemistry, 26, 2033-2036 Bastos, J.K., Carvalho, J.C.T., de Souza, G.H.B., Pedrazzi, A.H.P., Sarti, S.J., 2001. Anti-inflammatory activity of cubebin, a lignan from the leaves of Zanthoxyllum naranjillo Griseb. Journal of Ethnopharmacology, 75, 279-282 Beers, S.J., 2001. Jamu, the ancient Indonesian art of herbal healing. Periplus Editions (HK) Ltd. Bendjeddou, D., Lalaoui, K., Satta, D., 2003. Immuno stimulating activity of the hot water-soluble polysaccharide extracts of Anacyclus pyrethrum, Alpinia galanga and Citrullus colocynthis. Journal of Ethnopharmacology, 88, 155-160 Berim, A., Spring, O., Conrad, J., Maitrejean, M., Boland, W., Petersen, M., 2005. Enhancement of lignan biosynthesis in suspension cultures of Linum nodiflorum by coronalon, indanoyl-isoleucine and methyl jasmonate. Planta, 222, 769-776 Bermawie, N., Hernani, Suwijo, P., Kardono, L.B.S., 2005. Approaches for sustainable utilization of biodiversity of medicinal and aromatic plants in Indonesia. http://www.ics.trieste.it//Documents/Downloads/df3204.pdf Bhat, G.P., Surolia, N., 2001. In vitro antimalarial activity of extracts of three plants used in the traditional medicine of India. American Journal of Tropical Medicine and Hygiene, 65, 304-308 Borsato, M.L.C., Grael, C.F.F., Souza, G.E.P., Lopes, N.P., 2000. Analgesic activity of the lignans from Lychnophora ericoides. Phytochemistry, 55, 809-813 Bouttier, S., Fourniat, J., Garofalo, C., Gleye, C., Laurens, A., Hocquemiller, R., 2002. β-lactamase inhibitors from Anacardium occidentale. Pharmaceutical Biology, 40, 231-234 Bowles, D., Isayenkova, J., Lim, E.K., Poppenberger, B., 2005. Glycosyltransferases: managers of small molecules. Current Opinion in Plant Biology, 2005, 8, 254-263 Bradford, M.M., 1976. A rapid and sensitive methode for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72, 248-254 Bunpo, P., Kataoka, K., Arimochi, H., Nakayama, H., Kuwahara, T., Bando, Y., Izumi, K., Vinitketkumnuen, U., Ohnishi, Y., 2004. Inhibitory effects of Centella asiatica on azoxymethaneinduced aberrant crypt focus formation and carcinogenesis in the intestines of F344 rats. Food and Chemical Toxicology, 42, 1987-1997 Caksen, H., Odabas, D., Akbayram, S., Cesur, Y., Arslan, S., Uner, A., Oner, A.F., 2003. Deadly nightshade (Atropa belladonna) intoxication: an analysis of 49 children. Human & Experimental Toxicology, 22, 665-668 106

Calabrese, C., Berman, S.H., Babish, J.G., Ma, X.F., Shinto, L., Dorr, M., Wells, K., Wenner, C. A., Standish, L.J., 2000. A phase I trial of andrographolide in HIV positive patients and normal volunteers. Phytotherapy Research, 14, 333-338 Calixto, J.B., Santos, A.R.S., Filho, V.C., Yunes, R.A., 1998. A review of the plants of the genus Phyllanthus: Their chemistry, pharmacology and their therapeutic potential. Medical Research Review, 18, 225-258 Campos, A.H., Schor, N., 1999. Phyllanthus niruri inhibits calcium oxalate endocytosis by renal tubular cells: its role in urolithiasis. Nephron, 81, 393-397 Cesarone, M.R., Incandela, L., De Sanctis, M.T., Belcaro, G., Bavera, P., Bucci, M., Ippolito, E., 2001. Evaluation of treatment of diabetic microangiopathy with total triterpenic fraction of Centella asiatica: A clinical prospective randomized trial with a microcirculatory model. Angiology, 62, S49-S54 Chander, R., Srivastava,V., Tandon, J.S., Kapoor, N.K., 1995. Antihepatotoxic activity of diterpenes of Andrographis paniculata (Kal-Megh) against Plasmodium berghei-induced hepatic damage in Mastomys natalensis. International Journal of Pharmacognosy, 33, 135-138 Chang, C.C., Lien, Y.C., Liu, K.C.S., Lee, S.S., 2003. Lignans from Phyllanthus urinaria. Phytochemistry, 63, 825-833 Channa, S., Dar, A., Ahmed, S., Atta’ur Rahman, 2005. Evaluation of Alstonia scholaris leaves for broncho-vasodilatory activity. Journal of Ethnopharmacology, 97, 469-476 Chattopaday, S., Srivastava, A.K., Bhojwani, S.S., Bisaria, V.S., 2002. Production of podophyllotoxin by plant cell cultures of Podophyllum hexandrum in bioreactor. Journal of Bioscience & Bioengineering, 93, 215-220 Chattopadhyay, D., Arunachalam, G., Ghosh, L., Mandal, A.B., 2004. CNS activity of Alstonia macrophylla leaves extracts: an ethnomedicine of Onge of Bay Islands. Fitoterapia, 75, 673-682 Chattopadhyay, I., Biswas, K., Bandyopadhyay, U., Banerje, R.K., 2004. Turmeric and curcumin: biological actions and medicinal applications. Current Science, 87, 44-53 Cheenpracha, S., Karalai, C., Ponglimanont, C., Subhadhirasakul, S., Tewtrakul, S., 2006. Anti-HIV-1 protease activity of compounds from Boesenbergia pandurata. Bioorganic & Medicinal Chemistry, 14, 1710-1714 Chen, C.C., Hsin, W.C., Ko, F.N., Huang, Y.L., Ou, J.C., Teng, C.M., 1996. Antiplatelet arylnaphthalide lignans from Justicia procumbens. Jornal of Natural Products, 59,1149-1150 Chen, J.Y., Liu, P.Y., Chen, J.H., Lin, L.J., 2004. Safety of transvenous temporary cardiac pacing in patients with accidential digoxin overdose and symptomatic bradycardia. Cardiology, 102, 152155 Cheng, C.L., Guo, J.S., Luk, J., Koo, M.W.L., 2004. The healing effects of Centella extract and asiaticoside on acetic acid induced gastric ulcers in rats. Life sciences, 74, 2237-2249 Chi, C.W., Chang, Y.F., Chao, T.W., Chiang, S.H., Peng, F.K., Lui, W.Y., Liu, T.Y., 1994. Flowcytometric analysis of the effect of berberine on the expression of glucocorticoid receptors in human hepatoma hepg2 cells. Life Sciences, 26, 2099-2107 Chithra, V., Leelamma, S., 2000. Coriandrum sativum - effect on lipid metabolism in 1,2-dimethyl hydrazine induced colon cancer. Journal of Ethnopharmacology, 71, 457-463 107

Choi, E.M., Hwang, J.K., 2003. Investigations of anti-inflammatory and antinociceptive activities of Piper cubeba, Physalis angulata and Rosa hybrida. Journal of Ethnopharmacology, 89, 171-175 Choi, E.M., Hwang, J.K., 2005. Effect of some medicinal plants on plasma antioxidant system and lipid levels in rats. Phytotherapy Research, 19, 382-386 Choi, E.M., Hwang, J.K., 2005. Screening of Indonesian medicinal plants for inhibitor activity on nitric oxide production of RAW264.7 cells and antioxidant activity. Fitoterapia, 76, 194-203 Chong, J., Baltz, R., Fritig, B., Saindrenan, P., 1999. An early salicylic acid-, pathogen- and elicitorinducible tobacco glucosyltransferase: role in compartmentalization of phenolics and H2O2 metabolism. FEBS Letter, 458, 204-208 Chong, J., Baltz, R., Schmitt, C., Beffa, R., Fritig, B., Saindrenan, P., 2002. Downregulation of a pathogen-responsive tobacco UDP-Glc: phenypropanoid glucosyltransferase reduces scopoletin glucoside accumulation, enhance oxidative stress, and weakens virus resistance. Plant Cell, 14, 1093-1107 Chrubasik, S., Pittler, M.H., Roufogalis, B.D., 2005. Zingiberis rhizoma: A comprehensive review on the ginger effect and efficacy profiles. Phytomedicine, 12, 684-701 Chularojmontri, L., Wattanapitayakul, S.K., Herunsalee, A., Charuchongkolwongse, S., Niumsakul, S., Srichairat, S., 2005. Antioxidative and cardioprotective effects of Phyllanthus urinaria L. on doxorubicin-induced cardiotoxicity. Biological & Pharmaceutical Bulletin, 28, 1165-1171 Coon, J.T., Ernst, E., 2002. Panax ginseng: A systematic review of adverse effect and drug interactions. Drug Safety, 25, 323-344 Coutinho, P.M., Deleury, E., Davies, G.J., Henrissat, B., 2003. An evolving hierarchical family classification for glycosyltransferases. Journal of Molecular Biology, 328, 307-317 Cragg, G.M., Newman, D.J., 2005. Plants as a source of anti-cancer agents. Journal of Ethnopharmacology, 100, 72-79 Da Silva, R., De Souza, G.H.B., Da Silva, A.A., De Souza, V.A., Pereira, A.C., Royo, V.D., Silva, M.L.A.E., Donate, P.M., Araujo, A.L.S.D., Carvalho, J.C.T., Bastos, J.K., 2005. Synthesis and biological activity evaluation of lignan lactones derived from (-)-cubebin. Bioorganic & Medicinal Chemistry Letters, 15, 1033-1037 Dawkins, G., Hewitt, H., Wint, Y., Obiefuna, P.C.M., Wint, B., 2003. Antibacterial effects of Carica papaya fruit on common wound organisms. West India Medical Journal, 52, 290-292 Day, S.H., Chiu, N.Y., Won, S.J., Lin, C.N., 1999. Cytotoxic lignans of Justicia ciliate. Journal of Natural Products, 62, 1056-1058 De Clercq, E., 2000. Current lead natural products for the chemotherapy of human immunodefiency virus (HIV) infection. Medicinal Research Review, 20, 323-349 De Mejia, E.G., Ramirez-Mares, M.V., Arce-Popoca, E., Wallig, M., Villa-Trevino, S. 2004. Inhibition of liver carcinogenesis in Wistar rats by consumption of an aqueous extract from leaves of Ardisia compressa. Food and Chemical Toxicology, 42, 509-516 De Sanctis, M.T., Belcaro, G., Incandela, L., Cesarone, M.R., Griffin, M., Ippolito, E., Cacchio, M., 2001. Treatment of edema and increased capillary filtration in venous hypertension with total triterpenic fraction of Centella asiatica: A clinical, prospective, placebo-controlled, randomized, dose-ranging trial. Angiology, 52, S55-S59 108

C.. C.B.. V.. Xu. S. V. A. 145-150 Eno.H. Bioorganic & Medicinal Chemistry Letters. Immunology Investigations. Li. Sticher.E. Gao. Anti-malarial activity of some xanthones isolated from the roots of Andrographis paniculata.. S. B. Leaman.. 420-424 Giri.. in mice. Antitumor activity and underlying mechanisms of ganopoly. R. E. 2004.E. B.. J. M. Zhou. 50. H.C. Susiarti. Pras.L. Pereira.E. Bhatanager. Graham. 235-239 Ernst.H. Medicinal Herb Index in Indonesia..E. Royo.. U.. Tobler.. O. Blood pressure depression by the fruit juice of Carica papaya (L.T. the refined polysaccharides extracted from Ganoderma lucidum. S. D. Yang. H. A. Plant Physiology..D. Donate. Roy. V.. G. The use of plant cell cultures for the production of podophyllotoxin and related lignans. Saraiva... Hypolipidemic effect of Cuminum cyminum L. S..H.P. N.. Arnason. W.De Souza. R.J. Petersen.. D. E. N. Freitas.. Subramanian. 2003. A. A...I.. Phytotherapy Research.The Netherlands. O. B. Namasivayam.. Irawati. Oseroff.A.. De Souza. Grando.. Ellis. Joshi..) in renal and DOCA-induced hypertension in the rat. Trypanocidal activity of (-)-cubebin derivatives against free amastigote forms of Trypanosoma cruzi.. 303-307 Dhandapani. Journal of Ethnopharmacology. Pandey.. Risks associated with herbal medicinal products. V. Lan. P. 17-26 109 .. R. Miller. 34. Pittler. E. Chan. R. S..... Smith.K.... M... Sharma. M. V... 2nd ed. Khaja.K. Bastos. J. 829-834 Gamborg.E. C. 89. 2000.. Sharma. Montanheiro. Schor.. Da Silva.. 2005. 2002. J.. 183-189 Ficker. Rajagopal. V. R.. Jakarta Empt. Brun.. Journal of Organic Chemistry.L.. J.D.T. C. 15. R.. 2000.. M... M. Owo.. Narasu.. M. 69.. X. 151-158 Gao. 331-339 Dobhal. Antifungal. Tang. 95. 85.L..K. Huang.C.. 74. ‘s-Hertogenbosch.. M.A.Y.. A. Cytotechnology. M. R.A.B. R. J. Structural modifications of plumieride isolated from Plumeria bicolor and the effect of these modifications on in vitro anticancer activity. Xu.. W. Qjha. 2000. J.C..P. Duan. 2003.. 247-251 Eisei Indonesia PT. Li. Devi.. J.. C.H...J.. A. Boim.K. Wiener Medizinische Wochenschrift 152.T. 1968. U International.. A. S. 171-198 Gertsch. Planta Medica. 107.M. Pharmacological Research. J. M.. 1995. Konya. A. Experimental Cell Research. Itam. 46. M. Alferman.W. Joshi. O.. Carlson. A.D. M.P.A. Heilmann.. N.. cytotoxic and piscicidal properties of Justicidin B and a new arylnaphthalide lignan from Phyllanthus piscatorum. A β-glucosidase from lodgepole pine xylem specific for the lignin precursor coniferin. Albuquerque. 289-293 Flavor & Fragrance Library Shimadzu Benelux. S. Gryshuk.. G. Production of podophyllotoxin from Podophyllum hexandrum : a potential natural product for clinically useful anticancer drug. antiprotozoal..F.. 2002. Inhibition of human pathogenic fungi by members of Zingiberaceae used by the Kenyah (Indonesian Borneo).L.L. Journal of Ethnopharmacology. Oijama. Valecha. N. 6165-6172 Dua...C. 14. 2004.K. A. Journal of Applied Botany.. Da Silva.S. Subbatao. on alloxan-induced diabetic rats.L.A.U. Silva. 34..M. Y. 1995. Y.. 69... Nutrient requirements of suspension cultures of soybean root cells. M. 2002. The effect of Phyllanthus niruri on urinary inhibitors of calcium oxalate crystallization and other factors associated with renal stone formation. 2005. A. 251-255 Dharmawardhana. PT Eisei Indonesia.P.. Bhatnagar.

Journal of Ethnopharmacology. 180-185 Harmatha. sources.C. 1995.. H. C. Chang. McWilliam. G. P. J. 1995... 2004. Miyashiro. Screening of 25 compounds isolated from Phyllanthus species for anti-human hepatitis B virus in vitro. Sathish. 58.. 36.W. G. Developmentally related responses of maize catalase genes to salicylic acid. J. Shibahara.C. Chu. Antioxidant activity and hepatoprotective potential of Phyllanthus niruri. L.. N. Sumatra. 75-95 Guan.. Garcia.. Chen.. T. Cardiology . 1992. Hososda. M.. Compositae) (in Indonesian). A.K.. J. 2005.. M. Gray. N.. Wahyuono.Gnanapragasam..G. Proceeding of National Academic Sciences. Ream. J. 98. Podophyllotoxin: distribution. Devaki. Ernst. E. Inhibitory effects of Sudanese medicinal plant extracts on hepatitis C virus (HCV) protease. P. R. Miguel del Corral.H. 33. M.S. Antibacterial and antifungal activity of Indonesian ethnomedical plants.. fam. P.. D. L. 2006.1. applications and new cytotoxic derivatives. C. Patnaik.. Hsu.M. 28. Y. P. A. P.. Phytotherapy Research.L. Uses..S.. Manulis.W..W. D. Applied Environmental Microbiology. H.P.M. Insect feeding deterrent activity of lignans and related phenylpropanoids with a methylenedioxyphenyl (Piperonyl) structure moiety. Y. Govindaraju. The safety of herbal medicinal products derived from Echinacea species: A systematic review. Ohtaki.. Khasanah. Y.A.. E.. Nakamura. Identification of antimicrobial compound in volatile oil of the tagetes leaves (Tagetes erecta L... Y.A. Ou. Supriono.. Nguyen. 5930-5934 Gupta. Chen. 61. American Journal of Chinese Medicine. M. Isolintetralin : a new lignan from Phyllanthus niruri. Drug Safety. Phytotherapy research. Ebenezar. N.L.C. Misu... Shimotohno.. Medicinal-plants from Riau province. V. 2003. Food Chemistry. Sasaki.. R. 10.. 1998. Moore. S. 218 Harish.K. 2004.. Gomez-Zurita. Tandon.. 2879-2884 Huang. 40-47 Hass. 473-474 Huntley. D. J. Huang.. F. N.. M.. 2002. Ou.. 387-400 Hussein. Entomologia Experimentalis et Applicata. E. C.L. S. 2005.. Anti-allergic activity of andrographolides isolated from Andrographis paniculata (Burm F) Wall. 51-60 Hartati. Universal PCR primers for detection of phytophatogenic Agrobacterium strains. N...C.. Toxicon. Cunningham..A. 2002... Nawrot. Planta Medica.. Indonesia . 44. Shivanandappa. 92.K. J. Hattori. K. Shimada. 104. S. Pharmaceutical Biology.. Effect of Curcuma herbs on vasomotion and hemorheology in spontaneously hypertensive rat. Fushimi.. J. T. 2003. W. Fitoterapia. 441-459 Goto.. 592-596 Grosvenor. 95.. T. Sumiyoshi. 449-457 Goun.... 449-453 Huang.. 2000. H.. L. 14.. 17. 76. 45. Congestive heart failure caused by digitalis toxicity in an elderly man taking a licorice-containing Chinese herbal laxative. Gothard. A... Life Sciences. 74. Protective effect of Centella asiatica on antioxidant tissue defense system against adriamycin induced cardiomyopathy in rats. T.. Indonesian Journal of Pharmacy.L.. Kakiuchi.. K. K. J. K. C. Scandalios. 510-516 110 .. T. J.. Castro... 1999. Komatsu. Coon. G.O.. 72-74 Harada. 1995. 585-597 Gordaliza. Miles.

M.. K. T.. Effectiveness of the Kampo kami-shoyo-san (TJ-24) for tremor of antipsychotic-induced parkinsonism.. Yoshihara. 5761 Ibrahim. 1337-1340 111 . R. D. Journal of Ethnopharmacology. M. 1984. Maeyama.1.. H.. D.. 2005. M.. Effect of Alstonia scholaris in enhancing the anticancer activity of berberine in the Ehrlich ascites carcinoma-bearing mice. Dong.. Pihie.N.. 507-511 Ji.M. 31. 970-978 Jirovetz. Z. Aggarwal. Journal of Immunology.. Kudo. 53.J. Gara. Tengah.U. Isolation and characterization of a cDNA clone of UDP-glucose: anthocyanin 5-O-glucosyltransferase in Iris hollandica.... F. 2005. Nallapan M. Buchbauer. A. Z.W.H. M. L. Journal of Agricultural and Food Chemistry. Br.. Aroma compound analysis of Piper nigrum and Piper guineense essential oils from Cameroon using solid-phase microextraction-gas chromatography. Retnoningrum. 2000. Ino. Journal of Cellular Biochemistry. Murakami. Yabuya.. Funahashi. 23. 2015-2018 Ismail. N. enhances chemokine SDF-1 alpha-induced leukocytes chemotaxis. N.. 249-256 Imayama. T. H.. G. Y. I. 2004.I. Lo Cantore..T. 2001. Yamakawa. 976..S.. 95. Planta Medica. 2002.Iacobellis. Masuda. D. Yoshimatsu. Acetoxychavicol acetate..B.. K. T. 1976. W. Journal of Medical Food. a compound isolated from anti-inflammatory traditional Chinese medicine Andrographis paniculata. 235-244 Janssen. 75. Wahyuono. Kamada. 1029-1035 Jagetia.. G. Suprapta.. U. Anticancer Reasearch. 23.P. Mar’u.S. N. N.L.J. 7. 2000. Tanaka. in HeLa cells. Psychiatry and Clinical Neurosciences. Plant Cell.. B. Y.C. T... Andrograpanin. P. T..K. G. 700-708 Ichikawa. Capasso. Shimomura. 2221-2227 Iwo. 265-275 Jitoe. I. 177-183 Jackson.. 54. Z. J. 96. M. S.. Purification and properties of UDP-glucose: coniferyl alcohol glucosyltransferase from suspension cultures of Paul’s Scarlet Rose.. Baliga.. F. Soemardji. Baliga. A.A.. 2005..E. Grisebach.S. Journal of Agricultural and Food Chemistry. 2004.. The effect of seasonal variation on the antineoplastic activity of Alstonia scholaris R. H.. K. I. an antifungal component of Alpinia galanga.B. Journal of Chromatography A.. R. Wang... essential oils. Apocynaceae) bark extracts. Identification of a novel blocker of I kappa B alpha kinase that enhances cellular apoptosis and inhibits cellular invasion through suppression of NF-kappa B-regulated gene products. Nakatani. 25. 1992.. Phenolic Constituents in Tissue-Cultures of Phyllanthus niruri. Archives of Biochemistry and Biophysics. Takada. Geissler. Immunostimulating effect of Pule (Alstonia scholaris L.. Ngassoum. 40. T. Screening of several Indonesian medicinal plants for their inhibitory effect on histamine release from RBL-2H3 cells. 7383-7392 Ikawati..L.Br. F. solid-phase microextraction-gas chromatography-mass spectrometry and olfactometry... Wang.G. 1992. K. Phytochemistry 1992. Sukrasno.. 579-582 Ishimaru. Zhang. Journal of Ethnopharmacology. and Carum carvi L. A.M.. 174. A.S.. Dewick. Xanthorrhizol induces apoptosis via the up-regulation of Bax and p53 in Hela cells. Phytochemistry. P.. Antibacterial activity of Cuminum cyminum L. Scheffer. 2005. M. 167. Clinical Hemorheology and Microcirculation. 2005.C. Fukuchi-Mizutani. 1985. 37-42 Jagetia..C. Biosynthesis of Podophyllum Lignans .. L.. Antioxidant activity of tropical ginger extracts and analysis of the contained curcuminoids.B.. Senatore. 6... A... Cinnamic acid precursors of podophyllotoxin in Podophyllum hexandrum. 176. 1243-1248 Ishikawa..

J.M. 65. S. J. 2005..D. 1-7 Kim. Gratas. Journal of Natural Products.S.. 51. 53.M. L. Biosynthetic relationship of aryltetralin lactone lignans to dibenzylbutyrolactone lignans.. 117-129 Kassuya. 599-600. S. H. Rizvi. 599-604 King. L. Journal of Pharmacy and Pharmacology. J. A.B. R.. Rashmi. Shasany. a main component of the Kampo preparation Bakumondo-to (Mai-men-dong-tang).B-Verlag. Kamei. J. D. Y.D. Rapid isolation of DNA from dry and fresh samples of plants producing large amounts of secondary metabolites and essential oils... Fitoterapia. Yu. P.J.P. D. Lipid lowering activity of Phyllanthus niruri in hyperlipernic rats. Hamburg. Sahin..P. Biosynthesis of Podophyllum lignans . E. Journal of Natural Products. Cytotoxic and antimalarial constituents of the roots of Eurycoma longifolia.. J.. Lee. Kinghorn. H. against methicillin-resistant Staphylococcus aureus.D. 45-57 112 . K..P.T. Park.... R. 82. European Journal of Pharmacology. Darokar.. S. Studies on Indonesian Medicinal-Plants 2.A. F. J... 507. C. Chander.. Mizukami. Y. Antibacterial activity of Alstonia scholaris and Leea tetramera.. 1999. H. K.A. indigenous knowledge. T. H. Kinghorn. fractions and lignans isolated from Phyllanthus amarus. R. 2005.... S.T. Carlson..S. 1360-1367 Kardono. D.. A. Calixto..S. M. Padmawinata. 5. N.J.. Asano. W.. 57. Journal of Natural Products. Journal of Ethnopharmacology...P. M. P.J.R. Planta Medica. a cytotoxic principle from Justicia pectoralis. De Melo. M. Saitoh..V. C.. C. Roussakis.. Nakamura...K.. 163-168 Kamil.. The Atlas of Spectral Data of Sesquiterpene Hydrocarbons.. 25.Y.. Tsauri.H.H. In vitro and in vivo anti-inflammatory and antinociceptive effects of the methanol extract of the roots of Morinda officinalis. A. T.R. 1991.K. Justicidin B.L. Joulain.. M. Phytochemistry.J.L.. 19-22 Khanuja. 2004. Ichiki. I. H. W. Steele. Induction of apoptosis by curcumin and its implications for cancer therapy. J. A.R. 2003.H. 1986.D. J. L. König. T.G. 2005. Pharmacokinetic and pharmacodynamic profiles of the antitussive principles of Glycyrrhizae radix (licorice).. 197-202 Kardono.. Padmawinata.. A. 17. Pezzuto. Choe. K. Kumar. S. Moran. Won...4. Moulis. 1996. 2005. Seo..B. Nam.721-726 Keawpradub. Mensah. Plant Molecular Biology Reporter. Journal of Ethnopharmacology.O.. R.. drug discovery and intellectual property rights: creating reciprocity and maintaining relationships. Cytotoxic constituents of the bark of Plumeria rubra collected in Indonesia. J.. U. J. Iiduka. Dewick. Cha.C. J. 1990. 1998. Choi. You. 1988.. 690-694 Khan. Omoloso..M. 2005. Angerhofer. 1999.. 2093-2102 Kaminaga.. L.. S..S. Park. FEBS Letters. V. Leite. Kubo. 1447-1455 Karunagaran... Gleye. Planta Medica.. Pezzuto.. Y.B. K. 736-740 Khanna...K. Antiplasmodial activity of extracts and alkaloids of three Alstonia species from Thailand... Phytotherapy Research.J.. Kirby.M.K. Kihara.J. N. Anti-inflammatory properties of extracts. C.C. K. 19. Tsauri.D. 51. 71. Choi. B. 74..Joseph. G. 607-615 Kim... 567. A. Houghton. Antibacterial activity of Curcuma longa L.P. Kumar. Molecular cloning and characterization of a glucosyltransferase catalyzing glucosylation of curcumin in cultured Catharanthus roseus cells. Biological diversity..J.. Rehder. Current Cancer Drug Target.F. 2002.. 54. A..

P.H.and 2 '-benzoyloxycinnamaldehydes. Perfumer & Flavorist. Kim. 1996. Oh.W.M. 271-276 Koba. 27-32 Leaman. Ma.. D. Makins. 2005.P.J... G. Sridevi. (DC) Stapf. 1097-1099 Koulman... Rajagopal. S. I.. Ro. Koul. K. Berger. 49. 1115-1118 Kubo. C.. Journal of Ethnopharmacology. 1999. K. Efficient isolation of glycosidase inhibitory stilbene glycosides from Rheum palmatum. Kwon. I. Scandinavian Journal of Gastroenterology.H.. Soedjito. 29. Piperine from the fruits of Piper longum with inhibitory effect on monoamine oxidase and antidepressant-like activity. Konturek. Nanduri. Soetarno. I.. D. Ikenaga.B. Domschke. K. Pras.K. Han... A novel glucosyltransferase involved in steroid saponin biosynthesis in Solanum aculeatissimum. H... Alimentary Pharmacology & Therapeutics. 2004. 41.. nardus L. Taneja. R.S. Murai. 1980.. Murai. C.. R. Journal de Mycologie Medicale. Kumar. rendle and C. Yoshida. M. K. Hwang. Angerhofer... Eibl. S.. M.. D. 1992. Maczka. 1994.. S... A fast and simple GC-MS method for lignan profiling in Anthriscus sylvestris and biosynthetically related plant species. Antimicrobial activity of essential oils of Cymbopogon citratus L. H. schoenanthus L. 175-180 Kohara.P. McIntosh. Biological & Pharmaceutical Bulletin. 1999.. Roemantyo.X... N. M. Wu. S. Hwang.. 291-295 Langmead.. B. 57. Millet. J. Anti-inflammatory effects of Aloe vera gel in human colorectal mucosa in vitro.J. Journal of Natural Products. 19.. Tanaka. S.P. Journal of Ethnopharmacology. 858-862 Kubo. H.Y.. Chaumont.. S..S. Thor.H. S.. East Kalimantan. Pezzuto. 41.. W. W. Y. Hong.S.M. Han. Bos. M. Jones. H.. S.. Soediro. BCR-ABL influences the antileukaemic efficacy of alkylphosphocholines. X.. 2. 832-835 113 .. Plant Molecular Biology. S. I.. 31. Quax. Anticancer and immunostimulatory compounds from Andrographis paniculata. New trends in essential oils.. C. 1996. 225-239 Konstantinov. Screening for antitumor activity of 11 species oh Indonesian Zingiberaceae using human MCF-7 and HT-29 cancer cells... Oxygenated cyclohexanes from Piper cubeba. 1995...M.Kirana C. 65... Sanda. Park.A. Malaria remedies of the Kenyah of the Apo Kayan.S.. S.K.. K. R.. 2005..... J. 521-527 Lawrence. Spreng.. Matsuda.R.. Shoyama. C...H. 107. Sastrodihardjo.R. L. T.. 365-374 Konturek. Anti-inflammatory activities of 70% methanolic extract from Cinnamomi cortex. J. 92. Raynaud. Indonesian Borneo: A quantitative assessment of local consensus as an indicator of biological efficacy. Arnason.. Y. R. Mandin. S.W. 1-16 Lee. Y.J. Yusuf. 53.T. Dhar. H.. K.. J. 67. 2003. N. J.K. S.C. Muranaka. H. B. J. Planta Medica. G. 5. 2003. 1063-1065 Kubo.. Pharmaceutical Biology..S. 583-590 Koul..L.T. Lee. Hashimoto. 1041-1045 Kumar. S...M.M.... 263-266 Lee. Planta Medica. Nakajima.. A. 1991. Phytochemistry.K.. H. 19. British Journal of Haematology. Inhibition of human tumor growth by 2 '-hydroxy. Stoll. Rampton.A. 2001..J.S. J. B... Soetarno. Hong.. G.. Role of cholecystokinin in the control of gastric emptying and secretory response to a fatty meal in normal subjects and duodenal ulcer patients.J. Cytotoxic Anthraquinones from Rheum palmatum. 54. M. Medarde. S. 13. Soediro... Chemical & Phamaceutical Bulletin.... R. Record.V. Phytochemistry. A.. J. S. S. Kim. 2004. Sastrodihardjo. C.L. D.. Lee. J. I.

D. Kostyn.G... F. H. Bakhtiar.A. Ohashi. Journal of Agricultural and Food Chemistry.K. Journal of Agricultural and Food Chemistry. N. F.Y. Bowles.... C. Adzett. Antibacterial activity of Coriandrum sativum L.. Bohgaki.C.... Lukaszewicz. F... Phylogenetic analysis of the UDP-glycosyltransferase multigene family of Arabidopsis thaliana.. 400-405 Lorenc-Kukula. H. R. Y. McIntosh. D. an Indonesian traditional medicinal plant. 55. Lan. 24. A. Towers. 22.....X. 7862-7866 Lohezic-Le Devehat. A. Y... 617-621 Liu...S. In vitro anti-Helicobacter pylori action of 30 Chinese herbal medicines used to treat ulcer diseases. Y.Lee. A. Journal of Viral Hepatitis. vulgare (Miller) essential oils.. Watarai. 935-946 Ma’at. Q. F. Pan. 98. 2004.D..H. Amoros.J.. Proença da Cuhna.. Baldauf.. a naturally occurring anticarcinogen during the initiation..B.. International Journal of Cancer. K. M. 579. A. Fitoterapia. The antiviral action of lignans. Capasso.J. American Journal of Chinese Medicine. R. R. Xu. Antiviral and cytotoxic activities of some Indonesian plant. J. F. Juniar. Growth-inhibiting effects of Cinnamomum cassia bark-derived materials on human intestinal bacteria.C. 1989.. E.. J. 1996. Journal of Ethnopharmacology. T.. 153-164 Liu. Liou. Hsu. Jamu gendong. Bezivin.L.. G. J. Journal of Biological Chemistry. M. Tan. Zhang. K... S.. FEBS Letters.A. Korobczak. L. Boustie. 531-535 Manju. T. 201208 Lin. Identification and characterisation of Arabidopsis glycosyltransferases capable of glucosylating coniferyl aldehyde and sinapyl aldehyde.P. 63... Lin. C. Myricetin as the active principle of Abelmoschus moschatus to lower plasma glucose in streptozotocin-induced diabetic rats. J. 1083-1088 114 . T. Protective and immunomodulating effect of phyllanthus niruri's extract in the treatment of cancer. 49. Salgueiro.. Shibuya.T. 2005. 52..J.. 73.L. E.. 72 MacRae. 1998. Antihypertensive actions of methylripariochromene A from Orthosiphon aristatus. 2004. Nalini. W..W. 71. The protective effect of Alstonia scholaris R Br on hepatotoxin-induced acute liver damage. post-initiation stages of 1. 2005... A. 2802-2806 Limyati. M. Lin.. a kind of traditional medicine in Indonesia: the microbial contamination of its material and end products. Liu. 2002. Ahn.. Aksamit-Stachurska. Planta Medica. H. 46...H. Senatore. Iacobellis. C. 2019-2023 Matsubara. B. Essential oils from four Piper species. 1998.. J. De Marco.. Lin.L. Planta Medica. T. H.... 2001. Hudson. Y... J. Suzuki.. J. N.. Vila. S. 1998. Phytochemistry. K.. 8. Supriyatna. 2005... Bowles. Tomi. 329-333 Lim. S. I. S.2 dimethylhydrazine-induced colon cancer. Chemopreventive efficacy of ginger. S. S. Cheng.. 9. Szopa. Jackson. 8-12 Li. 60-67 Martins.M. Canigueral.. Glucosyltransferase: The gene arrangement and enzyme function. 2005. H..K. V. A. Casanova. and Foeniculum vulgare Miller var.. 2001. Lim. Biological & Pharmaceutical Bulletin. P. 100 (S13). S.S. D. Clinica Chimica Acta. 276. 1999.S.. 358-366 Lo Cantore. 358. 2002. Journal of Ethnopharmacology. 4338-4343 Li. Genus Phyllanthus for chronic hepatitis B virus infection: a systematic review.L. Cellular & Molecular Biology Letters.

Matsuda, H., Morikawa, T., Managi, H., Yoshikawa, M., 2003. Antiallergic principles from Alpinia galanga: Structural requirements of phenylpropanoids for inhibition of degranulation and release of TNF-alpha and IL-4 in RBL-2H3 cells. Bioorganic & Medicinal Chemistry Letters, 13, 31973202 Matsuda, H., Pongpiriyadacha, Y., Morikawa, T., Ochi, M., Yoshikawa, M., 2003. Gastroprotective effects of phenylpropanoids from the rhizomas of Alpinia galanga in rats: structural requirements and mode of action. European Journal of Pharmacology, 471, 59-67 Mehrotra, R., Rawat, S., Kulshreshtha, D.K., Patnaik, G.K., Dhawan, B.N., 1990. In vitro studies on the effect of certain natural products against hepatitis B virus. Indian Journal of Medicinal Research, 92, 133-138 Middel, O., Woerdenbag, H.J., Van Uden, W., Van Oeveren, A., Jansen, J.F.G.A., Feringa, B.L., Konings, A.W.T., Pras, N., Kellogg, R.M., 1995. Synthesis and cytotoxicity of novel lignans. Jornal of Medicinal Chemistry, 38, 2112-2117 Millonig, G., Stadlmann, S., Vogel, W., 2005. Herbal hepatotoxicity: Acute hepatitis caused by a Noni preparation (Morinda citrifolia). European Journal of Gastroenterology and Hepatology, 17, 445447 Miyakoshi, M., Yamaguchi, Y., Takagaki, R., Mizutani, K., Kambara, T., Ikeda, T., Zaman, M. S., Kakihara, H., Takenaka, A., Igarashi, K., 2004. Hepatoprotective effect of sesquiterpenes in turmeric. Biofactors, 21, 167-170 Mohagheghzadeh, A., Schmidt, T.J., Alfermann, A.W., 2002. Arylnaphthalene lignans from in vitro cultures of Linum austriacum. Journal of Natural Products, 65, 69-71 Mojica-Henshaw, M.P., Francisco, A.D., De Guzman, F., Tigno, X.T., 2003. Possible immunomodulatory actions of Carica papaya seed extract. Clinical Hemorheology and Microcirculation, 29, 219-229 Molog, G., Empt, U., Kuhlman, S., Van Uden, W., Pras, N., Alferman, A.W., Petersen, M., 2001. Deoxypodophyllotoxin 6-hydroxylase, a cytochrome P450 monooxygenase from cell cultures of Linum flavum involved in the biosynthesis of cytotoxic lignans. Planta, 214, 288-294 Moraes, R.M., Bedir, E., Barret, H., Burandt Jr., C., Canel, C., Khan, I.A., 2002. Evaluation of Podophyllum peltatum; accessions for podophyllotoxin production. Planta Medica, 68, 341-344 Morikawa, T., Matsuda, H., Yamaguchi, I., Pongpiriyadacha, Y., Yoshikawa, M., 2004. New amides and gastroprotective constituents from the fruit of Piper chaba. Planta Medica, 70, 152-159 Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. Journal of Immunology Methods, 65, 55-63. MS Library NIST107, National Institute of Standard and Technology. Murashige, T., Skoog, F., 1962. A Revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum, 15, 473-497 Mutalik, S., Chetana, M., Sulochana, B., Devi, P.U., Udupa, N., 2005. Effect of Dianex, a herbal formulation on experimentally induced diabetes mellitus. Phytotherapy Research, 19, 409-415 Nader, B.L., Cardoso, Taketa, A.T., Iturriaga, G., Pereda-Miranda, R., Villarreal, M.L., 2004. Genetic transformation of Glaphimia glauca by Agrobacterium rhizogenes and the production of norfriedelanes. Planta Medica, 70, 1174-1179 115

Naik, A.D., Juvekar, A.R., 2003. Effects of alkaloidal extract of Phyllanthus niruri on HIV replication. Indian Journal of Medical Sciences, 57, 387-393 Nawawi, A., Nakamura, N., Hattori, M., Kurokawa, M., Shiraki, K., 1999. Inhibitory effects of Indonesian medicinal plants on the infection of herpes simplex virus type 1. Phytotherapy Research, 13, 37-41 Notka, F., Meier, G., Wagner, R., 2004. Concerted inhibitory activities of Phyllanthus amarus on HIV replication in vitro and ex vivo. Antiviral Research, 64, 93-102 Ochman, H., Gerber, A.S., Hartl, D.L., 1988. Genetic applications of an inverse polymerase chain reaction. Genetics, 120, 621-623 Ogata, T., Higuchi, H., Mochida, S., Matsumoto, H., Kato, A., Endo, T., Kaji, A., Kaji, H., 1992. HIV-1 reverse transcriptase inhibitor from Phyllanthus niruri. AIDS Research and Human Retroviruses, 11, 1937-1944 Ohashi, K., Bohgaki, T., Matsubara, T., Shibuya, H., 2000. Indonesian medicinal plants. XXIII. Chemical structures of two new migrated pimarane-type diterpenes, neoorthosiphols A and B, and suppressive effects on rat thoracic aorta of chemical constituents isolated from the leaves of Orthosiphon aristatus (Lamiaceae). Chemical & Pharmaceutical Bulletin, 48, 433-435 Ojewole, J.A.O., 2004. Potentiation of the anti-inflammatory effect of Anacardium occidentale (Linn.) stem-bark aqueous extract by grapefruit juice. Methods and Findings in Experimental and Clinical Phamacology, 26, 183-188 Okazaki, Y., Iqbal, M. Okada, S., 2005. Suppressive effects of dietary curcumin on the increased activity of renal ornithine decarboxylase in mice treated with a renal carcinogen, ferric nitrilotriacetate. Biochimica et Biophysica Acta, 1740, 357-366 Okigawa, M., Maeda, T., Kawano, N., 1970. The isolation and structure of three new lignans from Justicia procumbens Linn. Var. Leucantha Honda. Tetrahedron, 26, 4301–4305 Omar, S., Zhang, J., MacKinnon, S., Leaman, D., Durst, T., Philogene, B.J.R., Arnason, J.T., SanchezVindas, P.E., Poveda, L., Tamez, P.A., Pezzuto, J.M., 2003. Traditionally-used antimalarials from the Meliaceae. Current Topics in Medicinal Chemistry, 3, 137-139 Orav, A., Stylova, I., Kailas, T., Müürisepp, M., 2004. Effect of storage on the essential oil composition of Piper nigrum L. fruits of different ripening states. Journal of Agricultural and Food Chemistry. 52, 2582-2586 Otaka, T., Mori, H., Morimoto, M., Ueba, N., Sutardjo, S., Kusumoto, I.T., Hattori, M., Namba, T., 1995. Screening of Indonesian plant-extracts for anti-human-immunodeficiency-virus type-1 (HIV-1) activity. Phytotherapy research, 9, 6-10 Oyedeji, A.O., Adeniyi, B.A., Ajayi, O., König, W.A., 2005. Essential oil composition of Piper guineense and its antimicrobial activity. Another chemotype from Nigeria. Phytotherapy Research, 19, 362-364 Padma, P., Pramod, N.P., Thyagarajan, S.P., Khosa, R.L., 1998. Effect of the extract of Annona muricata and Petunia nyctaginiflora on herpes simplex virus. Journal of Ethnopharmacology, 61, 81-83 Park, K.M., Cho, J.H., Sohn, J.H., Lee, S.H., Hwang, J.K., 2005. Antibacterial activity of panduratin A isolated from Kaempferia pandurata against Porphyromonas gingivalis. Food Science and Biotechnology, 14, 286-289 116

Parmar, V.S., Jain, S.C., Bisht, K.S., Jain, R., Taneja, P., Jha, A., Tyagi, O.D., Prasad, A.K., Wengel, J., Olsen, C.E., Boll, P.M., 1997. Phytochemistry of the genus Piper. Phytochemistry, 46, 597-673 Paul, J., Duncan, J.R., Sharp, P., Norris, A., Siddiq, M.A., Bacon, C., Weighill, J., 2005. Agranulocytosis and citrobacter infection associated with jamu, a herbal remedy containing phenylbutazone. Clinical Infectious Diseases. 40, 1859-1860 Petersen, M., Alfermann, A.W., 2001. The production of cytotoxic lignans by plant cell cultures. Applied Microbiology & Biotechnology, 55, 135-142 Pettit, G.R., Schaufelberger, D.E., 1988. Isolation and structure of the cytostatic lignan glycoside phyllanthostatin A. Journal of Natural Products, 51, 1104-1112 Poolsup, N., Suthisisang, C., Prathanturarug, S., Asawamekin, A., Chanchareon, U., 2004. Andrographis paniculata in the symptomatic treatment of uncomplicated upper respiratory tract infection: systematic review of randomized controlled trials. Journal of Clinical Pharmacy and Therapeutics, 29, 37-45 Prabhu, B.R., Mulchandani, N.B., 1985. Lignans from Piper cubeba. Phytochemistry, 24, 329-331 Pramono, E., 2002. The traditional use of traditional knowledge and medicinal plants in Indonesia. Multi-Stakeholder dialoque on trade, intellectual property and biological resources in Asia, BRAC Centre for Development Management, Rajendrapur, Bangladesh Pu, H.F., Huang, W.J., Tseng, W.M., Wang, S.W., Liu, Y.W., Doong, M.L., Wang, P.S., 2004. Effects of juice from Morinda citrifolia (Noni) on gastric emptying in male rats. Chinese Journal of Physiolgy, 47, 169-174 Rajasekaran, S., Sivagnanam, K., Ravi, K., Subramanian, S., 2004. Hypoglycemic effect of Aloe vera gel on streptozotocin-induced diabetes in experimental rats. Journal of Medicinal Food, 7, 61-66 Ram, V.J., 2001. Herbal preparations as a source of hepatoprotective agents. Drug News & Perspective, 14, 353-363 Reddy, S.V., Srinivas, P.V., Praveen, B., Kishore, K.H., Raju, B.C., Murthy, U.S., Rao, J.M., 2004. Antibacterial constituents from the berries of Piper nigrum. Phytomedicine, 11, 697-700 Reed, D.W., Davin, L., Jain, J.C., Deluca, V., Nelson, L., Underhill, E.W., 1993. Purification and properties of UDP-glucose thiohydroxymate glucosyltransferase from Brasica napus L. seedling. Archives Biochemistry and Biophysics, 305, 526-532 Rilantono, L.I., Yuwono, H.S., Hugrahadi, T., 2000. Dietary antioxidative potential in arteries. Clinical Hemorheology and Microcirculation, 23, 113-117 Riswan, S., Roemantyo, H.S., 2002. Jamu as traditional medicine in Java, Indonesia. South Pacific Study, 23, 2-10 Row, L.R., Srinivasulu, C., 1964. New Lignans from Phyllanthus niruri Linn. Tetrahedron Letters, 24, 1557-1567 Rukachaisirikul, T., Siriwattanakit, P., Sukcharoenphol, K., Wongvein, C., Ruttanaweang, P., Wongwattanavuch, P., Suksamrarn, A., 2004. Chemical constituents and bioactivity of Piper sarmentosum. Journal of Ethnopharmacology, 93, 173-176 Runnie, I., Salleh, M.N., Mohamed, S., Head, R.J., Abeywardena, M.Y., 2004. Vasorelaxation induced by common edible tropical plant extracts in isolated rat aorta and mesenteric vascular bed. Journal of Ethnopharmacology, 92, 311-316 117

R. J.. K. Calixto.. 48-51 Slightom.. S.. Eaton. J. 478-4809 Schmid. 40.M. Identification of open reading frames.. A. Dey.. Studies on aldose reductase inhibitors from natural-products. S..... Subrahmanyam.M.. Biosynthesis of podophyllotoxin in Linum album cell cultures..and hydroxyl-lignans from Phyllanthus niruri. T.A.. N. Anticonvulsant effect of the fruit essential oil of Cuminum cyminum in mice.P. Niero. 41. Venkateswarlu.B. I. P.M. S. Jouanin. M. structure and synthesis of new diarylbutane lignans from Phyllanthus niruri . A new lignan and a new neolignan from Phyllanthus niruri. 44-49 Sayyah..C. 2005.L. 2.J. Tetrahedron.. Windhövel.. R... 1988. 666-670 Satroamidjojo. J. M. M.S. Terashima. Hayashi.... P. K. Agrawal.. Durand-Tardif.J. 1986.. Journal of Biology and Chemistry. G. F. N. P. Yunes. Phyllanthus-niruri. L.. Horie. New seco. Y. Schwei.K. M. Yakugaku ZasshiJournal of the Pharmaceutical Society of Japan.C. 46. B. Viswanatham. Arisawa.. Chemical study of Indonesian medicinal plants.R. Luger. T. A.. 7343–7349 Santos..K. 41. 911-927 Shimizu. 2002. Cancer Research. De Felipe.. A.N. M.. Arroo. Petersen. 215. 1989. V. Antimicrobial activity of Andrographis paniculata. M. 108–121 118 .. D. J. Anti-inflammatory and anti-nociceptive activities of Ganoderma lucidum occurring in South India. Tepfer... H.synthesis of 5'-desmethoxy niranthin and an antitumor extractive.K. N. Yshizaki. Keyser. 2002.. Kitagawa. 2531-2532 Singha. R.. Mach. 1982. Fitoterapia. K. M. J. Peters C. Kasahara. 62. 2001. Ueno. Mantyh. 8931-8940 Satyanarayana. Pharmaceutical Biology. Rogers. 2003..... Enzymatic synthesis of lignin precursor: purification and properties of UDP-glucose: coniferyl alcohol glucosyltransferase from cambial sap of spruce (Picea abies L. 301-304 Shibuya.. Obat Asli Indonesia.. 2005.. V. 37. Isolation.).. Woolley. C. A.M. Vianna. European Journal of Cancer.. T. 1996.. 362-370 Seidel. Thakur. 1955-1968 Sheena.A. Medarde. Wada. 1991. P.. K. Ghilardi. Chemical & Pharmaceutical Bulletin. Journal of Pharmacy and Pharmacology. Grisebach. Planta. 261. 755-759 Sasaki.W.N. 116. M. Suzuki. C. Dian Rakyat. Pharmaceutical Biology. S. 1994... R. 51.G. Campos.. Curcumin: The story so far. Alfermann. 1989. Janardhanan. 47.. Active components of a Paraguayan crude drug para-parai mi.. A..R. Moreno. Plant and Cell Physiology. Mahboubi. Journal of Natural Products. European Journal of Biochemistry. W.M..B. M. P. J. R. 46.. 52.L. Gescher.A.P. 2003. D.. H. M... Kamalinejad. Roy. 2002.Sabino.W. 1031-1039 Sharma. 123.. T. H. Jongen. Studies on disease-modifying antirheumatic drugs: synthesis of novel quinoline and quinazoline derivatives and their antiinflammatory effect. P. Isolation and characterization of cDNAs encoding an enzyme with glucosyltransferase activity for cyclo-DOPA from four o’clocks and feather cockscombs. Filho.. Analgesic effects of callus culture extracts from selected species of Phyllanthus in Mice.. M...... Koda.. Nucleotide sequence analysis of TLDNA of Agrobacterium rhizogenes agropine type plasmid. G. Morita. 74.. S.. Ozeki. Ajith. 692-694 Singh. S.R. Steward. N.A. Adachi. Jakarta Satyanarayana. Journal of Natural Products.J.D..

871-874 Subeki. Cytotoxic mechanism of flavonoid from temu kunci (Kaempferia pandurata) in cell culture of human mammary carcinoma. 75. 1985. Maede. 68. A. Hikino. 1998. Edrada. Shastri.M. M... Polyphenols from plants used in traditional Indonesian medicine (Jamu): uptake and antioxidative effects in rat H4IIE hepatoma cells. 2002. Accumulation of podophyllotoxin and related lignans in cell suspension cultures of Linum album. Diuretic effects of selected Thai indigenous medicinal plants in rats... Wichers.. 32. Suwansaksri.. Darwanto. T. A systematic review of the safety of kava extract in the treatment of anxiety.W. Matsuura. Journal of Ethnopharmacology... H. Laupattarakasem. Series on liverprotective drugs ... Reumacon (CPH82) showed similar x-ray progression and clinical effects as methotrexate in a two year comparative study on patients with early rheumatoid arthritis.. 279-282 Svensson. M.S. The effect of the volatile oil of bark and leaves of Cinnamomum burmanni against bacteria and fungi (in Indonesian). Yoshihara. 41-44 119 . Brazilian Journal of Medical an Biological Research.. 1999. Shahsavari. Ernst. A. K. J.S.. Alfermann. 51. Watjen. Yamasaki. K. M. Kobayashi. Katakura. R. A.... Agromedia Pustaka. 2005. 1-15 Sripanidkulchai. Sheetal. Drug Safety. 2005. M. Y. Journal of Pharmacy and Pharmacology. Trimurningsih. 57.. Michels. M. 23. A.. K...P. 975-979 Soedjarto. S. K. Menguak tabir dan potensi jamu gendong. J. Kalenberg. J. Flavour and Fragrance Journal.... Ebel.. Suzuki.. Trimurningsih. H. Yoshihara T. Clinical Hemorheology and Microcirculation. O. Y. Journal of Ethnopharmacology. 2000. M... Wray.. O.. K. Journal of Veterinary Medical Science. 1999.R.19. Pai. A.A... Yamasaki. 2005. Takahashi.. H. Essential oil constituents of some Piper species.. W. H. Matsura.V. 14. Maede.. V. 25: 251-261 Subeki. Husain. G. S. 48. 10. P. Jakarta Sukandar. 185-190 Sumathykutty. S.. C. 14. Huntley. M... V. 2001... 38. Kahl.S.Smollny. E. 463-468 Steffan. Indonesian Journal of Pharmacy. B.G. Y. Biodiversity prospecting and benefit-sharing: perspectives from the field. Antihepatotoxic principles of Phyllanthus niruri herbs.Y. 31-39 Sukardiman. Jirakulsomchok. M. R. Wongpanich. Takahashi. Rao. Journal of Ethnopharmacology.. Anti-babesial and anti-plasmodial compounds from Phyllanthus niruri.A. 83-88 Syamasundar.M.. Yamato. H... U. Proksch. 1996. Suganda.. R. Chairul. Preclinical evaluation of the antidiabetic effect of Eugenia jambolana seed powder in streptozotocin-diabetic rats. K. Kiso.B. Darmadi. A. 537-539 Suharmiati. Chairul. Padmakumari. R. 2005. Tanjung. P. Singh... 2003.. Katakura.. Narayanan. Scandinavian Journal of Rheumatology.. E.. Phytochemistry.. D.. P. B.S. Niering. B.. R. Muslikhati. Petersen. 66. S.T.. Yamato... Journal of Natural Products. Thakur.. 233-240 Stevinson. Antibabesial activity of protoberberine alkaloids and 20-hydroxyecdysone from Arcangelisia flava against Babesia gibsoni in culture... 2003.. 185-190 Sridhar. C. M...D. Pettersson..

V.. 1991.V. Koul.. N. Rio de Janeiro. Yoshikawa. K. An aldose reductase inhibitor in licorice. Hatanaka. A. T. M. Pharmaceutical Biology.A. Dhar.Taguchi. T. Kuroyanagi. Okond’ahoka. Biological & Pharmaceutical Bulletin. H..5 '.. 27-32 Tona. Mekonnen. Hattori.. Kume. Yamasaki... Kikuchi. Selective inhibitors of inducible nitric oxide synthase: potential agents for the treatment of inflammatory diseases..T. L... K. six new dimeric (7. S. 2004. S. Vlietinck. Sasaki. Van Miert. 93. 47-57 Trimurningsih. Chrimwami.. Horibe.P. 2002. M. F.. Taylor. Tanaka.. A.F.8.. S. P. Kobayashi. 2005. L. T. 2001. T. Yamato.. M. Mesia. A. Helicterins A-F.. Apers. N. Pongprayoon.... 2005. European Journal of Pharmacology. Convention on Biological Diversity. Musuamba.. In vitro antiplasmodial activity of extracts and fractions from seven medicinal plants used in the Democratic Republic of Congo. 2005. T.. Antiplatetlet action of isoliquiritigenin. de Bruyne. Apers.. Effects of 19 herbal extracts on the sensitivity to paclitaxel or 5-fluorouracil in HeLa cells. 2006. Cimanga... Takahashi. S.. Vlietinck. M. Kusumoto.. W. Namba. M. O... Hayashida... Y.B. J. 349-352 United Nations. 2001. P... 871-874 Tawata.. W.. Ozaki. T. Pieters. Ohnishi.. G. Subeki.H. De Bruyne. K. 2908-2919 Tinker.2 ')-neolignans from the Indonesian medicinal plant Helicteres isora. 67. Cimanga. Y.. In-vivo antimalarial activity of Cassia occidentalis. Onaya. 501-508 Taneja..C. Claeson.. 30. Helvetica Chimica Acta. 6..V. 71. Phytochemistry. Hepatotoxicity of the methanol extract of Carica papaya (paw-paw) seeds in Wistar rats. K. Molecular cloning and heterologous expression of novel glucosyltransferase fro tobacco cultured cells that have broad substrate specificity and are induced by salicylic acid and auxin...S. T. P. Sulaiman. Phytochemistry. Totte. 77-92 Tona. T.. In vivo antimalarial activity of essential oils from Cymbopogon citratus and Ocimum gratissimum on mice infected with Plasmodium berghei. Pieters. Zollo.L..... K. Katakura. Santisuk.. M. European Journal of Biochemsitry. Wallace. 95. Yoshihara.L. Chainul.. Morinda morindoides and Phyllanthus niruri. 28. Obata. T.. Sematong. 20-23 Tezuka... M. T.M. Aida. Planta Medica... U. S... K. H. Najimudin..... Oxygenated cyclohexanes from Piper species. S. F. T. S. Okazaki. Reutrakul.J. S.. Schilf.. K. M.. 43.J..K. Hernans. 4086-4094 Takara. Terazono.. K.C. 1992 120 . Evaluation of the inhibitory activities of the extracts of Indonesian traditional medicinal plants against Plasmodium falciparum and Babesia gibsoni. 59. T. Y. Cytotoxic activities of major diterpenoid constituents of Andrographis paniculata in a panel of human tumor cell lines.. N. Totte. Journal of Veterinary Medical Sciences. Muhammad. Pharmaceutical Biology. P. S. E. S.. A. 829-831 Tuchinda. E. Maede. Kadota.. 169-173 Udoh. 1992. Anti-inflammatory cyclohexenyl chalcone derivatives in Boesenbergia pandurata... 2005.K.. 43. B.. R. L.I. Noguchi. C..T. Journal of Ethnopharmacology. N. Ngimbi.C. Y. 87-92 Tchoumbougnang. Yazawa. Mesia. 2000. Supriyatna... Matsuura. 138-142 Tan. N. 268. J. Y.. Current Topic of Medicinal chemistry. T.. Pushpangadan. 212.. Suzuki. K. Daniewski. 2005. Dagne.. M. Chin. L. Y. Hermans... S. Yokoyama.. P... N. W.. Udoh.. Annals of Tropical Medicine and Parasitology.

D. Improvement of 5methoxypodophyllotoxin using a new selected root culture of Linum flavum L. Joshi. 1991b. Heinrich. Y. The large scale isolation of deoxypodophyllotoxin from rhizomas of Antriscus sylvestris followed by its bioconversion into 5methoxypodophyllotoxin β-D-glucoside by cell cultures of Linum flavum. A.. H.. Malingré. Chauhan.. Phytother..P. T. C. R. Gupta. 233-260 Usia. Dobhal. Trends in Plant Science.... T. M. 5.S. Malingré. 217-224 Van Uden. 23. 102-110 Van Uden.. Simeray.. Pras... Metabolite-cytochrome P450 complex formation by methylenedioxyphenyl lignans of Piper cubeba: mechanism-based inhibition.. Visser..K. 55. 2000. P. T. M. 10. 2381-2391 Van Uden. J. Malingré.M. Woerdenbag. T.M.. E. 2004. p.J. Carbohydrate Polymers.. 1997. N.. 2005.. a lignan from root cultures of Linum flavum L. J.. 2005. S. and cytotoxicity of 6-methoxypodophyllotoxin... 64-68 Usia. N. 76. Pras. Leger. Are the caracteristics of betanidin glucosyltransferases from cell suspension cultures of Dorotheanthus bellidiformis indicative of their phylogenetic relationship with flavonoid glucosyltransferases?.J... N. P. 50-53 Vasilev. M. Potent cyp3A4 inhibitory constituents of Piper cubeba.. Fitoterapia... Journal of Natural Products. Provisional Agenda.L. Homan. Homan. Fang. J. 1-8 121 . T... 1990a On the improvement of the podophyllotoxin production by phenylpropanoid precursor feeding to cell cultures of Podophyllum hexandrum Royle. 2003. T. W. Kadota. Phytomedicine.F. T. 1997.. Jones. purification. 2005. X. 647-660 Wang. The accumulation of podophyllotoxin-β-D-glucoside by cell suspension cultures derived from the conifer Callitris drummondii. 115-121 Van Uden. G. M. S. B. 9.. Plant Cell Reports. Ionkova. L. N. 68.P. Planta 183: 25-30 Van Uden. D... 118-122 Vogt. 2005... 1991.. Woerdenbag. W. T. N. S.... Validated assays for human cytochrome P450 activities. Pras.. Bremner. 2003. Life Sciences. Glycosyltransferases in plant natural products synthesis: characterization of a supergene family.. I. Liu. Grimm... Malingré. H.. 27....M. W. Chaumont. Batterman. Cytotoxic activity of extracts from Linum cell cultures. Pras.J.. Regional Committee. W. Meyer. Cytotoxic activity of a podophyllotoxin-like lignan from Linum tauricum Willd. Wichers. 52. Pras. 32. Plant Cell Tissue and Organ Culture. Konstantinov. 349-361 Walsky. 76. Drug Metabolism and Disposition. 25.. Planta. Malingré. Tezuka.. Y.A.M.C... N. Momekov...N. 60... 425-429 Violon.. 401-403 Vasilev. R. Watabe. 1991a. J.. 60. The accumulation and isolation of coniferin from a high-producing cell suspension of Linum flavum L. Y. Boeke. Journal of Natural Products. 1991 Plantes Med. P.. Harkes.. Plant Cell Tissue and Organ Culture. J. Kadota. Bos. 1992. 1990b. Zimmermann. 380-386 Vogt.. Tezuka. N.. T. R. H.. Neoplasma. R... Isolation. 257-269 Van Uden.. I. Immunological activities and structure of pectin from Centella asiatica. A review on potentiality of medicinal plants as the source of new contraceptive principles. 95-101 WHO strategy for traditional medicine 2002-2005. R. G. B.M. 2005.Unny. T. Obach. W. Pras. M. Zaharieva.S.. T. Strack.S. N. Watabe. Ionkova. Journal of Natural Products.M. S. W.

Induction of apoptosis by panduratin a isolated from Kaempferia pandurata in human colon cancer HT-29 cells. 1075-1079 Yun. 2001.H. 2004. H. Cho.Y.. Lam. C. K. Yao.. C. Journal of Microbiology and Biotechnology. E. 1993.M.. 69.. The effect of Aloe vera A. D...R. G.. Van Uden. 97-100 Wunder.. L. Antihyperglycemic effect of andrographolide in streptozotocin-induced diabetic rats. P. Indonesia 122 . Tan.. Chen. 1990. N.W. 675-678 Zheng..T.Y. M. Clinical and Experimental Pharmacology and Physiology. Kenney. Hu. 200-206 Yang. Pharmacological Research.K. B. Kwon. Ku.. B. 14. 1999..H. Ma.K. Hypotensive activity of aqueous extract of Andrographis paniculata in rats.A.Y.S. A.. B. C. Y.K. Archives Oral Biology...F. Zhang. Aziz. Lerk. J. Deng. M...C. Planta Medica.C. C.. J. Yuan-Jian. Cardiovascular activity of 14-deoxy-11.W. 1998.. Y.H.. 153156 Zhou. 2003.. Plant Cell Reports. Kuroyangi.. 93. 13-15 November 2001. T. 38.Y.M..K. 2005. 33-37 Zhang. 2004.. 70. Pharmacology Biochemistry and Behavior. S. Wilson. Deng. H.. Hypoglycemic effect of exo.. The protective effects of ligustrazine on ischemia reperfusion and DPPH free radical induced myocardial injury in isolated rat hearts. 41. Jakarta. X. Malingré. Li..and endobiopolymers produced by submerged mycelial culture of Ganoderma lucidum in streptozotocininduced diabetic rats. H. Frijlink. B. 2005. Cheng. H. Dukungan teknologi pengembangan obat asli Indonesia dari segi budaya. Potential anticarcinogenic natural products isolated from lemongrass oil and galanga root oil.M. Darusman. Y. B. Diana. Tan.. 2004... Andarwulan.K.. Antidepressant effects of curcumin in the forced swim test and olfactory bulbectomy models of depression in rats.. H. 203-214 Xu. William. C. H. Planta Medica. Hung..H.. 44. L. S. 701. Mukhtar. Journal of Ethnopharmacology. Paper presented at the workshop on agribusiness development based on biopharmaca. C.. Ghulamahdi. 82.B. H. P.. Journal of Agricultural and Food Chemistry.J. Pras.P.. Song. W.Q. Berger (Liliaceae) on gastric acid secretion and acute gastric mucosal injury in rats.. Action of agent on glucosyltransferase from Streptococcus mutans in solution and adsorbed to experimental pellicle. Hwang. pelestarian dan pasca panen..K. W.A.Y... X. M. 818-822 Zuhud.T. 501-507 Yusuf. 972-977 Yu.J...Woerdenbag. 413-417 Zhang.12didehydroandrographolide in the anaesthetised rat and isolated right atria. Planta Medica.. 9. 1996. J. 23.M.. Y. Departemen Pertanian. Increased podophyllotoxin production in Podophyllum hexandrum cell suspension cultures after feeding coniferyl alcohol as a -cyclodextrin complex.J.. M. L. N. Agunu... Lin.

W. a village 56 km South of Padang. he will continue his work at the School of Pharmacy. A.. Elfahmi. List of publications 1. Herman J. Komar Ruslan. and Wim J. Bos. Rein Bos. Woerdenbag. H.. Momekov. Woerdenbag.. 2006. N..J. Production of cytotoxic arylnaphthalene lignan from genetically transformed root cultures of Linum leonii. R. I. Albert Koulman. K. Quax.. he received a grant from the Indonesian government through the University Research and Undergraduate Education (URGE) project for his master degree. H. Quax. Elfami. 55-58 2..J. as a lecturer and researcher. Kayser.J.J. Sieb Batterman. Reduced coniferin and enhanced 6-methoxypodophyllotoxin production in Linum flavum cell suspension cultures after treatment with Na2EDTA (submitted) 123 . W. Batterman. Konstantinov. T. R. Kayser. Hoge.. Vasilev. O.J.. University of Groningen with the research topic plant biotechnology.. 2006. Batterman. Bos. Bos.J. O. He finished the primary and elementary school in the village where he was born.. Woerdenbag.. Lignans from cell suspension cultures of Phyllanthus niruri. K. In 1989. Quax... an Indonesian medicinal plant (submitted) 5. Quax. Immediately after completing his study in Padang. he moved from Ampang Pulai to Padang when he passed the university entrance examination. In July 2006. He started his PhD study in June 2001 at the Department of Pharmaceutical Biology. W. He obtained his master degree from the Department of Pharmacy (since 2006 named School of Pharmacy). Koulman. West Sumatera.. an Indonesian medicinal plants. H. R.. Henricus L. S... S. S. G. Bos. Journal of Natural Products (in press) 3. Lignan profile of Piper cubeba. ITB. Essential oil constituents of Piper cubeba from Indonesia (submitted) 6. O. and partly by the University of Groningen.. Kayser. Journal of Natural Products. Ruslan. His PhD study was financially supported by the Quality for Undergraduate Education (QUE) project of the Department of Biology. Indonesia. Wim J. R. Ionkova. Woerdenbag. Ruslan.Curriculum Vitae Elfahmi was born on 25 April 1969 in Ampang Pulai. Herman J. Elfahmi. Quax. Andalas University. Hackl. Elfahmi.. Elfahmi. Oliver Kayser. Elfahmi. O. Rein Bos. During his study in Groningen he got a chance to attend scientific meetings in several countries to present his results and to publish his research output as listed below. Oliver Kayser.. Kayser. Jamu: The Indonesian traditional herbal medicine (submitted) 4. Institut Teknologi Bandung (ITB) in 1997. ITB. He obtained his doctorandus degree in 1993 and became a pharmacist (apoteker) in 1995.. for the Department of Pharmacy.. 2006. Woerdenbag.

124 .

Although it was only for short time being supervised by Niesko. I am grateful to the members of the reading committee. Sieb. Lidia. Ronald M. even people thought that we were fighting. I am glad that I have good results on this topic although the work has to be continued to yield a nice publication. for his support and approval of this thesis. I would also like to thank Prof. Dr. Linda. It was nice when I tried to send you an email in Dutch. Janita. Dr. Schmidt and Prof. My thanks also go to other colleagues. I would like to thank the QUE Project of the Department of Biology. Verpoorte. Dr. and then we can continue talking in such way. Paul and Marcel your expertise in plant genetics improved my knowledge in this field that I just entered. you have always tried to help me to find the solution for a problem I had. F. excellent in English. Dr. I appreciate it. Sometime we had a quite hard discussion. Prof. especially from the members of the Pharmaceutical Biology group. Nickolay. Working together in the lab with colleagues has stimulated me to finish my study. Mariana. You are hand van de meester and more than that. Melloney. Agata. Their support does not only include the scientific and academic aspects. 125 .J.J. Helga. for patience and guidance during my PhD period. you helped me to prepare samples to be analysed. and Peter. immediately in responding emails. Monique (ex-roommate). GC-MS. Muskiet. You also introduced me to some nice Gronings words. This could not happen without the support from many people. I wish to thank my promotor Prof. Almer. Albert Koulman. my best friend. I would like to express my gratitude to all of you. Chalid for helping me to arrange my deffence and subsequent party. Ykelin. Paul Dijkwel and Drs. but your knowledge in practical manners still helps me a lot. Together with Dr. Johanna. I thank you for helping me to arrange administration stuffs.. fast in correcting manuscript are things that I will never forget. Mags. Good luck with your Indonesian course. It is pity that you will not be here when I defend my thesis. My research was also partially supported by University of Groningen through a scholarship. Freeke. Sturee who gave me an opportunity to do work at the Department of Plant Molecular Biology in Haren. Wim J. Quax who gave me a chance to do research for my doctoral degree in his department. you also supervised me in many things.. followed by a lot of help and discussion concerning the research project. Ana. Janita Zwinderman and Freeke van Putten. Dr. Charles. I greatly appreciate the important assistance from Rein Bos. I appreciate it so much. Groningen. Herman Woerdenbag and Dr. Agus Dana Perdana and Dr. Rein’s expertise in analytical instruments (GC. Prof. Ronald D. Dr. Jacques Hille. I want to thank my paranimfen Mattijs and M. University of Groningen. Institut Teknology Bandung (ITB) for financial support during my PhD study. Robert. especially to Dr. Oliver Kayser. I would like to express my sincere appreciation to my copromotors. Taufikurrahan. Fast in answers. Geeske. Niesko Pras. Herman. Therefore. Sieb Battermann. Michiel. T. I know that you left the lab long time ago. but actually we were sharing ideas. you replied in Indonesian. I remember that you sent me much literature before I started my study here. many thanks I want to address to my colleagues especially to my roommate Mattijs Julsing for friendship. Mattijs. Carlos.Acknowledgements Alhamdulillah.A. Marcel G. R. you introduced me to the scientific atmosphere in your country. help and nice discussions. the directors of the project. you have prepared and maintained the plant cell culture that I have used for my research project. HPLC) helped me a lot. finally this thesis is finished. for the evaluation of the manuscript and for their valuable comments. I really enjoyed it. Henco. but also the social life during the years of my stay in the nice small city (fietsstad). Asia.

Unfortunately I miss the contact with you. tadarus. Fathiya Mufidah. Heni Rachmawati. Hasyim. Pak Ahmad. Indra. I enjoyed to stay in your house before my family came. I would like to thank Martin and Sanneke Broekhuijsen for hospitality and friendship. praying and a lot of other things you spent to help me. My family felt at home being together with you all. Zayd. You have stimulated me to develop my career. sharing ideas. My best gratitude goes to my parents and my brothers Da Manto. My children. Unfortunately you will not be here when I defend my thesis. although we were far from our home country. Ikhlasul Amal and their family for many things. Iman. Finally I come to address my appreciation to my wife. It is difficult to find words to express my gratitude for you. Nurul Rahimah and Ahmad Muzakki Imanullah have made me enjoy the life. I was happy to live in Groningen with you and our children. Thank you very much Dank u wel Terima kasih 126 . I thank you for your moral support and we keep in contact. Da Piyan. Also to Henk and Aaf Euverman. discussion. Martin. Ef and my sister Uni Etimurni for support in many ways. My warmest gratitude goes to my colleagues in several cities in the Netherlands. Deden. Iskandar. Yulia Helmi. It was nice to have routine gathering. I am sure that some people will be missing to be mentioned. Wak Asyiah. It was nice time to have dinners at your house.I want to thank my colleagues as well as my neighbours in Groningen. Zul. Satria. I thanks you for your moral support. My thanks also go to all members of deGromiest (the Indonesian Moslim Society in Groningen) for friendship. Didin. I am sure that you will enjoy it as well I am very sorry that I am not able to mention all people who have given a contribution to this thesis. Tante Caroline. Gun. you are a good cooker of lekkere dingen. Your houses were “my hotels” when I travelled to your city. Billi and Oka for many helps and kind friendship. I would like to thank all of you. Tante Ice. Lukman. I hope it can be kept and developed further. Mbak Nanie. Mbak Ellis. You have to go back to work and that was our best decision. To all members of PPI (Persatuan Pelajar Indonesia. Indonesian student society in Groningen). a moment when family and colleagues come together. My wife learned Dutch from you and you learned Indonesian from her.

Sign up to vote on this title
UsefulNot useful

Master Your Semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master Your Semester with a Special Offer from Scribd & The New York Times

Cancel anytime.