You are on page 1of 12

Protoplasma

DOI 10.1007/s00709-015-0771-z

ORIGINAL ARTICLE

Physiological performance, secondary metabolite and expression


profiling of genes associated with drought tolerance in Withania
somnifera
Sanchita & Ruchi Singh & Anand Mishra & Sunita S. Dhawan &
Pramod A. Shirke & Madan M. Gupta & Ashok Sharma

Received: 24 November 2014 / Accepted: 26 January 2015


# Springer-Verlag Wien 2015

Abstract Physiological, biochemical, and gene expression Keywords Withanolides . Water stress . Withania somnifera .
responses under drought stress were studied in Withania Gene expression . Photosynthesis rate
somnifera. Photosynthesis rate, stomatal conductance, transpi-
ration rate, relative water content, chlorophyll content, and
quantum yield of photosystems I and II (PSI and PSII) de-
Introduction
creased in response to drought stress. Comparative expression
of genes involved in osmoregulation, detoxification, signal
Withania somnifera (Ashwagandha) is an important medicinal
transduction, metabolism, and transcription factor was ana-
plant of Indian origin. The plant is well known to be effective
lyzed through quantitative RT–PCR. The genes encoding
in immunomodulation, hematopoiesis, anti-aging, chronic
1-pyrroline-5-carboxylate synthetase (P5CS), glutathione
stress, cardiovascular protection, hypothyroidism, anxiety,
S-transferase (GST), superoxide dismutase (SOD), serine
and depression (Verma and Kumar 2011). Secondary metab-
threonine-protein kinase (STK), serine threonine protein
olites play an important role in plants for adaptation and de-
phosphatase (PSP), aldehyde dehydrogenase (AD),
fense against adverse environmental conditions (Ramakrishna
leucoanthocyanidin dioxygenase/anthocyanin synthase
and Ravishankar 2011). These metabolites are useful for
(LD/AS), HSP, MYB, and WRKY have shown upregu-
humans as pharmaceutical agents. Withanolides are a class
lation in response to drought stress condition in leaf tissues.
of secondary metabolites synthesized in W. somnifera.
Enhanced detoxification and osmoregulation along with in-
Withanolide biosynthesis starts with Acetyl Co A, a byproduct
creased withanolides production were also observed under
of glycolysis, followed by terpenoid and steroid biosynthetic
drought stress. The results of this study will be helpful in
pathways. Generally, secondary metabolite content increases
developing stress-tolerant and high secondary metabolite
under stress conditions in plants. Drought stress generates
yielding genotypes.
reactive oxygen species (ROS) such as singlet oxygen, su-
peroxide anion radicals, hydroxyl ions, and hydrogen
peroxide (Cruz de Carvalho 2008). These ROS are con-
sidered as markers of initiation of stress, serving as signal-
Handling Editor: Bhumi Nath Tripathi ing molecules to activate the cell response against stress
Sanchita : A. Mishra : S. S. Dhawan : A. Sharma (*) (Shulaev and Oliver 2006). Osmolytes are organic molecules
Biotechnology Division, CSIR–Central Institute of Medicinal and of low molecular weight which play a prominent role as
Aromatic Plants, Lucknow, India osmoprotectant. The osmolytes such as glycine betaine and
e-mail: ashoksharma@cimap.res.in
proline accumulate in cells and balance the osmotic difference
R. Singh : P. A. Shirke between cytosol and surrounding of the cell. The accumula-
Plant Physiology Division, CSIR–National Botanical Research tion of these molecules results in the enhancement of stress
Institute, Lucknow, India tolerance (Agarwal et al. 2013). The leaf and soil water con-
tent decreases with the increase in drought stress. Due to loss
M. M. Gupta
Chemical Sciences Division, CSIR–Central Institute of Medicinal of relative water content (RWC), leaves lose their turgidity
and Aromatic Plants, Lucknow, India and stomata get closed. CO2 concentration decreases in
Sanchita et al.

the intercellular spaces and photosynthesis rate decreases un- kept in a growth chamber (PGC-105 HID; Percival Scientific,
der water stress (Singh 2014a). Oxidative stress is one of the Inc., 505 Research Drive, Perry, IA 5022D, USA) for the
most deleterious consequences of water deprivation. study. The photosynthetic photon flux density (PPFD)
Oxidative stress generated due to enhanced production of re- was increased gradually from 6:00 to 12:00 h (50–
active oxygen species (ROS) is minimized by controlled shut- 1300 μmol m−2 s−1) and after that decreased in a sim-
down of photosynthesis and by degradation of photosynthetic ilar way till 20:00 h to maintain 14 h light/10 h dark
structures like chlorophyll (Dinakar et al. 2012). Several en- cycle. Temperature varied between 28 and 33 °C with
zymes, viz., superoxide dismutase (SOD), catalase, glutathi- variation in light intensity. Relative humidity was 50–70 %.
one peroxidase, ascorbate peroxidase, glutathione S-transfer- One-and-half-month-old plants were used for the drought ex-
ase (GST), and glutathione reductase are reported to be in- periment. During drought, watering was stopped and the pot
volved in the detoxification of these substances (Gill and was covered with a thick plastic sheet so that vaporization of
Tuteja 2010). These genes have been reported earlier for their the water through the pot was minimized. The potted plants
involvement in the regulation as well as tolerance against were subjected to drought for 7 days followed by 5 days of
drought stress in different plants (Chen et al. 2012; Faize recovery. The physiological and biochemical parameters were
et al. 2011). We undertook this study to show the role of these assessed periodically during the drought treatment and on the
genes in W. somnifera under drought stress. Leaf physiologi- fifth day of rewatering. At the end of drought (seventh day),
cal and biochemical responses to different degrees of drought samples for gene expression and secondary metabolite estima-
stress and re-watering were observed. A comprehensive study tion were taken (Fig. 1).
of gene expression profiling, physiological performance under
drought stress along with withanolide content of W. somnifera Proline estimation
were performed. The genes undertaken for the study belonged
to different categories, viz., osmoregulation (Δ1P5CS), detox- Proline was determined according to a modified method of
ification (GST and SOD), signal transduction (STK and PSP), Bates et al. (1973). Approximately, 0.5 g fresh leaf sample
metabolism (AD and LD), and transcription regulation (HSP, was homogenized in 1 mL of 3 % (w/v) aqueous sulfosalicylic
MYB, and WRKY). The expression analysis of these genes acid. To the aliquots, 96 % acetic acid/3 % sulfosalicylic acid
was carried out for studying the variation in produced metab- in the ratio 2:1 was added followed by ninhydrin reagent. The
olites to justify their roles in drought stress. The expressions of mixture was incubated at 96 °C in a water bath for 1 h. The
drought-inducible genes were also analyzed through their ex- mixture was cooled to room temperature, toluene was added,
pression in leaf tissue of W. somnifera. With the increase in and the absorbance of fraction with toluene aspired from liq-
drought stress RWC, osmotic potential (OP) and chlorophyll uid phase was read at a wavelength of 520 nm. Proline con-
(Chl) content decrease. However, leaf electrolyte leakage and centration was determined using a calibration curve and
proline and malondialdehyde (MDA) content increase and expressed as micromoles of proline per gram FW.
cannot be recovered after re-watering (Makbul et al. 2011).
Efforts are further required for the identification of the Lipid peroxidation estimation
enzymes/genes for specific steroidal lactones, viz.,
withaferin-A, withanolide-A, etc. The expression profiling of Two hundred milligrams of plant tissue was extracted with
genes involved in biosynthetic pathway may provide a better 1 mL of 0.25 % TBA soluble in 10 % TCA. This mixture
understanding of secondary metabolism under drought stress.
The results from this study would provide an insight into
signaling cascade and biosynthesis of secondary metabolites
and indicate that there may be a crosstalk among various
pathways.

Materials and methods

Plant material

The seeds of W. somnifera variety Poshita were obtained from


CIMAP Experimental Farms, CIMAP, Lucknow. One-week-
old plantlets of W. somnifera were transferred in 10-L pots
(filled with garden soil) and regularly irrigated with 500 mL Fig. 1 Image of watering and 7-day drought-treated plants of
of tap water and weekly with Hogland solution. Plants were W. somnifera
Study of drought tolerance in Withania somnifera

was heated at 95 °C for 30 min and then cooled in ice to stop RNA isolation and cDNA synthesis
the color change. Then the extract was centrifuged at 10,
000 rpm and 4 °C for 10 min. The supernatant was taken Total RNA was isolated from approximately 100 mg of leaf
and OD measured at 532 and 600 nm. Corrected OD was tissues using Trireagent (Sigma, USA), according to the man-
calculated as A532 −A600 and lipid peroxidation is expressed ufacturer’s instructions. Any genomic contamination was re-
as micromoles of MDA formed using an extinction coefficient moved before cDNA synthesis by the treatment with RNase
of 155 mM cm−1 (Heath and Packer 1968). free DNaseI (Sigma, USA). The glasswares used for RNA
isolation was autoclaved and treated with 0.1 % DEPC to
make it RNase free. The RNA was isolated from root and leaf
Measurement of gas exchange parameters tissue on day 0 (taken as control), day 4, and day 8. The
nucleic acid quality was estimated by visual analysis on
Photosynthetic rate (A), stomatal conductance (gs), transpira- 1.2 % agarose gel electrophoresis. The purity and concentra-
tion rate (E), and WUE were measured with an LI-6400 por- tion of RNA were checked by using a Nanodrop ND-1000
table photosynthesis system (Li-Cor, Lincoln, NE) with red spectrophotometer (Nanodrop Technologies, Rockland, DE,
and blue LED light sources. All measurements were taken USA). The A260/A280 ratio of each RNA sample was kept to
between 8 and 10 h on five leaves per treatment on different be in the range 1.8–2.0 to minimize the effects of PCR inhib-
plants. Measurements were taken at 400 μmol CO2 mol−1 air, itors. All RNA samples were stored at −80 °C. The first strand
constant leaf temperature (Tleaf =33±2 °C), and constant vapor of cDNA was synthesized from 3 μg of total RNA with
pressure deficit (VPD=2.5±0.2 kPa) after the attainment of MultiScribe™ Reverse Transcriptase and random primer
steady-state photosynthetic rates. The ratio of (A) to (E) was (ABI, USA) according to user instructions. Total RNA sam-
taken as the intrinsic photosynthetic water use efficiency ples were denatured at 65 °C for 5 min and then quickly
(WUE). cooled on ice. Reverse transcriptase and other reaction com-
ponents were added to the samples. These were then incubated
Determination of leaf water states for 10 min at 25 °C (primer annealing), followed by 120 min
at 37 °C and finally 10 min at 85 °C to inactivate the enzyme.
Measurements of water potential and relative water content Reverse transcription (RT) negative controls, without the in-
(RWC) were made at predawn condition (before exposure of clusion of the reverse transcriptase enzyme, were performed in
light on plants) of fully expanded leaves (third forth leaf from parallel to test for the presence of genomic DNA contamina-
the terminal bud of twig). Water potential (Ψ) was measured tion in RNA samples. 18S ribosomal gene of W. somnifera
with a plant water status console (Soilmoisture, Santa Barbara, was considered as the endogenous gene to check the quality of
CA). The fresh weight was recorded just after harvesting the cDNA on 1.5 % agarose gel.
leaves and wrapped in aluminum foil. These leaves were kept
in water through their petiole for 5–6 h to attain full turgidity,
and turgid weight was taken. After that, leaves were dried for Primers for qRT–PCR
72 h at 70 °C in an oven and dry weight was recorded. The
RWC of the leaf was calculated as 100×(fresh weight−dry For all genes, qRT–PCR primers were designed using the
weight)/(turgid weight−dry weight) (Boyer et al. 2008). Primer Express 2.0 software. To ensure maximum speci-
ficity and efficiency during PCR amplification, a stringent
set of criteria was used for primer designing. These in-
Pigments estimation cluded predicted annealing temperatures (Tm) of 58–60 °C,
primer lengths of 18–24 nucleotides, GC contents of 50–
Twenty to twenty-five milligrams of leaf tissue was extracted 60 %, and PCR amplicon length of 100–120 bp. All
with 1 mL of 80 % acetone and chlorophyll, and carotenoids primers were customized from a commercial supplier
was extracted in 80 % acetone and calculated according to Integrated DNA Technology (IDT) India Ltd. In order to
Wellburn (1994). All samples were kept in dark during extrac- investigate the expression profiles, the primers for the
tion. For anthocyanin estimation, 30–35 mg of sample was genes were designed based on previously identified genes
extracted with 1 % acidified methanol. Absorbance of the in Solanum tuberosum. The genes of S. tuberosum were
supernatant was taken at 530 and 650 nm, and corrected considered for the similarity search against transcriptome
values were calculated as AA=A530 −(0.288×A650), where data of W. somnifera present in SRA database of NCBI.
AA is corrected anthocyanin absorbance. Total anthocyanin The primer designed from 18S ribosomal RNA gene,
content was then calculated by using the corrected OD and a DQ438948, was considered as internal control. The de-
molar absorbance coefficient for anthocyanin at 530 nm signed primers with default parameters have been listed
of 30,000 L mol−1 cm−1 (Murray and Hackett 1991). (Table 1).
Sanchita et al.

Table 1 Oligonucleotide sequences of forward and reverse primer pairs from genes considered for the study

Sr. no. Known pathway genes of withanolide biosynthesis Forward primer (5′→3′) Reverse primer (3′→ 5′)

1 1-Pyrroline-5-carboxylate synthetase (Δ1P5CS) GCTGAGCTGAGGTTACATCCAA GCAGACCTTCAAAAGCCTCAA


2 Glutathione S-transferase (GST) TGATGCCTTCGGATCCTTACA GCTGTTTCGTGTTCTTCCACTTT
3 Superoxide dismutase (SOD) CAGCCGCTCCGATGAAACT GAAATGCAGGCGGAAGGATT
4 Serine threonine-protein kinase (STK) GAAGTGGCGGTGTCACATTG TTTGGTAGCTCGCTCTTGCTT
5 Serine threonine protein phosphatase (PSP) GAAGCTAGCAAAAACCCCATGA TTGCATCAACCCCTGGACTT
6 Aldehyde dehydrogenase (AD) TCTGAAAGTAACAGCCCGACAGA CCACCCCAACGAGCAATAAG
7 Leucoanthocyanidin dioxygenase (LD) CCTGCAAGTAATGGGAAGCAA GTATGGAAGCAGACTAGGAGTGGAA
8 Heat shock protein (HSP70) CCGATAACCAACCTGGAGTATTG GGGAATACCGGAAAGCTCAAA
9 MYB transcription factor AGGCAACGAACTTACCGATCA TGAAATGGAAACCCGAAACC
10 WRKY transcription factor CAGTCAGATGGGAACTCATTCTTG CTGGCGTTTTTGGTATTAAGTGAA

The primers were used for expression profiling study through real-time PCR analysis in W. somnifera under drought stress

Quantitative real-time PCR Srivastava et al. 2008). A spherisorbs C18 (250×4.6 mm


i.d.) 10 μm particle size ODS2 column (Waters, Milford,
qRT–PCR was performed in 384-well plates using the MA, USA) was used with a 40:60 (v/v) mix of acetonitrile/
ABI 7900HT RT–PCR detection system. Three different 0.1 % (v/v) trifluoroacetic acid in water as the mobile phase.
biological replicates for each treatment were used. Each The flow rate was 1.0 mL min−1, and the detector wavelength
reaction mixture consist of 2 μL cDNA, 15 μL SYBR was 220 nm. The standard samples of withaferin A, 12
green mix (2×) (TaKaRa), 2 μL (5 pmol/μL) of both Deoxywithanostramonoside, Withanolides-A were purchased
forward and reverse primers, and 11 μL PCR-grade wa- from ChromaDex (Irvine, CA, USA).
ter equating to a final volume of 30 μL. This reaction
mix was dispensed in a 396-well PCR plate in tripli-
cates. The thermal profile of the reaction was an initial Data analysis
denaturation at 95 °C for 2 min, followed by 40 cycles
at 95 °C for 10 s and 60 °C for 10 s. This was follow- To study the level of significance, ANOVA was performed
ed by fluorescence acquisition after each cycle. All sam- between watered and drought treated samples at each time
ples for each reference gene were run on the same plate point for all physiological and biochemical data. Level of
to avoid between-run variations. Baseline and Ct values significance was shown as *p <0.05, **p <0.001, and
were automatically calculated by the Sequence Detection ***p <0.0001.
Systems (SDS) software version 2.2.1 (Applied
Biosystems). The relative quantification of transcript
abundance was done using the ΔΔCT method with de-
fault parameters. The relative quantity was calculated as Results
RQ=2−ΔΔCT (Livak and Schmittgen 2001; Pfaffl 2001).
18S gene allowed us to calibrate the signal output and Water status of the plants
correct for sample-to-sample variability.
Relative water content (RWC) of the leaf was measured to
Chemical analysis for estimation of withanolides determine the stage of drought. On the second, fifth, and sev-
during drought stress enth day of drought, leaf water content decreased by 5.3, 31,
and 51 %, respectively (Fig. 2a). On re-watering of the plants,
Four grams of dried leaf tissues were powdered for the RWC again increased. Osmotic potential (ψ) of the leaf
withanolide extraction and analysis. The protocol for extrac- was measured during drought and recovery. Ψ varied between
tion was followed as described previously (Chaurasiya et al. −1.5 and −2 MPa under watering condition while it reached
2008). The powder was extracted with 10 mL warm (50 °C) up to −5 MPa on the seventh day of drought (Fig. 2b). The
menthol for 4 h and filtered through Whatman filter paper no. membrane damage also increased as drought increased which
1. This process was repeated three times and the combined was measured as the percent conductivity. Relative conductiv-
methanol extracts were concentrated under vacuum for high- ity increased by 1.6, 2, and 2.5 times, respectively, on the
performance liquid chromatography (HPLC) analysis using second, fifth, and seventh day of drought as compared to their
the conditions reported earlier (Scartezzini et al. 2007; watered plants (Fig. 2c).
Study of drought tolerance in Withania somnifera

Fig. 2 Relative water content of leaf (a), osmotic potential (b), and separate measurements. Level of significance showed as *p <0.05, **p
relative conductivity (c) of the control (blue bar) and drought-treated <0.001, and ***p <0.0001 at the top of each bar according to ANOVA
(red bar) samples of W. somnifera. Data represents the mean±SD of four

Photosynthetic parameters and pigment content day of drought and decreased on the seventh day due to mar-
ginal increase in chl a. At recovery, there was no difference in
As the drought progressed, leaves lost their turgidity (de- a/b ratio (Fig. 4d). Similarly, carotenoids and anthocyanin
creased RWC and ψ) due to which internal CO2 and photo- pigments play an important role in the protection of leaf from
synthesis rate of the leaf decreased (Fig. 3a). Photosynthesis high light under water stress condition. Carotenoid content
rate decreased by 19 and 80 % on the second and fifth day of decreased during the second to seventh day of drought stress
drought and remained constant on further continuation of and did not recover during rewatering (Fig. 5a, b).
drought. Along with photosynthesis rate, stomatal conduc- Anthocyanin pigment showed an increasing trend with
tance and transpiration also decreased (Fig. 3b, c). Water use drought. It increased by 2.2, 2.4, and 5.4 times as compared
efficiency (WUE), which is calculated as the ratio of photo- to control plants on the second, fifth, and seventh day of
synthesis and transpiration rates, decreased on the second and drought, respectively. MDA and proline contents reflect the
fifth day of drought. However, WUE increased by 1.2-fold on grades of cellular damage. The level of MDA showed an
the seventh day of drought as compared to the control increasing trend with drought responses. It increased by 34,
plants (Fig. 3d). All the aforementioned gas exchange 41, 80, and 31 % on the second, fifth, and seventh day and
parameters showed almost 100 % recovery after 5 days recovery, respectively, as compared to the control (Fig. 5c, d).
of withdrawal of drought stress except in the stomatal conduc- The proline content increased significantly (p≤0.05) during
tance (Fig. 3a–c). Chlorophyll pigments are the major light every time period of drought stress as compared to control.
harvesting compounds present in the leaf. Under water stress, The proline content increased 2.2 times on the second day, 3.1
chl a degraded along with chl b with progress of drought. Chl times on the fifth and seventh day of drought stress. On re-
b degraded more while chl a/b ratio increased up to the fifth covery, the proline content showed marginal variation
day of drought. On the seventh day of drought, chl a increased (Fig. 5d). Some ROS scavengers were also measured during
marginally and chl b decreased. During recovery, chl a and b drought stress. Cellular content of SOD showed a 1.2-fold in-
recovered by 74 and 50 %, respectively, in 5 days (Fig. 4a, b). crease at the second day and 3-fold increase at the fifth and
Total chl content also decreased progressively during the sec- seventh day of drought (Fig. 6a). However, the cellular GST
ond to seventh day of drought and increased under recovery content increased 1.1, 1.4, and 1.7 times at the second, fifth, and
condition (Fig. 4a–d). Chl a/b ratio increased up to the fifth seventh day of drought as compared to control plants (Fig. 6b).
Sanchita et al.

Fig. 3 Net photosynthesis rate (a), stomatal conductance (b), represents the mean±SD of four replicates. Level of significance calcu-
transpiration rate (c), and water use efficiency (d) of the control (blue lated by ANOVA and showed as *p <0.05 and **p <0
bar) and drought-treated (red bar) samples of W. somnifera. Data

Fig. 4 Chlorophyll a (a), chlorophyll b (b), chlorophyll a+b (c), and chlorophyll a/b (d) of the control (blue bar) and drought-treated (red bar) leaves of
W. somnifera. Data represents the mean±SD of four samples and level of significance shown as *p <0.05, **p <0.001, and ***p <0.0001
Study of drought tolerance in Withania somnifera

Fig. 5 Carotenoid content (a), anthocyanin (b), lipid peroxidation of W. somnifera. Data represents the mean±SD of six separate measure-
expressed in terms of MDA concentration (c), and cellular content of ments. Level of significance considered as *p <0.05, **p <0.001, and
proline (d) of the control (blue bar) and drought-treated (red bar) samples ***p <0.0001

Energy distribution between photosynthesis and quenching at different light intensity under drought stress (Fig. 7c).
of PSI and PSII in W. somnifera under severe (seventh day) Y(NA) represents the fraction of overall P700 that cannot be
drought stress oxidized by a saturation pulse in a given state due to a lack of
oxidized acceptors. Y(NA) did not show any change at any
Photochemical quantum yield of PSI and PSII [Y(I) and light intensity under drought stress (Fig. 7d). This may be due
Y(II)] decreased at different light intensity under drought to degradation of the chlorophyll and reduction in PQ pool
stress (Fig. 7a, b). Y(I) marginally increased at low light size. The fraction of energy that is passively dissipated in the
intensity (0 to 75 μmol m−2 s−1) and decreased by 50 form of heat and fluorescence in PSII, Y(NO), i.e., the quan-
and 75 % at moderate and high light intensity (300–400 tum yield of non-regulated energy dissipation, also increased
and 1800 μmol m−2 s−1), respectively (Fig. 7a). Similarly, by 1.5 times as compared to watered plants at different light
Y(II) decreased by 10, 50, and 70 % at low, moderate, and intensity under drought stress (Fig. 7e). The fraction of energy
high light intensity, respectively (Fig. 7b). The fraction of dissipated as heat via the regulated non-photochemical
overall P700 that is oxidized in a given state, Y(ND), increased quenching mechanism Y(NPQ) strongly increased under

Fig. 6 Cellular level of SOD (a) and glutathione S-transferase and GST measurements. Level of significance shown as *p <0.05, **p <0.001,
activity (b) of the control (blue bar) and drought-treated (red bar) samples and ***p <0.0001 according to ANOVA
of W. somnifera. Data represents the mean ± SD of six separate
Sanchita et al.

Fig. 7 Calculated parameters for


the PSI and PSII at the seventh
day of drought at different light
intensities (light response curve).
Photochemical quantum yield of
PSI, Y(I) (a), photochemical
quantum yield of PSII, Y(II) (b),
quantum yield of non-
photochemical energy dissipation
due to donor side limitation,
Y(ND) (c), quantum yield of non-
photochemical energy dissipation
due to acceptor side limitation,
Y(NA) (d), quantum yield of non-
regulated energy dissipation,
Y(NO) (e), quantum yield of reg-
ulated energy dissipation,
Y(NPQ) (f), electron transfer rate
through the PSI, ETR(I) (g), and
electron transfer rate through the
PSII, ETR(II) (h). Data represents
the mean±SD of six separate
measurements

severe drought stress at different light intensity (Fig. 7f). ETR Chemical profiling of secondary metabolites
through PSI and PSII also decreased under water stress con-
dition at different light intensity under water stress condition. Variation in secondary metabolites were studied under effect of
ETR followed the same trend as Y(I) and Y(II) (Fig. 7g, h). drought stress conditions. The extent of variation of accumula-
tion of secondary metabolites in plants also depends upon spe-
cies, growth condition, and tissues (Martin et al. 2003; Kannan
Relative expression analysis in leaf tissues of W. somnifera

The expression profiling of key genes of different categories


have been performed using leaf tissues for control and drought
stress samples of W. somnifera. The modulation of secondary
metabolites due to stress response involves changes in expres-
sion of responsible genes. The up and down expression of
different genes might be involved in the alteration of produc-
tion of different secondary metabolic compounds. All the
genes considered in this study were overexpressed as com-
pared to control sample. Under drought condition, the expres-
sion of osmoregulatory genes, Δ1P5CS, increased 12.3 times.
GST and SOD, the detoxifying genes, have shown 9 and 69
times increased expression, respectively. The genes
responding to signaling pathways, STK and PSP, were
overexpressed 14.4 and 12 times, respectively, and the genes
Fig. 8 Comparative expression profiling of genes associated with
of metabolic pathways, AD and LD, were overexpressed 30
drought tolerance in leaf tissue of W. somnifera at the seventh day of
and 9.3 times, respectively. The transcription factor coding water stress. Relative fold change calculated as compared to watering
genes HSP, MYB, and WRKY have shown 8.3, 27.7, and control plants. Data represents the mean ± SD of three separate
28.5 times overexpression, respectively (Fig. 8). measurements
Study of drought tolerance in Withania somnifera

Fig. 9 Comparative analysis of


withanolide contents in control
and seventh-day drought-treated
samples of leaf tissues of
W. somnifera. Data represents the
mean±SD of three separate
measurements

and Kulandaivelu 2011). The assays were successfully used to Adams 2006; Pogson et al. 2005). Anthocyanin is another
quantify major compounds of the secondary metabolism of pigment, which increases under drought stress. They act as
W. somnifera, such as withaferin-A, 12-withastromonolides, light attenuators, protecting photosynthetic machinery from
and withanolide-A. The quantity of withaferin-A increased by high light stress by absorption of high-energy from blue-
42.7 %, whereas 12-withastromonolides and withanolide-A green wavelengths of the solar spectrum (Ranjan et al. 2014;
showed a decrease of 78 and 71 %, respectively (Fig. 9). Chalker-Scott 1999). The anthocyanin pigments do not trans-
fer the absorbed light energy to the photosynthetic apparatus
and protect photosystems from photoinhibition (Hogewoning
Discussion et al. 2012). The gene coding for leucocyanidin dioxygenase
(LD) is involved in anthocyanin biosynthesis (Petrussa et al.
Drought is a well-characterized abiotic stress in which water 2013). Anthocyanin is the pigment synthesized via flavonoids
supply is a major limitation along with high temperature, low biosynthesis. The production of anthocyanin in plants is a
humidity, and intense light. Primarily leaf water content is clear visible marker for plant response to unfavorable growth
reported to be reduced due to stomatal closure, CO2 supply conditions (Chalker-Scott 1999). Our study revealed that the
limitation, and photosynthetic rate to an extent of 60–80 % higher expression of LD leads to increase in the synthesis of
during drought condition (Marchese et al. 2010; Silva anthocyanin (Figs. 5b and 8). The variations of carotenoids
et al. 2009; Singh et al. 2014a). Decreased photosynthesis content were in accordance with an earlier report on drought
fully copes with degradation of chlorophyll (Chl) and ca- stress experiment in tobacco (Mackova et al. 2013). The
rotenoid content. Carotenoid content decreases more drought stress leads to a high level of malondialdehyde
rapidly as compared to Chl content and Chl/ (MDA) content. The MDA are synthesized in plant cells
carotenoids ratio increases during drought stress. The through lipid peroxidation. The up expression of aldehyde
distinctive yellow color of light-harvesting carotenoids dehydrogenase (AD) level of MDA through catalyzing the
becomes more apparent in leaves during drought when chlo- oxidation process of aldehydes formed during stress can be
rophyll degrades. Carotenoids are required for the correct as- correlated to high MDA accumulation. Several reports are
sembly and functioning of photosystems to maintain CO2 as- available on development of transgenics through overexpres-
similation (Li et al. 2009; Pogson et al. 2005). They absorb sion of AD gene conferring the tolerance against abiotic stress
light across a broader range of sun irradiance and transfer the as well as reducing the level of MDA derived from cellular
energy to chlorophyll, thus performing photochemical events lipid peroxidation (Huang et al. 2008; Kotchoni et al. 2006).
of photosynthesis (Polivka and Frank 2010). In plants, carot- Increased MDA content and AD gene expression fully corre-
enoids are bound in discrete pigment–protein complexes re- lates with increased electrolyte leakage (in terms of percent
ferred to as the LHCII trimeric complex, which typically ben- conductivity) under water stress in W. somnifera (Figs. 2c, 5c,
efits from lutein, neoxanthin, as well as violaxanthin to trans- and 8). It is reported that in stress condition, proline act as both
fer energy to chlorophyll and protect the plant from metabolite as well as signal molecule (Szabados and Savoure
photoinhibition (Dall’Osto et al. 2010; Demmig-Adams and 2010). Proline is synthesized via two pathways, i.e., glutamine
Sanchita et al.

and ornithine pathways. However, it is mainly synthesized MAPKs are involved in signaling pathway phosphorylating
through glutamine pathway. Δ1P5CS enzyme of this pathway the specific serine/threonine residues on the target protein and
belonging to aldehyde dehydrogenase family is a novel bi- regulate a variety of cellular activities against different types
functional enzyme that catalyzes the first two steps of proline of stress conditions (Zhu 2002). In contrast to STK, phospho-
biosynthesis in plants (Kavi-Kishor et al. 2005). The relation- protein phosphatase (PSP) is a group of protein that dephos-
ship among proline content, expression of Δ1-pyroline-5-car- phorylates the substrate proteins. Although PSPs are involved
boxylate synthetase (Δ1P5CS), and drought tolerance justifies in a wide range of cellular processes, including meiosis and
the higher accumulation of proline (Denga et al. 2013). In our cell division, apoptosis, protein synthesis, metabolism, cyto-
study, proline accumulation with increased expression of skeleton reorganization, and the regulation of membrane re-
Δ1P5CS under drought stress was observed (Figs. 5d and 8). ceptors and channels (Ceulemans and Bollen 2004), they are
The role of up-regulation of Δ1P5CS leading to proline accu- mainly the negative regulator for ABA signaling. They are
mulation has earlier been studied in Arabidopsis thaliana un- also known to be involved in providing resistance against
der osmotic stress condition (Yoshiba et al. 1995). The proline drought stress in A. thaliana (Bhaskara et al. 2012; Pizzio
content is reported to be enhanced significantly with the in- et al. 2013). The transgenic studies based on PSP have also
crease in drought stress, suggesting to maintain the plant cell’s been done for drought stress resistance in different plants
water potential more negative and enhance active absorption (Zhang et al. 2013; Xu et al. 2007). HSPs are small protein
of water (Fan et al. 2011). The reactive oxygen species (ROS) molecules translated by HSP genes which accumulate in re-
production is related to normal functioning of the cell-like sponse to heat shock. In expression analysis of leaf tissue of
aerobic metabolism (Moller 2001) and photosynthesis W. somnifera, we found high HSPs expression in drought-
(Asada 1999). The excess ROS are detoxified through antiox- treated samples. HSPs function as H2O2 sensors and help to
idant enzymes to make a balance in the formation and elimi- maintain the level of H2O2 scavengers like antioxidant en-
nation of ROS (Alvarez et al. 2009). It has been reported that zymes (Miller and Miller 2006). The increased level of
the overexpression of antioxidant enzymes is the indication of HSPs expression or HSPs content in cotton (Burke et al.
mechanism of plant tolerance against ROS (Gill and Tuteja 1985), A. thaliana (Mu et al. 2013), and Nicotiana tabacum
2010). In our analysis, the expression of genes coding for (Rizhsky et al. 2002) has already been reported under water
antioxidant enzymes, glutathione S-transferase (GST), and su- stress condition. The enhanced tolerance to drought/osmotic
peroxide dismutase (SOD) have shown increased expression. stress has been studied in transgenic A. thaliana showing
SOD converts superoxide to H2O2, which is further scavenged overexpression of heat shock protein (Mu et al. 2013). Thus,
by catalase. So, the antioxidant genes as well as compounds HSPs may play a key role in imparting tolerance to
have proven to be a good mode for reducing the cell toxicity W. somnifera against drought. WRKY is a transcription factor
caused due to ROS. The gene manipulation study through protein family, which is highly induced by abiotic stresses
antioxidant genes for developing transgenic plants may be a (Ulker and Somssich 2004). It modulates jasmonic acid-,
good approach for reducing the level of ROS. The role of abscisic acid-, and salicylic acid-induced signaling events dur-
overexpression of GST and SOD genes in stress tolerance ing pathogen attack (Li et al. 2006) and osmotic stress (Chen
has also been justified in earlier reports (Alscher et al. 2002; et al. 2010). In our study, the overexpression of WRKY cod-
Liu et al. 2013; Sharma et al. 2014; Tsang et al. 1991). In our ing gene showed its role in drought tolerance mechanism.
study, the cellular content of SOD and GST fully correlates Another transcription factor, MYB, has also shown the over-
with gene expression data. The anthocyanins are also reported expression in W. somnifera for its response against drought
as non-enzymatic antioxidant agents scavenging the accumu- stress. MYB is reported to be involved in various processes of
lated ROS (Johnson et al. 2003). The increased GST content plant growth, development, and stress response. It has been
along with GST gene expression under water stress in reported to show its role in drought stress tolerance in
Gossypium sp. is also available in an earlier report (Singh A. thaliana (Zhang et al. 2012), rice (Xiong et al. 2014), and
et al. 2014b). Our results revealed an increase in the levels potato (Shin et al. 2011) through transgenic approach. The
of anthocyanin with the increase in duration of drought stress drought stress tolerance in any medicinal plants leads to the
for detoxification of ROS. Serine/threonine specific protein increase in the level of secondary metabolism. An earlier
kinase (STK) is a group of kinase proteins having the role in study has reported a 5 % increase in withaferin-A content
phosphorylation of the OH group of serine or threonine under water stress as compared to control (Kannan and
(Sanchita et al. 2014). STK group consists of different types Kulandaivelu 2011). In the present study, under stress condi-
of kinase proteins, viz., mitogen-activated protein kinase tion, the genes responsible for withaferin-A biosynthesis may
(MAPK), calmodulin-dependent protein kinases (CaM), pro- possibly be overexpressed, but the reverse phenomena was
tein kinase A (PKA) and C (PKC), and phosphorylase kinase observed in the case of 12-deoxy-withastromonolides and
(PhK). In this study, MAPK was selected for the expression withanolide-A (Fig. 9). The down expression of genes respon-
analysis under drought stress and showed the overexpression. sible for the synthesis of these two withanolides might exist.
Study of drought tolerance in Withania somnifera

The results are in accordance with the earlier study reported on Denga G, Lianga J, Xua D, Longa H, Pana ZH, Yua M (2013) The
relationship between proline content, the expression level of P5CS
the effect of drought stress on reduction of 12-deoxy-
(Δ1-pyrroline-5-carboxylate synthetase), and drought tolerance in
withastromonolides and withanolide-A contents (Shah Tibetan hulless barley (Hordeum vulgare var. nudum). Russ J Plant
et al. 2010). Physl 60(5):693–700
Dinakar C, Djilianov D, Bartels D (2012) Photosynthesis in desiccation
Acknowledgments The authors S, RS, and AM are thankful to CSIR, tolerant plants: energy metabolism and antioxidative stress defense.
New Delhi, India for CSIR-SRF fellowship. Plant Sci 182:29–41
Faize M, Burgos L, Faize L, Piqueras A, Nicolas E, Barba-Espin G,
Conflict of interest The authors declare that no conflicting interests Clemente-Moreno MJ, Alcobendas R, Artlip T, Hernandez JA
exist. (2011) Involvement of cytosolic ascorbate peroxidase and Cu/Zn-
superoxide dismutase for improved tolerance against drought stress.
J Exp Bot 62(8):2599–2613
Fan SL, Yuan ZH, Feng LJ, Wang XH, Ding XM, Zhen HL (2011)
References Effects of drought stress on physiological and biochemical parame-
ters of Dahlia pinnata. Ying Yong Sheng Tai Xue Bao 22(3):651–
657
Agarwal PK, Shukla PS, Gupta K, Jha B (2013) Bioengineering for
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant ma-
salinity tolerance in plants: state of the art. Mol Biotechnol 54(1):
chinery in abiotic stress tolerance in crop plants. Plant Physiol Bioch
102–123
48(12):909–930
Alscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases
Heath RL, Packer L (1968) Photoperoxidation in isolated chloroplasts. I.
(SODs) in controlling oxidative stress in plants. J Exp Bot 53(372):
Kinetics and stoichiometry of fatty acid peroxidation. Arch Biochem
1331–1341
Biophys 125(1):189–198
Alvarez S, Zhu M, Chen S (2009) Proteomics of Arabidopsis redox
Hogewoning SW, Wientjes E, Douwstra P, Trouwborst G, van Ieperen W,
proteins in response to methyl jasmonate. J Proteomics 73(1):30–40
Croce R, Harbinson J (2012) Photosynthetic quantum yield dynam-
Asada K (1999) The water-water cycle in chloroplasts: scavenging of
ics: from photosystems to leaves. Plant Cell 24(5):1921–1935
active oxygens and dissipation of excess photons. Annu Rev Plant
Huang W, Ma X, Wang Q, Gao Y, Xue Y, Niu X, Yu G, Liu Y (2008)
Physiol Plant Mol Biol 50:601–639
Significant improvement of stress tolerance in tobacco plants by
Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free
overexpressing a stress-responsive aldehyde dehydrogenase gene
proline for water-stress studies. Plant Soil 39(1):205–207
from maize (Zea mays). Plant Mol Biol 68(4–5):451–463
Bhaskara GB, Nguyen TT, Verslues PE (2012) Unique drought resistance
Johnson SM, Doherty SJ, Croy RRD (2003) Biphasic superoxide gener-
functions of the highly ABA-induced clade A protein phosphatase
ation in potato tubers. A self-amplifying response to stress. Plant
2Cs. Plant Physiol 160(1):379–395
Physiol 131(3):1440–1449
Boyer JS, James RA, Munns R, Condon T, Passioura JB (2008) Osmotic
Kannan ND, Kulandaivelu G (2011) Drought induced changes in phys-
adjustment leads to anomalously low estimates of relative water
iological, biochemical and phytochemical properties of Withania
content in wheat and barley. Funct Plant Biol 35(11):1172–1182
somnifera Dun. J Med Plants Res 5(16):3929–3935
Burke JJ, Hatfield JL, Klein RR, Mullet JE (1985) Accumulation of heat
shock proteins in field-grown cotton. Plant Physiol 78(2):394–398 Kavi-Kishor PB, Sangam S, Amrutha RN, Sri Laxmi P, Naidu KR, Rao
KRSS, Rao S, Reddy KJ, Theriappan P, Sreenivasulu N (2005)
Ceulemans H, Bollen M (2004) Functional diversity of protein
Regulation of proline biosynthesis, degradation, uptake and trans-
phosphatase-1, a cellular economizer and reset button.
port in higher plants: its implications in plant growth and abiotic
Physiol Rev 84(1):1–39
stress tolerance. Curr Sci 88(3):424–438
Chalker-Scott L (1999) Environmental significance of anthocyanins in
plant stress responses. J Photochem Photobiol 70(1):1–9 Kotchoni SO, Kuhns C, Ditzer A, Kirch HH, Bartels D (2006) Over-
expression of different aldehyde dehydrogenase genes in
Chaurasiya ND, Uniyal GC, Lal P, Misra L, Sangwan NS, Tuli R,
Arabidopsis thaliana confers tolerance to abiotic stress and protects
Sangwan RS (2008) Analysis of withanolides in root and leaf of
plants against lipid peroxidation and oxidative stress. Plant Cell
Withania somnifera by HPLC with photodiode array and evapora-
Environ 29(6):1033–1048
tive light scattering detection. Phytochem Anal 19(2):148–154
Li J, Brader G, Kariola T, Palva ET (2006) WRKY70 modulates the
Chen H, Lai Z, Shi J, Xiao Y, Chen Z, Xu X (2010) Roles of Arabidopsis
selection of signaling pathways in plant defense. Plant J 46(3):
WRKY18, WRKY40 and WRKY60 transcription factors in plant
477–491
responses to abscisic acid and abiotic stress. BMC Plant Biol 10:281
Li Z, Wakao S, Fischer BB, Niyogi KK (2009) Sensing and responding to
Chen JH, Jiang HW, Hsieh EJ, Chen HY, Chien CT, Hsieh HL, Lin TP
excess light. Annu Rev Plant Biol 60:239–260
(2012) Drought and salt stress tolerance of an Arabidopsis glutathi-
one S-transferase U17 knockout mutant are attributed to the com- Liu D, Liu Y, Rao J, Wang G, Li H, Ge F, Chen C (2013) Overexpression
bined effect of glutathione and abscisic acid. Plant Physiol 158(1): of the glutathione S-transferase gene from Pyrus pyrifolia fruit im-
340–351 proves tolerance to abiotic stress in transgenic tobacco plants. Mol
Cruz de Carvalho MH (2008) Drought stress and reactive oxygen species: Biol (Mosk) 47(4):591–601
production, scavenging and signaling. Plant Signal Behav 3(3):156– Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression
165 data using RealTime quantitative PCR and the 2−ΔΔCT method.
Dall'Osto L, Cazzaniga S, Havaux M, Bassi R (2010) Enhanced Methods 25(4):402–408
photoprotection by protein-bound vs free xanthophyll pools: a com- Mackova H, Hronkova M, Dobra J, Tureckova V, Novak O, Lubovska Z,
parative analysis of chlorophyll b and xanthophyll biosynthesis mu- Motyka V, Haisel D, Hajek T, Prasil IT, Gaudinova A, Storchova H,
tants. Mol Plant 3(3):576–593 Ge E, Werner T, Schmulling T, Vankova R (2013) Enhanced
Demmig-Adams B, Adams WW 3rd (2006) Photoprotection in an eco- drought and heat stress tolerance of tobacco plants with ectopically
logical context: the remarkable complexity of thermal energy dissi- enhanced cytokinin oxidase/dehydrogenase gene expression. J Exp
pation. New Phytol 172(1):11–21 Bot 64(10):2805–2815
Sanchita et al.

Makbul S, Guler NS, Durmus N, Guven S (2011) Changes in anatomical Shin D, Moon SJ, Han S, Kim BG, Park SR, Lee SK, Yoon HJ, Lee HE,
and physiological parameters of soybean under drought stress. Turk Kwon HB, Baek D, Yi BY, Byun MO (2011) Expression of
J Bot 35(4):369–377 StMYB1R-1, a novel potato single MYB-like domain transcription
Marchese JA, Ferreira JFS, Rehder VLG, Rodrigues O (2010) Water factor, increases drought tolerance. Plant Physiol 155(1):421–432
deficit effect on the accumulation of biomass and artemisinin in Shulaev V, Oliver DJ (2006) Metabolic and proteomic markers for oxi-
annual wormwood (Artemisia annua L., Asteraceae). Braz J Plant dative stress. New tools for reactive oxygen species research. Plant
Physiol 22(1):1–9 Physiol 141(2):367–372
Martin DM, Gershenzon J, Bohlmann J (2003) Induction of volatile ter- Silva EC, Nogueira RJMC, Vale FHA, Melo NF, Araujo FP (2009) Water
pene biosynthesis and diurnal emission by methyl jasmonate in fo- relations and organic solutes production in four umbu tree (Spondias
liage of Norway spruce. Plant Physiol 132(3):1586–1599 tuberosa) genotypes under intermittent drought. Braz J Plant Physiol
Miller G, Miller R (2006) Could heat shock transcription factors function 21(1):43–53
as hydrogen peroxide sensors in plants? Ann Bot 98:279–288 Singh R, Naskar J, Pathre UV, Shirke PA (2014a) Reflectance and cyclic
Moller IM (2001) Plant mitochondria and oxidative stress: electron trans- electron flow as an indicator of drought stress in cotton (Gossypium
port, NADPH turnover, and metabolism of reactive oxygen species. hirsutum). Photochem Photobiol 90(3):544–551
Annu Rev Plant Physiol Plant Mol Biol 52:561–591 Singh R, Pandey N, Naskar J, Shirke PA (2014b) Physiological perfor-
Mu C, Zhang S, Yu G, Chen N, Li X, Liu H (2013) Overexpression of mance and differential expression profiling of genes associated with
small heat shock protein LimHSP16.45 in Arabidopsis enhances drought tolerance in contrasting varieties of two Gossypium species.
tolerance to abiotic stresses. PLoS One 8(12):e82264 Protoplasma. doi:10.1007/s00709-014-0686-0
Murray JR, Hackett WP (1991) Dihydroflavonol reductase activity in Srivastava P, Tiwari N, Yadav AK, Kumar V, Shanker K, Verma RK,
relation to differential anthocyanin accumulation in juvenile and Gupta MM, Gupta AK, Khanuja SPS (2008) Simultaneous quanti-
mature phase Hedera helix L. Plant Physiol 97(1):343–351 fication of withanolides in Withania somnifera by a validated high-
Petrussa E, Braidot E, Zancani M, Peresson C, Bertolini A, Patui S, performance thin-layer chromatographic method. J Aoac Int 91(5):
Vianello A (2013) Plant flavonoids—biosynthesis, transport and 1154–1161
involvement in stress responses. Int J Mol Sci 14(7):14950–14973 Szabados L, Savoure A (2010) Proline: a multifunctional amino acid.
Pizzio GA, Rodriguez L, Antoni R, Gonzalez-Guzman M, Yunta C, Trends Plant Sci 15(2):89–97
Merilo E, Kollist H, Albert A, Rodriguez PL (2013) The PYL4
Tsang EWT, Bowler C, Herouart D, Vancamp W, Villarroel R, Genetello
A194T mutant uncovers a key role of PYR1-LIKE4/protein phos-
C, Vanmontagu M, Inze D (1991) Differential regulation of super-
phatase 2CA interaction for abscisic acid signaling and plant
oxide dismutases in plants exposed to environmental-stress. Plant
drought resistance. Plant Physiol 163(1):441–455
Cell 3(8):783–792
Pfaffl MW (2001) A new mathematical model for relative quantification
Ulker B, Somssich IE (2004) WRKY transcription factors: from
in real-time RT–PCR. Nucleic Acids Res 29(9):1–6
DNA binding towards biological function. Curr Opin Plant
Pogson BJ, Rissler HM, Frank HA (2005) The roles of carotenoids in
Biol 7(5):491–498
photosystem II of higher plants. In: Wydrzynski KS T (ed)
Verma SK, Kumar A (2011) Therapeutic uses of Withania somnifera
Photosystem II: the light-driven water: plastoquinone oxidoreduc-
(ashwagandha) with a note on withanolides and its pharmacological
tase. Springer, Dordrecht, pp 515–537
actions. Asian J Pharm Clin Res 4:1–4
Polivka T, Frank HA (2010) Molecular factors controlling photosynthetic
light harvesting by carotenoids. Acc Chem Res 43(8):1125–1134 Wellburn AR (1994) The spectral determination of chlorophylls a and b,
Ramakrishna A, Ravishankar GA (2011) Influence of abiotic stress sig- as well as total carotenoids, using various solvents with spectropho-
nals on secondary metabolites in plants. Plant Signal Behav 6(11): tometers of different resolution. J Plant Physiol 144:307–313
1720–1731 Xiong H, Li J, Liu P, Duan J, Zhao Y, Guo X, Li Y, Zhang H, Ali J, Li Z
Ranjan S, Singh R, Singh M, Pathre UV, Shirke PA (2014) Characterizing (2014) Overexpression of OsMYB48-1, a novel MYB-related tran-
photoinhibition and photosynthesis in juvenile-red versus mature- scription factor, enhances drought and salinity tolerance in rice.
green leaves of Jatropha curcas L. Plant Physiol Biochem 79:48–59 PLoS One 9(3):e92913
Rizhsky L, Liang H, Mittler R (2002) The combined effect of drought Xu C, Jing R, Mao X, Jia X, Chang X (2007) Awheat (Triticum aestivum)
stress and heat shock on gene expression in tobacco. Plant Physiol protein phosphatase 2A catalytic subunit gene provides enhanced
130(3):1143–1151 drought tolerance in tobacco. Ann Bot 99(3):439–450
Sanchita, Dhawan SS, Sharma A (2014) Analysis of differentially Yoshiba Y, Kiyosue T, Katagiri T, Ueda H, Mizoguchi T, Yamaguchi-
expressed genes in abiotic stress response and their role in signal Shinozaki K, Wada K, Harada Y, Shinozaki K (1995) Correlation
transduction pathways. Protplasma 251(1):81–91 between the induction of a gene for Δ1-pyrroline-5-carboxylate
Scartezzini P, Antognoni F, Conte L, Maxia A, Troia A, Poli F (2007) synthetase and the accumulation of proline in Arabidopsis thaliana
Genetic and phytochemical difference between some Indian and under osmotic stress. Plant J 7(5):751–760
Italian plants of Withania somnifera (L.) Dunal. Nat Prod Res Zhang J, Li X, He Z, Zhao X, Wang Q, Zhou B, Yu D, Huang X, Tang D,
21(10):923–932 Guo X, Liu X (2013) Molecular character of a phosphatase 2C
Shah S, Saravanan R, Gajbhiye NA (2010) Phytochemical and physio- (PP2C) gene relation to stress tolerance in Arabidopsis thaliana.
logical changes in Ashwagandha (Withania somnifera Dunal) under Mol Biol Rep 40(3):2633–2644
soil moisture stress. Braz J Plant Physiol 22(4):255–261 Zhang L, Zhao G, Xia C, Jia J, Liu X, Kong X (2012) A wheat R2R3-
Sharma R, Sahoo A, Devendran R, Jain M (2014) Over-expression of a MYB gene, TaMYB30-B, improves drought stress tolerance in
rice tau class glutathione s-transferase gene improves tolerance to transgenic Arabidopsis. J Exp Bot 63(16):5873–5885
salinity and oxidative stresses in Arabidopsis. PLoS One 9(3): Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu
e92900 Rev Plant Biol 53:247–273