You are on page 1of 460

NU00128

lf 1111111111/llllllllflllflflll
Prefácio

Em seu prefácio da primeira edição do Genética Médica, publi- com exemplos tirados da medicina. Uma característica adicio-
cado há 35 anos, James e Margaret Thompson escreveram nal nova desta edição do Genética Médica é um conjunto de casos
destinados a demonstrar e reforçar os princíP,ios da herança,
A genética é fundamental para as ciências básicas da educação patogenia, diagnóstico, tratamento e informação genética das
médica pré-clínica, e tem importantes aplicações para a medicina doenças. O livro não pretende ser um compêndio de doenças
clínica, saúde pública e pesquisa médica. Com o reconhecimento genéticas, nem um tratado enciclopédico de genética humana em
do papel da genética na medicina, surgiu o problema de achar um
geral. Ao contrário, os aucores esperam que a sexta edição do
lugar para ela no currículo de graduação, um problema que só foi
resolvido parcialmente na maioria das escolas médicas. Este livro Genética Médica forneça aos estudantes um arcabouço para com-
foi escrito para introduzir o estudante de medicina nos princípios preenderem o campo da genética médica, oferecendo-lhes, ao
da genética aplicada à medicina, e oferecer-lhes uma base para a mesmo tempo, uma base sobre a qual estabelecer um programa
abordagem da extensa e aceleradamente crescente literatura no de educação continuada nessa área. Qualquer médico ou estu-
campo. Caso seus colegas graduados também o considerem útil, dante de consulta (co1mseling) genética, em curso avançado de
ficaremos duplamente satisfeitos. graduação, graduado em genética, residente em qualquer campo
da clínica médica, médico generalista ou das áreas médicas de
O que era antes verdade agora o é mais ainda, à medida que enfermagem ou fisioterapia, pode encontrar neste livro uma apre-
nossos conhecimentos de genética e do genoma vêin rapidamente sentação não-exaustiva dos fundamentos da genética humana
se tornando uma parte integral da saúde pública e da prática aplicada à saúde e à doença.
médica Esta nova edição do Genética Médica, a sexta da série,
tem a mesma meta que as cinco anteriores: fornecer uma expo-
sição precisa dos fundamentos da genética humana, com ênfase ROBERT L. NUSSBAUM, MD
nos genes e mecanismos moleculares que operam nas doenças RODERICK R. MclNNES, MD, PhD
humanas. Os conceitos apresentados neste texto são ilustrados HUNTINGTON F. WILLARD, PhD
Agradecimentos

Os autores desejam expressar seu apreço e gratidão aos muitos co- cine; Mark Kay, da Stanfo,:d University; Michael Hershfield, da
legas que, com suas idéias, sugestões e criticas, contribuíram para Duke University; Charles Scriver e Paula Waters, da McGill Uni-
melhorar esta edição revisada do Genética Médica . Em particular versity; Alex Levine, Joe Clarke, David Chitayet, Peter Ray e
somos gratos a Gregory Barsh, da Stanford University School of Donald Mahuran, do The Hospital for Sick Children, Toronto; Ants
Medicine, por sua extraordinária contribuição ao Cap. 17, Aspec- Toi, da University Health Network, Princess Margaret Hospital,
tos Genéticos do Desenvolvimento, e a Cheryl Shuman e Riyana Toronto; Peter St. George-Hyslop, da University of Toronto;
Babul, do The Hospital for Sick Children, em Toronto, pela ajuda Joseph Goldstein, da University ofTexas Southwestem Medical
no Cap. 18, Diagnóstico Pré-natal. Também agradecemos a Donald Center; Robert Desnick, da Mount Sinai School ofMedicine, New
Hadley e Sara Hull, do National Human Genome Research Insti- York; Diane Cox, da University of Alberta; e Douglas C. Wallace
tute; Richard Spielman, da University of Pennsylvania; Terry e John M. Shoffner, da Emory Urúversity.
Hassold, Pat Hunt e Stuart Schwartz, do Case Westem Reserve Os mais profundos agradecimentos a nossa colega e amiga
School ofMedicine; Eric Fearon, da University ofMichigan; David Ora. Margaret Thompson, não só por sua ajuda em rever o ma-
Ledbetter, da University of Chicago; Huda Zoghbi e Lisa Shaffer, terial, mas também por sua confiança e orientação durante o pro-
do Baylor College of Medicine; George Stamatoyannopoulos e cesso de revisão. Finalmente, agradecemos a nossas famílias por
Peter Byers, da University ofWashington; Aravinda Chakravarti, sua paciência e compreensão durante as muitas horas de traba-
David Valle e Garry Cutting, do Johns Hopkins School of Medi- lho consumidas na sexta edição do Genética Médica.
i
1 --
Introdução

O PAPEL DA GENÉTICA NA MEDICINA terações gene-gene e gene-ambiente nas doenças; o papel das
mutações somáticas no câncer e no envelhecimento; a
Genética como uma Especialidade Médica exiqüibilidade do diagnóstico pré-natal, dos testes pré-sintomá-
ticos e da triagem populacional e a promessa de poderosas tera-
Esta é uma época especialmente estimulante na genética médica pias gênicas são conceitos que hoje penneiam toda a prática
e humana. A genética médica atingiu um papel reconhecido como médica e ficarão cada vez mais importantes no futuro. Assim, os
a especialidade da medicina que lida com o diagnóstico, o trata- fundamentos e os enfoques da genética não se restringem a ne-
mento e o controle dos distúrbios hereditários.. A idéia de que a nhuma subespecialidade única da medicina.
genética médica está envolvida apenas com a herança de carac- Um aspecto da prática da genética médica relevante para toda
te1isticas triviais, superficiais e raras cedeu lugar à compreensão a medicina merece ênfase especial: ele enfoca não só o paciente,
do papel fundamental do gene nos processos básicos da vida. Os mas também toda a família. Uma boa história familiar é uma
geneticistas médicos e humanos estão na fronteira das investi- primeira etapa importante na análise de qualquer distúrbio, seja
gações da variabilidade e da hereditadedade humana, enquanto ele genético ou não. Como destacou Childs, "não obter uma boa
também participam e se bene ficiam do rápido progresso da bio- história familiar é uma medicina ruim ... "Uma história familiar
logia molecular, da bioquímica e da biologia celular. Em parti- é importante porque ela pode ser crucial no diagnóstico, pode
cular, a última década do século XX e o começo do século XXI mostrar que um distúrbio é hereditário, pode dar infonnações
presenciaram o início do Projeto do Genoma Humano, um es- sobre. a história natural de uma doença e a variação em sua ex-
forço internacional para determinar o conteúdo completo do pressão e pode esclarecer o padrão de herança. O diagnóstico de
genoma humano, definido simplesmente como a soma total das urna condição hereditária permite que o risco seja avaliado para
informações genéticas de nossa espécie, codificadas dentro de outros membros da família, de modo que a conduta apropriada,
cada célula nucleada do corpo.. Em parceria com todas as outras a prevenção e a infonnação sejam oferecidas ao paciente e sua
disciplinas da biologia moderna, o Projeto do Genoma Humano família.
já está revolucionando a genética médica e humana, fornecendo
a compreensão de muitas doenças e promovendo o desenvol-
vimento de meios muito melhores de diagnóstico, medidas pre- Disciplinas dentro da Genética
ventivas e métodos terapêuticos em um futuro próximo Quan- Médica e Humana
do o Projeto do Genoma Humano estiver completo, ele possibi-
A genética é um tema diverso, envolvido com a variação e a
litará o conhecimento da seqüência completa de todo o DNA hu-
hereditariedade em todos os organismos vivos. Dentro deste
mano. O conhecimento da seqüência completa permitirá, por sua amplo campo, a genética humana é a ciência da variação e da
vez, a identificação de todos os genes humanos e, finalmente,
hereditariedade dos seres humanos, enquanto a genética médi-
possibilitará a determinação de corno as variações nestes genes ca lida com o subgrupo da variação genética humana que tem
contribuem para a saúde e a doença. significado na prática da medicina e na pesquisa médica.
Dentro da genética humana e médica, existem muitos cam-
-..,.'Relevância da Genética para Toda a pos de interesse, como indicado pelas várias direções nas quais
Prática Médica a genética tem se desenvolvido. As principais áreas reconheci-
das de especialização são o estudo dos cromossomos (citogené-
Embora a genética médica tenha se tornado uma especialidade tica); o estudo da estmtura e da função de genes individuais (ge-
reconhecida, também ficou bastante claro que a genética huma- nética molecular e bioquímica); o estudo do genoma, sua or-
na fornece conceitos unificadores impo1tantes que ilurrúnam e ganização e seu funcionamento (genônúca); o estudo da varia-
unificam toda a prática médica. Para dar aos pacientes e a suas ção genética nas populações humanas e os fatores que determi-
famílias o benefício total do conhecimento genético em expan- nam as freqüências alélicas (genética de populações); o estudo
são, todos os médicos e seus colegas da área de saúde precisam do controle genético do desenvolvimento (genética do desen-
compreender os princfpios subjacentes da genética humana A volvimento) e a aplicação da genética ao diagnóstico e aos cui-
existência de formas alternativas de um gene (alelos) na popula- dados do paciente (genética clínica) .. O significado literal de
ção; a ocorrência de fenótipos similares que se desenvolvem da clínica é à beira do leito (klinikos, do grego "ao lado do leito"),
mutação e da variação em toei diferentes; a importância das in- e um geneticista clínico é um médico geneticista apropriadamente
r

2 1 INTRODUÇÃO

qualificado que está envolvido de forma direta no diagnóstico Nos distúrbios cromossômicos, o defeito não se deve a um
de doenças genéticas e nos cuidados dos pacientes com tais do- únicoerro no códlgo geºnético;-m'ãs a'uiil"excessõ-oú'a i.lma
dêfí-
enças. A consulta genética*, que combina o fornecimento da dência dos genes'cõntiêlos-em cromossomos mteiros ou se8!!1en-
informação sobre o risco com o suporte psicológico e educacio- fos"éroino_is9nií.Ços.Por exemplo, a preseiiÇã<le-umâ-có-pia extra
nal, amadureceu para uma nova profissão de saúde, com toda uma de um cromossomo 21 produz um distúrbio específico, a síndro-
equipe de profissionais de genética dedicados aos cuidados dos me de Down, muito embora nenhum gene individual no cromos-
pacientes e suas famílias. somo seja anormal. Como um grupo, os distúrbios cromossômi-
Além do contato direto co.m o paciente, o médico geneticista cos são bem comuns, afetando cerca de 7 em cada 1.000 crian-
fornece cuidados às pessoas, por meio de diagnósticos laborato- ças nascidas vivas, e contribuindo com cerca de metade de to-
riais, e à população em geral, por meio de programas de triagem dos os abortos espontâileos de prlmeirõ_trimésltê:- · --- ----------
destinados a identificar pessoas em risco de desenvolver ou trans- . A herançà multüatorial é responsável por vários distúrbios
mitir uma doença genética. O diagnóstico de uma doença gené- do desenvolvimento que resultam em malformações congênitas
tica em pacientes, testes de portador, diagnóstico pré-natal e a e muitos distúrbios comuns da vida adulta. Parece não haver um
identificação de pessoas em risco de desenvolver uma doença euo único na informação genética em muitas destas condições.
mais tarde na vida são especialidades em rápida expansão nos A qg~_!lça resulta de uma combinação de pequenas variações no~
laboratórios clínicos. A triagem populacional de doenças gené- genes cjiiejiíiifai;" podem produzir ou predispor a um grave defei-
ticas também está se tomando cada vez mais difundida. .!°-~-~!11 ~~~ai em conjunto com fatg~biC?_ntai_~: Os distúrbios
multifatoriais tendem a recorrer nas famílias, mas não apresen-
tam os padrões característicos de heredogramas deêaraC:iérísti~
CLASSIFICAÇÃO DOS casfoõiiõ·g-êõicas: As estimativas do impacto da doença multifa-
DISTÚRBIOS GENÉTICOS torial variam de 5% na população pediátrica até mais de 60% na
população toda.
Na prática clínica, o principal significado da genética é no es-
clarecimento do papel da variação genética e da mutação na eti-
ologia de um grande número de distúrbios. Absolutamente qual- CONTINUIDADE
quer doença é o resultado da ação combinãclaoos genes e do
ambi~-~~;~as O_E~P~_!:~l~~.Y~.~~~~~.~~ente genético pode s~r Durante os 40 anos de vida profissional dos atuais estudantes de
grande ou pequeno, medicina e de consulta genética, grandes mudanças provavelmen-
Entieõs.distfubios causados total ou parcialmente por fato- te ocorrerão na avaliação - e na atividade - do papel da gené-
res genéticos, sao recorihec1dos trêf"__!!P.I?.~ P.i:!n_c~~· -- ··-······ tica na medicina. É difícil imaginar que qualquer período possa
englobar mudanças maiores que as vistas nos últimos 50 anos,
1. Distúrbios monogênicos durante os quais o campo foi desde o primeiro reconhecimento
2. Distúrbios cromossômico? da identidade do DNA como o agente ativo da herança até o
J . Distúrbios multifatoriais descobrimento da estrutura molecular do DNA e dos cromosso-
mos e a determinação do código completo do genoma humano.
Os distúrbios mo~ogênicos são causados E_~_gene~.1.!!~­ A julgar pelo passo acelerado das descobertas apenas na última
tantes individuais A mutação pode estar presente em apenas década, é certo que estamos no começo de uma revolução na
Úm cromossomo de um par (com um alelo normal no cromos- integração dos conhecimentos da genética e do genoma com a
somo homólogo) ou em ambos os cromossomos do par. Em saúde pública e a prática da medicina
alguns casos, a mutação é no genoma mitocondrial, e não no Uma introdução à linguagem e aos conceitos da genética hu-
nuclear Em qualquer caso, ª-c-ªusa é um erro crític.Q.J!~ .i~for­ mana e médica e uma apreciação da perspectiva genética e ge-
~ação genética levada por um único g~I!,e. Os distúrbios nômica na saúde e na doença formarão uma estrutura para a
m<;>_I10gêni cos ern_g~rn!..~-~i!2e._rp_p~<;lr.õ.§Â_Q
Í.].iere.4ogramXQQ- aprendizagem duradora, que é parte de qualquer carreira de um
vi os e característicos. A maioria destes defeitos é rara., com profissional de saúde
uma freqüência que pode ser tão alta quanto 1 em 500, mas
em geral é muito menor. Embora individualmente raros, os Referências Gerais
distúrbios monogênicos como um grupo, são responsáveis por Childs B (1982) Genetics in the medical curriculum Am J Med
uma proporção significativa de doenças e mortes. Conside- Gcnet 13:3 19-324.
rando a população como um todo, os distúrbios monogênicos King RA, Roner J l, Morulsky AG (1992) The Genetic Basis of
afetam 2% da população durante todo o tempo de vida. Em Common Diseases. Oxford University Press, Oxford, England.
um estudo populacional de mais de 1 milhão de crianças nas- M(Kusick VA (1998) Mendelian lnheritance in Mim: Caralogs of
Autosomal Dominam, Autosomal Recessive, and X-Linked
cidas vivas, a incidência de graves distúrbios monogênicos na Phenotypes, 12th ed. Johns Hopkins University Press, Balti-
população pediátrica foi estimada como sendo de 0,36%; en- more. See online version at http:ll'IUWw3 .ncbi.11/m nih .gov.
tre as crianças hospitalizadas, de 6% a 8% provavelmente têm Rimoin DL, Connor JM, Pyetitz RE (1997) Emery and Rimoin's
distúrbios monogênicos. Principies and Pracàce of Medical Geneàcs, 3rd ed. Churchill
L.i1~ngstone, Edinburgh.
Scriver CR, Beaudet AL, Sly WS, Valle D (eds) (2000) The Meta-
bolic and Molecular Bases of lnherited Disease, 8th ed
*N .T.; O termo counseling será traduzido como consulta em todo o livro, pois ,'\kC ;raw-Hill, New York.
não são dados conselhos, mas sim infonnações, cabendo ao casal tomar suas Vogcl 1\ Morulsl-y AG (1997) Human Genetics: Problems and
decisões uma vez que esteja bem-infonnado. Approaches, 3rd ed . Springer-Verlag, Ncw York

L....
Bases Cromossômicas da
Hereditariedade
A avaliação da importância da genética na medicina requer uma estrutura normal, sua composição molecular, as localizações dos
compreensão da natureza do matedal genético, de como ele é genes que eles contêm e suas numerosas e variadas anomalias.
embalado no genoma humano e de como ele é transmitido de A análise cromossômica tornou-se um importante procedi-
célula para célula durante a divisão celular e de geração para mento diagnóstico em medicina clínica. Como será descrito mais
geração durante a reprodução. O genoma humano consiste em amplamente nos capítulos subseqiientes, algumas destas aplica-
grandes quantidades de ácido desoxirribonucléico (DNA), que ções incluem as seguintes:
contém em sua estrutura a informação genética necessária para
especificar todos os aspectos da embriogênese, do desenvolvi- Diagnóstico Clínico. Vários distúrbios médicos, incluindo
mento, do crescimento, do metabolismo e da reprodução, ou seja, alguns que são muito comuns, tais como a síndrome de Down,
to.dos os aspectos que tomam o ser humano um organismo fim- estão associados a mudanças microscopicamente visíveis no
cional. O genoma contém, pelas estimativas atuais, cerca de número ou na estrutura dos cromossomos e necessitam de uma
50.000 genes, que a este ponto definiremos simplesmente corno análise cromossômica para diagnóstico e informação genética
unidades de informação genética. Os genes são codificados no (ver Caps. 9 e 10),
DNA que constitui organelas em forma de bastão chamadas cro-
mossomos no núcleo de cada célula. A influência dos genes e Mapeamento Gênico. Uma meta importante da genética
da genética nos estados de saúde e doença é generalizada, e suas médica hoje em dia é o mapeamento de genes específicos em
bases são as informações codificadas no DNA encontrado no cr<?.!!!.Q§?.Qmos c_~!!.19. i>me~Ciif!life,tQ·_~C?.OellQmãHürnãrfo : Fste
genoma humano. tópico será citado repetidamente, mas aparece discutido em de-
Dentro de cada célula, o genoma é embalado como cromati- talhes no Cap. 8
na, na qual o DNA forma um complexo com várias classes de
proteínas cromossômicas Algumas das proteínas encontradas na Citogenética do Câncer. As mudanças cromossômicas nas
cromatina desempenham papéis estruturais, enquanto outras ser- células somáticas estão envolvidas no início e na progressão de
vem para regular a expressão de genes individuais. Exceto du- muitos tipos de câncer (ver Cap. 16).
rante a divisão celular, a cromatina é distribuída pelo núcleo e é
relativamente homogênea em aspecto ao microscópio . Quando Diagnóstico Pré-natal. A análise cromossômica é um pro-
uma célula se divide, entretanto, seu material nuclear condensa- cedimento essencial no diagnóstico pré-natal (ver Cap. 18)
se para se apresentar como cromossomos microscopicamente
visíveis. Portanto, os cromossomos são visíveis como estruturas A habilidade para interpretar um relato cromossômico e al-
distintas apenas nas células em divisão, mas eles·, no entanto, gum conhecimento da metodologia, do escopo e das limitações
conservam sua integridade entre as divisões celulares. dos estudos cromossômicos são habilidades essenciais aos mé-
Cada espécie tem um complemento cromossômico (cari~ti(!Q) dicos e aos outros profissionais que trabalham com pacientes que
característico êniteiITios-·de niiiiiero e mcnf9\ogj~_<:l~_~eus cro- têm defeitos de nascimento, retardo mental, distúrbios do desen-
..inossomos. Os genes estão em ordem linear ao longo dos cro- volvimento sexual e muitos tipos de câncer.
mossomos, ca4ª_g~n~JS<m!.QJ!~a posição exata ou locus. O mapa
gênico é o mapa de localizações cromossômicas dos genes e tam- //
' ;'

bém é característico de cada espécie e indivíduos dentro de uma OS CROMOSSOMOS HUMANOS


espécie.
O estudo dos cromossomos, de sua esuutura e de sua herança Com exceção das células da linhagem germinativa, todas as cé-
é chamado de citogenética. A ciência da moderna citogenética lulas que contribuem para o nosso corpo são chamadas de cé·
humana data de 1956, quando Tjio e Levan desenvolveram téc- lulas somáticas (soma, corpo). Os 46 cromossomos das célu-
nicas efetivas de análise cromossômica e estabeleceram que o las somáticas humanas constituem 23 pares , Destes 23 pares,
número normal de cromossomos humanos é 46 . Desde esta épo- 22 são similares em homens e mulheres e são chamados de
ca, muito se tem aprendido sobre os cromossomos humanos, sua autossomos, numerados em ordem decrescente do maior (cro-
4 1 BASES CROMOSSÔMICAS DA HEREDITARIEDADE

mossomo 1) até o menor (cromossomos 21e22) O par restan-


te constitui os cromossomos sexuais: XX nas mulheres e XY
nos homens. Cada cromossomo possui um subgrupo diferente
de genes que são dispostos linearmente ao longo de seu DNA .
Os membros de um par de cromossomos (descritos como cro-
mossomos homólogos ou homólogos) possuem informações
genéticas similares, isto é, têm os mesmos genes, na mesma
seqüência . Em um locus específico, entretanto, eles podem ser
idênticos ou ter formas levemente diferentes do mesmo gene,
chamados de a leios. Um membro de cada par de cromossomos
é i)erdado do pai; o outro, da mãe . Normalmente, os membros
c)é um par de autossomos são microscopicamente indistinguí-
,heis um do outro. Nas mulheres, os cromossomos sexuais, os
./ dois cromossomos X, são igualmente indistinguíveis. Nos ho-
mens, entretanto, os cromossomos sexuais diferem. Um é um
X~ idêntico aos X das mulheres, herdado por um homem de sua
mãe e transmitido para suas filhas. O outro, o cromossomo Y,
é herdado de seu pai e transmitido para seus filhos . No Cap.
10, veremos algumas exceções à regra simples e quase univer- Fig. 2. 1 Um ciclo celular mitótico típico. descrito no texto São in-
sal de que as mulheres são XX e os homens, XY. dicados os telômeros. o centrômero e as cromátides irmãs
Existem dois tipos de divisão celular: mitose e meiose. A
mitose é a divisão comum das células somáticas, pela qual o
corpo cresce, diferencia-se, e efetua a regeneração tissular.* A tos de controle monitoram e controlam a precisão da síntese de
divisão mitótica normalmente resulta em duas célula.S filhas, cada DNA, bem como a montagem e a ligação de uma elaborada rede
uma com cromossomos e genes idênticos aos da células parental. de microtúbulos que facilita o movimento dos cromossomos. Se
Podem ocorrer dúzias ou mesmo centenas de mitoses sucessi- for detectado um dano ao genoma, estes pontos de controle pa-
vas em uma linhagem de células somáticas. Em contraste, a rarão a progressão do ciclo celular até que sejam feitos os repa-
meiose só ocorre na linhagem germinativa. A meiose resulta na ros ou, se o dano for excessivo, até que a célula seja instruída a
formação de células reprodutivas (gametas), cada uma das quais morrer pela morte celular programada (um processo chamado de
tem apenas 23 cromossomos: um de cada tipo de autossomo e apoptose) .
um X ou um Y. Assim, enquanto as células somáticas têm o G, é seguido da fase S, o estágio de síntese de DNA. Durante
complemento cromossômico diplóide (diploos, duplo) ou o com- este estágio, cada cromossomo, que em G 1 era uma única molé~
plemento 2n de cromossomos (46 cromossomos), os gametas têm cuia de DNA (cuja estrutura exata examinaremos no Cap. 3),
o complemento haplóide (haploos, único) ou n de cromossomos replica-se para se tomar um cromossomo bipartido que consiste
(23 cromossomos) As anomalias de número ou estrutura de cro- em duas cromátides irmãs (ver Fig. 2 l ), cada uma das quais
mossomos, que em geral são clinicamente significativas, podem contém uma cópia idêntica da molécula original linear de DNA.
surgir ou em células somáticas ou na linhagem germinativa por As pontas de cada cromossomo (ou cromátide) são marcadas por
exros na divisão celular. telômeros, que consistem em seqüências especializadas de DNA
que garantem a integridade do cromossomo durante a divisão
celular. As duas cromátides irmãs são mantidas fisicamente jun-
O CICLO DE VIDA DE UMA tas no centrômero, uma região do DNA que se associa a vá.Iias
CÉLULA SOMÁTICA proteínas específicas para formar o cinetócoro. Esta estrutura
complexa serve para ligar cada cromossomo aos microtúbulos
Um ser humano começa a vida como um ovócito fertilizado (zi- do fuso mitótico e para controlar o movimento cromossômico
goto), uma célula diplóide a partir da qual todas as células do durante a mitose . A síntese de DNA durante a fase Sé não-
corpo (estimadas em cerca de 100 trilhões) são derivadas, por sincrônica em todos os cromossomos, ou mesmo dentro de um
meio de dezenas ou centenas de mitoses. A mitose obviamente é único cromossomo. Ao contrário, ao longo de cada cromosso-
crucial para o crescimento e a diferenciação, mas ocupa apenas mo ela começa em centenas a milhares de pontos, chamados de
uma pequena parte do ciclo de vida de uma célula. O que ocoxre origens de replicação do DNA. Os segmentos cromossômicos
na intérfase, o período entre duas mitoses sucessivas? individuais têm seu próprio tempo característico de replicação
Como mostra a Fig. 2.1, a mitose é a mais curta das quatro durante as 6 a 8 horas da fase S .
fases do ciclo celular. Imediatamente após a mitose, a célula entra Ao final da fase S, o conteúdo de DNA da célula dobrou, e a
em uma fase chamada GI' na qual não há síntese de DNA. Algu- célula entra em um breve estágio seguinte, chamado G2 . Duran-
mas células levam um longo tempo, dias ou mesmo anos, em G 1; te todo o ciclo celular, os ácidos ribonucleicos e as proteínas são
outras passam por este estágio em horas. Embora os mecanis- produzidos, e a célula aumenta de modo gradual, eventualmente
mos moleculares que controlam a progressão do ciclo celular não dobrando sua massa total antes da mitose seguinte. G, termina
sejam completamente conhecidos, o ciclo celular é controlado em mitose, que começa quando os cromossomos individuais ini-
por uma série de pontos de controle (checkpoints) que deter- ciam um condensamento e tomam-se visíveis ao microscópio
minam a duração de cada etapa na mitose. Além disso, os pon- como filamentos finos e longos, um processo que será conside-
rado em maiores detalhes na seção seguinte e no Cap . .3.
As fases G 1, S e G2 juntas constituem a intérfase. Nas células
*N T.: Também existem mitoses na primeira fase da gametogênese masculina e humanas com divisão típica, as três fases levam um total de 16 a 24
feminina Ver em meiose horas, enquanto a mitose dura apenas de 1 a 2 horas (ver Fig 2.1 ).
BASES CROMOSSÔMICAS DA HEREDITARIEDADE 1 5

Entretanto, há uma grande variação na duração do ciclo celular, que bulos. Os centrossomos movem-se gradualmente para tomar
vai desde algumas boias nas células com divisão rápida, tais como posições nos pólos da célula.
as da denne da pele ou da mucosa intestinal, até meses em outros
tipos de células. De fato, alguns tipos de células, tais como os neu- Pró-metáfase. A célula entra na pró-metáfase quando a
rônios e as hemácias, não se dividem, pois são totalmente diferenci- _i:nembra~ª1' se desfaz, permitindo que os cromossomos
adas. Ao contrário, elas ficam permanentemente paradas durante G 1 se dispersem na célula e se liguem, via seus cinetócoros, aos
em uma fase conhecida como G0 . Outtas células, tais como as célu- microtúbulos do fuso mitótico. Os cromossomos começam a se
las hepáticas, podem entrar em G0 , mas, após um dano ao órgão, mover pru-a um ponto mediano entre os pólos do fuso, um pro-
eventualmente voltam a G 1 e continuam o ciclo celular. cesso chamado de congregação. Os cromossomos continuam a
se condensar durante este estágio

--
Mitose
Durante a fase mitótica do ciclo celular, constitui-se um elabo-
rado aparelho para garantir que cada urna das duas células filhas
receba um conjunto completo de informação genética. Este re-
Metáfase. Na metáfase, os cromossomos atingem a máxi-
ma condensação. Eles se tomam dispostos na placa equatorial
da célula, balanceados pelas forças iguais exercidas no cinetócoro
de cada cromossomo pelos microtúbulos que emanam dos dois
sultado é obtido por um mecanismo que distribui uma cromáti- pólos do fuso. Os cromossomos de uma célula humana em divi-
de de cada.cromossomo para cada célula filha e é ilustrado es- são são analisados mais facilmente na metáfase ou no estágio de
quematicamente na Fig. 2.2. O processo de distribuição de uma pró-metáfase-da mit~se (ver discussão mais adiante e no Cap. 9).
cópia de cada cromossomo para cada célula filha é chamado de
segregação cromossômica. A impÔrtância deste processo para Anáfase. A anáfase começa abruptamente quando os cromos-
·o crescimento celular nonna1 é ilustrada pela observação de que somos se separam no centrômero As cromátides irmãs de cada
muitos tumores são invruiavelmente caracterizados por um es- cromossomo agora se tornam cromossomos filhos independen-
tado de desequi!Jbrio genético que resulta de erros rnitóticos na tes, que se movem para os pólos opostos da célula (ver Fig. 2 .2).
distribuição de cromossomos para as células filhas.
O processo de mitose é contínuo, mas são distintos cinco es- Telófase. Na telófase, os cromossomos começam a se
tágios: prófase, pró-metáfase, metáfase, anáfase e telófase. descondensru· de seu estado altamente contraído, começa a ser
reconstituída a membrana nuclear ao redor de cada um dos dois
Prófase. Este estágio inicia a mitose e é marcado por uma núcleos filhos e cada núcleo gradualmente reassume seu aspec-
condensação gradual dos cromossomos, eventual desaparecimen- to interfásico.
to do_pucléol.9 e começo da formação do fuso mitótico.. Um par
de centros organizadores de microtúbulos, também chamado de Para completar o processo da divisão celular, o citoplasma
centl'ossomos, formam focos dos quais se irradiam os microtú- é clivado por um processo conhecido como citocinese, o qual

Célula em G2

,.f'
Fases _,,/
//
lntérfase
Células em G1 ,/

@-
~,..,
, .· Cromatina
-~· descondesada

Cltool"~
0~
~Telófase
Pró-metáfase

't~...

'\. Anáfase Metáfase

Microtúbulos

Fig. 2.2 Mitose Representação diagramática. mostrando apenas dois pares de cromossomos Para maiores detalhes. ver o texto
6 ! BASES CROMOSSÔMICAS DA HEREDITARIEDADE

começa à medida que os cromossomos se aproximam dos pó-


los do fuso. Formam-se duas células filhas completas, cada uma
com um núcleo contendo toda a informação genética da célula
original.
Há uma diferença importante entl'e uma célula que entra em
mitose e uma que acabou de completar o processo. Cada cromos-
somo da célula original em G2 tem um par de cromátides, mas
os cromossomos da células filhas consistem em apenas uma có-
pia do material genético. Esta cópia só será duplicada quando a
célula filha atingir a fase S do próximo ciclo celular (ver Fig. 2. l).
Todo o processo de mitose garante uma duplicação ordenada e
uma distribuição do genoma por sucessivas divisões celulares.

O Cariótipo Humano
Os cromossomos condensados de uma célula humana em divi-
são são prontamente analisados na metáfase ou na pró-metáfase.
Nestes estágios, os cromossomos são visíveis ao microscópio
como uma dispersão cromossômica e cada cromossomo pode
ser visto constituído de suas cromátides irmãs, unidas pelo
centrômero ..
A maioria dos cromossomos pode ser diferenciada não só por
seu tamanho, mas também pela localização do centrômero . O
centrômero é aparente como uma constrição primária, um
marco citogenético reconhecível, dividindo o cromossomo em Fig. 2.3 Uma dispersão cromossômica preparada a partir de uma
dois braços, um braço curto, designado por p (de petit), e um cultura de linfócitos que foi corada com bandeamento Giemsa
braço longo, designado por q. Os métodos de coloração origi- (bandeamento G) O núcleo de cor escura adjacente aos cromos-
nalmente disponíveis para análise citogenética humana, entretan- somos é de uma célula diferente em intérfase. quando o material
to, não permitiam a identificação individual dos 24 tipos de cro- cromossômico está difuso pelo núcleo. (Fotomicrografia por cor-
mossomos (22 autossomos, X e Y). Os cromossomos podiam ser tesia de Stuart Schwart:z.. University Hospitais of Cleveland)
classificados apenas em sete grupos, designados pelas letras A a
G, com base em seu tamanho geral e posição do centrômero Estas
designações não são mais de uso geral, mas são vistas na litera-
ficou condensado a um tamanho total de cerca de 50 µ,m Quan-
tura. Com as técnicas de uso comum hoje em dia, todos os cro-
mossomos podem ser individualmente identificados. do condensado de forma máxima na metáfase, o DNA dos cro-
A Fig. 2.3 mostra uma célula em pró-metáfase na qual os cro- mossomos tem cerca de 1/10.000 de seu estado totalmente dis-
mossomos foram corados pelo método de bandeamento Giernsa tendido. Quando os cromossomos são preparados para revelar
(bandeamento G), a técnica mais amplamente usada nos labo- bandas (ver Figs. 23 e 2 4), até 1.000 bandas ou mais podem ser
ratórios de citogenética, Primeiro os cromossomos são tratados reconhecidas em preparações coradas de todos os cromossomos,
com tripsina, para digerir as proteínas cromossômicas, e então e cada banda citogenética contém, portanto, até 50 genes ou mais,
com o corante Giernsa, Cada par de cromossomos cora-se de Após a metáfase, à medida que as células completam a mitose,
modo característico de bandas claras e escuras (bandas G). Usan- os cromossomos descondensam-se e voltam ao seu estado rela-
do este método e outras técnicas de bandeamento, todos os cro- xado como cromatina no núcleo interfásico, prontos para come-
mossomos podem ser individualmente diferenciados. Mais ain- çar o ciclo outra vez (ver Fig, 25)
da: a natureza de qualquer anomalia estrutural ou numérica pode
ser prontamente determinada, como veremos em maiores deta- Meiose
lhes nos Caps. 9 e 10.
Embora os especialistas com freqüência possam analisar os A meiose é o tipo de divisão celular pelo qual as células diplóides
cromossomos metafásicos diretamente ao microscópio, um da linhagem germinativa originam gametas haplóide,s A meiose
procedimento comum é recortar os cromossomos de uma foto- consiste em uma rodada de síntese de DNA seguida de duas ro-
micrografia e anumá-los aos pares em uma classificação padrão, dadas de segregação cromossômica e divisão celular (Fíg. 2.6)
como mostra a Fig 24. O resultado final é chamado de um As células na linhagem germinativa que sofrem meiose, esper-
cariótipo A palavra cariótipo também é usada para designar o matócitos e ovócitos primários, são derivadas do zigoto por uma
conjunto cromossômico padrão de um indivíduo ("um cariótipo longa série de mitoses antes do início da meiose.
masculino normal") ou de urna espécie ("o cariótipo humano") Os gametas masculinos e femininos têm histórias diferentes,
e, como verbo, para se referir ao processo de preparação de tal mas a seqüência de eventos é a mesma, embora suas épocas se-
figura padrão ("cariotipar"). jam bem diferentes, As duas divisões meióticas sucessivas são
Ao contrário dos cromossomos vistos em preparações cora- chamadas de meiose l e meiose Il A meiose I também é conhe-
das ao microscópio ou em fotografias, os cromossomos de célu- cida como divisão reducional, pois é a divisão na qual o núme-
las vivas são estruturas fluidas e dinâmicas . Durante a mitose, ro de cromossomos é reduzido de diplóide para haplóide pelo
por exemplo, a cromatina de cada cromossomo interfásico pareamento de homólogos na prófase e pela sua segregação para
condensa-se muito (Fig. 2.5). Na prófase, quando os cromosso- células diferentes na anáfase da meiose I. Os cromossomos X e
mos tornam-se visíveis ao microscópio óptico, o cromossomo l Y não são homólogos no sentido estrito, mas têm segmentos
BASES CROMOSSÔMICAS DA HEREDITARIEDADE 1 7

~. !
_l.,\-·.
j

..'
: ·i
' .ísl:
"" . íi ;
"'
-y'(· ~

2 3 4 5

6 7 8 9 10 11 12

- ~"li·!-
F' ~
-i ;i~
~ "'-' ,,,
-fli\~1-

13 14 15 16 17 18

-f,. -'t:f'-
. ':i,J
! ~

19 20 21 22

CROMOSSOMOS SEXUAIS

Fig. 2.4 Um cariótipo humano masculino com bandeamento Giemsa (bandeamento G ) Os cromossomos estão no estágio de pró-metáfase
da mitose e estão dispostos em uma classificação padrão, numerados de 1 a 22 em ordem de tamanho. com os cromossomos X e Y
mostrados separadamente (Fotomicrografia por cortesia de Stuart Schwartz. University Hospitais of Cleveland )

homólogos nas pontas de seus braços curtos e longos e ficam A Primeira Divisão Meiótica
pareados em ambas as regiões. (Meiose 1)
A meiose l também é notável porque é o estágio no qual ocorre
a recombinação genética (também chamada de crossing over PRóFASE 1
meiótico) Neste processo, os segmentos homólogos de DNA são
trocados entre as cromátides não-innãs de um par de cromosso- A prófase da meiose I é um processo complicado que difere da
mos homólogos, garantindo assim que nenhum dos gametas pro- prófase mitótica de vários modos, com conseqüências genéticas
duzidos pela meiose seja idêntico a outro. O conceito de recombi- importantes Vários estágios são definidos. Ao longo de todos
nação é fundamental para o processo de mapeamento dos genes os estágios, os cromossomos condensam-se continuamente, fi-
responsáveis por distúrbios herdados, como discutiremos com mais cando mais curtos e mais grossos.
detalhes no Cap. 8. Como a recombinação envolve o entrelace fí-
sico dos dois homólogos até um ponto apropriado durante a meiose Leptóteno. Os cromossomos, que já se replicaram durante
I, ela também é crítica para garantir a segregação cromossômica a fase S anterior, tomam-se visíveis como filamentos finos que
apropriada durante a meiose . A falha em se recombinar de fonna estão começando a se condensar. Neste estágio inicial, as duas
apropriada pode levar a uma segregação errada de cromossomos cromátides irmãs de cada cromossomo estão em tal proximida-
na meiose I e é uma causa freqüente de anomalias cromossômi- de que não podem ser distintas.
cas, como a síndrome de Down (ver Cap. 9)
A meiose II segue-se à meiose I sem uma etapa intercalar de Zigóteno. Neste estágio, os cromossomos homólogos come-
replicação do DNA Como na mitose comum, as crornátides se- çam a se parear ao longo de todo o seu comprimento. O proces-
param-se e uma cromátide de cada cromossomo passa para cada so de pareamento, ou sinapse, normalmente é muito preciso,
célula filha. Alguns dos estágios distintos na meiose, bem como colocando seqüências correspondentes de DNA em alinhamen-
o processo de crossing over, são mostrados na Fig. 2.7. to ao longo do tamanho de todo o cromossomo.
8 1 BASES CROMOSSÔMICAS DA HEREDITARIEDADE

Metáfase

Cromatina
descondensada

Fig. 25 Ciclo de condensação e descondensação à medida que um cromossomo progride no ciclo celular

Embora a base molecular da sinapse não seja totalmente com- Paquíteno. Durante este estágio, os cromossomos tomam-
preendida, a microscopia eletrônica revela que os cromossomos se mais helicoidizados. A sinapse está completa e cada par de
são mantidos j untos por um complexo sinaptinêmico, uma es- homólogos apresenta-se como um bivalente (às vezes chamado
trutura contendo proteínas (Fig. 2.8). O complexo sinaptinêmi- de tétrade porque contém quatro crom átides). O paquíteno é o
co é essencial ao processo de recombinação. estágio no qual ocorre o crossing over (ver Fig 2.7).

Diplóteno. Após a recombinação, o complexo sinaptinêmi-


co desaparece, e os dois componentes de cada bivalente agora
começam a se separar uns dos outros . Embora os cromossomos
homólogos separem-se, cada um de seus centrômeros pennane-
Replicação cromossômica ~ ce intato, de modo que cada conjunto de cromátides innãs inici-
almente permanece unidas. Eventualmente os dois homólogos

®
de cada bivalente são mantidos juntos apenas em pontos chama-
dos quiasmas (cruzamentos), que são tidos como marcando os
locais de crossings. O número médio de quiasmas vistos em es-
Meiose 1 I \ permatócitos humanos é de cerca d e 50, isto é, vários por
bivalente.

([)(]) Diacinese. Neste estágio, os cromossomos atingem a


condensação máxima.

MoID~11 J\ METÁFASE I
A metáfase I começa, como na mitose, quando a membrana nu-

CDCD CDCD
Quatro gametas haplóides
clear desaparece. Forma-se um fuso, e os cromossomos parea-
dos alinham-se na placa equatorial com seus centrômeros orien-
tados para pólos diferentes.

ANÁFASE 1
Fig. 2 .6 Uma representação simplificada das etapas essencia is na
meiose. consistindo em uma rodada de repl icação do DNA. se- Os dois membros de cada bivalente separam-se e seus respec-
guida de duas rodadas de segregação cromossômica. meiose 1 e tivos centrômeros com as cromátides irmãs ligadas são leva-
meiose li dos para pólos opostos da célula, em um processo chamado
BASES CROMOSSÔMICAS DA HEREDITARIEDADE 1 9

de disjunção. Assim, o número de cromossomos é reduzido


à metade, e cada produto celular da meiose 1 tem o número
haplóide de cromossomos. Os bivalentes diferentes se segre-
gam independentemente um do outro e, como resultado, os
conjuntos originais de cromossomos paterno e materno são
distribuídos em combinações aleatórias. O número possível
de combinações dos 23 pares de cromossomos que podem
estar presentes nos gametas é 223 (mais de 8 milhões) . De fato,
a variação no material genético que é transmitido do genitor
para a prole é muito maior que isto por causa do processo de
crossing over. Como resultado deste processo, cada cromáti-
de contém tipicamente segmentos derivados de cada membro
do par cromossômico parental. Por exemplo, neste estágio, um
cromossomo 1 típico é composto de três a cinco segmentos,
alternadamente de origem paterna e materna. (Ver uma mai-
or discussão no Cap. 8.)
Muitos erros podem ocorrer na divisão celular. A anáfase
da meiose I é a etapa mais propensa a erro, o que resulta em
ambos os homólogos de um par cromossômico indo para o
mesmo pólo em vez de para pólos opostos. Este processo pa-
togênico é chamado de não-disjunção. Algumas das conse-
qüências das irregularidades meióticas serão discutidas nos
Caps. 9 e 10.

TELÓFASE 1
Na telófase, os dois conjuntos _haplóides de cromossomos nor-
malmente se agrupam em E§lo~.pnstos.Jtu:.é.ll.IJ.a.

Citocinese
Após a telófase I, a célula divide-se em duas células filhas
!'1ªpliSides e entra na intérfase meiótica. Na espermatogênese, o
citoplasma é dividido mais ou menos igualmente entre as duas
células filhas (Fig 2 9), mas na ovocitogênese um produto (o
ovócito secundário) recebe quase todo o citoplasma, e o produto
reciproco toma-se o primeiro glóbulo polar (Fig. 2.10).\Em con-
traste à mitose, a intérfase é curta, e a meiose Il começa. O pon-
to notável que distingue a intérfase meiótica e mitótica é que~
!l!U!~e .S.(~l!.111 .~ím~~~_ckJ?~~) entre a primeira e a segunda
divisões meióticas

-
Q)
A Segunda Divisão Meiótica (Meiose li)

,i A segunda divisão meiólica é similar a uma mitose comum, ex-


C/)

~
o ceto pelo foto de que o número de cromossomos da célula que
·a:;
~
entra em meiose II é haplóide . O resultado final é de quatro cé-
lulas haplóides, cada uma contendo 23 cromossomos (ver Fig.
2 7) . Como mencionado antes, por causa do crossing o ver na

Fig 2. 7 Representação diagramática da meiose e suas conseqüên-


ujl cias Um único par de cromossomos e um só crossing são mostra-
dos. levando à formação de quatro gametas distintos Os cromos-
{/ somos replicam-se du rante a intérfase e começam a se condensar
à medida que a célula entra na prófase da meiose 1. Na meiose l.

CDCD os cromossomos ficam pareados e recombinam-se. Os quiasrnas


são visíveis à medida que os homólogos al inham-se na metáfase l.
com os centrômeros orientados para pólos opostos Na anáfase 1.
a troca de DNA entre os homólogos é aparente à medida que os
cromossomos são levados para pólos opostos Após o término da
meiose 1e da citocinese. a meiose ((continua com urna divisão tipo
mitose Os cinetócoros irmãos separam-se e movem-se para os
pólos opostos na anáfase 11. gerando quat ro produtos haplóides
r

1O 1 BASES CROMOSSÔMICAS DA HEREDITARIEDADE

Fig. 2.8 Micrografia eletrônica de um espermatócito primário humano em meiose. mostrando os 22 complexos sinaptinêmicos autossô·
micos e o par XY (seta) O DNA de cada bivalente não é visfveL mas está distendido lateralmente em cada lado dos complexos
sinaptinêmicos (Fotomicrografia por cortesia de A C Chandley Western General Hospital. Edinburgh )

meiose I, os cromossomos dos gametas resultantes não são idên- te a sexta semana para as cristas genitais e associam-se às
ticos. A segregação de diferentes alelos paternos e matemos de células somáticas para formar as gônadas primitivas, que logo
cada gene ocorre durante a primeira ou a segunda divisão meió- se diferenciam em testículos e ovários, dependendo da cons-
tica (ver boxe), dependendo de se eles estiveram envolvidos em tituição dos cromossomos sexuais (XY ou XX) das células,
um evento de crossing na meiose L como veremos em maiores detalhes no Cap. 10 Tanto a es-
permatogênese quanto a ovocitogênese necessitam de meiose,
mas têm diferenças importantes em detalhes e época que po-
GAMETOGÊNESE HUMANA E dem ter conseqüências clínicas e genéticas para a prole. A
FERTILIZAÇÃO meiose feminina é iniciada uma vez, cedo durante a vida fe-
tal, em um número limitado de células. Em contraste, a meiose
As células germinativas humanas primordiais são reconhecí-
masculina é iniciada continuamente em muitas células de uma
veis na quarta semana do desenvolvimento do embrião, n a en-
população de células em divisão, ao longo da vida adulta de
doderme do saco vitelínico. A partir daí, e las migram duran-
um homem.
É difícil estudar a meiose humana diretamente. Na mulher,
os sucessivos estágios da meiose ocorrem no ovário fetal, no

~ Conseqüências Genéticas da Meiose


ovócito próximo à época da ovulação e após a fertilização . Em-
bora os estágios de pós-fertilização possam ser estudados in vi-
tro, o acesso aos estágios iniciais é limitado. O material testicu-
1. Redução do número de cromossomos de cliplóide para lar para o estudo da meiose masculina é menos difícil de se ob-
haplóide, a etapa essencial na formação de gametas . ter, pois a biópsia testicular é incluída na avaliação de muitos
2. Segregação de alelos, tanto na meiose I quanto na homens que procuram clínicas de infertilidade. Ainda temos
meiose II, de acordo com a primeira lei de Mendel. muito o que aprender sobre a citogenética, a bioquímica e os
3. Embaralharnento do material genético por distribuição mecanismos moleculares envolvidos na meiose normal, bem
independende dos homólogos, de acordo com a segun- como sobre as causas e conseqüências das irregularidades
da lei de MendeL rneióticas.
4. Embaralhamento adiciona] de material genético por
crossing over, que é tido como tendo evoluído corno Esp ermatogênese
um mecanismo para aumentar substancialmente a va-
riação genética, mas que, além disso, é crucial para Os estágios da espermatogênese são mostrados na Fig. 2.9. Os
garantir a distribuição cromossômica normal espermatozóides são formados nos túbulos seminíferos dos tes-
tículos após ter sido atingida a maturidade sexual. Os túbu1os
BASES CROMOSSÔMICAS DA HEREDllARIEDADE ! J1

·:-··· são revestidos de espermatogônias, que estão em estágios di-


ferentes de diferenciação. Estas células desenvolveram-se de
células germinativas primordiais por uma longa série de mito-
.:· · ···.-- : ses . O último tipo de célula na seqüência de desenvolvimento
é o espermatócito primário, que sofre meiose 1 para formar
dois espermatócitos secundários haplóides. Os espermatóci-
tos secundários rapidamente entram na meiose II, cada um for-
mando duas espermátides, que se diferenciam sem outras di-
visões em espermatozóides . Nos seres humanos, todo o pro-
cesso leva cerca de 64 dias. O enorme número de espermato-
zóides produzidos, tipicamente 200 milhões por ejaculação e
uma estimativa de 1012 durante a vida, requer várias centenas
de mitoses sucessivas.

Ovocitogênese
Em contraste à espermatogênese, que é contínua durante a vida
adulta, a ovocitogênese é confinada ao desenvolvimento pré-
natal. O processo é mostrado na Fig. 2.10. Os ovócitos desen-
volvem-se das ovogônias, células no córtex ovariano que des-
cendem das células germinativas primordiais por uma série de
cerca de 30 mitoses . Cada ovogônia é a célula central de um
folículo em desenvolvimento. Por volta do terceiro mês do de-
(!) senvolvimento pré-natal, as ovogônias do embrião começaram
UJ a se desenvolver em ovócitos primários, a maioria dos quais
o ...
·; '. já entrou em pró fase 1 da meiose. O processo de ovocitogênese
ã não é sincronizado, coexistindo tanto estágios iniciais quanto
': " avançados no ovário fetal. Existem cerca de 2,5 milhões de -
ovócitos na época do nascimento, mas a roaio1ia se degenera e

-- apenas cerca de 400 eventualmente amadurecem. Na época do


nascimento todos os ovócitos primários atingiram a prófase 1,
e aqueles que não se degeneram permanecem neste estágio por
décadas.
Após uma mulher ter atingido a maturidade sexual, cada folí-

23,X 23,X
@ 23,Y 23,Y
culo individual arnaduresce e ocorre a ovulação. Cada ovócito
completa rapidamente a meiose l, dividindo-se de tal modo que
uma célula torna-se o ovócito secundário, contendo a maioria do
citoplasma com suas organelas, e a outra se torna o primeiro
't '~ Espermálides ''I
i~ ji ! ~
ft
glóbulo polar (ver Fig. 2.1O) A meiose II começa imediatamen-
~ te e continua para o estágio de metáfase durante a ovulação, mas

u
~
i,J

~ \Y i só se completa se ocorrer a fertilização.


V

Fertilização
A fertilização do ovócito em geral ocorre na trompa falopiana
cerca de um dia após a ovulação. Embora um grande número de
espermatozóides esteja presente, a penetração de um só deles no
ovócito desencadeia urna série de eventos bioquímicos que im-
pedem a entrada de outro espermatozóide .
A fertilização é seguida do término da meiose II, com a for-
23,X 23,X 23,Y 23,Y mação do segundo glóbulo polar (ver Fig. 2 .10). Os cromosso-
mos do ovócito fertilizado e do espermatozóide tomam-se pró-
núcleos, cada um circundado por uma membrana nuclear. Os
Fig . 2.9 Diagrama para ilustrar a espermatogênese em relação às cromossomos do zigoto diplóide replicam-se logo após a fertili-
duas divisões meióticas. A seqüência de eventos começa na puber- zação, e o zigoto divide-se por mitose para fonnar duas células
dade e leva cerca de 64 dias para se completar São mostrados o
filhas diplóides. Esta mitose é a primeira de uma série de divi-
número de cromossomos (46 ou 23) e a constituição dos cromos-
somos sexuais (X ou V) de cada célula (Modificada de Moore K. L sões de clivagem que iniciam o processo de desenvolvimento
e Persaud l . V N l 1'1981 The Developing Human: Clinically Orien- embrionário (ver Cap. 17).
ted Embryology. 6 • ed W B Saunders. Philadelphia ) Embora o desenvolvimento comece com a formação do zi-
goto (concepção), em medicina clinica, o estágio e a duração da
gestação em geral são contados como a "idade mensuual". indo
12 1 BASES CROMOSSÔMICAS DA HEREDlTARIEDADE

desde o começo da última menstruação da mãe, cerca de 14 dias


antes da concepção.

!
RELEVÂNCIA MÉDICA DA
MITOSE E DA MEIOSE
O significado biológico da mitose e da meiose está em garantir a
constância do número de cromossomos de uma célula para sua
prole e de urna geração para a S!!guinte. A relevância médica des-
tes processos está em erros de um ou outro mecanismo de divi-
são celular, levando à formação de uma pessoa ou uma linhagem
celular com um número anormal de cromossomos.
Como veremos em detalhes no Cap. 9, a não-disjunção mei-
ótica, em particular na ovocitogênese, é o mecanismo mutacio-
nal mais comum em nossa espécie, responsável por fetos cromos-
somicamente anormais em pelo menos uma boa porcentagem de
todas as gestações reconhecidas. Entre as gestações que sobre-
vivem a termo, as anomalias cromossômicas são uma causa im-
portante de defeitos de desenvolvimento, falta de desenvolvimen-
to no período neonatal e retardo mental.
A não-disjunção mitótica também contribui para à daença-ge--
nética. A não-disjunção logo após a fertilização, s~ja no embrião
em desenvolvimento seja nos tecidos extra-embrionários, como
a placenta, leva a um mosaicismo cromossômico que pode estar
subjacente a algumas condições médicas, tais como uma-propor-
ção de pacientes com síndrome de Down. A segregação anor-
mal de cromossomos em tecidos com divisão rápida, tais como
nas células do cólon, com freqüência é uma etapa no desenvol-
vimento de tumores cromossomicamente anormais e, portanto,
J Ovulação a avaliação do balanço cromossômico é um teste diagnóstico e
'V prognóstico importante em muitos cânceres.

Referências Gerais
Handel MA (ed) (1998) Meiosis and Gametogcnesis Acadcmic
Press, San Diego.
Moore KL, Persaud TVN (1998) The Developing Human: Clini-
cally Orientcd Embryology, 6rh ed WB Saunders, Philadel·
phia
Murray A, Hunt T (1993) The Cell Cycle: An Introduction.
Oxford Universicy Press, Oxford, England.
Th~rman E, Susman M (1993) Human Chromosomes: Structure,

~
l Fertilízação Behavior, Effects, 3rd ed . Springer-Verlag, New York

Problemas
2" glóbulo polar
1. Em um detenninado loê:us, uma pessoa tem dois alelos A e a
a) Quais os genótipos dos gametas desta pessoa?
b) Quando A e a se segregam (i) se não houver crossing entre o
locus e o centrômero do cromossomo? (ii) se houver um só
crossing entre o Jocus e o centrõmero?
2 Qual a principal causa das anomalias cromossômicas numéricas nos
seres humanos?
.3 . Não considerando o crossing, que aumenta a quantidade de variabi-
Óvulo maduro lidade genética, avalie a probabilidade de que todos os seus cromos-
somos tenham vindo da mãe de seu pai e da mãe de sua mãe. Você
seria homem ou mulher?
Fig. 2. 1ODiagrama para ilustrar a ovocitogênese humana e a ferti- 4 Um cromossomo que está entrando em meiose é composto de duas
lização em relação às duas divisões meíótícas Os ovócitos primá- cromátides, cada uma das quais tem uma única molécula de DNA.
rios são formados no período pré-natal e ficam suspensos na a) Em sua espécie, ao final da meiose I, quantos cromossomos
prófase da meiose 1 por décadas. até o início da puberdade Um existem por célula? Quantas cromátides?
ovócito completa a meiose 1à medida que seus folículos amadure- b) Ao final da meiose II, quantos cromossomos existem por célu-
cem. resultando em um ovócito secundário e o primeiro glóbulo la? Quantas cromátides?
polar Após a ovulação. cada ovócito continua até a metáfase da c) Quando o número diplóide de cromossomos é restaurado?
meiose li A meiose li só se completa se ocorrer a fertilização. re- Quando a estrutura de duas cromátides de um típico cromosso-
sultando em um óvulo maduro e o segundo glóbulo polar mo metafásico é restaurada?
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -•õ' /

O Genoma Humano: Estrutura e


Função dos Genes e Cromossomos
Nos últimos 20 anos, um grande progresso foi feito em nossa se em longas cadeias polinucleotidicas por ligações fosfodiéster
compreensão sobre a estrutura e a função dos genes e cromosso- 5•-3' formadas entre unidades adjacentes de desoxirribose (Fig.
mos no nível molecular. Mais recentemente, isto foi suplemen- 3.2). No genoma humano, estas cadeias polinucleotídicas (em sua
tado por uma compreensão aprofundada da organização do ge- forma de dupla hélice) têm centenas de milhões de nucleotideos
noma humano no nível de sua seqüência de DNA Estes avan- de tamanho longo, variando de cerca de 50 milhões de pares de
ços deveram-se em grande parte às aplicações da genética mole- bases (para o menor cromossomo, o 21) até 250 milhões de pa-
cular e da genômica a muitas situações clínicas, fornecendo as- res de bases (para o maior cromossomo, o 1).
sim os instrumentos para um enfoque novo e diferente à genéti- A estrutura anatômica do DNA leva a informação química que
ca médica. Neste capítulo apresentamos uma visão geral da or- permite a transmissão exata da informação genética de uma cé-
ganização do genoma humano e os aspectos da genética mole- lula para suas células filhas e de uma geração para a seguinte.
cular que são necessários para uma compreensão do enfoque Ao mesmo tempo, a estrutura primária do DNA especifica as
genético à medicina. Este capitulo não pretende fornecer uma seqüências de aminoácidos das cadeias polipeptídicas das pro-
ampla descrição da abrangência das novas informações sobre a teinas, como será descrito mais adiante neste capítulo. O DNA
estrutura e a regulação gênica. Para suplementar a informação tem características especiais que lhe dão estas propriedades. O
discutida aqui, o Cap. 4 descreve muitos enfoques experimen- estado nativo do DNA, como esclarecido por James Watson e
tais da genética molecular moderna que estão se tomando cruciais Francis Crick em 1953, é uma dupla hélice (Fig. 3.3). A estrutu-
para a prática e a compreensão da genética humana e médica. ra helicoidal assemelha-se a uma escada em caracol com giro para
O aumento do conhecimento dos genes, bem como de sua a direita, na qual suas duas cadeias polinucleotídicas correm em
organização no genoma, teve um enorme impacto na medicina e sentidos opostos, mantidas juntas por pontes de hidrogênio en-
na nossa percepção da fisiologia humana. Como disse Paul Berg, tre os pares de bases: A em uma cadeia pareada com T da outra
ganhador do Prêmio Nobel, no infcio desta nova era: e G com C (ver Fig. 3.3). Conseqüentemente, o conhecimento
da seqüência de nucleotfdeos em um filamento automaticamen-
Assim como nosso atual conhecimento e nossa prática da te nos permite determinar a seqüência de bases do outro
medicina baseiam-se em um sofisticado conhecimento da filamento. A estrutura em dupla hélice das moléculas de DNA
anatomia humana, da fisiologia e da bioqufmica, lidar com a permite que elas se repliquem precisamente pela separação dos
doença no futuro demandará uma compreensão detalhada da dois filamentos, seguida pela síntese de dois novos filamentos
anatomia molecular, fisiologia e bioquímica do genoma complementares, de acordo com a seqüência dos filamentos-
humano . . Precisaremos de um conhecimento mais detalhado molde originais (Fig 3.4) Similarmente, quando necessário, a
sobre como os genes humanos são organizados e como eles complementariedade permite um reparo eficiente e correto das
funcionam e são regulados. Precisaremos também de médicos que
conheçam a anacomia molecular e a fisiologia dos cromossomos e moléculas danificadas de DNA.
genes, como o cirurgião cardíaco conhece o funcionamenco do
coração.
O DOGMA CENTRAL:
DNA -7 RNA -7 PROTEÍNA
ESTRUTURA DO DNA: UMA BREVE REVISÃO
A informação genética está contida no DNA dos cromossomos
· O DNA é uma macromqlé~!!lª po.l\.m~r,.i_ç:,t de ácidQJJ!Jcleico com- dentro do núcleo celular, mas a síntese de proteínas, durante a qual
_posta de três.tipos de unidades: um açúc<l:f ~~..<::tn~c;i_s~ºonos. a a informação codificada no DNA é usada, ocorre no citoplasma.
desoxinibose, uma base nitrpgenada e um_g~p.Q__fu_sfato (Fig. Esta compartimentalização reflete o fato de que o organismo hu-
3. l ). As bases são de dois tipos, purinas e pirimidinas . No DN A, mano é um eucarionte. Isto significa que as células humanas têm
existem duas bases purinas, adenina (A) e guanina (G), e duas um núcleo genufno que contém o DNA, o qual é separado do cito-
bases pirimidinas, timina (T) e citosina (C). Os nucleotídeos, cada plasma por uma membrana nuclear. Em contraste, nos procariontes,
um composto de uma base, um fosfato e um açúcar, polimerizam- como na bactéria intestinal Escherichia coli, o DNA não está encer-
14 l O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

Purinas Pirimidinas
NH2 o
1 li
N::::::'c"'-·c..--N~ e
HN/ "'--e- CH3
1 li ~CH 1 ll
HC~N",_....c......._N/ 9C"'-. ,.....CH
o N''
1 1 o
H
H 11 s
-o-P-O-CH2 o
àase
. .
Adenina (A) Timlna (T)
1 1 -.....- ~·
o- e·_....... e
H
\. H Hy•H
'\1 1
NH2 3.c-c
1 1
1 OH H
e Fosfato Desoxirribose
N-;:::::' ""'-cH
l li
o9C"'-.'N./,,...CH
1
H
Guanina (G) Citosina (C)

Fig.. 3.1 As quatro bases do DNA e a estrutura geral de um nucleotfdeo no DNA Cada uma das quatro bases liga-se à desoxirribose (pelo
nitrogênio mostrado em vermelho) e a um grupo fosfato para formar os nucleotfdeos correspondentes

rado dentr'O de um núcleo. Devido à compartimentalização das A ligação molecular entre estes dois tipos relacionados de
células eucariótícas, a transferência de informação do núcleo para informação (o código de DNA dos genes e o código de aminoá-
o citoplasma é um processo muito complexo, que tem sido foco cidos das proteínas) é o ácido ribonucleico (RNA). A estrutura
da atenção dos biólogos molecular·es e celular·es. química do RNA é similar à do DNA, exceto pelo fato de que
cada nucleotídeo no RNA tem um açúcar ribose em vez de de-
soxirribose. Além disso, uracil (U) substitui timina como uma
das pirimidinas do RNA (Fig. 3 5). Uma diferença adicional entre
Ponta 5' o RNA e o DNA é que na maiori<rdUS"Ur-g~mos o RNA exis(e
como uma molécula unifilamentar, enquanto o E>NA_Wste~mo
uma dupla hélice
A correlação informacional entre DNA, RNA e proteína está
interligada: o DNA dirige a síntese e a seqüência do RNA, o RNA
dirige a síntese e a seqüência dos polipeptídeos e especifica as
proteínas que estão envolvidas na síntese e no metabolismo do
DNA e do RNA Este fluxo de informação é chamado de "dogma
central" da biologia molecular.
A informação genética é estocada no DNA por meio de um
código (o código genético, discutido mais adiante), no qual 'a
seqüência de bases adjacentes determina a seqüência de amino-
ácidos no polipeptídeo codificado. Primeiro, o RNA é sintetiza-
do a partir de um molde de DNA por um processo conhecido
como transcrição, O RNA, levando a informação codificada em
uma forma chamada de RNA mensageiro (mJlN.A), é então
transportado do núcleo para o citoplasma, onde a seqüência de
RNA é decodificada, ou traduzida, para determinar a seqüência
de aminoácidos na proteína que está sendo sintetizada O pro-
cesso de tradução ocorre nos ribossomos, que são organelas
citoplasmáticas com sítios de ligação para todas as moléculas que
interagem, incluindo o mRNA, envolvidas na síntese de proteí-
nas. Os ribossomos são feitos de muitas proteínas estruturais
Ponta 3' diferentes em associação com um tipo específico de RNA, co-
nhecido como RNA ribossômico (rRNA). A tradução envolve
ainda um terceiro tipo de RNA, o RNA transportador (tRNA),
que fornece a ligação molecular entre a seqüência de bases do
Fig. 3.2 Um trecho de uma cadeia polinucleotfdica de DNA. mos- mRNA e a seqüência de bases da proteína,
trando as ligações fosfodiéster 3'-5' que unem nucleotfdeos adia· Devido ao fluxo interdependente de informação representa-
centes do pelo dogma centr'al, podemos começar a discussão da genéti-
o GENOMA HUMANO: ESIRUlURA E FUNÇÃO DOS GENES E CROMOSSOMOS ' rs·

3'

3.4 A

34À

/
,/
/
/
/

/ "
Pontes de
hidrogênio
20À

Fig. 3.3 A estrutura do DNA Esquerda: Uma representação bidimensional dos dois filamentos complementares de DNA. mostrando os
pares de bases Ale GC. Notar que a orientação dos dois filamentos é invertida Direita: O modelo da dupla hélice de DNA. como propos-
to por Watson e Crick Os ..degraus.. horizontais representam as bases pareadas A hélice é dita dextrógira porque o filamento que vai do
canto inferior esquerdo para o superior direito cruza o filamento oposto (Baseado em Watson J D, Crick F H C ( 1953) Molecular structure
of nucleic acids -A structure for deoxyribose nucleic acid Nature 171 :737-738)

ca molecular da expressão gênica em qualquer um dos três ní- Estrutura e Organização do Gene
veis informacionais: DNA, RNA ou proteína. Começaremos a
examinar a estrutura dos genes como uma base pma nossa dis- Em sua forma simples, um gene pode ser visualizado como um
cussão do código genético, transcrição e tradução. segme~o de UIJ!ê_IDQlé_c;.qlª_çle_DNA c()n!.ti!l99 o. !=l~djgo_p_at.a..J!
seqüência de aminoáci'dos de uma cadeia polipeptídica e_~ s(!qüên-
Cià~-~~g~lâ.~?ras neces~á!i~s PE~.~~ssão. Esta descrição, en-
tretanto, é inadequada para os genes do genoma humano (e, na
verdade, para a maioria dos genomas eucarióticos), pois alguns
genes existem como seqüências codificantes contínuas, A grande
maioria dos genes é interrompida por uma ou mais regiões não-
codificantes. Estas seqüências intercalares, chamadas íntrons, são
inicialmente transcritas em RNA no núcleo, mas não estão pre-
sentes no mRNA final no citoplasma Assim, a informação das
seqüências intrônicas normalmente não é representada no produ-
to proteico final. Os íntrons alternam-se com seqüências
codificantes, ou éxons, que finalmente codificam a seqüência de
aminoácidos da proteína (Fig. 3..6). Embora alguns genes do ge-

o
li
e
HN/ '---cH
1 li
o~c.,N/CH
1
H
Uracil (U)

Fig. 3.4 Replicação de uma dupla hélice de DNA que resulta em Fig. 3. 5 A pirimidina uracil e a estrutura de um nucleotídeo no RNA
duas moléculas filhas idênticas, cada uma composta de um Notar que o açúcar ribose substitui o açúcar desoxirribose do DNA
filamento parental (preto) e um recém-sintetizado (verme/{10) Comp~rar com a Fig 3 1
J
i6 1 O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

"Anterior" Exons (seqüências "Posterior"


Inicio da codificantes)
trans~rição ~ \ \ --------- / Códon finalizador

5
' --P-r
orn
-0-10-r --CIBB==="=-,=~ - 1 3'
!::.. ....._ Códon Íntrons 1
t iniciador
(seqüências Sinal de
região 5' Intercalares) poliadenilação
não-traduzida região 3'
não-traduzida

Sentido da transcrição

Beta Globina
2 3
$jii:fi

"CAT"
t 1 ºCill 0,5 1,0 1,5 2.0 kb

"TATA"

Fator VIII
1 2-6 7 • 13 14 15 - 22 23 . 25 26
Ol====tl=l=tl==tll=l=U=t==.llflllll====llDts:::::====tll===mJ--
o 50 100 150 200 kb
/
' TATA'

. ,
HPRT
2 3 4 5 6 78 9
---01=========t=l=======t==l==t===tl::llll- - -
25 50 kb
"rica em GC" / o
'--~~~~~~~~~~__..~~~~~~~~~~~~

Fig. 3 .6 Estrutura geral de um gene humano típico As características individuais estão marcadas na figura e são discutidas no texto Os
exemplos de três genes humanos de importância médica são apresentados na parte inferior da figura Os éxons individuais são nume·
rados Mutações diferentes no gene de j3-globina causam uma variedade de hemoglobinopatias importantes As mutações no gene de
fator VIII causam hemofilia A As mutações no gene de hipoxantina fosforibosiltransferase (HPRn levam à síndrome de Lesch-Nyhan

noma humano não tenham íntrons, a maioria dos genes contém com a estrutma de vários genes de relevância médica. Juntos, ilus-
pelo menos um e em geral vários íntrons .Surpreendentemente, em tram a gama de características que caracteriza os genes humanos.
muitos genes, o tamanho cumulativo dos íntrons é uma proporção Nos Caps. 1 e 2, definimos "gene" em termos gerais. Neste ponto,
muito maior do gene que o dos éxons. Embora alguns genes te- podemos dar uma definição molecular de um gene. Em circuns-
nham apenas alguns quilobases (kb, em que 1 kb = 1.000 pares tâncias típicas, definimos gene como wna seqüência de DNA cro-
de bases) de tamanho, outros, como o gene de fator vm mostrado mossômico que é necessária para a produção de um produto fim-
na Fig. 3.6, têm centenas de quilobases. Existem alguns genes cional, seja um polipeptídeo ou uma molécula funcional de RNA
excepcionalmente grandes, incluindo o gene de distrofina ligado Como está claro na Fig. 3.6, um gene inclui não só as seqüências
ao X (mutação que leva à distrofia muscular Duchenne), que ocu- realmente codificantes, mas também as seqüências nucleotíclicas
pa mais de 2 milhões de pares de bases (2.000 kb), dos quais me- adjacentes necessárias para a expressão apropriada do gene- isto
nos de 1% consiste em éxons codificantes. é, para a produção de uma molécula normal de mRNA, na quan-
tidade correta, no local correto e no momento correto durante o
CARACTERÍSTICAS ESTRUTURAIS DE UM GENE HUMANO TÍPICO
desenvolvimento oil d~rante o ciclo celular.
As seqüências adjacentes de nucleotídeos fornecem os sinais
Uma representação esquemática de uma parte do DNA cromos- moleculares de "início" e "fim" para a síntese do mRNA trans-
sômico contendo um gene típico é mostrada na Fig. 3 .6,juntarnente crito do gene. Na ponta 5' do gene está uma região promotora,
O GENOMA HUMANO: ESTRUWRA E FUNÇÃO DOS GENES E CROMOSSOMOS 1 17

que inclui seqüências responsáveis pelo inicio apropriado da são mais similares em seqüência uns aos outros que a genes de
transcrição Dentro da região 5' estão vários elementos do DNA outros grupamentos. Assim, cada grupo é tido como tendo evo-
cuja seqüência é conservada entre muitos genes diferentes. Esta luído de uma série de eventos seqüenciais de duplicação gêni-
conservação, junto com os estudos funcionais da expressão gê- ca nos ú[timos 100 milhões de anos. Os padrões éxon-íntron
nica em muitos laboratórios, indica que estes elementos particu- de genes de globina parecem ter sido bastante conservados
lares de seqüência têm um papel importante na regulação. Exis- durante a evolução. Cada um dos genes funcionais de globina
tem vários tipos diferentes de promotor encontrados no genoma mostrados na Fig . 3.7 tem dois íntrons em locais similares,
humano, com diferentes propriedades reguladoras que especifi- embora as seqüências contidas dentro dos fntrons tenham acu-
cam os padrões de desenvolvimento, bem como os níveis de mulado muito mais mudanças de bases nucleotídicas com o
expressão de um determinado gene em tecidos diferentes. Os tempo que as seqüências codificantes de cada gene.. O controle
papéis dos elementos promotores individualmente conservados, da expressão dos vários genes de globina, no estado normal bem
identificados na Fig. 3.6, são discutidos em maiores detalhes na como nas muitas hemoglobinopatias herdadas, será considera-
seção "Fundamentos da Expressão Gênica". Tanto os promoto- do em maiores detalhes tanto mais adiante, neste capítulo, quan-
res quanto outros elementos reguladores (situados em 5' ou 3' to no Cap. I 1.
de um gene ou em seus íntrons) podem ser sítios de mutação nas Vários genes de globina não produzem nenhum RN A ou pro-
doenças genéticas que podem interferir com a expressão normal duto proteico e, portanto, é improvável que tenham alguma fun-
de um gene. Estes elementos reguladores, incluindo os ção. As seqüências de DNA que se assemelham muito a genes
acentuadores, os silenciadores e as regiões controladoras de conhecidos mas não são funcionais são chamadas de pseudo-
locus (LCRs), serão discutidos mais amplamente mais adiante genes. Os pseudogenes estão dispersos no genoma e são tidos
neste capítulo. como subprodutos da evolução, representando genes que já
Na ponta 3' de um gene está uma região não-traduzida de foram funcionais mas que agora são vestigiais, tendo sido ina-
importância que contém um sinal de adição de uma seqüên- tivados por mutações em seqüências codificantes ou regulado-
cia de unidades adenosina (a chamada cauda poliA) na ponta ras. Em alguns casos, como nos genes de pseudo-a-globina e
do mRNA finaL Embora em geral seja aceito que tais seqüên- pseudo-~-globina, os pseudogenes supostamente surgiram por
cias reguladoras proximamente vizinhas são parte do que é duplicação gênica, seguida da introdução de várias mutações
chamado de "gene", as dimensões exaras de qualquer gene nas cópias extras do gene que já foi funcional Em outros ca-
especifico permanecerão um tanto incertas até que as funções sos, os pseudogenes foram formados por um processo, chama-
potenciais das seqüências mais distantes sejam totalmente ca- do de retrotransposição, que envolve a transcrição, a geração
racterizadas . de uma cópia de DNA do mRNA e, finalmente, da integração
de tais cópias de DNA ao genoma Os pseudogenes criados por
retrotransposição não têm íntrons e são chamados de pseudo-
FAMÍLIAS DE GENES
genes processados. Eles não estão necessária ou usualmente
Muitos genes pertencem a famílias de seqüências de DNA pro- no mesmo cromossomo (ou região cromossômica) que seu gene
ximamente relacionadas, reconhecidas como famílias por cau- genitor.
sa da simOaridade da seqüência de nucleotídeos dos próprios A maior farrúlia de genes conhecida no genoma humano é a
genes ou da seqüência de aminoácidos dos polipeptídeos co- chamada superfamília de imunoglobulina, que inclui muitas
dificados. centenas de genes envolvidos nos eventos de reconhecimento da
Uma familia de genes pequena, mas medicamente importan- superfície celular nos sistemas imune e nervoso, tais como os
te, é composta de genes que codificam as cadeias de proteína genes nos cromossomos 2, 14 e 22, que codificam as próprias
encontradas nas hemoglobinas. Os grupamentos gênicos de a- cadeias pesada e leve de imunoglobulinas, os genes no cromos-
globina e de ~-globina, nos cromossomos 16 e 11, respectiva- somo 6, que constituem o complex.o principal de histocompati-
mente, são mostrados na Fig. 3 7 e são tidos como tendo surgi- bilidade, os genes nos cromossomos 7 e 14, cujos produtos cons-
do por duplicação de um gene precursor primitivo há cerca de tituem o receptor de células T, e os genes que são expressos pri-
500 milhões de anos Estes dois grupamentos contêm genes que mariamente em tecidos neuráis, tais como os genes para molé-
codificam cadeias de globina proximamente relacionadas ex- culas de adesão celular ou glicoproteinas associadas à rnielina
pressas em estágios de desenvolvimento diferentes, do embrião A estrutura e a função de muitos destes genes serão examinadas
até o adulto. Os genes individuais dentro de cada grupamento em detalhes no Cap 14.

ç 'l'ç 1vo. a2 o.1


genes tipo ex 5' - 3· Cromossomo 16

Gy Ay 'JIP õ p
genes tipo 13 s· li E 6 o ia m 3· Cromossomo 11

o 20 40 60 kb

Fig. 3 .7 Organização cro mossômica de dois grupos de genes de globina humana Os genes funcionais são indicados em vermelho Os
pseudogenes são indicados pelos boxes vazados (Redesenhado de Nienhuis A W.. Maniatis T 11987] Structure and expression of globin
genes in erythroid cells. ln Stamatoyannopoulos G . Nienhuis A W. Leder P Majerus P W ieds l 'The Molecular Basis of Blood Disea-
ses W B Saunders. Philadelphia. pp 28-65 )
18 ' O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

FUNDAMENTOS DA EXPRESSÃO GÊNICA ada um pouco antes da primeira seqüência codificante no pon-
to inicial de transcrição, o ponto que corresponde à ponta 5' do
O fluxo de informações do gene para o polipeptídeo envolve vári- produto final de RNA (ver Figs. 3.6 e 3.8), A síntese do trans-
as etapas (Fig 3.8). O início da transcrição de um gene está sob a crito primário de RNA oco~re no sentid~ 5' para 3': enq~anto
influência dos promotores e de outros elementos reguladores, bem o filamento do gene transcnto é de fato hdo no sentido 3 para
como de protefuas específicas, conhecidas como fatores de trans- 5' com relação à direção da estrutura desoxirribose fosfodiéster
crição, que interagem com seqüências específicas dentro destas (ver Fig, 3.2). Como o RNA sintetizado corresp~nd.e tanto em
regiões. A transcrição de um gene é iniciada no "ponto de início" polaridade quanto em seqüência de bases (substitumdo T por
transcricional no DNA cromossômico antecedente às seqüências U) ao filamento do DNA 5' para 3', este filamento de DNA não-
codificantes e continua ao longo do cromossomo, indo desde vá- transcrito às vezes é chamado de "codificante" ou "com senti-
rias centenas de pares de bases a mais de um milhão de pares de do". O filamento de DNA .3' para 5' transcrito é então chama-
bases, ao longo tanto de íntrons quanto de éxons e além do final do de "não-codificante" ou "anti-sentido".* A trancrição con-
das seqüências codificantes. Após a modificação tanto das pontas
tinua incluindo íntrons e éxons do gene, além da posição no cro-
5' quanto das pontas 3' do transcrito primário de RNA, as partes
mossomo que eventualmente corresponde à ponta 3' do mRNA
correspondentes a íntrons são removidas e os segmentos corres-
final. Não sabemos se a transcrição termina em ponto final 3'
pondentes a éxons são reunidos. Após a recomposição do RNA, o
predeterminado. . _
mRNA resultante (agora colinear às partes codificantes do gene)
O transcrito primário de RNA é processado pela ad1çao de uma
é transportado do núcleo para o citoplasma, onde o mRNA é fi-
estrutura química "cap" na ponta 5' do RNA e uma clivagem na
nalmente traduzido na seqüência de aminoácidos do polipeptídeo
codificado. Cada urna das etapas desta via complexa está sujeita a ponta 3' em um ponto específico ao final da informação
codificante. Esta clivagem é seguida pela adição de uma cauda
erro, e as mutações que interferem nas etapas individuais foram
implicadas em vários distúrbios genéticos (ver Caps, 5, 11 e 12). poliA na ponta 3' do RNA. A cauda poliA parece aumentar a
estabilidade do RNA poliadenilado resultante O ponto de
poliadenilação é especificado em parte pela seqüência AAUAAA
Transcrição
A transcrição de genes codificantes de proteínas pela RNA po-
limerase II (uma das várias classes de RNA polimerases) é inici- •N T: Esta inversão é uma causa constante de confusão por parte dos alunos

Filamento não-transcrito \ .
, Exons: 1 .2
3 3'
5 ~--Qiiiiii!i\'41M
ll*ID==s·
Filamento!rans~ri~-<~ 3' íl
3

~RNA ~
1. Transcrição 5' CAP-miil.l~~iliiiilBl!lim!l·~~~~~~~;m!ililil!&!B-~t~~- 3 '

~ Mçáo do poll(A)

2. Processamento e
recomposição do RNA s· -\4.m wS"2. eveme AAAA 3'

Núcleo

Ciloplasma
/ ' Cadeia polipeptrdica
J... J_' J! JJ · crescente
4. Tradução
5' -&6-b-ooo AAAA 3'

"º""m" / ~

5. Montagem da proteína W Polipeptídeo completo

Fig. 3 ..8 Fluxo de info rmação do DNA para o RNA para a proteína de um gene hipo tético com três éxons e dois íntrons As etapas i ncluem
transcrição. processamento e recomposição do RNA. transporte do núcleo para o citoplasma e tradução
O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS ! 19

(ou uma variante disto), em geral encontrada na parte 3' não-tra- teoria, são possíveis variações quase infinitas na disposição das
duzida do RNA transcrito. Estas modificações pós-transcricionais bases ao longo de uma cadeia polinucleotídica. Em qualquer
ocorrem no núcleo, assim como o processamento do RNA O posição existem quatro possibilidades (A, T, C ou G). Assim,
RNA totalmente processado agora é chamado de mRNA e é trans- existem 4" combinações possíveis em urna seqüência de n ba-
portado para o citoplasma, onde ocorre a tradução (ver Fig. 3.8) ses. Para três bases, há 43, ou 64, combinações possíveis de trin-
cas. Estes 64 códons constituem o código genético.
Como existem apenas 20 aminoácidos e 64 possíveis códons,
Tradução e o Código Genético a maioria dos aminoácidos é especificada por mais de um códon.
No citoplasma, o mRNA é traduzido em proteína pela ação de Por isto o código é dito degenerado. Por exemplo, a base na
uma variedade de moléculas de tRNA, cada uma específica para terceira posição da trinca pode ser urna puri na (A ou G), ou urna
um determinado aminoácido. Estas moléculas, cada uma com pirimidina (T ou C) ou, em alguns casos, qualquer uma das qua-
apenas de 70 a 100 nucleotídeos de tamanho, têm a função de tro bases, sem alterar a mensagem codificada (ver Quadro 31).
transferir os aminoácidos corretos para suas posições ao longo A leucina e arginina são especificadas por seis códons. Apenas
do molde de mRNA, para que sejam adicionados à cadeia poli- a rnetionina e o triptofano são cada um deles especificado por
peptídica crescente. A síntese de proteínas ocorre nos ribosso- um único códon. Três dos códons são chamados de códons
mos, complexos macrornoleculares feitos de rRNA (codificados finalizadores (ou sem sentido) porque designam o término da
pelos genes de rRNA 18S e 28S) e várias dúzias de proteínas tradução do mRNA neste ponto.
ribossomiais (ver Fig. 3.8). A tradução de um mRNA processado é sempre iniciada em
A chave para a tradução é um código que relaciona aminoá- um códon que especifica metionina. A metionina é, portanto, o
cidos específicos a combinações de três bases adjacentes ao lon- primeiro aminoácido codificado (amino-terminal) de cada cadeia
go do mRNA. Cada conjunto de três bases constitui um códon polipeptídica, embora em geral seja removido antes que a sínte-
específico para um determinado aminoácido (Quadro 3.1). Em se da proteína esteja completa. O códon para metionina (o códon

QUADRO 3-1

Segunda Base

Primeira Terceka
Base V e A G Base

uuu fen ucu ser UAU tir UGU eis u


uuc fen ucc ser UAC tir UGC eis e
u
UUA leu UCA ser UAA fim UGA fim A
UUG leu UCG ser UAG fim UGG trp G
cuu leu ccu pro CAU his CGU arg u
cuc leu ccc pro CAC his CGC arg e
e .
CUA leu CCA pro CAA gln CGA arg A
CUG leu CCG pro CAG gln CGG arg G
AUU ile ACU tre AAU asn AGU ser u
AUC ile ACC tre AAC asn AGC ser e
A
AUA ile ACA tre AAA lis AGA arg A
AUG met ACG tre AAG lis AGG arg G
GUU vai GCU ala GAU asp GGU gli u
GUC vai GCC ala GAC asp GGC gli e
G
GUA vai GCA ala GAA glu GOA gli A
GUG vai GCG ala GAG glu GGG gli G
Abreviações dos aminoácidos:
ala (A) alanina leu (L) leucina
nrg (R) arginina !is (K) lisina
asn (N) asparagina met (M) metionina
asp (D) ácido aspártico fem (F) fenilalanina
eis (C) cistefnn pro (P) prolina

gln (Q) giutamina ser (S) seri na


glu (E) ácido glutâmico tre (T) treonina
gli (G) glicina trp(W) triptofano
bis (H) histidina tir (Y) tirosina
ile (I) isoleucina vai (V) valina
Outra abreviação:
fim códon tinalizador
Os códons são mostrados em termos do rnRNA, que são complementnres aos códons correspondentes no DNA
20 1 O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

iniciador, AUG) estabelece a matriz de leitura do rnRNA Cada A Expressão Gênica em Ação: O Gene de
códon subseqüente é lido, por sua vez, para prever a seqüência Beta-Globina
de aminoácidos da proteína.
As ligações moleculares entre os códons e os aminoácidos são O fluxo de informações destacado nas seções anteriores pode ser
as moléculas específicas de tRNA. Um determinado sítio de cada mais bem apreciado com relação a um gene particularmente bem
tRNA forma um anticódon com três bases que é complementar estudado, o gene de 13-globina. A cadeia de 13-globina é um
a um códon específico no rnRNA. A ligação entre o códon e o polipeptídeo com 146 aminoácidos, codificada por um gene que
anticódon coloca o aminoácido apropriado na posição seguinte ocupa aproximadamente 1,6 kb no braço curto do cromossomo
no ribossomo para a ligação pela formação de uma ligação 11. O gene tem três éxons e dois íntrons (ver Fig. .3.6). O gene
peptídica com a ponta carboxila e a cadeia polipeptídica crescen- de j3-globina, bem como outros genes no grupo de 13-globina (ver
te. O ribossomo então desliza ao longo do rnRNA a cada três Fig. 3.7), é transcrito em uma direção do centrômero para o telô-
bases, alinhando o códon seguinte para o reconhecimento por mern. Esta orientação, entretanto, é diferente para outros genes
outro tRNA com o aminoácido seguinte. Assim, as proteínas são no genoma e depende de qual filamento da dupla hélice cromos-
sintetizadas a partir de seu terminal amino até o terminal sômica é o filamento codificante de um determinado gene.
carboxila, que corresponde à tradução do rnRNA no sentido 5' As seqüências de DNA necessárias para uma iniciação preci-
para 3'. sa da transcrição do gene de 13-globina estão situadas no promo-
Como mencionado antes, a tradução termina quando um tor em cerca de 200 pares de bases antecedentes ao ponto de iní-
códon finalizador (UGA, UAA ou UAG) é encontrado na mes- cio da transcrição. A seqüência de dupla hélice de DNA desta
ma matriz de leitura que o códon iniciador. (Os códons região do gene de j3·globina, a seqüência correspondente de RNA
finalizadores em uma das mauizes de leitura não são lidos e, e a seqüência tr·aduzida dos 10 primeiros aminoácidos são mos-
portanto, não têm efeito na tradução.) O polipeptídeo completo tradas na Fig. 3.9 para ilustrar as relações entre estes três níveis
é então liberado do ribossomo, que se toma disponível para co- de informação. Como mencionado antes, é o filamento 3' para
meçar a síntese de outra proteína. 5' do DNA que serve como molde e é transcrito, mas é o
filamento 5' para .3' do DNA que corresponde mais diretamente
à seqüência 5' para 3' do mRNA (e, de fato, é idêntica a ele,
Processamento Pós-traducional exceto por U substituindo T). Devido à sua correspondência, o
filamento 5' para .3' do DNA de um gene (o filamento que não é
Muitas proteínas sofrem amplas modificações pós-traducionais. transcrito) é o filamento em geral relatado na literatura científi-
A cadeia polipeptídica que é o produto primário da tradução é ca ou nos bancos de dados.
dobrada e associada em uma estrutura tridimensional específica De acordo com esta convenção, a seqüência completa de apro-
que é determinada pela própria seqüência de aminoácidos. Duas ximadamente 2,0 kb do cromossomo 11 que inclui o gene de 13-
ou mais cadeias polipeptídicas, produtos do mesmo gene ou de globina é mostrada na Fig ..31 O. (Vale a pena refletir que esta pá-
genes diferentes, podem se combinar para formar um único com- gina de nucleotídeos representa apenas 0,000067% da seqüência
plexo proteico final. Por exemplo, duas cadeias de a-globina e de todo o genoma humano). Dentro destes 2,0 kb está contida a
duas cadeias de 13-globina associam-se de modo não convalente maioria dos elementos de seqüência necessários para codificar e
para formar a molécula tetramérica de hemoglobina a.2 132• Os regular a expressão deste gene, mas não todos. Na Fig. .3JO são
produtos proteicos também podem ser modificados quimicamen- indicadas muitas das características importantes do gene de 13-
te por, por exemplo, adição de fosfato ou carboidratos em sítios globina, incluindo os elementos de seqüência promotora conser-
específicos. Outras modificações podem envolver a clivagem da vados,.os limites de íntrons e éxons, os sítios de corte do RNA, os
proteína, s~ja para remover seqüências amino-terminais especí- códons iniciadores e finalizadores e o sinal de poliadenilação, to-
ficas após terem direcionado uma proteína para o seu local cor- dos os quais são conhecidos como estando mutados em vários
reto dentro da célula (p. ex., proteínas que funcionam dentro do defeitos herdados do gene de 13-globina (ver Cap. 11).
núcleo ou mitocôndrias) ou para dividir a molécula em cadeias
polipeptídicas menores. Por exemplo, as duas cadeias que cons-
INÍCIO DA TRANSCRIÇÃO
tituem a molécula de insulina, uma com 21 e a outra com 30
aminoácidos, originalmente são parte de uma tradução primária O promotor de 13-globina, como muitos outros promotores gê-
com 82 aminoácidos, chamada de pró-insulina. nicos, consiste em uma série de elementos funcionais relati-

TATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC 3·
DNA ; ATAACOAATGTAAACGAAGACTGTGTTGACACAAGTQATCGTTGOAGTTTGTCTGTGGTACCACGTGGACTGAGGACTCCTCTTCAGACGG s
t Transcrição 1
Início
f Matriz de leitura
mRNA l lllr-11111111"111111111

t
5 ACA UUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACACCAUGGUGCACCUGACUCC UGAGGAGAAGU CUGCC

Tradução

(3-QIObína • "' •V n 1 H i 'lo u T h t P r o G 1 u G 1 u L y' S ~ 1 A 1a

Fig. 3.9 Estrutura da seqüência de nucleotfdeos da ponta 5· do gene humano de 13-globina no braço curto do cromosso mo 11 A trans-
crição do filamento 3· para 5· (inferior) começa no ponto indicado para produzi r o mRNA de 13-globina A matriz de leitura traducional é
determinada pelo códon iniciador AUG ( • •• ); os códons subseqüentes que especificam aminoácidos são indicados em vermelho As
outras duas matrizes potenciais não são usadas
O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS ! / 'Í 3)
'-._/

cromossomos humanos . Como vimos na seção anterio~, cada f cromatina estão bem descondensados em relação ao estado alta-
c~q.m.os~,omo. é.. tigo_ .C:c>".!c>._cg!l,!_is..tirz_<!_o_e!f! ~1~ia ~'J.k_a__<fEpJ.a. ~é­ mente condensado da cromatina na metáfase. Entretanto, mes-
lice contínua de DNA. Isto é, cada cromossomo no núcleo é uma mo nos cromossomos interfásicos, o DNA na cromatina está
longa molecuiãfüfilãmentar e linear de DNA. Os cromossomos substancialmente mais condensado do que estaria como uma
não são duplas hélices nuas de DNA . A molécula de DNA de dupla hélice nativa, livre de proteínas .
um cromossomo existe como um complexo, com uma família Os longos filamentos de nucleossomos estão eles próprios
de proteinas cromossômicas básicas chamadas histonas e com mais compactados em uma estrutura secundária helicoidal de
um grupo heterogêneo de proteínas não-histônicas ácidas que cromatina do que parece ao microscópio eletrônico, como uma
não são tão bem caracterizadas, mas que parecem ser cruciais fibra espessa de 30 nm (aproximadamente três vezes mais gros-
para o estabelecimento de um ambiente apropriado para garantir sa que a fibra nucleossômica) (ver Fig. 3.11). Esta fibra
o comportamento normal dos cromossomos e a expressão apro- "solenóide" (do grego solenoeides, "em foxma de tubo") cilín-
priada dos genes. Em conjunto, este complexo de DNA e P!E.- drica parece ser a unidade fundamental da organização da cro-
teinas, é chamado de cromatina. matina. Os solenóides são compactados em alças ou domínios
Existem cinco tipos principais de histonas que têm um papel ligados a intervalos de cerca de 100 kb a um arcabouço não-
crucial no acondicionamento da fibra de cromatina. Duas cópias histônico de protefna ou matriz. Tem-se especulado que as al-
de cada uma das quatro histonas cerne H2A, H2B, H3 e H4 cons- ças são, de fato, unidades funcionais de replicação do DNA ou
tituem um octãmero, ao redor do qual se enrola um segmento da de transcrição gênica, ou ambos, e que os pontos de ligação de
dupla hélice de DNA (Fig. 3.11). Cerca de 140 pares de base do cada alça são fixados ao longo do DNA cromossômico. Assim,
DNA estão associados a cada cerne de histona, dando quase duas um nível de controle da expressão gênica pode depender de
voltas ao redor do octâmero_Depois de um curto segmento (de como o DNA e os genes são acondicionados nos cromossomos
20 a 60 pares de bases) "espaçador" de DNA, forma-se um novo e de sua associação a proteínas da cromatina no processo de
complexo de DNA, e assim por diante, dando à cromatina um acondicionamento.
aspecto de contas em um colar.. Cada complexo de DNA com Os vários níveis hierárquicos de acondicionamento vistos em
histonas cerne é chamado de um nucleossomo, que é a unidade um cromossomo interfásico são ilustrados esquematicamente
estrutural básica da cromatina. A quinta histona, a Hl, parece na Fig. 3 .11 . A enorme quantidade de DNA embalada em um
ligar-se ao DNA em seguida a cada nucleossomo, na região cromossomo pode ser apreciada quando os cromossomos são
espaçadora intemucleossômica. A quantidade de DNA associa- tratados para remover a maioria das proteínas da cromatina a
da ao cerne de nucleossomo,juntamente com a região espaçadora, fim de se observar o arcabouço proteico (Fig. 3.12). Quando o
tem cerca de 200 pares de bases. DNA é liberado pelos cromossomos tratados deste modo, lon-
Durante o ciclo celular, como vimos no Cap. 2, os cromosso- gas alças de DNA podem ser vistas, e o arcabouço residual pode
mos passam por etapas ordenadas de condensação e desconden- ser visto reproduzindo uma estrutura de um típico cromosso-
sação (ver Fig. 2 .5). No núcleo inte1fásico, os cromossomos e a mo metafásico.

2nm ±10nm ±30 nm

Cada alça contém


± 100 .000 pb de DNA

Dupla hélice Fibra de nucleossorno Solenóide Núcleo


("contas de um colar") interfâsico

Fig. 3. 11 Níveis hierárquicos de acondicionamento da cromatina em um cro mossomo h umano


22 ! O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

vamente curtos que são tidos como interagindo com proteí- da de região controladora de Jocus (LCR) e situada anteceden-
nas específicas (em geral chamadas de fatores de transcri- do o gene de e-globína (ver Fig. 3 .7), que é necessária para a
ção) que regulam a transcrição, incluindo, no caso dos genes expressão apropriada em alto nível. Como esperado, as mutações
de g!obina, as proteínas que restringem a expressão destes que perturbam ou deletam as seqüências acentuadoras ou LCR
genes a células eritróides, as células nas quais é produzida a interferem ou impedem a expressão do gene de 13-globina (ver
hemoglobina Uma seqüência promotora importante é o Cap. 11).
"TATA boxe", uma região conservada rica em adeninas e
timinas que está cerca de 25 a 30 pares de bases antecedendo
RECOMPOSIÇÃO DO RNA
o ponto de início da transcrição (ver Figs. 3. 6 e 3. 1O} O TATA
boxe parece ser importante para a determinação da posição O transcrito primário de RNA do gene de [3-globina contém
do início da transcrição, que no gene de [3-globina está apro- dois éxons, cerca de 100 e 850 pares de base de tamanho, que
ximadamente a 50 pares de bases antecedentes ao ponto de precisam ser reunidos O processo é exato e muitíssimo efici-
início da tradução (ver Fig. 3 9), Assim, neste gene existem ente. Noventa e cinco por cento dos transcritos de [3-globina
cerca de 50 pares de bases de seqüência que são transcritos são tidos como sendo recompostos precisamente para gerar
mas não são traduzidos. Em outros genes, esta região 5' trans- um rnRNA funcional de globina. As reações de recomposi-
crita mas não traduzida (chamada de 5' UTR) pode ser muito ção são guiadas por seqüências específicas tanto nas pontas
maior e, de fato, pode ser interrompida por um ou mais ín- 5' quanto nas pontas .3' dos íntrons. A seqüência 5' consiste
trons. Urna segunda região conservada, o chamado CAT boxe em nove nucleotídeos, dos quais dois (o dinucleotídeo GT,
(na verdade, CCAAT), está antecedente há algumas dezenas situado no íntron imediatamente adjacente ao ponto de corte)
de pares de bases (ver Fig. 3.10) Tanto as mutações experi- são virtualmente invariantes entre os pontos de corte em ge-
mentalmente induzidas quanto aquelas de ocorrência natural nes diferentes (ver Fig. 3 .10). A seqüência 3' consiste em cerca
em um destes elementos de seqüência, bem como em outras de uma dúzia de nucleotídeos, dos quais, mais uma vez, dois,
seqüências reguladoras mais antecedentes, levam a uma in- os AG situados imediatamente a 5' do limite íntron/éxon, são
tensa redução no nível de transcrição, demonstrando assim a obrigatórios para a recomposição normaL Os próprios pon-
importância destes elementos para a expressão normal do tos de corte não estão relacionados com a matriz de leitura do
gene Muitas mutações nestes elementos reguladores foram rnRNA em particular. Em alguns casos, como no do íntron 1
identificadas em pacientes com o distúrbio [3-talassemia (ver do gene de ~-globina, o íntron corta um códon específico (ver
Cap.11). Fig. 3. I 0).
Nem todos os promotores gênicos contêm os dois elementos A importância médica da recomposição do RNA é ilustrada
específicos descritos Em particular, os genes que são expressos pelo fato de que as mutações dentro das seqüências conservadas
constitutivamente na maioria ou em todos os tecidos (chamados nos limites íntron/éxon comumente pnijudicam a recomposição
de "genes de manutenção" [housekeeping genes)) em geral não do RNA, com a redução concomitante da quantidade de mRNA
têm o CAT e TATA boxes, que são mais típicos de genes final normal de [3-globina; as mutações nos dinucleotídeos GT
histoespecíficos. Os promotores de muitos genes de manutenção ou AG mencionadas antes invariavelmente eliminam a remoção
em geral contêm uma alta proporção de citosinas e guaninas em normal do íntron contendo a mutação. Várias mutações de sítio
relação ao DNA circundante (ver o promotor do gene de hipo- de corte, identificadas em pacientes com [3-talassemia, serão
xantina fosforlbosiltransferase na Fig. .3 .6) Tais promotores ri- discutidas em detafües no Cap. 11.
cos em CG em geral estão situados nas regiões do genoma cha-
madas de ilhas de CG (ou de CpG), assim chamadas em fünção
da alta concentração do dinucleotídeo 5' -CG-3' que fica fora da POUADENI LAÇÃO
região cromossômica mais geral rica em AT Algumas das se- O mRNA final de 13-globína contém aproximadamente 1.30 pa-
qüências ricas em CG encontradas nestes promotores são tidas res de bases do material de .3' não-traduzido (3' UTR) entre o
como servindo como pontos de ligação para fatores específicos códon finalizador e o local da cauda poliA (ver Fig. 3.10). Como
de transcrição em outros genes, a clivagem da ponta 3' do mRNA e a adição da
Em adição às seqüências que constituem o próprio promotor, cauda poliA é controlada, pelo menos em parte, por uma seqüên-
existem outros elementos de seqüência que podem alterar muito cia AAUAAA de cerca de 20 pares de bases antes do sítio de
a eficiência da transcrição. As mais bem caracterizadas destas poliadenilação. As mutações neste sinal de poliadenilação nos
seqilências "ativadoras" são chamadas de acentuadores pacientes com [3-talassemia (bem como mutações no sinal de
(enhancers) . Os acentuadores são elementos de seqüência que poliadenilação correspondente no gene de o:-globina nos paci-
podem agir à distância (em geral vários kb) de um gene para entes com o:-talassemia) documentam a importância deste sinal
estimular a transcrição Ao contrário dos promotores, os para a clivagem apropriada em 3' e a poliadenilação (ver Cap ..
acentuadores são independentes de posição e orientação e podem 11). A região 3' não-traduzida de alguns genes pode ser bem
estar localizados a 5' ou a 3' do ponto de início da transcrição. longa, de até vários kb. Outros genes têm vários sítios de
Os elementos acentuadores funcionam apenas em alguns tipos poliadenilação alternativa, e a seleção entre eles pode influenci-
de células e, portanto, parecem estar envolvidos no estabeleci- ar a estabilidade do mRNA resultante e, portanto, o estado de
mento da especificidade tissular e/ou o nível de expressão de equilíbrio de cada rnRNA
muitos genes, em conjunto com um ou mais fatores de transcri-
ção. No caso do gene de [3-globina, vários acentuadores
histoespecíficos estão presentes dentro do próprio gene e em suas ESTRUTURA DOS
regiões flanqueadoras. A interação de acentuadores com deter-
CROMOSSOMOS HUMANOS
minadas proteínas leva a níveis aumentados de transcrição.
A expressão normal do gene de 13-globina durante o desen- A composição de genes no genoma humano, bem corno os de-
volvimento também requer uma seqüência mais distante, chama- terminantes de sua expressão, é especificada no DNA dos 46
O GENOMA HUMANO: ESTRUWRA E FUNÇÃO DOS GENES E CROMOSSOMOS
!

cromossomos humanos. Como vimos na seção anterio~, cada\ cromatina estão bem descondensados em relação ao estado alta-
CIJ!lt}OSSOmo é ticjo_ c:q'l!o__cq!_l_!_ÍS_tin_qo e'!! Ll'!ta !!n_(i;a.A.!:!P.ͪ..~é­ mente condensado da cromatina na metáfase. Entretanto, mes-
lice contínua de DNA . Isto é, cada cromossomo no núcleo é uma mo nos cromossomos interfásicos, o DNA na cromatina está
longa moleêüíafülilamentar e linear de DNA. Os cromossomos substancialmente mais condensado do que estaria como uma
não são duplas hélices nuas de DNA. A molécula de DNA de dupla hélice nativa, livre de proteínas.
um cromossomo existe como um complexo, com uma fanu1ia Os longos filamentos de nucleossomos estão eles próprios
de proteínas cromossômicas básicas chamadas histonas e com mais compactados em uma estrutura secundária helicoidal de
um grupo heterogêneo de protefnas não-histônicas ácidas que cromatina do que parece ao microscópio eletrônico, como uma
não são tão bem caracterizadas, mas que parecem ser cruciais fibra espessa de 30 nm (aproximadamente três vezes mais gros-
para o estabelecimento de um ambiente apropriado para garantir sa que a fibra nucleossômica) (ver Fig . 3.11). Esta fibra
o comportamento normal dos cromossomos e a expressão apro- "solenóide" (do grego solenoeides, "em forma de tubo") cilln-
priada dos genes Em conjunto, este complexo de DNA e P!_~~ drica parece ser a unidade fundamental da organização da cro-
teínas, é chamado de cromatina. matina. Os solenóides são compactados em alças ou domínios
Existem cinco tipos principais de histonas que têm um papel ligados a intervalos de cerca de 100 kb a um arcabouço não-
crucial no acondicionamento da fibra de cromatina. Duas cópias histônico de proteína ou matriz. Tem-se especulado que as al-
de cada uma das quatro histonas cerne H2A, H2B, H3 e H4 cons- ças são, de fato, unidades funcionais de replicação do DNA ou
tituem um octâmero, ao redor do qual se enrola um segmento da de transcrição gênica, ou ambos, e que os pontos de ligação de
dupla hélice de DNA (Fig. 3J 1). Cerca de 140 pares de base do cada alça são fixados ao longo do DNA cromossômico . Assim,
DNA estão associados a cada cerne de histona, dando quase duas um nível de controle da expressão gênica pode depender de
voltas ao redor do octâmero. Depois de um curto segmento (de como o DNA e os genes são acondicionados nos cromossomos
20 a 60 pares de bases) "espaçador" de DNA, forma-se um novo e de sua associação a proteínas da cromatina no processo de
complexo de DNA, e assim por diante, dando à cromatina um acondicionamento,
aspecto de contas em um colar. Cada complexo de DNA com Os vários níveis hierárquicos de acondicionamento vistos em
histonas cerne é chamado de um nucleossomo, que é a unidade um cromossomo interfásico são ilustrados esquematicamente
estrutural básica da cromatina.. A quinta histona, a Hl, parece na Fig. 311. A enorme quantidade de DNA embalada em um
ligar-se ao DNA em seguida a cada nucleossomo, na região cromossomo pode ser apreciada quando os cromossomos são
espaçadora intemucleossômica. A quantidade de DNA associa- tratados para remover a maioria das proteínas da cromatina a
da ao cerne de nucleossomo, juntamente com a região espaçadora, fim de se observar o arcabouço proteico (Fig. 3. 12). Quando o
tem cerca de 200 pares de bases. DNA é liberado pelos cromossomos tratados deste modo, lon-
Durante o ciclo celular, como vimos no Cap. 2, os cromosso- gas alças de DNA podem ser vistas, e o arcabouço residual pode
mos passam por etapas ordenadas de condensação e desconden- ser visto reproduzindo uma estrutura de um típico cromosso-
sação (ver Fig. 2.5). No núcleo interfásico, os cromossomos e a mo metafásico ..

2nm :!:10 nm :!:30 nrn

n n

Dupla hélice Fibra de nucleossomo Solenõide Núcleo


("contas de um colai") interfásico

Fig 3 .11 Níveis hierárquicos de acondicionamento da cromatina em um cromossomo humano


24 O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

Fig . 3. 12 Micrografia eletrônica de um cromossomo metafásico sem proteína. mostrando o arcabouço cromossômico residual e as alças
do DNA As fibras individuais do DNA podem ser mais bem visualizadas nas margens das alças de DNA Barra = 2µ (De Paulson 1 R .
L.aemmli U K 119771 The structure of histone-depleted metaphase chromosomes Cell 12:817-828 Reimpresso com permissão dos au-
tores e Cell Press )
O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS I 25

O Cromossomo Mitocondrial as seqüências envolvidas. Assim, as anomalias dos cromossomos


ricos em genes ou regiões cromossômicas tendem a ser muito
Um subgrupo pequeno mas importante de genes codificados mais graves clinicamente do que os defeitos similares envolvendo
no genoma humano reside nas mitocôndrias do citoplasma. Os partes do genoma pobres em genes.
genes rnitocondriais exibem herança exclusivamente mater- À medida que o Projeto do Genoma Humano vai ficando
na (ver Cap.. 5) . As células humanas têm centenas de mito- quase completo, toma-se aparente que a organização do DNA
côndrias, cada uma delas contendo várias cópias de uma pe- no genoma humano é muito mais complexa do que foi anteci-
quena molécula circular, o cromossomo mitocondrial. A mo- pado, como ilustra a Fig. 3 .13 para a região totalmente carac-
lécula de DNA mitocondrial tem apenas 16 kb de tamanho terizada do cromossomo 17 na vizinhança do gene BRCAJ,
(menos de 0,03% do menor cromossomo nuclear!) e codifica cujas mutações são responsáveis por algumas fonnas de cân-
apenas algumas dezenas de genes. Embora os produtos des- cer de mama familiar (ver Cap. 16). Do DNA genômico, me-
tes genes funcionem nas mitocônddas, deve-se destacar que nos de 10% codifica genes. Apenas de metade a três quartos
a grande maioria das proteínas encontradas nas mitocôndrias do tamanho linear total do genoma consiste no chamado DNA
são, de fato, os produtos de genes nucleares . As mutações nos de cópia única ou DNA único, isto é, DNA cuja seqüência de
genes mitocondriais foram demonstradas em vários distúrbi- nucleotideos é representada apenas uma vez (ou, no máximo,
os herdados maternamente, bem como distúrbios esporádicos algumas vezes) por genoma haplóide. O resto do genoma con-
(ver Cap . 12)., siste em várias classes de DNA repetitivo e inclui DNA cuja
seqüência de nucleotídeos é repetida, seja perfeitamente ou com
alguma variação, de centenas a milhares de vezes no genoma.
ORGANIZAÇÃO DO GENOMA Embora a maioria (mas não todos) dos 50.000 genes estima-
HUMANO dos no genoma esteja representada como DNA de cópia única,
As regiões do genoma com características similares ou organi- as seqüências na fração de DNA repetitivo contribuem para
zação, replicação e expressão não são dispostas aleatoriamente, manter a estrutura cromossômica.
mas sim tendem a ser agrupadas. Esta organização funcional do
genoma está muito bem correlacionada com sua organização Seqüências de DNA de Cópia Única
estiutural, como revelado pelo bandeamento dos cromossomos
metafásicos (introduzido no Cap. 2 e discutido em detalhes no Embora o DNA de cópia única constitua a maior parte do DNA
Cap . 9).. O significado geral desta organização funcional é que no genoma, grande parte de sua função permanece um mistério,
os cromossomos não são uma coleção aleatória de tipos diferen- pois, como mencionado, as seqüências que de fato codificam
tes de genes e outras seqüências de DNA. Algumas regiões cro- proteínas (a parte codificante dos genes) constituem apenas uma
mossômicas, ou mesmo cromossomos inteiros, são ricas em con- pequena porção de todas as cópias únicas do DNA. Longos tre-
teúdo gênico, enquanto outras não são. Alguns tipos de seqüên- chos de seqüências de DNA único(> 25 kb) são bem raros no
cias são característicos de diferentes marcos físicos de cromos- genoma, A maioria do DNA de cópia única é encontrada em
somos humanos. As conseqüências clinicas das anomalias de pequenos trechos (vários kb ou menos), intercalados com mem-
estrutura do genoma refletem a natureza especifica dos genes e bros de várias familias de DNA repetitivo (ver Fig. 3.13).

Genes: BRCA 1 Rho7 VAT1 IFP35


Éxons: 1 5-7 11 13-24----~ 6+-1 1-+6 /
={]Ili 1 1li 1 11 mi 1 1 Ol=:t:I:t:I=:t:I=FI=F==F=:t:I:t:I:t:Ii=il!l=====02~1ttll=lllll==llF=ttlll=lllSHI==~=
1 1
pseudogene pseudogene

Repetição
de DNA:

10 kb

Fig 3. 13 Organização seqüencial da região do genoma humano próxima ao gene BRCA1 . que é responsável por alguns casos de câncer
de mama familiar de início precoce São encontrados quatro genes e dois pseudogenes nesta seqüência de 11 "7 kb do cromossomo 17.
e suas localizações e estruturas são indicadas acima do cromossomo. Quase metade da seqüência consiste em vários elementos repe-
titivos intercalados. incluindo 170 cópias das repetições Alu. e 8 cópias das repetições LI que são indicadas abaixo do cromossomo
BRCA1 contém um promotor rico em GC, com vários sítios de ligação de fatores de transcrição específicos O gene RH07 codifica um
membro da família de proteínas de ligação de GTP VA T1 codifica uma proteína de membrana encontrada nas vesículas sinápticas Tanto
RH07 quanto VAT1 também têm promotores ricos em GC. IFP35 codifica uma proteína cuja expressão pode ser induzida por intérferon
(Baseada em Smith l M . Lee M K . Szabo C. 1 et ai 119961Complete genomic sequence and analysis of 1 17 kb human DNA containing
the gene BRCA 1 Genome Research 6: 1029-1049 )
26 1 O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

Famílias de DNA Repetitivo foram implicadas como a causa de mutações em doenças here-
ditárias pelo processo de retrotransposição, inu·oduzido em uma
Várias categorias diferentes de DNA repetitivo são reconhe- seção anteiior. Pelo menos algumas cópias das farru1.ias U e Alu
cidas. Uma característica distinta útil é se as seqüências re- ainda são transposicionalmente ativas e geram cópias de si m~s­
petidas ("repetições") estão agrupadas em um ou alguns pou- mas que podem se integrar em outras partes do geno~a, ocas10-
cos locais ou se estão dispersas pelo genoma, intercaladas nalmente causando inativação insercional de um gene importante
com seqüências de cópia única ao longo do cromossomo. As em termos médicos. A freqüência dos eventos de retrotransposi-
seqüências repetidas agrupadas constituem de 10% a 15% do ção que causam doenças genéticas em seres humanos atualmen-
genoma e consistem em arranjos de várias repetições curtas te é desconhecida, mas eles podem contribuir com até l em 500
organizadas em tandem. Os diferentes tipos de tais repetições mutações. Além disso, os eventos de recombinação aberrante
em tandem são coletivamente chamados de DNA satélite, entre cópias diferentes de repetições dispersas também podem
assim denominados porque muitas das famílias de repetições ser uma causa de mutação em algumas doenças genéticas (ver
originais em tandem podiam ser purificadas por densidade de Cap. 6).
centrifugação do resto do genoma como frações "satélite" do
DNA.
As famílias de DNA satélite variam com relação ao seu lo- VARIACÃO NA EXPRESSÃO GÊNICA E SUA
cal no genoma, ao tamanho total da disposição em tandem e RELEVANCIA PARA A MEDICINA
ao comprimento das unidades repetidas constituintes do agru-
A expressão regulada dos cerca de 50.000 genes codificados
pamento. Em geral, os arranjos-satélites podem ter vários mi-
nos cromossomos humanos envolve um conjunto de inter-re-
lhões de pares de bases ou mais de tamanho e constituir até
lações complexas entre níveis diferentes de controle, incluin-
vários por cento do conteúdo de DNA de um cromossomo do a dosagem gênica apropriada (controlada por mecanismos
humano. Muitas seqüências-satélites são importantes como de replicação cromossômica e segregação), a estrutura gênica
ferramentas moleculares que revolucionaram a análise cito- e, finalmente, a transcrição, a estabilidade do mRNA, a tradu-
genética clínica em função de sua relativafacHidade de de- ção, o processamento de proteínas e a degradação de proteín.as.
tecção (ver Cap. 9). Algumas seqüências-satélites humanas Para alguns genes, as flutuações no nível de produto gêmeo
são baseadas nas repetições (com alguma variação) de uma funcional, devidas ou à variação herdada na estrutura de um
seqüência curta, tal corno um pentanucleotídeo. Longas dis- determinado gene ou às mudanças induzidas por fatores não-
posições de tais repetições são encontradas nas regiões genéticos tais como dieta ou o ambiente, são relativamente de
heterocromátícas nos braços longos proximais dos cromosso- pouca importância. Para outros genes, as mudanças no nível de
mos l, 9 e 16 e em quase todo o braço longo do cromossomo expressão podem ter conseqüências clínicas, refletindo a im-
Y (ver Cap. 9) Outros DNAs satélites são baseados em repe- portância destes produtos gênicos em determinadas vias bioló-
tições um pouco mais longas. Por exemplo, a família a-saté- gicas. A natureza da variação herdada na estrutura e na função
lite de DNA é composta de disposições em tandem de cópias dos cromossomos e genes, bem como a influência desta varia-
diferentes de uma unidade de aproximadamente 171 pares de ção na expressão de características específicas, é a própria es-
bases, encontrada na região centromérica de cada cromosso- sência da genética médica e molecular e será tratada nos capí-
mo humano. Esta família de repetições é tida como tendo um tulos subseqüentes.
papel na função do centrômero, garantindo a segregação cro-
mossômica apropriada na mitose e na meiose. Referências Gerais
Além do DNA satélite, outra classe importante de DNA
repetitivo no genoma consiste em seqüências relacionadas Abel T, Manfoós T ( 1994) ,\lechanisms of cukaryotic gene regub-
tion. /11 Stam;novannopoulos G, Nienhuis AW, Majerus P\V,
que são dispersas pelo genoma em vez de localizadas (ver Varmus H, (eds) ·The lvlob:ular Basis of Blond Dise;iscs. WB
Fig . .3.13). Embora muitas famílias de DNA pequeno aten- Saunders, Philadelphia. pp 33- 70. .
dam a esta descrição geral, duas em particular garantem a ..lJherts B, Brny D, Lewis), et :11. (199·+) Molecubr Biology of thc
discussão porque juntas constituem urna porção significati- Cell, 3rd ed Garland Puhlishing, New York
va do genoma e porque foram implicadas em doenças gené- Bernardi G (l 995) The human genomc, organi:mion, anel ernlu-
tinnarv historv. :\nn Rev Genet 29:H5 -·+76
ticas. Os mais bem estudados elementos repetitivos disper- L.ewin B ·(2000} Genes VII, 7th ed Oxford University Press, Ox-
sos pertencem à chamada família Alu. Os membros desta ford, England
família têm cerca de .300 pares de bases de tamanho e são Semenza G (1999) Trnnscriptinn Factors and Hunnn Disc:isc . Ox-
reconhecivelmente relacionados uns aos outros, embora não ford Univcrsin· Press, f'.iC\I' York
Singer M, Berg P (l 99i) Exploring Genetic Mcch:inisms L'nfrer-
sejam iguais em seqüência No total, existem cerca de siw Science Books, Sausalito, California.
500 . 000 membros da família Alu no genoma, constituindo \~Tolffe A (1998) Chromatin Structure and Function, 'nl ed :\cad-
pelo menos vários por cento do DNA humano. Em algumas cmic Prcss, San Diego
regiões do genoma, entretanto, incluindo aquela próxima ao
gene BRCAJ como visto na Fig. 3.13, eles constituem uma Referências Espedficas aos Tópicos Particulares
porcentagem muito mais alta do DNA Uma segunda famí-
Berg- P (1981) Dissecdons and reconstruccions oi' genes ;md chro-
lia importante de DNA repetitivo disperso é chamada de ;11osomes (Nobel Prii.e lecture) Scienc:c 113:296- l0.1
família LL Os elementos Ll são seqüências longas e repe- K•z.azian HH, \for;m JV (1998) Thc impact of L l rctrotrans-
titivas (de até 6 kb de tamanho) que são encontrados em cerca posnns on the hum;m genome . Nature (;cnetics l 'I: 19-24
de 100.000 cópias por genoma . Eles são abundantes em al- L.awn RM, Efstmiadis A. O'Connell C, et ai (1'180) Thc nu-
gumas regiões do genoma, mas relativamente esparsos em cleotide sequencc of the human ~-glohin gene Cell
21:647-651
outras Smith TM, Lcc MK, Sz.aho Cl, et ai (1996) Complete gcnomic sc-
As familias de repetições dispersas pelo genoma são claramen- quence anel analysis of l li kb of human DNA conrnining the
te de importância médica. Tanto as seqüências Alu quanto as L. l ... ,lfene BRC."1 l Genome Research 6: l 019- l O-l9.
O GENOMA HUMANO: ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS 1 27

\Vallace DC (1999) ll·litochomlrial diseases in man ;tnd mouse Sd-


ence 283:1-!82-H88 p15

Problemas
As seqüências de aminoácidos que se seguem representam parte de
uma proteína São mostradas a seqüência normal e quatro formas
mutantes. Consultando o Quadro 3. l, determine a seqüência
bifilamentar da seção correspondente do gene normal. Qual filamento
a RNA polimerase irá ler? Qual seria a seqüência do mRNA resul-
tante? Que tipo de mutação é mais provável que cada proteína mu-
tante represente?
Normal -lis-arg-his-his-tir-leu-
Mutante 1 -lis-arg-his-his-cis-leu-
Mutante 2 -lis-arg-ile-ile-ile-
Mutante 3 -lis-glu-tre-ser-leu-ser-
Mutante 4 -asn-tir-leu-
2 Os itens que se seguem estão relacionados uns aos outros de modo
hierárquico. Quais são estas relações? Cromossomo, par de bases,
nucleossomo, banda G, pares de kb, intron, gene, éxon, cromatina,
códon, nucleotfdeo. 5 Sp-
3.. O desenho esquemático que se segue ilustra um cromossomo 5 no
qual a banda mais distal (banda pl5) no braço curto está deletada. 4 A maior parte do genoma humano consiste em seqüências que não são
Este cromossomo deletado está associado à síndrome do cri du clzat transcritas e não codificam diretamente produtos gênicos. Para cada um
(ver Caps. 9 e 10) Com o que você sabe sobre a organização dos dos que se seguem, considere os modos pelos quais estes elementos
cromossomos e do genoma, aproximadamente quanto DNA foi de- genômicos podem contribuir para uma doença humana: íntrons, seqüên-
letado? Quantos genes? cias repetitivasA/11 ou LI, regiões controladoras de locus, pseudogenes.
~I

i~,~
Ferramentas da
Genética Molecular Humana
Um dos principais objetivos da genética médica moderna é com- dos os outros segmentos de DNA ou moléculas de mRNA
preender a base molecular das mutações que levam a uma doen- presentes na célula. As últimas três décadas testemunharam
ça genética e usar esta informação para melhorar os métodos de uma revolução tecnológica que resolveu tanto os problemas
diagnóstico e tratamento. Os avanços em nossa compreensão da de quantidade quanto os de purificação. Estas duas tecnolo-
genética molecular têm contribuído consideravelmente para o gias completares são a clonagem molecular e a reação em
desenvolvimento de novas e revolucionárias tecnologias que cadeia da polimerase (PCR) (Fig. 4 ..1).
permitem a análise detalhada de genes normais e anormais. A Como muitos avanços tecnológicos, estes possuem seu jar-
aplicação destas técnicas tem tanto aumentado a compreensão gão, cujo domínio pode parecer mais importante que os concei-
dos processos moleculares em todos os níveis, do gene ao orga- tos envolvidos (ver boxe).
nismo inteiro, quanto apoiado o desenvolvimento de uma ampla
gama de procedimentos laboratoriais para a detecção e o diag-
nóstico das doenças genéticas. Clonagem Molecular
Este capítulo não pretende ser um livro de receitas para expe- O processo de clonagem molecular envolve a transferência de
rimentos genéticos ou métodos de diagnóstico laboratorial. Ao uma seqüência de DNA de interesse para uma única célula de
cont:rátio, serve apenas como uma introdução para as técnicas que um microrganismo. O microrganismo é ~ubseqüentemente cul-
têm sido e continuam a ser amplamente responsáveis pelos avan- tivado, de modo a reproduzir a seqüência de DNA junto com seu
ços tanto na pesquisa básica quanto na genética aplicada Os próprio complemento de DNA. Grandes qd~ntidades da seqüên-
conteúdos deste capítulo suplementam o material básico apre- cia de interesse podem ser isoladas em foi:ma pura para uma
sentado nos Caps. 3 e 5 e fornecem uma base para a compreen- análise molecular detalhada (ver Fig . 4.1).
são de grande parte da informação genética contida nos capítu-
los que se seguem Os leitores que tiveram um curso ou uma
experiência laboratorial em genética molecular humana podem Enzimas de Restrição
usar este capítulo como uma revisão ou pulá-lo inteiramente sem
Um dos principais avanços no desenvolvimento da clonagem
que isso vá interferir na continuidade do texto . Para outros que
molecular foi a descoberta, no início da década de I 970, das
acham o material deste capítulo muito resumido, as técnicas
endonucleases de restrição bacterianas (em geral chamadas
modernas mais detalhadas, juntamente com referências comple-
de enzimas de restrição), enzimas que reconhecem seqüênci-
tas, podem ser encontradas nas Referências Gerais citadas ao final
as bifilamentares específicas no DNA e clivam o DNA no sítio
deste capítulo.
de reconhecimento ou próximo a ele .. Por exemplo, a enzima
de restrição EcoRI reconhece a seqiiência específica de seis
ANÁLISE DO DNA INDIVIDUAL E pares de bases 5 ' -GAATTC-3 ' sempre que ela ocorre na
SEQÜÊNCIAS DE RNA molécula bifilamentar de DNA. A enzima cliva o DNA neste
sítio introduzindo um corte em cada filamento entre o G e o
Os geneticistas moleculares enfrentam dois obstáculos fun- A adjacente. A clivagem gera dois fragmentos, cada um com
damentais para desenvolver suas investigações sobre a base quatro bases, com pontas unifilamentares (Fig. 4.2). Tais pon-
molecular das doenças hereditárias. O primeiro obstáculo é tas "adesivas" são úteis para as reações subseqüentes de união
obter uma quantidade suficiente de uma seqüência de DNA na construção de moléculas recombinantes de DNA. Outras
ou RNA de interesse que permita sua análise, pois em geral enzimas de restrição reconhecem seqüências diferentes de
cada célula tem apenas duas cópias de um gene e alguns ge- nucleotídeos que são específicas para cada enzima em parti-
nes podem ser transcritos apenas em certos tecidos ou apenas cular Hoje são conhecidas mais de LOOO destas enzimas .
em pequena quantidade, ou ambos, gerando um pequeno nú- Algumas das mais comumente usadas são mostradas no Qua-
mero de moléculas de RNA mensageiro (mRNA). O segundo dro 4.1 A maioria das enzimas de restrição tem sítios de re-
obstáculo é o de purificar a seqüência de interesse dentre to- conhecimento que consistem em quatro ou seis pares de ba-
f'ERRAMENIAS DA GENÉTICA MOLECULAR HUMANA ' 29

~ A Linguagem da Tecnologia do DNA Recombinante


Biblioteca: urna coleção de clones recombinantes de uma primers seja complementar a um segmento de DNA de um
fonte conhecida como contendo o gene, o cDNA ou outras filamento e o outro seja complementar a um segmento de
seqüências de DNA de interesse. Em principio, urna bibliote- DNA do outro filamento de uma molécula de dupla hélice
ca pode conter todas as seqüências de DNA ou cDNA repre- de DNA. Um par especifico de primers serve para iniciar
sentadas na célula, no tecido ou no cromossomo original. Uso: a síntese de DNA em uma reação de PCR. Uso: "Fiz pri-
"uma biblioteca de cDNA de músculo" ou "uma biblioteca mers para PCR."
genômica humana". Reação em cadeia da polimerase (PCR): amplificação
Clone: uma molécula de DNA recombinante contendo um enzimática de um fragmento de DNA situado entre um par
gene ou outra seqüência de DNA de interesse. Também, o ato de primers. Uso: "fiz uma PCR do fragmento" ou "isolei o
de gerar tal molécula Uso: "para isolar um clone" ou "para fragmento usando PCR".
clonar um gene". Sonda: uma molécula de DNA ou RNA clonada, marcada
DNA Complementar (cDNA): um DNA sintético feito com radioatividade ou outro traçador detectável, usada para iden-
por uma DNA polirnerase especial conhecida como transcrip- tificar suas seqüências complementares por hibridização mole-
tase reversa, que usa o RNA mensageiro (mRNA) como mol- cular; também, o ato de usar tal molécula. Uso: "a sonda de (3-
de. Usado para se referir seja a uma cópia unifilamentar seja globina" ou "sondar o DNA de um paciente".
a seu derivado bifilamentar. Uso: "um clone de cDNA", "uma Transferência de Southern: um filtro para o qual o DNA
biblioteca de cDNA" ou "para isolar um cDNA". foi transferido, em geral após a digestão com a enzima de
Endonucleases de restrição (enzimas de restrição): en- restrição e eletroforese em gel para separar as moléculas de
zimas que reconhecem seqüências bifilamentares específicas DNA por tamanho (assim nomeada em homenagem a quem
de DNA e cortam o DNA no sítio de reconhecimento ou pró- desenvolveu a técnica, Ed Southern); também, o ato de gerar
ximo a ele. Uso:" uma digestão com enzima de restrição" (ou tal filtro e hibridizá-lo a uma sonda específica. Uso: "sondar
apenas "uma digestão de restrição") ou "a enzima de restri- uma transferência de Southem" ou "eles fizeram urna Sou-
ção EcoRI". them".
Hibridização: o ato de duas moléculas de ácido nucleico Transferência Northern: um filtro para o qual o RNA foi
complementares e unifilamentares fonnarem ligações de acor- transferido após eletroforese em gel para separar as molécu-
do com as regras de pareamento de bases (A com T ou U, G las de RNA por tamanho, assim denominada em comparação
com C) e se transformarem em uma molécula bifilamentar. à transferência de Southem (ver mais adiante); também, o ato
Uso: "A sonda hib1idizada a um gene." de gerar tal filtro e hibridizá-lo a uma sonda específica. Uso:
Hospedeiro: o organismo usado para isolar e propagar uma "sondar uma transferência Northem" ou "fizeram uma Nor-
molécula de DNA recombinante. Em geral uma linhagem da thern".
bactéria Escherichia coli ou da levedura Saccharomyces ce- Transferência W estem: um filtro para o qual foi transfe-
revisiae. Uso: "Em que hospedeiro clonar?" rida uma molécula de proteína após eletroforese em gel para
Inserção: um fragmento de DNA clonado em um deter- separar as moléculas de protefnas por tamanho (assim desig-
minado vetor. Uso: "Eles purificaram a inserção." nada como uma brincadeira com o nome de Southem, tal como
Ligação: o ato de fonnar ligações fosfodiéster para unir a Northem); também, o ato de gerar tal filtro e expô-lo a um
duas moléculas bifilamentares de DNA com a enzima DNA anticorpo específico Uso: "sondar uma Westem" ou "eles fi-
ligase. Uso: " Os fragmentos foram ligados." zeram uma Westem"
Oligonucleotídeo: um filamento curto de ácido nucleico Vetor: a molécula de DNA na qual o gene ou outro frag-
que varia de tamanho desde alguns pares de bases até algu- mento de DNA de interesse é clonado, capaz de se replicar
mas dezenas de pares de bases, em geral sintetizado quimica- em um determinado hospedeiro. Os exemplos incluem plas-
mente. Em geral chamado de um "oligo". mídeos, bacteriófago lambda, cosmideos e eromossomos ar-
Primers (par-a PCR): dois oligonucleotídeos, um de tificiais de leveduras ou bactérias. Uso: "um vetor de clona-
cada lado de uma seqüência-alvo, de modo a que um dos gem" ou "o vetor cosmídeo".

ses, embora algumas tenham sítios maiores Em geral, as se- ma. Como EcoRI cliva um DNA bifilamentar especificamente
qüências são palíndromos, isto é, a seqüência de bases no sf- em cada 5'-GAATTC-3' que encontra, e como mesmo uma
tio de reconhecimento, lida de 5' para 3', é a mesma em am- única mudança de base em um potencial sítio de clivagem abole
bos os filamentos. seu reconhecimento e clivagem pela enzima, tal digestão per-
A clivagem de uma molécula de DNA com uma determina- mite que se examine, de fato, esta seqüência particular· de seis
da enzima de restrição digere o DNA em uma coleção caracte- nucleotídeos em aproximadamente l milhão de locais no ge-
rística e reproduzível de fragmentos, os quais refletem a fre- noma. (Em média, uma enzima com um sítio de reconhecimento
qüência e a localização de sítios especificas de clivagem. Esta de seis pares de bases deve cortar o DNA humano a cada 46
propriedade das enzimas de restrição tem duas implicações im- pares de bases, ou uma vez a cada 4 kb. Na realidade, entretan-
portantes e centrais ao seu papel na tecnologia do DNA recom- to, tais sítios não estão situados aleatoriamente, refletindo a
binante e à sua aplicação em genética médica. Primeira, a di- composição particular de bases e seqüências de diferentes re-
gestão de amostras do DNA genômico com, por exemplo, a giões do genoma, e são observados fragmentos de EcoRl vari-
enzima EcoRI gera uma coleção de cerca de 1 milhão de frag- ando de tamanho desde alguns pares de bases até mais de 1
mentos de EcoRl, cada um de um determinado local no geno· milhão de pares de bases.)
30 1 FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA

DNA
Seqúência de

-··~
interesse

Célula humana

Digestão com
enzima de
restrição
j

Isolar e replicar o Biblioteca de Mistura de Fragmentos com seqüência de


clone com a diferentes fragmentos fragmentos de interesse amplificada por PCR
seqüência restrição
de interesse

Fig.. 4. 1 O uso da clonagem molecular e da reação em cadeia da polimerase (PCR) para isolar arbitrariamente grandes quantidades de
uma seqilência em particular de DNA de interesse na forma pura

Segunda, todas as moléculas de DNA digeridas com Eco RI, PLASM(DEOS


não importa sua origem, têm pontas adesivas unifilamentares
idênticas, independente da natureza das seqüências de DNA flan- Os plasmídeos são moléculas circulares e bifilamentares de
queadoras de um determinado sítio de EcoRl. Portanto, quais- DNA que se replicam extracromossomicamente em bactérias
quer duas moléculas de DNA que tenham sido geradas por di- ou leveduras. Os plasmídeos usados como vetores são deriva-
gestão com EcoRI podem ser unidas in vitro pela interação de dos de moléculas circulares de ocorrência natural que foram
suas pontas complementares de quatro bases, que é seguida pelo descobertas primeiro em bactérias porque levavam genes de
término das seqüências fosfodiéster em cada filamento por uma resistência a antibióticos e podiam ser facilmente passadas de
enzima chamada DNA ligase. Esta etapa de ligação cria uma uma bactéria para outra, espalhando assim a resistência a anti-
molécula de DNA "recombinante'', com uma ponta derivada de bióticos com rapidez pela população microbiana. Os plasmí-
uma fonte de DNA e a outra derivada de uma fonte diferente (ver deos especificamente destinados à clonagem molecular em geral
Fig. 4.2). Muitas enzimas de restrição, tais como a EcoRI, ge- são pequenos (vários kb de tamanho) e contêm uma origem de
ram pontas adesivas curtas. Outras, entretanto, cortam ambos os replicação (para se replicar em Escherichia coli ou em levedu-
filamentos no mesmo local, deixando pontas retas.. A DNA Iiga- ra), um ou mais marcadores selecionáveis (tais como um gene
se pode unir pontas retas criadas por uma enzima de restrição que que confere resistência a antibióticos) e um ou mais sítios de
corte o DNA sem deixar pontas adesivas restrição que podem ser cortados e usados para a ligação de
moléculas exógenas de DNA. Um esquema das etapas impor-
'tantes envolvidas na clonagem de DNA no sítio de EcoRl de
Vetores um plasmídeo é mostrado na Fig . 4.2 . A identificação de colô-
Um vetor é uma molécula de DNA que pode se replicar de modo nias que contêm o plasmídeo recombinante desejado, seguida
autônomo em um hospedeiro, tal como uma bactéria ou células de um crescimento em massa e do isolamento de DNA plasmi-
de levedura, do qual pode ser subseqüentemente isolado em for- dial puro, permite o isolamento de grandes quantidades da in-
ma pura para análise. A clonagem de fragmentos de DNA hu- serção clonada. A clonagem em plasmídeos é um procedimen-
mano em um vetor por meio de enzimas de resuição e DNA li- to padrão para a análise de moléculas pequenas de DNA (ver o
gase, como descrito, permite a propagação de um fragmento clo- Quadro 42).
nado juntamente com a molécula vetor. Como os vetores repli-
cantes em geral podem ser obtidos em um alto número de cópias BACTERIÓFAGO LAMBDA
por célula, e como o hospedeiro bacteriano ou de levedura pode
ser cultivado indefinidamente no laboratório, podem ser obtidas Outro vetor muito usado é o bacteriófago lambda, um vírus
grandes quantidades de seqüências do DNA de interesse. A ha- bacteriano com uma molécula de DNA bifilamentar relativa-
bilidade de gerar qualquer número des~jado de cópias idênticas mente grande (cerca de 45 kb). Após infectar uma E. coli,
(clones) de uma seqüência em particular é um produto da tec- lambda replica-se para produzir grandes números de vírus
nologia do DNA recombinante O nome "DNA recombinan- infecciosos, rompendo a bactéria (lise) e liberando cerca de 1
te" refere-se a novas combinações de DNA criadas in vitro entre milhão de bacteriófagos Cerca de um terço do genoma de
seqüências de DNA humano (ou outro) de interesse e moléculas bacteriófago não é essencial (indicado como "fragmentos in-
vetores bacterianos (ou outro) capazes de duplicação indefinida ternos" na Fig. 4.3) para o crescimento e a lise e pode ser
dentro de uma linhagem de laboratório de microrganismos, Vá- substituído por outras seqüências de DNA. Assim, o fago
rios vetores são comumente usados para este fim, cada um com lambda é extremamente adequado à clonagem de trechos de
suas vantagens e limitações (Quadro ~.2) DNA humano de até 20 kb .
FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA ! 31

DNA humano

\ ~~serção em

\"'"""
@@
, .
@ '{Crescimento
~
em
cas seletivas
Bactena ~

DNA cromossômico DNA do plasmldeo

Crescimento bacteriano

Isolamento do DNA do
plasmldeo em
grandes quantidades

Fig. 4.2 O processo de clonagem de um segmento de DNA humano (entre dois sítios de EcoRI) em um vetor de clonagem plasmidial
Aqui ori· indica a origem da replicação dó DNA para replicação do plasmideo nas células bacterianas; ..ampr'" e ·'tetr" indicam genes
bacterianos que conferem resistência à ampicilina e à tetraciclina O crescimento de bactérias em placas contendo antibióticos seleci-
ona as células que contêm cópias do plasmldeo. com a inserção humana clonada . (Modificada de Fritsch E F.. Wozney l.M 119941 Me-
thods of molecular genetics ln Stamatoyannopoulos G . Nienhuis A W . Majerus P W . Varmus H leds ! lhe-Molecular Basis of Blood
Diseases. 2 • ed W B Saunders. Philadelphia )

C OSM IDEOS E CROMOSSOMOS A Rl lFICIAIS DE BAC TÉRIAS ção da bactéria de um modo similar ao do vírus lambda, o cos-
mídeo recirculariza-se e replica-se como um grande plasrrúdeo.
Uma desvantagem dos plasrrúdeos padrão como vetores é que Os fragmentos de DNA exógeno com duas vezes o tamanho das
eles são ineficientes para a introdução de moléculas de DNA inserções de fago lambda podem ser clonados em vetores cos-
recombinante nas bactérias se as inserções forem maiores que mídeos,
cerca de 20 kb . Um método para superar esta ineficiência foi o No final da década de 1990, tornou-se disporúvel a tecnologia
desenvolvimento de vetores cosmfdeos. Os cosrrúdeos são essen- para clonar, em bactérias, fragmentos de DNA muito maiores que
cialmente plasmfdeos que usam a habilidade das partículas in- os cosrrúdeos. Tais plasrrúdeos enormes são chamados de cromos-
fecciosas do bacteriófago lambda para "embalar" eficientemen- somos artificiais de bactérias (BACs). Os BACs podem levar in-
te grandes pedaços lineares de DNA em capas de proteína que serções de DNA humano de 100 a 300 kb de tamanho.
então se ligam à superfície das bactérias e injetam seus conteú- O uso de vetores cosmídeo ou BAC para clonagem é essenci-
dos de DNA. A limitação do tamanho de inserção do cosrrúdeo almente o mesmo que o mostrado para os plasrrúdeos na Fig. 4,2.
é que lambda não é capaz de acomodar seu DNA (ou um cosrrú- A diferença entre plasmideos, cosrrúdeos e BACs é como os
deo), haja ou não uma inserção, se o cromossomo do bacteriófa- vetores portadores destas grandes inserções são introduzidos nas
go exceder a aproximadamente 50 kb de tamanho. Após a infec- bactérias.
32 1 FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA

QUADRO 4-1
Exemplos ~e. Enzimas de Restrição e s·uas Seqüências d e Reé:ôn~ecimento
E nzimas de Restrição Fonte Seqüências de Reconhecimento*
BamHI Bacillus amyloliquefaciens H 5'- G" GATC C-3'
3'-C CTAG "G-5'
EcoRI Escherichia coli RY 13 G"AATTC
CTTAA"G
Haelll Haemophilus aegyptius GG"CC
CC"GG
HindIII Haemophilus influenzae R,, A"AGCTT
TTCGA"A
Notl Nocardia otitidis-cavarium GC"GGCCGC
CGCCGG"CG
Sau.3A Staphylococcus aureus 3A "GATC
CTAG"
SHil Streptomyce.5 stanford CCGC"GG
GG"CGCC
•Todas as seqüências de reconhecimento são dadas na polaridade 5' ~ 3', como mostrado para BamHI Os sítios de clivagem
em cada filamento são indicados por circunflexos

CROMOSSOMOS ARTIFICIAIS DE LEVEDURA ocorrer a clivagem aleatória de tais sítios, poderá ser obtida uma
coleção de fragmentos superpostos de tamanhos adequados para
Para muitos dos enfoques de clonagem gênica e mapeamento
clonagem e ligados aos "braços" do bacteriófago lambda prepara-
gênico, ilustrados no Cap. 8, é vanta,joso isolar o maior pedaço
dos de modo que as pontas Sau3A dos fragmentos de DNA hu-
possível de DNA humano .. O vetor de clonagem com a maior
mano possam ser ligados ao vetor (ver Fig. 4.J). Após o acondici-
capacidade é o cromossomo artificial de levedura (YAC) . Dois
onamento do cromossomo lambda recombinante em partículas
braços, um contendo um telômero de levedura, um centrômero
infecciosas de bacteriófago, a biblioteca, contendo 1 milhão ou
e um marçador selecionável e outro contendo um telômero e um
mais fragmentos do DNA genôrnico, pode ser estocada para futu-
segundo marcador selecionável, estão ligados às pontas de gran-
des fragmentos de restrição gerados pela digestão parcial do DNA ro isolamento de muitos genes. Bibliotecas genônúcas contendo
genôrnico, criando assim um cromossomo artificial (Fig. 4.4). fragmentos muito maiores de DNA genôrnico têm sido feitas por
Estes fragmentos são transferidos para um hospedeiro, Saccha- meio da produção de YACs contendo DNA parcialmente digeri-
romyces cerevisiae (levedura do pão), onde se replicam e se se- do com, por exemplo, EcoRI (ver Fig. 4 4).
gregam como cromossomos normais lineares de levedura. Os
YACs pernútem a clonagem e o isolamento de fragmentos de BIBUOTECAS DE DNA COMPLEMENTAR
DNA de até l.000 a 2.000 kb de tamanho, bem menores que um
Outro tipo comum de biblioteca usada para isolar genes é a bi-
cromossomo humano normal, mas aproximadamente do mesmo
blioteca de cDNA, a qual representa cópias de DNA complemen-
tamanho de um cromossomo normal de levedura.
tar (logo, cDNA) da população de mRNA presente em um de-
ternúnado tecido.. Tais bibliotecas de cDNA em geral são prefe-
Construção de Bibliotecas ríveis às bibliotecas genômicas como uma fonte de genes clona-
dos (1) porque o clone obtido é uma representação direta das
A finalidade da clonagem molecular, logicamente, é isolar um
determinado gene ou outra seqüência de DNA em grandes quan-
tidades para posterior estudo. Um enfoque comum para gerar
grandes quantidades de uma seqüência é construir um conjunto QUADRO 4-2
de clones de bactérias ou leveduras que contenham um vetor no
qual os fragmentos de DNA foram inseridos. Tal coleção de clo-
nes é chamada de biblioteca, a qual, pelo menos teoricamente,
contém todas as seqüências encontradas na fonte original, inclu- Tipo de Tamanho
indo sua seqüência de interesse. Temos, então, que identificar o Vetor Hospedeiro Clonagem da Inserção
clone ou os clones de interesse na biblioteca usando métodos
Plasnúdeos Bactérias, Genõmica, Até :t 15 kb
sensíveis de triagem que, em alguns casos, são capazes de en- leveduras cDNA
contrar até mesmo uma única cópia do clone de interesse em uma Bacteriófago Bactérias Genõmica, Até :t 20 kb
coleção de até 10 milhões de clones iniciais. lambda cDNA
Cosnúdeos Bactérias Genômica Até :t 45 kb
BIBLIOTECAS GENÔMICAS
BACs Bactérias Genômica de 100 a
300 kb
Um enfoque para construir uma biblioteca de DNA genôrnico é YACs Leveduras Genômica de lOOa
mostrado na Fig. 4.3. O DNA genônúco humano é parcialmente 2.000kb
digerido com uma enzima de restrição como a Sau3A de tal modo BAC = cromossomo artificial de bactérias; YAC = cromossomo artificial de
que alguns dos sítios são cortados e outros, não. Deste modo, se leveduras .
FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA 1 33

____...i Sítios ~f Bam !,_______


-"Braço esquerdo"
· -
"Braço direito"
DNAvetor

! Digestão com
BamHI

Digestão parcial com


Sau 3A para obter
fragmentos de
:!: 20 kb de tamanho
Fragmentos internos

Remover fragmentos
internos não
essenciais à replicação

1
do lago

"Braço esquerdo" "Braço direito"

DNA ligase

"Braço Inserção de "Braço direito"


esquerdo" :!: 20 kb

"Embalar" em bacteriófago
e infectar E. coli

J
Biblioteca de
fragmentos de
DNA humano

etc

Fig. 4.3 Const rução de uma "biblioteca.. de DNA do genoma humano em um bacteriófago vetor Cada uma das partícu las dé fago recom-
binante na parte iníerior contém um fragmento diferente do DNA humano Uma coleção de vários milhares de tais fagos representaria
todo o DNA do genoma humano

seqüências codificantes, sem intrnns ou outras seqüências não- cação do tamanho ou do número de éxons ou a seqüência dos
codificantes encontradas no DNA genômico, e (2) porque o uso pontos de corte em 5' e 3' .
de uma determinada fonte de mRNA em geral enriquece subs- Vários métodos foram desenvolvidos para clonar cDNAs,
tancialmente as seqüências derivadas de um determinado gene todos eles baseados na enzima transcriptase reversa, uma
conhecido como expresso seletivamente neste tecido.. Por exem- DNA polimerase depende nte de RNA derivada de retrovirus
plo, o gene de .B-globina é representado em apenas urna parte por que pode sintetizar um filamento de cDNA a partir de um mol-
milhão em urna biblioteca genômica humana, mas é o principal de de RNA (Fig. 4,5) A transcriptase reversa necessita de um
rnRNA transcrito nas hemácias. Assim, uma biblioteca de cDNA primer para iniciar a síntese de DNA Em geral, é usado um
preparada de hemácias representa uma excelente fonte de clo- oligonucleotídeo contendo timinas (oligo-dT). Este curto ho-
nagem para isolar cDNAs do gene de .B-globina. Similarmente, mopolímero liga-se à cauda poliA na ponta 3' das moléculas
uma biblioteca de cDNA de ffgado ou músculo é uma boa fonte de mRNA (ver Cap. 3) e assim inicia a síntese de urna cópia
de clones para genes conhecidos como expressos preferencial ou complementar Este cDNA unifilamentar é então convertido em
exclusivamente nestes tecidos. Um cDNA, entretanto, contém uma molécula bifilamentar por um dos vários métodos dispo-
apenas os éxons de um gene, mas não os introns ou seqüências níveis, e o cDNA bifilamentar pode então ser ligado a um ve-
promotoras Além disso, um cDNA não fornece nenhuma indi- tor adequado, em geral um plasmídeo ou um bacteriófago, para
34 r FERRAMENTAS DA GENÉTICA MOL.ECULAR HUMANA

DNA genõmico humano


Braços do YAC

~
Telómero

Marcador n22 Centrómero


selecionável

Telõmero .
' Digestão parcial com
Marcador n91 EcoRI para obter
selecionável fragmentos > 500 kb

Ligar pontas
compatíveis de EcoRI

Biblioteca de leveduras, cada uma contendo um YAC que leva um fragmento genõmlco humano diferente

Fig .. 44 Const rução de uma bibl ioteca genômica em cromossomos artificiais de levedura (YACsJ Grandes fragmentos(> 500 kb) de
DNA humano são gerados por digestão parcial com EcoRI do DNA genômico humano Cada braço do vetor contém um telômero em
uma ponta e urna EcoRI compatível na o utra ponta Cada um também tem um marcador selecionável diferente. e um braço contém
ainda um centrômero Os braços do vetor são ligados aos fragmentos de DNA humano para gerar um cromossomo linear artificial
com telôrneros de levedura e marcadores selecionáveis em cada ponta e um centrômero de levedura em uma ponta Os YACs são
transferidos para a levedura . e os marcadores selecionáveis são usados para selecionar apenas as leveduras que contêm o YAC apro-
priadament e construído

criar uma biblioteca de cDNA que represente todos os mRNA é feita com uma técnica muito usada em genética molecular,
originalmente transcritos encontrados no tipo de célula ou te- conhecida como hibridização de ácidos nucleicos. Em uma
cido inicial (ver Fig . 4. 5) . Alguns vetores inteligentemente reação de hibridização, ácidos nucleicos unifilamentares são
construídos, chamados de vetores de expressão, contêm sinais misturados sob condições de temperatura e concentração de sal
de transcrição e tradução adjacentes ao sítio de inserção do que permitem apenas o parearnento correto de bases (A com T,
cDNA, para facilitar a expressão da proteína codificada pelo G com C) entre os fil amentos de DNA. Apenas os filamentos
cDNA clonado em E coli ou em levedura. de pares de bases que são corretos podem formar um ácido
Bibliotecas representativas de cDNA de muitos tecidos dife- nucleico bijilamentar estável. Não serão formadas moléculas
rentes ou de épocas diferentes do desenvolvimento são fontes bifilamentares estáveis entre seqüências não-complementares
valiosas para a clonagem gênica. Hqje, centenas de tais bibliote- na mistura (Fig . 4 .6)
cas estão amplamente disponíveis e são a fonte de clones usados A especificidade da hibridização de ácidos nucleicos para fi-
em seqüenciamento para gerar enormes bancos de dados de se- lamentos complementares possibilita o uso de sondas de ácidos
qüências marcadas expressas como parte do Projeto do Geno- nucleicos. Uma seqüência (o "alvo") em uma mistura de ácidos
ma Humano (ver Cap. 8). nucleicos é testada quanto à sua complementariedade a um frag-
mento de DNA ou RNA de seqüência conhecida (a "sonda"), que
Sondas de Ácidos Nucleicos foi marcada com um traçador radioativo, um composto bioquí-
mico ou um corante fluorescente para permitir que a sonda s~ja
Uma vez feita uma biblioteca, a etapa seguinte é identificar o subseqüentemente detectada, Por exemplo, um modo comum de
clone portador da seqüência de interesse dentre os milhões de marcar uma sonda é com o fósforo 32 (32P), cuja alta energia é
ouuos clones portadores de outros fragmentos. A identificação exposta em um filme de raios X. Podemos introduzir 32P em urna
do clone portador de uma inserção de interesse é chamada de sonda por uma variedade de métodos que adicionam o 32P à es-
triagem de biblioteca. A triagem de urna biblioteca em geral trutura fosfodiéster de um filamento de DNA. Se a sonda for
FERRAM ENTAS DA GENÉTICA MOLECULAR HUMANA ! 35

complementar ao alvo, ela formará uma molécula bifilamentar adiante) quanto a uma mutação específica tida como responsá-
estável. A seqüência-alvo no DNA original ou amostra de RNA vel pela anemia falciforme. Com amostras de RNA, o proble-
agora é identificada pela marcação na sonda, facilitando, assim, ma é detectar e medir a quantidade e a qualidade de um deter-
sua subseqüente detecção e análise ou isolamento. minado mRNA em uma amostra de RNA de um tecido no qual
As sondas podem ser clonadas genomicamente ou as molé- o mRNA desejado possa constribuir com apenas l/LOOO ou
culas de cDNA podem ser obtidas pelo uso da tecnologia do menos do total de RNA transcrito. Por exemplo, podemos que-
DNA recombinante, fragmentos de DNA gerados por PCR (ver rer usar uma sonda para o gene da distrofina ligado ao X para
discussão mais adiante) ou moléculas de ácido nucleico sinté- fazer uma análise Northern (ver mais adiante) de uma amostra
ticas (em geral DNA) As sondas derivadas de DNA clonado de RNA de músculo obtida de um paciente portador de distro-
ou geradas por PCR em geral são de várias centenas a vários fia muscular Duchenne ligada ao X para mRNA transcritos de
milhares de nucleotídeos de tamanho. Também podemos usar distrofina. A solução para este problema de detectar uma se-
como sondas quimicamente sintetizadas moléculas unifilamen- qüência rara dentre muitas envolve o uso de eletroforese em gel
tares de DNA, tipicamente com 15 a 60 nucleotídeos de tama- para separar as moléculas de DNA ou RNA pelo tamanho e
nho, conhecidas como sondas oligonucleotídicas ou, apenas, então fazer a hibridização dé ácidos nucleicos com uma sonda
oligonucleotideos. para identificar a molécula de interesse.
A hibridização dos ácidos nucleicos é um conceito fundamen-
tal em biologia molecular. A técnica é usada não só para a tria- Transferência de Southern
gem de bibliotecas de DNA clonado, mas também, de modo mais
geral, para a análise de DNA ou RNA nas células e tecidos, como A técnica da transferência de Southem, desenvolvida em mea-
descrito na próxima seção deste capítulo. dos da década de 1970, é o método padrão para a análise da es-
trutura do DNA cortado por enzimas de restrição. Neste proce-
dimento, diagramado na Fig. 4.7 para uma amostra de DNA ge-
MÉTODOS DE ANÁLISE DOS ÁCIDOS nômico, o DNA primeiro é isolado de uma fonte acessível.
NUCLEICOS Qualquer célula do corpo pode ser usada como fonte de DNA,
exceto as hemácias maduras, que não têm núcleo. Para a análi-
A análise de RNA ou DNA, ou de ambos, requer a detecção de se de amostras do DNA de um paciente, preparamos o DNA
uma determinada seqüência de DNA ou RNA dentre todas as genômico de linfócitos obtidos por venopunção rotineira. Uma
outras muitas seqüências presentes em uma amostra de células amostra de 1Omi de sangue peciférico contém cerca de 108 leu-
ou tecidos. Ao analisar o DNA genômico, o problema é encon- cócitos e fornece mais de 100 µg de DNA, o que é suficiente
trar e examinar o fragmento específico de DNA de interesse em para dezenas de digestões com enzimas de restrição. O DNA
uma mistura complexa de DNA genômico que contém vários genômico também pode ser preparado de outros tecidos, inclu-
milhões de fragmentos de DNA. Por exemplo, podemos usar indo culturas de fibroblastos, líquido amniótico ou células de
urna sonda para o gene de /3-globina para examinar uma amos- vilosidade cotiônica para diagnóstico pré-natal (ver Cap 18),
tra do DNA de um paciente pela análise de Southem (ver mais bem como qualquer amostra de biópsia de órgão (p. ex., figa-

i
mANA

Transcriptase reversa

5' AA AA 3'
Filamento de cDNA 3' - - - - - - - - - - - - - - - - - - T T T T 5'

t1 Remover mANA,
síntese do segundo filamento

eDNA 5' - - - - - - - - - - - - - - - - - - - - - : , . . 3'


bifilamentar
3' ~------------.~------ 5'
1 Clonar em
t vetor apropriado

Vetor

Biblioteca de
clones de
cDNA

cDNA 1 cDNA2 c0NA3

Fig. 4.5 Construção de uma biblioteca de cDNA em um plasmldeo vetor ORNA de um determinado tecido é copiado no DNA pela
enzima transcriptase reversa Após a síntese do segundo filamento complementar. o cDNA bifilamentar é então clonado
36 ! FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA

Desnaturação Hibridização
-----~

DNA bifilarnentar DNA unifilarnentar DNA blfilarnentar


renaturado

Fig. 4.6 O princípio da hibridização dos ácidos nucleicos Os dois filamentos complementares de urna dupla hélice de Watson-Crick
podem ser desnaturados" por uma variedade de tratamentos (tais como alta temperatu ra. pH alto ou condições de pouco sal) para
produzir uma coleção de moléculas unifilamentares de DNA Sob condições que favorecem a formação de DNA b ifilamentar renaturado.
os filamentos complementares irão se 'hibridizar·· uns com os outros, mas não com outros filamentos de DNA que tenham uma seqüên-
cia de nucleotfdeos diferente

do, rins, placenta). Os fragmentos distintos de DNA, cerca de to a um filme de raios X para revelar a posição de um ou mais
1 milhão, gerados por clivagem com enzimas de restrição de fragmentos aos quais a sonda se hibridizou. Assim, como mostra
uma amostra de DNA genômico são separados, com base no a Fig, 4.8 (direita), bandas radioativas específicas são detectá-
taman110, por eletroforese em gel de agarose, na qual os frag- veis no filme de raios X para cada coluna de DNA humano no
mentos pequenos movem-se mais depressa em um campo elé- gel de agarose original. Nesta amostra, a técnica de transferên-
trico do que os maiores. Quando o DNA digerido separado deste cia de Southern mostra que o gene para o receptor de andróge-
modo é corado com um DNA fluorescente, tal como o brome- no ligado ao X, que é responsável pelas características sexuais
to de etídio, os fragmentos de DNA genômico surgem como secundárias masculinas (ver Cap. 10), está ausente na amostra
um esfregaço de material fluorescente, porque em geral exis- de DNA genômico de um paciente com síndrome de insensibi-
tem muitos fragmentos de DNA para que algum se destaque dos lidade androgênica ligada ao X (também conhecida como fe-
outros (Fig 4. 8, esquerda). A técnica da transferência de Sou- minízação testicular). A transferência de Southern permanece
tbern nos permite encontrar e examinar, em um nível grossei- o procedimento padrão para o diagnóstico de muitas doenças
ro, um ou dois fragmentos de interesse nesta aparente coleção genéticas nos laboratórios de diagnóstico molecular ao redor
não-informativa de um milhão ou mais de fragmentos de res- do mundo, mas tem sido freqüentemente substítuída por méto-
trição. Os fragmentos bifilamentares de DNA são pdmeiro dos baseados em PCR.
desnaturados com uma base forte para separar os dois filamen-
tos complementares de DNA (ver Fig. 4.6). As moléculas de
DNA, agora unifilamentares, são então transferidas do gel para
Análise com Sondas Oligonucleotídicas
um filtro de nitrocelulose ou náilon por capilaridade (donde o AI elo-Específicas
nome "transferência de Southem") Quando uma determinada mutação é conhecida em pelo me-
Para identificar um ou mais fragmentos de interesse dentre nos alguns casos de uma doença genética, podemos refinar a
os milhões de fragmentos no filtro, é usada uma sonda especí- análise de mutações para investigar se esta mutação está pre-
fica marcada. Como descrito antes, a sonda em geral é um tre- sente ou ausente em uma amostra de DNA de um determina-
cho de DNA clonado que foi marcado radioatívamente e des- do paciente. A melhor sonda a usar para a detecção de uma
naturado para se tomar unifilamentar. A sonda marcada e o fil- determinada mutação de uma só base é um oligonucleotídeo
tro são incubados juntos em uma solução sob condições que sintético, porque seu tamanho curto o torna mais sensível até
favorecem a formação de moléculas bifilamentares de DNA mesmo a um só pareamento enado entre a sonda e a amostra
(como na Fig. 4 6). Devido à extrema especificidade do parea- a ser analisada. Assim, uma sonda oligonucleotídica sinteti-
mento de bases do DNA, a sonda se helicoidiza e forma pontes zada para complementar exatamente a seqüência normal de
de hidrogênio estáveis apenas com seu filamento complemen- DNA de um gene (um oligonucleotídeo alelo-específico, ou
tar no filtro, e não com todos os outros fragmentos de DNA. Se ASO) só se hibridiza com a seqüência complementar nonnal,
a sonda for um trecho de DNA genômico clonado, ela em ge- mas não com uma seqüência complementar imperfeita, na qual
ral se hibridizará a apenas um ou dois fragmentos no filtro, há um ou mais pareamentos errados entre o alvo e a sonda (Fig .
dependendo de como o gene (ou genes) na amostra original de 4 .9). De modo similar, uma ASO feita para a seqüência cor-
DNA foi cortado pela enzima de restrição específica usada. Se respondente a um gene mutante só se hibridiza com a seqüên-
a sonda for um cDNA clonado, entretanto, muitos fragmentos cia complementar, mas não com a seqüência em um gene
podem se hibridizar, pois o DNA genômico em geral não é normal.
colinear ao rnRNA transcrito do gene devido à presença de ín- É importante reconhecer a distinção entre a análise ASO e a
trons (ver Cap. 3). Após ter sido lavado para remover a sonda análise convencional de Soutbern com sondas de DNA clona-
não-ligada, o filtro (com sua sonda radioativa ligada) é expos- do. No caso das sondas de DNA clonado, a análise em geral
FERRAMENTAS DA GENÉT ICA MOLECULAR HUMANA 1 37

DNA genõmico
2 3

Etetroforese em gel de agarose


-
-
-
--
-
-
-
-
---
-
- -
- -
-
-
-
- -
-
- -
-
-
---
---
-
-
-
-
-
-
-
-
-
-
-
-
-
- -
- -
-
--
- --
--- - +
Transferir DNA para
filtro de nitrocelulose
ou náilon

Gel

2 3
Hibridização
DNA-DNAcom
sonda marcada
com 32p·

Filtro Filme de raios X

Fig. 4.7 O procedimento da transferência de Southern para a análise de seqüências específicas de DNA em uma mistura complexa de
seqüências diferentes, tais como o DNA genômico Neste exemplo. a amostra 3 tem um padrão diferente de enzima de restrição para a
seqüência de DNA detectada pela sonda. Esta variação pode ser decorrente de um polimorfismo de comprimento do fragmento de res-
trição (ver Cap 6) ou a de uma deteção do DNA perto da seqüência detectada

não revela uma única alteração de base, a menos que, por aca- A análise de ASO permite a exata identificação de uma se-
so, a única mudança de base crie ou destrua um sítio de enzima qüência de DNA em particular e pode distinguir as pessoas que
de restrição próximo à região de complementariedade da son- portam a seqüência normal de DNA em ambos os cromossomos,
da, alterando assim o tamanho do fragmento detectado pela a seqüência mutante em ambos os cromossomos ou as pessoas
sonda. Na grande maioria dos casos, os genes mutantes devi- com a seqüência normal em um cromossomo e a seqüência mu-
dos a mudanças de uma só base ou a pequenas mudanças no tante no outro (ver Fig. 4 .9). Entretanto, devemos tomar cuida-
DNA (pequenas deleções ou inserções, por exemplo) são in- do ao interpretar os resultados da análise de ASO, pois nem to-
distinguiveis dos genes normais por análise de Southem feita dos os genes mutantes em um determinado locus compartilham
usando sondas de DNA clonado padrão. Apenas as sondas ASO exatamente a mesma alteração de seqüência do DNA . Assim, a
pequenas têm a habilidade de detectar de modo confiável as falta de hibridização ao gene mutante ASO não significa neces-
alterações de um nucleotideo. saiiamente que o gene do paciente seja normal em toda a sua
38 ' FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA

rificado) obtido de um determinado tipo de célula é separado de

TT acordo com o tamanho pela eletroforese em gel de agarose e trans-


ferido para filtros de nitrocelulose ou náilon Como no procedi-
mento da transferência de Southem, o filtro é então incubado com
uma sonda marcada desnaturada, que se hibridiza a um ou mais
RNA transcritos . Após a exposição do filtro lavado a um filme
de raios X, uma ou mais bandas podem surgir, revelando a posi-
ção e a abundância dos transcritos específicos de interesse.

A REAÇÃO EM CADEIA DA POLIMERASE


A reação em cadeia da polimernse (PCR) é uma alternativa à
clonagem para gerar essencialmente quantidades ilimitadas de
uma seqüência de interesse (ver Fig. 4 1). A PCR pode amplifi-
car seletivamente uma única molécula de DNA ou RNA vá1ios
bilhões de vezes em algumas horas e revolucionou tanto o diag-
nóstico molecular quanto a análise das doenças genéticas. A PCR
é uma amplificação enzimática de um fragmento de DNA (o alvo)
situada entre dois "primers" oligonucleotídicos. Estes primers
são criados de modo a que um deles seja complementar a um
filamento da molécula de DNA de um lado da seqüência-alvo e
o outro s~ja complementar ao outro filamento da molécula de
DNA no lado oposto da seqüência-alvo. Como a ponta .3' de cada
primer oligonucleotfdico (ver Fig. 3. 2) segue para a seqüência-
alvo a ser amplificada e os primer.s são flanqueadores da seqüên-
cia-alvo, os primers são amplificados pela síntese, pela DNA
Fig. 4 .8 Detecção de uma deleção gênica pela transferência de polimerase, da seqüência entre eles. Como esquematicamente
Southern Quando o DNA genômico dos membros de uma família diagramado na Fig. 4.10, os primers são orientados de modo que
é digerido com uma enzima de restrição e o DNA é corado com um iniciem dois novos filamentos de DNA que sejam complemen-
corante fluorescente de DNA (tal como o brometo de etfdio) após tares e formem essencialmente uma segunda cópia da seqtiên-
eletroforese. todas as amostras parecem iguais (esquerda) . Após a
transferência de Southern e a hibridização a uma sonda de cDNA
para o gene humano ligado ao X de receptor de andrógeno. pode-
se ver que a pessoa com a síndrome de insensibilidade androgêni-
ca tem a deleção deste gene (direila. coluna do meio) O indivíduo com Mutação T-> C
insensibi lidade androgênica tem o cariótipo 46.XY. mas é ASO normal
fenotipicamente feminino (Figura por cortesia de R Lafreniere.
Stanford University)
o •• D D
i : !

i
A-+-+-
. :
': '1 ~ ~• ~ ~A°'r~
.
/ e e e o ' ' T~ .,,.., • • 1 •~'-e~
+) Hibridização (-) Pareamento errado,
sem hibridização
seqtiência. Pode haver uma mutação em outra parte do gene, em
outra localização que não a examinada por um determinado ASO.
A análise de ASO é usada principalmente nos casos em que há Genótip.....
lo_:- -
+-/+___ ·=_·'~_::_:_.:_.? ----/---~
uma forte probabilidade, baseada em outras linhas de evidência,
de que uma família ou um indivíduo esteja em risco de uma
mutação específica conhecida. O uso da análise de ASO é, por- ASO mutante
tanto, restrita a situações nas quais uma determinada mutação em
uma família é conhecida ou para distúrbios genéticos que são o o o •
; ~
D
i ! i
.,....G,.__
: i '.
o- a ac o
1 1 !
o-G-o-o.-.
: : ' !
caracterizados por um número finito de mutações diferentes. Os / • • ' ' • 'r~. ./•••••·e~
exemplos específicos de tais doenças serão considerados nos :+) Pareamento errado, (-) Hibridização
Caps. 5, 11e12. sem hibridização

Transferência Northern
A contraparte da técnica de Southern para a análise de amostras
GenótipL..lo_:--+-!+___ =
_---_+:_~._-_ _"-~-'-~·-e_•_,
de RNA é chamada de "Northern" ou blotting (borrão) de RNA.
A transferência Northem é o enfoque padrão para determinar o Fig. 4.9 Detecção de mutações de um só par de bases usando
tamanho e a abundância do mRNA de um gene específico em sondas oligonucleotfdicas alelo-espedficas A sonda "normal'
uma amostra de RNA ORNA não pode ser cortado pelas enzi- fará pareamento de bases apenas com as seqüências de DNA que
mas de restrição usadas para a análise de DNA. Os diferentes forem idênticas à sonda (em cima) Asonda "mutante" só irá parear
com as seq(lências de DNA que difiram da seqüência "normal"
RNAs transcritos são de tamanhos diferentes, entretanto, depen- por uma mutação específica de um par de bases (embaixo) As pes-
dendo do tamanho e do número de éxons dentro do gene trans- soas com todos os três genótipos podem ser diferenciadas por
crito (ver Cap. 3). Assim, um RNA celular total (ou mRNA pu- este método
FERRAMENTAS DA GE NÉTICA MOLECUW\R HUMANA 39

eia-alvo original. Ciclos repetidos de desnaturação por aqueci- cilrnente seqüenciado (ver discussão posterior) ou testado pelos
mento, hibridização aos primers e síntese enzimática de DNA métodos de hibridização ASO O que era um procedimento muito
resultam em urna amplificação exponencial (2, 4. 8, 16, 32, .. trabalhoso, envolvendo a construção de urna biblioteca genômi-
cópias) da seqüência-alvo de DNA (ver Fig. 4.10). Com o uso ca ou de cDNA a partir do DNA ou do RNA dos pacientes, se-
de "máquinas de PCR" especificamente ciladas, uma rodada de guido da triagem do gene de interesse, agora pode ser feito em
amplificação leva apenas alguns minutos. Em apenas algumas menos de um dia . A PCR facilitou muito o desenvolvimento e a
horas, muitos bilhões de cópias podem ser criadas a partir de uma aplicação clínica de muitos testes diagnósticos de DNA.
seqüência inicial. A PCR também pode ser aplicada à análise de pequenas amos-
A amplificação rápida de seqüências específicas por l'CR pode tras de RNA, um procedimento em geral chamado de PCR de
ser usada para facilitar a clonagem de genes específicos a partir transcriptase reversa.. Um único filamento de cDNA é primeiro
de amostras de DNA para a análise de mutação (ver Fig. 4. 1). sintetizado a partir do mRNA de interesse com a mesma trans-
Trechos particulares de um gene (em geral éxons) de um DNA criptase reversa que é usada para preparar bibliotecas clone de
podem ser rapidamente amplificados usando-se primers especí- cDNA (ver Fig. 4.5). Os primers de PCR são então adicionados,
ficos para o gene normal. O gene mutante pode então ser ou fa- juntamente com a DNA polimerase, como no caso da PCR de

Segmento de DNA
a ser amplificado

: : : : : : : inrmmmnmm""'111mrmnmmrmmnriJ-Ermimm"""'""mrmmrmmmr'"""""~>~lmTm!Tl!mm1TIT!nmmmmrmrm'1!!1m111'""----­
iiil!iillllliiR!!!llllllllllHl!!liillilOll!l!iii!iilliiii!IOll!Hl1lllOll!lllO!!Olllil!liOll!llii!llOilillllllllli!Ollllllllilll!hllllilll!lil!!ll!!llllll!!l!iil
Desnaturar e íl Primerpara adiante ~
helicoidizar primers ~ Primer reverso =
- - - - - •• - - - -n1111111111,,,11111111
11nl7TI11111111mnn1111nn111111111111111111umu11!7Tiliilll!1U1mi11111111m1'!!i11Ul"'
"""""""'""11111111m1111'!!i1
1111m1111111rn1~"'·'"'··
· "· '.llll!,"'1!!1'111,!!1'1111111'111!1!111111!!11!1!i!i!lln!liimr1111mr111r-1 - - - - - - - - -

u1111111m1m111m!1111111utmt11~1f1Et!tl!IJl!!!!llll!11111 umu111111111111111111w111nt11111111111um1t1m1111

! Síntese de DNA

- - - - - - - - -,,,ii!,.,,,."""'"'""""'"'"''"'""'"'""""
"""'"""""''"""""'"!"'
,}'"'!!!!""gLmTllJl,llll'!!""!'.'!""'J!'m!l.'111rnrn1mr1
g1mrw:rn!11~nn.mnml1'·•"""'""'""""""''""'""'"""""
'"""",... - - - - - - - "' -

______ _ __ 111
" ' "'·""'
"'"'"'.""""'
'""'""""
"'"''"'"
!!!WJ"'"' '.J
,,,M
!i!ffi!ii.jjtijamàffilliluimmrtttillm
111 i!l!l!li!l!lllmmtt!hflll!íliiftlllilímm1t!ii1nttjjj]mmlmlllr1ii..
.....
" ...
,,...
. ....
,,...
...... !!!
.., .. . . . . . . . . . . . . . ________ _

Desnaturar

Helicoldizar primers

~11111111111111u11t111111111mu11111m1m11111111m Síntese de DNA 'fMíôDttlâl11@!m!!1fi@f!U!ffl1!rltlbft!dl!l!!ll1!"7l1

ililllllll/IUiliJll\lllilllltlliliilUliilitlUllJUll~

Desl)aturar

Hellcoidizar prime~s
umu111u1uuumuuuu1111u11mm111111m•1img tmmm;mlt!Mhntillbm!O!hU@llrMlrffiittti&fnti

ffflimlt11m11m1m1t111m1111mnm1w1nurn11m111m Slntese de DNA t(:~!!l1~1!~~.M!_1~~~·!tWJJ~'E'5!'.!~1iei

itmiiiJll:lliiliiüWllUUIUIMIJUllUMiilJU~ fWjDíljiü]J1tfflttITT!!tfi1trt1mmmmnm1mffinnMMni

Mmmílt1111!11!1l!l!fll t!l!!!ll!!N!!!!!!!l!Jjl!!Qlt!!l!lljll

Desnaturar

Helicoldizar primers
ilJ4llWllUUlllUiililUIUIUill11lilldllilllliill~

f i 1111t1!1!1!Hlllltnttl!!!lll! !!Ult!!l!!l!!!UUl!!tt!t! ft1®ffii111lmmnmrmn1mtm1rtmiffi!frtíhtrtttfi$


mu1111m1111111munmunrnnmurn11mm1~

Mumnn!!t!J!t1!l!llttnmmu1m11111n11m1nM Slntese de DNA fj;ãffifüID1iMfütffiittltffirdfildrfttllrijMrttffl@ltn

ütQlllUl4iUlllllikllWllUIUWllUUrnn11111~

fiüffiffiiiijtuuurn1111n1m111111mmnun11111mnmm1' mnm;mmnntiuijfltm1md1111@ftlil©f1Htlubiftltn

mu11 mu1111mmuum1111mumm1111m1111~

=
Fig. 4. J O A reação em cadeia da polimerase Pela síntese repetida de uma região do DNA situada entre dois prlmers de DNA. esta região
do DNA é específica e seletivamente amplificada de modo exponencial lrês rodadas sucessivas de amplificação são mostradas. resul-
tando em um total de oito cópias da seqüência-alvo Após 30 rodadas de amplificação. são criadas mais de um bilhão de cópias da
seqüência
40 ' FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA

DNA. Um dos oligonucleotídeos inicia a síntese do segundo fi- HIBRIDIZAÇÃO IN SITUEM CROMOSSOMOS
lamento do cDNA, que em sua forma bifilamentar serve como
alvo para a amplificação pela PCR. Do mesmo modo que as sondas de ácidos nucleicos podem ser
A PCR é uma técnica extremamente sensível Ela permite a hibridizadas com amostras de DNA digerido por enzimas deres-
detecção e a análise de seqüências gênicas específicas em uma trição ou RNA purificado imobilizado em filtros para análise de
amostra do paciente sem clonagem e sem a necessidade de trans- Southern e Northern, as sondas também podem ser hibridizadas
ferência de Southern ou No1thern. As análises podem ser feitas ao DNA contido dentro de cromossomos imobilizados em lâmi-
até mesmo em uma única célula obtida de um fio de cabelo, das nas de microscopia (ver Cap. 3). Esta técnica é chamada de hi-
poucas células bucais presentes em um bochecho, de um único bridização in sihl porque o DNA nos cromossomos metafási-
blastômero removido de um embrião no estágio de quatro célu- cos fixados em lâminas é desnaturado no local (donde o "in situ")
las, de espermatozóides colhidos de uma amostra vaginal de uma para expor os dois filamentos do DNA, pemútindo assim que uma
vítima de estupro ou de uma gota de sangue seco da cena de um sonda marcada se hibridize ao DNA cromossômico. O método
crime. A PCR elimina, po1tanto, a necessidade de preparar gran- mais comum de marcar sondas para a hibridização in situ nos
des quantidades de DNA ou RNA das amostras de tecido. cromossomos é com um cmante fluorescente . A sonda hibridi-
A PCR rapidamente está se tomando um método padrão para zada fluoresce quando os cromossomos são vistos com um com-
a análise de amostras de DNA e RNA nos laboratórios de pes- primento de onda que excita o corante fluorescente A localiza-
quisa, nos laboratórios de diagnóstico clínico molecular e nos ção do sinal de hibridização e, portanto, a localização do segmen-
laboratódos forenses e de medicina legal. A PCR é mais rápida, to de DNA ao qual a sonda se hibridiza é então determinada ao
menos dispendiosa, mais sensível e usa menos amost1as dopa- microscópio (ver Figs. 8 .8 e 9 4) . Esta técnica, conhecida como
ciente que qualquer outro método de análise de ácidos nuclei- hibridização ili situ com fluorescência (FISH), é amplamente
cos Exemplos específicos de seu uso para a detecção de muta- usada em citogenética clínica diagnóstica (Ver Caps. 9 e 10), bem
ções nos distúrbios genéticos são apresentados no Cap. 19 como em mapeamento gênico (ver Cap. 8)

A Análise Molecular de uma Mutação Humana


Como se faz para identificar uma mutação em um gene de apenas um par de bases, a menos que elas perturbem o sítio
um paciente com um distúrbio genético que se sabe ou sus- da endonuclease de restrição.
peita que seja decorTente de defeitos neste gene? Por exem- Se o gene está presente, ele é transcrito? Para determinar
plo, considere um paciente com um diagnóstico de /3- se um transcrito específico está presente, é usada a transfe-
talassemia, um defeito recessivo autossômico no gene de rência Northern . Este enfoque também nos possibilita de-
/3-globina (ver Cap. 11 ). O diagnóstico inicial em geral é tectar grandes mudanças nos níveis de mRNA ou na estrutu-
feito apenas com base em achados clínicos e hematológi- ra de um gene específico, mas não permite detectar pequenas
cos. É importante examinar o próprio gene, primeiro para alterações (p. ex., uma mutação que mude um códon em um
confirmar o diagnóstico clínico e, segundo, para determi- éxon)
nar a mutação específica no locus de /3-globina tanto para Tendo questionado se há grandes mudanças no gene ou em
uso futuro no teste de portador quanto para um possível seu mRNA, podemos examinar a estrutura gênica e a expres-
diagnóstico pré-natal na família do paciente. Além disso, são em níveis progressivamente mais refinados de análise. Na
a identificação da mutação aumenta nossa compreensão da /3-talassemia, como em muitos outros distúrbios genéticos,
relação entre mutações específicas em um gene e a fisio- muitas mutações já conhecidas são responsáveis pela doen-
patologia resultante. ça. Para determinar se uma das mutações conhecidas é res-
Váiios testes podem ser inicialmente usados para exami- ponsável por um determinado caso de ,8-talassemia, podemos
nar a integridade do própxio gene de {3-globina e seu mRNA usar oligonucleotídeos alelo-específicos (ASOs), que possi-
Ambas as cópias do gene estão presentes no paciente e sua bilitam a detecção de mutações específicas de um único par
estrutura está normal? Ou uma ou ambas as cópias do gene de bases (ver texto principal). Se a análise ASO não revelar
estão deletadas, como foi descrito em alguns casos de /3- uma mutação conhecida, pode ser necessário comparar a se-
talassernia? A transferência de Southern do gene de {3-globi- qüência do gene mutante de /3-globina (ou cDNA) do paci-
na pode abordar· a questão de se o gene está presente e se sua ente com um gene normal de {3-globina usando a reação em
estrutura está normal. Por este método, podemos detectar gnm- cadeia da polimerase (PCR) para gerar especificamente
des defeitos moleculares (p. ex., deleções, rearranjos) que muitos milhões de cópias de um determinado fragmento gê-
estão bem abaixo do nível de sensibilidade da análise cromos- nico e seqüenciá-lo. Deste modo, a mutação específica res-
sômica, A transferência de Southem não pode revelar a pre- ponsável pelo distúrbio genético no paciente pode ser identi-
sença da maioria das mutações únicas, contudo, tais como mu- ficada e usada para desenvolver testes diretos de triagem para
danças de um par de bases ou deleções muito pequenas de esta mutação na família do paciente.

Um tipo comumente usado de sonda para FISH é uma seqüên- sonda FISH também pode ser uma mistura complexa de DNA
cia genômica contígua única, clonada como inserção em um de uma parte de um braço cromossômico, um braço inteiro de
cosmídeo, um BAC ou um vetor Y AC que se hibridize no local um cromossomo ou mesmo um cromossomo inteiro. Dependendo
da seqüência-sonda em um par de cromossomos homólogos. A de como a sonda é constituída, uma grande parte de um braço
FERRAMENTAS DA GENÉllCA MOLECULAR HUMANA 1 41

cromossômico, o braço inteiro ou o cromossomo inteiro irá se podem ser facilmente cariotipadas (ver Cap, 3), tal como tumores
corar com a sonda hibridizada fluorescente . Tal mistura de son- sólidos e sarcomas de tecidos moles. A técnica tem sua aplicação
das é conhecida como sondas multicolor-idas de cromossomos mais ampla no estudo das aberrações cromossômicas nas células
(ver Cap. 9 para exemplos), cancerosas (ver Cap 16).
Duas técnicas recentemente desenvolvidas ampliam ainda mais Urna segunda técnica FISH poderosa é a cariotipagem espec-
o poder da tecnologia FISH para a análise dos cromossomos hu- tral (SKY). Um reagente essencial para SKY é ter 24 diferentes
manos. A primeira destas técnicas, a hibridização genômica com- sondas multicoloridas de cromossomos, uma para cada um dos 24
parativa, é usada para medir as diferenças no número de cópias cromossomos humanos . Estas sondas específicas de cromossomos
ou dosagem de um segmento cromossômico em particular entre são obtidas pela separação de cada cromossomo com base no tama-
duas amostras diferentes de DNA . O DNA total de uma amostra é nho e nas características de bandeamento de todos os outros cromos-
marcado com um corante fluorescente vermelho e a outia amos- somos usando a distribuição cromossômica ativada por fluorescên-
tra é marcada com um corante verde. As duas amostras de DNA cia. Cada amostra de DNA específica de cromossomo é marcada
marcado são misturadas em quantidades iguais e usadas como uma com uma combinação diferente de corantes fluorescentes, que emi-
sonda multicolorida para FJSH com cromossomos metafásicos tem comprimentos de onda diferentes. Deste modo, cada cromos-
humanos normais. A proporção de fluorescência de vermelho para somo humano é representado por uma sonda com seu próprio es-
verde errútida pela sonda ao longo de cada cromossomo é então pectro característico de comprimentos de onda de fluorescência.
medida. Se o DNA de uma determinada região de um cromosso- Todas as 24 sondas para os cromossomos humanos são então com-
mo for igualmente representado nas duas amostras que constitu- binadas e usadas para FJSH de cromossomos metafásicos (ver Fig.
em a sonda, a proporção de fluorescência de vermelho para verde 9.5B, encarte em cores) . Como cada sonda específica de cromos-
no sinal FISH será de 1: 1 (Fig. 4.11). Se, entretanto, o DNA mar- somo emite seu próprio comprimento de onda de fluorescência, os
cado com verde for de uma linhagem celular normal e o DNA rearranjos estruturais são facilmente vistos, e os cromossomos en-
marcado com vermelho vier de células que têm falta de material volvidos podem ser identificados com facilidade.
(monossomia, ver Cap. 9) ou que têm material adicional (trisso-
mia, ver Cap. 9) de um cromossomo todo ou de parte de um cro-
mossomo, a proporção de fluorescência de vermelho para verde ANÁLISE DA SEQÜÊNCIA DO DNA
mudará de 1: 1 para menos de l, no caso de monossomia, ou mais
de 1, no caso de trissomia, na região do cromossomo com a dosa- O enfoque mais amplamente usado para a análise da seqüência de
gem gênica anormal. Por exemplo, como mostra a Fig. 4.11, o DNA é o seqüenciamento de Sanger (em homenagem a Fred San-
DNA marcado com vermelho dos tecidos de uma pessoa com tris- ger, que, com Walter Gilbert, recebeu o Prêmio Nobel em 1980
sarnia parcial da ponta do cromossomo I 8p resulta em uma pro- por desenvolver o seqüenciamento do DNA). Agora, a seqüência
porção de vermelho para verde de 1,5:1em18p distal. De modo de qualquer segmento de DNA purificado pode ser determinada,
similar, se a pessoa tiver monossomia 18p, a proporção de fluo- seja um fragmento clonado seja uma seqüência-alvo amplificada
rescência de vermelho para verde ao longo de 18p será de 0,5:1 por PCR. O seqüenciamento de Sanger tira proveito de análogos
A hibridização genômica comparativa é particula.cmente útil para químicos de nucleotídeos para inibir a enzima DNA polimerase à
encontrar mudanças na dosagem gênica em tecidos que podem medida que ela sintetiza o filamento complementar ao molde ori-
servir como uma fonte de DNA para fazer uma sonda, mas não ginal que está sendo seqüenciado (Fig. 4J3). Para fazer a reação

+Verde +Vermelho +Verde +Vermelho


1
1
1
, , , .
: Sinal 1 8 ina1
1 fluorescente 1 fluores~ente
1
1 1
1 1 1 1
1 1 1 1 1
1 1 1 1 1 1 1 1
1 1 1 1 1
1 1 1 1

Proporção vermelho:verde: 0,5 2 0,5 2

DNA de trissomia distal 18p marcado com vermelho DNA de monossomia distal 18p marcado com
e DNA normal marcado com verde vermelho e DNA normal marcado com verde
Proporção vermelho:verde =1,5: 1 na área Proporção verrnelho:verde =0,5:1 na área da
da trissomia, 1:1 nas outras áreas monossomia, 1:1 nas outras áreas
Fig. 4 11 Resultados de hibridização genômica comparativa. tipicamente relatados por um gráfico de intensidade de fluorescência ao
longo da extensão de um cromossomo O DNA de duas fontes diferentes é purificado. cada um é marcado com um corante fluorescente
diferente e as sondas são misturadas e usadas como corantes cromossômicos em metáfases normais A intensidade de hibridização a
cada corante será igual em todas as regiões dos cromossomos metafásicos que estiverem presentes em quantidades iguais nas duas
fontes diferentes de DNA Se um segmento de um cromossomo estiver duplicado ou deletado em urna linhagem celular versus a outra. a
intensidade relativa de hibridização com o corante não será mais de 1: 1
42 1 FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA

DNA a ser
seqüenciado

ATCGCCTTGC .
5' 3'
3'<1( - - 5'
G A T C 3'
---..e
e~
------------e eG
T
T
e
e
G
e
T
A
5'

Fig, 4.13 o método de Sanger para determinação da seqüência


nucleotídica de um fragmento de DNA clonado Ver o texto para a
descrição

para determinar a seqüência de nucleotídeos do fiagmento de DNA


que esiá sendo analisado (ver Fig. 4. l3).
H~je, as máquinas automatizam o procedimento de seqüen-
ciamento de DNA, que é rotineiramente aplicado para a análise
tanto de genes normais quanto mutantes. A informação da se-
Fig . 4 12 Cariotlpagem espectral (SKY) As 24 sondas multicolori-
das de cromossomos individuais são marcadas com corantes fluo- qüência de DNA é crucial para prever a seqüência de aminoáci-
rescentes diferentes e usadas como corantes cromossômicos do dos codificada por um gene recém-isolado, para detectar muta-
genoma total Os sinais fluorescentes são analisados por um so- ções individuais em doenças genéticas e para criar sondas ASO
íisticado software de imagem e arquivados em um computador Para ou primers de PCR usados em procedimentos diagnósticos mo-
gerar a fotografia . o computador atribui uma cor diferente para cada leculares O seqüenciamento automatizado também está sendo
um dos 24 espectros diferentes de fluorescência gerados pelas son-
das multicoloridas de cromossomos individuais Nesta metáfase
de uma mulher 46.X.X. apenas 23 cores estão presentes O espec-
tro único gerado pela sonda multicolorida do cromossomo Y não é
visto (Ver Fig 9 5B. e11carte em cores) (Figura por cortesia da Ora
Amalia Outra. National Human Genome Research lnstitute )

.- ......
.:.' ~ r ~.
de seqüenciamento, a síntese de DNA é iniciada por um oligonu-
cleotídeo pequeno, e a DNA polimerase continua ao longo da se-
qüência molde, ampliando o primer (iniciador) e incorporando ou .,,;· . . ...

ilf~cc
nucleotídeos radioativamente marcados ou nucleotídeos com
marcadores fluorescentes na nova seqüência sintetizada. Obtemos . .,.._ Distrofina
informações da seqüência adicionando um dos análogos inibido- 427 kDa
res,juntamente com todos os quatro nucleotideos normais, em cada
uma das quatro reações de seqüenciamento. Assim, na reação para
definir a localização das unidades G, um análogo de G é incluído
·:.->~·._: : . . · ·:,·.·.'
na reação, de modo que a ampliação de uma parte das moléculas
individuais irá parar quando a DNA polimerase incorporar o aná-
logo. As quantidades relativas de nucleotídeo G normal e análogo
de G nesta reação são ajustadas de modo que a polimerase incor- ; ·.···-':
pore o análogo de G em alguns filamentos recém-sintetizados no
mesmo momento que incorporaria uma G, enquanto em outros fi- iH:.;:
lamentos um análogo de G é incorporado no momento seguinte à ..·. - ·.

incorporação de G, alguns no terceiro, e assim por diante. Quando


Fig, 4, 14 Uma transferência Western demonstrando a presença ou
esta amostra é então analisada por eletroforese em gel, observa-se
a ausência da proteína muscular distrofina (seta) nos extratos de
urna série de bandas de comprimentos correspondentes aos locais proteína de pacientes com a forma grave Duchenne ou branda Be-
de cada unidade G. Reações similares para A.Te C fornecem stSrjes cker de distrofia muscular ligada ao X Ver Cap 12 para maior des-
correspondentes de fragmentos O conjunto de quatro reações pode crição (Foto original por cortesia de P Wray. Hospital for Sick Chil-
então ser lido como uma "escada" direcional de seqüenciamento dren. Toronto)
FERRAMENTAS DA GENÉTICA MOLECULAR HUMANA 1 43

muito aplicado no Projeto do Genoma Humano para obter a se- Monaco AP, Larin Z (1994) YACs, BACs, PACs and (\llACs: Artifi-
qüência de nucleotídeos de todos os três bilhões de bases de todo cial chromosomes as research cools 'Trends Biocechnol
12:280-286
o genoma humano (ver Cap. 8), bem como para completar a se- Vncncak-Jones CL ( 1999) Molecular resring for inherited diseases
qüência de outros organismos de importância médica e cientifi- Am.J Clin Pachol 112 (suppl 1): Sl9-S32
ca, incluindo a E coli, a levedma S cerevisiae, o ve1me Cae- Wwln VW (1996) Forensic DNA reses Clin Lab Med
norhabditis elegans, a mosca-das-frutas Drosophila melanogas- lfi:ll!i-196
ter, o camundongo e muitos microrganismos patogênicos.
Problemas
MÉTODOS DE ANÁLISE DE PROTEÍNAS
1. Considere as simações diagnósticas que se seguem Que método (ou
A análise do funcionamento gênico tanto normal quanto anor- métodos) de laboratório seria o mais apropriado?
mal em geral requer um exame da proteína codificada por um (a) Diagnóstico pré-natal de um feto masculino com risco de por-
gene normal ou mutante de interesse. Na maioria dos casos, de- tar distrofia muscular Duchenne (DMD) . Estudos anteriores
seja-se conhecer não só o defeito molecular no DNA, mas tam- nesta família já documentaram uma deteção gênica completa
bém como este defei to altera a proteína codificada para produzir (b) Você deseja avaliar a quantidade de mRNA de distrofina pre-
sente em uma amostra de músculo de urna portadora obrigató-
o fenótipo clínico. ria brandamente afetada por DMD.
(c) Diagnóstico pré-natal de um feto masculino com risco de por-
Transferência Western tar DMD. Estudos anteriores já documentaram uma detenni-
nada mudança de base nucleotídica que é responsável pelo de-
Logo depois do desenvolvimento das transferências de Southem feito nesta família
e Northem para o DNA e o RNA, um procedimento conceitual- 2 Quais são algumas das vantagens ou desvantagens da PCR para o
mente con-elato para a detecção de proteínas especificas foi des- diagnóstico de defeitos genéticos em comparação com a transferên-
crito como transferência Western. Esta técnica pode ser usada cia de Southern? Com as dosagens bioquímicas de níveis enzimáti-
para obter informações sobre o tamanho e a quantidade da pro- cos para diagnóstico de deficiências enzimáticas?
teina mutante nos extratos celulares de pacientes com doenças 3. De qual dos seguintes tecidos pode ser obtido DNA para procedi-
genéticas, Neste método, as proteínas isoladas de um extrato mentos diagnósticos: amostra de tecidos de biópsia, leucócitos, cul-
celular são separadas de acordo com o tamanho por uma eletro- tura de célula!> de líquido amniótico, hemácias?
forese em gel de poliacrilamida e então transferidas para uma
4 Por que a clonagem de um gene é considerada um avanço significa-
membrana. A membrana contendo as proteínas separadas é en- tivo para o campo da genética médica? O que a disponibilidade de
tão incubada com anticorpos que reconhecem especificamente a um gene clonado pemtlte fazer que não se podia antes?
proteína a ser analisada. A interação especifica entre o anticorpo
e seu antígeno pode então ser detectada por um segundo anticdr- 5 . Você quer clonar um gene que é expresso no fígado e que se suspei-
ta de que esteja envolvido em uma doença genética. Tanto uma bi-
po contra o primeiro, marcado com urna substância detectável blioteca de DNA genômico humano quanto uma biblioteca de cDNA
histoquimicamente, por fluorescência ou radioativa. Um exem- de fígado estão disponíveis Qual você escolheria e por quê?
plo de transferência Westem usada para detectar a presença 01,1
ausência e, se presente, o tamanho da proteína muscular distro- 6. Um pacient.e com uma doença genética tem uma mutação (C para
T, sublinhada) no éxon 18 de um gene. A seqüência normal é:
fina em pàcientes com distrofia muscular ligada ao X é mostia-
do na Fig. 4.14. CTGTGCCGTATGAAAAGACCAATC,ÇGA-
GAAGTTCCTGTIACCAAACTCATAGAC
Referências Gerais A seqüência no paciente é:
CTGTGCCGTATGAAAAGACCAATCIGA-
Davies K,(1995) Human Genetic Disease Analysis: A Pra~cical Ap- GAAGTICCTGITACCAAACTCATAGAC
. proach, 2nd cd. IRL Prcss, Oxford, Ei:igland .
Dicffcnhach C, Dvcksler G (1995) PCR Prinier: A bboratory (a) Qual é a conseqüênçia desia mutaç?o no füncionamento do
i\lanual Cold Spring Harbor l:.aboratory, Cold Spring Harbor, gene? (Os primeiros três nucleotídeos de cada seqüência cons-
Nen York tituem tim códon do gene.)
Fricsch EF, Wozney JM (1994) Mechods of molecular genetics. ln (b) Você precisa desenvolver um ASO para a mutação no DNA
Sramacoyannopoulos G, Nienhuis AvV, 1\llajerus PvV, Vamms H genômico. Qual(is) do(s) seguinte(s) oligonucleotfdeo(s)
(cds) The Molecular Basis of Blood Diseases, 2nd ed W.B. seria(m) útil(eis) em um ASO para a seqüência normal? Para a
Saundcrs, Philadclphia.
Samhrook ], Russell D (2001) Molecular Cloning: A Laboracory seqüência mutante? Explique seus motivos para selecionar ou
Manual, Jrd ed Cold Spring Harbor Laboracory, Cold Spring rejeitar cada oligonucleotideo.
Harbor, New York. l. 5'GCCGTATGAAAAGACCAATCTG
2 5'GACCAATCCGAGAAGITCC
.3 . 5' GACCAATCTGAGAAGTTCC
Referências Espec11icas aos Tópicos Particulares 4 5' GGAACTT'CTCAGATrGGTC
Hanclyside AH ( 1998) Clinicai evaluacion of preimplanracion ge- 5 5' ATClGAG
netk diagnosis Prenac Diagn 18: 1345 - 1348
Padrões de Herança
Monogênica
No Cap. 1, as três principais categorias de distúrbios genéticos, nar o assunto a princípio inacessível. Para auxiliar o problema
monogênicos, cromossômicos e complexos, foram citadas e re- de linguagem, revisamos alguns termos e introduzimos outros
sumidamente caracterizadas. Na primeira seção deste capítulo, que não foram previamente definidos.
os padrões típicos de transmissão dos distúrbios monogênicos A variação herdada no genoma é a pedra angular da genética
serão discutidos em maiores detalhes. A ênfase está nos meca- humana e médica. Corno introduzido no Cap. 2, as variantes al-
nismos genéticos e moleculares pelos quais as mutações nos ternativas da informação genética em um determinado locus são
genes resultam em padrões de herança recessiva, dominante e chamadas de alelos. Para muitos genes, há uma única versão que
ligada ao X . Na seção seguinte, descreveremos como o imprin- prevalece, presente na maioria das pessoas, que os geneticistas
ting gênico e o mosaicismo podem alterar ou obscurecer padrões chamam de alelo normal ou tipo se]vagem As outras versões
de herança tipicamente monogênicos. do gene são os alelos mutantes, que difeiem do alelo selvagem
As.. características monogênicas em geral são chamadas de por mutação, uma mudança permanente na seqüência de nucle-
mendelianas, pois, assim como as características das ervilhas es- otídeos ou disposição do DNA. Se existirem pelo menos dois
tudadas por Gregor Mendel, elas ocorrem em média em propor- alelos relativamente comuns do locus na população, o locus é dito
ª-
ções_ fiX!J.S entre prn!e. _ç!_«_ Ji.po~ ~~p~_cíj}cos de reproduç.ª-.o Os como ex.ibindo um polimorfismo (literahnente "muitas formas"),
fenótipos monogênicos conhecidos até agora estão citados na re-
como será discutido em detalhes nos capítulos subseqüentes.
ferência clássica de Victor A McKusick, Mendelian lnheritance
Além de um alelo normal ou dos alelos polimórficos comuns, os
in Man (12 •edição, 1998), que tem sido indispensável aos gene-
ticistas médicos por décadas A versão online do Mendelian Inhe- loci também podem ter um ou mais alelos variantes raros Al-
ritance in Man (OMIM) é continuamente atualizada e está dispo- guns destes alelos raros foram originalmente identificados por-
nível na World Wide Web. OMIM cita mais de 9.300 genes, dos que causam doenças genéticas, enquanto outros não são signifi-
quais mais de 1.400 são loci gênicos estabelecidos nos quais as cativos para a saúde.
mutações estão associadas a um distúrbio clinicamente significa- O genótipo de uma pessoa é o conjunto de alelos que consti-
tivo. Assim, dos cerca de 50 000 genes humanos, mais de .3% já tui sua composição genética, seja coletivamente em todos os loci
foram identificados como genes que contribuem de modo impor- ou, mais tipicamente, em um único locus. Em contraste, o fenó-
tante para doenças humanas . Estes 3% provavelmente são uma su- tipo é a expressão observável de um genótipo como urna carac-
bestimativa. O ritmo de descoberta de novos genes é veloz e pare- terística morfológica, clínica, bioquímica ou molecular É lógi-
ce certo que se acelerará devido aos esforços internacionais dedi- co que um fenótipo pode ser nmmal ou anormal em um determi-
cados ao mapeamento e ao seqüenciamento de todo o genoma nado indivíduo, mas neste livro, que destaca os distúrbios de sig-
humano e os genes expressos em tecidos humanos diferenciados nificado médico, enfocaremos os fenótipos anormais; isto é, os
Os distúrbios monogênicos são primariame11te, mas de modo distúrbios genéticos.
algum exclusivamente, distúrbios da faixa de idade pediátrica Menos l)m distúrbio monogênico é aquele determinado pelos ale-
de 10% manifestam-se após a puberdade e apenas 1% ocorre após los em um único locl!~, Um alelo variante, que surge por mu-
o final do período reprodutivo. Embora individualmente raros, corno tação em algum momento do passado recente ou remoto e em
um grupo são responsáveis por uma proporção significativa de do- geral é relativamente raro, substitui um alelo selvagem em um
enças e mortes na infância Em um estudo populacional de mais de ou em ambos os cromossomos. Quando uma pessrn~ tem um
1 milhão de nativivos, a incidência de graves distúrbios rnonogêni- P-ª1:.!Í.e. ªle.1.Q~j.Q~n_tiç_Q~,_e)-ª é dHa Ç()IJ19.~e.nçlp bomozigota (um
cos foi estimada como sendo de 0,36%; entre crianças hospitaliza- homozigoto) . Quando os alelos são diferentes, ela é heterQ-
das, de 6% a 8% são tidas como tendo distúrbios monogênicos. zigota (um heterozigoto, portador). O termo heterozigoto
composto é usado para descrever um genótipo no qual estão
TERMINOLOGIA presentes dois alelos mutantes diferentes do mesmo gene em
vez de um normal e um mutante Estes termos (homozigoto,
Muito embora os princípios da genética médica sejam relativa- heterozigoto e heterozigoto composto) podem ser aplicados
mente fáceis de entender, a terminologia não-familiar pode tor- a pessoas ou a um genótipo. O termo mutação é usado em
PADRÕES DE HERANÇA MONOGÊNICA 1 45

genética médica com dois sentidos: às vezes, para indicar uma primeiro grau são primos e.m segundo grau, e um filho é um
nova mudança genética que antes não era conhecida em uma primo germano de seus primos em primeiro grau . Os casais que
família e, às vezes, apenas para indicar um alelo causador de têm um ou mais ancestrais em comum são consangüíneos . Se
doença. Mutação e mutante, entret~nto, não são usados para só houver um membro afetado em uma familia, ele ou ela será
designar seres humanos que tenham alelos mutantes que sur- um caso isolado, ou se o distúrbio for determinado como sen-
giram por mutação. do causado por uma nova mutação no propósito, um caso es-
Os distúrbios monogênicos são caracterizados por seu pa- porádico (ver Fig. 5 ..2).
drão de transmissão nas famílias. Para e~tabelecer o padrão de
transmissão, em geral a primeira etapa é obter informações
sobre a história familiar do paciente e resumir os detalhes sob DISTÚRBIOS GENÉTICOS COM HERANCA
a forma de um heredograma, uma representação gráfica de MENDELIANA CLÁSSICA ,
uma árvore genealógica, usando símbolos padrão (Fig. 5.1). O
membro por meio do qual uma família com um distúrbio gené- Os padrões apresentado~~~__c!\g_ú.E~~°.~ ~()~?~ênicos nos he-
tico é inicialmente avaliada é o probando (sinônimo de pro- redogramas depende.~e_!inciP.~me_!!~~ d~~~i-~fE-!?.~.~~: (l).o lo-
pósito ou caso-índice), se ele for afetado. A pessoa que leva a cal cromossômico d9JQQgª-.gfü).j!_:_Q,. q_~~_po_de_ ~er autossômico
família para a avaliação de um consultor de genética é chama- (situado em um.~l!~q~~Q!l!.Ql.~~l!g~-~-<1 .;!0. ~ (situ~d.o__no cromos-
da de consulente O consulente pode ser uma pessoa afetada somo X), e (2) se o fenóti_pg_§._!!,~~~1.':~!e (expresso quando
ou um parente não-afetado de um probando. Uma família pode apenas um cromossomo de um par porta o alelo mutante, a des-
ter mais de um probando, se avaliada por meio de mais de uma peito de haver um alelo normal no outro cromossomo do par) ou
fonte. Irmãos e irmãs de uma família focmam uma prole. A recessivo (expresso apenas quando ambos os cromossomos-de
família ampliada, ou seja, considerada como todos os membros um par portam o alelo mutante) Assim, existem quatro padrões
nela incluídos, é chamada de parentesco (Fig. 5.2). Os paren- básicos de herança monogênica:
tes são classificados como de primeiro grau (pais, irmãos e
prole do probando); segundo grau (avós e netos, tios e tias,
sobrinhos, sobrinhás e meio-irmãos); terceiro grau (p. ex , Dominante Recessivo
primos em primeiro grau) e assim por diante, dependendo do
Autossômico Autossômico dominante Autossômico recessivo
número de etapas (em outras palavras, o número de meioses)
Ligado ao X Dominante ligado ao X Recessivo ligado ao X
no heredograma entre os dois parentes. A prole de primos em

D Homem
0-0 Casamento ou união

o Mulher
0-0 Divórcio

o Sexo não-especificado
D=O Consangüinidade

0© Número de filhos
do sexo indicado
00 Gêmeos monozigótlcos

110
[O([)
Afetados

Portador não-penetrante,
60 Gêmeos dizigóticos

m1
.
p~de m.ani~~star doença

Portadores obrigatórios,
Ó'b Gêmeos de zigosidade desconhecida

não manifestam a doença 1 2 Heredograma com


gerações e números
Probando das pessoas
li 1 @2 3

Pessoa falecida l1
Natimorto Aborto
.
[Ó] Adotado pela famflia Sem prole

[Q] Adotado fora da familia Uniões múltiplas

Fig. 5 1 Símbolos comumente usados nos heredogramas Embora não exista um sistema uniforme de notação de heredogramas. os
símbolos usados aqui estão de acordo com as recentes recomendações feitas por profissionais no campo da informação genética (De
Bennett R L . Steinhaus K A Uhrich S B et ai ( 1995) Recomrnendations for standardized pedigree nomenclatu re 1Genet Counsel
4:267-279 )
46 ! PADRÕES DE HERANÇA MONOGÊNICA

2 3 4

li

Ili

IV
[_J
2º e 4º
V

Fig. 5 2 Parentesco em um heredograma A seta indica a probanda, 111·5. que representa um caso isolado de um distúrbio genético Ela
tem quatro Irmãos, 111-3. 111-4.111-7 e 111-8 Seu parceiro/marido é 111-6. e eles têm três filhos (sua prole FI J A probanda tem nove parentes
em primeiro grau (seus país. irmãos e prole) . nove parentes em segundo grau (avós. tios/tias. sobrinhos/sobrinhas. netos). dois paren·
tes de terceiro grau {primos em primeiro grau) e quatro parentes em quarto grau {primos germanos) IY-3. JY-5 e IY-6 são primos em
segundo grau de IY- 1 e IY-2 lY-7 e IV-8. cujos genitores são consangüíneos. são duplamente aparentados à probanda: parentes em
segundo grau por seu pai e em quarto grau por sua mãe

Herança Autossômica e Ligada ao X Estritamente falando, é o fenótipo, e não o alelo, que é domi-
nante ou recessivo Entretanto, os alelos em geral são classifica-
A distinção entre herança autossômica e ligada ao X é óbvia, pois dos como dominantes ou recessivos com base no fato de causa-
depende apenas da localização cromossômica do gene. A expres- rem uma mudança no fenótipo quando nó estado heterozigoto
são clínica de um gene anormal também depende de ele ser au- ou homozigoto, respectivamente, e assim os termos "gene ou
tossômico ou ligado ao X. Existem duas considerações, que se- alelo dominante" e "gene ou alelo recessivo" são amplamente,
rão discutidas em maiores detalhes mais adiante: ( 1) Os homens embora de modo impróprio, usados
têm apenas um X e, portanto, são ditos hemizigotos com rela- A distinção entre herança dominante e recessiva não é ab-
ção aos genes ligados ao X em vez de homozigotos ou heterozi-
soluta. É uma designação arbitrária, baseada em fenótipos clí-
gotos. Os homens 46,XY nunca são heterozigotos para caracte- nicos, que pode não ter significado no nível da ação gênica.
rísticas ligadas ao X (2) Para compensar o complemento duplo
Embora um fenótipo recessivo seja definido como sendo cli-
de genes ligados ao X nas mulheres, os alelos para a maioria dos
nicamente indetectável em heterozigotos, muitas caracterís-
genes ligados ao X são expressos por apenas um dos dois cro-
ticas classificadas como recessivas têm manifestações no he-
mossomos X em qualquer célula determinada de uma mulher (ver
terozigoto quando examinadas no nível celular, bioquímico
inativação do cromossomo X, mais adiante), enquanto ambos
ou molecular. Por exemplo, o distúrbio bem conhecido de he-
os alelos da maioria dos loci autossômicos, mas não de todos,
estão ativos (ver ímprí11ting, mais adiante). moglobina, a anemia falciforme, é herdado como uma doen-
ça autossômica recessiva (ver Cap. 11 para maior discussão)
Os pacientes com a doença são homozigotos para um alelo de-
Herança Dominante e Recessiva feituoso no locus de ,B-globina e, conseqüentemente, produ-
zem a hemoglobina anormal S (Hb S) em vez da hemoglobi-
Por definição, um fenótipo expresso do mesmo modo tanto em
na adulta normal A (Hb A) em suas hemácias, que se tomam
homozigotos quanto em heterozigotos é dominante, enquanto
falcêmicas sob condições de baixa tensão de oxigênio. Os
um fenótipo expresso apenas em homozigotos (ou, para carac-
terísticas ligadas ao X, hemizigotos) é recessivo. Em genética heterozigotos produzem tanto Hb A quanto Hb S, uma pro-
médica, entretanto, esta definição é muito rígida para ser útil porção de suas hemácias apresenta o fenômeno falcêmico e
na prática. Em vez disso, qualquer fenótipo expresso em hete- eles têm anemia branda Assim, no nível de síntese de hemo-
rozigotos é classificado como dominante, tenham ou não os he- globina, o alelo normal de ,B-globina e o alelo defectivo são
terozigotos e homozigotos para o alelo mutante o mesmo fe- expressos como alelos co-dominantes; no nível de funciona-
nótipo. De fato, os distúrbios autossômicos dominantes são ti- mento fisiológico, o alelo normal é incompletamente domi-
picamente mais graves nos homozigotos que nos heterozigo- nante (e o alelo anormal é incompletamente recessivo). No
tos, e até agora apenas dois distúrbios autossômicos dominan- nível clínico, a anemia falciforme c omporta-se corno uma
tes, a doença de Huntington (ver Cap 12) e a adenomatose característica recessiva.
endócrina múltipla I, são conhecidos como sendo igualmente Muitos dos distúrbios autossômicos recessivos descritos hqje
graves em ambos os genótipos. Quando o fenótipo devido a um em dia são defeitos enzimáticos, nos quais parece haver uma
genótipo heterozigoto é diferente do fenótipo visto em ambos margem de segurança grande o suficiente para permitir o funci-
os genótipos homozigotos e sua gravidade é intermediária a eles, onamento normal dos heterozigotos, muito embora apenas um
o fenótipo pode ser descrito mais precisamente como sendo de um par de alelos seja totalmente funcional e o outro (anor-
incompletamente dominante. Se a expressão de cada alelo mal) s~ja defeituoso ou não-funcional. Em contraste, nos distúr-
puder ser detectada mesmo na presença do outro, os dois ale- bios autossômicos dominantes, a doença ocorre a despeito da
Ios serão chamados de co-dominantes. presença do produto gênico normal feito a partir do alelo normal
PADRÕES DE HERANÇA MONOGENICA 1 47

restante. De um modo geral, existem pelo menos quatro situa- pode requerer a demonstração de defeitos no nível do produto
ções diferentes nas quais uma cópia normal do gene não é sufi- gênico ou do gene.
ciente para evitar a doença: Muitos pacientes com distúrbios genéticos .não têm parentes
afetados de modo similar, mas ainda pode ser possível reconhe-
L A fisiologia normal requer mais de 50% do produto gênico cer que o distúrbio é genético . Em função de uma marcante se-
totalmente ativo para evitar a doença. Não há margem de se- melhança de fenótipo entre farru1ias diferentes com o mesmo
gurança grande o suficiente para permitir o funcionamento defeito, padrões bem estabelecidos de herança em outras famili-
no1mal em heterozigotos, muito embora apenas um de um par as com o mesmo distúrbio em geral podem ser usados corno base
de alelos seja totalmente funcional . Quando a perda de meta- para o diagnóstico e a consulta, mesmo se o paciente for um caso
de da atividade normal de uma proteína causa a doença, a si- isolado na familia.
tuação é chamada de haploinsuficiência. Demonstrou-se que
a haploinsuficiência ocorre em mutações nos genes que codi-
Idade de Início e Outros Fatores que Afetam os
ficam alguns fatores de transcrição, proteínas estruturais e
receptores de superfície celular. Padrões de Heredogramas
2. Ao contrário de uma simples deficiência ou disfunção do pro-
IDADE DE INÍCIO
duto proteico, uma proteína anormal pode ser sintetizada,
causando um fenótipo anormal por interferir no funcionamen- Nem todos os distúrbios genéticos são congênitos Muitos só se
to do produto do alelo normal (efeito negativo dominante), expressam mais tarde na vida, alguns em uma idade característi-
como é visto nas mutações do colágeno na osteogênese im- ca e outros em idades variáveis. Como os termos "genético" e
pe1feita ("doença dos ossos quebradiços") (ver Cap. 12) "congênito" são freqüentemente confundidos, é importante ter
3 . A proteína mutante pode estar acentuada em uma ou mais em mente que um distúrbio genético é aquele que é determinado
de suas propriedades normais por meio de uma mutação pelos genes, enquanto um distúrbio congênito é meramente um
(simples ganho de função), como na condição do nanismo que esteja presente ao nascimento, que pode ou não ter uma base
acondroplásico, ou tomar-se tóxica para a célula pela aqui- genética.
sição de uma propriedade, como na doença de Huntington Muitos distúrbios genéticos desenvolvem-se na fase pré-
(ver Cap. 12).. natal e, assim, são tanto genéticos quanto congênitos . Fenóti-
4 . Uma disfunção herdada de uma cópia de alguns genes au- pos dismórficos de muitos tipos originam-se durante o desen-
tossômicos pode resultar em heredogramas com cânceres volvimento e são reconhecidos ao nascimento (ou mesmo no
de herança dominante (p, ex , retinoblastoma; ver Cap. 16) . período pré-natal, em alguns casos, por ultra-sonografia; ver
A perda aleatória do outro alelo nor~al, mesmo se um Cap. 18) como "defeitos de nascimento". Alguns distúrbios
evento extremamente raro ocorrer em apenas algumas cé- genéticos podem ser letais na vida pré-natal. Outros são ex-
lulas, elimina ambas as cópias do gene nas células e torna- pressos tão logo a criança começa sua vida independente.
as cancerosas Assim, embora a predisposição ao câncer Outros, ainda, apar·e cem mais tarde ou têm seu aparecimento
seja herdada de modo dominante, as mutações que levam clínico em uma variedade de idades, desde o nascimento até
ao câncer são recessivas em nível celular, pois ambas as os anos pós-reprodutivos.
cópias do gene devem estar disf11ncionais para que o cân-
cer se desenvolva ÜUTROS FAIORES QUE AFETAM OS PADRÕES DE HEREDOGRAMA

Em resumo, a distinção entre um alelo dominante e um re- Embora como regra geral os heredogramas de distúrbios mo-
cessivo mutante é na verdade uma só: nos heterozigotos, com um nogênicos possam ser prontamente classificados como autos-
alelo normal e um mutante, a metade da quantidade normal do sômicos ou ligados aos X e como dominantes ou recessivos, o
produto gênico do alelo nonnal é suficiente para efetw,tr uma padrão de herança de um heredograma individual pode ser obs-
determinada função? Se a resposta for sim, ó alelo mutante (e curecido por vários outros fatores que podem dificultar a.inter-
oSeu distúrbio associado) será ehamado de recessivo. be o àldo precação do modo de herança . A segregação dos genes dos ge-
o
mutante causar a doença, a despeite) de haver uni alei sei vagem nitores para 's eus filhos por meio dos gametas é um processo
funcionando normalmente, a resposta será não, e o alelo (e a aleatório e, especialmente com o pequeno tamanho tfpico da
doença) será chamado de dominante maioria das famílias dos países desenvolvidos de hoje em dia,
o paciente pode ser o único membro afetado . o padrão de he-
rança, se houver, pode não ser imediatamente aparente. Alguns
Outros Padrões de Heredograma
outr·os pontos a ter em mente são os seguintes: uma mutação
Às vezes um padrão de heredograma simula um padrão mono- nova não é uma causa infreqüente de doença dominante e liga-
gênico, muito embora o distúrbio não tenha uma base monogê- da ao X; as dificuldades diagnósticas podem ocorTer em fun-
nica. Deste modo é fácil se confundir por efeitos teratogênicos; ção de uma expressão ausente ou variável do gene envolvido;
por alguns tipos de distúrbios cromossômicos herdados, tais como outros genes e fatores ambientais podem afetar a expressão do
translocações balanceadas ou microdeleções que causam raras gene; pessoas com alguns genótipos podem não sobreviver até
síndromes de genes contiguos (ou síndromes de microdele- o nascimento; pode estar faltando uma informação precisa so-
ção), nas quais há uma deleção de múltiplos genes em loci pro- bre a presença do distúrbio t;m parentes ou sobre as relações
ximamente ligados (ver Cap. 10); ou por exposições ambientais familiares.
compartilhadas pelos membros familiares. Os distúrbios mono-
gênicos herdados em geral podem ser diferenciados dos outros Heterogeneidade Genética
tipos de distúrbios familiares por suas taxas de segregação tipi-
camente mendelianas nas famílias . A confirmação de que uma Quando um distúrbio genético que parece ser uma entidade úni-
doença deve-se a mutações em um único gene eventualmente ca é mais bem estudado, com freqüência descobre-se que ele é
48 ' PADRÕES DE HERANÇA MONOGÉNICA

geneticamente heterogêneo. Isto é, inclui vários fenótipos que são glios colônicos, levando a uma motilid ade colônica defeituo-
similares, mas que de fato são determinados por genótipos dife- sa e uma grave constipação crônica (doença de Hirschsp-
rentes. A heterogeneidade genética pode ser o resultado de mu- rung) (ver Cap. 15), enquanto outras mutações no mesmo
tações diferentes no mesmo locus (heterogeneidade alélica), de gene resultam em câncer de herança dominante da tireóide e
mutações em loci diferentes (heterogeneidade de locus), ou de das glândulas supra-renais (neoplasia endócrina múltipla
ambos O reconhecimento da heterogeneidade genética é um tipos lia e Ilb) (ver Cap. 16). Um terceiro grnpo de muta-
aspecto importante do diagnóstico clínico e da consulta genéti- ções em RET causa tanto doença de Hirschsprung quanto ne-
ca (ver Cap. 12, Quadro 12.2). oplasia endócrina múltipla nas mesm as pessoas.
A menos que tenha genitores consangüíneos, a maioria das
HETEROGENEIDADE DE Locus pessoas com distúrbios autossômicos recessivos tem mais pro-
babilidade de ter genótipos compostos do que verdadeiramen-
Para muitos fenótipos, apenas a análise dos heredogramas tem te homozigotos, embora para a maioria das finalidades estas pes-
sido suficiente para demonstrar a heterogeneidade genética. Por soas em geral ainda sejam chamadas de homozigotas, se tive-
exemplo, a retinite pigmentosa, uma causa comum de preju- rem um par de alelos anormais em um locus. Como combina-
ízo visual causada por degeneração de fotorreceptor associada ções alélicas diferentes podem ter conseqüências clínicas um
à distribuição anmmal de pigmento na retina, há muito tem sido tanto diferentes, os clínicos devem estar cientes da heteroge-
conhecida como um dis túrbio que ocorre nas formas autossô- neidade alélica como uma possível explicação para a variabili-
mica dominante, autossômica recessiva e ligada ao X Nos úl- dade entre pacientes considerados corno portadores da mesma
timos anos, demonstrou-se que a heterogeneidade é mais am- doença
pla. A análise de DNA demonstrou que há uma probabilidade
de pelo menos 3 formas ligadas ao X, 12 formas autossômicas
dominantes e 5 fo1mas autossômicas recessivas deretinite pig- · 'HERANÇA AUTOSSÔMICA RECESSIVA
mentesa que não estão associadas e outras anomalias fenotípi-
cas. Se incluirmos os distúrbios nos quais a retinite pigmento- Começaremos com os fenótipos autossômicos recessivos por-
sa é encontrada em conjunto com outros defeitos, tais como que, embora sejam menos comuns que os autossômicos do-
retardo mental ou surdez, o número de doenças genéticas dife- minantes, seu padrão de herança e mecanismo de doença em
rentes que manifestam retinite pigmentosa ficará bem acima de geral são mais bem compreendidos em termos moleculares.
30! A síndrome de Ehlers-Danlos, na qual a pele e outros te- Como foi discutido na seção anterior, a doença autossômica
cidos conjuntivos podem ser excessivamente elásticos ou frá- recessiva ocorre apenas nos homozigotos, pessoas com dois
geis devido a um defeito subjacente da estrutura do colágeno, alelos mutantes e nenhum ateio normal, porque nestas doen-
também pode ser autossômica dominante, autossômica reces- ças uma cópia do gene normal em um heterozigoto é capaz
siva ou ligada ao X, e a análise em níveis clínicos e molecula- de compensar o alelo mutante e evitar que a doença ocorra .
res mostraram que existem mais de 10 loci diferentes associa- Corno uma pessoa herda 11penas um dos dois alelos em um
dos ao distúrbio. locus de um genitor, os homozigotos devem herdar um alelo
mutante de cada genitor (bloqueando a nova mutação rara).
Um heredograma típico ilustrándo a h erança autossômica re-
HETEROGENEIDADE ALÉLICA
cessiva é mostraclo na Fig. 5 3 . Ambos os genitores de uma
A heterogeneidade alélica é uma causa importante de varia- pessoa afetada são heterozigotos (portadores) . .Q risco de
ção clínica . Muitos loci possuem mais de um alelo mutante. cada um de seus filhos receber um alelo recessivo é de 50%
De fato, em um determinado locus pode haver algumas ou de cada genitor e, portanto, a chance de herdar dois alelos re-
muitas mutações. Às vezes estas mutações diferentes resul- cessivos e ser afetado é de 1/2 X 1/2 ou 1 em 4. O probando
tam em distúrbios clinicamente indistinguíveis ou bastante pode ser o único membro da família afetado, mas se outros
similares . Em outros casos, alelos mutantes diferentes no forem afetados, eles em geral estarão entre seus irmãos e não
mesmo locus resultam em apresentações clínicas bem diferen- em outra parte da família, a menos que a família seja altamente
tes. Por exemplo, algumas mutações no gene RET, que codi- endogâmica.
fica um receptor de tirosina cinase, pode causar uma insufici- Embora qualquer reprodução na qual cada genitor tenha pelo
ência dominantemente herdada.de desenvolvimento dos gân- menos um alelo recessivo possa produzir prole homozigota afe-

li

Ili

IV
1~ !"' --
Fig.. 5.3 Heredograma típico mostrando herança autossômica recessiva.
PADRÕES DE HERANÇA MONOG ENICA 1 49

tada, o mais comum é a reprodução de dois portadores não-afe- CONSANGÜINIDADE


tados. Os três tipos de reprodução, com o risco para a prole em
cada caso, são mostrados aqui. O ateio recessivo mutante é sim- A chance de que ambos os genitores sejam portadores de um alelo
bolizado por r e seu alelo dominante normal, por R. mutante no mesmo locus aumentará substancialmente se os ge-
nitores forem parentes e cada um tiver herdado o alelo mutante
a partir de um ancestral comum, uma situação chamada de con·
Genitorcs Risco para a Prole sangüinidade. A consangüinidade dos genitores de um pacien-
Portador X portador: Rir X Rir 114 RIR, 112 Rir, 114 rir te com um distúrbio genético é uma forte evidência (embora não
3/4 não-afetados, 1/4 afetados uma prova) de herança autossômica recessiva desta condição. Por
exemplo, o distúrbio no heredograma da Fig. 5 4 provavelmente
Portador X afetado: Rir X rir 1/2 Rir, 112 rir é de uma característica autossômica recessiva, muito embora
1/2 não-afetados, 1/2 afetados outras informações no heredograma possam parecer insuficien-
tes para estabelecer este padrão de herança. Mesmo que os geni-
Afetado X afetado: rir X rir Só rir
tores considerem-se não-apar·entados, eles podem ter um ances-
Todos afetados
tral comum nas últimas gerações, especialmente se forem de
origem étnica ou geográfica similar próxima. Assim, ao colher
Freqüência Gênica e Freqüência de Portadores uma história familiar, é importante perguntar sobre a consangüi-
nidade e a origem.
Os portadores de genes autossômicos recessivos não são cli- Embora na maioria das populações das sociedades ocidentais
nicamente reconhecíveis, mas são muito mais comuns que os de hoje a incidência de casamentos consangüfneos seja baixa, ela
homozigotos afetados. O ateio mutante responsável por um tem sido relativamente comum em alguns grupos étnicos; por
distúrbio recessivo em geral é raro e, portanto, a chance de exemplo, no Japão, no sudeste da Índia e no Oriente Médio. Na
que uma pessoa tenha duas cópias de um alelo raro mutante é época atual, a taxa de casamentos de primos em primeiro grau e
muito menor do que a chance de que ela herde um alelo nor- de consangüíneos em geral está declinando em muitas socieda-
mal e um mutante. (Discutiremos como calcular as freqüên- des tradicionais.
cias reais de portadores e da doença no Cap . 7.) Como um dis- Uma nota de cautela: é importante reconhecer que a consan-
túrbio autossômico recessivo deve ser herdado de ambos os güinidade não é a explicação mais comum para uma caracterís-
genitores, o risco de que qualquer portador tenha um filho tica autossômica recessiva. A reprodução entre pessoas não-apa-
afetado depende, em parte, da chance de que seu cônjuge tam- rentadas, cada uma das quais pode por acaso ser portadora, con-
bém seja portador da condição. Assim, conhecer a freqüên- tribui para a maioria dos casos de doença autossômica recessi-
cia de portadores de uma doença é clinicamente importante va, particularmente se uma característica recessiva tiver uma alta
para a consulta genética. freqüência na população. Assim, a maioria das pessoas afetadas
O çlis(ú.rbio autossômico recessi.YQ .mill.~__ç_9_1n_4m_~rrt__çr!!ln­ por um distúrbio relativamente comum, tal como a CF, não é o
cas caucasianas é a fibrose cística (CF) (ver Cap. 12). A CF é resultado de consangüinidade, pois o alelo mutante é muito co-
d-~~conhecida nas populações asiáticas e é relativamente rara mum na população em geral. A consangüinidade é encontrada
nas populações afro-americanas, mas nas populações caucasi- com mais freqüência nos antecedentes de pacientes com condi-
anas cerca de l criança em 2 000 tem dois alelos CF mutantes ções muito rar·as. No xeroderma pigmentoso, uma rara condição
e tem a doença. A freqüência de portadores pode ser calculada autossômica recessiva de reparo do DNA (ver Cap. 16 e Quadro
como sendo de aproximadamente 1122 (ver Cap. 7). Em uma 9.6), por exemplo, mais de 20% dos casos são relatados como
população de 2 000 caucasianos, então, espera-se um paciente resultantes de casamentos entre primos em primeiro grau.
com CF, 90 portadores não-afetados da mutação CF e 1. 909 ho- Embora as pesquisas genealógicas tragam alguma luz sobre
mozigotos normais. Como um paciente tem dois alelos CF e a história da espécie humana como uma única farm1ia, o risco
um po1tador só tem um, 90/92 (cerca de 98%) de todos os ge- genérico para a prole de casamentos consangüíneos entre pesso-
nes CF nesta população de 2.000 indivíduos estão escondidos as aparentadas não é tão grande quanto às vezes se imagina Os
nos portadores (que em geral não sabem disso) e apenas 2% riscos absolutos de prole anormal (natimorto, morte neonatal e
estão nos pacientes.

Consangüinidade e Endogamia
Como já foi discutido, a grande maioria dos alelos mutantes res-
ponsáveis pelos distúrbios autossômicos recessivos está nos por-
tadores e não nos homozigotos. Os alelos mutantes podem ser
li
transmitidos nas famílias por várias gerações sem que nunca
apareçam na fo1ma homozigota. A presença de tais genes reces-
sivos escondidos não é revelada, a menos que o portador se case
com outro portador do alelo mutante no mesmo locus e ambos Ili
os alelos deletérios sejam herdados por uma criança. Sabemos,
por estudos da prole de reproduções incestuosas, que todos nós
temos pelo menos de oito a dez alelos mutantes para distúrbios IV
autossômicos recessivos bem conhecidos e facilmente reconhe-
cíveis O número total de mutações gênicas deletérias recessi-
vas pmtadas por uma pessoa certamente é maior que esta esti- Fig. 5.4 Heredograma no qual a consangüinidade sugere herança
mativa mínima autossômica recessiva
50 ' PADRÕES DE HERANÇA MONOGÊNICA

malformações congênitas) para casamentos entre primos em pri- 64 de ser homozigoto em IV -1 . Assim, a probabilidade de que
meiro grau são de 3% a 5%, cerca do dobro do risco geral de 2% IV-1 seja homozigoto para qualquer um dos quatro alelos é 4 X
a 3% para a prole de um casal não-aparentado (ver Cap. 19). A 1/64 = 1/16. O Quadro 5 .1 mostra os coeficientes de endogamia
consangüinidade no nível de primos em terceiro grau ou paren- para a prole de vários casamentos consangüíneos. Se uma pes-
tescos mais remotos não é considerada como sendo geneticamen- soa é endogâmica por mais de uma linha de descendência, os
te significativa, e o risco aumentado de prole anormal é despre- coeficientes separados são somados para encontrar seu coefici-
zível em tais casos. Ainda assim, muitas pessoas que são homo- ente total de endogamia.
zigotas para um alelo raro podem muito bem tê-lo herdado de
ambos os genitores vindo de um ancestral comum que era hete-
DISTÜRBIOS RECESSIVOS RAROS EM ISOLADOS GENETICOS
rozigoto.
Existem muitos grupos pequenos nos quais a freqüência de al-
A MEDIDA DA CONSANGUINIDADE guns genes recessivos raros é bem diferente da população em
geral Tais grupos, isolados genéticos, podem ter se separado de
A medida da consangüinidade é relevante em genética médica seus vizinhos por barreiras geográficas, religiosas ou lingüísti-
porque o risco de uma criança ser homozigota para algum alelo cas Embora tais populações não sejam, estritamente falando,
recessivo raro é proporcional ao grau de parentesco dos genito- consangiiíneas, a chance de se reproduzirem com outro portador
res. Alguns tipos de reproduções consangüíneas que têm um ris- de uma determinada condição recessiva pode ser tão alta como a
co aumentado são mostrados na Fig. 5.5. observada nos casamentos entre primos
O coeficiente de endogamia (F) é a probabilidade de que um Por exemplo, entre os judeus Ashkenazi dos EUA, o gene para
homozigoto tenha recebido ambos os alelos em um locus da a doença de Tay-Sachs (gangliosidose GM2) é muito comum.
mesma fonte ancestral. É também a proporção de loci nos quais A doença de Tay-Sachs é um distúrbio degenerativo neurológi-
uma pessoa é homozigota ou idêntica por descendência. Na Fig. co autossômico recessivo que se desenvolve quando a criança
5 6, a pessoa IV-1 é a prole de um casamento de primos em pri- tem cerca de 6 meses de idade. As crianças afetadas desenvol-
meiro grau, Para qualquer alelo específico que seu pai possua, a vem cegueira e regridem mental e fisicamente (ver Cap. 12). A
chance de que sua mãe também tenha herdado o mesmo alelo da doença é fatal no início da infância. A freqüência da doença de
mesmafonte é de 1/8, Assim, para qualquer gene que o pai passe Tay-Sachs é 100 vezes mais alta nos judeus Ashkenazi (1 em
para sua prole, a chance de que a mãe transmita o mesmo alelo é 3 600) do que na maioria das outras populações ( 1 em 360.000),
de 1/8 (a chance de que ela tenha o aielo) X 112 (a chance de que Assim, a freqüência de portadores entre os judeus Ashkenazi é
ela o transmita)= 1/16. Este é o coeficiente de endogamia para de aproximadamente 3% (calculada como descrito no Cap. 7).
o filho de primos em primeiro grau. Isso significa que a prole de Quando uma característica recessiva tem uma alta freqüên-
um casamento entre primos em primeiro grau tem uma chance cia em uma população, a consangüinidade em geral não é uma
de 1/16 de ser homozigota por descendência em qualquer locus característica marcante nos heredogramas com a característi-
ou, alternativamente, que o filho seja homozigoto em 1116 (cer- ca. Conseqüentemente, entre os judeus Ashkenazi, os pais das
ca de 6%) de seus locL Um modo alternativo de chegar à mesma crianças afetadas em geral não são consangüíneos próximos,
conclusão (e ao mesmo coeficiente F) é considerar que cada um enquanto em outras populações nas quais a freqüência de por-
dos quatro alelos no locus A na geração Item uma chance de li tadores é muito baixa, como em Quebec, Canadá, a taxa de con-

Pai-filha Irmão-irmã Irmão-meia-irmã Tio-sobrinha Meio-tio-sobrinha


ou tia-sobrinho

Primos em primeiro grau Primos em primeiro Meio-primos em Primos germanos Primos em


grau duplo primeiro grau segundo grau

Fig. 5 . 5 Tipos de casamentos consangüíneos A probabilidade de que a prole de cada um destes casamentos seja homozigota pordes-
cendência em qualquer locus é igual ao coeficiente de endogamia, F
PADRÕES DE HERANÇA MONOGÊNICA 1 51

sangüinidade nos genitores de pacientes portadores de Tay-


A1JA2
Sachs é alta .
Embora façamos uma distinção entre a consangüinidade que
ocorre dentro de uma fa!Ill1ia e a endogamia, que ocorre entre
li
indivíduos não-aparentados em um isolado genético, em ambas
as situações existe um risco aumentado de reprodução entre he-
terozigotos portadores de distúrbios autossômicos recessivos.
Para medir o risco em populações endogânúcas, o conceito de Ili
coeficientes de endogamia pode ser expandido para incluir po-
pulações, bem como parentes em fanúlias, e alguns exemplos são IV
dados no Quadro 5 2. Assim, pessoas de uma população mais ou
menos restrita podem ter um coeficiente F significativo, muito
embora não se imaginem consangüíneos . Para algumas popula- Fig. 5 .6 Um casamento entre primos. usado no texto para demons-
ções altamente endogâmicas, o valor médio do coeficiente F é trar como calcular o coeficiente de endogamia. F. do filho IV-1
tão alto ou mais alto que o valor para filhos de primos em segun-
do grau. Por exemplo, F = 0,04 para os samaritanos, um grupo
de apenas 500 pessoas que ficaram geneticamente isolados por
mais de 3.000 anos, em comparação com 0,016 para a prole de A análise de segr·egação é um método estatístico que usa a fre-
primos e m segundo grau. No Japão, Fé de cerca de 0,005 (0,5% ), qüência e distribuição de indivíduos afetados e não·afetados nas
o que indica que, em média, uma pessoa japonesa é homozigota fanúlias para determinar ó modo mais provável de herança. Os
por descendência em até 250 loci padrões de herança resultam da transmissão de alelos de uma
geração para a outra. Grande parte da genética é, portanto, o re-
sultado de pequenas probabilidades_ Urna pessoa tem urna certa
Distúrbios Influenciados pelo Sexo probabilidade de herdar um alelo.versus outro alelo ou uma cer-
Embora os distúrbios autossômicos recessivos em geral ocoCTam ta probabilidade de desenvolver um fenótipo ou outro. Para es-
com freqüência igual em homens e mulheres, alguns fenótipos tudar tais processos, os geneticistas tornam como base uma for-
autossômicos recessivos são influenciados pelo sexo, isto é, ex- mulação matemática que é freqüentemente usada para descrever
pressam-se em ambos os sexos, mas com freqüências diferen- tais processos: o teorema binomial. A seção que se segue faz
tes. Entre os distúrbios autossômicos, a hemocromatose é um uma introdução básica ao teorema binomial e aplica-o a um exem-
exemplo de um fenótipo mais comum nos nomens Neste dis- plo simples de análise de segregação. Ele também é usado em
túrbio autossômico recessivo comum do metabolismo do ferro, genética de populações (ver Cap. 7) e no mapeamento gênico por
há uma absorção aumentada do ferro da dieta, que leva a uma ligação (ver Cap. 8) .
sobrecarga de ferro com graves conseqüências patológicas. A
incidência mais baixa do distúrbio clinico nas mulheres (um
TEOREMA BI NOMIAL
décimo da incidência vista nos homens) é tida como estando
relacionada a uma ingestão dietética de ferro mais baixa e a um Suponha que existam dois resultados alternativos de um expe-
aumento da perda de ferro por meio da menstruação. rimento, o "sucesso" ocorrendo com a probabilidade p e o "fra-
casso" ocorrendo com a probabilidade q .Como só existem dois
Análise de Segregação resultados possíveis, p + q deve ser igual a 1. Portanto, q = 1
- p . Da primeira vez que o experimento é feito, a probabilida-
Nem sempre é óbvio pela inspeção se um heredograma reflete de de um sucesso é p e a probabilidade de um fracasso é q . Se
urna herança autossômica recessiva ou outra forma de herança o experimento for feito duas vezes, a probabilidade de dois

QUADRO 5-1
càsamentos
- .
consangüíneos·
' ·-.·- ·-·· ..
.· .• -·- :: : ; -., . -:--.·. ··.
Proporções Coeficiente de
Tipo Grau de Parentesco de Genes em Comum Endogamia da Criança (F')
GêmeosMZ 1
Genitor-filho 1. o 1/2 114
Irmão-irmã (incluindo !.º 112 1/4
gêmeos dizigóticos)
Innão-meia-itmã 2.º 114 1/8
Tio-sobiinha ou tia-sobrinho 2.º 114 1/8
Meio-tio-sob1inha 1º 1/8 1/16
Primos em 1. º grau 3.º 118 1116
Primos em 1 ° grau duplos 2º 114 118
Meio-primos em l .º grau 4.º 1116 1/32
Primos germanos 4.º 1116 1/32
Primos em 2.0 grau 5º 1/32 1/64
Coeficientes de endogamia para a prole de vários casamentos consangU!neos Se uma pessoa for endogâmica por mais de uma linhagem de descendência, os coe-
ficiemes separados serjo somados para que se encontre seu coeficiente total de endogamia.
52 ' PADRÕES DE HERANÇA MONOGÉNJCA

QUADRO 5-2 nem sabíamos que os genitores eram portadores. Das .37 fanu1i-
Exemplos de Coeficientes de Endogamia.(F) para as restantes podemos avaliar que:
Algumas Populações Humanas ·· · ·
27 (73%) tenham 1 filho afetado;
População F
9 (24%) tenham 2 filhos afetados;
Canadá l (3%) tenha 3 filhos afetados.
Católica romana 0,00004-0,0007
EUA No grupo de avaliação, então, o número total de filhos afeta-
Católica romana 0-0,0008 dos entre 111 crianças de .37 famflias é 27 X 1 afetados + (9 X
Huteritas 0,02 2 afetados) + (1 X 3 afetados) = 48 afetados dentre 111 crian-
Dunkers (Pensilvânia) 0,03
América L.alina 0-0,003 ças, ou 43%, bem maior que os 25% teoricamente esperados para
Sudeste da Europa 0,001-0,002 herança autossômica recessiva. Este é um exemplo de tenden-
Japão 0,005 ciosidade de averiguação, que devemos evitar em pesquisas
Índia (Andhra Pradesh) 0,02 médicas, especialmente em genética médica Nos testes para
Samaritanos 0,04 herança autossômica recessiva, as proles sem membros afetados
são invariavelmente omitidas .. O problema pode ser ainda pior
se, como pode ocorrer ocasionalmente, a chance de avaliação de
uma prole puder ser mais alta quando ela tem dois ou mais mem-
sucessos será p X p = p1, de dois fracassos será q2 e de um bros afetados do que quando só tem um, Vários métodos estatís-
sucesso e um fracasso será 2 X p X q (o fator 2 vem de dois ticos para corrigir a tendenciosidade sob diferentes condições de
modos de haver um sucesso e um fracasso: o sucesso pode vir averiguação são conhecidos e estes métodos são descritos em
no primeiro experimento e o fracasso no segundo ou vice-ver- muitos textos de estatística.
sa) Com três experimentos, a chance de três sucessos será p
X p X p = p 3 ; de três fracassos será q3 ; sucesso e dois fracas-
~
sos será .3 X pq2 (porque o sucesso pode vir no primeiro, no í'~r1 ,, d a Herança Autossom1ca
segundo ou no terceiro experimento); e, similannente, dois "'. ' Caractenst1cas A·

sucessos e um fracasso será .3p2q. Em termos gerais, quando Recessiva


existem dois eventos alternativos, um com probabilidade p e o
outro com probabilidade 1 - p = q, as freqüências de possí- I , Um fenótipo autossômico recessivo, se aparecer em
veis combinações de p e q em n tentativas são dadas pelos ter- mais de um membro de uma famHia, é visto tipicamen-
mos individuais da expansão de (p + q)". Esta formulação de te apenas nos irmãos do probando, e não nos seus geni-
probabilidades de uma série de experimentos baseados na pro- tores, na sua prole ou em outros parentes.
babilidade dos resultados de um único experimento é o teore- 2, Para a maioria das doenças autossômicas recessivas, ho-
ma binomial mens e mulheres têm a mesma chance de ser afetados,
3. Os genitores de um filho afetado são portadores assin-
APLICAÇÃO DO TEOREMA BINOMIAL À ANALISE DE SEGREGAÇÃO
tomáticos de alelos mutantes .
4. Os genitores da pessoa afetada podem, em alguns ca-
Examinaremos agora um exemplo simples do uso do teorema sos, ser consangüíneos, Isto é especialmente provável
binomial na análise de segregação para um problema clinicamen- se o gene responsável pela condição for raro na popu-
te relevante.. Suponha que alguém queira determinar se um de- lação.
terminado distúrbio cujo padrão de herança ainda não foi esta- 5 O risco de recorrência para cada irmão do probando é
belecido é autossômico recessivo Fazemos isto examinando se de 1 em4.
a doença ocorre na prole nas proporções que se ajustam à expec-
tativa de 25% de herança autossômica recessiva.
Supondo uma herança recessiva, que proporção das fanu1ias
com três filhos teria O, 1, 2 e .3 filhos afetados? De acordo com o
enfoque usado antes,p (chance de filho clinicamente nmmal) = PADRÕES DE HERANÇA
.3/4, q (chance de filho afetado) = 1/4, n = .3 e (p + q)3 = p 3 + AUTOSSÔMICA DOMINANTE
3p2q + 3pq2 + q3, Assim, o que teoricamente se espera, com base Dentre os cerca de 6.000 fenótipos mendelianos conhecidos,
na herança autossômica recessiva, é que mais da metade são características autossômicas dominantes
A inci9_in_c_i~ -º~-ª.J.ggrr~_djs!!!.r!'.!iº~--ª!1-1.Q~sômi.f.Q!L dqraj~ é
27/64 (42%) de todas estas famílias não tenham nenhum filho afetado; bem alta,~).Q_fil_~~os em áJ:eas g(!Qgf,@ç_~s_específicas: pôr
27/64 (42%) das familias tenham 1 filho afetado; exemplo, 1 em 500 para hipercolesterolemia familiar em po-
9/64 (14%) tenham 2 filhos afetados; pulações descendentes de europeus ou japoneses; mais de 1 em
1164 (2%) tenham 3 filhos afetados. l . 000 para distrofia miotônica em alguma parte dos EUA e cerca
de 1em2500 a 3.000 para várias condições, tais como doença
Determinamos as proporções esperadas de filhos afetados em de Huntington (em populações de origem da Europa setentrio-
famfüas com três filhos de genitores que são portadores de um nal), neurofibromatose e doença do rim policístico Embora
distúrbio autossômico recessivo. Suponha, entretanto, que só muitos distúrbios autossôrnicos dominantes s«jam individual-
agora incluímos ("avaliação") uma farru1ia em nosso estudo quan- mente muito menos comuns, eles são tão numerosos que, em
do já havia pelo menos um filho afetado, Então 27 das 64 famí- conjunto, sua incidência total é apreciável. A carga dos distúr-
lias com risco (42%) não serão incluídas no estudo porque nós bios autossômicos dominantes é ainda mais aumentada devido
PADRÕES DE HERANÇA MONOGÊNICA 1 53

à sua natureza hereditária. ~t!S..Ps>_dert\ S~!Jransmitidas por fa- Mutação Nova em Distúrbios
mili!!:~.t! ~e tomar u!ll problema não.só para as P~S.~.9.~ 1 f!l~P<l:í.~­ Autossômicos Dominantes
a f~_f!lfli.a if!t~~E~·-~fl! geral ao longo de muitas gerações. Em
alguns casos, a carga é composta por dificuldades sociais re- Em qualquer população, novos alelos surgem por mutação e são
sultantes de deficiências físicas ou mentais. mantidos ou removidos por seleção Após o surgimento de uma
Na herança autossômica dominante típica, cada pessoa afeta- nova mutação, sua sobreyida na população depende da adapta-
da em um heredograma tem um genitor afetado, que também tem bilidade das pessoas que a possuem em comparação com a das
um genitor afetado, e assim por diante, até onde se possa acçim- pessoas que possuem outros alelos no locus envolvido.
panhar o distúrbio ou até a ocorrência da mutação oiiginal. Isto A adaptabilidade de uma condição é medida pelo número de
também é verdade, como será discutido mais adiante, nos here- prole de pessoas afetadas que sobrevivem até a idade reproduti-
dogramas de herança dominante ligada ao X. A herança autos- va em comparação com um grupo controle apropriado. Muitos
sômica dominante pode ser distinta da dominante ligada ao X, distúrbios autossômicos dominantes estão associados com a re-
entretanto, pela transmissão de homem a homem, que obvia- dução da adaptabilidade. Há uma relação inversa entre a adapta-
mente é impossível na herança ligada ao X, pois os homens trans- bilidade de um determinado distúrbio autossômico dominante e
mitem o cromossomo Y, e não o X, para seus filhos. a proporção de todos os pacientes com este distúrbio que têm
A maioria das mutações causadoras de doenças é rara na po- genes mutantes novos. Quando um distúrbio reduz a adaptabili-
pulação em comparação com os alelos normais. Sendo A o alelo dade reprodutiva das pessoas afetadas, uma proporção de todos
mutante e a o alelo normal, as reproduções que geram filhos com os afetados provavelmente recebeu o gene defeituoso como uma
uma doença autossômica dominante são, portanto, em geral en- mutação nova em um gameta de um genitor genotipicamente
tre um heterozigoto para a mutação (Ala) e um homozigoto para normal. Alguns distúrbios têm uma adaptabilidade zero. Em
um alelo normal (ala) . A prole esperada de uma reprodução Ala outras palavras: os pacientes com tais distúrbios nunca se repro-
X ala é dada no quadro que se segue. duzem . Essencialmente todos os casos observados de um distúr-
bio com adaptabilidade zero são, portanto, devidos a mutações
f~t.~tfW:~;~~~~(i~~~?.~-&4:.x':.~/~·,:<;.;?,::: ,_..~ ,:.:,:;;::; .·'.:'?:'.:.~-·~·'. ':<~ :'.~'},: novas, porque as mutações não podem ser herdadas. Outros dis-
túrbios têm adaptabilidade reprodutiva virtualmente normal por
Gcnitor Normal ala causa do infcio em idade mais avançada nos casos típicos. Quan-
a a do a adaptabilidade é normal, o distúrbio raramente é visto como
resultado de mutação nova; é muito mais provável que o pacien-
A Ala Ala te tenha herdado o distúrbio do que tenha um novo gene mutan-
Afetado Afetado te. A medida da freqüência de mutação e a relação entre a fre-
Genitor Afetado
ala
qüência de mutação co.m a adaptabilidade serão mais discutidas
Ala a ala
Normal Normal no Cap 7.

Cada filho desta reprodução tem 50% de chance de receber o Variabilidade de Manifestações Fenotfpicas de
alelo anormal A do genitor afetado e, portanto, ser afetado (Ala) Genes Mutantes: Penetrância, Expressividade e
e 50% de chance de receb~r o alelo normal a e, portanto, não ser Pleiotropia
afetado (ala). (0 genitor não-afetado pode transmitir apenas um
alelo normal a para cada filho.) Estatisticamente falando, cada Muitas condições genéticas segregam-se nitidamente nas famí-
gestação é um "evento independente", não-governado pelo re- lias Isto é, o fenótipo anormal pode ser claramente distinto do
sultado das gestações anteriores.. Assim, em uma família, adis- normal. Na experiência clinica, entretanto, alguns distúrbios não
tribuição de crianças afetadas e não-afetadas pode ser bem dife- são expressos em pessoas geneticamente predispostas e outros
rente da teórica 1: 1, embora na população como um todo a prole têm uma expressão extremamente variável em termos de gra-
de genitores Ala X ala seja de aproximadamente 50% Ala e 50% vidade clinica ou idade de início, ou ambos. A expressão de um
ala A herança autossômica dominante típica pode ser vista no genótipo anormal pode ser modificada pelos efeitos do enve-
heredograma de uma família com surdez hereditária (Fig. 5.7). lhecimento, outros loci genéticos e os efeitos do ambiente . Estas

li

Ili

IV

Fig. 5.7 Heredograma mostrando herança tlpica de urna forma de surdez neurossensorial progressiva (DFNAI) herdada como urna ca-
racterfstica autossôrnica dominante
54 1 PADRÕES DE HERANÇA MONOGÊNICA

diferenças de expressão, que são particularmente característi- da (1) pelo crescimento de múltiplos tumores carnosos benig-
cas de distúrbios autossômicos dominantes, embora de modo nos, neurofibromas, na pele; (2) pela presença de múltiplas le-
algum restritos a eles, em geral podem levar a dificuldades de sões pigmentadas, achatadas e iuegulares na pele, conhecidas
diagnóstico e interpretação de heredogiamas. Existem muitos como manchas café-au-lait; (3) pelo crescimento de pequenos
modos diferentes pelos quais tais diferenças de expressão po- tumores benignos (hamartomas) na íris do olho, chamados de
dem ocorrer: penetrância reduzida, expressividade variável nódulos de Lisch; e (4) com menos freqüência, por retardo
e pleiotropia. mental, tumores do sistema nervoso central, neurofibromas
A penetrância é a probabilidade de que um gene tenha qual- plexiformes difüsos e o desenvolvimento de câncer do sistema
quer expressão fenotípica. Quando a freqüência de expressão de nervoso ou músculo
um fenótipo é menor que 100%, isto é, quando algumas pessoas A NF I foi inicial e completamente descrita pelo médico Von
que têm o genótipo apropriado não o expressam em absoluto, diz- Recklinghausen em 1882, mas é provável que a doença já fosse
se que o gene apresenta penetrância reduzida A penetrância é conhecida há muito tempo. Embora os heterozigotos adultos
um conceito de tudo ou nada. Em termos estatísticos, é a por- quase sempre demonstrem algum sinal da doença (a penetrância
centagem de pessoas com um determinado genótipo que são afe- é, portanto, dita como sendo de 100% nos adultos), alguns po-
tadas, pelo menos em algum grau. dem ter apenas as manchas café-au-lait, sardas nas axilas e nó-
A expressividade é a gravidade da expressão do fenótipo dulos de Lisch, enquanto outros podem ter tumores benignos
Quando a gravidade da doença difere nas pessoas que têm o ameaçadores da vida envolvendo a coluna dorsal ou sarcomas
mesmo genótipo, o fenótipo é dito como tendo expressividade malignos em uma extremidade. Assim, com fregüêncil!_ há~a .
variável. Mesmo dentro de uma famI1ia, um distúrbio pode va- grande variabilidade_ na expressão da doença; mesmo denti:~~e
riar em gravidade em relação a qualquer manifestação. U!!.J~.f!!.!Jlília, alguns i.D_(l_iyjJly_q~. são gra\f.~mente afetados ~._9u­
Quando um único gene anormal - ou um par de genes anor- tros, apenas de forma branda. O diagnóstico é ainda mais com-
mais - produz efeitos fenotípicos diversos, tais como quais sis- plicado em crianç~~J29~91:1.e_o~ .~in.~!:5...SÓ se desenvõivem C?rft o
temas orgânicos são envolvidos e que sinais e sintomas pruticu- tempõcfurãnfe-ã infância.. Por exemplo, no período neonatal,
lares ocorrem, sua expressão é dita como sendo pleiotrópica. ·- menos da metade de todos os neonatos afetados apresentam os
Cada gene tem apenas um efeito primáiio: ele dirige a síntese de sinais mais sutis da doença, um aumento da incidência de man-
uma cadeia polipeptídica ou uma molécula de RNA. A partir chas café-au-lait. A penetrância, portanto, depende da idade.
deste efeito primáJ:io, entretanto, podem haver múltiplas conse- Aproximadamente metade dos casos de NFl resulta de uma
qüências Na mesma família, duas pessoas portando os mesmos mutação nova, e não de uma herdada. Na farru1ia mostrada na
genes mutantes podem ter alguns sinais e sintomas em comum, Fig. 5. 9, o probando (indicado por uma seta) parece ter um gene
embora outras manifestações da doença possam ser bem diferen- mutante novo, pois seus genitores e seus avós não são afetados
tes, dependendo de quais tecidos ou órgãos estão afetados nas O principal problema na consulta genética das farru1ias de
duas pessoas aparentadas . Para a maioria dos distúrbios pleio- pacientes com NFI é decidir entre duas possibilidades iguais: a
trópicos, a conexão entre as várias manifestações não é nem óbvia doença nesta família é causada por uma mutação nova ou o pa-
nem bem compreendida. ciente herdou uma forma clinicamente significativa do distúrbio
Algumas das dificuldades em compreender a herança de um de um genitor no qual o gene está presente, mas só se expressa
fenótipo de doença nas famílias são demonstradas pela doença de forma branda? Se o paciente tiver herdado o defeito, o risco
autossômica dominante neurofibromatose (NFI ). A NFI é um de que qualquer um de seus irmãos também herde será de 50%,
distúrbio comum do sistema nervoso, mostrado em uma de suas mas se a criança tiver um gene mutante novo, haverá um risco
apresentações clínicas típicas na Fig. 5 .8. A NFl é caracteriza- muito pequeno de que qualquer irmão Sf'.ja afetado Significati-
vamente, em ambos os casos, o risco do paciente transmitir o gene
para alguém da sua prole é de 50%. A imprevisibilidade da gra-
vidade das manifestações da NFl, urna característica de muitos
distúrbios autossômicos dominantes, é uma complicação adici-
onal da consulta genética. Em vista destas incertezas. éjIJlpQr-
tante q~as fan.y1iaLdQS.JJJlC~com NFJ2-ªiba,in _q ue o gi~-

li

Ili

Fig. 5 ..8 Neurofibromatose tipo 1: manchas café-au-lail. hiperplgmen-


tadas na pele, são um sinal diagnóstico útil nos membros familia- IV
res que de outro modo parecem não-afetados A maioria dos paci·
entes tem seis ou mais pontos com pelo menos 15 mm de diâme- Fig. 5.9 Heredograma de uma família com neurofibromatose tipo
tro. em geral no tronco {Foto por cortesia de Rosanna Weksberg. 1. originada aparentemente de uma nova mutação no probando
The Hospital for Sick Children. Toronto) (sela)
PADRÕES DE HERANÇA MONOGÊNICA l 55

túrpjg_ppç!~ ~~.u;l.§.~~ç,tªç!p ª-.!l~~_çl_Q.J!.p~ento dos sintomas e um homozigoto podem, teoricamente, ser Ala X Ala, AIA x AI
m_!:§f.110 no perjodo pré~natal por.af}ál.is~_genética rpo!ecu!a.!' (ver a, ou AIA X AIA. ou o paciente pode, em casos muito raros, ter
Cap. 18) Infelizmente, não há modo de [!rever a grande QrDQQ.r- recebido uma nova mutação de um genitor geneticamente não-
çãn de casos_q.ue_são...causadQS_p.Qt.IrulJQção.JJ.QY!!. afetado. Em termos práticos, entretanto, apenas a reprodução de
/ Um outro exemplo de uma malformação autossôrrúca domi- dois heterozigotos precisa ser considerada, e mesmo isto é um
nante com penetrância reduzida é a deformidade da mão divi- evento incomum para a maioria das condições autossôrnicas
dida ou malfocmação em garra de lagosta, um tipo de ectrodac- dominantes
tilia (Fig. 510). A malformação origina-se na sexta ou sétima
semana de desenvolvimento, quando as mãos e os pés estão se
formando . A falta de peneuância nos heredogramas de malfor-
Prole da ReproduÇ~~·pa XA/q ·:;/,:;{(::./,\"!} ' . .. <·><..> <o·
Genitor Afetado Ala
mação da mão dividida pode levar a um aparente pulo de gera-
ções, o que complica a consulta genética, pois a pessoa em risco A a
com mãos normais pode, entretanto, possuir o gene para a con-
dição e, assim, ser capaz de ter filhos afetados. A AIA Ala
Homozigoto Afetado
A Fig. 5 11 é um heredograma de defornúdade de mão divi-
Afetado
dida no qual a pessoa mostrada pela seta é o consulente (a pes- Genitor Afetado
soa que procura a consulta genética) . Sua mãe é uma portadora Ala a Ala ala
não-peneu-ante da mutação da mão dividida. A revisão da litera- Afetado No1mal
tura sobre a deformidade da mão dividida sugere que o distúrbio
tem cerca de 70% de penetrância (isto é, apenas 70% das pesso- Clinicamente, a distinção entre heterozigotos afetados e homo-
as que têm o gene exibem o defeito) . Usando esta informação na zigotos pode ser feita com considerável certeza em muitos casos
análise bayesiana, um método matemático para deternúnar as porque os distúrbiqg _l)!9JiSÔrrúÇQS dorrúnantes em geral são mui:.
probabilidades condicionais nos heredogramas (ver uma discus- .. to {Il_fl.i_~g@_V~-~.!l~~h2mg_zjgQI9~.9!.!~. !!Q.S..~eterQzi_gQ~OS. A Fig. 5..12
são maior no Cap . 19), podemos calcular o risco de que o consu- mostra uma criança com a forma típica heterozigota da acondro-
lente possa ter um filho com a anormalidade p~~~. llII1. ~st.ú!bi(). ~s_qu.elético de nl!!!ign_q,dos. Il1.e11!~f.9§_curto~
.. e. cab.eça d.e .tam?-!!1}()_gr_~g~, A maioria dos indivíduos acondro-
Homozigotos para Características Autossômicas plásicos~.ro_i_@!jjgênçja._nonnaLe.JeY.a_uma..Yida..normald.entm.
de suas possibilidades ffsicas. É compreensível que os casamen-
Dominantes tos entre dois indivíduos acondroplásicos não sejam comuns, Um
Na prática médica, os homozigotos para fenótipos dominantes filho homozigoto de dois heterozigotos em geral é reconhecível
raros geralmente não são vistos, pois as reproduções que podem apenas em bases clinicas. Os pacientes acondroplásicos homozi-
gerar prole homozigota são raras. Mais uma vez representando gotos são afetados com muito mais gravidade que os heterozigo-
o alelo mutante como A e o alelo normal com a, os genitores de tos e é comum que não sobrevivam ao inicio da lactância.

fig. . 5. 1o Deformidade da mão dividida. uma característica au tossômica dominante envolvendo as mãos e os pés de um menino de 3
meses A. parte superior do corpo; B parte inferior do corpo (De Kelikian H 119741Congenital deformities of the hand and forearm WB
Saunders. Philadelphia )
56 ! PADRÕES DE HERANÇA MONOGÊNICA

li

Ili

Fig. 5, 1 J Heredograrna da deformidade da mão dividida demons-


trando falta de penetrãncia na mãe do consulente. o qual é indica-
do por uma seta A penetrãncia reduzida deve ser levada em conta
na consulta genética

Um outro exemplo é a hipercolestcrolcmia familiar (ver Cap


l 2), um distúrbio autossômico dominante que leva a uma doen-
ça coronariana prematura, na qual os raros pacientes homozigo-
tos têm uma doença muito mais grave, com uma expectativa de
vida muito mais curta, que os heterozigotos, relativamente co-
muns (Fig. 5.13).
De fato, em quase todos os exemplos relatados, a homozigo-
se para um alelo defeituoso resulta em um fenótipo mais grav~­
mente anonnal que a heterozigose. Uma exceção bem conheci-
da é a doença de Huntington (HD), uma doença neurodegene-
rativa caracterizada por demência progressiva e movimentos
anormais (ver Cap . 12) Os homozigotos HD podem ser distin- Fig. 5. 12 Acondroplasia. um distlirbio autossômico do~inante que
tos dos heterozigotos, muito mais comuns, por análise molecu- em geral ocorre como uma mutação nova Notar a baixa estatura.
lar do gene mutante, e a expressão clínica parece ser a mesma os membros curtos. a cabeça grande. a ponte nasal baixa. a cabeç.a
em ambos os genótipos. proeminente e a lordose lombar (De Tachdjian M O 11 9721 Ped1-
atric Orthopedics. vol 1 WB Saunders. Philadelphia. p 284 l
Fenótipo Limitado ao Sexo na Doença
Autossômica
podem determinar o padrão de herança e o conseqüente risco
Como já foi discutido para as condições autossômicas recessi- de recorrência.
vas, os fenótipos autossômicos dominantes podem demonstrar
uma proporção sexual que difere significativamente de 1: 1 A
extrema divergência de proporção sexual é vista nos fenótipos HERANÇA LIGADA AO X
limitados ao sexo, nos quais o defeito é transmitido autossomi-
camente, mas se expressa apenas em um sexo Um exemplo é a Os cromossomos X e Y, que são responsáveis pela determina-
puberdade precoce limitada ao sexo (testotoxicose familiar), ção do sexo (verCap. 10), são distribuídos de m~do desigua! para
um distúrbio autossômico dominante no qual os meninos afeta- homens e mulheres nas famílias Por este motivo, os fenot1pos
dos desenvolvem características sexuais secundárias e têm um determinados pelos genes do X têm uma distribuição sexual ca-
racterística e um padrão de herança que em geral é fácil de iden-
surto de crescimento adolescente por volta dos 4 anos de idade
(Fig. 5.14). Em algumas farm1ias, o defeito foi relacionado a uma tificar. Cerca de 500 genes já foram mapeados no cromossomo
X, 70% dos quais associados a fenótipos de doenças .
mutação no gene que codifica o receptor de hormônio luteini-
Considere um gene mutante ligado ao X, Xh(por exemplo, a
zante que ativa constitutivamente a ação sinalizadora dos recep-
hemofilia A causada por uma mutação no gene para o fator VIII
tores mesmo na ausência do hormônio. O defeito é não-penetrante de coagulação), em comparação com um alelo normal, XH Con:o
em mulheres heterozígotas. A Fig. 515, parte de um heredogra- os homens têm um cromossomo X mas as mulheres têm dois,
ma muito maior, mostra que, embora a doença possa ser trans- existem dois genótipos possíveis nos homens, mas três nas i:nu-
mitida diretamente por mulheres não-afetadas, também pode ser lheres. Os homens são hemizogotos com relação aos genes liga-
transmitida diretamente de pai para filho, mostrando que é au- dos ao X, enquanto as mulheres podem ser homozigotas para
tossômica e não-ligada ao X qualquer um dos alelos ou podem ser hete1oz.igotas.
Os homens com puberdade precoce têm fertilidade normal
e são conhecidos vários heredogramas com muitas gerações.
Genótipos Fenótipos
Para distúrbios nos quais os homens afetados não se reprodu-
zem, entretanto, nem sempre é fácil distinguir a herança autos- Homens Não-afetado
sômica limitada ao sexo da ligada ao X, pois a evidência cruci- Afetado
al, a ausência de transmissão de homem para homem, não pode
ser observada . Outras linhas de evidência, especialmente o ma- Mulheres Homozigota não-afetada
peamento gênico para verificar se o gene responsável está Heterozigotas
mapeado no cromossomo X ou em um autossomo (ver Cap 8), Homozigota afetada
PADRÕES DE HERANÇA MONOG~NICA t 57

Fig. 5 13 Comparação dos graves sintomas da hipercolesterolemia familiar (FH): xantomas cutâneos em um homozigoto para FH (es-
querda) e xantomas tendinosos em heterozigotos para FH (direita) . (Fotos por cortesia de 1 L Goldstein. University ofTexas Southwestern
Medical Center. Dallas )

til
'~"'' Características da Herança Autossômica
par de alelos na mulher geralmente é equivalente. O mecanismo
pelo qual esta "compensação de dose" é obtida pode ser explica-
Dominante do pelo princípio da inativação do X (Fig. 5.16), que em geral é
chamado de hipótese de Lyon, porque foi originalmente deta-
1. O fenótipo em geral aparece em todas as gerações, com lhado pela geneticista de camundongo Mary Lyon. Em resumo,
as pessoas afetadas tendo um genitor afetado . o princípio tem três pontos:
Exceções, ou aparentes exceções, a esta regra em ge-
nética clínica: ( 1) casos que surgiram por mutação nova
em um gameta de um genitor fenotipicamente normal;
(2) casos nos quais o distúrbio não se expressa (não-pe-
netrante) ou é expresso apenas levemente em uma pes-
soa que herdou o gene responsável.
2 . Qualquer filho de um genitor afetado tem um risco de
50% de herdar a característica
Isto é verdade para a maioria das famílias, nas quais
o outro genitor é fenotipicamente no1mal. Como em
termos estatísticos cada membro da familia é o resulta-
do de um "evento independente", grandes desvios da
esperada proporção 1:1 podem ocorrer por acaso em
uma única família.
1 Membros da famflia fenotipicarnente normais não trans-
mitem o fenótipo para seus filhos .
A falta de penetrância ou uma expressividade muito
baixa de uma condição pode levar a aparentes exceções
a esta regra.
4. Homens e mulheres têm igual probabilidade de trans-
mitir o fenótipo para seus filhos de ambos os sexos. Pode
ocon-er a transmissão de homem para homem, e os ho-
mens podem ter filhas não-afetadas
S. Uma proporção significativa de casos isolados deve-se
a mutações novas. Quanto menor é a adaptabilidade,
maior é a proporção devida a uma mutação nova.

lnativação do X, Compensação de Dose, e


Expressão de Genes Ligados ao X Fig. 5.. 14 Puberdade precoce li mitada ao homem {testotoxicose
familiar). um distúrbio autossômico dominante expresso exclusi·
HIPÓ'IESE OE LYON vamente nos homens Esta criança. de 4.9 anos. tem 120 cm de
altura (acima do 97º percentil para sua idade) Note a massa mus-
Embota os homens tenham apenas uma cópia, ou "dose", de cada cular e o desenvolvimento precoce da genitália externa A fusão
gene ligado ao X, enquanto as mulheres têm duas, a quantidade epifiseal ocorre em idade precoce e as pessoas afetadas são relati-
de produtos formados por um único alelo no homem ou por um vamente baixas quando adultas
58 1 PADRÕES DE HERANÇA MONOGÊNICA

li

Ili

Fig. 5 . 15 Padrão de heredograma de puberdade precoce limitada ao homem na família da criança mostrada na Fig 5 14 Este distúrbio
autossômico dominante pode ser transmitido por homens afetados ou por mulheres portadoras não-afetadas A transmissão de ho-
mem para homem mostra que a herança é autossômica e não ligada ao X Como a característica é transmitida por mulheres portadoras
não-afetadas, não pode ser ligada ao Y

1. Nas células somáticas das fêmeas dos mamíferos, apenas um lo, a implantação placentária está ocorrendo, há diferencia-
cromossomo X é transcricionalmente ativo. O segundo X é ção do trofoblasto em citotrofoblasto e sinciciotrofoblasto, e
heterocromático e inativo e surge nas células interfásicas corno o epiblasto, que consiste em talvez apenas 100 células, sofre
cromatina sexual, o corpúsculo de Brur. gastrulação (ver Cap. 17).
2. A inativação ocorre cedo na vida embrionáiia, começando .3 . Em qualquer célula somática feminina, o X inativo pode ser
Jogo após a fertilização, mas não é completa na massa celular o X paterno ou materno (XP ou xm). É inteiramente uma ques-
interna, que forma o embrião, até cerca do final da ptimeira tão de acaso qual do par ficará inativado em qualquer célula.
semana de desenvolvimento. Neste estágio do desenvolvimen- Depois que um cromossomo X ficou inativo em uma célula,
entretanto, todas as células descendentes desta terão o mes-
mo X inativo Em outras palavras, a inativação é determina-
da aleatoriamente, mas quando ocorre, a decisão é permanente.
Zigoto
Nesta seção, descreveremos três conseqüências da inativação
do X que são significativas tanto genética quanto clinicamente:
Primeira compensação de dose, variabilidade de expressão em mulheres
clivagem heteroz.igotas e rnosaicismo. As implicações da inativação do X
para a citogenética clínica serão discutidas em maiores detalhes
no Cap. 10.
lnativação
aleatória do X COMPENSAÇÃO DE DOSE

A inativação do X dá urna explicação para a compensação de


dose, pois o cromossomo X inativo é quase totalmente silencia-
do e, com algumas exceções, seus genes parecem não ser trans-
critos, As características básicas da hipótese de Lyon foram fir-
memente estabelecidas Os detalhes de corno isto ocorre não são
Mosaico totalmente conhecidos.. Nossa compreensão atual sobre o meca-
feminino nismo da inativação do X está apresentada no Cap. 10,
adulto
ESCAPE DA INATIVAÇÃO DO X
Embora nas células somáticas femininas a maior parte do X seja
inativada, várias regiões do braço curto e pelo menos urna região
do braço longo contêm genes que escapam da inativação e con-
tinuam a se expressar em ambos os cromossomos X nas mulhe-
res. Os genes ligados ao X que escapam da inativação enquadram-
se em três classes. Uma classe são os genes situados na região
Fig. 5 . 16 A hipótese de Lyon da inativação aleatória do cromosso- pseudo-autossômica, nos segmentos distais dos braços longo e
mo Xnas células somáticas femininas XP = cromossomo X herda- curto do X, onde existem seqüências correspondentes ao cromos-
do paternamente; xm = cromossomo X herdado maternamente Os somo Y, por meio das quais o X e o Y pareiam-se na meiose e
ovais cinza ou vermelhos representam os corpúsculos de Barr for-
~ados pelo cromossomo X paterno ou materno inativado. respec- trocam rnatetial por crossing over. Os genes no segmento pseudo-
tivamente. Os tecidos adultos (embaiw) são um mosaico de popu- autossôrnico permanecem ativos, e tanto as mulheres (duas có-
lações clonais que expressam alelos de XP ou xm (Modificado de pias do X) quanto os homens (um X e um Y) têm duas doses
Rosenberg L E 119801 lnborn errors of metabolism ln Bondy p K. expressas de tais genes Os alelos para genes na região pseudo-
Rosenberg L E jedsl Metabolic control and disease. 8 • ed WB autossôrnica podem apresentar transmissão de homem para ho-
Saunders. Philadelphia. p 73-102 ) mem por crossing over entre X e Y, que podem ser passados para
PADRÕES DE HERANÇA M ONOGÊNICA l 59

a prole masculina e, assim, númetizar uma herança autossômi- imunodeficiências ligadas ao X (ver Cap 14), disceratose con-
ca Uma segunda classe de genes ligados ao X que escapa da gênita (uma forma ligada ao X de doença de pele e insuficiência
inativação está situada fora da região pseudo-autossômica no de medula óssea) e incontinência pigmentar (uma condição li-
braço curto e no braço longo. Estes genes têm cópias correlatas gada ao X que afeta a pele e os dentes).
no cromossomo Y e, assim, tanto os homens quanto as mulheres
têm duas cópias ativas destes genes. As cópias ligadas ao X des- MOSAICISMO FUNCIONAL RESULTANTE DE l NAl lVAÇÃO DO X
tes genes não apresentam herança pseudo-autossômica porque
não participam do crossing com o cromossomo Y na meiose As mulheres têm duas populações de células, nas quais um ou
masculina. Uma terceira classe de genes que também escapa da o outro cromossomo X é o ativo (ver Fig. 5.16). Em outras pa-
inativação está situada fora da região pseudo-autossômica do lavras, as mulheres são mosaicos com relação aos seus genes
cromossomo X e não tem uma cópia no Y Por exemplo, o gene ligados ao X. O mosaicismo nas mulheres é prontamente de-
para esteróide sulfatase (deficiência que causa uma forma liga- tectado para alguns distúrbios Por exemplo, na DMD, as mu·
da ao X da doença de pele ictiose) não está na região pseudo- lheres portadoras exibem uma expressão típica de mosaicismo,
autossômica do cromossomo X, mas sim próxima a ela, e per- permitindo que as mulheres sejam identificadas pela imunoco-
manece parcialmente ativa, mesmo no X inativo. Como não existe loração de distrofina (Fig. 5 17). Além disso, a heterozigose
cópia ativa no cromossomo Y nos seres humanos, o número de para vários distúrbios ligados ao X pode ser demonstrada ex-
cópias e os niveis de expressão são maiores nas mulheres que perimentalmente por cultura de células únicas para criar clo-
nos homens. nes, que podem então ser analisados para mostrar que alguns
A relevância clínica da maiocia dos genes que escapa da clones têm um X paterno ativo, enquanto outros têm um X
inativação é incerta, mas pelo menos um gene não-inativado, matemo ativo
de esteróide sulfatase, um distúrbio clinico ligado ao X, está A inativação do X contribui para uma importante diferença
associado com a perda de função deste gene. Estes genes tam- entre a herança autossômica e a herança ligada ao X. Nas mu-
bém são candidatos a explicar sintomas clínicos em casos de lheres, como nos homens, há apenas um X totalmente funcio-
anomalias numéricas do cromossomo X, tais como a síndro- nal em qualquer célula. Conseqüentemente, embora os padrões
me de Turner 45,X (ver Cap. 10), porque seus produtos gêni- ligados ao X "dominantes" e "recessivos" de herança sejam dis-
cos não apresentariam a dosagem apropriada em comparação tintos com base no fenótipo de mulheres heterozigotas, a dis-
com as mulheres normais, portadoras de dois cromossomos tinção desaparece na prática. Esta dificuldade ocorre porque
X normais em uma mulher heterozigota para um distúrbio dominante ou
um recessi vo, o alelo mutante é o único alelo funcional em
EXPRESSIVIDADE VARIÁVEL DE GEN ES LIGADOS AO X EM cerca de metade (mas, às vezes, mais ou menos que a metade)
HEl EROZ !GOTAS de suas células somáticas. Nos homens, o alelo herdado é ine-
vitavelmente expresso, seja sua expressão nos heterozigotos do-
Como a inativação é aleatória mas é estabelecida em um está- minante ou recessiva. Alguns geneticistas médicos preferem
gio do desenvolvimento embrionário em que o embrião tem não classificar os fenótipos ligados ao X como dominantes ou
menos de 100 células, a fração de células nas mulheres porta- recessivos, mas outros acreditam que a distinção é útil porque
doras nas quais o alelo normal ou o mutante permanece ativo alguns fenótipos ligados ao X são consistentemente expressos
pode ser bem variável Como resultado, a variação clínica na em portadoras (dominantes), enquanto outros em geral são não
expressão dos distúrbios ligados ao X é vista comumente em expressos nas portadoras (recessivos), a menos que exista um
heterozigotas e pode ser extrema, indo desde absolutamente padrão de inativação altamente desbalanceado. Na discussão
normal até totalmente manifestante do defeito, com todas as que se segue, a dominância e recessividade serão examinadas
gradações intermediárias Uma heterozigota manifestante, na separadamente
qual o alelo deletério es1á situado no X ativo e o alelo normal
no X inativo em todas as células ou na maioria delas, é um
exemplo extremo de inativação do X altamente desbalanceada
Herança Recessiva Ligada ao X
ou "desviada" Heterozigotas manifestantes 1êm sido descritas A herança de fenótipos recessivos ligados ao X segue um padrão
para muitos distúrbios ligados ao X, incluindo o daltonismo, a bem definido e facilmente reconhecível (Fig. 518). Uma muta-
hemofilia A (hemofilia clássica, por deficiência do fator VIII), çj.ipJ!fü1.c!.'.l_ao ,X:~_ tipiçam.~m_e...§JÇPI~§a em termos fenotípicos
a hemofilia B (doença de Christmas, deficiência do fator IX), e!ll todos os homens que a recebem, mas apenas nas mulheres
a distrofia muscular Duchenne (DMD), a síndrome de Wiskott- ..9\!e são homozigotas para a mutaçi!q Em conseqüência, os dis-
Aldrich (uma imunodeficiência ligada ao X) e vários outros túrbios recessivos ligados ao X em geral são restritos aos homens
distúrbios oculares ligados ao X. e, com exceção das raras heterozigotas manifestantes já discuti-
Além das heterozigotas manifestantes, o padrão oposto de das, dificilmente são vistos entr·e as mulheres.
inativação desbalanceada (isto é, com o alelo mutante prefe- A h~_mofilia A é_ um distúrbio clássico n() qu~l o ~~~Kl±.~.!:1.à,9
rencialmente no X inativo em alguns ou em todos os tecidos da coagula normalmente em função de uma deficiência do fat()_r_ym,
mulher heterozigota) também pode ocorrer e é característico de Ulp-ª:_ Q~<:J~ína da-~ascata de coagulação . A natureza hereditária
vários distúrbios ligados ao X Em geral, a inativação desbalan- da hemofilia e mesmo seu padrão de transmissão já são reconhe-
ceada deste tipo é vista em heterozigotas assintomáticas e é tida cidos há muito tempo, e a condição tomou-se conheéida como
como refletindo a sobrevida de uma célula ou a desvantagem "hemofilia real" por causa de sua ocoITência entre os descenden-
proliforntiva das células que originalmente tinham o alelo mu- tes da rainha Victoria da Inglaterra, que era portadora.
tante no X ativo (ver Cap . 10) Os padrões de inativação desba- Como na discussão anterior, Xh representa o ateio do fator VIlI
lanceada em tecidos relevantes têm sido usados para diagnosti- mutante causador da hemofilia A e XH representa o alelo normal.
car o estado portador para algumas condições ligadas ao X, in- Se um hemofílico se casar com uma mulher normal, todos os filhos
cluindo várias formas de retardo mental ligadas ao X, algumas receberão o cromossomo Y de seu pai e um X matemo, não sendo
60 r PADRÕES DE HERANÇA MONOGÉN ICA

li

Ili

IV

Fig. 5 . 18 Padrão de heredograrna mostrando um distúrbio reces-


sivo ligado ao Xtal como a hemofilia A. transmitido a partir de um
homem afetado através das mulheres para um neto afetado e um
bisneto afetado

Agora suponha que uma filha de um homem afetado


reproduza-se com um homem não-afetado São possíveis quatro
genótipos na prole, com iguais probabilidades

Xn xh
X,; X111XH X11IX11 Filhas: 112 normais,
112 ponadoras
y XHfY Xi.fY Filhos: 1/2 normais,
112 afetados

A hemofilia de um avô afetado, que não aparece em nenhum


de seus filhos, tem uma chance de 50% de aparecer em qualquer
filho de suas filhas. Entretanto, não reaparecerá entre os descen-
dentes de seus filhos.
Urna filha de uma portadora tem uma chance de 50% de ser
portadora (ver Fig. 5.18) . Por acaso, um ateio recessivo ligado
ao X pode ser transmitido sem ser detectado por uma série de
mulheres portadoras antes de se expressar em um descendente
masculino.

Fig. 5.17 imunocoloração para distrofina em amostras de múscu- MULHERES HOMOZIGOTAS AFETADAS
lo (em cima) de uma mulher normal ( X 480). (meio) de um homem
com distrofia muscular Duchenne (x 480) e (embaixo) de uma mu- Um gene para um distúrbio ligado ao X ocasionalmente está
lher portadora (X 240) O músculo dos pacientes com DMD não tem presente tanto em um pai quanto uma mãe portadora, e a prole
coloração de distrofína O músculo das portadoras de DMD exibe feminina pode então ser homozigota afetada, como mostra o
tanto manchas positivas quanto negativas de imunocoloração de heredograma de daltonismo ligado ao X, um distúrbio rela-
distrofína. refletindo a inativação do X (Fotos por cortesia de K tivamente comum . A maioria das doenças ligadas ao X, en-
Arahata. National lnstitute of Neuroscience. Tokyo) tretanto, é tão rara que é muito incomum que uma mulher seja
homozigota, a menos que seus pais sejam consangüíneos
(Fig 5. 19).
afetados, mas todas as filhas receberão o cromossomo X paterno com
seu aleio de hemofilia e serão portadoras obrigatórias .
:O:ólllelll,Afet1ldo?<
..·.. .· , ·.· · . .. .
··, ' ,
:l\1wher_
· .... .. ,.
',.
Porta:d. ora;· X.ifY-
.... ,...
•'. ·. .•x·X
, .1
jrx~
.. ·-
· ·.>:l ,\: ; ;.·

IJ.01~·e.iri:~fetad~><, ~~fü~f f'i<friJi.~Ii. ~~,:~:~:l(li~i.d/L/\~:.i:;/i;·: '.'.;:: .. XH xh


Xn Xn XH/Xh xµh Filhas: 1/2 portadoras,
112 afetadas
Filhas: TODAS portadoras
y XttfY Xi/Y Filhos: 1/2 normais,
y Filhos: TODOS não-afetados 1/2 afetados
PADRÕES DE HERANÇA MONOG ÊNICA ! 61

MUTAÇÃO NOVA EM DISTÚRBIOS LIGADOS AO X


Nos homens, os genes para distúrbios ligados ao X são expostos à
seleção. A seleção é completa para alguns distúrbios, parcial para
outros e ausente para outros ainda, dependendo da adaptabilidade li
do genótipo. Os hemofílicos têm apenas cerca de 70% da prole
que os homens não-afetados. Isto é, a adaptabilidade dos homens
afetados é de cerca de 0,70. A seleção contra os alelos mutantes é
Ili
mais acentuada para os distúrbios ligados ao X, tais corno a DMD,
uma doença do músculo que afeta meninos pequenos (ver Cap.
12). O distúrbio em geral é aparente na época em que a criança
começa a andar e progride inexoravelmente, de modo que a crian- IV
ça é confinada a uma cadeira de rodas por volta dos 1Oanos e, em
geral, não sobrevive até os 20 anos.. Embora a situação possa mudar Fig. 5. 19 Consangüinidade em um heredograrna recessivo ligado
em conseqüência dos avanços nas pesquisas destinadas à terapia ao X para daltonismo verde-vermelho. resultando em urna mulher
dos meninos afetados, a DMD é dita um letal genético, pois os hornozigota afetada
homens afetados não se reproduzem. Ela pode, é lógico, ser trans-
mitida por mulheres portadoras, que raramente apresentam algu-
ma manifestação desta doença, ca distintiva de um heredograma dominante ligado ao X to-
talmente penetrante (Fig. 5.20) é que todas as filhas e nenhum
dos filhos de homens afetados são afetados . Se alguma filha
não for afetada ou algum filho for afetado, a herança deve
~ Características da Herança Recessiva ser autossômica, não-ligada ao X. O padrão de herança atra-
vés das mulheres não é diferente do padrão autossômico do-
Ligada ao X minante. Corno as mulheres têm um par de cromossomos X
como têm pares de autossomos, cada filho de uma mulher
1. A incidência da caracteristica é mais alta nos homens afetada tem uma chance de 50% de herdar a característica,
que nas mulheres. independente do sexo. Como regra geral, os fenótipos.raros
2 As mulheres heterozigotas em geral não são afetadas, dominantes ligados ao X são cerca de duas vezes mais co-
mas algumas podem expressar a condição com gravi- muns nas mulheres que nos homens, embora a expressão em
dade variável, determinada pelo padrão de inativação geral seja mais branda nas mulheres, que são quase sempre
do X. heterozigotas .
3. O gene responsável pela condição é transmitido por um Apenas alguns distúrbios genéticos são classificados como do-
homem afetado para todas as suas filhas . Qualquer fi- minantes ligados ao X. Um exemplo é o raquitismo hipofosfa-
lho de suas filhas tem um risco de 50% de herdá-lo. têmico (também chamado de raquitismo resistente à vitamina D),
4. O gene em geral nunca é transmitido diretamente do pai no qual a habilidade dos túbulos renais de reabsorver o fosfato
para o filho, mas é transmitido por um homem afetado filtrado é prejudicada Este distúrbio ajusta-se ao critério de um
para todas as suas filhas. distúrbio dominante ligado ao X, pois, embora ambos os sexos
5. O gene pode ser transmitido por uma série de mulheres sejam afetados, o nível de fosfato sérico é menos diminuído e o
portadoras. Caso isso ocorra, os homens afetados em raquitismo é menos grave nas mulheres heterozigotas que nos
uma familia são relacionados através das mulheres. homens afetados. O produto gênico defeituoso parece ser um
6. Uma proporção significativa de casos isolados deve-se membro de uma famflia de endopeptidases que ativam ou degra-
à mutação nova. dam uma variedade de hormônios peptidicos. O mecanismo pa-
togênico pelo qual uma deficiência desta endopeptidase resulta
em um distúrbio do metabolismo de fosfato e em raquitismo não
· é conhecido,
As novas mutações constituem uma fração significativa de ca-
sos isolados de muitas doenças ligadas ao X. Quando os pacien- í'
tes são afetados por uma doença ligada ao X muito grave, tal como X'/
a DMD, eles não podem se reproduzir (a seleção é completa) e,
portanto, os alelçis mutantes que eles possuem são perdidos da
população. Como·a incidência de DMD não está mudando, os
alelos mutantes perdidos pela não-reprodução dos homens afe- li
tados têm que ser continuamente substituidos por mutações no-
vas. Para a hemofilia, na qual a reprodução é diminuída mas não
eliminada, urnii fração proporcionalmente menor de casos será
causada por mutações novas O equibbrio entre as mutações novas Ili
e a seleção será mais bem discutido no Cap. 7.

Herança Dominante Ligada ao X IV fD. •


. ~· /' _
,. f. ·.... / ~' ,·
Um fenótipo ligado ao X é descrito como dominante caso Fig. 5 .20 Padrão de heredograma demonstrando herança dominan-
se expresse regularmente nos heterozigotos. A caracteristi- te ligada ao X
62 l PADRÕES DE HERANÇA MONOGÊNICA

li

Ili

Fig. 5.21 Padrão de heredograma demonstrando um distúrbio


dominante ligado ao X. letal em homens durante o período pré-
natal

Alguns dos raros defeitos genéticos expressos exclusivamente Fig.. 5.22 Eritema linear típico e bolhas em uma menina com in-
ou quase exclusivamente nas mulheres parecem ser condições continência pigmentar À medida que a criança fica mais velha. as
dominantes ligadas ao X que são letais nos homens antes do nas- lesões da pele tornam-se faixas achatadas e pigmentadas (Foto por
cimento. Os heredogramas típicos destas condições mostram a cortesia de Virginia Sybert. Unlversity of Washington. Seattle )
transmissão por mulheres afetadas, que produzem filhas afetadas,
filhas normais e filhos nonnais em proporções iguais (1: 1: 1) (Fig.
5 21 ), A incontinência pigmentar tipo 2 (IP2) (Fig. 5 22) é um
distúrbio marcante que atende a todos os critérios de um distúrbio X e Y que pode ser regularmente trocada entre os dois cromos-
dominante ligado ao X que é letal nos homens (hemizigotos). O somos sexuais, mimetizando assim uma herança autossômica A
distúrbio ocorre exclusivamente nas mulheres. Ele é caracteriza- discondrosteose, uma displasia esquelética herdada dominante-
do por exantemas da pele que começam na Jactância como um mente, com baixa estatura desproporcional e deformidade do
padrão de eritema na pele, vesículas e pústulas, que então progri- antebraço, é um exemplo de uma condição pseudo-autossômi-
dem para espessamento e hiperpigmentação e, por fim, fibrose e ca. Uma prevalência maior da doença foi vista nas mulheres, se
adelgaçamento. Microcefalia, retardo mental, dentes pequenos ou comparadas com os homens, sugerindo um distúrbio dominante
ausentes e perda de cabelo também são vistos com freqüência. A ligado ao X, mas a presença da transmissão de homem para ho-
hipótese de que a IP2 seja letal nos homens é apoiada pelo fato de mem exclui claramente a herança ligada ao X (Fig 5. 23). O gene
que são conhecidos apenas um ou dois homens gravemente afeta- responsável por esta síndrome de nanismo é um gene pseudo-
dos, e a proporção de homens para mulheres na prole de mulheres autossômico que escapa da inativação do X e codifica um fator
heterozigotas para o distúrbio é de apenas 1:2 em vez da 1: l espe- de transcrição provavelmente envolvido na regulação da estatu-
rada. Além disso, as mulheres heterozigotas têm um padrão quase ra. A deleção ou uma mutação deste gene resulta em discondros-
que totalmente não-aleatório de inativação do X, o que pode ser teose tanto em homens quanto em mulheres heterozigotas
explicado supondo-se que uma mulher heterozigota sobrevive
apenas porque o cromossomo X com a mutação responsável pela
IP2 está inativo em quase 100% de suas células. :. PADRÕES ATÍPICOS DE HERANÇA
Como regra geral, os padrões de herança e as proporções de se-
gregação dos distúrbios monogênicos estão de acordo com os
princípios da herança mendeliana Durante o século XX, desde
Características da Herança Dominante que Garrod e Bateson aplicaram pela primeira vez as leis de
Ligada ao X Mendel aos erros hereditários do metabolismo, foram observa-
das poucas exceções à herança mendeliana . Entretanto, o exame
1. Os homens afetados que se reproduzem com mulheres atento de alguns distúrbios incomuns e a análise das mutações
normais não têm filhos afetados nem filhas normais. em detalhe molecular têm mostrado que as exceções à herança
2. A prole tanto masculina quanto feminina de mulheres mendeliana ocon-em nos distúrbios monogênicos e devem ser
portadoras tem um risco de 50% de herdar o fenótipo. consideradas em genética médica. Nesta seção, descreveremos
O padrão do heredograma é o mesmo visto com a he- resumidamente situações nas quais a herança de distúrbios mo-
rança autossômica dominante, nogênicos diverge dos padrões típicos mendelianos
.3. Para fenótipos raros, as mulheres afetadas são cerca de
duas vezes mais comuns que os homens afetados, mas Padrões Incomuns de Herança Devidos ao
é típico que as mulheres afetadas tenham uma expres-
são mais branda (embora variável) do fenótipo
lmprinting Genômico
Com base nos princípios mendelianos, um alelo mutante de um
gene autossômico tem igual probabilidade de ser transmitido
por um genitor, de um dos sexos, para uma prole de um dos
PADRÕES DE HERANCA sexos De modo similar, uma mulher tem igual probabilidade
PSEUDO-AUTOSSÔMICA de transmitir o gene mutado ligado ao X para um filho de um
dos sexos Orjginalmente, pouca atenção foi dada a se o sexo
A herança pseudo-autossômica descreve o padrão de herança do genitor tinha algum efeito na expressão dos genes que cada
visto em genes da região pseudo-autossômica dos cromossomos genitor transmite Entretanto, hoje sabemos que em alguns dis·
PA DRÕES DE HERANÇA MONOGÊNICA 1 63

caracterizada por aspecto facial incomum, baixa estatura, gra-


ve retardo mental, espasticidade e convulsões (Fig 5 .26), há
uma deleção de aproximadamente a mesma região cromossô-
mica, mas no cromossomo 15 herdado da mãe. Os pacientes
li
com AS, portanto, têm a informação genética em 15qll-ql3
derivada apenas do pai. Esta circunstância incomum demons-
tra marcantemente que a origem parental do material genético
Ili (neste caso, no cromossomo 15) pode ter um profundo efeito
na expressão clinica de um defeito
Grandes deleções não são a única causa de AS. Em particu-
lar, as mutações na cópia materna de um único gene, o gene E6-
IV AP de ubiquitina-protefna ligase, foram vistas causando AS. O
gene E6-AP ubiquitina-proteina ligase está situado em 15ql 1-
Fig. 5.23 Heredograrna mostrando herança de discondrosteose q 13 e expressa-se normalmente apenas pelo alelo matemo no
decorrente de mutações em um gene pseudo-autossômico nos cro-
sistema nervoso central. As mutações em um único gene "im-
mossomos X e Y A seta mostra um homem que herdou a caracte-
rística em seu cromossomo Yde seu pai. Seu pai, entretanto. her- piintado" ainda não foram encontradas na PWS.
dou a caracterlstica em seu cromossomo X de sua mãe (De Shears Uma minoria (cerca de 30%) dos pacientes com PWS não tem
D. J. et ai ( 19981 Mutation and deletion of the pseudoautosomal gene deleções citogenéticas Em vez disso, eles têm um par intato do
SHOX cause Leri-Weill dyschondrosteosis Nat Genet 19:70·73) cromossomo 15, ambos herdados da mãe (ver Quadro 5.3). Em
contraste, apenas uma pequena minoria dos pacientes com AS
(cerca de 3% a 5%) tem dois cromossomos 15 intatos de origem
paterna Esta situação incomum, chamada de dissomia unipa-
túrbios genéticos a expressão do fenótipo da doença depende rental (ver a seção que se segue), confirma que a PWS e a AS
de se o alelo mutante foi herdado do pai ou da mãe. As diferen- resultam da perda da contribuição paterna e materna de genes em
ças na expressão gênica entre o alelo herdado da mãe e o alelo 15ql l ·q l3, respectivamente
herdado do pai resultam de impri11ting genômico. O imprin- Além da deleção cromossômica e da dissomia uniparental,
ting é causado por uma alteração incompletamente compreen- alguns pacientes com PWS e AS parecem ter um defeito no pró-
dida na cromatina que afeta a expressão de um gene, mas não prio centro de imprinting (ver Quadro 5.3). Como resultado, a
sua seqüência de DNA Assim, é uma forma reversfvel de ina- mudança de imprinting de feminino para masculino durante a
tivação gênica, mas não é uma mutação. espermatogênese ou de masculino para feminino durante a ovo-
Um tipo importante de imprinting ocorre durante a gameto- citogênese (ver Fig. 5.24) não ocorre A fertilização por um es-
gênese, antes da fertilização, e marca alguns genes como ten- permatozóide levando um imprint feminino anormalmente per-
do vindo da mãe ou do pai Após a concepção, o imprint supri- sistente produziria uma criança com PWS. A fertilização de um
me a expressão do alelo "imprintado" em alguns ou em todos ovócito portador de um imprint masculino impropriamente per-
os tecidos somáticos do embriao e mesmo no período pós-na- sistente resultaria em AS.
tal, na vida adulta, ao longo de centenas de divisões celulares
Entretanto, o imprinting deve ser reversível: um alelo paterna-
01SSOMIA UNIPARENTAL
mente "imprintado", quando herdado por uma mulher, deve ser
convertido em sua linhagem germinativa, de modo que ela en- A dissomia uniparental é definida como a presença de uma li-
tão possa transmiti-lo com um imprint materno para a sua pro- nhagem celular dissõmica contendo dois cromossomos, ou par-
le. Similarmente, um alelo maternamente "imprintado", quan- tes deles, herdados de um genitor. Se o cromossomo idêntico
do herdado por um homem, deve ser convertido em sua linha- estiver presente em duplicata, a situação é desc1ita como uma
gem germinativa, de modo que ele possa ser transmitido como isodissomia . Se ambos os homólogos de um genitor estiverem
paternamente "imprintado" para sua prole (Fig. 5.24) . O con- presentes, a situação é uma heterodissomia
trole deste processo de conversão parece ser governado por um Até quase o final da década de 1980, a dissomia uniparen-
elemento do DNA chamado de centro de imprillti11g, situado tal era desconhecida, mas agora que as técnicas da genética
na própria região "imprintada". molecular permitem que a fonte parental dos cromossomos
seja prontamente identificada, ela foi documentada em vári-
SÍNDROMES DE PRADER-WILU E ANGELMAN
os distúrbios clínicos além da PWS e AS. Por exemplo, dois
pacientes com CF e baixa estatura foram descritos com duas
Talvez os exemplos mais bem estudados do papel do imprin- cópias idênticas da maioria ou de todo o cromossomo 7 ma-
ting genômico em doenças humanas sejam a síndrome de temo.. Em ambos os casos, a mãe era portadora de CF, e como
Prader-Willi (PWS) e síndrome de Angelrnan (AS). A PWS a criança recebeu duas cópias maternas do gene CF mutante
é uma síndrome dismórfica relativamente comum, caracterizada e nenhuma cópia paterna do gene CF normal, a criança de-
por obesidade, hábitos alimentares indiscriminados e excessi- senvolveu a doença. A falta de crescimento não foi explica-
vos, mãos e pés pequenos, baixa estatura, hipogonadismo e da, mas pode estar relacionada com a perda de genes paterna-
retardó men~al (Fig. 5 .25). Em cerca de 70% dos casos da sín- mente "imprintados" não-identificados no cromossomo 7. A
drome, há uma deleção citogenética (ilustrada no Cap . 9, Fig. dissomia uniparenta l para uma parte do cromossomo 11
9.5H) envolvendo o braço longo proximal do cromossomo 15 (l lpl 5) está implicada na síndrome de Beckwith-Wiede-
( 15q 11 -q 13 ), ocorrendo no cromossomo 15 herdado do pai do mann . As crianças afetadas são grandes ao nascimento e têm
paciente (Quadro 5.3) Assim, os genomas destes pacientes têm língua aumentada, bem como freqüente protrusão do umbi-
a info1rnação genética em 15q l l -q 13 derivada apenas da mãe. go Uma grave hipogliceµlia é uma complicação que ameaça
Em contraste, em cerca de 70% dos pacientes com a rara AS, a vida, da mesma forma que as malignidades dos rins , das
64 ' PADRÕES DE HERANÇA MONOGÉNICA

~ Cromos. 15 ~ ~ ~Homem
~mp,m~tomo l) ' M ulher

Cromos 15
Fertilização 1+--i--com imprint
materno

Concepção

Desenvolvimento
embrionário/fetal

Tecido somático

Gametas masculinos Gametas femininos

Fig. 5 24 Diagrama da conversão de material e impri111i11g materno e paterno durante a passagem pela linhagem germinativa para fazer gametas
masculinos e femininos O apagar do impri11I uniparental em um cromossomo e a conversão para o il11pri11t do outro sexo é marcado por•

Fig. 5.25 Síndrome de Prader-Willi Esquerda Face típica de um menino de 9 anos afetado (De Pettigrew A l . Gollin S M , Greenberg F.
et ai l 19871 Duplication of proximal l 5q as a cause of Prader-Willi syndrome Am 1Med Genet 28:791-802 Copyright© 1990 Wiley-liss.
lnc Reimpresso por permissão de John Wiley and Sons. lnc) Direita . Obesidade. hipogonadismo e mãos e pés pequenos em um menino
de 9.5 anos afetado. que também tem baixa estatura e retardo de desenvolvimento (De lones K L J19881 Smith-s Recognizable Patterns
of Human Malformation. 4 • ed WB Saunders. Philadelphia. p 173)
PADRÕES DE HERANÇA MONOGÊNICA 1 65

QUADRO 5-3
· ~-~~~nismcis 'Mol_~<:Ula'res CaiJsadores·'d_a s' Síndroµl~s-'de Prader-Willí e Arigelmà,n'_·~·~::- '' .XNf:!.[~;\\:. :::·/:·: .'..\.
' -~ ...;· - .'•

........ .. . ,.,. . ... -- . - .. si~d~~~~-de ·P~:ad~r-Willi . .. .. ..:.:Síndr~~~-d~Angelman


'. '
'·: ~.·: ~: i ~t\' /=~:~·: ~

Deleção !Sql l-ql3 :±: 70% (paterna) :±: 70% (materna)


Dissomia uniparental :±: 30% (materna) de 3% a 5% (paterna)
Mutação monogênica ND E6-AP ubiquitina-proteína ligase
(de 2% a 4% do total, mas vista só
em casos familiares)
Mutação no centro de impriwing 1%-2% 7%-9%
Outros ND 10%-20%
ND = nenhuma detectada
Dados de Jiang Y., Tsai T. F., Bressler J. Beaude1 A L. ( 1998) Imprinting in Angelman and Prader-Willi syndromes. Curr Opin Genet Dev 8:334-342 and Nicholls
R D, Saitoh S, Horsthemke B (1998) lmprinting in Prader-Willi and Angelman syndromes Trends Gene! 14:194-200

supra-renais e do fígado . A condição resulta de um excesso Mosaicismo


de contribuição de genes paternos ou perda de maternos, ou
ambos, no cromossomo l l p 15, incluindo o gene do fator 2 de O mosaicismo é definido como a presença em um indivíduo ou
crescimento similar à insulina A dissomia uniparental tam- em um tecido de pelo menos duas linhagens celulares que dife-
bém pode envolver os cromossomos sexuais, como mostrou rem geneticamente, mas são derivadas de um único zigoto Em-
um caso relatado de transmissão de pai para filho de hemofi- bora em geral pensemos em nós mesmos como sendo compos-
lia A, no qual um menino afetado herdou seus cromossomos tos de células que possuem exatamente o mesmo complemento
X e Y do pai, sem contribuição de cromossomo sexual da mãe. de genes e cromossomos, isto, na verdade, é um conceito muito
' Embora seja muito cedo para dizer se a dissomia uniparental simplificado. Já introduzimos o conceito de mosaicismo devido
é uma raridade interessante ou um fenômeno relativamente co- à inativação do X que gera duas populações diferentes de célu-
mum, existem várias regiões no genoma que mostram evidência las somáticas nas mulheres, aquelas em que o X paterno é o cro-
de imprinti11g genômico (ver Fig. 9.13). Os médicos e consulto- mossomo ativo e aquelas em que o X matemo é o cromossomo
res genéticos devem ter o impri!!ling em mente como uma pos- ativo. De modo mais geral, as mutações que surgem em células
sível causa de distúrbios genéticos, especialmente nos casos de únicas na vida pré-natal ou pós-natal podem originar clones de
distúrbios autossômicos recessivos nos pacientes que têm ape- células geneticamente diferentes do zigoto original (Fig. 5.27).
nas um genitor portador documentado ou nos casos de distúrbi- O mosaicismo é um fenômeno clirucamente impottante nos dis·
os ligados ao X transmitidos de pai para filho ou expressos sob a túrbios cromossômicos (ver Cap. 9), e a mutação somática é re-
forma homozigota nas mulheres. conhecida como a principal causa de muitos tipos de câncer (ver

Fig. 5.26 Síndrome de Angelman em uma menina afetada de 4 anos Notar a abertura e a posição dos braços Comparar com o fenótipo
da síndrome de Prader-Willi na Fig 5 25 Ver o texto para discussão. (Foto por cortesia de lan M Friedman De Magenis R E , Toth-Fejel
S . Allen L 1 . el ai 11990 J Comparison of the l Sq deletions in Prader-Willi and Angelman syndromes: specific regions extent of deletions.
parental origin and clinica! consequences Am 1Med Genet 35:"333-349 Copyright © 1990. Wiley-Liss. lnc Reimpresso com permissão
de lohn Wiley and Sons. lnc J
66 ' PADRÕES DE HERANÇA MONOGÊN ICA

Cap. 16). O mosaicismo para mutações de genes únicos, de cé- possa ocorrer mais de uma vez em uma prole é muito baixa,
lulas somáticas ou germinativas, parece ser uma explicação pro- pois as mutações em geral são raras (da ordem de 1 chance em
vável para várias observações clínicas incomuns. 105 a 106 ), e ter duas que ocorram independentemente nomes-
mo gene na mesma farru1ia é muito improvável. É freqüente,
MOSAICISMO SOMÁTICO portanto, informar os genitores de um filho que aparentemente
possui uma mutação nova de que a chance do mesmo defeito
Uma mutação que afeta a morfogênese e ocone durante o de- surgir em um filho subseqüente é desprezível, equivalente ao
senvolvimento embrionário pode se manifestar como uma ano- risco populacional. Existem, entretanto, raras exceções nas
malia segmentar ou em trechos, dependendo do estágio no qual quais os genitores que são fenotipicamente normais têm mais
a mutação ocorreu e da linhagem de células somáticas nas quais de um filho afetado. Supondo-se que os genitores não foram
se originou. Se ocorrer em um estágio inicial, antes da separa- incorretamente diagnosticados como homozigotos fenotipica-
ção das células germinativas das somáticas, ela estará presente mente normais devido à expressividade variável ou à penetrân-
em ambas as linhagens e, portanto, será u·ansmitida para a prole cia reduzida da doença, tais heredogramas incomuns podem ser
em sua forma completa, bem como será expressa somaticamen- explicados por mosaicismo na linhagem germinativa. Durante
te em forma de mosaico. o início do desenvolvimento do genitor, uma mutação somáti-
A NFl às vezes é segmentar, afetando apenas uma parte do ca ocorreu em uma célula da linhagem germinativa ou precur-
corpo. Em tais casos, o paciente tem genitores normais, mas se
sora, persistiu em todas as descendentes clonais desta célula e,
tiver um filho afetado, o fenótipo da criança será típico de NF l,
eventualmente, atingiu uma proporção dos gametas (ver Fig.
isto é, não-segmentar. A possível causa da NFI segmentar é uma
5.27). Existem cerca de 30 mitoses nas células da linhagem
mutação em uma ancestral da célula somática do segmento afe-
germinativa antes da meiose na mulher e várias centenas no
tado.. Nos casos nos quais a NFl é transmitida geneticamente por
um paciente que tem a forma segmentar, entretanto, a mutação homem, criando uma grande oportunidade para que ocorram
deve ter ocorrido antes da separação das células germinativas das mutações durante os estágios mitóticos do desenvolvimento dos
somáticas que possuem a mutação. gametas (ver Cap. 2).
O mosaicismo somático também foi documentado em vários Agora que o fenômeno de mosaicismo da linhagem germi-
distúrbios ligados ao X tanto em homens quanto em mulheres. nativa foi reconhecido, os geneticistas estão cientes da poten-
Um exemplo marcante é o caso da disfunção do ciclo hepático cial imprecisão em prever que um fenótipo autossômico do-
da uréia devido a uma deficiência da enzima ornitina transcar- minante específico que aparece em cada teste seja urna muta-
bamilase (OTC) em um menino com uma forma branda incomum ção nova, tendo um risco desprezível de recorrência na prole.
do distúrbio. Os estudos moleculares demonstraram que o me- O mosaicismo de linhagem germinativa está bem documenta-
nino tinha mosaicismo somático para uma deleção no gene OTC. do em até 6% das formas graves e letais do distúrbio autossô-
O mosaicismo somático também foi relatado para a hemofilia A mico dominante osteogênese imperfeita (Fig. 5 .28) (ver Cap .
e a DMD em mulheres que transmitem a mutação e, portanto, 12), no qual as mutações nos genes de colágeno tipo l levam
devem ter tido um mosaicismo de linhagem germinativa, bem a um colágeno anormal, ossos frágeis e fraturas freq üentes. Os
como somático. heredogramas que podem ser explicados por mosaicismo na
linhagem gerrninativa foram relatados para vários outros dis-
M OSAIC!SMO DE L INHAGEM GERMINATIVA
túrbios bem conhecidos, tais corno a hemofilia A e B e a DMD,
mas não têm sido vistos em outras doenças dominantes, tais
Como já foi discutido neste capítulo, a chance de que um dis- como a acondroplasia. A medida precisa da freqüência de mo-
túrbio decorrente de uma nova mutação autossômica dominante saicismo de linhagem germinativa é difícil, mas as estimati-

)\
~~~i\
®® ®® ®®
@@ @@
Células mutadas

F~g. 5.27 Ap_r~sentação esquemática das divisões celulares mitóticas Uma mutação que ocorre durante a proliferação celular. em
celul~s s~rnat1cas ou durante a gametogênese. leva a uma proporção de células com a mutação. isto é. a uma mutação somática ou
germmat1va
PADRÕES DE HERANÇA MONOGÊNICA 67

RESUMO
Uma determinação precisa do heredograma familiar é uma par-
3 te importante do trabalho com cada paciente. Os heredogramas
li podem demonstrar um padrão direto, típico de herança mendeli-
ana, ou um padrão mais atípico, como visto no imprinting, nas
mutações mitocondriais e no mosaicismo germinativo. Determi-
nar o padrão de herança não só é importante para fazer um diag-
Ili nóstico do probando, mas também identifica outros indivíduos
Fig. 5. 28 Heredograrna demonstrando a recorrência do distúrbio
na familia que podem estar em risco e precisam de avaliação e
autossôrnico dominante osteogênese imperfeita Ambas as crian- informação. A despeito dos sofisticados testes citogenéticos e
ças afetadas têm a mesma mutação de ponto em um gene de colá- moleculares disponíveis aos geneticistas, uma história familiar
geno Seu pai (seta) não é afetado e não tem tal mutação no DNA precisa, incluíndo o heredograma familiar, ainda é um instrumen-
dos tecidos somáticos examinados Ele deve ter sido um mosaico to fundamental para os médicos e consultores genéticos usarem
para a mutação em sua linhagem germinativa nos cuidados de seus pacientes.

Referê1tcias Gerais
vas sugerem que a mais alta incidência encontrada hoje em dia
é na DMD, na qual de 14% a 15% das mães de casos isolados Jones KL (1996) Smích's Recognízable Panerns of Human Malfor-
mation, ;eh ed. WB Saunders, Philaddphia.
não apresentam evidência de mutação em seus tecidos somá- McKusick VA (1998) Mendelian lnherirance in Man: Carnlogs
ticos e possuem a mutação em sua linhagem germinativa. As- of Human Genes and Genetíc Disorders, 12ch ed Johns
sim, nas doenças conhecidas como apresentando mosaicismo Hopkins Universíty Press, Baltimore. See online version at
de linhagem germinativa, os pais fenotipicamente normais de bttp:Ihvww.rubi nlm .nib.govl0111i111I.
uma criança cuja doença é tida como sendo devida a uma nova Rimoin DL, Connor JM, Pyerírz RE (1997) Emery and Rímoins
Principies and Practice of Medical Genetics, 3rd ed. Churchill
mutação devem ser informados de que o risco de recorrência Lh'ingstone, Edinburgh.
não é despreziveL O risco exato de recorrência é, entretanto, Scriver CR, Beaudet AL, Sly WS, Valle D (eds) (2000) The Meta-
difícil de avaliar porque depende de em que proporção osga- bolic and Molecular Bases of Inherited Oisease, Sth ed
metas contêm a mutação De modo mais geral, os genitores .\ltcGraw-Hill, New York.
Vogel F, Morulsky AG (1997) Human Genetics: Problems and
aparentemente não-portadores de uma criança com um distúr- i\pproaches, 3rd ed. Springer-Verlag, New York
bio autossômico dominante ou ligado ao X no qual a ocorrên-
cia de mosaicismo seja desconhecida também podem ter al-
gum risco de recorrência, que pode ser tão alto quanto 3% a Referências Especi1icas aos Tópicos Particulares
4% Estes casais devem receber um teste diagnóstico pré-na-
Baird PA, Andersen TW. Newcombe HB, Lowry RB (1988) Ge-
tal que seja apropriado. netic disorders in childrcn and young adules: A population
srudy. Anl] Hum Genet 42:677-693.
Cassidy SB, Schwmz S (1998) Prader-Willi and Angelman syn-
Herança Materna de Mutações Mitocondriais dromcs, disorders of genomic imprinting. Medicine
77: 140-1 51
O cromossomo mitocondrial (mtDNA) é uma molécula circu- Co~ta 1 ; Scriver CR, Chílds B ( 1985) The effect of mendelian dis-
lar de aproximadamente 16,5 kb situada na organela mitocôn- ease on human health: A measurcment Am J Mcd Genet
dria, não no núcleo, como desccito no Cap. 3. Duas caracterís- 21 :2.3 1-242.
ticas incomuns das mitocôndrias resultam em um padrão dife- Jíang Y, Tsai TF, Bressler J, Bcaudcc AL (1998) Imprinting in An-
gelman and Prader· Willi syndromes. Curr Opin Gener Dev
rente de doenças causadas por mutações no mtDNA. Primeira, 8:334-H2.
o ovócito, e não o espermatozóide, fornece ao zigoto todas as Nicholls RD, Saitoh S, 1-lorsthemke B (1998) lmprinting in
suas mitocôndrias. Em conseqüência, uma mãe portadora de Prader-Willi and Angelman syndromcs Trends Genet
uma mutação no mtDNA transmitirá a mutação para toda a sua 14:194- 200.
prole, enquanto um pai portador da mesma mutação não a pas- Shoffncr JM, Wallace DC (1992) Mitochondrial genetics: Princi-
pies and practice. Amj Hum Genet 51:1179-1186.
sará para ninguém. Os defeitos no mtDNA demonstram, por- Smahi A, Courrois G, Vabres P, et ai (2000) Genomíc rearrange-
tanto, uma heranÇa materna . Outra característica única do mem in NEMO ímpairs NF-kappaB activacion and is a cause of
cromossomo mitocondrial é a ausência da segregação rigida- incontinencia pigmenci. Nacure 405:466-472
mente controlada vista em cromossomos no genoma nuclear. Zlotogora J (1998) Germ line mosaicism. Hum Genet
102:381-386
Na divisão celular, o mtDNA replica-se e é dist1ibuído aleato-
riamente entre as novas mitocôndrias sintetizadas, que por sua
vez são distribuídas aleatoriamente entre as duas células filhas .
Cada célula filha pode receber proporções muito diferentes de Problemas
mitocôndrias levando mtDNA normal e mutante (ver Fig .
12.33 ). Como as mitocôndrias funcionam quase essencialmente f Cathy está grávida pela segunda vez. Seu primeiro filho, Donald, tem
em todas as células e a expressão fenotípica de uma mutação CF. Cathy tem dois irmãos, Charles e Colin, e uma irmã, Cindy, Colin
e Cindy são solteiros Charles é casado com uma mulher não-aparenta-
no mtDNA depende das proporções relativas de mtDNA nor-
da, Carolyn, e tem uma filha de 2 anos de idade, Debbie Os pais de Cathy
mal e mutante nas células que constituem tecidos diferentes, a são Bob e Betty A irmã de Beny, Barbara, é a mãe do marido de Cathy,
penetrância reduzida, a expressividade variável e a pleiotropia Calvin, que tem 25 anos. Não há histó1ia familiar prévia de CF.
são características típicas dos heredogramas de distúrbios mi- (a) Faça o heredograma, usando os símbolos padrão.
tocondriais . As doenças causadas por mutações no mtDNA (b) Qual o padrão de transmissão da CF e qual o risco de CF para
serão discutidas em detalhes no Cap. 12. o próidmo filho de Cathy?
68 1 PADRÕES DE HERANÇA MONOGÉNICA

(c) Como o risco de CF nos primos em primeiro grau de Donald análise molecular mostra que ambos os pacientes têm grandes
compara-se ao risco da população de 1/2 000? deleções no gene de distrofina, que codifica a proteína que está
_ (d) Que pessoas neste heredograma são heterozigotos obrigatórios? deficiente ou defeituosa nos tipos Duchenne e Becker de dis-
trofia muscular
2. George e Grace, que têm audição normal, têm 8 filhos. Duas de (i) Descobre-se que um paciente com um distúrbio recessivo her•
suas 5 filhas e 2 de seus 3 filhos são congenitamente surdos Outro dou ambas as cópias de um cromossomo do mesmo genitor e
casal, Harry e Helen, ambos com audição normal, também têm 8 nenhum representante deste cromossomo do outro genitor
filhos; 2 de suas 6 filhas e 1 de seus 2 filhos são surdos Um tercei- G) Uma criança com doença da urina em xarope de bordo nasce
ro casal, Gilbert e Gisele, que são congenitamente surdos, têm 4 de genitores que são primos em primeiro grau
filhos, também surdos Sua filha Hedy casou-se com Horace, um
filho surdo de George e Grace, e Hedy e Horace, por sua vez, têm Quais dos conceitos citados a seguir são ilustrados pelas situa-
4 filhos surdos. Seu filho mais velho, Isaac, casou-se com Ingrid, ções descritas anteriormente?
uma filha de Harry e Helen Embora tanto Isaac quanto Ingrid se- Expressividade variável
jam surdos, todos os seus 6 filhos têm audição normal. Faça o he- Dissomia uniparental
redograma eresponda às perguntas que se seguem. (Pista: quantos Consangüinidade
tipos diferentes de surdez congênita estão se segregando neste he- Endogamia
redograma?) Herança dominante ligada ao X
(a) Cite os prováveis genótipos das crianças na última geração. Mutação nova
(b) Por que todos os filhos de Gilbert e Gisele e de Hedy e Horace Heterogeneidade alélica
são surdos? Heterogeneidade de Jocus
Homozigose para uma característica autossômica domi-
.3 Considere as seguintes situações: nante
(a) A retini te pigmentosa ocorre nas formas ligada ao X e autossô- Pleiotropia
rnica
(b) Dois genitores têm um caso típico de hipercolesterolemfa fa- CJDon e seu avô materno, Bany, têm hemofilia A. Diane, mulher de
núliar diagnosticada com base na hipercolesterolemia, arcu.s Don, é a filha de sua tia materna Don e Diane têm um filho, Edward,
comeae, xantomas tendinosos e demonstram deficiência de e duas filhas, Elise e Emily, todos com hemofilia A Também têm
receptores de LDL, juntamente com uma história famíliar do uma filha não-afetada, Enid.
distúrbio Eles têm um filho que teve um nível plasmático de (a) Faça o heredograma
colesterol muito alto ao nascimento e dentro de alguns meses (b) Por que Elise e Emily são afetadas?
desenvolveu xantomas e aterosclerose generalizada. (c) Qual a probabilidade de que um filho de Elise seja hemofílico?
(c) Um casal com visão normal, de uma comunidade isolada, teve Qual a probabilidade de que sua filha seja hemofílica?
um filho com atrofia de giro autossômica recessiva da retina (d) Qual a probabilidade de que um filho de Enid seja hemofílico?
A criança cresceu, casou-se com outro membro (com visão E uma filha?
normal) da mesma comunidade e teve um filho com o mesmo 5 Nasceu um menino com várias malformações, mas que não tem uma
disttlrbio ocular. síndrome reconhecível Os genitores não são parentes e não há his-
(d) Uma criança tem uma grave neurofibromatose (NFl). Seu pai tória familiai· de uma condição similar. Qual das condições que se
é fenotipicamente normal; sua mãe parece clinicamente normal, seguem poderia explicar a situação? Quais são improváveis? Por quê?
mas tem várias áreas café-au-lair e áreas de hipopigmentação, (a) Herança autossômica dominante com mutação nova
e o exame de làmpada de fenda mosu·a que ela tem alguns nó- (b) Herança autossômica dominante com penetrância reduzida
dulos de Lisch (crescimentos hamattomatosos na íris que são (c) Herança autossômica dominante com expressividade vaiiável
comuns nas pessoas com NFl) (d) Herança autossômica recessiva
(e) Pais de estatura normal têm um filho com acondroplasia. (e) Herança recessiva ligada ao X
(f) Um homem adulto com distrofia miotônica tem catarata, cal-
(f) Herança autossômica dominante, erro de paternidade
vície frontal e hipogonadismo, além de miotonia.
(g) Ingestão materna de uma droga teratogênica em um estágio
(g) Um homem com raquitismo resistente à vitamina D transmite
sensível do desenvolvimento embrionário
a condição para todas as suas filhas, que têm uma forma da
doença mais branda que seu pai. Nenhum de seus filhos é afe- i 6; Um casal tem um filho com NFI. Ambos os genitores são clinica-
tado. As filhas têm aproximadamente números iguais de filhos ,. · mente normais e nenhuma das famílias apresenta uma história fa-
não-afetados, filhos afetados, filhas não-afetadas e filhas afe- miliar positiva
tadas.Os filhos afetados são mais gravemente afetados que suas (a) Qual a explicação provável para a NFI em seu filho?
irmãs afetadas. (b) Qual o risco de recorrência em outros filhos deste casal?
(h) Um menino teve distrofia muscular progressiva com início no (c) Se o marido tivesse ouuo filho com outra mulher, qual seria o
começo da infância e ficou em cadeira de rodas por volta dos risco de NF l?
12 anos. Um homem não-aparentado também tem distrofia (d) Qual o risco de que alguém na prole do afetado também tenha
muscular progressiva, mas ainda está andando aos 30 anos . A NFI?
Variação Genética em Indivíduos:
Mutação e Polimorfismo
Este capfrulo é um dos vários nos quais exploraremos a natureza das ções podem ser classificadas em três categorias: as mutações
diferenças geneticamente determinadas entre as pess~as. Embora a q~~-i!f~_tam o número de cromossom<?s na célula (mutações ge-
base das diferenças fenotípicas possa ser ou mudanças genéticas f!Ômi<::is), as mu_taçõe~ que alteram a es~tur.a _cl~CJOffiOSSO­
codificadas no DNA ou diferenças não-genéticas no ambiente, nes- mos individuais (mutações cromossômicas) e as mutações que
te capítulo lidaremos com as diferenças permanentes entre as pes- ~t.~r!lm.&e_n.~§._igdjyj9ua!~.(IB!l_tªç_9_~s_g~n!_c~) (Quadici'6~-f)~-Ãs
soas nas seqüências de nucleotídeos de seus genomas e o efeito destas lll.Utaç.Q.~genômicas são alterações no número de cromosso-
diferenças, se é que alguma, no fenótipo A seqüência do DNA nu- mos intatos (chamadas aneuploidias) que sµrge_rn de erros d~
clear é quase 99,9% idêntica entre quaisquer dois seres humanos . É _sJ<greg~ção..f.!Q!l!..OS.~ômi<;'.<1__g_!:!_ral}t~~--nJ~iose ou mitose. As
exatamente esta pequena fração de seqüências de DNA que é dife- mutações cromossômicas são desequilíbrios que envolvem
rente entre as pessoas que é responsável pela variabilidade geneti- apenas uma parte de um cromossomo, tais como as duplicações,
camente deterntinada entre os humanos. Logicamente, algumas di- deleções, inversões e translocações, que podem ocorrer espon-
ferenças de seqüência de DNA têm pouco ou nenhum efeito no f~­ taneamente ou podem resultar da segregação anormal de cro-
nótlpo, enquanto outras diferenças são diretamente responsáveis por mossomos translocados durante a meiose. As mutações gêni-
causar doenças. Entre estes dois extremos está a variação responsá- ç-ªs são m'!f!!fil~~ seqüência de DNA, que variam de apenas
vel pela variabilidade fenotípica geneticamente deterntinada na ana- um único nucleotídeo a mudanças que podem afetar muitos
tomia, na fisiologia, nas intolerâncias dietéticas, nas respostas tera- milhares de pares de bases, mas sempre em uma escala muito
pêuticas ou nas reações adversas a medicações, na suscetibilidade à pequena para ser vista mesmo com a análise citogenética de alta
infecção, na predisposição ao câncer e mesmo na variabilidade em resolução.
várias caracteristicas de pen;onalidade, aptidão atlética e talento ar- Uma mutação genômica que deleta ou duplica um cromosso-
tístico. Um dos importantes conceitos da genética humana e médi- mo inteiro altera a dosagem e, portanto, os níveis de expressão
ca é que a doença genética é a manifestação mais óbvia, e em geral de centenas ou milhares de genes. Similarmente, uma mutação
a mais extrema, das diferenças genéticas, superposta sobre um nm- cromossômica que deleta ou duplica grandes partes de um ou
do de variabilidade genética totalmente normal. mais cromossomos também pode afetar a expressão de milhares
de genes. Mesmo uma pequena mutação gênica pode ter gran-
des efeitos, dependendo de que gene foi alterado e de que efeito
MUTAÇÃO a alteração tem na expressão do gene. Uma mutação gênica que
A Natureza da Mutação Humana consista na mudança de um único nucleotídeo na seqüência co-
dificante de um determinado gepe pode levar a uma perda com-
A mutação é definida como qualquer mudança na seqüência de pleta de expressão do gene ou à formação de uma proteína vari-
nucleotídeos ou arranjo do DNA Em termos amplos, as muta- ante com propriedades alteradas. As mudanças fenotípicas produ-

QUADRO 6-1
Tipós dE! Mutaçõt;?S e .suas Freqüências Estimàdas· >>·
..-_ - ·. -: -·
. ·. . . ..; . -. . ..
" .·- .:
- ; ;. .: . . ·. :. ··. ':.-.... ·.: : ~', ~ - .
.'. .. , }... . ·.. '... .
Classe de Mutação Mecanismo Freqüência (Aproximada) Exemplos
Mutnção genômica Não-disjunção dos cromossomos 10-2/divisão celular Aneuploidia
Mutação cromossômica Rearranjo cromossômico 6 X 10-•/divisão celular Trans locações
Mutação gênica Mutação de par de bases 10- 10/par de bases/divisão celular Mutações de ponto
10- s 10- 6/locus/geração
TECA
Baseado cm Vogel F . Moiulsky A G (1997) Human Genelics, 3 'ed. Spdnger-Verlag, Berlim.
UN1PA0
n e cne.a
UtJ"7 uo
70 ' VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO

zidas pelas mutações gênicas serão consideradas em detalhes nos


Caps. 11e 12
Normal ~
Akll!!H\~.A'lg_~.l!ill..!lQ...DN~,_~ntr:.~tanto, podem não ter e A T T e A e e T G T A e e A
efeito.fenotípic.Q Um!LI!lll_tf!Ç~º _ç:~_Q!!!Q§Sômica pode não afe- G T A A G T G G A e A T G G T
tar:.uma parte.crucial do genoma e pode nãoter ne.nhl!Il1 e fei-
Substituição
tofenotípico. Urna mutação dentro de um gene pode não ter
nenhum efeito porque a mudança não altera a seqüência pri-
1 1 1
)
1 1 1 1 ' 1 1 1 1 1 1 1: 1 1 1
1
1
mária de aminoácidos de um polipeptídeo ou porque, mesmo e A T : G e A:C e T : G T A ! C e A!
que o faça, a mudança resul tante na seqüência do aminoácido G T A!C G T! G G A!C A T!G G r:
codificado não alt~r.a a~ propriedades func ionais do polipep- '
tídeo Nem todas as mutações, pottanto, têm conseqüências
clínicas . Deleção
1 1 1.
1
i 1 1 1 1 1 1 1 1 1 1 1 1
Todos os três tipos de mutação ocorrem em freqüências apre-
e A r : e A e e T G T A e e A G
ciáveis em muitas células diferentes. Se uma mutação ocmrer no G T A:1 G T G G A e A T G G T e
DNA de células que irão popular a linhagem germinativa, a
mutação será uma mudança herdável, que pode ser passada adi-
ante para as gerações futuras Em contraste, algumas mutações "'
~ ~\"""<>-
Inserção
- as mutações somáticas - ocorrem apenas por acaso em um 1 1 1 ; 1 1 1
1
1 1 1 1
1
1 1 1 '
1

ê1t
1 1

subgrupo de células de apenas alguns tecidos e resultam em e A T ! G T C;A e G T:A e e:


mosaicismo somático, corno visto, por exemplo, em muitos ca- G T A!c A GiT G G!A e A!T G G: 1

sos de câncer. As mutações somáticas n~_QJ10dem ser transmiti-


das pani a geração seguinte'. \
0~

A Origem das Mutações -· Fig. 6.1 Exemplos de mutações gênicas A primeira base do segun-
do códon está mutada por uma substituição de base. deteção ou
MUTAÇÕES GENÕMICAS inserção Tanto a deleção quanto a inserção de um só par de bases
leva a urna mudança de matriz de leitura. na qual o molde de tra-
Como discutiremos ao longo do Cap. 9, a má segregação de um dução é alterado Ver o texto para discussão
par cromossômico durante a meiose causa mutações genômicas
responsáveis por condições tais como a trisscimia do 21 (síndro-
me de Down). As mutações genômicas produzem aneuploidia
cromossômica e sã.o_as_mulaçõ.e.s.urn.is ç_cmums._vistas ~J.!l_§_er:~~ Erros de Re plicação do DNA. A grande maioda dos erros
hymanQ.$. (ver Quadro 6.1), com uma taxa de um evento de má de replicação é rapidamente removida do DNA e corrigida por
segregação por 25 a 50 divisões de células meióticas (ver Cap. uma série de enzimas de reparo do DNA que primeiro reconhe-
9). Esta estimativa é claramente o mínimo, pois as conseqüênci- cem que filamento na dupla hélice recém-sintetizada contém a
as desenvolvimentais de muitos destes eventos podem ser tão base incorreta e então a substitui pela base complementar apro-
graves que os fetos aneuplóides resultantes são espontaneamen- priada, um processo chamado de "revisão". A replicação do DNA
te abortados logo após a concepção sem que s~jam detectados. (ver Fig . .34) precisa ser um processo extremamente preciso, pois
/:).s mµt11çõe.s genô.n;iiç:as. também são muito comuns nas células mesmo que as mutações sejam in::roduzidas apenas uma vez a
cancerosas (ver Cap. 16). cada milhão de pares de bases, a carga da mutação sobre o orga-
nismo seria intolerável, e nossa espécie não existiria mais Na
verdade, a maquinaria de replicação do DNA faz mais do que
MUTAÇÕES CROMOSSÔMICAS
gerar uma mutação a cada milhão de bases . Por meio de uma
As mutações cromossômicas ocorrem com muito menos fre- combinação de regras estritas de pareamento de bases (A pare-
qüência que as mutações genômicas, ocorrendo a uma taxa de ando com T e C com G) e revisão molecular, a enzima DNA
cerca de um rearranjo por 1.700 divisões celulares. Embora as polimerase duplica fielmente a dupla hélice, embora introduza
freqüências das mutações genômicas e cromossômicas possam um nucleotídeo incorreto em um dos filamentos filhos em cres-
parecer altas, ~stas mutaç_ões raramente sã9 perpetuadas de uma cimento a cada 1O milhões de pares de bases (isto enquanto se
geração.par:a a.seguinte, pois, em geral, são incompatíveis com move ao longo de um cromossomo humano a uma velocidade
_a sobrevida ou a reprodução normal. As mutações qoJIIO§SÔ- de cerca de 20 pares de bases por segundo!). Uma verificação
raj_cÊ.§.1.am!2é.m_sªº-YÍ.SJªs.fü;_q_ü..enJement~ niis c;élu.las ci,m_
c ero- adicional dos erros de replicação corrige então mais de 99,9%
sas (ver Cap 16) dos erros de replicação do DNA . Assim, a taxa geral de mutação
como um resultado de erros de replicação é tão baixo quanto lo- •o
MUTAÇÕES GÉl~ICAS
por par de bases por divisão celular. Como o genoma humano
diplóide contém aproximadamente 6 X 109 pares de bases do
As mutações gênicas, incluindo as substituições de pares de ba- DNA, os erros de replicação introduzem menos de uma muta-
ses, inserções e deleções (Fig. 6 1), podem se originar por um de ção de par de bases por divisão celular.
dois mecanismos básicos: erros introduzidos durante o processo
normal de replicação do DNA ou mutações que surgiram por Mutação Durante o Re paro de Dano ao DNA. Além dos
falha no reparo de danos ao DNA. Algumas mutações são es- erros de replicação, as mutações podem ser causadas por pro-
pontâneas, enquanto outrauª_Qj_ndu:?.lll~or ªMPt~~ .físicos ou cessos químicos espontâneos, tais como depurinação, desme-
químicos, chamados m utágenos porque estes agentes aumentam tilação ou desaminação, por reação com mutágenos químicos
muito a freqüência de mutações (naturais ou outros) no ambiente e por exposição à radiação
VARIAÇÃO GENÉ71CA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO 1 71

ultravioleta ou ionizante. Em contraste com as mudanças no diferente. Em muitos distúrbios, tais como as hemoglobino-
DNA relacionadas à replicação, que em geral são c01rigidas por patias descritas no Cap. 11 , a grande maioria das mutacões
mecanismos de revisão, as mudanças de nucleotideos introdu- detectadas é de sentido trocado . As mutações de sentido.tro-
zidas por danos ao DNA em geral ficam como mutações per- cado contribuem com mais da metade de todas as mutações
manentes. relatadas como causadoras de doenças genéticas em seres
humanos .
Outras substituições de bases que ocorrem dentro ou fora das
A BASE MOLECULAR DAS seqüências codificantes de um gene também podem ter grandes
MUTAÇÕES E SUA DETECÇÃO efeitos no produto gênico ou interferir diretamente no próprio
processo de transcrição. Como será discutido em detalhes no Cap .
Muitos tipos de mutação são representados entre os diversos ale-
11, várias mutações na região 5' do promotor ou na região 3' não-
los detectados em loci individuais. Subjacentes tanto à variação
traduzida do gene de beta-globina levam a uma intensa diminui-
nonnal na população quanto aos exemplos de doenças herdadas,
ção na quantidade de mRNA de beta-globina processado produ-
mutações que variam desde mudanças em um só par de bases até
zido.. De fato, tais mutações foram cmciais para elucidar a im-
a deleção de muitos milhões de pares de bases já foram docu-
portância da expressão gênica de determinados nucleotideos
mentadas. Com a atual aplicação aparentemente rotineira de téc-
nestas regiões .
nicas moleculares à detecção e elucidação das mutações, um
grande número de mutações específicas está sendo descoberto
em vários distúrbios genéticos diferentes. A descrição de muta- Mutações de Término de Cadeia
ções diferentes não só aumenta o conhecimento da diversidade
genética humana e da fragilidade da herança genética humana, Normalmente, a tradução do mRNA pára quando é atingido um
como também, e mais significativamente, contribui com infor- códon finalizador (ver Cap. 3). Uma mutação que cria um có-
mações para a detecção e a triagem de doenças genéticas em don finalizador pode causar· o término prematuro da tradução,
determinadas farrúlias em risco, bem como, para algumas doen- enquanto uma mutação que destrói um códon finalizador per-
ças, na população em geral. mite que a tradução continue até que o próximo códon finali-
Aqui consideraremos a natureza das diferentes mutações, seus zador seja atingido. Uma mutação que gera um dos três códons
mecanismos subjacentes e seu efeito nos genes envolvidos. Nos "fim" é chamada de mutação sem sentido. Em geral, tais mu-
Caps. 11 e 12, voltaremos aos modos pelos quais as mutações tações não têm efeito na transcrição. Entretanto, o mRNA por-
causam doenças. Cada tipo de mutação discutida aqui é ilustra- tador de uma mutação prematura geralmente é instável. Se o
da por um ou mais exemplos de doenças . Devemos lembrar, mRNA for suficientemente estável para ser traduzido, o pro-
entretanto, que as mutações na maioria das doenças genéticas são duto truncado de tradução em geral será tão instável que será
bem heterogêneas. Portanto, casos diferentes de um determina~ rapidamente degradado dentro da célula (decomposição de
do distúrbio em geral serão causados por mutações subjacentes mRNA mediado por falta de sentido). As mutações prema-
diferentes (ver o boxe). turas de término constituem cerca de 12% de todas as mutações
que causam doença.
Substituições de Nucleotídeos
Mutações de Recomposição (Splicing) de RNA
Uma única substituição de nucleotideos (ou mutação de pon-
to) em uma seqüência de DNA pode alterar o código em uma Como descrito no Cap. 3, o mecanismo normal pelo qual os ín-
trinca de bases e causar a substituição de um aminoácido por trons são excisados a partir de RNA não-processado e os éxons
outro no produto gênico Tais mutações são chamadas de mu- são reunidos para formar um mRNA final depende de determi-
tações de sentido trocado porque alteram o "sentido" do fi- nadas seqüências de nucleotídeos situadas nos limites intron/
lamento codificante do gene, especificando um aminoácido éxon (sitio aceptor) e éxon/fntron (sítio doador) ou próximas a
, ..ç:::>
rr
Tipos de Mutações em Doenças Genéticas Humanas

Substituições de Nucleotídeos (Mutações de Ponto) Deleções e Inserções


Mutações de sentido trocado (substituições de aminoáci- Adição ou deleção de um pequeno número de bases:
dos). se o número de bases envolvidas não for um múltiplo de
Mutações sem sentido (códons finalizadores prematuros) 3, causará uma mudança de matriz de leitura;
Mutações de processamento de RNA (destroem sítios de con- se o número de bases envolvidas for um múltiplo de 3, cau-
senso de corte, sítios cape sítios de poliadenilação ou cri- sará perda ou ganho de códons e, subseqüentemente,
am sítios crípticos). A recomposição anormal em geral leva aminoácidos no produto traduzido.
a mudanças de matriz de leitura e códons finalizadores pre- Deleções gênicas maiores, inversões, fusões e duplicações
maturos . (podem ser mediadas pela homologia de seqüência de
Mutações reguladoras que afetam a ligação de fator de trans- DNA, seja dentro ou entre os filamentos de DNA).
crição, controle transcricional ou outros aspectos da expres- Inserção de elemento L 1 ou Alu (perturba a transcrição ou in-
são gênica. terrompe a seqüência codificante).
Expansão de seqüências de ttinucleotídeos repetidos
72 ! VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO

esses limites. Duas classes gerais de mutações de recomposi- geral devem deletar pelo menos de 2 a 4 milhões de pares de bases
ção já foram descritas. As mutações que afetam as bases ne- do DNA Em muitos casos, tais deleções removem mais que um
cessárias no sítio doador ou no sítio aceptor interferem (e em único gene e estão associadas a uma síndrome de genes contí-
alguns casos abolem) no corte normal do RNA neste sítio (ver guos (ver Cap 10)
Caps, 11 e 12). Uma segunda classe de mutação de recomposi-
ção envolve substituições de bases de íntron que não afetam as
PEOUENAS DELEÇÕES OU INSERÇÕES
próprias seqüências doadora ou aceptora Tais mutações criam
sítios doadores e aceptores alternativos que competem com os Algumas deleções e inserções afetam apenas um pequeno nú-
sítios normais durante o processamento do RNA. Assim, em mero de pares de bases . Quando o número de bases envolvidas
tais casos pelo menos uma proporção do mRNA final pode não é um múltiplo de três (não é um número integral de códons),
conter seqüências íntron impropriamente processadas. Os exem- e quando ocorre em uma seqüência codificante, a matriz de lei;
plos deste mecanismo de mutação também estão apresentados tura é alterada, começando no ponto da inserção ou deleção E
no Cap 1L As mutações que afetam a recomposição são res- gerada, portanto, uma seqüência diferente de aminoácidos no
ponsáveis por 10% das mutações relatadas como causadoras de tenninal carboxila. Estas mutações também são chamadas de
doenças genéticas humanas mudanças de matriz de leitura. Outras pequenas inserções ou
deleções não causam a mudança de matriz de leitura porque o
número de pares de bases envolvidos é um múltiplo de três, Elas
"Pontos Quentes" de Mutação produzirão uma inserção ou uma deleção do aminoácido cor-
As mudanças nucleotídicas que envolvem a substituição de uma respondente no produto gênico traduzido As deleções ou in-
purina por outra (A ~ G) ou de uma pirimidina por outra serções de apenas alguns pares de bases constituem quase um
(T ~ C) são chamadas de transições . Em contraste, a ·substi- quarto de todas as mutações responsáveis pelas doenças gené-
tuição de uma purina por uma pirimidina (ou vice-versa) é cha- ticas humanas .
mada de transversão Se as substituições de nucleotídeos fos-
sem aleatórias, deveria haver tantas transversões quanto transi- GRANDES DELEÇÕES E INSERÇÕES
ções, pois cada base pode sofrer duas transversões, mas apenas
uma transição Entretanto, processos mutagênicos diferentes As alterações na estrutura gênica grandes o suficiente para que
s~jam detectadas pela transferência de Southem são incomuns
podem causar preferencialmente um ou outro tipo de substitui-
ção. Assim, o achado de uma freqüência maior de transições do (cerca de 6% das mutações causadoras de doenças), mas foram
que o esperado entre uma coleção de alelos mutantes é tido como descritas em muitos distúrbios hereditários. A freqüência de tais
uma evidência de um mecanismo favorecido de mutação em vez mutações difere acentuadamente entre doenças genéticas dife-
de uma substituição espontânea ou aleatória de bases. rentes. Alguns distúrbios são caracterizados por uma alta freqüên-
A compreensão do excesso de transições entre substituições cia de deleções detectáveis, enquanto em outros a deleção é uma
de um só par de bases causando doenças genéticas veio com a causa muito rara de mutação . Por exemplo, as deleções dentro
descobe1ta de que uma forma importante de modificação do do grande gene de distrofina no cromossomo X na distrofia
DNA no genoma humano envolve a metilação de citosinas muscular Duchenne estão presentes em mais de 60% dos casos
(para formar 5-metilcitosina), especificamente quando elas (ver Cap, 12) Muitos casos de a-talassemia são devidos à dele-
ção de um dos dois .genes de a-globina no cromossomo 16, en-
estão situadas imediatamente a 5' de uma guanina (p ex ., como
quanto a f3-talassemia apenas raramente se deve à deleção do gene
o dinucleotídeo 5'-CG-3'). A desaminação espontânea de 5-
de /3-globina (ver Cap. 11). Em alguns casos, a base para a dele-
metilcitosina em timina (compare as estruturas da citosina e
ção gênica é bem compreendida e provavelmente é mediada pela
timina na Fig 3.1) no parCG origina transições e~ Tou G ~
recombinação abemmte entre múltiplas cópias de seqüências de
A (dependendo de em qual filamento do DNA a 5-metilcitosina
DNA similares ou idênticas. Em outros casos, a base para a de-
está mutada). Mais de 30% de todas as substituições de um só
Jeção é desconhecida
nucleotídeo são deste tipo, e elas ocorrem a uma taxa 25 vezes
A inserção de grandes quantidades de DNA é uma causa de
maior que qualquer outra mutação de um único nucleotídeo
mutação muito mais rara que a deleção. Entretanto, um meca-
Assim, o par CG representa um verdadeiro "ponto quente" para
nismo novo de mutação foi descrito em dois casos não-corre-
mutação no genoma humano
lacionados e esporádicos de hemofilia A. Como discutido no
Cap, 3, a família Ll de seqüências intercalares repetitivas re-
Deleções e Inserções presenta uma classe de DNA repetido que pode ser transcrita
em um RNA que, quando reversamente transcrito, gera uma
As mutações também podem ser causadas pela inserção, inver- seqüência de DNA que pode se inserir em pontos diferentes do
são, fusão ou deleção de seqüências de DNA Algumas deleções genoma Em alguns pacientes com hemofilia A, seqüências LI
e inserções envolvem apenas alguns nucleotídeos e em geral com vários kb de tamanho foram encontradas inseridas em um
podem ser detectadas apenas por análise molecular envolvendo éxon no gene do fator vm, interrompendo a seqüência codifi-
seqüenciarnento de nucleotídeos. Em outros casos, um segmen- cante e inativando o gene. Este achado sugere que pelo menos
to substancial de um gene ou um gene inteiro é de!etado, inver- algumas das estimadas 100000 cópias da faJru1ia Ll no geno-
tido, duplicado ou translocado para criar um novo gene híbtido. ma humano são capazes de causar doença por mutagênese in-
Tais mutações em geral são detectadas no nível da transferência sercionaL
de Southem de um DNA de um paciente ou pela análise da rea-
ção em cadeia da polimerase (PCR) da junção. Em raros casos,
DELEÇÕES E DUPLICAÇÕES CAUSADAS POR RECOMBINAÇÃO
as deleções são grandes o suficiente para que sejam visíveis no
nível citogenétíco. Para que sejam detectadas mesmo com ban- Uma causa importante de mutação em alguns distúrbios envolve
deamento pró-metafásico de alta resolução, estas mutações em deleção ou duplicação mediada por recombinação entre seqüên-
VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO 1 73

cias de DNA similares ou idênticas. Existem muitos genes como A .recombinação entre seqüências de DNA homólogas não-
membros de fanúlias multigênicas (ver Cap. 3). Quando os codificantes também pode causar doença genética. A recombi-
membros de ta.l família gênica estão situados em tandem na nação entre membros diferentes da família Alude DNA repeti-
mesma região cromossômica, eles às vezes ficam desalinhados do intercalar (ver Cap. 3) foi documentada como a causa de uma
e fazem um pareamento errado na meiose (quando os dois ho- duplicação de vários éxons no gene de receptor de lipoproteína
mólogos ficam pareados) ou na mitose após a replicação (quan- de baixa densidade na hipercolesterolemia familiar (ver Cap. 12).
do as duas cromátides irmãs em geral trocam DNA). A recom- Finalmente, uma classe recém-descrita de mutações tem sido
binação que ocorre entre cromossomos ou cromátides malpa- vista em distúrbios tais como a doença de Huntington e a sín-
reados pode levar à deleção ou à duplicação. O mecanismo de drome do X frágil (Cap. 12).. Nestas doenças, uma simples re-
crossing over desigual é tido como o responsável pela dele- petição de trinucleotídeo, situada na região codificante (no caso
ção de um dos genes de a-globina na a-talassemia (ver Cap . da doença de Huntington) ou em uma região transcrita mas não
11) e pela variação no número de cópias dos genes de pigmen- traduzida de um gene (no caso da síndrome do X frágil), pode se
tos visuais verdes no grupo de genes de pigmento visual ver- ampliar e interferir na expressão gênica normal. Urna repetição
melho e verde no cromossomo X, tanto em pessoas com visão na região codificante gerará um produto proteico anormal, en-
de cores normal quanto nos homens com defeitos ligados ao X quanto a expansão repetida nas partes transcritas mas não tradu-
na percepção da cor vermelha ou verde (Fig. 6.2A) Um pare- zidas de um gene pode interferir na transcrição ou no processa-
amento e uma recombinação anormais entre duas seqüências mento do mRNA (ver Cap. 12)
similares em um único filamento de DNA também podem ocor- À medida que os pesquisadores identificam e catalogam mi-
rer. Dependendo da orientação destas seqüências, tal recombi- lhares de mutações em genes causadores de doenças. surge uma
nação pode levar a uma deleção ou a uma inversão Por exem- necessidade óbvia de que haja uma nomenclatura uniforme para
plo, quase metade de toda a hemofilia A grave deve-se à re- descrever qualquer mutação, sem ambigüidades, nos bancos de
combinação que inverte um número de éxons, perturbando as- dados que são os repositórios de toda essa informação (ver boxe).
sim a estrutura gênica (ver Fig . 6.?B).
Estimativas das Taxas de Mutações Gênicas
Germinativas em Humanos
A taxa de mutação de um gene em geral é expressa pelo número
de novas mutações por locus, por geração. O modo mais direto
de avaliar a taxa é medir a incidência de um novo caso esporádi-
co de uma doença genética autossômica dominante ou ligada ao
X que é totalmente penetrante com um fenótipo claramente re-
conhecível ao nascimento ou logo após A acondroplasia é uma
destas doenças que atende aos requisitos para se avaliar direta-
mente uma taxa de mutação Em um ·estudo, 7 crianças acondro-
plásicas nasceram em uma série de 242. 257 nascimentos conse--
cutivos Todas nasceram de pais com estatura normal e, como a
acondroplasia é totalmente penetrante, estes 7 casos foram con-
siderados como decorrentes de mutações novas. Supondo-se um
diagnóstico preciso, a nova taxa de mutaÇão pode ser calculada
corno 7 novas mutações em um total de 2 X 242.257 alelos ou,
aproximadamente, 1,4 ::!:: 0,5 X 10-s mutações por locus, por
geração
B 1 21 22 23
~#--CffiJ--@-<-~ - . -@1- A taxa de mutação foi estimada para vários distúrbios herda-
dos, como mostra o Quadro 6.2 A taxa de mutação gênica mé-
23
·µ1~
o-
dia é de cerca de 1 X 1 6 mutações por locus, por geração, mas
as taxas variam em urna gama de 1.000 vezes, de 10- 4 a 10-1
mutações por locus, por geração. A base destas diferenças pode
estar relacionada ao tamanho do gene, à fração de alelos muta~­
tes que dão um fenótipo particular observável, ao mecanismo
mutacional ou à presença ou ausência de "pontos quentes" mu-
tacionais, tais corno os dinucleotideos CG metilados, no gene.
Os genes da distrofia muscular Duchenne e da neurofibroma-
tose são ambos muito grandes, 2 ..000 kb de tamanho. Assim, não
surpreende que as taxas de mutação nestes loci sejam bem altas.
A acondroplasia, por outro lado, resulta quase exclusivamente
Fig. 6.2 A . Recombinação desigual mas homóloga entre cromáti- de uma mutação em um ponto quente, uma mudança nucleotidi-
des irmãs desalinhadas ou cromossomos homólogos contendo ca em um códon de glicina que substitui urna arginina na posi-
seqüências altamente homólogas (setas cinza everme/fias) levam a dois ção 380 (Gii380Arg) no receptor do fator de crescimento do fi-
produtos. um com apenas uma cópia e um com três cópias da se-
broblasto. As estimativas no Quadro 6.2 refletem as medidas
qüência Em B. a recombinação entre seqüências homólogas inver-
tidas situadas distando 500 kb no mesmo filamento (uma antece- feitas em mutações bem visíveis e deletérias. As mutações me-
dendo o gene do fator VIII e a outra no fntron 22 do gene) resulta nos graves ou óbvias escapariam à detecção, bem como as mu-
na inversão dos éxons l até 22 do gene. perturbando o gene e cau- tações letais mais graves. Assim, a taxa geral de novas mutações
sando hemofilia pode ser consideravelmente maior.
74 1 VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO

Nomenclatura das Mutações

A posição de uma mutação é designada como sendo no de um sítio aceptor de corte no mesmo íntron é designada
DNA genômico ou em uma seqüência de cDNA pelo pre- como gJVS33-2A>T.
fixo g. ou c., respectivamente. 5. Pequenas deleções são indicadas pelo termo "dei" escrito
2 O A do início de transcrição ATG é designado + 1. A base após os números de nucleotídeos deletados ( 1524-
seguinte anterior é -1; não há O. 1527del).
3. Uma mudança de nucleotídeo é indicada primeiro pela 6. Pequenas inserções são similarmente designadas pelo ter-
base original, o número do nucleotídeo desta base, um mo "ins" após os dois nucleotídeos entre os quais ocorreu
símbolo maior que (>) é o novo nucleotídeo nesta posi- a inserção, seguido dos nucleotídeos inseridos. Por exem-
ção Por exemplo, uma mutação responsável por uma de- plo, cl277-1278insTATC indica uma inserção de qua-
terminada mutação de sentido trocado que causa a doen- tro bases entre os nucleotídeos 1277 e 1278 no cDNA para
ça de Tay-Sachs pode ser designada como c.Gl444>A hexosaminidase A, uma mutação comum que causa a do-
nocDNA ença de T ay-Sachs
4 Se a seqüência genômica total não for conhecida, os nu- 7. Se uma mutação sem sentido for descrita no nível de pro-
cleotídeos em um íntron (designados pela expressão "se- teína, os aminoácidos (código de três letras; ver Quadro
qüência intercalar", ou IVS) serão contados como+ l, +2 3. 1) serão numerados de modo que a metionina iniciadora
etc., em que + 1 é a não-variante G de GT no sítio doador seja designada como número 1. A mutação de sentido tro-
do corte em 5', ou como -1, - 2 etc., contando a partir da cado na /3-globina no aminoácido número 6 que causa a
não-variante G no sítio aceptor de corte AG em 3' Uma anemia falcifonne converte um glutamato em valina e é
mutação que substitui um A pelo T altamente conservado designada Glu6Val (E6V). Uma mutação prematura de tér-
em um sítio doador de corte do íntron .33 de um gene é de- mino causadora de /3º-talassemia, tal como a mutação que
signada como g IVS3.3 + 2T> A, enquanto uma mutação troca glutamina na posição 39 de /3-globina por um códon
que substitui um T por um A no A altamente conservado finalizador, é chamada de Gln39X (Q39X).

As taxas de mutação também têm sido estimadas usando-se mutações genninativas: cerca de 10-• a 10-6 por locus, por ge-
eletroforese para triar as proteínas do soro quanto às alterações ração . Como existem cerca de 50.000 genes no genoma, isto
de carga e tamanho, um método que independe da gravidade sugere que, no mínimo, pelo menos 1 em cada 20 persoas pro-
da mutação. O surgimento em uma criança de uma nova va1i- vavelmente recebeu um novo gene mutado de um de seus geni-
ante eletroforética que não está presente nos genitores sugere tores.
uma mutação que alterou a carga ou o tamanho da proteína co-
dificada. Tais variantes são detectadas a uma freqüência de Mutações Herdadas nas
cerca de 2 X 10-6 por locus, por geração. Como apenas cerca
de um terço de todas as mudanças de aminoácidos produz uma Diferenças Sexuais Humanas
alteração detectável por eletroforese, a verdadeira taxa de no- Mutações novas podem ocorrer na linhagem genninativa duran-
vas mutações nas proteínas do soro usando este enfoque pode te qualquer divisão mitótica ou durante a divisão meíótica na
ser estimada como sendo de .3 X 2 X 10- 6 ou 6 X 10- 6 por lo- espermatogênese ou ovocitogênese. Existem, entretanto, diferen-
cus, por geração. ças marcantes entre os sexos tanto no número quanto na época
A despeito das limitações destes e de outros enfoques para das divisões mitóticas e meióticas, diferenças que podem afetar
determinar a taxa média de mutação gênica, todos os métodos a freqüência e os tipos de mutação em gametas paternos versus
dão essencialmente a mesma gama de valores para as taxas de matemos.

QUADRO 6-2

Doença Herança Locus (Proteína) Taxa de Mutação*

Acondroplasia AD FGFR3 (receptor 3 do fator de 0,6-1,4 X J0- 5


crescimento de fibroblasto)
Aniridia AD AN2 (Pax6) 2,9-5 X J0- 6
Distrofia muscular Duchenne Ligado ao X DMD (distrotina) 3,5- 10,5 X 10- 5
Hemofilia A Ligado ao X F8 (fator Vill) 3,2-5,7 X 10- 5
Hemofilia B Ligado ao X F9 (fator IX) 2-3 X J0- 6
Neurofibrornatose, úpo 1 AD NF1 (neurotibromina) 4-IOXI0-5
Doença do rim policístico, úpo 1 AD PKDJ (policistina) 6,5 - 12X10-s
Retinoblastoma AD RB (Rb) 5- 12 X JQ- 6
*Expressa como mutações/Jocusfgeração
AD = autossômica dominante
Baseado em dados de Vogel F, Motulsky A G (1997) Human Genetics, 3 • ed., Springer-Verlag, Berlim.
VARIAÇÃO GENÉTICA EM INDIVÍDUOS MUTAÇÃO E POLIMORFISMO l 75

Na ovocitogênese, corno vimos no Cap. 2, cada ovócito ha- como foi mostrado para espermatozóides portadores de expan-
plóide é o produto de cerca de 22 divisões mitóticas na vida sões muito grandes da repetição CGG associadas à síndrome
fetal. após o que ocone a meiose I, ficando então suspensa ai do X frágil
por anos ou mesmo décadas, até que a meiose I seja finalmen-
te completada na época da ovulação Há uma especulação de
que quanto mais tempo os ovócitos ficam na meiose I. maior é
Mutações Somáticas e Câncer
a chance de que ocorra um eno quando as células finalmente As mutações podem ocorrer em qualquer célula, tanto nas cé-
completam a meiose. Estas características da ovocitogênese lulas da linhagem germinativa quanto nas somáticas. _Apena~
podem ajudar a explicar por que a não-disjunção meiótica que 11s mu_t~_ç_õ~s da linhagem germinativa sãçi !ransmitidas de uma
leva a mutações genômicas tais como as trissarnias autossô- _gi;:r.'!Ǫ()J~.lil.'.ª a seguinte e SãQ .?-_S r(_!~p.onsáveis pelas <loenças
micas dos cromossomos 13. 18 e 21 ocorre com muito mais ~~redit.~d!!~... lsto não significa, entretanto, que as mutações
freqüência na linhagem genninativa materna que na paterna e de células somáticas não sejam medicamente importantes. Na
aumenta em freqüência com o aumento da idade da mãe e não verdade, a grande maioria das divisões celulares que produ-
do pai (ver Cap. 10) zem um organismo adulto com cerca de 10 14 células a partir
A espermatogênese, por outro lado, envolve uma série con- de uma única célula, o zigoto, ocorre nas linhagens somáti-
tínua de divisões celulares durante a vida, resultando em um cas . Conseqüentemente, a maioria das mutações ocorre nas
total de cerca de 1 trilhão de espermatozóides. Estas células são células somáticas, Considerando-se uma freqüência de 10- 10
o resultado de cerca de 30 divisões mitóticas desde o estágio erros de replicação por base do DNA por divisão celular e uma
embrionário até a época da puberdade e de cerca de 20 a 25 estimativa de 1015 divisões celulares durante a vida de um
ciclos de replicação por ano a partir daL Considerando urna fre- adulto, os erros de replicação resultam em milhares de novas
qüência de io- 10 enos de replicação por base de DNA por di- mutações no genoma em cada célula do organismo. A magni-
visão celular, cada espermatogônia diplóide, que contém 6 X tude geral da carga mutacional é obviamente enonne. A grande
109 pares de bases de DNA. acumulará cerca de uma mutação maioria das mutações ocorre nas células somáticas e, portan-
nova a cada vez que se replica antes da meiose. Como um exem- to, não é herdável. Dependendo da natureza da mutação, en-
plo, cada espermatozóide de um homem de 27 anos é o produ- g_etanto, sua !ocaliz~ão no genoma e o tecido enygLvido, o
to de cerca de 300 ciclos de replicação e, portanto, cada esper- ~fl!iJ.9_k110JiP-i.G.Q. de. 1.1n.rn.m\Jtª.ç_ii,Q....somátic.a_pQd~Je.r.11m jm-
matozóide conterá cerca de 3 X 102 X 6 X 109 X 10- 10 = 180 .. pacto de_v_ast<idocn.o_indi:vid.u_o,_cªsoJeye_i'_!.9_ câncer. Mutações
mutações novas resultantes de e1ros de replicação do DNA Em- cromossômicas tais como translocações e inversões são res-
bora a grande maioria destas mutações não vá ser deletéria (ou ponsáveis por muitas formas de leucemia e linfoma malig-
vá ser recessiva ou letal ao espermatozóide e, portanto, não no. As mutações em genes somáticos são tidas como estando
aparente fonotipicamente em uma concepção resultante e nas- implicadas na maioria - se não em todas - das fonnas de
cimento), algumas serão . De acordo com as taxas calculadas câncer. Por exemplo, sabe-se que a maioria dos casos de cân·
de mutações deletédas em loci individuais, podemos estimar· cer colorretal em adultos, de retinoblastoma e de tumor de
que aproximadamellte 1em10 espermatozóides tem uma nova Wilms em crianças, apenas para citar algumas, são resultan-
mutação deletéria tes de mutações gênicas somáticas. Neste sentido, o câncer é
Como o DNA no espermatozóide sofreu mais ciclos de repli- fundamentalmente uma doença "genética" , e as mutações são
cação que o DNA nos ovócitos, podemos esperar que as muta- centrais à sua etiologia ou progressão, como apresentado no
ções que surgem de erros de replicação possam ser mais freqüen- Cap. 16.
temente paternas que maternas quanto à origem Além disso,
quanto mais idoso o homem, mais ciclos de replicação precede-
Defeitos Generalizados no Reparo do DNA
ram as divisões meióticas e, portanto, podemos esperar que a
freqüência de novas mutações paternas aumente com a idade do Como se poderia esperar em função do importante papel que
pai Na verdade, um excesso de mutações gênicas de origem a replicação do DNA e as enzimas de reparo têm na vigilân-
paterna tem sido observado para alguns distúrbios, notadamente cia e na prevenção de mutações, os defeitos herdados que al-
a neurofil>romatose, a acondrnplasia e a hemofilia B (na qual teram o funcionamento de tais enzimas podem ·levar a um
o avô matemo é a fonte de uma mutação nova). Em outras doen- aumento acentuado na freqüência de mutações de todos os
ças, entretanto, as novas mutações não são com mais freqüência tipos. Os distúrbios autossômicos recessivos, tais como o
de origem paterna, e, mesmo quando há uma tendenciosidade xeroderma pigmentoso, a ataxia telangiectasia, a anemia
para uma migem paterna, nem sempre há um aumento na taxa de Fanconi e a síndrome de Bloom, são decorrentes da per-
de mutação com o avanço da idade paterna O motivo pelo qual da de função de proteínas necessárias ao reparo ou à replica-
as mutações em alguns distúrbios apresentam uma tendenciosi- ção normal do DNA. Os pacientes com estas condições têm
dade de origem parental ou um efeito de idade, enquanto outras uma alta freqüência de mutações cromossômicas e gênicas, o
não, ainda é ignorado que predispõe as pessoas afetadas ao câncer (ver Caps. 9e16).
Nos distúrbios de repetição de trinucleotídeos (ver Cap. Os pacientes com câncer de cólon não-polipose hereditá-
12), um acentuado efeito de origem parental é bem conheci- rio, um câncer de cólon familiar autossômico dominante, são
do. Por exemplo, as grandes expansões da repetição CAG que heterozigotos para uma cópia anormal de uma classe de ge-
causam a doença de Huntington juvenil geralmente são de nes necessáiios ao reparo de pareamentos errados de bases
oiigem paterna . Por outro lado, as grandes expansões da re- introduzidos durante a replicação ou o reparo do DNA. Se a
petição CGG na síndrome do X frágil quase sempre ocorre m outra cópia normal restante do gene for perdida ou mutada em
durante a gametogênese feminina Tais diferenças podem ser uma célula epitelial intestinal, a célula não terá a capacidade
devidas a diferenças biológicas fundamentais entre a ovoci- de reparar os pareamentos eiradas de bases do DNA, as mu-
togênese e a espermatogê nese, mas também podem resultar tações gênicas se acumularão e a célula se tornará cancerosa
de seleção contra gametas portadores de expansões repetidas, (ver Cap 16).
76 1 VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO

DIVERSIDADE GENÉTICA HUMANA afetam a interação do indivíduo com o ambiente Os alelos poli-
mórficos em regiões reguladoras também podem ser importan-
A maioria das estimativas das taxas de mutação descritas envol- tes na determinação do fenótipo, afetando a regulação transcri·
ve a detecção das mutações deletérias com um efeito óbvio so- cional dos genes.
bre o fenótipo. Muitas mutações, entretanto, não são deleções, Avalia-se que qualquer pessoa tem a possibilidade de ser he-
mas são tidas como sendo seletivamente neutras Com base na terozigota para alelos que determinam polipeptídeos estrutural-
informação já apresentada neste capítulo, cada novo zigoto se- mente diferentes em cerca de 20% de todos os loci. Quando com-
da esperado contendo cerca de 100 mudanças de pares de bases paramos pessoas de grupos étnicos diferentes, e mesmo frações
não presentes no genoma de um dos genitores A maioria destas maiores de proteínas, observamos que elas exibem polimorfismos
variações não está na seqüência codificante, mas sim em seqüên- detectáveis, Assim, um grau marcante de individualidade bioquí-
cias extragênicas ou em regiões não-codificantes dos cromosso- mica existe dentro da espécie humana em sua constituição de en-
mos, Durante o curso da evolução, o constante influxo de novas zimas e outros produtos gênicos. Além disso, como os produtos
variações de nucleotídeos garantiu um alto grau de diversidade de muitas das vias bioquímicas codificadas interagem, podemos
genética e individualidade, Este tema abrange todos os campos concluir que cada pessoa, independente de seu estado de saúde,
da genética humana e médica. A diversidade genética pode se tem uma constituição única geneticamente determinada e, portan-
manifestar como mudanças nos padrões de coloração dos cro-
to, responde de modo único a influências ambientais, dietéticas e
mossomos (ver Cap 9), como variação de proteínas, como mu-
farmacológicas. Este conceito de individualidade química, des-
danças de nucleotídeos no DNA ou corno doença. tacada pela primeira vez há um século pelo brilhante médico in-
glês Sir Archíbald Garrod, permanece verdadeiro até hoje.
O Conceito de Polimorfismo Genético
'·,·,,1
,:.;
Quando a seqüência exatamente da mesma região do DNA situ- VARIACÃO HERDADA E
ada em uma certa posição de um cromossomo é determinada em
um grande número de cromossomos portados por muitas pesso- POLIMORFISMO EM PROTEÍNAS
as diferentes no mundo, um nível marcantemente alto de simila- Grupos Sanguíneos e seus Polimorfismos
ridade é observado. Na verdade, qualquer segmento específico
do DNA humano com cerca de I .000 pares de bases de tamanho Os primeiros casos de variação proteica geneticamente detenni-
contém, em média, apenas um par de bases que varia entre dois nada foram detectados em antígenos encontrados no sangue, os
indivíduos na população Corno já vimos antes, diferentes ver- chamados antígenos de grupos sanguíneos. São conhecidos
sões de uma certa seqüência de DNA em um determinado local vários polimorfismos existentes nos componentes do sangue
cromossômico (locus) são chamadas de alelos. Quando os ale- humano, especialmente nos antígenos ABO e Rh das hemácias
los são tão comuns que são encontrados em mais de 1% dos cro- (Quadro 6.J). Em particular, os sistemas .8-:12_0_~ M são imP-or-
mossomos na população em geral, os alelos constituem o que é ~tes__I!~ [!l!nsfusão de sangue, no transplante de tecidos e _d_e
conhecido como um polimorfismo genético, Em contraste, os órgãos e no tratamento da do~nça_hemqJ-iticago n.~PIJ!lt!J, ··
alelos com freqüências de menos de l % são, por convenção, cha-
mados de variantes raras. Alguns alelos representam uma mu- 0 SISTEMA ABO
dança na seqüência de DNA situada entre os genes ou dentro dbs
íntrons e não têm conseqüência para o funcionamento de qual- Landsteíner e colaboradores descobriram que o sangue humano
quer gene, podendo ser detectados apenas pela análise direta do podia ser classificado em quatro tipos, de acordo com a presen-
DNA Outras mudanças de seqüência estão situadas na seqüên- ça de dois antígenos, A e B, na superfície das hemácias e apre-
cia codificante dos próprios genes e podem resultar em variantes sença de dois antico1pos correspondentes, anti-A e anti-B, no
proteicas diferentes, que podem levar, por sua vez, a fenótipos plasma,
nitidamente distintos A maioria (mas não todas) das mutações Existem quatro fenótipos principais: O, A, B e AB As pesso-
deletérias que levam a uma doença genética é de variantes raras. as do tipo A têm antígeno A em suas hemácias, as do tipo B têm
Os alelos mutantes que levam a doenças genéticas gr'aves em geral antígenoB, as pessoas AB têm os antígenos A e B e as pessoas
são apenas a forma mais óbvia de diversidade genética. Ao exa- do tipo O não têm nenhum dos dois. Uma característica dos gru-
me, muitas proteínas foram encontradas em populações diferen- pos ABO que não é compartilhada pelos outros sistemas de gru-
tes sob formas distinguíveis relativamente comuns po sanguíneo é a relação recíproca, em um indivíduo, entre os
Embora todo polimorfismo seja, em última análise, o resulta- antígenos presentes nas hemácias e os anticorpos no soro Quan-
do de diferenças na seqüência de DNA, alguns loci polimórfi- do as hemácias não têm o antígeno A, o soro contém anti-A; quan-
cos foram estudados examinando-se a variação nas proteínas co-
dificadas pelos aleios em vez de examinando-se as diferenças na
seqüência de DNA dos próprios alelos. Discutiremos mais adi-
ante, em detalhes, alguns polimorfismos de significado médico: QUADRO 6-3
os grupos sanguíneos ABO e Rh, importantes na determinação
da compatibilidade para transfusões de sangue e, em algum grau, Fenótipo Reação com Reação com Anticorpos
para o transplante de tecidos, e o sistema de alfa -antitripsina da Hemácia Anti·A Anti-B no Soro
sérica (ai-AT), implicado em uma grave doença p~lmonar Es-
tudar a variação nas proteínas em vez de estudar o DNA que as o -~· '·.
.....
~
. - ~ .~....;.. ...
anti-A, anti-B
codifica tem uma utilidade real: afinal, é o produto proteico de A + anti-B
um alelo polimó1fico, e não a própria mudança da seqüência de B + anti-A
DNA, que em geral é responsável por fenótipos diferentes e, AB + + Nenhum
portanto, provavelmente dita como algumas variações genéticas - represenia sem reação; + representa reação
VARIAÇÃO GENÉTICA EM INDIV/DUOS: MUTAÇÃO E POLIMORFISMO ! 77

do as células não têm o antígeno B, o soro contém anti-B. O motivo população é separada em indivíduos Rh-positivos, que expres-
para esta relação recíproca é incerto, mas a formação de anti-A e sam em suas hemácias o antígeno Rh-D, um polipeptfdeo codi-
anti-B é tida como sendo uma resposta à ocorrência natural de ficado por um gene no cromossomo l , e indivíduos Rh-negati-
antígenos similares a A e similares a B no ambiente (por exem- vos. que não expressam este antígeno, O fenótipo Rh-negativo
plo. nas bactérias). A reação das hemácias de cada tipo com anti- em geral se origina da homozigose para um alelo não-funcional
soro anti-A e anti-B é mostrada no Quadro 63 . do próprio gene Rh-D. A freqüência de indivíduos Rh-negativo
varia muito em grupos étnicos diferentes . Por exemplo, 17% dos
Base Genética Molecular do Sistema ABO
ingleses são Rh-negativo, enquanto a freqüência entre os japo-
neses é de 0,5%.
Os grupos sanguíneos ABO são determinados por um Jocus no
cromossomo 9. Os alelos A, B e O neste locus são um exemplo Doença Hemolítica do Neonato. Clinicamente, o princi-
1f.
clás:,ico mu~tialelismo no qu~J três ai.elos, d~is dos quai~ (A e pal significado dos sistema Rh é que as pessoas Rh-negativo
B) sao dó-dorrunantes e o terceiro (O) e recessivo, detenrunam podem formar rapidamente anticorpos anti-Rh após a exposição
quatro fenótipos . Os antígenos A e B são feitos pela ação dos a hemácias Rh-positi vo. Isto é especialmente um problema quan-
alelos A e Bem uma proteína da superfície das hemácias chama- do uma grávida Rh-negativo porta um feto Rh-positivo. Normal-
da de antígeno H. O alelo B codifica uma glicosiltransferase que mente, durante a gravidez, pequenas quantidades de sangue fe-
reconhece preferencialmente o açúcar D-galactose e o adiciona tal cruzam a barreira placentária e atingem a corrente sanguínea
à proteína H. O alelo A codifica uma forma um pouco diferente materna. Se a mãe for Rh-negativo e o feto for Rh,positivo, a
da enzima, que preferencialmente reconhece N-acetilgalactosa- mãe formará anticorpos que voltam para a circulação fetal e da-
mina em vez de D-galactose e adiciona N-acetilgalactosamina nificam as hemácias fetais, causando doença hemolítica do neo-
ao precursor, criando, assim, o antígeno k Um terceiro alelo, nato, com conseqüências que podem ser graves, caso não sejam
O, codifica uma versão mutante da transferase que não tem ati- tratadas.
vidade de transferase e não afeta detectavelmente a substância A descoberta do sistema Rh e seu papel na doença hemolítica
H. A especificidade antigênica é, portanto, conferida por qual do neonato foi uma contribuição importante da genética para a
açúcar terminal especifico, se é que algum, é adicionado. medicina. Já tendo sido a doença genética humana mais comum,
As diferenças moleculares no gene de glicosilttansferase que a doença hemolítica do neonato hoje é relativamente rara em
são responsáveis pelos alelos A, B e O já foram determinadas função de medidas preventivas que se tomaram prática rotineira
São encontradas quatro diferenças de seqüência de nucleotideos na medicina obstétrica . Quando meninas ou mulheres Rh-nega-
entre os alelos A e B que resultam em mudanças de aminoácidos tivo de jdad_Ç!_feprodutiva precisam de transfusões, elas devem
que alteram a especificidade da glicosiltransferase codificada pelo receber apenas sangüeroi:negativo, Nas mulheres grávidas Rh-
gene ABO. O ale lo O tem uma âeleção de um único par de bases negativo, o risco de imunização por hemácias fetais Rh-positivo
na região codificante do gene ABO, que causa uma mutação de pode ser minimizado com injeções dejmti11og~obulina Rh durante
mudança de matriz de leitura, a qual elimina a atividade de trans- e após a gestação ou após o ténnino da gestação, para eliminár
ferase nas pessoas do tipo O. Agora que as seqüências de DNA qualquer célula Rh-positivo da circulação materna antes que ela
estão disponíveis, a tipificação do grupo sanguíneo ABO está faça uma resposta imune.
sendo feita diretamente no genótipo em vez de no fenótipo, es- A maioria dos casos de doença hemoli~ica do neonato reco-
pecialmente quando existem dificuldades técnicas na análise nhecidos clinicamente se deve à incompatibilidade de Rh, mas a
serológica, como em geral é o caso nas investigações forenses incompatibilidade de ABO também pode ocorrer e, embora di-
ou de teste de paternidade. fícil de diagnosticar, ela tende a ser branda e a não precisar de
A principal importância médica do grupo sanguineo ABO é tratamento
na transfusão de sangue e no transplante de tecidos ou de órgãos.
No sistema do grupo sanguíneo ABO, existem combinações
compatíveis e incompatíveis . Uma combinação compatível é uma Polimorfismo de Proteínas do Soro:
na qual as hemácias de um doador não levam o antígeno A ou B Deficiência de Alfa 1-Antitripsina
que corresponde aos anticorpos no soro do receptor. Embora
teoricamente existam doadores universais (grupo 0) e recepto- A a 1-AT é uma importante proteína do soro que inibe a ativida- •
res universais (grupo AB), um paciente recebe sangue de seu de de várias enzimas proteolíticas específicas, tais como a tr1p-
próprio grupo ABO, exceto em emergências. A presença regu- sina, a quimotripsina e a elastase pancreática. Seu principal alvo
lar de anti-A e anti-B explica a falha de muitas das tentativas é a elastase leucocitária, uma enzima que, se não for inativada
iniciais em transfundir sangue, pois estes anticorpos podem cau- pela a 1-AT, destrói as proteínas do tecido conjuntivo pulmonar
sar a destruição imediata de células ABO incompatíveis Nos (particularmente a elastina), levando a danos da parede alveo-
transplantes de tecidos ou órgãos, a compatibilidade ABO do lar. A deficiência de a 1-AT causa um enfisema muito grave, de
doador e do receptor, bem como a compatibilidade do antígeno inicio precoce. O gene para a a,-AT está no cromossomo 14 e é
leucocitário humano (HLA) (descrita no Cap. 14), é essencial para altamente polimórfico: existem vários alelos relativamente co-
a sobrevida do enxerto muns, com freqüências de 10% a 75% em populações diferen-
tes, e cerca de 25 alelos raros (Quadro 6.4). Cada um dos três
alelos mais comuns (M1, M2 e M3) codifica uma versão estrutu-
0 SISTEMA RH 1almente diferente de uma proteína funcionalmente normal, como
O sistema Rh, juntamente com o sistema ABO, também tem o fazem alguns dos alelos rar·os. Alguns alelos causam a doença
importância clínica em função de seu papel na doença hemoUti- porque codificam moléculas de a 1-AT com atividade inibidora
ca do neonato e nas incompatibilidades de transfusão. O nome de protease cliniCamente muito reduzida. Outros o fazem por-
Rh vem dos macacos Rhesus, que foram usados nos experimen- que sua secreção pelo fígado está prejudicada e a a 1-AT anor-
tos que levaram à descoberta do sistema, Em termos simples, a mal acumula-se nos hepatócitos -
78 ! VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POUMORFISMO

QUADRO 6-4

~el~s ·s.e!~ci~Mcil)s .~<> ~su~··~.~ iw~1~-fy1~'trijls~n~ ·~m· f.~#·~1.~~?~~}t);~~~~~~~~·• ·•· ::o;;·; .~··: ../::\·,:.;.:
Freqüências Alélicas
População Mi M2 M3 s Z Outra
Caucasianos nos EUA 0,724 0,1.37 0,095 0,023 0,014 0,007
Afro-americanos 0,981 0,015 0,004
Dinamarca 0,728 0,136 0,082 0,022 0,023 0,009
Portugal 0,510 0,260 0,053 0,150 0,009 0,018
China (média de 5 populações) 0,709 0,209 0,070 0,012
Japão 0,785 0,153 0,062
Baseado em dados resumidos por Cox D. W. (2000) a -Antitrypsin deficicncy. Ili Scriver C. R , Beaudct A L, Sly W S, Vallc D
(eds) The Mctabolic and Molecular Bases of lnberited 0isease, 8' ed McGraw-Hill, New York

O principal significado médico do polimorfismo de ai-AT está 95% restantes do genoma humano? Nos grandes levantamentos
nos alelos cujos produtos levam a uma deficiência da atividade da nos quais foram seqüenciados os mesmos segmentos de DNA
a 1-AT no soro. O mais comum e mais importante deles é o alelo Z, de muitas pessoas, como já mencionado, a proporção total de
que tem uma freqüência de 1% a 2% nas populações caucasianas. posições de bases polimórficas foram estimadas como sendo de
As pessoas com o genótipo Z/l têm menos de 15% da concentra- cerca de 1 em 1.000 pares de bases para qualquer trecho de DNA
ção nonnal no plasma de a 1-ATe têm um alto risco de doença pul- escolhido aleatoriamente no genoma. Este dado é cerca de 2,5
monar obstrutiva no início da vida adulta, como discutiremos em vezes mais alto que a proporção de nucleotídeos heterozigotos
detalhes no Cap. 12. A deficiência de ai-AT é vista com uma fre- estimados para regiões codificantes de proteínas do genoma (cer-
qüência de 1/2 .000 a 1/8.000 nas populações caucasianas, mas ape- ca de l em 2.500 pares de bases) . A diferença não é surpreen-
nas raiamente nas populações afro-americanas ou asiáticas. dente, pois parece intuitivamente provável que as regiões codi-
O polimorfismo genético no locus de a 1-AT leva a uma vari- ficantes de proteínas estejam sob uma pressão seletiva mais rí-
ação de várias vezes na atividade da enzima entre pessoas apa- gida e, assim, a incidência de mutações nestas regiões durante a
rentemente "normais" . Parte desta vaiiação pode ser altamente evolução deve ser mais baixa.
significativa do ponto de vista de saúde pública, pois há uma
sugestão de predisposição a vários distúrbios, tais como doença
pulmonar (pruticulaimente em fumantes), asma e artrite reuma- Polimorfismos de Comprimento de Fragmentos
tóide (bem como outros distúrbios imunes) entre as pessoas he- de Restrição
lerozigotas para o alelo Z ou S (estimada como de aproximada-
mente 3% a 5% da população caucasiana). As enzimas de restrição têm seqüências específicas de reconhe-
cimento no DNA (ver Cap. 4) e, conseqüentemente, as mudan-
ças no DNA genômico levam à criação ou à eliminação de de-
VARIAÇÃO HERDADA E te1minados sítios de clivagem, alterando, assim, o tamanho de
POLIMORFISMO NO DNA um ou mais fragmentos de DNA que surgem após a transferên-
cia de Southem e a hibridização com uma sonda de DNA clona-
A seção anterior concentrou-se nas mutações e nos polimorfis- do (Fig. 6.3). Logo após a aplicação da transferência de Southem
mos em partes do genoma que codificam proteínas, estimadas para análise genômica no final da década de 1970, descobriu-se
como 5% do DNA genômico totaL E quanto à diversidade nos que nem todas as pessoas têm exatamente a mesma distribuição

AA AB BB
A
B
emm

lil!i!!iE!!I
Sonda
*
1-1 l~I
AA AB BB

1=1 1-1
~-~"'::~ ~~
A m::;:sa

B lilill!l.D
Sonda
~
Fig. 6.3 Polimorfismos de comprimento de fragmentos de rest rição (RFLPs) detectados por hibridização de DNA (transferência de Sou-
thern) Em cima. o polimorfismo deve-se à variação em um sítio específico de clivagem para uma enzima de restrição; no ale lo A. o sítio
está ausente (aslerisco) e o fragmen to de restrição resultante detectado pela sonda é maior que no alelo B Na parte de baixo. o polimor-
fismo deve-se à inserção (alelo A) ou à deleção (a leio B) de um segmento do DNA (barra cinza) dentro de um determinado fragmento de
restrição detectado pela sonda Para ambos os tipos de polimorfismo são indicados os padrões de transferência de Southern observa·
dos no DNA de pessoas com os três genótipos possíveis neste locus
VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO l 79

E E
Alelo 1
*

E E
Alelo2 ;::.:=-..::::.-;;::;

Sonda

Fig. 6.4 Herança co-dominante de um polimorfismo de com primento de fragmento de restrição (RFLP) ligado ao X Os alelos 1 e 2 dife-
rem pela va riação em um sítio de reconhecimento para a enzima de restrição EcoRl (E) Os símbolos vermelhos indicam a herança do
ateio 2

de sítios de enzima de restrição. Embora a existência de alguma Os RFLPs devidos a mudanças em determinados sítios de cli-
variação de nucleotídeos pudesse ser prevista pelo que se sabia vagem de endonuclease são um pequeno subgrupo de uma classe
sobre mutação e polimorfismos de proteína, o grau de variação mais geral de polimorfismo, conhecida como polimorfismos de
detectado pela transferência de Southem foi urna surpresa. nucleotídeo único (SNPs). Os modernos métodos de detecção de
As variações no DNA nos sítios de restrição detectadas pela seqüências de DNA permitem a detecção ~e qualquer SNPs e não
transferência de Southem são chamadas de polimorfismos de apenas daqueles que alteram um sítio de enzima de restrição Os
comprimento de fragmentos de restrição (RFLPs). Os dife- SNPs são várias ordens de magnitude mais freqüentes que os
rentes comprimentos de fragmentos de restrição constituem ale- VNTRs ou polimorfismos de microssatélites (ver adiante) e são
los co-dominantes em um locus de DNA (ver Fig. 6.3). Assim, unifonnemente distribuídos por todo o genoma. Estas càracteris-
podemos facilmente examinar uma transferência de Southem e ticas os tomam excelentes marcadores para gerar mapas genéti-
ler diretamente todos os diferentes comprimentos de fragmen- cos bem densos (ver Cap. 8), tais como os necessários para avali-
tos como um reflexo do genótipo (a seqtiência de DNA) em um ar a contribuição potencial de um determinado gene para um dis-
determinado sítio de restrição (Fig . 6.4). Os RFLPs também túrbio complexo (ver Cap. 15) Os RFLPs (e os SNPs de modo
podem surgir de deteções ou inserções de DNA em vez de mu- mais geral) usualmente têm apenas dois alelos correspondendo a
danças de nucleotídeos únicos. Se um segmento de DNA entre duas bases diferentes que ocupam uma determinada posição
dois sitios de restrição for deletado ou inserido, o tamanho do A descoberta dos SNPs aumentou muito a extensão do reco-
fragmento de restrição resultante será diferente (ver Fig. 6.3). nhecimento de q uais cópias individuais de determinados genes

M1~M2
CGT~CAT M3
(AC)n Arg~His

i
5'--71--Q "' "' "' * "'"' "' 1
flll=:ll i:J "' "' "' "' 3'

GAA~GTA
*
Glu~Val
i i
s
*

z
GAG-+MG
Glu~Lys

Fig. 6.5 Esquema do gene de a 1-AT e a localização dos sítios polimórficos de DNA. variantes proteicas normais e duas mutações de
doença no gene e ao redor dele. Os éxons estão em boxes e os éxons codificantes estão em vermelho Os triângulos pretos indicam
si tios de polimorfismos de um nucleotídeo. cada um consistindo em dois alelos si tuados em partes não-codificantes do gene Os aste-
riscos pretos acima do gene indicam os sítios de mutações em éxons resultantes nos alelos M2 e M3. enquanto os asteriscos vermelhos
z.
abaixo do gene são mutações em éxons resultantes nos alelos Se respectivamente As mutações no DNA e as substituições de ami-
noácidos nos alelos M2. M3, Se Z são indicadas Notar que o alelo M2 tem uma mutação em comum com o alelo M3 no éxon 5. bem
como uma no éxon 2 A posição de um locus de microssat élite altamente polimórfico (AC)" com 18 alelos diferentes é mostrada na re·
gião flanqueadora 5
80 1 VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO

são verdadeiramente únicas Em tennos conceituais, entretanto, de um sítio de reconhecimento de endonuclease de restrição
os polimorfismos de DNA não são novidade. Eles são simples- Por exemplo, uma classe especial de polimorfismos resulta da
mente a manifestação molecular da variação no genoma que há inserção, em tandem, de múltiplas cópias de uma seqüência
muito é aparente pelos estudos dos polimorfismos de proteínas. de DNA com 10 a 100 pares de bases de tamanho, conhecida
Como ilustração, considere novamente a variação no locus de como minissatélite, no DNA entre dois sítios de restrição
a 1-AT. Como já foi discutido antes e apresentado no Quadro 6.4, Esta classe de RFLP, conhecida como um polimorfismo de
um amplo polimorfismo já foi documentado no nível da proteína número variável de repetições em tandem (VNTR), é ca-
nos estudos populacionais e nos estudos de pacientes com defici- racterizada por muitos alelos (Fig. 6.6), pois o tamanho de um
ência herdada de a 1-antitripsina. Um grau similar de variação de fragmento de restrição contendo seqüências de minissatélite
seqüência é indicado pela análise de DNA no locus de cx1-AT. A difere dependendo de quantas cópias do minissatélite estejam
Fig. 6.5 mostra a estrutura do gene de cx 1-AT, incluindo as posi- presentes. Os marcadores mais informativos têm várias dúzi-
ções e as freqüências de alguns dos sítios mais comuns de varia- ar. ou mais alelos e, assim, nenhum par de indivíduos não-
ção do DNA: os SNPs (identificados originalmente como RFLPs), aparentados tem probabilidade de compartilhar os mesmos
um locus polimórfico de microssatélite no DNA S' flanqueador, ai elos.
duas variantes no1mais na região codificante do gene e duas mu- As seqüências minissatélite repetidas encontradas em muitos
tações patológicas. Observe na Fig. 65 que as mutações de uma polimorfismos diferentes do tipo VNTR em geral são suficien-
só base responsáveis pelos SNPs, situadas nos íntrons ou no DNA temente similares para possibilitar a detecção simultânea de
flanqueador, são conceitualmente idênticas às mudanças respon- muitos loci diferentes usando um fragmento de minissatélite
sáveis pelos alelos nonnais M2 e M3, bem como pelos alelos pa- como sonda em uma única hibridização de transferência de Sou-
tológicos Z e S vistos nos pacientes com deficiência de cx1-AT. As
únicas diferenças entre os vários tipos de polimorfismos residem
em suas freqüências alélicas, sua localização dentro do gene e suas
conseqüências patológicas, se é que alguma.
6b
Polimorfismos de Minissatélite
e Microssatélite
POLIMORFISMOS DE VNTR
Alguns RFLPs são baseados na inserção ou deleção de uma
quantidade variável de DNA em vez de na perda ou no ganho

2
3
4

Número variável de repetições em !andem


Alelo 1
Alelo2
Alelo3~--l

Alelo4 ~--1
Sonda
Fig. 6.6 Herança co-dominante de um polimorfismo de DNA au- Fig. 6 .7 Fingerprinting de DNA de gêmeos por meio de uma sonda
tossômico hipervariável causada por um número variável de repe- que detecta polimorfismos do número variável de repetições em
tições em tandem (VNTR) Os alelos de J a 4 estão relacionados tandem (VNTRI em muitos loci pelo genoma Cada par de colunas
por um número variável de curtas seqilências de DNA idênticas (ou contém DNA de um par de gêmeos Os gêmeos do primeiro par
quase) (setas) A variação de tamanho pode ser detectada após di· (bem como os gêmeos do terceiro pari têm fingcrprints idênticos de
gestão com enzimas de restrição e hibridização com urna só son- DNA, o que indica que são gêmeos idênticos (monozigóticos) O
da, que fica fora das próprias seqüências VNTR. mas dentro dos conjunto do meio tem fingerprints claramente diferentes. o que in·
sítios de restrição usados para definir os fragmentos alélicos (Foto dica que são gêmeos fraternos (Transferência de Southern forne-
original por cortesia de A Bowcock. Washington University. St cida por cortesia de Alec leffreys. Universidade de L-eicester. Reino
Louis) Unido)
VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POLIMORFISMO 81

Primer 1
- - - - - - - - - A C A C A C · · ... ACAC - - - - - - - -
- - - - - - - - T G T G T G ··· ·· ·T G T G - - - - - - -
Primer2

2 3 4

(AC)19

Fig. 6.8 Marcadores microssatélite em DNA humano. Em cima, o DNAcontendo um marcador microssatélite (AC)" em um cromossomo
Os primers 1 e 2 são primers da reação em cadeia da p()limerase ( PCR) complementares a seqüências únicas flanqueadoras da repetição de
dinucleotídeo. No meio. um heredograrna demonstrando a herança co-dorninante de um polimorfismo de microssatélite devido a nú-
meros variáveis do dinucleotídeo AC O genótipo de cada indivíduo é mostrado abaixo de seu slrnbolo no heredograma Os fragmentos
de tamanhos diferentes são amplificados usando PCR e os prin1ers 1 e 2 flanqueadores do trecho de dinucleotrdeos AC e seus tamanhos
relativos são determinados pela separação deles usando eletroforese em gel

them. Apenas os gêmeos idênticos apresentam um padrão indis- dos de ligação genética (ver Cap. 8). Primeiro, um locus de
tinguível (Fig. 6.7) e, portanto, a detecção simultânea de vários microssatélite em geral tem muitos alelos (tamanhos de repeti-
polimo1fismos de VNTR tem sido chamada de DNAftngerprin- ção) presentes na população, criando a probabilidade de que
ting. Os VNTR marcadores foram amplamente superados pelos uma pessoa seja heterozigota em geral em mais de 70% (ver o
marcadores microssatélíte (ver adiante) para a análise de liga- Cap . 8 para uma discussão da importância de ser heterozigoto
ção genética (ver Cap 8), mas ainda são muito usados para a para os estudos de ligação). Segundo, ao contrário das análises
identificação individual, como na comparação do DNA de um de RFLP ou VNTR, a genotipagem dos alelos de microssatéli-
suspeito com o de uma pessoa que cometeu um crime, a identi- te não requer o uso das técnicas de transferência de Southern
ficação dos restos de vítimas de crime e de pessoal militar e os O uso de primers de PCR complementares a seqüências únicas
testes de paternidade. de DNA flanqueadoras de microssatélites gera fragmentos que
diferem em tamanho dependendo de quantas repetições este-
jam presentes (Fig. 6.8). Finalmente, dezenas de milhares de
MARCADORES MICROSSATÉLITE
loci polim61ficos de microssatélites já foram identificados ao
Mais freqüentes e polimórficos que os loci minissatélites de longo do genoma humano, de modo que quase nenhuma região
VNT são o loci de microssatélites. Os microssatélites são tre- do genoma não pode ser mapeada pelos métodos de ligação
chos de DNA que consistem em unidades repetidas de dois, três genética usando estes marcadores.
ou quatro nucleotídeos, tais como TGTG .. TG, CAACAA .
CAA ou AAATAAAT ... AAAT. O número de unidades de USOS DE POLIMORFISMOS EM
nucleotídeos repetidos contidos dentro de qualquer microssa-
télite pode diferir entre os dois cromossomos homólogos de uma GENÉTICA MÉDICA
pessoa e entre pessoas na população. Um detenninado micros- Os polimorfismos são elementos importantes em todas as pes-
satélite é, po1tanto, um locus polimórfico, e os diforentes nú- quisas de genética humana. A habilidade de distinguir formas
meros de unidades repetidas em um determinado microssatéli- herdadas diferentes de um gene ou segmentos diferentes do ge-
te constituem os alelos deste locus . Três caracteristicas de noma fornecem ferramentas que são cxuciais para uma ampla
marcadores microssatélites os tomam muito úteis para os estu- gama de aplicações Temos testemunhado uma explosão do nú-
82 ' VARIAÇÃO GENÉTICA EM INDIVÍDUOS: MUTAÇÃO E POUMORFISMO

mero e da utilidade de polimorfismos de DNA Como ilustrado quality, hígh resolution human genome-widc línbge nrnps
nos capítulos subseqüentes, os marcadores genéticos são de enor- Hum Mol Genct 4: l 83 7- l 8H
Wang DG, Fan J, Siao C, et ai (l 9'18) Large-scale identí!icarion,
me uso prático em genética médica para o seguinte: mapeamen- mapping, nnd genotyping of single-nucleoride puli111orphisms
to de um gene em uma detenninada região de um cromossomo in the human genome Science 280:1077-1082 ,
pela análise de ligação (ver Cap, 8); diagnóstico pré-natal de \Vebcr JL (1990) lnformati\'eness of hum;m (dC-dA)0 (dG-<l T),,
doenças genéticas (ver Cap. 18); detecção de portadores hetero- polymorphisms Genomics 7:52+-530
zigotos de doenças genéticas (ver Cap. 19); avaliação de pesso-
as com risco alto e baixo com predisposição a distúrbios adultos
comuns, tais como doença coronariana, câncer e diabetes (ver URLs para Bancos de Dados de Mutações Humanas
Cap, 15); teste de paternidade e aplicações forenses na identifi-
cação de restos de vítimas de crime ou comparação do DNA de Hunian Genome Organization (HUGO) database
http:1/ariel ucs.1mirnelb au: BOl-co11011/mdi. lirm
um suspeito de crime; e tipagem tissular para transplante de ór-
gãos.. Institute of Medical Genetics in Cardiff
hup:/larcl1ive uwcm. ac 11k/11wcmlmglhgmd0. !11ml

Referências Gerais Bancos de dados de mutações em centenas de genes diferentes de doenças.Ambos


incluem /irrks para bancos de dados de mutações específicas de locus e específi-
CrowJF, Denniston C (1985) Mutation in human populations Adv cas de doenças mantidos por pesquisadores de todo o mundo
Hum Genct 14:59-124.
Harris H (1980) The Principies of Human Biochcmical Genetics,
.lrd ecl Elsevier-North Holland, Amsterdam.
r:
Vogcl ,\forulsk]' AG (1997) H uman Genetics, hd ed Springer- Problemas
\'erlat{, Berlin
1. Dentre 4,5 milhões de nascimentos em uma população durante um pe-
ríodo de 40 anos, 41 crianças diagnosticadas com a condição autossô-
núca dominante aniridia nasceram de genitores nonnais. Supondo que
estes casos foram devidos a mutações novas, qual a taxa de mutação
Referências Específicas aos Tópicos Particulares estimada no locus de aniridia? Em que suposições esta estimativa é
Amonarakis SE (1998) Recommendations for a nomencla rure baseada e por que esta estimativa pode ser muito alta ou muito baixa?
systcm for human gene mutations Nomendarure Working
Clroup. Hum Mutat 11:1-3 2, Os seguintes padrões são observados para um polimorfismo de DNA
Cox D\V (2000) a 1-Antitrypsin deficiency. /11 Scriver CR, Beaudet após digestão de DNA genõmico com uma detenninada enzima de
AL, Sly WS, Valle D (eds) The Metabolic and Molecular Bases restrição Em homens, um fragmento de 9 ou 11 kb; em mulheres,
of Inherircd Disease, Sth ed. McGraw-Hill, Ncw York um fragmento de 9 ou 11 kb, ou ambos
DunnenJT and Antonarakis SE (2000) Mutatíon nomenclarure ex- (a) Qual a provável origem destes padrões?
tcnsions and suggcsrions to describe complex murntions: A dis- (b) O que seria previsto se as amostras de DNA fossem digeridas
cussion. HumMutat 15:7-12. com uma enzima de restrição diferente?
Ga~dner RJ (1977) A ncw estimatc of thc achon1lropl:1sia mutarion
rate, Clin Genet 11 :31-28 3 Um polimorfismo de DNA tipo VNTR detecta cinco aleios diferen-
Jcffreys AJ (1993) DNA typing: Appronchcs ;md applirntions J tes, cada um com uma freqüência de 0,20. Que proporção de indiví-
forensic Sei Soe 33:20.f-21 l. duos se poderia esperar como sendo heterozigota para este locus?
l.owe JB (199·~) Red cell memlmme amigens. Ili Stamatoy-
annopoulos G, Nienhuis AW, Majerus PW, \!;irmu.1 H (eds) 4 Uma mulher que é Rh negativo casa-se com um homem Rh positi-
Molecular Basis of Blood Diseascs, 2nd ed WB S:1umlcrs, vo. Os filhos correm dsco neonatal de doença hemolítica? Se os fi-
Philadelphia, pp 293-330 lhos correm risco, este risco de doença é maior ou menor durante a
Sheffield VC, Weber JL, Buetow KH, ct ;11 (1995) A collcction of primeira gestação ou nas gestações subseqüentes? A doença pode
tri- and tetranucleotide rcpeat markers used to generatc high ser evitada? E se o homem também fosse Rh negativo?
Variação Genética em Populações
Em genética, mais que em qualquer outra especialidade médica, Os atuais estudos antropológicos sugerem que os ancestrais
o paciente é um reflexo da família e da população à qual perten- humanos surgiram há cerca de 1,5 milhão de anos, na África, e
ce. A genética médica está envolvida não só em fazer o diagnósti- então se espalharam pelo resto do mundo em sucessivas ondas
co correto em um caso particular, mas também em detenninar de migração . Pequenos grupos humanos dispersos eram geográ-
os genótipos de outros membros familiares e avaliar os riscos de fica e, portanto, geneticamente isolados uns dos outros e desen-
recorrência tanto para os genitores de uma pessoa afetada quan- volveram-se em grupos étnicos, com conjuntos de freqüências
to para seus irmãos e irmãs, e também para os parentes mais dis- gênicas caracteósticos. A seleção de mutações favoráveis em
tantes Saber sobre os diferentes genes de doenças que são co- resposta a condições ambientais ou a sobrevida ao acaso de
muns em populações diferentes e sobre seu papel na saúde e na mutações especfficas neutras ou mesmo prejudiciais, juntamen-
doença pode ser um ponto valioso no diagnóstico clínico e na te com um grau de isolamento reprodutivo entre os grupos, per-
consulta genética. A genética é única entre as várias disciplinas mifüam que as diferenças genéticas entre os grupos populacio-
na medicina em função de sua ênfase tanto no paciente indivi- nais fossem estabelecidas. Em geral, existem diferenças acentu-
dualmente quanto na fanu1ia. adas de freqüências alélicas entre grupos populacionais, tanto
A genética de populações é o estudo da distribuição dos ge- para alelos que causam doenças genéticas (Quadro 7.1) quanto
nes nas populações e de como as freqüências dos genes e genóti- para marcadores genéticos supostamente neutros em temios se-
pos são mantidas ou alteradas. A genética de populações envolve letivos, tais como alguns grupos sanguíneos e polimorfismos de
tanto os fatores genéticos, tais corno a mutação e a reprodução, proteínas e alguns polimorfismos de DNA (Quadro 7 .2). Embo-
quanto os fatores ambientais e sociais, tais como a seleção e a ra os alelo!\ que causam doenças genéticas sejam altamente sig-
migração, que, em conjunto, determinam a freqüência e adistri- nificativos para a çletenninação de riscos de doenças em grupos
buição das doenças genéticas nas famílias e comunidades. populacionais específicos, os marcadores genéticos seletivamehte
Nesta seção, descreveremos o principio subjacente à genéti- neutros também são importantes como marcadores da recente
ca de populações, o equilíbrio de Hardy-Weinberg. Considera- evolução humana.
remos suas suposições e os fatores que podem causar um desvio
verdadeiro ou aparente do equilíbrio em populações reais em
oposição àquelas idealizadas; consideraremos, também, como i FENÓTIPOS, GENÓTIPOS E
determinar as freqüências e taxas de mutação de genes específi- '1FREOÜÊNCIAS CÊNICAS
cos de importância clínica, tanto autossômicos quanto ligados ao
X. Finalmente, o capítulo fornecerá alguma compreensão sobre Obtenção das Freqüências Alélicas a
como surgem as diferenças nas freqüências gênicas entre os Partir das Freqüências Genotípicas
membros de grupos diferentes, mais ou menos isolados geneti- Se pudéssemos conhecer o genótipo real de cada locus, em cada
camente. indivíduo e em cada familia que procura a consulta genética,
poderíamos fazer uma detenninação altamente precisa dos ris-
cos de reco!lência. Infelizmente, em muitos casos, o genótipo
DIVERSIDADE GENÉTICA EM
responsável pela doença é desconhecido, e é apenas o fenótipo
PQJ'.)JJLAÇÕES .HUMANAS da doença que podemos observar e medir. Assim, há uma neces-
A espécie humana, com quase 5 bilhões de membros, é separada sidade de ser capaz de usar dados de incidência para uma doen-
em muitas subpopulações distinguíveis Embora os cromosso- ça herdada ou outra caracteristica genética para determinar a fre-
mos humanos e os loci que eles contêm sejam idênticos na espé- qüência de determinados genótipos e então deduzir as freqüên-
cie, a natureza dos diferentes alelos e suas freqüências em mui- cias dos alelos responsáveis pelos diferentes genótipos.
tos loci variam amplamente entre grupos populacionais. Algu-
mas vaiiantes são virtualmente restritas a membros de um único A Genética da Resistência ao Vfrus da
grnpo, embora não estejam necessariamente presentes em todos Imunodeficiência Humana
os membros do gmpo. Com mais freqüência, os alelos variantes
podem ser encontrados em muitas amostras populacionais, mas Um exemplo importante de uma característica autossômica
têm freqüências diferentes em populações diferentes comum, controlada por um único par de a leios, pode ser usa-
84 ' VARIAÇÃO GENÉTICA EM POPULAÇÕES

QUADRO 7-1
Ex~mplós· Seledónad9s· de ;\leios de Doenças ·.cÓm Freqüências Diferentes em P~pulações Dif~rentes
• .: : · .· • ·< ; ...r ·. ."· . • . . · · • • • • '

Alelo/Doença Variação Populacional


Alelo Wdo gene de [3-globina (anemia falciforrne) Mais alta na África, menos comum em outras partes. Freqüência alélica de 1/20 entre
os afro-americanos; < 1/200 entre os hispano-americanos
Alelo Wdo gene de [3-globina Alta no oeste da África (especialmente Gana e Burquina Faso), onde a freqüência
alélica é de 1/6. Freqüência alélica de 1/100 entre os afro-americanos
Fibrose cística (todos os alelos da doença) Alta nas populações européias e caucasianas dos EUA (freqüência alélica de
1140-1/50); baix.a nas populações finlandesa, asiática e africana
Fenilcetonúria (todos os alelos da doença) Mais alta nas populações européias de origem celta e na Europa setentrional
(freqüência alélica de 1/67-1/90) . Freqüência alélica de 1/1 25 na Suíça e Itália, de
1/223 e ntre os afro-americanos, de 1/330 no Japão e de 1/500 na Finlândia
Doença de Tay-Snchs Alla freqüência nos judeus Ashkenazi (freqüência alélíca de 1/60); cem vezes menor
em outros grupos
Hipercolcstemlemia familiar Alta em certas regiões de Quebec (freqüência alélíca de 1/244) e nos africânderes na
África do Sul (freqüência alélica de J/140) . Freqüência alélica de 111000 na Europa
e nos EUA
Distrofia miotõnica Freqüência alélíca de 1/50.0 00 na Europa e inexistente na Áfricn sub-Saara.
Freqüência alélíca de 1/950 em algumas regiões de Quebec

do para ilustrar os princípios básicos que determinam as fre- Com base nas freqüências genotípicas observadas, podemos
qüências gênicas nas populações . Considere o gene CCR.5, determinar diretamente as freqüências alélicas simplesmente
que codifica um receptor de citocina da superfície celular qu e contando os alelos, Neste contexto, quando nos referimos à fre-
serve como ponto de entrada para algumas linhagens do ví- qüência populacional de um alelo, estamos considerando umpool
rus da imunodeficiência humana (HIV) que causa a síndro- de genes como uma coleção de todos os alelos em um determi-
me da imunodeficiência adquirida (AIDS). Uma deleção de nado locus para toda a população. Para loci autossômicos, o ta-
32 pares de bases neste gene resulta em um alelo (LlCCR.5) manho do pool de genes em um locus é o dobro do número de
que codifica uma proteína não-funcional devida a uma mu- pessoas da população, pois cada genótipo autossômico consiste
dança de matriz de lé itura e término prematuro. As pessoas em dois alelos, isto é, o indivíduo LlCCR.51LlCCR5 tem dois aie-
homozigotas para o alelo LlCCR5 não expressam o receptor los LlCCR5 e um indivíduo CCR.51LlCCR5 tem um de cada-Neste
em sua superfície celular e, conseqüentemente, são resisten- exemplo, então, a freqüência observada do alelo CCR5 é
tes ao HIV . A perda de função de CCR5 parece ser uma ca-
racterística benigna e sua única conseqüência fenotípica co- + (1 X 134) = O 906
(2 X 647)
nhecida é a r esistência à infecção por HIV . O alelo normal e 788 X 2 '
o alelo com deleção de 32 pares de bases, LlCCR5, são facil- Similarmente, podemos calcular a freq üência do alelo LlCCR.5
mente distinguíveis pela análise da reação em cadeia da po- como 0,094, seja somando o número de alelos LlCCR5 direta-
limerase do gene. Uma amostra de 788 indivíduos europeus mente ((2 X 7) + (1 X 134) = 148 de um total de 1.576 alelos)
nos deu números absolutos de pessoas que eram homozigo- seja simplesmente subtraindo a freqüência do alelo normal CCR5,
tas para ambos os alelos ou heterozigotas, como mostra o 0,906, de 1 (portanto, a freqüência de LlCCR5 = 1 - 0,906 =
Quadro 7.3 . 0,094), pois as freqüências dos dois alelos devem somar L

QUADRO 7-2
J;:~e~pl'?s d~: toéi_'Polimódicos_com freqi.\êÍiciar; .Ai~ifoas .Diferentes em Populações [?ifere'1tés~- .. :,·: ~ ;: ·:.:-:
. · .:,-_· • . . <.
·.,, . · . , .;
• . .. ' ·. ·-- ':' . . • -. •... .... ,-..--. . . . .• .. ·: -.. -.1. ~ ~-- - · ~ ~ - ·.. :·:~ . .......... . ~ . . ... ' ' -• ,~·: . ·:·· . . \·.~ .• . ! .; ·. -· ...... ' . •. • . ". . . ~·,.·:-~ ·: . ·• • '.· ' ·

Lo cus Variação Alélica


Grupo sanguíneo ABO Ampla variação; p ex ., alelo B comum em asiáticos, mas ausente nas populações americanas nativas
Alfa 1-antitripsina As freqüências dos três principais alelos M variam entre as populações (p ex., Ml de 0,51a0,98;
M2 de O a 0,26)
Álcool desidrogenase Três loci: ADHJ, ADH2, ADH3 Variante de ADH2 muito mais comum nos japoneses (90%) que nos
europeus (15%)
Aldeído desidrogenase Deficiência de ALDH1 em 50% dos asiáticos, <5% nos norte-americanos nativos
Sistema HLA Vários alelos em cada locus constituindo todo o complexo, com ampla variação em freqüência
(ver Cap 14)
Metabolismo de debrisoquina Vários alelos codificando atividades enzimáticas que variam da deficiência total ao metabolismo
(CYP2D6 4-hidroxilase) extremamente rápido. Uma deficiência devida à homozigose ou heterozigose composta de ai elos
de metabolismo muito lento é vista em 30% dos chineses de Hong Kong, 8% de caucasianos
europeus e 1% das populações árabes
Atividade de lactase Dois alelos principais, para atividade alta e baixa Uma atividade baixa após o início da infância
(intolerância à lactose) é comum nos africanos e asiáticos (freqüência alélica de 0,8-0,95) e menos comum nos europeus
setentrionais e nos caucasianos dos EUA (freqüência alélica de 0,17-0,48)
VARIAÇÃO GENÉTICA EM POPULAÇÕES 1 85

QUADRO 7-3
·Frêqü~ncias -GenotípÍcas parà·O'·Ale lo CCR5·Nórnfáf é{o1\lef(:{bêfoi~êia{'a"êtR5·.:-~'.~~J7~:' ,-rp::;:;:~~;~'.~;.;,;~~:'.~;:~'i:',-.~~:<:
~· ~ '~ . : '··· . • ::~ ' • • •- - • • • ' . •• • -· ~-- ,· 1 , :. '~ • .:-.- ~ • L •, ;', • -: ·.1: :.~:..: .::.~: ; .__. r.--·-, ~ -·. '., . :.': .~t.-...: ;( : !".• ·,t;~~.;~.;.,;..u. ~3•.. !:'I.'-,.::-:.;.,:.. -._::~-;,::-L:.·/, i.:,', ~,'...-~..\~::~.:~.;_;'°1.:>;_; .~;:'::_\=-;';.·...
N.0 de Freqüência Genotípica Freqüências
Genótipo Pessoas Relativa Observada AlelO Alélicas Derivadas
CCR5/CCR5 647 0,821
CCR5/ílCCR5 134 0,1682 CCR5 0,906
ílCCR5/ílCCR5 7 O,Ql08 .dCCR5 0,094
Total 788 l,000
Dados de Martinson J l, Chapman N. H , Rees D C , et ai (1997) Global distribution of the CCR5 gene 32 basepnir deletion . Nat Genet 16: 100-103.

A LEI DE HARDY-WEINBERG alelo A pode ser herdado da mãe e o alelo a do pai, ou vice-versa).
A primeira propriedade importante da lei de Hardy-Weinberg é
Como mostramos no exemplo do gene de receptor de citocina que as freqüências dos três genótipos AA, Aa e aa são dadas pe-
CCR5, podemos usar uma amostra de indiv~duos de uma popu- los termos da expansão binomial de (p + q)2 = p2 + 2pq + <f.
lação para obter as estimativas da freqüência relativa dos dois Uma segunda e crucial implicação da lei de Hardy-Weinberg é
aielos na população como um todo simplesmente contando os que as proporções dos genótipos não mudam de geração para ge:.
alelos em indivíduos com cada genótipo. E quanto ao contrário? ração. Isto é, as freqüências genotfpicas da população permanece-
Podemos calcular a proporção da população com vários genóti- rão constantes, em equilfürio, se as freqüências alélicasp e q se man-
pos uma vez que saibamos as freqüências alélicas? Obter as fre- tiverem constantes. Mais especificamente, quando há uma repro·
qüências genotfpicas a partir das freqüências alélicas não é tão dução aleatória em uma popufação na qual os genótipos AA, Aa e
direto quanto a contagem porque não sabemos antecipadamente aa estão presentes nas proporções p1:2pq:q2, as freqüências geno-
como os alelos são distribuídos entre os homozigotos e hetero- típicas na geração seguinte pe~anecerão nas mesmas proporções
zigotos. Entretanto, quando uma população atende a certas su- relativas,p2:2pq:<f. A prova deste equil.fürio é mostrada no Qua-
posições, há uma relação matemática simples, conhecida como dro 7.4, E importante notar que o equilfürio de Hardy-Weinberg
a lei de Hardy-Weinberg, para calcular as freqüências genotí- não especifica nenhum valor particular para p e q: quaisquer que
picas a partir das freqüências alélicas. Esta lei, a pedra angular sejam as freqliências a/éticas presentes na população resultarão
da genética de populações, foi assim designada porqu.e Geoffrey nas freqüências genotípicas de p 2.:2pq:<f e estas freqüências ge-
Hardy, um matemático inglês, e Wilhelm Weinberg, um m~dico notípicas relativas continuarão cons_tantes de geração para gera-
alemão, formularam-na independentemente em 1908. ção enquanto as freqüências alélicas permanecerem constantes.
Suponha que p seja a freqüência de um alelo .1 e g seja a fre- Aplicando a fórmula de Hardy-Weinberg ao exemplo de
qüência de uni alelo a no pool de genes e ·qúe o,s alelos se combi- ·CCR5 dado anteriormente, com as freqüências relativas dos dois
nem aleatoriamente em genótipos. Ou seja, a reproduÇão na po- alelos no pool de genes de 0,906 (para o alelo normal CCR5) e
pulação é totalmente aleatória com relação aos genótipos neste 0,094 (para ílCCR5), a lei de Hardy-Weinberg diz que as pro-
locus. A chance de que dois alelos A formem um par para dar um porções relativas das três combinações de àielos (genótipos) são
genótipo AA é p1, a chance de que dois alelos a se juntem para dar p1 = 0,906 X 0,906 = 0,821 (para obter dois alelos CCR5 do
um genótipo aa é q2 e a chance de ter um par com um A e um a, pool), q2 = 0,094 X 0,094 = 0,009 (para dois alelos ílCCR5) e
resultando no genótipo Aa, é 2pq (o fator 2 vem do fato de que o 2pq = (0,906 X 0,094) + (0,094 X 0,906) 0,170 (para um =
QUADRO 7-4
Freqüências de Tipos Reprodutivos e Proles para uma Populaçâo em Equilíbrio· dé ·Hardy~Weinberg c~m
' GéhotiposPar~ntaisria -Proporçãopl:ipqiq2_:.,_<· . .:·:_·_._ , · ._ ·. .. . ·. ,.. -"-'·.-· · ·.
: . ·· · ·~·.'• .•; ..: ·'..· ' . · • • •: -~ •• ~ .-. :
» -. .. .
'.:. • •• ,,, . , • •• · . _. . . . .. .. ( ... ·• - ~:-.-: •• ': ·.'~ ·;''· .. . . . .. . , , • ·. ... . . . .. .. . • ,_
.- _··:< :):"" ..:
... . . . .•. .~··· ·. ' • • • 1 -

Tipos Reprodutivos Prole


Mãe Pai Freqilência AA Aa ªª
AA AA p1 X p1 = p4 1 (p')
AA Aa p1 X 2pq = 2p3q 1/2 (2p3q) 1/2 (2p3q)
Aa AA 2pq X p2 = 2p3q 112 (2p3q) 1/2 (2p3q)
AA p2 X q2 = p?q? 1 (p2q2)
ªª
AA pl X q2= p2q2 1 (pl ql)
ªª
Aa Aa 2pq X 2pq = 4p2q1 1/4 (4p1q2) 112 (4p2q2) 1/4 (4p2q2)
Aa 2pq X q1 = 2pq3 1/2 (2pq3) 1/2 (2pq3)
ªª
Aa 2pq X q2 = 2pq3 1/2 (2pq3) 112 (2pq3)
ªª ql X q1 = cf 1 (q4)
ªª ªª
Genótipos resultantes de todas p? 2pq q'
as reproduções passiveis

Soma da prole M = p' + 2q'q + p1q1 = p'(p1 + 2pq + q1) = p'(p + q)' = p' (Lembre que p + q = 1)
Soma da prole Aa = 2/Yq + 4p'q' + 2pq' = 2pq(p' + 2pq + q') = 2pq(p + q)' = 2pq EÜBLIOTECA
Soma da prole aa = p'q' + 2pq' + q' = q'(p' + 2pq + q') = q' (p + q)' = q2 UN1PA0
JUIZ DE FORA - M~
86 ' VARIAÇÃO GENÉTICA EM POPULAÇÕES

CCR.5 e um alelo LlCCR.5). Quando estas freqüências genotípi- ilustrar as freqüências gênicas e freqüências genotípicas quando
cas, que foram calculadas usando a lei de Hardy-Weinberg, são o gene de interesse é ligado ao X, usamos a característica conhe-
aplicadas a uma população de 788 indivíduos, os números obti· cida como daltonismo vermelho-verde, que é causada por muta-
dos de pessoas com os três genótipos diferentes (647: 134:7) são, ções nas séries de genes de pigmento visual vermelho e verde
de fato, idênticos aos reais, observados no Quadro 7..3. no cromossomo X Usamos o daltonismo como um exemplo
Como vimos, as distribuições de Hardy-Weinberg dos genó- porque, tanto quanto sabemos, esta não é uma característica de-
tipos nas populações são simplesmente uma distribuição bino- letéria (exceto por possíveis dificuldades nos sinais de trânsito),
mial (p + q)", na qual os símbolos p e q representam as freqüên- e as pessoas daltônicas não são sujeitas à seleção Como já foi
cias de dois alelos alternativos em um locus (em que p + q = 1) discutido, considerar o efeito da seleção complica as estimati-
e n ,,,, 2, representando o par de alelos em qualquer locus autos- vas de freqüências gênicas
sômico ou qualquer locus ligado ao X nas mulheres, (Como os Usamos o símbolo cb para o alelo mutante de daltonismo e o
homens são únicos em ter só um cromossomo X, as freqüências símbolo + para o alelo normal, com as freqüências q e p, res-
de genes ligados ao X nos homens serão consideradas separada- pectivamente, como mostra o Quadro 7.5 As freqüências dos
mente, mais adiante ) Se um locus tiver três alelos, com as fre- alelos nonnal e mutante podem ser detenninadas diretamente pela
qüências p, q e r, a distribuição genotípica poderá ser determi- incidência dos fenótipos correspondentes nos homens simples-
nada por (p + q + r) 2. Em termos gerais, as freqüências genotí- mente contando os alelos. Como as mulheres têm dois cromos-
picas para qualquer número conhecido de alelos a,, com freqüên- somos X, seus genótipos são distribuídos binomialmente, da
cias alélicas p ,, p 2 . .. • p podem ser obtidas a partir dos termos da
11 mesma fonna que os genótipos autossômicos, mas como os ale-
expansão de (p 1 + Pi + PY Jos de daltonismo são recessivos os homozigotos normais e he-
terozigotos não são distinguíveis. Corno mostra o Quadro 7.5, a
Uso da Lei de Hardy-Weinberg freqüência de daltonismo nas mulheres é muito mais baixa que
nos homens, muito embora as freqüências alélicas sejam, logi-
A principal aplicação prática da lei de Hardy-Weinberg em ge- camente, as mesmas em ambos os sexos . Menos de 1% das mu-
nética médica é na consulta genética para distúrbios autossômi- lheres são daltônicas, mas quase 15% são portadoras de um ale-
cos recessivos. Para uma doença tal como a fenilcetonúria (PKU) lo mutante para daltonismo e estão, portanto, em risco de ter fi-
(ver Cap 12), a freqüência de homozigotos afetados na popula- lhos daltônicos.
ção pode ser determinada com precisão, pois a doença é identi-
ficada pelos programas de triagem neonatat Os heterozigotos,
entretanto, são assintomáticos, portadores silenciosos, e sua in- FATORES QUE PERTURBAM O
cidência populacional é impossível de avaliar diretamente pelo EQUILÍBRIO DE HARDY-WEINBERG
fenótipo. A lei de Hardy-Weinberg permite que uma estimativa
da freqüência de heterozigotos seja feita e usada subseqüente- A formulação da lei de Hardy-Weinberg requer várias suposi-
mente para a consulta. Por exemplo, a freqüência de PKU é de ções fundamentais citadas no Quadro 7,6. No mundo real da
cerca de 114.500 na Irlanda Como todos os indivíduos afetados genética médica envolvendo populações humanas e alelos de
são homozigotos para um alelo mutante, q2 = 1/4.500 e, portan- doenças, estas suposições em geral não se confinnam, e os ge-
to, q = ~1/4.500 = 0,015 e 2pq = 0,029 ou cerca de .3%. A nótipos em uma população podem não estar em equilíbrio de
Hardy-Weinberg. Como será mostrado nas seções que se seguem,
freqüência de portadores na população irlandesa é, portanto, de
a violação da suposição de reprodução aleatória pode causar gran-
.3%, e haveria uma chance de aproximadamente .3% de um geni-
des desvios da freqüência da doença baseada em freqüências
tor conhecido como portador de PKU pelo nascimento de um
alélicas . Por outro lado, as mudanças em freqüências alélicas
filho afetado descobrir que um novo côr\juge de etnicidade ir-
decorrentes de mutação, seleção ou migração causam mais des-
landesa também é portador. Se este novo cônjuge fosse da Fin-
lândia, entretanto, onde a freqüência de PKU é muito menor(± vios pequenos e sutis do equilíbrio de Hardy-Weinberg. Se o
1/200 .000), sua chance de ser portador(a) seria de apenas 0,6%. equilíbrio de Hardy-Weinberg não ocorrer em um determinado
locus, é instrutivo investigar por que um determinado alelo de
doença e seus genótipos associados não estão em equilíbrio de
FREQÜÊNCIAS DE GENES E Hardy-Weinberg em uma determinada população. Quais das
GENÓTIPOS LIGADOS AO X suposições subjacentes estão sendo violadas e o que isto nos
ensina sobre a população que está sendo estudada, a taxa de
Lembre-se de que para genes ligados ao X só existem dois ge- mutação para este locus, e o efoito do alelo da doença na sobre-
nótipos masculinos possíveis, mas três genótipos femininos Para vivência e na reprodução?

QUADRO 7-5
.. · '. ·.\::\ ~· .
.. .
- '·-·. :,·; ' .' :::.:~··,·.-..::.:'·-:' ·.:·
Sexo Genótipo Fenótipo Incidência (Aproximada)
Homem x+ Visão em cores normal p = 0,92
X'b Daltonismo q = 0,08
Mulher X+fX+
x +fXcb
Normal (homozigoto) p 2 = (0,92)2 0,8464=
Normal (heterozigoto) 2pq = 2(0,92)(0,08) = 0,1472
Normal (total) p 1 + 2pq = 0,9936
,X<bfXcb Daltônico q 2 = (0,08) 2 = 0,0064
VARIAÇÃO GENÉTICA EM POPULAÇÕES ! 87

QUADRO 7-6 indo os americanos nativos, os asiáticos e os hispânicos. De modo


A Lei de Ha~dy-Weinbe~g É aaseada 'en:i-:>·: .... ; {;_O:: :- • semelhante, as freqüências gênicas podem vaziar muito entre os
países da Europa ou da Ásia. Quando a seleção de cônjuges em
Vári~~SUP?,siçõe~ .- -;, ·" ~_< :-: . '-~ ', , · ._· .:,;J,i , .'.; o•::
uma população é restrita a membros de um deterniinado su~gru­
I. A população é grande e as reproduções são aleatóriás com relação po dentro desta população, o resultado para qualquer locus com
ao locus em questão
mais de um alelo é um excesso de homozigotos na população como
2 As freqüênciàs alélicas permanecem constantes com o tempo
porque: um todo e uma correspondente deficiência de heterozigotos.
(a) Não há uma taxa apreciável de mutação Suponha que uma população contém um grupo minoritário
(b) Os indivíduos com todos os genótipos são igualmente capazes constituído de 10% da populàção na qual um alelo mutante para
de se reproduzir e transmitir seus gene.s, ou seja, não há uma doença autossômica recessiva tem uma freqüência q min = 0,05 .
seleção contra nenhum genótipo em particular Na maioria restante de 90% da população, qm,i é de quase O. Uin
(c) Não houve imigração significativa de indivíduos de urna exemplo de tal situação é a população afro-americana dos EUA e
população com freqüências alélicas muito diferentes da o alelo mutante do locus de 13-globina responsável pela anemia
população endógena falciforme. A freqüência geral do alelo da doença na população
total, %or• é, portanto, igual a 0,05/10 = 0,005 e, simplesmente se
aplicando a lei de Hardy-Weinberg, a freqüência da doença na
população como um todo seria de q2pop = 0,000025, se a reprodu-
Exceções à Reprodução Aleatória ção fosse perfeitamente aleatória em toda a população. Em mui-
tos casos, entretanto, um grupo minoritário se reproduz quase que
O princípio da reprodução aleatória é que, para qualquer locus, exclusivamente com outros membros do grupo minoritário . En-
um indivíduo com um determinado genótipo tem uma probabi- tão, a freqüência de indivíduos afetados no grupo minoritário se-
lidade puramente aleatória de se casar com outro de qualquer ria (<fmin) = 0,0025, e como o grupo minoritátio representa 1/10
outro genótipo, sendo as proporções determinadas apenas pelas da população total, a verdadeira freqüência da doença na popula-
freqüências relativas dos diferentes genótipos na população. A ção total é de 0,0025/10 = 0,00025, 10 vezes maior do que se
simples observação, entretanto, mostra que vários fatores, alguns esperaria aplicando a lei de Hardy-Weinberg à população como
geneticamente significativos e outros provavelmente neutros em um todo sem considerar a estratificação. Por comparação, a estrati-
termos genéticos, entram na escolha de um cônjug~ . Estes fato- ficação não tem efeito na freqüência de uma doença autossômica
res são a estratificação, o casamento preferencial e a c·onsan- dominante e só teria um efeito muito pequeno na freqüência de
güinidade. uma doença ligada ao X aumentando o pequeno número de mu-
lheres homozigotas para o alelo mutante.
E$TRA'T lf'ICAÇÃO
. : Como o~ subgrupos provavelmente têm freqüências diferen-
tés de vários-ge_n.és de d9enças à~tossê)il:~"icas recessi~as, _ suas.
Uma popuiação estratificada é áquda que corit.ém vários_sut.>giu- doênçás cara~terísticas provavelmente diferem. Os exemplos
pos qué permaneceram,' eni sua maior parte, geneticamente dis- bem conhecidos ~ncluem a doença de Tay:Sáchs nas pessoas
tintos durante a evolução uioderria. Em todp ô mando;·existem com ancestrais judeus Ashkenaz,i, tipos característicos de talas-
várias populações estratificadas. Por exemplo, a população dos semia nas pessoas do Mediterrâneo ou descendentes do leste
EUA é estratificada em dois subgrupos p1incipais, os caucasianos da Ásia, anemia falciforme em afro-americanos e fibrose cisti-
e os afro-americanos, bem como vários outros subgrupos, inclu- ca e PKU em caucasianos (ver os quadros 7.1 e 7.7). Cada

QUADRO 7- 7
lnddênc:ia/ Freqüência GênÍca e Fréquê~cia de Heterozigotos para DistÜrbios Autossômicós R~cessivos ·
. Seléciona~~~:-~'?. P°-p~~~-Ções Di~~ren~~~/':\. · · . · . . < ; .· . ·... · · · ·. ' . · / >:- 0
.' , · <,. .,
Freq"üência Freqüência de Heterozigotos
Incidência Gênica Heterozigotos Homozigotos
Distúrbio População (ql) (q) (2pq) (2pq/ql)

Anemia falciforme Afro-americanos I em 400 0,05 l em 11 38


(genótipo SIS) Hispano-americanos 1em40.000 0,005 l em 101 396
Deficiência de o: 1-antitripsina Dinamarca 1em2..000 0,023 1em 22 90
(genótipo m) Afro-americanos 1em100 000 0,004 1em125 800
dos EUA
Fibrose cistica Caucasianos dos EUA l em 2.000 0,023 l em 22 90
Fenilcetonúria Escócia 1em5.300 0,014 l em 30 175
Finlândia l em 200.000 0,002 1em250 800
Japão 1em109.000 0,003 l em 166 657
Doença de Tay-Sachs Judeus Ashkenazí 1em3900 0,016 1em30 130
dos EUA
Caucasianos não- l em ll2000 0,003 1 em 170 660
Ashkenazi dos EUA
Os números são aproximados Dados do Online Mendelian Inhericance in Man ( <http l /www3.ncbi nlm.nili.gov!Omim.1>) e de Scriver C R., Beaudet A. L . Sly W
S , Valle D. (eds) (2000) 111e Membolic and Molecular Basis of lnherited Disease, 8' ed McGraw-Hill, New York
88 ' VARIAÇÃO GENÉTICA EM POPULAÇÕES

subgrupo parece ter seu próprio perfil de distúrbios que são mais QUADRO 7-9
comuns e outros que são menos comuns que na espécie como Et.nicidade de Doenças Genéticas
um todo
a 0-talassemia Diferentes mutações de deleção no
A ESTRATIFICAÇÃO AFETA A FREQÜÊNCIA DE
Mediterrâneo e sudeste da Ásia
Atrofia de giro Única mutação predominante no gene de
ALELOS ESPECÍFICOS DE DOENÇAS
ornitina arninotrnnsferase na Finlândia
Muitos distúrbios genéticos são caracterizados por mutações Mutações diferentes encontradas em
alélicas que variam em freqüência entre populações de diferen- outras populações. .
tes grupos, provavelmente porque um pequeno número de mu- Doença de Tay-Sachs Inserção de 4 pares de bases no éxon 11
e uma substituição de G por C no
tações ancestrais tomou-se prevalecente em determinadas po- primeiro nucleotídeo do íntron 12 são
pulações e não se espalhou para a população como um todo as duas mutações comuns nos judeus
devido à estratificação A existência de alelos mutantes espe- Ashkenazi; uma deleção de 7,6 kb na
cíficos de populações tem um significado para a compreensão ponta 5' do gene é a mutação mais
das origens das doenças genéticas e também cria oportunida- comum nos franco-canadenses Outros
des para o diagnóstico de alelos específicos em uma popula- alelos são vistos em outras populações
ção de risco Por exemplo, os estudos da 13-talassemia levaram Câncer de mama Heterogeneidade mutacional na
à identificação de defeitos moleculares específicos no gene de hereditário maioria das populações, mas deleção
(BRCAJ e BRCA2) de 2 pares de bases na posição 185 e l
13-globina e ao reconhecimento de suas distribuições populaci-
inserção de par de bases na posição
onais (ver Cap . 11 ) . Muito embora dúzias de alelos diferentes 5.382 em BRCA2 e deleção de um par
possam causar 13-talassemia, alguns alelos tendem a ser mais de bases em 6 174 em BRCAI
comuns em algumas populações que em outras, de modo que constituem a maioria dos alelos
cada população tem apenas alguns alelos comuns (Quadro 7 8). mutantes nos judeus Ashkenazi
Por exemplo, os alelos mais comuns de 13-talassemia em pes- Hipercolestcrolemia Heterogeneidade mutacional na
soas do Mediterrâneo, responsáveis por mais de 90% dos ca- familiar maioria das populações, mas os franco-
sos da goença, são muito raros nas pessoas do sudeste da Ásia canadenses têm uma mutação
ou da Asia subcontinental. De modo similar, os alelos mais predominante, urna deleção do
comuns nos indivíduos do sudeste da Ásia e nos índios asiáti- promotor e do éxon l ; um códon de
término prematuro no aminoácido 660
cos são raros nos dois outros grupos étnicos não-relacionados é muito freqüente nos libaneses, mas
Esta informação é de grande valor prático na consulta genética raro em outras partes.
e no diagnóstico pré-natal. Por exemplo, na América do Norte,
quando as pessoas descendentes do Mediterrâneo estão em ris-
co de ter um filho com ~-talassemia, o teste do DNA parental
para apenas sete alelos mutantes tem mais de 90% de probabi-
Um aspecto clinicamente importante do casamento preferen-
lidade de da:r a informação necessária ao diagnóstico pré-na-
cial é a tendência de escolher parceiros com problemas médicos
tal. Uma freqüência similar aumentada de alguns alelos mutan-
similares, tais como surdez ou cegueira congênita ou estatura
tes foi observada em populações específicas para muitas outras
excepcionalmente baixa (nanismo). Em tais casos, a expectativa
doenças genéticas (Quadro 7 9).
do equilíbrio de Hardy-Weinberg não se aplica, pois o genótipo
do parceiro no locus da doença não é determinado pelas freqüên-
(ASAlvlEMTO PREFEREMCIAL cias alélícas encontradas na população em geral. Por exemplo,
no caso de dois genitores com acondroplasia, um distúrbio do-
O casamento preferencial é a escolha de um pa:r·ceiro porque ele
minante, a prole homozígota para o gene de acondroplasia tem
P?ssui alguma característica determinada. O casamento preferen-
uma forma grave e letal de nanismo que quase nunca é vista, a
cial em geral é positivo, isto é, a pessoa tende a escolher uma
menos que ambos os genitores s~jam heterozigotos para acon-
outra que lhe seja similar (p. ex., mesma língua, inteligência,
droplasia
estatura, cor da pele, talento musical ou habilidade atlética). O
casamento preferencial negativo, a seleção de um parceiro com Quando os parceiros têm distúrbios autossômicos recessi-
cara7terísticas diferentes de si mesmo, é menos comum. Do ponto vos causados pela mesma mutação ou por mutações alélicas
de v1~ta de que a característica compartilhada pelos parceiros é º?mesmo gene, toda a sua prole também terá a doença. Lo-
geneticamente determinada, o efeito genético geral do casamento gicamente, nem toda surdez, cegueira ou baixa estatura tem a
prefere_ncial p_ositivo é um aumento na proporção de genótipos mesma base genética, Por exemplo, foram descritas muitas fa.
homozigotos a custa do genótipo heterozigoto. mílias nas quais dois genitores albinos tiveram filhos com pig-
mentação normal ou dois genitores surdos tiveram filhos com
audição normal devido à heterogeneidade de locus (discutida
no Cap. 5) No entanto, mesmo se houver uma heterogenei-
QUADRO 7-8 dade genética, com o casamento preferencial a chance de que
as duas pessoas estejam portando mutações no mesmo locus
Aleios' de p-tala~selllia:
.
~m. bifeiêni~s Grupos
. _.. -- ; - .. ' •... .'--: ·. -:. ·, ·.. >.<, -_,.. ·: . ó···::, :_: . : ..
Étnicos
·., : - : : ' . ' :. ·. -. ·::,
~,
< de doença aumenta em relação ao que aumentaria com uma
N.º de Alelos reprodução aleatória e, portanto, o risco do distúrbio em sua
População de /I·talassemia prole também aumenta.. Embora para a população o efeito a
longo prazo deste tipo de casamento preferencial positivo
Mediterrânea 15 (7 correspondem a 92% do total)
Chinesa/Sudeste da Ásia sobre as freqüências de genes de doença seja insignificante,
9 (8 correspondem a 91 % do total)
Asiáticos Indianos 10 (5 correspondem a 90% do total} uma família específica pode se encontrar em um risco genéti-
co muito alto ..
VARIAÇÃO GENÉTICA EM POPULAÇÕES 1 89

CONSANGÜINIDADE S ELEÇÃO CONlRA MUTAÇÕES AUTOSSÔMICAS


DOMINANTES
O casamento consangüíneo ou endogamia, assim como a es-
tratificação e o casamento preferencial positivo, causa um aumen- Os alelos mutantes domiriantes estão totalmente expostos à se-
to na freqüência de doenças autossômicas recessivas pelo aumen- leção, em contraste com os alelos mutantes recessivos, cuja
to da freqüência com a qual os portadores de um distúrbio au- maioria está "escondida" nos he terozigotos. Conseqüentemente,
tossômico recessivo se casam. Ao contrário dos distúrbios em os efeitos da seleção e da mutação são mais óbvios e podem
populações estratificadas, nos quais cada subgrupo provavelmen- ser mais prontamente avaliados para características dominan-
te tem uma alta freqüência de alguns alelos, os tipos de distúrbi- tes. Um alelo dominante letal, se totalmente penetrante, é ex-
os reçessivos vistos na prole de genitores aparentados podem ser posto à seleção nos heterozigotos, havendo a remoção de to-
muito 1aros e incomuns, pois os casamentos consangüíneos per- dos os alelos responsáveis pelo distúrbio em uma única gera-
mitem que alelos incomuns fiquem em homozigose. ção. Várias doenças humanas são suspeitas ou conhecida~ como
sendo características autossômicas dominantes com adaptabi-
Exceções à Constância das Freqüências Alélicas lidade zero ou quase zero e, portanto, sempre resultam de mu-
tações novas, em vez de herdadas, autossômicas dominantes
Em contraste com o casamento não-aleatório, que pode pertur- (Quadro 7. 10). Em algumas delas, os genes e os alelos mutan-
bar muito o equilíbrio de Hardy-Weinberg, as mudanças nas fre- tes específicos são conhecidos, e os estudos familiares mostram
qüências alélicas decorrentes de seleção, mutação ou migração mutações novas nos indivíduos afetados que não foram herda-
em geral ocorrem lentamente, em pequenos aumentos, e causam das dos genitores. Em outzas condições, os genes não são co-
muito menos desvio do equilíbrio de Hardy-Weinberg. A muta- nhecidos, mas o efeito da idade paterna (ver Cap . 6) já foi vis-
ção e a migração em geral ocorrem em taxas que estão bem abaixo to, o que sugere (mas não prova) uma nova mutação na linha-
da freqüência de portadores e, assim, também têm pouco efeito gem germinativa paterna como uma possível causa do distúr-
a curto prazo sobre a freqüência alélica geral. Como veremos mais bio . A implicação para a consulta genética é que o genitor de
adiante, a seleção também tem pouco efeito nas freqüências alé- uma criança com uma condição genética letal autossômica
licas em doenças autossômicas recessivas, pois a grande maio- dominante tem um risco baixo de recorrência, pois a condição
ria dos alelos mutantes está protegida da seleção negativa nos em geral necessitMia de outra mutação independente para re-
heterozigotos. Entretanto, para doenças dominantes ou ligadas correr (exceto nas raras circunstâncias de mosaicismo da linha-
ao X, bem como no caso dos heterozigotos para doenças reces- gem germinativa para a condição; ver Cap. 5).
sivas que têm vantagem seletiva sobre os homozigotos para o Se uma doença dominante for deletéria ni.as não letal, as pes-
alelo normal, a seleção pode perturbar significativamente as fre- soas afetadas poderão se reproduzir, mas, entretanto, contribu.i -
qüências aléiicas em relação ao que seria esperado sob o equilí- rão com menos que o número médio de prole para a geração
brio de Ha.rdy-Weinberg, reduzindo ou aumentando substanci- seguinte. Isto é, sua adaptabilidade, f. pode ser reduzida. Tal
almente alguns genótipos. mutação é perdida por seleção a uma taxa proporcional à perda

MUfAÇÃO E SELEÇÃO

A base molecular da mutação foi considerada em detalhes no Cap. QUADRO 7- 10


6. No presente contexto, introduzimos o conceito de adaptabi-
lidade, o principal fator que determina se uma mutação é imedi-
atamente perdida, toma-se estável na população ou até mesmo,
com o tempo, transforma-se no alelo predominante no locus
envolvido. A freqüência de um alelo em uma população repre-
senta um balanço entre a taxa na qual os alelos mutantes surgem
.l~~i~li~i~i(t.~l~ifil~~~iii~~i~i~lt
Acrodisostose Anomalias congênitas múltiplas,
especialmente mãos curtas com
disostose periférica, nariz pequeno e
por mutação e os efeitos da seleção Se a taxa de mutação ou a
deficiência mental.
efeti vidade da seleção for alterada, a freqüência do alelo deverá Síndrome de Apert Craniosinostose, polegar e háJux grandes,
mudar. 61bitas rasas, hipertelodsmo e
A transmissão de um alelo para a geração seguinte depende deficiência mental variável, mas
de sua adaptabilidade (f), que é uma medida do número de des- freqüente. Mutação no gene receptor-2
cendentes de pessoas afetadas que sobrevivem até a idade repro- do fator de crescimento de fibroblasto.
dutiva, quando comparados com um grupo controle apropriado. É muito raro que uma pessoa com esta
Se um alelo mutante tiver a mesma probabilidade que o alelo síndrome dismórfica tenha prole. Caso
nonnal de ser representado na geração seguinte,fserá ig ual a 1. tenha, cerca de 50% da prole é afetada.
Se um alelo causar a morte ou esterilidade, o que significa que a Atelosteogênese Fmma letal precoce de nanismo de
membros curtos
seleção atua totalmente contra ele,fserá igual a O. Um parâme-
Síndrome de Comelia Retardo mental, rnicromelia, sinofris
tro relacionado é o coeficiente de seleção, s, que é a medida da de Lange e outras anomalias.
perda de adaptabilidade e é definido por 1 - f Do ponto de vista Síndrome de Osso denso; sinfalangismo; pele
genético, uma mutação que impede a reprodução por um alelo é hiperostose de frouxa.
tão letal quanto uma que causa um aborto de um embrião, pois Lenz-Majewski
em ambos os casos o mutante não é transmitido para a geração Osteogênese imperfeita, Tipo letal petinatal, com um defeito
seguinte. A adaptabilidade é, portanto, o resultado dos efeitos tipo 2 no colágeno tipo 1 (ver Cap.. 12)
conjuntos da sobrevida e da fertilidade. No sentido biológico, a Displasia tanatofódca Forma letal precoce de nanismo de
adaptabilidade não tem conotação de capacidade superior, ex- membros curtos devida a mutações no
ceto em um aspecto: a habilidade comparativa prua contribuir gene de receptor-3 do fator de
crescimento de fibroblasto.
para o pool de genes da geração seguinte .
90 1 VARIAÇÃO GENÉTICA EM POPULAÇÕES

de adaptabilidade dos heterozigotos Por exemplo, os anões acon- apenas l indivíduo em 10.000 (q2) é um homozigoto com dois
droplásicos têm apenas cerca de um quinto dos filhos que as alelos mutantes. A proporção de alelos mutantes nos heterozi-
pessoas nonnais da população Assim, sua adaptabilidade mé- gotos é dada por
dia, f, é 0,20, e o coeficiente de seleção, s, é 0,80. Na geração
subseqüente, apenas 20% dos atuais alelos de acondroplasia são 2/10.000 = ± o 02
passados adiante pela atual geração para a seguinte. Como a fre- (2/10 000) + (1/100) •
qüência da acondroplasia não está diminuindo, novas mutações Assim, apenas cerca de 2% de todos os alelos mutantes na
devem ser responsáveis por substituir os 80% de genes mutan- população estão em homozigotos afetados e, portanto, expostos
tes na população perdidos pela seleção. à seleção se um tratamento dietético não estiver disponível. Eli-
minar a seleção contra um distúrbio autossômico recessivo tal
0 BALANÇO ENTRE MUTAÇÃO E
como a PKU por meio de tratamentos médicos bem-sucedidos
SELEÇÃO NAS DOENÇAS DOMINANTES
teria um efeito muito lento no aumento da freqüência gênica em
muitas gerações. Assim, desde que os casamentos sejam aleató-
A taxa de mutação dos distúrbios autossômicos dominantes pode rio.s, os genótipos em doenças autossômicas recessivas podem
ser medida tanto direta quanto indiretamente. Como vimos no ser co11siderados como estando em equilfbrio de Hardy-Wei11-
Cap 6, as medidas diretas são precisas apenas quando todos os berg, a despeito da seleção contra os homozigotos para o ale/o
casos de um distúrbio na população são corretamente diagnosti- recessivo. A relação matemática e11tre genótipo e freqüências
cados e avaliados e os pacientes com genitores não-afetados são alélicas descrita na lei de Hardy-Weinberg se mantém para a
identificados, Também podemos medir a incidência de uma nova maioria dos.fins práticos em genética médica. Exemplos seleci-
mutação em um locus de doença indiretamente se houver dispo- onados das relações entre a incidência, a freqüência gênica e a
nibilidade de uma medida precisa da adaptabilidade: a taxa de freqüência de portadores (heterozigotos) para doenças autossô-
mutação por geração em um Iocus de doença deve ser suficiente micas recessivas em vários grupos étnicos são mostrados no
para justificar a proporção de alelos mutantes perdidos pela se- Quadro 7.7..
leção em cada geração. Assim, a taxa de mutação, µ, dev~ ser
igual ao coeficiente de seleção, s, vezes a freqüência do alelo, q.
SELEÇÃO CONTRA MUTAÇÕES RECESSIVAS LIGADAS AO X
A freqüência alélíca observada em qualquer geração repre-
senta um balanço entre a perda de alelos mutantes pelos efeitos Quase todos os fenótipos ligados ao X de interesse médico são
da seleção e o ganho de alei os mutantes por mutação recorrente. recessivos, e, portanto, como regra geral, a seleção ocorre em
Uma freqüência estável de alelo é atingida em qualquer nível que homens hemizigotos e não em mulheres heterozigotas, exceto
balanceie as duas forças opostas: uma (seleção) que remove ale- para a pequena proporção de mulheres que são heterozigotas
los mutantes do pool de genes e uma (mutação nova) que volta a manifestantes com baixa adaptabilidade. Nesta rápida discussão,
adicionar uma nova. Assim, se a adaptabilidade das pessoas afe- entretanto, assumimos que as mulheres heterozigotas têm adap-
tadas repentinamente aumentasse (em função dos avanços mé- tabilidade normal.
dicos, por exemplo), a incidência observada da doença na popu- Se um fenótipo ligado ao X for benigno e se os homens afeta-
lação aumentaria e atingiria um novo equilíbrio. O retinoblasto- dos tiverem adaptabilidade normal, um terço dos alelos mutan-
ma e alguns outros tumores embrionários dominantes com iní- tes correspondentes estará nos homens e dois terços estarão nas
cio na infância são exemplos de condições que agora têm um mulheres, como já foi mostrado na discussão do daltonismo. Nos
prognóstico muito melhor, com as previstas conseqüências do graves distúrbios clínicos ligados ao X, tal como a distrofia
aumento de freqüência gênica na população. Por outro lado, se muscular Duchenne (DMD), nos quais os homens afetados não
as pessoas afetadas decidirem não ter nenhum filho (reduzindo se reproduzem, apenas os genes presentes nas mulheres porta-
assim efetivamente a adaptabilidade do alelo mutante a zero), a doras são transmitidos para a geração seguinte (ver Quadro 7.11).
incidência da doença imediatamente cairia, não a zero, mas a um Assim, nas doenças como a DMD, na qual há uma desvantagem
nível mantido pela introdução de novas mutações no pool gêni- seletiva operando apenas contra os homens hemizigotos (e, por-
co em cada geração. A freqüência alélica, a taxa de mutação e a tanto, apenas contra um terço dos alelos mutantes), a taxa de
adaptabilidade estão relacionadas . Assim, se quaisquer duas des- mutação deve ser igual ao coeficiente de seleção, s, vezes q/3 .
tas três características forem conhecidas, poderemos avaliar a Quando .s = l, tais doenças são chamadas letais genéticos liga-
terceira. dos ao X, e um terço de todas as cópias de tal gene mutante per-
de-se em cada geração. Como vimos no caso das mutações au-
tossôrnicas dominantes, os aielos mutantes perdidos por seleção
SELEÇÃO CON TRA MUTAÇÕES AUTOSSÔMICAS RECESSIVAS
devem ser substituídos por novas mutações recorrentes para
A seleção contra mutações recessivas pr~judiciais tem muito manter a incidência da doença observada . Portanto, prevê-se que
menos efeito na freqüência populacional do alelo mutante que a um terço de todas as pessoas que têm tais distúrbios letais liga-
seleção contra mutações dominantes porque, como já foi discu- dos ao X tem urna mutação nova, e suas mães geneticamente
tido, apenas uma pequena proporção dos genes está presente nos normais têm pouco risco de ter filhos subseqüentes com o mes-
homozigotos e, portanto, exposta às forças seletivas. Mesmo que mo distúrbio (sem rnosaicismo).
ocorresse uma seleção completa contra os homozigotos lf = O), Nos distúrbios menos graves, tais corno a hemofilia A, a pro-
como em muitas condições letais autossômicas recessivas, leva- porção de indivíduos afetados que representam mutações novas
ria muitas gerações para reduzir significativamente a freqüência é menor que um terço (de fato, cerca de 15%) . Como o tratamento
gênica, pois a maioria dos aielos mutantes é levada por heterozi- da hemofilia está melhorando rapidamente, a freqüência total de
gotos com adaptabilidade normal. Por exemplo, a freqüência de aielos mutantes deverá crescer relativamente rápido e atingir um
alelos mutantes causadores de PKU, q, é de aproximadamente novo equil.Jbrio, corno vimos no caso das condições autossômi-
1% em muitas populações caucasianas. Dois por cento da popu- cas dominantes, Supondo que a taxa de mutação neste locus per-
lação (2 X p X q) é heterozigota, com um alelo mutante, enquanto maneça a mesma, a proporção de hemofílicos que resulta de uma
VARIAÇÃO GENÉT'lCA EM POPULAÇÕES 1 91

QUADRO 7-11
..•.-_fo<:id.ên~i_a· ~·
·~ .Pl"~\i~itêndâ _d~ ·H~t~l-9zigô~as t>âr~·:. :·1[)i~tiír~i.ôsLigaâdsa<l
'·, ,·: ; ' ·: . . -, ---.. ,., -·.· ; : ,•-:: ··--.·; '.-.. :: •->> -.;_' .- ·.-e•,:_.-· :. -,._-_-'- , __.._. ; --_, ": .• >. ·.. · ;'. -.: '. ,. .;-._ .. ,·:_,_
~ ~.:: .--·.:·... ;__.. :
.:~_-_: ,"-~·:.-' :~_.
x: seiedônâdos
,.-' ;..··-_..: ;:. .. ::..: /:-.-·:-_:; .·.. :, .·.;.·.>. ',·. ,._: ·>: ..;· -·. _..:-.· ;·__.... _
··•,., -·····
-._: -·..-:· _,. ; -,:_. _.._. .
=. i _:-.. -·: _: ';__·,; • : : ~ '·
- :-:-·,_.:. ;~
·,:,>-·; :. . ·, , '·

Incidência cm Prevalência cm
Homens Aferodos Heterozigotas
Distúrbio População (Nativivos Masculinos) (População Feminina) Comentários
Distrofia muscular Europa, EUA, 113.650 112 740 Prevalência de heterozigotas
Duchenne Japão calculada supondo-se
adaptabilidade f = Oe taxas
de mutação iguais em homens
e mulheres
Hemofilia A EUA 115.000 1/2..500 Prevalência em heterozigotas
calculada supondo-se
adaptabilidade f = 0,7 e taxa de
mutação masculina > > taxa de
mutação feminina (15:1)
Deficiência Japão 1/80 000 1162 500 Prevalência em heterozigotas
de omitina calculada supondo-se
transcarbamilase adaptabilidade j = Oe taxas
de mutação iguais em homens
e mulheres
Síndrome do Austrália, EUA, 1-2/6.000 113 200 (com :!: Prevalência de heternzigotas
X frágil Finlândia, metade afetada) (portadoras de mutação total)
Taiwan, estimada
Holanda 1-2/500 pmtadoras Prevalência de heterozigotas
de pré-mutaÇão (portadoras de pré-mutação)
medida
Os números são aproximados. Os dados são do On-line Mendelian lnheritance in Man ( <hrrp llwww3.ncbi.nlrn.níh.gov/Omiml); Scriver C. R. et ai (1997) The
Metabolic and Molecular Bases of Inherited Disease, CD-ROM; de Vries B. B. et ai (1997) Screening and diagnosis for the fragile X syndrorne among the mentally
retarded: An epidemiological and psychological survey. Am J Hum Genet 61 :660-667; Morton J E. er ai ( 1997) Frngiie X syndrorne is less cornmon than previously
estirnated. I Med Genct 34:1-5; Reiss A L et ai (1994) Frequency and stability of the fragile X premutation. Hum Mo!Genet 3:393-398; Rousseau F. (1995)
Prevalence of caniers of premutation-size alicies of the FMR l gene - and implications for the population genetics of the fragile X syndrome Am J Hum Genet
57:1006-1018; Ryynanen M. er ai (1999) Feasibility and acceptance of screening for fragik X mutntions in low-risk pregnancies. Eur J Hum Genet 7:212-216;
TumerG. et ai (1996) Prevalence of fragile X syndrome. Am I Mcd Genet 64:196-197; Tzeng C C era[ (1999) Pilo! fragile X screening in nonnal population of
Taiwan Diagn Mo! Pathol 8:152-156. ·

nova mutação diminuirá, muito embora a incidência da doença mente elevada para um nível maior que o esperado, que é man-
aumente. Tal mudança telia implicações significativas para a tido seja pela taxa de mutação extraordinariamente alta ou pelo
consulta genética deste distúrbio (ver Cap. 19). aumento da adaptabilidade dos portadores heterozigotos sobre
os homozigotos nonnais em determinados ambientes.
Uma taxa de mutação elevada poderia, teoricamente, manter
SELEÇÃO A FAVOR DE l-IEIEROZIGOTOS
a alta freqüência de um alelo deletélio que é perdido de modo
(VANTAGEM DO HETEROZIGOT'O)
eficiente por seleção nas pessoas homozigotas recessivas. Entre-
As considerações feitas nas seções anteriores explicam as fre- tanto, não existe evidência de taxas de mutação aumentadas em
qüências atuais de alelos mutantes raros como um balanço entre distúrbios tais como a anemia falcifonne ou a fibrose cistica. O
a perda por seleção e o ganho por mutações novas. Entretanto, que existe, em vez disso, são situações ambientais nas quais os
como podemos explicar os distúrbios nos quais o alelo mutante heterozigotos para algumas doenças têm uma adaptabilidade
atinge freqüências bem altas, a despeito da adaptabilidade redu- aumentada em relação a ambos os genótipos homozigotos, uma
zida dos indivíduos afetados portadores destes alelos? Por exem- situação chamada de vantagem do heterozigoto. Mesmo uma
plo, as freqüências de portadores na fibrose cística são de 5% pequena vantagem do heterozigoto pode levar a um aumento na
entre os caucasianos, enquanto a freqüência da mutação da ane- freqüência de um alelo que é gravemente prejudicial nos homo-
mia falciforme nos afro-americanos é de 9% a 10%. Conside- zigotos, pois os heterozigotos superam em número os homozi-
rando a seleção substancial contra homozigotos para estes ale- gotos na população,
los mutantes, as duas únicas explicações possiveis são as seguin- Um exemplo bem conhecido de vantagem dos heterozigotos,
tes: (1) O alelo mutante está em uma freqüência maior que a embora não a única, é a resistência à malária nos heterozigotos
esperada em função de um fenômeno conhecido como deriva para a mutação da anemia falcifonne . O alelo falcêmico atingiu
genética: a população, embora razoavelmente grande agora, na sua freqüência mais alta em certas regiões do oeste da África,
verdade é derivada de um grupo muito pequeno de indivíduos, onde os heterozigotos são mais bem adaptados que ambos os
nos quais, apenas pelo acaso, a freqüência do alelo da doença homozigotos porque têm resistência ao organismo da malária.
começou muito alta. A freqüência do alelo mutante na verdade Nas regiões onde a malária é endêmica, os homozigotos normais
não está estavelmente elevada, mas ainda não passou tempo su- são suscetíveis à malária Muitos são infectados e afetados de
ficiente para que a seleção nos homozigotos diminua a freqüên- forma grave, ou mesmo fatal, levando a uma adaptabilidade muito
cia do alelo da doença. O papel da deriva genética será tratado reduzida. Os homozigotos para a anemia falciforme são ainda
na próxima seção. (2) A freqüência do alelo mutante é estavel- mais gravemente prejudicados, com uma adaptabilidade perto de
92 1 VARIAÇÃO GENÉTICA EM POPULAÇÕES

zero, por causa de sua grave doença hematológica (ver Cap. 11) Deriva Genética
Os heterozigotos para a anemia falciforme têm hemácias inós-
pitas ao organismo da malária, mas não sofrem afoiçamento sob Outra causa das altas freqüências para alelos de doenças deleté-
condições ambientais normais. Os heterozigotos são relativamen- rias em uma população é um fenômeno conhecido como deriva
te mais adaptados que ambos os homozigotos e se reproduzem genética, a flutuação de freqüência alélica aleatória que opera
em alta taxa. Assim, com o tempo, o alelo mutante da anemia em um pequeno pool de genes contido em uma população pe-
falciforme atingiu uma freqüência tão alta quanto 0,15 em algu- quena. Por exemplo, quando ocorre uma mutação nova, sua fre-
mas áreas do oeste da África onde há malária endêmica uma qüência é representada por apenas uma cópia entre todas as có-
freqüência bem mais alta do que se poderia esperar por m~tação pias deste gene na população. Se a população é pequena, fatores
recorrente aleatórios, tais como a fertilidade aumentada ou a sobrevida, ou
A vantagem do heterozigoto na anemia falciforme demons- ambos, do portador da mutação, que ocorram por motivos não-
tra como a violação de uma das suposições fundamentais do relacionados ao fato de o indivíduo ser portador do a/elo nm-
equilíbrio de Hardy-Weinberg, a de que as freqüências alélicas ta/lfe, podem fazer com que a freqüência alélica suba por moti-
não são significativamente alteradas pela seleção, faz com que a vos que não têm nada a ver com a mutação em si. Em uma gran-
relação matemática entre as freqüências alélicas e genotípicas de população, tais efeitos aleatórios tenderiam a uma média, mas
sejam diferentes daquelas esperadas pela lei de Hardy-Weinberg. nas populações pequenas as freqüências alélicas podem flutuar
Considere dois alelqs, o normal A e o mutante S, que dão origem de geração para geração pelo acaso. De modo semelhante, quando
a três genótipos: AIA (normal), AIS (portadores heterozigotos) e uma pequena subpopulação separa-se de uma maior, as freqüên-
SIS (anemia falciforme). Em uma amostra de 12.387 indivíduos cias gênicas na população menor podem ser bem diferentes da-
da população adulta do oeste de África, os três genótipos foram quelas da população da qual se originou, pois o novo grupo con-
detectados nas seguintes proporções: 9J65 AIA:2.993 AIS:29 SI tém urna amostra pequena e aleatória do grupo parental e, por
S. Contando os alelos A e S nestes três genótipos, podemos de- acaso, pode não ter as mesmas freqüências gênicas que o grupo
terminar as freqüências alélicas como sendo de p = 0,877 para o parental. Nas gerações seguintes, embora o tamanho da popula-
alelo A e de q = 0,123 para o alelo S No equilíbrio de Hardy- ção do novo grupo permaneça pequeno, pode haver uma consi-
Weinberg a proporção dos genótipos deveria ser AIA:AIS:SIS = derável flutuação de freqüência gênica. Estas mudanças prova-
p 2: 2pq:q2 = 9 .527:2 672:188 As proporções observadas, entre- velmente se diluem à medida que a população aumenta
tanto, AIA-AIS SS = 9..365:2.993:29, diferem significativamen- Uma forma de deriva genética é o efeito do fundador: se um
te do esperado. O exemplo do alelo falciforrne ilustra como as dos fundadores originais de um novo grupo tiver um alelo rela-
forças da seleção, operando não só no genótipo relativamente raro tivamente raro, este alelo terá uma freqüência maior do que ti-
SIS, mas também nos outros dois, muito mais freqüentes, AIA e nha no grupo maior do qual este pequeno grupo se originou . Um
AIS, distorcem a transmissão dos alelos A e Se causam um des- exemplo é a alta incidência da doença de Huntington na região
vio do equilíbrio de Hardy-Weinberg em uma população do lago Maracaibo, na Venezuela (ver Cap. 12), mas existem
Uma situação na qual as forças seletivas operam tanto para outros numerosos exemplos do efeito do fundador envolvendo
manter um alelo deletério quanto para removê-lo do pool gêni- outros alelos de doença em isolados genéticos pelo mundo.
co é descrita como um polimorfismo balanceado. Espera-se O efeito do fündador é bem ilustrado pela Old Order Amish,
que uma mudança na pressão seletiva ocasione uma mudança um isolado religioso de descendência européia que se instalou
rápida na freqüência relativa do alelo. H~je em dia, muitos he- na Pensilvânia e originou um número pequeno - e geneticamen-
terozigotos para a anemia falciforme vivem em regiões que não te isolado - de subpopulações por todo os EUA e o Canadá. A
têm malária, e mesmo nas áreas com malária, grandes esforços Old Order Am.ish tende a ter grandes farru1ias e uma alta freqüên-
estão sendo feitos para erradicar o mosquito responsável pela cia de casamentos consangüíneos A incidência de síndromes
transmissão da doença. Há uma evidência de que, na popula- autossômícas recessivas raras, tais como a síndrome de Ellis-
ção afro-americana dos EUA, a freqüência do gene falciforme van Creveld (Fig. 7.1 ), em algumas comunidades Amish, mas
já pode estar caindo em relação ao seu alto nível na população não em outras, é uma ilustração do efeito do fundador.
africana imigrante original de várias gerações atrás, embora
o~tros ~atores, tais como a introdução de genes de populações
nao-afncanas no pool de genes afro-americano, também pos-
sam ter um papel
Também se acredita que alguns outros alelos deletérios, in-
cluindo os genes para a hemoglobina e, as talassemias e a defi-
ciência de glicose-6-fosfato desidrogenase (ver Cap. 12), bem
como o alelo benigno FY do grupo sanguíneo Duffy, St<jam man-
tidos em suas atuais altas freqüências em algumas populações
em função da proteção que dão contra a rnaláJ:ia .
A vantagem dos heterozigotos também foi proposta para ex-
plicar as altas freqüências da fibrose cística nos caucasianos e
da doença de Tay-Sachs e outros distúrbios que afetam o meta-
bolismo de esfingolipídeos na população de judeus Ashkenazi.
Entretanto, a deriva genética (discutida mais adiante) é outro
mecanismo poderoso para a alteração de freqüências gênicas e
pode contribuir adequadamente para as freqüências incomumente Flg. 7. 1 As mãos de um paciente com a síndrome de Ellis-van Cre·
altas que alguns genes deletérios atingem em alguns ambientes. veld. um distúrbio muito raro visto com freqüência aumentada em
Para a fibrose cística e a doença de Tay-Sachs, a questão perma- alguns grupos Amish (Foto por cortesia de David Rimoin. Cedars-
nece sem solução. Sinai Medical Center. Los Angeles )
VARIAÇÃO GENÉTICA EM POPULAÇÕES 1 93

Outro exemplo marcante do efeito do fundador é dado pela A população da Finlândia, por muito tempo isolada genetica-
população de africânderes da África do Sul. A população foi mente pela geografia, linguagem e cultura, expandiu-se nos úl-
estabelecida por 20 casais originais, piincipalmente da Holan- timos 300 anos de 400.000 para cerca de 5 milhões de pessoas.
da, ao longo de algumas décadas começando em 1652, e teve um O isolamento e a expansão populacional permitiram que a po-
crescimento explosivo em seus primeiros anos, Hoje em dia, pulação da Finlândia desenvolvesse um padrão distinto de dis-
quase 1 m:ilhão dos 2.500.000 africânderes têm os sobrenomes túrbios monogênicos. Há uma alta freqüência de pelo menos 20
dos 20 fundadores originais. Um dos fundadores trouxe o gene doenças que são raras em outras partes., Por exemplo, a coroide-
para porfiria variegada (VP), um distúrbio autossômico domi- remia, uma doença ocular degenerativa ligada ao X, é muito rara
nante de infcio relativamente tardio . A VP resulta da deficiência no resto do mundo. Apenas cerca ele 400 casos foram descritos.
da enzima protoporfirinogênio oxidase, que é da via de síntese Um terço do número total de pacientes, entretanto, é de uma
de heme, Os heterozigotos desenvolvem fotossensibilidade e pequena região da Finlândia, povoada 'por uma grande família
siiltomas neuroviscerais, induzidos por barbituratos e outros fa- ampliada que descendeu de uma dupla fundadora nascida na
tores. Os homozigotos têm um distúrbio mais grave, com início década de 1640 (Fig, 7.2). Outra doença genética finlandesa é a
mais cedo e retardo de crescimento e desenvolvimento mental. hiperornitinemia com atrofia de giro da c9róide e retina, uma
Hoje em dia a VP na África do Sul é de aproximadamente 1/333. condição autossômica recessiva causada pela deficiência de or-
A incidência da VP na Holanda é desconhecida, mas foi deter- nitina aminotransferase e que leva à perda de visão em adultos
minada como sendo de cerca de 11100,000 na Finlândia. jovens (ver Fig., 7 2). Como se poderia esperar com um efeito do
A população franco-canadense do Canadá também tem fre- fundador, foi encontrada uma mutação na fonna homozigota na
qüências altas de alguns distúrbios que são raros em outras par- grande maioria de casos aparentemente não-relacionados de atro-
tes. Uma doença caractedstica da região relativamente isolada fia de giro na Finlândia, mas não foi observada em todos os ca-
do Lac Saint Jean de Quebec é a tirosinemia tipo I hereditária, sos não-finlandeses, Contrariamente, os distúrbios que são co-
Esta condição autossôroica recessiva causa insuficiência hepáti- muns em outras populações européias, tais como a PKU, são bem
ca e disfunção tubular renal causada por deficiência de fumari- raros na Finlândia,
lacetoacetase, uma enzima da via cie degradação da tirosina A Assiro, um dos resultados do efeito do fundador e da deriva
doença tem uma freqüência geral de cerca de 1/100.000 em ou- , genética é que cada população pode ser caracterizada por suas
tras partes de Quebec e na Noruega e na Suécia, mas sua freqüên- mutações moleculares particulares, bem como por um aumento
cia é de I/685 no Lac Saint Jean, onde o efeito do fundador foi ou urna diminuição de doenças especificas. Como mostram es-
demonstrado, tes exemplos, aderi va genética pode favorecer o estabelecimen-

Fig, 7.2 A origem geográfica de casos de dois distúrbios genéticos prevalecentes na Finlândia: a coroideremia ligada ao X (esquerda} e a
hiperornitinemia com atrófia de gi ro da coróide e retina (direita) A maioria dos casos de cada doença originou-se de determinadas co-
munidades na Finlândia, mas as distribuições das doenças diferem (Baseada em Mitchell G,A , Brody L C, Sipila L, et ai 119891 At least
two rnutant alleles of omithine-ô-aminotransferase cause gyrate atrophy of the choroid and retina in Finns Proc Natl Acad Sei USA 86: 197-
201: e Nario R , Nevanlinna H R , Perheentupa l l 1973 1 Hereditary diseases in Finland: Rare flora in rare soil Ann Clin Res 5: 109-141 l
94 ! VARIAÇÃO GENÉTICA EM POPULAÇÕES

to de uma alta incidência de alelos que não são favoráveis ou própria Europa é mais coerente com a deriva genética agindo em
mesmo neutros, mas sim prejudiciais. A mobilidade relativa da um polimorfismo neutro, embora s(!ja possível que outro fator
maioria das populações atuais, em comparação com seus ances- seletivo (talvez outra doença infecciosa, tal como a peste bubô-
trais de apenas algumas gerações, pode reduzir o efeito da deri- nica) possa ter elevado a freqüência do alelo !J.CCR5 nas popu-
va genética no futuro. lações do nordeste da Europa durante um intenso período de
seleção.
Um outro exemplo de fluxo gênico entre grupos populacio-
Fluxo Gênico nais é o que se reflete na freqüência de alelos específicos que
Em contraste com a deriva genética, que leva a uma variação causam PKU. Há uma forte evidência de que as mutações mais
aleatória nas freqüências alélicas de populações pequenas, o fluxo comuns originaram-se dos celtas. As mesmas mutações surgi-
gênico é definido como a lenta difusão de genes através de urna ram em muitas populações ao redor do mundo. A presença dos
barreira, um processo que envolve uma grande população e uma mesmos alelos em populações diferentes reflete a migração
mudança gradativa nas freqüências gênicas. Os genes das popu- geográfica dos celtas. Assim, a freqüência de PKU é de cerca de
lações migrantes, com suas próprias freqüências gênicas carac- 1/4.500 na Irlanda, mas o distúrbio é progressivamente menos
terísticas, são gradualmente dispersos no pool gênico da popu- prevalecente no nordeste e no sudeste da Europa. Tem havido
lação para a qual migraram. (0 termo "migrante" é usado aqui um fluxo consideravelmente menor de genes do leste da Ásia; a
no sentido amplo de cruzar uma barreira reprodutiva, que pode incidência de PKU no Japão é de apenas cerca de l/109000 .
ser racial, étnica ou cultural, e não necessariamente geográfica,
requerendo um movimento físico de urna região para outra.)
Enquanto o mecanismo da deriva genética é aleatório, o do flu-
CONCLUSÃO
xo gênico é de mistura populacional. Uma descrição matemática do comportamento dos genes nas po-
As freqüências da deleção de 32 pares de bases do alelo do pulações é um elemento importante de muitas disciplinas, inclu-
gene de receptor de citocina CCR5, !l.CCR5, foram estudadas em indo a antropologia, a biologia evolutiva e a genética humana Na
muitas populações pelo mundo. A freqüência cio .alelo !l.CCR5 genética médica prática, a aplicação da genética de populações tem
declina de cerca de 10% no leste europeu e na Rússia para al- sido principalmente prática: fornecendo freqüências alélicas para
guns poucos por cento no Oriente Médio e na índia subcontinen- cálculos de risco. No momento, os estudantes de genética huma-
taL O alelo !l.CCR5 está absolutamente ausente na África e no na estão usando os princípios e os métodos da genética de popula-
Extremo Oriente, o que sugere que a mutação originou-se nos ções para abordar muitas dúvidas sem resposta quanto à estrutura
caucasianos e difundiu-se para as outras populações (Fig. 7.3). genética de populações humanas, o fluxo de genes entre as popu-
Os gradientes noroeste e sudeste de freqüência do alelo lações e entre as gerações e os métodos ideais para a identificação
J.CCR5, logicamente, não explicam por que a freqüência alélica das contribuições genéticas para doenças comuns (ver Cap. 15).
é tão alta como é no noroeste da Europa. Por exemplo, a freqüên- Uma compreensão dos princípios da genética de populações se
cia mais alta do alelo t1CCR5 é de 21 %, vista nos judeus Ashke- tornará mais e mais importante à medida que os testes genéticos e
nazi, e quase tão alta na Islândia e nas ilhas britânicas . A atual as tecnologias terapêuticas ampliarem o impacto dos cuidados da
pandemia de AIDS é muito recente para ter afetado as freqüên- genética médica na saúde pública e no risco de doenças genéticas
cias gênicas por seleção. A variação nas freqüências alélicas da nas futuras gerações (ver Cap. 20) .

Fig. 7.3 Freqüência dos alelos L1CCR5 nas populações da Europa. África e Ásia (Reproduzida com permissão de Martinson 1 1. Chapman
N H . Rees D C . et ai 119971 Global distribution of the CCR5 gene 32 basepair deletion Nat Genet 16: l 00-103 )
VARIAÇÃO GENÉTICA EM POPULAÇÕES 1 95

Referências Gerais (a) a freqüência do alelo de ~-talassemia (supondo que há uma só


mutação comum de ~-talassem.ia nesta população);
C:ivalli-Sforza ll (1998) The DNA revolution in population gc- (b) a proporção de casamentos nesta população que podem produ-
ncrics . Trends <.ienet 1+:60-65
zir um filho afetado;
de la Ch,1pelle A (l993) Discasc gene mapping in isolared human
popularions: The example of Finland. J Med Gener 30~857-865 (c) a incidência de fetos afetados ou neonatos nesta população;
Emery AEH (1986) Merhodology in lvledical Genetics, 2nd ed (d) a incidência de ~-talassemia entre a prole de casais em que
C:hurchill l.ivingstone, Edinhurgh ambos são heterozigotos
Harcl DL, Clark AG (1997) Principies of Population Generics, Jrd
3 Quais das seguintes populações estão em equilíbrio de Hardy-Wein-
ed. Sinauer Associares, Sunderland, England.
berg?
Li CC (1975) Fim Course in Populaàon Genetics. Boicwood Press,
Pacific Grave, California (a) AIA, 0,70; Ala, 0,21; ala, 0,09
Morton NE (1982) Oudine of Generic Epidemiology. Karger, (b) Grupos sanguíneos MN: (i) M, 0,33; MN, 0,34; N, 0,33. (ii)
Base!. 100%MN
Peltonen L, Uusiralo A ( l997) Rare disease genes-lessons and (c) AIA, 0,32; Ala, 0,64; ala, 0,04
challenges. Genome Res 7:65-767. {d) AIA, 0,64; Ala, 0,32; ala, 0,04.
Que explicações você pode dar para as freqüências nestas popula-
ções que não estão em equilíbrio?
Referências Especr1icas aos Tópicos Particulares 4. Você é consultado por um casal. Abby e Andrew, que lhe diz que a
Lorey FW, Arnopp J, Cunningham GC (1996) Distriburion of irmã de Abby, Anna, tem síndrome de Hurler (uma mucopolissaca-
hemoglobinopathy variants by ethnicity in a mulàethnic srate. ridose) e que está preocupado com a possibilidade de ter um filho
Genet Epidemiol 13:501-512 com o mesmo distúrbio A síndrome de Hurler é uma condição au-
MarcinsonJJ, Chapman NH,'Rees DC, et ai (1997) Global disrrib- tossômica recessiva com uma incidência populacional de cerca de 1
ucion of the CCR5 gene 32 basepair delerion. Nat Genet em 90.000 em sua comunidade.
16:100- 103
(a) Se Abby e Andrew não forem consangüíneos, qual será o risco
Nagel RL, Ranney H (1990) Geneàc epidemiology of strucrural
mucacions of rhe 13-globin gene. Semin Hemarol 27:342 - 359. de o primeiro filho deles ter a síndrome de Hurler?
Sachse C, Brockmoller ], Bauer S, Roots I ( 1997) Cytochrome (b) Se eles forem primos em primeiro grau, qual será o risco?
P450 206 variants in a caucasian population: Alicie frequencies (c) Como suas respostas a estas questões difeririam se a doença em
and phenotypic consequenccs. Arn J Human Genet questão fosse a fibrose cística, em vez da síndrome de Hurler?
60:284-295.
5 Em uma determinada população, três distúrbios - retinoblastoma
Stephens JC, Reich DE, Goldstein DB, er ai (1998) Dating the
origin of che CCR5-delta32 AIDS-rcsistance alicie by the coa- autossômico dominante, ataxia de Friedreich autossômica recessiva
lescence of haplotypes. Arn J Human Genet 62:1507- 1S15 (um distúrbio neuromuscular) e coroideremia ligada ao X (uma causa
Tada K, Tareda H, Arashima S, et ai (1984) Follow-up srudy of a de perda de visão nos homens em idade jovem)- têm cada um uma
naàon-wide nconacal mecabolic screening program in Japan. A freqüência populacional de aproximadamente 1/25.000
collaborative srudy group of neonacal screening for inbom er- (a) Quais as freqüências gênicas e de heterozigotos para cada dis-
rors of metabolism injapan . Eur J Pediurr 142:204-207 túrbio?
(b) Suponha que cada um possa ser tratado de forma bem-sucedi-
da, de mo.d o que toda a seleção contra ele seja removida. Qual
Problemas seria o efeito na freqüência gênica em cada caso? Por quê?
6. Como foi discutido neste capítulo, a condição autossômica recessi-
Em uma população em equilíbrio, três genótipos estão presentes nas va tirosinemia tipo 1 tem uma incidência observada de 1/685 indiví-
seguintes proporções: AIA, 0,81; Ala 0,18; ala 0,01. duos em uma população da província de Quebec, mas uma incidên-
(a) Quais as freqüências de A e a? cia de cerca de 1/100.000 em outra parte. Qual a freqüência do alelo
(b) Quais serão suas freqüências na próxima geração? mutante de tirosinemia nestes dois grupos?
(c) Que proporção de todos os casamentos nesta população é de AI
7 Para a população de Quebec na questão 6, você esperaria que os ale-
a X Ala?
los mutantes de tirosinemia fosse homogêneos ou heterogêneos? E
2. Em um programa de triagem para detectar portadores de ~- talasse­ quanto aos casos de neurofibromatose 1 autossômica dominante na
mia em uma população italiana, a incidência encontrada foi ·de cerc mesma população franco-canadense? E a distrofia muscular Ouchen-
ca de 4%. Calcule ne ligada ao X? E daltonismo ligado ao X?
Mapeamento Gênico e o
Pro;eto do Genoma Humano .
O mapeamento do genoma humano é uma das áreas do estudo MAPEAMENTO FÍSICO DOS
da genética médica em mais iápida expansão hoje em dia. Ter o GENES HUMANOS
!.fHlJ!ª gfüpc:o h1:!'P~~-~ompleto é conhe-cer a lç~aJizaçã.Q de apro-
ximadamente 50.000 genes nos 24 cromossomos, suas posições O mapeamento físico dos genes engloba uma variedade de mé-
relativas uns aos outros e as distâncias entre eles. Tal informa- todos diferentes, cada um dos quais usa unidades de medida di-
ção de mapa é extremamente valiosa não apenas porque pode ser ferentes e fornece níveis de resolução diferentes, variando de um
aplicada ao diagnóstico de doenças e à consulta genética, mas cromossomo inteiro a um único par de bases.
também pofqüe fornece uma via direta para identificar os genes
responsáveis por doenças genéticas.
No inicio, a localização cromossômica era feita exclusivamen- Genética de Células Somáticas
te com estudos familiares de grandes heredogramas para avaliar o A genética de células somáticas é o ~~t}l_çlp_c!aorganiza~i­
modo de herança. Desta forma, os genes para características liga- ca, d-ª..!l.XP~~~são e da regulação em células cultivadf:is 9btj_d~_d_e
das ao X podiam ser situados no cromossomo X porque as caracte- te.cidos somáticÕs, em oposição à lirihagemgefrninativa A ge-
rísticas apresentavam um padrão único de transmissão. Além dis-
nética de células somáticas tira proveito da capacidade que._y_ári-
so, algumas características autossômicas dominantes ou co-domi-
os tipos celulares diferentes têm de crescer, às vezes indefinida-
nantes foram atribuídas a autossomos individuais por causa da des-
mente, em cultura de células. A manutenção bem-sucedida das
coberta fortuita de que o fenótipo da característica foi herdado por
culturas por longos períodos requer o desenvolvimento de mei-
muitas gerações em tandem com um determinado grupo sanguí-
os que satisfaçam os restritos requisitos nutricionais das células,
neo ou com um cromossomo com uma variante estrutural
bem como o início de precauções para evitar a contaminação por
citogeneticamente detectável (heteromortismo; ver Cap. 9) A
grande maioria dos genes humanos, entretanto, não podia ser ma- microrganismos, leveduras ou outras linhagens celulares culti-
peada deste ou de qualquer outro modo até o advento da metodo- vadas.
logia do mapeamento físico e genético, o assunto deste capítulo A cultura de células demonstrou-se útil em muitas situações.
Existem dois enfoques fundamentalmente diferentes para criar A técnica permite a propagação de uma única célula de consti·
mapas gênicos de cromossomos humanos: o mapeamento físico tuição genética definida para obter um grande número de célu-
e o mapeamento genético. O i;napeament~ fi~ico situa os g~l_l_~_s las (clones), g~~~ti.c~ente idênticas à célula original, disponí-
em d~t~rrnin.ados locais ao lo_~g9 ..de !J!Il cromossomo usando veis para estudo. Uma linhagem celular pode ser obtida de um
medidas que"saõ um refíeXoda distância física eritre "õs genés' paciente com um raro distúrbio ou um cariótipo incomum quan-
-·cm baixa resolução, os mapas físicos colocam os genes nos cro- do o paciente está disponível e a amostra pode ser congelada mais
mossomos ou em regiões de um cromossomo de acordo com as ou menos permanentemente em nitrogênio líquido para estudo
bandas citogenéticas em cromossomos metafásicos . Na maior re- em uma época conveniente, mesmo décadas após a morte do
solução, o mapeamento físico fornece os locais e as distâncias paciente.
entre os genes nas medidas físicas reais, tais como o tamanho do Os fibroblastos, em geral cultivados a partir de pequenas
DNA (em unidades de pares de bases). O mapeamento genéti- amostras de pele, estão entre os tipos celulares mais úteis para
_Ç_o, por outro lado, usa um método totalmenteciíferente, cfiãmâ- os estudos de genética de células somáticas. Os fibroblastos têm
do de análise de ligaçã9,_par1;1 determinar a distância entre os um aspecto fusiforme, crescem em monocamadas aderidas a
genes. A anáfüe de ligação é baseada em medir a freqüência com superfícies de plástico ou vidro e dividem-se por cerca de 30 a
a qual dois genes ficam jun~Q~ (permanecem ligados) através da 100 gerações até que se tomem incapazes de novas divisões (se-
~meclüfaq-~e,. sª9_(!:_.aJ!~raj!i_dos de_u.IDª _geração para a nescência) Algumas linhagens celulares em cultura sofrem
s.~gymt~. Neste capitulo, discutiremos ambos os tipos de niape- transformação, o que significa que as células assemelham-se
amento e examinaremos várias de suas aplicações para identifi- a células cancerosas em sua capacidade de crescer indefinida-
car e isolar determinados genes humanos e dar informações di- mente . A transformação pode ser espontânea ou induzida por
agnósticas em genética médica vírus, tais como o Epstein-Barr. Este vírus é hqje rotineiramente
MAPEAMENTO GÊNICO E O PROIETO DO GENOMA HUMANO I 97

usado para transformar linfócitos de sangue periférico para criar HIBRIDIZAÇÃO DE CÉLULAS SOMÁTICAS
linhagens celulares linfoblastóides imortalizadas, pois as amos-
tras de sangue são relativamente fáceis de se obter e o proces- O enfoque mais amplamente usado para a transferência cromos-
so de transformação é rápido e eficiente. As linhagens trans- sômica é fundir células somáticas de espécies diferentes para
formadas não sofrem senescência e podem reter parte das ca- fazer células somáticas híbridas interespecíficas, Quando uma
racterísticas diferenciadas das células a partir das quais foram mistura de células somáticas humanas e de roedor, cultivadas em
obtidas, mas, com a notável exceção das células linfoblastóides, monocamadas ou em suspensão, é exposta a agentes que promo-
a maioria das linhagens transformadas não mantém um cariótipo vem a fusão das membranas celulares, duas células podem se
euplóide normal.. fundir em uma única célula luôrida, Imediatamente após a fu-
são, os dois núcleos são mantidos separados no mesmo citoplas-
ma (Fig. 8. 1). Se os híbridos recém-formados forem luôridos
Mapeamento por Transferência Cromossômica interespecíficos, isto é, contiverem núcleos de células de roedor
e humana, eles serão conhecidos como heterocárions. (Homo-
A transferência cromossômica é um método laboratorial podero- cárions são luôridos que contêm núcleos da mesma espécie.)
so que permite que cromossomos inteiros, ou segmentos de cro- Após um heterocádon sofrer mitose e diyis~o.celular, os dois con-
mossomos, sejam transferidos de uma célula doadora para uma teúdos nucleares unem-se em um único núcleo "híbrido" e, com
célula receptora em cultura. Tão logo ficou claro que as células as posteriores divisões celulares, perdem um número variável de
humanas e outras células de marrúferos podem ser mantidas em cromossomos humanos aleatoriamente dos híbridos humano/
cultura, os geneticistas humanos começaram a transferir cromos- roedor. Os cromossomos do roedor não são perdidos, por moti-
somos das células de uma espécie para células de outra espécie vos ainda desconhecidos.
para separar genes diferentes e seus alelos em clones separados Como uma conseqüência da perda aleatória de cromossomos
de células. Pela correlação de que genes estão presentes em uma humanos, diferentes células luôridas filhas contêm números dife-
célula receptora quando cromossomos específicos ou segmentos rentes, bem como combinações diferentes, de cromossomos hwna-
cromossômicos.foram transferidos, a localização cromossômica nos. Cada clone independente de células luôridas pode ser isolado e
dos genes transferidos pode ser detenninada. analisado quanto ao seu conteúdo de cromossomos humanos usan-

HPAT-

Fibroblasto Linfócito ~ Roedor


Humano

Fusão celular

@ ........ ~
Célol'5 rotai' Heterocárions l Seleção

l emHAT

Hlbrid;s· · 8
~ celulares
e .,./ o
Morte celular sobreviventes

Proliferação e
perda preferencial
de cromosi;omos
humanos

Colónias híbridas independentes contendo cromossomos humanos diferentes


Fig. 8.1 Esquema de hibridização interespecffica de células somáticas Após a fusão celular. os clones híbridos de células somáticas
humana/roedor são cultivados em um sistema de seleção. tal como o meio hipoxantina. aminopterina e tirnidina (HAT) Estes híbridos
celulares preferencialmente perdem cromossomos humanos o que torna possível isolar clones híbridos contendo combinações dife-
rentes de cromossomos humanos Estes clones podem então ser analisados quanto à presença ou ausência de um determinado gene
humano. permitindo assim a localização do gene em um cromossomo humano específico
98 ' MAPEAMENTO GÊNICO E O PROJETO DO GENOMA HUMANO

Fig.. 82 Metáfase cromossômica de uma célula híbrida camundongo/humana Os cromossomos humanos podem ser identificados por
um método de detecção que marca especificamente o DNA humano mas não o de camundongo Este híbrido contém seis cromossomos
humanos. identificados como cromossomos 13. 20 (duas cópias) e o X (três cópias) (Cortesia de V E Powers. Stanford University l

do várias técnicas de cariolipagem que distinguem os cromossomos nes contendo subgrupos diferentes de cromossomos humanos.
humanos dos cromossomos de roedor (ver Figs 8.1 e 8.2) Um conjunto de clones híbridos independentes de células so-
A fusão de células somáticas não é eficiente: a maioria das máticas, chamados de painel, pode ser usado para mapear· um
células em cultura não se fundem e, para as que o fazem, não há gene ou um segmento de DNA humano em um determinado
um método para garantir que uma célula humana tenha sempre se cromossomo simplesmente testando-se os híbridos no painel,
fusionado a uma célula de roedor e não a outra célula humana (e cada um dos quais leva cromossomos humanos diferentes,
vice-versa para as células de roedor). Determinadas condições e quanto à presença ou ausência de um determinado gene huma-
técnicas de cultura celular são usadas para tornar não-fusionáveis no . Os resultados são comparados aos cromossomos humanos
os tipos celulares parentais e os hibridos derivados de homocárions residuais presentes em cada híbrido, para determinar a concor-
incapazes de sobrevida, enquanto permitem que os híbridos for- dância entre a presença de um determinado cromossomo e a
mados de heterocárions sobrevivam e cresçam. Embora vários presença do gene. Deste modo, por exemplo, a presença ou
esquemas seletivos tenham sido desenvolvidos, um dos primeiros ausência do gene para hexosaminidase A (HEXA), na qual as
e mais comumente usados envolve a seleção em meio contendo mutações causam a doença de Tay-Sachs (ver Cap. 12), de-
hipoxantina, arnínopterina e timidina (o chamado meio HA As n monstrou ser correlata à presença do cromossomo humano 15
células só podem crescer em meio HAT se possuírem a enzima em um painel de híbridos de células somáticas (Quadro 8. 1).
hipoxantina guanina fosforibosilt:ransferase (HPRT), que poupa a Todos os híbridos que conservavam o cromossomo humano 15
base purínica hipoxantina contida no meio HAT para a síntese do continham o gene humano HEXA e todos aqueles sem o cro-
DNA (ver Fig . 123).. As células deficientes em atividade de HPRT mossomo 15 não continham HEXA humana . Esta concordân-
(HPRT·) devem produzir as bases purinicas de novo e, portanto, cia perfeita foi observada apenas para o cromossomo 15 e não
não podem sobreviver em meio HAT, pois a arnínopterina inibe a para qualquer outro cromossomo humano, permitindo, assim,
biossíntese de novo de purina (bem como de pirim.idina). a localização do gene HEXA no cromossomo 15. Neste tipo de
Quando linhagens celulares de roedores HPRT- (em geral ca- análise, a presença de um gene humano pode ser monitorada
mundongo ou hamster) fundem-se com células humanas HPRT+, medindo-se sua atividade bioquímica se o gene for expresso
apenas os híbridos de células somáticas roedor/humano são ca- em híbridos de células somáticas e se as atividades humanas e
pazes de crescimento prolongado em meio HAT: tanto a linha- de roedores puderem-ser diferenciadas. Os métodos do DNA
gem parental de roedor HPRT- quanto qualquer homocárion que distinguem o gene humano do gene de roedor agora são
formado a partir delas morre em HAT As células parentais hu- usados mais comumente (Fig. 8 3). Estes métodos incluem a
manas e os homocárions delas derivados não sobrevivem por- reação em cadeia da polimerase (PCR) com pares de primers
que não são transformados e não têm potencial de crescimento a específicos de humanos versus roedores e a transferência de
longo prazo (ver Fig. 8.1). Southem para visualizar as diferenças de comprimento de frag-
mentos de restrição que distinguem as seqüências de DNA de
PAINÉIS DE MAPEAMENTO DE CÉLULAS SOMÁTICAS HíBRIDAS
humanos e de roedores Este tipo de análise de concordância
em um painel de híbridos interespecíficos de células somáti-
A perda ou retenção aleatória de cromossomos humanos em cas permitiu que milhares de genes fossem situados em cro-
híbridos interespecíficos de células somáticas resulta em elo- mossomos humanos individuais.
MAPEAMENTO CÊNICO E O PROJETO DO GENOMA HUMANO 1 99

OUADR08-I

i.~~!i~~fü~:º~,~;-~~.~~~~·~ .~~fü~·~~i:~.~~.~º~?i~~'~:~,~!~~~,:~~dS~J~l~~:~~fü~~~,~~~JJJ.5:~~]í!i~~!f5i:\i: :,:fJ;>:f#1J~':'.:Ji:füii}:J:;}.,i::I!\'\g{U4;':j;.fü;:.t


Cromossomos Humanos
HEXA
Hrbrido Gene 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X y

I + + + + + + + + +
II + + + + + + + + + + +
IIl + + + + + + + + :- + + + + +
IV + + + + + + + + + +
V + + + + + + + + + + + + +
VI + + + + + + + +
VII + + + + + + + + + + + + + +
VIII + + +
Nota: Um painel de híbridos de células somáticas camundongo/humana, cada um contendo de 2 a 13 cromossomos humanos, foi usado para testes quanto à presença
ou ausência do gene humano de hexosaminidase A (HEXA) por meio de transferência de Southern de DNA preparado a partir dos híbridos (ver Fig. 8.3). Há uma
correlação perfeita entre a presença ou ausência de HEXA e a presença ou ausência do cromossomo humano 15. Para todos os outros cromossomos humanos. exis-
tem híbridos que contêm HEXA, mas não 1êm o cromossomo, e existem híbridos que contêm o cromossomo. mas não têm HEXA Assim. estes resultados indicam
que o gene HEXA deve estar no cromossomo humano 15.

MAPEANDO UM GENE EM UMA res do cromossomo de interesse nos híbridos possibilitou locali-
REGIÃO ESPECIFICA DE UM CROMOSSOMO zar genes em regiões ainda menores.
Os estudos usando híbridos humano/roedor permitem a atribui-
ção de um gene a um determinado cromossomo. Uma resolução MAPEAMENTO DE HfBRIDOS DE RADIAÇÃO
adicional pode ser obtida isolando-se os cromossomos estrutu-
ralmente anonnais, tais como os descritos nos Caps. 9 e 10, em Embora a hibridização de células somáticas de cromossomos
híbridos de células somáticas. Se um determinado gene estiver estruturalmente anonnais possa fornecer a localização regional
presente apenas nos híbridos com um cromossomo deletado ou de um gene em uma determinada parte de um cromossomo, as
translocado, então o gene poderá ser localizado na parte do cro- regiões cromossômicas definidas ainda são muito grandes em
mossomo retida nos híbridos. Alternativamente, se soubennos comparação com o tamanho de um gene médio. O mapeamento
que um gene está mapeado em um determinado cromossomo mas gênico de resolução ainda maior pode ser obtido com o mapea-
está ausente de um híbrido contendo uma cópia deletada ou mento híbrido d e radiação, uma técnica de hibridização de
translocada deste cromossomo, então o gene poderá ser atribuí- células somáticas que tira proveito da c;apacidade dos raios X de
do à parte do cromossomo que está faltando. A Fig. 8.4 mostra causar quebras bifilamentares no DNA . As células humanas re-
como dois cromossomos X estruturalmente anonnais são usados cebem raios X para quebrar seus cromossomos, e os fragmentos
no mapeamento gênico para localizar genes ligados ao X e se- são separados em um grande número de lubridos por fusão de
qüências de DNA em determinadas regiões do cromossomo X. células somáticas com células de roedor HPRT-. Os híbridos
Examinando-se híb1idos diferentes, cada um contendo um dos contendo fragmentos de cromossomos humanos podem ser iso-
cromossomos translocados, o cromossomo X pode ser dividido lados por seleção em HAT, pois os híbridos que contêm o frag-
em três intervalos, e genes diferentes atribuídos a cada um. A mento do cromossomo X levando HPRT invariavelmente tam-
ampliação desta estratégia e o exame de regiões cada vez meno- bém contêm um conjunto aleatório de fragmentos de outros cro-

o<='~
(l;<c-0 '><;-~ Híbridos de células somáticas
-<'-f' ' cl' 11 111 IV V VI VII VIII
Específico de
humano .

Especifico de
camundongo

+ + + + +
Gene humano HEXA

Fig.. 8..3 Eletroforese em gel de uma reação em cadeia da polimerase (PCR) para mapear o gene humano HEXA no cromossomo 15. em
urna série de híbridos de células somáticas camundongo/h umana Apenas os híbridos 1. 111. VI. VII e VIII contêm seqüências humanas
HEXA. as quais podem ser diferenciadas das seqüências gênicas de camundongo pelo uso de pares de p1imers diferentes para PCR que
são específicos da seqüência humana ou da seqüência de ca mundo ngo e ampli ficam fragmentos de tamanhos diferentes nas duas es-
pécies Os fragmentos especificos de humanos e camundongo são então separados por eletroforese em gel
100 1 MAPEAMENTO GÊNICO E O PROJETO DO GENOMA HUMANO

Translocações Mapeamento por Dosagem Gênica Usando


no paciente Hfbridos
A B C Células de Pacientes
Um outro enfoque do mapeamento gênico também tira proveito
de cromossomos estruturalmente rearranjados, mas não se ba-
+ seia em primeiro separar os cromossomos anormais em células
somáticas híbridas. Este enfoque depende da detecção de dife-
renças de dosagem dos produtos gênicos ou das próprias seqüên-
cias gênicas entre as células do paciente que contêm números
diferentes de cópias de um determinado gene. A estratégia da
dosagem gênica foi inicialmente usada para localizar genes do
cromossomo 21 pela detecção dos níveis da atividade enzimáti-
+ + ca em linhagens celulares de pacientes com síndrome de Down
(que têm três cópias -ou doses -do cromossomo 21), que eram
1,5 vez maiores que os níveis em linhagens celulares de genitores
cromossomicamente normais (duas doses) .. No nível do DNA, o
enfoque da dosagem tem sido crescentemente usado para situar
marcadores de DNA no cromossomo X (pela comparação da
dosagem de DNA de pessoas com um [isto é, cariótipo masculi-
no normal] até cinco [isto é, um cariótipo 49,XXXXX] cromos-
somos X) (Fig . 8.6) ou regiões muito pequenas de um determi·
nado cromossomo (examinando-se grupos de pacientes com
trissomias parciais [três cópias] ou monossomias [uma cópia];
+ + . ver Caps 9 e 10).
Uma das aplicações mais diretas do mapeamento por dosa-
gem gênica é a localização de genes de doenças ligadas ao X
em regiões específicas do cromossomo X examinando-se ho-
mens com deleções citogeneticamente detectáveis de parte do
cromossomo X . Em um exemplo bem-estudado, um menino
sem história familiar de nenhuma doença genética possuía qua-
tro condições distintas ligadas ao X: distrofia muscular
+
Duchenne (DMD). doença granulomatosa crônica (CGD), re-
<....
tinite pigmentosa (RP) e um raro tipo de fenótipo de hemácia.
Uma cuidadosa análise citogenética revelou uma pequena mas
detectável deleção na banda Xp2 l (Fig . 8.7) A coexistência de
quatro distúrbios monogênicos com a pequena deleção levou à
Fig. 8.4 Mapeamento regional de genes ligados ao X por análise
de cromossomos de translocação X;autossomo em híbridos de conclusão de que os genes para estas quatro características li-
células somáticas Os produtos recíprocos de duas translocações gadas ao X estavam mapeados no intervalo deletado. A corre-
X:autossomo diferentes são segregados em clones de híbridos de lação deste tipo de análise com outros indiv.íduos simultanea-
células somáticas e podem ser analisados quanto à presença ou mente afetados por múltiplas doenças ligadas ao X permitiu a
ausência de genes do cromossomo X humano Os resultados com- localização regional de vários genes nesta região do cromos-
binados permitem a localização regional dos três genes em partes somo X (ver Fig. 8.7). O paciente com a deleção Xp21 foi ain-
diferentes do X. como indicado à direita da mais significativo para a genética médica, pois (como des-
crito em mais detalhes adiante neste capítulo) seu cromosso-
mo X deletado foi usado para identificar e isolar os genes para
mossemos humanos (Fig. 8.5). As células humanas não- DMD e CGD. Este paciente forneceu ainda um outro exemplo
fusionadas ou homocárions humanos morrem por intenso dano de como o reconhecimento do incomum em medicina - neste
cromossômico, enquanto as células de roedores HPRT- não- caso, a ocorrência de múltiplas doenças genéticas em uma só
fusionadas'ou homocárions de roedores morrem em HAT. pessoa - pode dar novas informações importantes sobre ge-
Quanto mais perto dois genes humanos estiverem em um cro- nes normais, sua organização e sua função.
mossomo, menos provável será que ocorra uma quebra induzida
por raios X entre eles. Como resultado, dois genes em proximi- Mapeamento Gênico por Hibridização ln Situ
dade física são retidos em muitos dos mesmos luôridos, enquan-
com Fluorescência
to os genes que não estão próximos em geral residem em frag-
mentos cromossômicos diferentes e, portanto, normalmente não Os métodos de mapeamento já discutidos são indiretos, pois for-
estão presentes nos mesmos híbridos. Uma análise estatística de necem informações sobre a localização física de um gene em um
com que freqüência dois genes estão presentes em clones híbri- determinado cromossomo, mas, na verdade, não permitem ma-
dos de radiação nos dá uma medida da distância entre os genes pear a posição do gene a ser visualizado. A visualização direta
A resolução do mapeamento de luôridos de radiação pode ser pode ser obtida usando-se o método de hibridização in situ, que
ajustada usando-se doses menores ou maiores de raios X para envolve a hibridização de sondas marcadas de DNA (ou RNA)
gerar freqüências de quebras diferentes e, portanto, fragmentos diretamente com cromossomos metafásicos (ver Cap. 4). O DNA
de tamanhos variados. dos cromossomos metafásicos é desnaturado no local (daí, in situ)
MAPEAMENTO GENICO E O PROJET'O DO GENOMA HUMANO 1 101

Raios X

l\ HPRT"
~ou@
Fibroblasto Linfócito ~
Roedor
Humano

fol .. .. .... lo;0


\V ~
l _
lGJ
Heterocáríons
Seleçao

_ o'/ /,_ O
l emHAT

::;, -
o
o- () © Híbridos
····· ·· ·Q
V
celulares
Morte celular sobreviventes
Proliferação e
perda preferencial
de fragmentos
de cromossomos
humanos

Colônias híbridas independentes contendo fragmentos diferentes de cromossomos humanos


Fig. 8.5 Mapeamento com híbridos de radiação As células humanas são letalmente irradiadas para fragmentar os cromossomos e en-
tão hibridizadas a células somáticas de roedor. Os híbridos contendo um fragmento humano portador de um marcador bioquímico
selecionável_tal como hipoxantina guanina fosforibosiltransferase (HPRT). sobrevivem no meio seletivo Cada célula híbrida contém
um conjunto aleatório de fragmentos cromossômicos (exceto pelo fragmento portador do marcador bioquímico usado para selecionar
os híbridos interespedficos)

na lâmina, para permitir a hibridização com uma sonda marca- Os métodos para mapeamento de seqüências gênicas de có-
da _O local do sinal de hibridização - e, portanto, a localizaçãopia única por hibridização in siltl foram d~senvolvidos de modo
do gene ao qual a sonda se hibridizou - é então detenninado ao a possibilitar a detecção rápida de sondas marcadas hibridizadas
microscópio. não-radioativamente com compostos que podem ser vistos por
microscopia de fluorescência (Fig _8.8). Mesmo em uma única
metáfase, podemos facilmente ver a posição do gene a ser
Caríótipos de pacientes mapeado. Em combinação com os métodos de bandeamento para
identificação de cromossomos (ver Caps. 2 e 9), a hibridização
4- +4' -{}+4- ++ ill situ com fluorescência (ASH) é usada para mapear genes em
bo-~' ~· ~· bo-~·
uma região de 1 a 2 milhões de pares de bases na cromatina alta-
Sonda 1 --.... - - - - c::::io=> mente condensada de um cromossomo metafásico ou pró-meta-
fásico.
Um mapeamento de resolução maior foi obtido pelo ma-
peamento FISH de fragmentos de DNA usando fibras de cro-
-sonda2 matina interfásica (fiber-FISH), que estão bem menos
condensadas que os cromossomos metafásicos. Marcadores
tão próximos quanto algumas centenas de kb distantes foram
Fig. 8. 6 Exemplos de mapeamento por análise de dosagem Ason- resolvidos quando marcados com corantes de cores diferen-
da 1de DNA usada à esquerda pode ser mapeada no cromossomo
X porque a intensidade de hibridização parece ser uma função do tes, o que permitiu a determinação de sua ordem relativa en-
número de X presentes em cada amostra de DNA Asonda 2 de DNA tre si A técnicajiber-FISH tem sido muito útil nas pesquisas
mostra a mesma intensidade de hibridização nas colunas de 1 a 3_ destinadas à identificação de genes de doenças humanas, pois
mas está ausente na coluna 4 Este locus está no cromossomo Y fornece aos pesquisadores informações detalhadas sobre a
102 f MAPEAMENTO GÉNlCO E O PROIETO DO GENOMA HUMANO

pter ordem e a distância entre genes individuais na vizinhança de


22.33 um gene de doença
2232

2231 MAPEAMENTO DE GENES HUMANOS POR


222 ANÁLISE DE LIGAÇÃO

22 13 A ligação pode ser definida como a tendência que os ai elos pró-


ximos no mesmo cromossomo têm de ser transmitidos juntos,
22,12
como urna unidade intata, pela meiose. A análise genética de
2211
ligação é um método de mapeamento de genes que usa estudos
21.3 familiaies para determinar se dois genes apresentam ligação (es-
21 2 tão ligados) quando são transmitidos de uma geração para a se-
21.1 guinte. O mapeamento por análise genética de ligação difere do
mapeamento pelos métodos físicos porque um mapeamento fí-
11 4 sico baseia-se em ter um método laboratorial para localizar um
gene por FJSI-I ou por hibridização de células somáticas Em
11.3 contraste, a análise de ligação é um enfoque imensamente im-
11 23 portante e poderoso em genética médica porque é o único méto-
do que permite o mapeamento de genes, i11c/uí11do os gene5 de
11.22
11 .21
doença, que ~ão detectáveis apenas como caraCTerúticas feno-
11.1 típicas A grande maioria dos genes subjacentes a doenças ge-
cen néticas está nesta categoria, pois nem as bases bioquímicas nem
as bases moleculares foram elucidadas.
Fig. 8 ..7 Localização regional de genes ligados ao X em pacientes
com deleções do cromossomo X A correlação entre a extensão da
deleção citogenética com um determinado disturbio presente em Ligação, Sintenia e Recombinação
cada caso permite o mapeamento fino dos genes individuais de
doença com regiões particulares do cromossomo X DMD = dis- RECOMBINAÇÃO HOMÓLOGA MA MEIOSE
trofia muscular Duchenne; OTC = deficiência de ornitina
transcarbamilase. CGD = doença granulomatosa crônica RP = Para compreender totalmente os conceitos subjacentes à análise
retinite pigmentosa GKD = deficiência de glicerol cinase, AHC = de ligação genética é necessário rever de modo resumido o com-
hiperplasia adrenal congênita (Cortesia de U Francke. Stanford portamento dos cromossomos e dos genes durante a meiose. Os
University J cromossomos homólogos formam pares durante a meiose L e os

Fig. 8.8 Mapeamento gênico por hibridização


in silu de uma sonda de DNA marcada com
biatina para o gene de glicogênio fosforilase
(MGPJ em cromossomos metafásicos humanos
A localização do gene MGP é indicada pelos
pontos brilhantes vistos em cada cromátide no
sítio do gene na banda q 13 do cromossomo 11
O mapeamento de MGP em l l q 13 também si-
tua o locus para a doença de McArdle. uma mi-
oglobinúria a utossômica recessiva causada
pela deficiência de MGP (Foto por cortesia de
Peter Lichter. Yale Uníversity J
MAPEAMENTO CÊNICO E O PROJETO DO GENOMA HUMANO J 103

Locus 1 D

Genitor
d l~!fi~~

íll íll
~~

~~i
M m Locus 2
·.

d
li
Gametas

Não-recombinante (DM + dm) Recombinante (dM + Dm)


Ili
Fig. 8.IO Comportamento meiótico de alelos em dois loci. 1 e 2.
quando estão situados em cromossomos separados

te na meiose . Assim, observamos quatro tipos de prole (quatro


Fig. 8 .. 9 O efeito da recombinação na origem de várias partes de tipos de gametas) em proporções iguais: DM e dm, q'ue são cha-
um cromossomo Devido ao cmssing rneiótico. a cópia de um mados de não-recombinantes porque são idênticos aos cromos-
cromossomo herdada pelo menino na geração Ili é na verdade somos parentais originais, e os genótipos Dm e dM, que são cha-
um mosaico de partes de todas as quatro cópias dos avós deste mados de recombinantes porque representam uma nova com-
cromossomo
binação de alelos que difere daquela dos cromossomos parentais.
Quando são vistos números iguais de genótipos recombinantes
e não-recombinantes (tal como quando dois loci não estão situ-
pares alinham-se no fuso meiótico. Os homólogos paternos e ados no mesmo cromossomo), os loci são ditos não-ligados.
matemos trocam segmentos homólogos por crossing over e cri-
am novos cromossomos que são um "mosaico", consistindo em Loci no Mesmo Cromossomo não Estão
partes alternadas dos cromossomos da avó e do avô (Fig. 8.9). A
Necessariamente Ligados
criação de tal "mosaico" cromossômico enfatiza a noção da in-
dividualidade genética humana: cada cromossomo herdado por Suponha, entretanto, que os loci 1 e 2 estão no mesmo cromos-
uma criança de um genitor nunca é essencialmente igual a uma somo Os genes que residem no mesmo cromossomo são ditos
das duas cópias deste cromossomo no genitor, mas contém al- sintênicos (liteialmente, "no mesmo filamento"), independente
guns segmentos derivados do avô da criança e outros segmen- do quão próximos ou distantes eles estejam neste cromossomo.
tos da avó da criança. Sabemos que o crossing over ocon-e no estágio de quatro fila-
Se os cromossomos homólogos em geral parecem idênticos mentos da meiose, quando existem quatro cromátides por par de
ao microscópio, devemos ter um meio de diferenciar os cromossomos. Se não ocorrer crossing entr·e os loci, apenas os
homólogos Só deste modo podemos deduzir a origem dos avós genótipos não-recombinantes DM e dm serão vistos na prole. Se
de cada segmento de um cromossomo herdado por uma deter- um ou mais crossings ocorrerem entre eles, entretanto, a propor-
minada criança e assim detenninar se e onde ocorreram os even- ção de genótipos não-recombinantes para recombinantes se tor-
tos de recombinação ao longo dos cromossomos homólogos. Para nará 1: l. De fato, uma média de 1 a 3 eventos recombinantes
este fim, usamos os marcadores genéticos, que são definidos ocorrem em algum lugar ao longo de cada cromossomo por
como qualquer característica situada no mesmo lugar em um par meiose. Como mostra a Fig. 8. 11, uma, duas ou mais recombi-
de cromossomos homólogos que nos permite distinguir um nações que ocorrem entre dois loci resultam em uma prole que é
homólogo do outro No passado, os genes que codificavam vari- 50% recombinante e 50% não-recombinante. Assim, se dois loci
antes eletroforétícas ou antígenos de superfície celular serviram sintênicos estiverem muito distantes no mesmo cromossomo, de
. como marcadores . Entretanto, na era do Projeto do Genoma modo a que exista pelo menos um crossing entre eles a cada
Humano, os marcadores genéticos são mais comumente polimor- meiose, os genótipos recombinantes e não-recombinantes ocor-
fismos de seqüência de DNA que podem ser detectados por rerão na prole em proporções iguais, e os dois loci parecerão não-
amplificação por PCR do segmento de DNA contendo o marca- ligados, como se os loci estivessem em cromossomos separados.
dor (ver Cap. 6). A análise de ligação genética tira proveito destas proprie-
Como os marcadores genéticos são usados para o mapeamento dades da meiose usando a freqüência de recombinação para
de ligação genética? Suponha que existam dois loci marcadores medir o quão próximos uns dos outros estão os loci genetica-
genéticos, 1e2, com os alelos D e M no cromossomo de origem mente diferentes. Como mostra a Fig. 8 12A, se pelo menos um
paterna e os alelos d e m no cromossomo de origem materna em crossing oconer no segmento do cromossomo entre os loci 1 e
uma pessoa (Fig. 8 10). Se os dois loci estiverem situados em 2, tanto os genótipos não-recombinantes DM e dm quanto os
cromossomos diferentes, eles se distribuirão independentemen- genótipos recombinantes Dm e dM serão vistos, em média, em
J04 1 MAPEAMENTO CÉNICO E O PROJETO DO GENOMA HUMANO

e recombinantes de alelos na prole, mas a freqüência de genó-


tipos recombinantes nos dois loci cairá para entre 0% (totalmen-
te ligados) e 50% (totalmente não-ligados): quanto menor a
freqüênc ia de recombinação, mais próximos estão os dois Zoei.
Uma representação comum para a frequência de recombinação
D D d d é a letra grega 8.
Mm Mm
Detecção da Ligação e
Medida da Distância Genética
A detecção dos eventos de recombinação que permitem uma
avaliação da ligação entre dois loci requer que um genitor s~ja
heterozigoto ("informativo") em ambos os loci. Se a mãe na
família mostrada na Fig. 8J3 fosse homozigota nos loci mar-
cadores, seria impossível determinar se tinha ocorrido recom-
D D d d
MMmm
binação . Os loci mais informativos para a análise de ligação,
portanto, são aqueles altamente polimórficos, tais como os
marcadores microssatélites analisados por PCR, e, portanto,
são heterozigotos em uma grande proporção de indivíduos (ver
NR: R= 0:4 Cap 6) .

Crossing MEDIDA DA D ISTÂNCIA GENÉTICA


duplo
NR: R = 8:8=1:1 Com estes comentários introdutórios, podemos ?-gora exami-
nar como se mede a ligação entre dois loci. Suponha que al-
guém esteja interessado em avaliar a possível ligação entre
dois loci em uma série de famílias . Entre a prole das meioses
informativas (aquelas em que um genitor é heterozigoto em
ambos os loci), 80% não são recombinantes e 20% são recom-
binantes . A freqüência de recombinação 8, portanto, é de 20%.
A distância genética é medida em unidades c hamadas de
D D d d
centiMorgan (cM), definida como a distância genética na qual,
m MM m
em média, observa-se recombinação em 1% das vezes. ( 0 cM
é 11100 de um Morgan, designado em homenagem a Thomas
Hunt Morgan, que primeiro observou o crossing over, na mos-
ca-das-frutas Drosophila.) Portanto, traduzindo urna fração de
recombinação de 20% em distância genética, pode-se estimar
que os dois distam cerca de 20 cM geneticamente. Esta esti-
mativa, entretanto, só é válida se o tamanho da prole for sufici-
D D d d ente para que se possa confiar o que a proporção observada de
Mm mM
80:20 de não-recombinantes para recombinantes é de fato di·
Fig.. 8. 11 Crossing entre cromossomos homólogos na meiose. re- ferente da proporção 50:50 esperada para loci que se distri-
sultando em uma nova combinação de alelos de origem materna e buem independentemente, pois estão muito distantes no mes-
paterna nos cromossomos recombinantes Se não ocorrer crossing mo cromossomo ou em cromossomos diferentes. De fato, se
no intervalo entre os loci 1 e 2. apenas os genótipos parenta is (não- quatro dentre cinco crianças fossem não-recombinantes e uma
recombinantes) DMe dm ocorrerão na prole. Se ocorrer um ou dois recombinante, esta proporção não seria significativamente di-
crossings no segmento entre os loci. metade da prole conterá um ferente do resultado esperado para loci totalmente não-ligados
genótipo não-recombinante e metade. o genótipo recombinante que se distribuem aleatoriamente (você considerari<1 significante
O mesmo é verdade se > de 2 crossings ocorrerem entre os loci
(não ilustrados aqui) se ao lançar uma moeda cinco vezes desse cara quatro vezes?).
Caso observássemos a mesma proporção de 80:20 após avaliar
várias dúzias de crianças de várias famílias, entretanto, certa-
mente seria considerado diferente de 50:50, assim como você
iguais proporções na prole. Por outro lado, se os dois loci esti- acharia incomum que ao lançar uma moeda 50 vezes desse cara
verem tão próximos no mesmo cromossomo que o crossing 40 vezes.
nunca ocorra entre eles, haverá uma ligação completa: os ge-
nótipos não-recombinantes (cromossomos parentais DM e dm
VALORES L OD: DOIS LOCI ESTÃO LIGADOS?
na Fig. 8.12B) serão transmitidos juntos sempre, apenas as
combinações alélicas não-recombinantes DM e dm nestes dois Suponha que des~jernos determinar se dois loci estão ligados.
loci ocorrerão, e a freqüência dos genótipos recombinantes Dm Para fazer isto, precisamos de duas informações. Primeiro, de-
e dM será O. Entre estes dois extremos está a situação na qual vemos determinar a fração de recombinação 8 entre os dois loci,
dois loci estão suficientemente distantes para que ocona a re- pois determinar se os dois loci estão ligados é equivalente a per-
combinação entre eles em algumas meioses e não em outras (ver guntar se a fração de recombinação entre eles difere significati-
a Fig. 8. 12C). Observaremos combinações não-recombinantes vamente da fração 0,5 que se espera para loci não-ligados Se-
MAPEAMENTO CÊNICO E O PROJETO DO GENOMA HUMANO ! 105

A B e

Não-recombinante Recombinante Não-recombinante Não-recombinante Recombinante

(DM + dm) = (Dm + dM) só (DM+ dm) (DM + dm) » (Dm + dM)

Fig. 8 . 12 Comportamento meiótico de alelos em dois Icei. 1 e 2. quando (AJ eles estão situados bem distantes no mesmo cromossomo.
(B} eles estão situados bem próximos no mesmo cromossomo e (C) quando estão situados no mesmo cromossomo, mas suficiente-
mente distantes para que ocorra crossing meiótico

gundo, precisamos determinar se um desvio, se é que algum, de e


loci estão ligados em alguma fração de recombinação, em com-
0,5 é verdadeiramente significativo usando um instrumento es- paração com a situação na qual eles não estão ligados As chan-
tatístico, chamado de proporção das probabilidades, do seguinte ces a favor de um determinado valor de 8 são, portanto, =
modo: examinamos um conjunto de dados familiares reais, con-
tamos o número de filhos que apresentam ou não recombinação probabilidade dos dados se os Joci estiverem ligados em um certo e
entre os loci e, finalmente, calculamos a probabilidade de obser-
probabilidades dos dados se os loci não estiverem ligados (8 = O, 50)
e.
var os dados em vários valores possíveis de variando de = e
0,0 (sem recombinação) a e= 0,50 (distribuição aleatória). To-
As proporções computadas em geral são expressas como log 10
mamos as proporções destas duas probabilidades para calcular
as chances de obter os dados observados supondo que os dois desta proporção e chamadas de valor lod (Z) para "logaritmo das
chances." (0 uso de logaritmos peunite que os dados coletados
de famílias diferentes sejam combinados por simples adição.)
A proporção das chances é importante de dois modos . Primei-
2
ro, ela fornece um método estatístico válido para usar os dados

Loc~~~ =:; ~a~ familiares para estimar· a freqüência de recombinação entre os


loci: o valor de 8 que dá o maior valor de Zé, de fato, a melhor
estimativa da fração de recombinação que você pode fazer com
e.... emu
1-+~ ~
os dados. Este valor de & é chamado de Se diferir de
50%, você terá evidência de ligação . Entretanto, mesmo que em..
Locus
seja a melhor estimativa de 8 que você pode ter, o quão boa ela
é? A proporção das chances também lhe dá uma resposta para
esta pergunta, pois quanto maior o valor de Z, melhor a estima-
li tiva de 8 . Os valores positivos de Z (chances> l) sugerem
que os d~Í~ loci estão ligados, enquanto os valores negativos
(chances < 1) sugerem que a ligação é menos provável (neste
valor de 8) que a possibilidade de que os dois loci não estejam
ligados . Por convenção, um valor lod combinado de +3 ou maior
(equivalente a maior que 1.000:1 chances a favor da ligação) é
considerado uma evidência definitiva de que os dois loci estão
Fig. 8. 13 Ligação do gene para urna torma autossômica dominan- ligados
te de retinite pigmentosa RP9, em um locus marcador A mãe A localização de genes por análise de ligação nos dá uma
(1- 1} é afetada por esta doença dominante e é heterozigota no oportunidade de identificar genes medicamente relevantes que
locus RP9 (Dd} bem como em dois outros locí. 1 e 2 . no cromos- não são compreendidos em termos bioq~írnicos ou moleculares .
somo 7 Ela leva os alelos A e B no mesmo cromossomo que o Considere a família mostrada na Fig. 813 A mãe tem uma for-
aielo mutante RP9 (D} O pai não-afetado é homozigoto normal
ma autossômica dominante de RP (RP9). Ela também é
(dd} no locus RP9. bem como nos dois locí marcadores (AA e BB)
Suas contribuições não são consideradas depois Todos os três
heterozigota para dois loci no cromossomo 7, um perto do gene
filhos afetados herdaram o alelo B no locus 2 de sua mãe. enquan- RP9 e outro não . Podemos ver que a transmissão do alelo mu-
to os três não-afetados herdaram o alelo fJ . Assim. todos os seis tante RP9 (D) invariavelmente "segue" a do alelo B no locus
filhos são não-recombinantes para RP9 e o locus marcador 2 En· marcador 2 da primeira geração parn a segunda geração nesta
tretanto. os indivíduos IH . 11-3 e11-5 são recombinantes para RP9 família Todos os três filhos que herdaram o alelo mutante RP9
e o locus marcador 1. o que indica que o crossing meiótico ocor· da mãe também herdaram o alelo B no locus marcador 2, enquan-
reu entre estes dois locí to toda a prole que herdou o alelo no1mal da mãe herdou o alelo
106 1 MAPEAMENTO CÊNICO E O PROJETO DO GENOMA HUMANO

b. O gene RP9, entretanto, não apresenta tendência de seguir o


alelo no locus marcador 1.
Suponha que Oseja a "verdadeira" fração de recombinação
entre RP9 e o locus 2, a fração que veríamos se tivéssemos nú-
meros ilimitados de prole para testar. Visto deste modo, (J pode
ser considerado como sendo a probabilidade, a cada meiose, de
que ocorra uma recombinação entre os dois loci. Como a recom-
binação ocorre ou não ocorre, a probabilidade de uma recombi-
nação, O, e a probabilidade de não haver recombinação devem
somar 1. Portanto, a probabilidade de que não ocorra recombi-
nação é 1 - (J
Em acoplamento: D e 1 d e 2 Em acoplamento: d e 1 D e 2
De fato, existem apenas seis filhos , todos não apresentan- Em repulsão: d e 1 D e 2 Em repulsão: D e 1 d e 2
do recombinação A probabilidade de ver Oprole recombinan-
te e 6 sem recombinação entre RP9 e o locus marcador 2 é Fig. 8. 14 Fases de ligação possíveis dos aleios 1 e 2 em um locus
dada por ( 8)0 ( 1 - 8)6 O valor de lod entre RP9 e o marcador marcador com os a leios D e d em um locus de doença
2 é portanto,

(8)º(1 - 8)6
Z = log consideramos dois exemplos que demonstram a importância de
10 (1/2)º (1/2)6 conhecer a informação da fase na análise de ligação. A Fig. 8.15
mostra heredogramas de duas fann1ias com neurofibromatose tipo
O valor máximo de Z é 1,81 quando e = O, o que sugere, mas 1 (NFl) autossômica dominante, Na fanu1ia com duas gerações,
não evidencia de forma definitiva, ligação, pois Zé positivo, mas a mãe afetada é heterozigota tanto no locus NF1 (D/d) quanto
menor que 3. Se resultados similares forem obtidos pelo estudo no locus marcador (1!2), mas nós não sabemos se o alelo NFJ
de outras famílias, os valores lod poderão ser somados para se está em acoplamento cóm oalelo 1 oü o alelo 2 no lócus marca-
atingir a significância (Z > 3). Neste caso, podemos dizer defi- dor. O pai nesta análise não é informativo, pois é homozigoto
nitivamente que o gene RP9 e o locus marcador 2 estão ligados, para o alelo normal d no locus NF1 e para o alelo 1 no locus
enquanto o gene RP9 e o locus 1 não estão (muito embora ainda marcador. Ele transmite para sua prole um cromossomo que tem
sejam sintênicos) Como a localização cromossômica do locus 2 o alelo normal (d) e o alelo 1, independente do quão distantes
já era conhecida como estando em 7p15 pelos métodos de ma- estejam os loci ou se ocorreu recombinação. Por inspeção, en-
peamento físico, a localização do locus RP9 agora também é tão, podemos deduzir quais alelos em cada filho vieram da mãe.
conhecida como estando próxima de 7p 15 Dois filhos herdaram os alelos D e 2 e um filho recebeu d e 1.
Dependendo da fase real destes alelos na mãe, ou todos os três
FASE NA ANÁLISE DE LIGAÇÃO
filhos são recombinantes ou todos os três não são recombinan-
tes (ver Fig. 8.15, esquerda).
Ser heterozigoto para um marcador polimórfico ligado e o gene Qual destas duas possibilidades é a correta? Não há modo de
da doença (como na Fig. 8.13) não é, entretanto, suficiente para saber com certeza e, assim, devemos comparar as probabilida-
detectar ligação. Também precisamos conhecer quais dos alelos des dos dois resultados possíveis. Em metade das vezes, a fase
polimórficos estão situados no mesmo cromossomo que o alelo correta é D2 e dl, e todas as três crianças herdaram um cromos-
da doença, isto é, a fase deve ser conhecida. Diz-se que os alelos somo no qual nenhuma recombinação ocorreu entre NF1 e o
no mesmo homólogo estão em acoplamento (ou eis), enquanto locus marcador. Se a probabilidade de recombinação entre NFJ
os alelos em homólogos diferentes estão em repulsão (ou trans) e o marcador é e, a probabilidade de não haver recombinação é
(Fig. 8. 14). Os alelos em acoplamento em um corüunto de mar- (1 - 0), e a probabilidade de três cromossomos não-recombi-
cadores proximamente ligados constituem o que é conhecido nantes é (1 - (J)3. A probabilidade geral, então, supondo esta fase,
como haplótipo para estes loci. Para ilustrar o conceito de fase, é 1/2 (1 - 0)3. Na outra metade das vezes, entretanto, a fase cor-

Fase desconhecida Fase conhecida

dd~Dd
11_12

íi Dd dd

Dd
12 11 12
Dd dd Dd
11 12 11
Fase Fase
Se D-1/d-2: A A A 0-1/d-2: NA NA NA
Se D-2/d-1: NA NA NA

Fig. 8 .I 5 Comparação da informação de ligação em heredogramas com fase desconhecida e fase conhecida R = recombinantes. NR =
não-recombinantes Ver o texto para discussão
MAPEAMENTO CÊNICO E O PROIETO DO GENOMA HUMANO 1 107

QUADRO 8-2

;-~~i~~t~~~ri;.~~,;;·ri~~~r~~i:~in~:~~J:ri~1:~i~~g!~b~jt]~t!~,j,~~~~:!:~j~~-~ fil~~$&~~~t~
Valores Lod (Z) em Vários Valores de O
Tipo de Heredograma
º·ºº 0,01 0,05 0,10 0,20 0,30 0,40

Fase desconhecida
Fase conhecida
0,602
0,903
0,589
0,890
0,533
0,837
0,465
0,765
0,318
0,612
0,170
0.438
0,049
0,237
0,602
0,903 º·ºº
0,00

reta é Dl e d2, que toma cada uma destas três crianças 1ecombi- Determinação da Fase em Heredogramas Ligados ao
nantes . A probabilidade, supondo esta fase alternativa, é 1/2 &. X. Para a análise de ligação em heredogramas ligados ao X, o
Para calcular a probabilidade geral do alelo D da doença NFI genótipo do pai da mãe é particularmente importante, pois, como
estar em acoplamento com o alelo marcador 2 em todas as três ilustrado na Fig. 8. 16, ele nos dá uma informação direta da fase
crianças, somamos a probabilidade calculada supondo que uma de ligação na mãe.. Como não pode haver recombinação entre os
fase na mãe está correta com a probabilidade calculada supondo genes ligados ao X em um homem porque a mãe sempre recebe
que a outra fase está correta. Portanto, a probabilidade geral é = apenas o único X do pai, qualquer marcador ligado ao X presen-
1/2 (l - 8) 3 + 1/2 &. te em seu genótipo, mas não em seu pai, deve ter sido herdado
Por outro lado, se não há ligação entre estes loci, espera-se da mãe . O conhecimento da fase, tão importante na consulta
uma segregação independente dos dois loci, e as probabilidades genética, pode assim ser prontamente avaliado pelos membros
de um genótipo recombinante e um não-recombinante na prole masculinos apropriados de um heredograma ligado ao X, se eles
são iguais a 1/2 A probabilidade de ter três filhos com estes estiverem disponíveis para estudo.
genótipos, sob a suposição de não-ligação, é de (112)3, ou 1/8.
Então, as chances relativas para este heredograma são Eou1UBRJO DE LIGAÇÃO

1120 - 8) 3 + 112 e3 As duas famílias da Fig. 8.15 ilustram um outro conceito muito
importante . Em uma família, o alelo mutante NF1 estava associ-
1/8 ado ao alelo 1 no locus marcador proximamente ligado . Na ou-
tra família, NFJ estava associado ao alelo 2. Em geral, não há
Avaliando as chances relativas para valores de (J de Oa 0,5, o associação entre os alelos da doença e determinados alelos em
valor máximo do valor lod, zmou' é de loglO(4) = 0,602 quando 8 um lócus polimórfico ligado. A fase de ligação tem que seres-
= 0,0 (Quadro 8.2) Como isto está distante de um valor lod maior tabelecida para cada familia independentemente das outras fa-
que 3, precisaríamos de pelo menos cinco famHias equivalentes mílias não-relacionadas. As freqüências alélicas nos dois loci são
para estabelecer a ligação (em 8 = 0,0) entre este locus marca- ditas estando em equilíbrio de ligação. As proporções relativas
dor e NFJ Com cálculos um pouco mais complexos (feitos mais das combinações alélicas passiveis podem ser previstas pelo
facilmente por programas computadorizados escritos para faci- produto das freqüências populacionais dos alelos em loci indi-
litar a análise de ligação), podemos calcular os valores lod de viduais. Assim, se urna doença estiver ligada a um marcador
outros valores de 8 (ver Quadro 8.2). polimódico com dois alelos de igual freqüência, o alelo da do-
ença estará em acoplamento com um dos alelos marcadores em
Conhecimento da Fase e Heredogramas Desconheci~ metade das famílias afetadas e com o outro alelo na outra meta-
dos .. A segunda família na Fig. 8. 15 é similar, exceto pelo fato
de os genitores da mãe estarem disponíveis para análise.. Por ins-
peção, fica claro que o avô materno deve ter transmitido tanto o
alelo (D) de NFJ quanto o alelo 1 para sua filha. (Este achado
não requer nenhuma suposição sobre se ocorreu ou não um
crossing na linhagem gexminativa do avô. Tal suposição não
estaria garantida.) A fase na mãe deve, portanto, ser Dl em um
cromossomo e d2 no outro A disponibilidade de uma terceira
geração toma este he1·edograma com fase conhecida As três Previsto como
crianças podem agora ser definitivamente dadas como não- - - - não-afetado
recombinantes. Comparar as possibilidades de ligação e não-li-
gação agora é mais simples, pois não temos que considerar a fase
oposta. A probabilidade de ter três crianças com os genótipos
observados é conhecida (l - t3)3. Como no heredograma anteri- Fig. 8. 16 Na ligação ao X. o fenótipo do avô materno pode revelar
or com fase desconhecida, a probabilidade dos dados observa- a fase de ligação em sua filha Neste heredograma. o cromossomo
dos, se não houver ligação entre os loci, é de ( l/2)3 = 1/8. As X do avô materno afetado leva o ateio A em um locus marcador
proximamente ligado ao gene para hemofilia A (Íl). Assim, sua fi.
chances relativas deste heredograma são (1 - 8)3: 1/8 a favor da
lha tem estes alelos em um de seus cromossomos X e os alelos a e
ligação e o valor lod máximo Z em 8 = 0,0 é 0,903 (ver Quadro H no outro. muito embora não exista informação direta sobre o
8.2), Assim, a força da evidência que apóia a ligação é duas ve- genótipo da mãe O conhecimento da fase do genótipo pode ser
zes maior na situação de fase conhecida que na situação de fase usado para prever os genótipos de sua prole masculina. incluindo
desconhecida um feto masculino diagnosticado na fase pré-natal
108 ' MAPEAMENTO CÊNICO E O PROJETO DO GENOMA HUMANO

de das failll1ias. Compare esta situação com uma na qual uma


mutação que produza doença s~ja vista em acoplamento apenas
com um determinado alelo em um locus ligado ao gene da doen-
ça. Esta situação, chamada de desequilíbrio de ligação, é rara,
mas é extremamente valiosa para a análise genética, como ilus- li
trado mais adiante neste capítulo com relação ao gene da fibrose
cística (CF).
2
Mapas de Ligação Genética 111
AaBbcc Aabbcc
Mapas de ligação de um grande número de loci, mesmo de cro-
mossomos inteiros, foram criados combinando-se medidas de
distâncias genéticas entre loci proximamente ligados obtidos dois Crossings em 11-1
de cada vez. Suponha que dois loci, A e B, estejam ligados dis- Ordens possíveis
tando cerca de 1O cM, Com esta informação, podemos agora
construir um mapa genético para o cromossomo no qual os loci BAC
A e B estão situados. Loci adicionais poderão ser acrescentados
ao mapa de ligação se suas distâncias dos loci A e B puderem ser
medidas , Por exemplo, considere um terceiro locus C, que acha-
e
mos estar ligado a A com um valor lod máximo em = 0, 12 e
ligado a B com um valor lod máximo em 8 = 0,05. Com apenas
estes dados de dois pontos, a ordem dos três loci em relação uns
aos outros pode ser estabelecida por inspeção: a ordem provável ABC
será A-B-C, com o seguinte mapa.

1 =O,lO=j=0,05= j

-A ~ t- ACB
===== 0,12 =====

Note que a distância A-C medida pela freqüência de recom-


binação é menor que a soma das distâncias A-B e B-C Esta dis-
crepância deve-se ao fato de que os crossings duplos (um no in- Fig. 8.17 Determinação da ordem de marcadores usando-se cru-
tervalo A- B e um no intervalo B-C) não resultam em recom- zamen tos multiponto Os indivíduos lll-J e 111-2 receberam game-
binação entre A e C e, portanto, leva a uma subestimação das tas de seu paL 11- 1. nos quais devem ter ocorrido crossings Exis-
distâncias entre eles. tem três ordens possíveis. com os toei A, B ou C situados entre os
outros dois Crossings duplos serão necessários para explicar os
genótipos de 111-1 e 111-2 se A ou C estiver entre os outros dois loci
Análise de Ligação Multiponto Apenas a ordem que coloca B entre A e C explicaria os genótipos
dos indivíduos 111-1 e 111-2 por eventos de crossing único Outras
Um método alternativo para determinar a ordem entre três loci é ordens são menos prováveis
considerar todos os dados juntos, um processo chamado de aná-
lise multiponto, em vez dos cruzamentos separados de dois
pontos. O princípio da análise multiponto é estabelecer a ordem
de marcadores diminuindo o número de crossings aparentemen- indo muitos de significado médico, estão sendo semanalmente
te múltiplos (Fig . 8 17). Nos estudos de mapeamento muito com- adicionados ao mapa genético humano .
plexos em particular, aqueles que envolvem dúzias de locí mar-
cadores, a análise multiponto pode dar um forte suporte estatís-
tico de que uma determinada ordem de marcadores está coneta
Relação entre Distância Genética e Física
Os mapas criados pela análise multiponto podem então ser usa- O tamanho genético total dos 23 cromossomos em todo o ge-
dos como estrutura para fornecer a informação diagnóstica a ser noma humano haplóide foi inicialmente estimado como sendo
usada na consulta genética (Fig. 8.18), de cerca de 3 000 cM, com base no número observado de
Com o aumento da atenção enfocada no mapeamento gênico quiasmas vistos na meiose 1 na espermatogênese (ver Cap. 2).
como parte do Projeto do Genoma Humano (ver discussão mais Urna medida recente e mais apurada de cerca de 4.300 cM foi
adiante), detalhados mapas genéticos de ligação de todo o geno- ge1 ada somando-se todas as distâncias entre os milhares de
ma humano foram construídos usando uma bateria de grandes marcadores genéticos que foram situados no mapa genético
f3Illl1ias de três gerações para medir o mais precisa e refinada- humano pelo Cooperative Human Linkage Center. Se o geno-
mente possível a freqüência de recombinação entre milhares de ma, com um tamanho físico haplóide de aproximadamente .3
marcadores microssatélites de DNA informativos (ver, por exem- x 109 pares de bases, mede cerca de 4-300 cM em distância
plo, os bancos de dados de mapas de ligação humanos gerados genética, 1 cM equivale a aproximadamente 700.000 pares de
pelo Cooperative Human Linkage Center). Não há mais nenhum bases. O Quadro 8J resume as relações entre os marcos cito-
"território geneticamente não-mapeado", e novos genes, inclu- genéticos, as distâncias físicas e as distâncias genéticas e as
MAPEAMENTO GENICO E O PROIETO DO GENOMA HUMANO ! 109

11- Mapeamento de Genes de


Doença por Análise de Ligação

NFl-~~t ti A IMPORTÂNCIA DOS ESTUDOS DE FAMÍLIAS

O mapeamento de genes de doenças começa com a identifica-


ção e o registro de um número suficiente de familias para esta-
belecer a ligação Achar familias adequadas, entretanto, pode ser
um desafio, em particular· para distúrbios raros ou distúrbios nos
quais as pessoas afetadas morrem ainda jovens (e amostras de
DNA não estão disponíveis para análise). Os membos familia-
res são cuidadosamente examinados prua determinar quem é e
quem não é afetado pela doença. O DNA é obtido de todos os
Ordem de marcador: Desconhecida Conhecida membros familiares relevantes disponíveis Qualquer célula
Diagnóstico: ? Afetado nucleada pode servir como fonte de DNA: os leucócitos de san-
gue periférico são as usadas com mais freqüência, mas as célu-
Fig. 8 .18 Mapa normal de ligação genética no cromossomo !7 e
sua aplicação na consulta genética para NF1 Conhecer a ordem de
las da mucosa bucal da parte interna da bochecha, células
marcadores no cromossomo 17 nos permite interpretar os dados cutivadas e mesmo tecidos de amostras fixadas embebidas em
de ligação na famllia e o diagnóstico no feto masculino que se prevê parafina podem fornecer DNA para análise . Uma vez conhecida
que seja afetado Sem o mapa normal para comparação. a família a condição de doença de todos os membros da família, suas
não teria sido informativa pois a posição do crossing observado amostras de DNA são usadas para descobrir seus genótipos em
com relação ao locus NF'1 teria sido desconhecida Assim. nenhum um conjunto de marcadores polimórficos pelo genoma. O gene
diagnóstico teria sido possível responsável pelo fenótipo da doença pode então ser analisado
quanto à ligação a cada um dos marcadores polimórficos.
Dois tipos de farru1ias têm sido usados para mapeai· genes de
correlaciona com o conteúdo gênico aproximado. A freqüên- doenças (Fig. 8.19). Em um, é avaliado um pequeno número de
cia de recombinação, entretanto, não é constante ao longo de familias muito grandes. A desvantagem deste enfoque é que to-
um cromossomo ou pelo genoma. Além disso, a freqüência de dos os membros afetados do heredograma são conhecidos como
recombinação entre dois loci também nem sempre é idêntica tendo a mesma doença genética, causada por uma mutação no
na meiose masculina e feminina. Como conseqüência, a distân- mesmo gene . O enfoque altemalivo é coletar um grande número
cia genética (medida como a porcentagem de recombinação na de fanúlias um pouco menores Esta estratégia é mais fácil para
meiose) e a distância ffsica (medida em pares de bases ou ban- doenças relativamente comuns, tais como a CF (ver Fig. 8.19),
das cromossômicas) só podem ser comparadas como uma li- mas tem o risco de que nem todas as famílias tenham o distúrbio
geira aproximação e fornecem medidas muito diferentes, em- geneticamente idêntico. A heterogeneidade de Iocus é causada
bora correlatas, da distância entre os genes por defeitos em dois ou mais loci genéticos. A presença de hete-
rogeneidade de locus desconhecida pode confundir a análise
genética de ligação, pois pode dar a impressão de que um mar-
A~LICAÇÃO DO MAPEAMENTO cador não está ligado a um locus de doença quando de fato ele
pode estar ligado, mas apenas em parte das familias analisadas.
GENICO HUMANO
Esta situação é ilustrada mais adiante no caso da ligação em RP
A principal aplicação do mapeamento gênico à genética médica autossômica dominante ·
é a localização e a identificação dos genes de doenças. Os mar-
cadores ligados a genes de doenças podem então servir como
0 LIMITE DE 10 CENllMORGAN
marcos para os mapas físicos usados pára clonar genes respon-
sáveis por uma doença genética. O mapeamento genético é aju- Na prática da genética humana, podemos esperar encontrar liga-
dado pelo conhecimento da posição no mapa físico dos marca- ção apenas em uma distância de cerca de 10 cM ou menos, pois
dores polimórficos usados na análise de ligação. Os esforços do com distâncias maiores em geral não podemos encontrar mate-
mapeamento físico para refinar a localização de um gene podem rial familiar suficiente para estabelecer evidência significativa de
ser orientados pela existência de crossings meióticos específicos, ligação (um valor lod > 3) Em outras palavras, um marcador
detectados como parte da análise de ligação, os quais podem polimórfico geralmente tem que estar mais ou menos dentro de
definir os limites dentro dos quais o gene da doença deve estar. 7 ,5 milhões de pares de bases distante do gene da doença de in-
Os mapas genéticos e os mapas físicos são interdependentes e teresse para que a ligação possa ser detectada, Para uma caracte-
complemelltares. Iistica autossômica, 7,5 milhões de pares de bases é aproxima-

QUADRO 8-3
; (:;<>It11'~rélÇ~9 ~~-~élf~~~tl"o~ f i;~~gellétic(>s. •tísicos e. (ie.11éticg~ ~~- ~,en~lllél ·
Citogenética Tamanho Físico Distância Genética
9
Genoma haplóide de 23 cromossomos 3 X 10 pares de bases 4 300cM :t 50 .000 genes
Um cromossomo médio 1,5 X 108 pares de bases :t 200cM :t 2 .200 genes
l banda cromossômica 3 X 106 pares de bases ± 5cM :!: 50 genes
110 ' MAPEAMENTO CÉNICO E O PROJETO DO GENOMA HUMANO

Fig. 8 .19 Dois enfoques de coleta de famílias para análise de ligação A ligação bem-sucedida da doença de Huntington a um marcador
polimórfico no cromossomo 4 baseia-se em grande parte em um único heredograma grande da Venezuela. do qual uma pequena parte
é mostrada em A A ligação bem-sucedida da fibrosedstica a um marcador polimórfico no cromossomo 7. entretanto, baseia-se em uma
coleção de muitas famílias menores. algumas das quais são mostradas em B (Adaptada de Gusella J F , Wexler N S. Conneally P M ,
et al 119831 A polimorphic DNA marker genetically linked to Huntington·s disease Nature 306:224-238. e Tsui L-C. Zengerling A, Willard
H F . Buchwald M 119861 Mapping of the cystic fibrosis locus on chromosome 7 Cold Spring Harbor Symp Ouant Biol 51 :325-335 l

damente 1/400 do genoma e, portanto, poderíamos prever que, doença em famílias para fins diagnósticos. Eles também podem
em média, 400 ou mais marcadores polimórficos bem espaça- servir como pontos de partida para refinados estudos de mapea-
dos serviriam como um conjunto adequado de marcadores para mento direcionados para identificar e isolar o próprio gene da
testar a ligação na coleção familiar. Deve ficar claro que a situ- doença.
ação é consideravelmente mais fácil para doenças ligadas ao X, Uma vez confirmado o resultado da ligação suspeita, testa-
pois já conhecemos a localização cromossômica do gene. Em mos outros marcadores que estão mapeados perto dos marcado-
conseqüência, uma doença ligada ao X pode ser mapeada em uma res ligados conhecidos para encontrar outros marcadores que
região específica do cromossomo X usando apenas de 15 a 20 estejam ligados tão proximamente que não apresentem recom-
marcadores ligados ao X. binação com o gene da doença (em.. = O) Neste estágio, tam-
bém é extremamente importante identificar os marcadores mais
CONFIRMAÇÃO DA LIGAÇÃO E
próximos em ambos os lados do gene da doença que se recom-
DEFll~IÇÀO DO MEl~OR INTERVALO DE LIGAÇÃO
binam pelo menos uma vez com o gene da doença nas famílias
que estão sendo estudadas. Os marcadores que apresentam pelo
Quando se começa uma pesquisa sobre ligação, a expectativa em menos um evento de recombinação definem os limites do inter-
relação a um determinado marcador polimórfico é que, por aca- valo no qual pode estar o gene da doença.
so, ele não esteja ligado ao gene da doença (de fato, por acaso, é
improvável que qualquer marcador esteja no mesmo cromosso-
MAPEAMENTO DE ALTA RESOLUÇÃO
mo do gene da doença). Portanto, são necessárias apenas algu-
mas meioses informativas para estabelecer que o marcador não Técnicas tais como a hibridização de células somáticas, luôridos
está perto do gene de interesse Quando um marcador apresenta de radiação e FISH em cromossomos metafásicos podem locali-
evidências sugestivas de ligação (um valor lod máximo combi- zar genes em regiões que variam de tamanho desde um cromos-
nado entre 2 e 3, por exemplo), a integração dos mapas físicos e somo inteiro até um segmento de um cromossomo de aproxima-
genéticos já amplos de cada cromossomo humano toma-se ex- damente 350.000 pares de bases, ou cerca de 0,1 % a 0,7% do
tremamente valiosa.. Outros marcadores conhecidos como estan- tamanho linear de um cromossomo típico. A resolução do ma-
do na mesma região que o marcador ligado podem ser imediata- peamento de ligação genética é ainda mais limitado por dois
mente testados para determinar se a ligação pode ser confüma- motivos. Primeiro, o valor de 8 sempre tem a imprecisão ineren-
da. Se, por exemplo, o marcador estiver mapeado em uma posi- te a uma estimativa estatística e depende de que material da fa-
ção no braço longo do cromossomo 7, podemos enfocar a aten- rru1ia está disponível para o estudo. Segundo, após eventualmente
ção em outros marcadores polimórficos nesta região para con- identificar um conjunto de marcadores em urna região, todos os
firmar ou rejeitar o resultado de ligação sugerido . Depois que qurus não apresentam recombinação com o gene da doença, não
encontramos um ou mais marcadores dentro de cerca de 5 cM é possível um maior aumento de resolução: o gene da doença
do gene da doença, podemos usá-los para rastrear os genes da pode estar em qualquer ponto entre os marcadores que não se
MAPEAMENTO GENICO E O PROJETO DO GENOMA HUMANO ! 111

recombinam nas familias Reduzir ainda mais o intervalo de li- nhança de um gene de interesse é um modo rápido para isolar
gação requer famHias adicionais, na esperança de encontrar re- trechos consideráveis de DNA genômico em uma forma clonada
combinações adicionais no que já é uma região limitada, para adequada a uma análise posterior mais detalhada (Fig. 8.20). O
permitir um maior estreitamento do intervalo ao redor do gene segmento de DNA contido em cada YAC pode então ser subdi-
da doença (embora uma resolução maior seja possivel se o dese- vidido constmindo-se um contig de cromossomos artificiais de
quilíbrio de ligação estiver presente; ver discussão posterior). O bactérias (BACs) superpostos que incluam o segmento de DNA
aumento de precisão necessário para identificar a localização dos contido no YAC. Os BACs geralmente contêm de 100 a 200 kb
genes responsáveis pela doença genética e permitir sua identifi- de DNA, são menores que os Y ACs e são adequados a uma
cação e seu isolamento requer enfoques de mapeamento de alta subclonagem posterior em fragmentos cada vez menores e, fi-
resolução para mapear e clonar regiões do DNA até a seqüência nalmente, o seqüenciamento. Deste modo, a localização e a es-
de nucleotídeos (único par de bases), um nível de resolução bem trutura de um gene podem ser determinadas não só para a reso-
abaixo da faixa dos métodos citogenéticos e de ligação.
lução de éxons e íntrons individuais, mas até sua seqüência real
de DNA, incluindo as mutações responsáveis pela doença. As
Contigs de Cromossomos Artificiais técnicas usadas para o mapeamento físico são mostradas e com-
paradas no Quadro 8.4.
O mapeamento de alta resolução baseia-se no isolamento de um
conjunto de grandes fragmentos superpostos de DNA (chamado
de um contig) que inclui todo o segmento de DNA contiguo que Mapeamento Gênico Humano e
contém tanto o gene de interesse quanto os marcadores genéti- Identificação de Genes de Doença
cos usados para mapear o gene. Usando os métodos descritos no
Cap. 4, estes grandes fragmentos em geral são isolados de bibli- A aplicação do mapeamento gênico à genética médica teve um
otecas de DNA humano clonado preparadas em uma variedade sucesso espetacular. A estratégia geral -o mapeamento da lo-
de cromossomos artificiais de levedur·a (YACs) ou de bactéri- calização de um gene de doença pela análise de ligação para
as. Os YACs contêm fragmentos de até 1.000 kb. O isolamento definir marcadores que sejam usados no diagnóstico de doenças
de um contig de YACs contendo todos os marcadores na vizi- e consulta genética, seguido de tentativas de clonar o gene com

-
Localização por análise de ligação
li
1---l
10.000 kb
Marcador Marcador
genético genético
recombinante recombinante
',·',.,+
__,y'-----,ô~-__.W.___
~r~~i~s~~mo artificial ~ ~ ----Y~
de levedura --Y.L----f[i] V ~ ~ -'W._
,· - - - - 1-1
100 kb

Éxons individuais do gene B


Contig de cromossomo --'--+++-
artificial de bactéria _ _..___ +++ - - H
20kb
/
/
''
/
'
/
I
''
/
/
''
Identificação do gene e
determinação de fü:~J~;KtJ~f'k~:fff~~,WI 1--1
sua estrutura / ' 100bp
I '

/
/
I '
''
CAG AAC TIA
Análise de seqüência do DNA Análise de
i
CAG AAC TGA
mutação

Fig. 8.20 Mapeamento de alta resolução para clonagem e análise de um gene hipotético de doença O mapeamento começa com a
análise de ligação genética. com marcadores fortemente ligados dentro de um intervalo definido por marcadores flanqueadores que
apresentam recombinação com o locus da doença A resolução aumenta a partir da análise de ligação para a clonagem em cromosso-
mos artificiais de leveduras e cromossomos artificiais de bactérias. para isolamento gênico e caracterização. e finalmente para identifi-
cação de um defeito molecular pela determinação da seqüência de DNA
112 ! MAPEAMENTO CÉNICO E O PROIETO DO GENOMA HUMANO

QUADRO 8-4
... ::·,; ; . ,: ..
· ."~:,. .· ··. ~•. ·: . • :.~: ~ :)'!.', ;:,' /;.:::: ~:-;.•: :._.·.- .

: : _.,·;.: .>I .; ~: · . ·. ~:· ·.· ~< ~ :~·~:.~;>:.~·:;:~~>~·,:.('.'. ·: .,?·:.:,.' •·:· ~ ~.. :::.'.\
Resolução Típica do
Método Meta Mapeamento (em pares de bases)

Híbridos de células somáticas roedor/humana Localização no cromossomo 50-250 X 106


Híbridos roedor/humano contendo cromossomos Localização regional 5-20 X 106
humanos rearranjados
Mapeamento de híbrido de radiação Localização regional 3,5-5 X 105
Análise de dosagem gênica Localização no cromossomo X e regional 5-20 X 106
Hibridização in siru com fluorescência (FISH) Identificação do cromossomo e localização l-2 X 106
regional dentro de uma banda cromossômica
Mapeamento de restrição de longo alcance Mapeamento fino da região gênica J05 - J06
FISH de fibra de cromatina Mapeamento fino de região gênica e IQl - 106
determinação da ordem de marcador
Clonagem em cromossomos artificiais Clonagem gênica (fragmentos grandes)
Clonagem em bactérias Clonagem gênica (fragmentos médios e
pequenos)
Reação em cadeia da polimerase Clonagem e mapeamento gênico 102 - 104
Seqüenciamento de DNA Seqüência de nucleotídeos 1

base em sua posição de mapa - pode ser mais bem ilustrada por nestas famílias ficou clara quando as investigações citogenéti-
exemplos específicos. Os exemplos que serão discutidos ilustram cas mostraram que as pacientes tinham uanslocações balancea-
vários enfoques. Um que seja bem-sucedido para uma determi- das X; autossomo (ver Cap. 10). O autossomo envolvido diferia
nada doença depende de características e circunstâncias únicas em cada caso, mas o local da translocação do X era sempre o
dessa doença mesmo: Xp21 . Os pesquisadores levantaram a hipótese de que a
O enfoque da clonagem de um gene que torne por base ape- quebra em Xp21 perturbou o gene DMD nestas meninas. O DNA
nas sua posição de mapa, sem saber quase nada sobre o que o foi isolado do ponto de translocação X;autossorno e usado para
gene faz ou com que se parece, é chamado de clonagem procurar e identificar seqüências gênicas na vizinhança do pon-
posicional, a fim de distingui-la da estratégia alternativa para a to de quebra da translocação .
identificação gênica na qual se inicia com uma proteína conhe- A clonagem do gene DMD e seu cDNA permitiu um intenso
cida, determina-se sua seqüência de aminoácidos e usa-se esta estudo do distúrbio e seu defeito básico Ao contrário da situa-
informação para isolar o gene (ver Cap . 4). ção da CF (ver a próxima seção), a maioria das mutações DMD
deve-se a deleções gênicas parciais.
CLONAGEM POSICIONAL USANDO ANOMALIAS CROMOSSÔMICAS
ESTRUTURAIS: DISTROFIA MUSCULAR DUCHENNE CLONAGEM POSICIONAL USANDO
MAPEAMENTO DE l -IGAÇÃO GENÉTICA: FIBROSE CfSTICA
O gene DMD ligado ao X, no qual as mutações causam a distro-
fia muscular Duchenne e a forma alélica menos severa Becker Devido à sua freqüência relativamente alta, em particular nas
(BMD), foi um dos primeiros genes de doença localizados por populações caucasianas, e à ausência quase aosoluta de compre-
análise genética de ligação e um dos primeiros clonados por uma ensão de sua patogenia fisiológica subjacente, a CF representa
estratégia posicional. A genética molecular da DMD (e da BMD) outro alvo importante para a clonagem posicional. Como não se
e a natureza da proteína codificada, a distrofina, serão discuti- enconuou nenhuma anomalia cromossômica estrutural envolvi-
das no Cap 12. Urna vez que o gene foi localizado por análise da na CF, o mapeamento de ligação genética foi usado para lo-
de ligação em Xp21, a clonagem bem-sucedida do gene baseou- calizar e clonar o gene. Amostras de DNA de quase 50 fanu1ias
se em dois enfoques diferentes, ambos os quais usaram DNA de com CF foram analisadas quanto à ligação entre a CF e centenas
pacientes incomuns com DMD cuja doença era o resultado de de marcadores de DNA pelo genoma, até que finalmente se iden-
anomalias estruturais envolvendo o cromossomo X. tificou uma ligação entre a CF e os marcadores no braço longo
No primeiro enfoque, o gene DMD foi clonado usando-se o do cromossomo 7. A ligação a marcadores adicionais de DNA
DNA de um paciente que tinha DMD mais três outros distúrbios em 7q3 l a q.32 refinaram a localização do gene CF nesta região
genéticos decorrentes da deleção de quatro genes resultantes de do cromossomo 7. Devido ao grande número de meioses dispo-
urna deleção citogeneticamente visível de Xp21 (ver Fig 8.7). níveis para estudo, foi possível identificar a localização do lo-
As seqüências de DNA de Xp21 que faltavam no cromossomo cus CF entre os loci MET e D7S8, dois marcadores distando cerca
X do paciente foram isoladas e testadas em um grupo de meni- de 1.500 kb que foram vistos flanqueando o locus de CF pela
nos afetados sem a aparente deleção citogenética Descobriu-se inspeção de eventos de crossing.. A localização do gene foi en-
que alguns destes fragmentos também estavam deletados em tão ainda mais estr·e itada, para uma região com cerca de 500 kb,
pacientes com deleções muito menores, submicroscópicas. A usando-se marcadores mais polimórficos entre MET e D7S8 para
análise posterior de alguns destes fragmentos revelou que eram encontrar crossings individuais adicionais em muitas centenas
éxons do gene DMD. de famílias com CF estudadas em todo o mundo.
O segundo enfoque tirou proveito de amostras de DNA de Desequilíbrio de Ligação na CF. Neste ponto, entretanto,
mulheres com DMD. As mulheres com DMD são muito raras, surgiu uma característica incomum da genética da CF: embora
pois a doença é recessiva ligada ao X, mas a etiologia da DMD os marcadores mais próximos ainda estivessem a alguma distân-
MAPEAMENTO G~NICO E O PROJETO DO GENOMA HUMANO 1 113

eia do gene CF, ficou claro que 90% dos cromossomos CF ti- alta nos cromossomos portadores da mutação da doença, como
nham um haplótipo particular em loci fo1temente ligados à CF ilustra a Fig. 8..21, pois os marcadores são situados muito próxi-
(alelos em acoplamento a estes loci da mutação CF), enquanto mos ao gene para que a recombinação embaralhe alelos diferen-
apenas cerca de 25% dos cromossomos normais (não-CF) tinham tes em acoplamento ao alelo da doença Este modelo prevê que
este haplótipo. Este resultado, que é conhecido como desequilí- o mais alto grau de desequilfüiio deve ser encontrado mais perto
brio de ligação, está em contradição com o equilíbrio de liga- da mutação da doença. Isto porque quanto mais perto estiverem
ção em geral observado entre os marcadores ligados a uma do- o gene da doença e os marcadores no desequilfürio de ligação,
ença, tal como com a NFl (já discutida) ou a DMD, na qual os menos provável será que o alelo da doença e os alelos marcado-
a!elos em loci ligados ao gene da doença são diferentes em fa. res flanqueadores que estavam presentes no cromossomo ances-
mílias diferentes. O desequilíbrio de ligação é definido como a tral tenham sido separados por crossing over ao longo das gera-
associação prefencial de um gene de doença com determinados ções. Portanto, para tirar proveito da existência do desequilfürio
alelos em marcadores proximamente ligados. A interpretação de ligação para a clonagem posicional, devemos enfocar a aten-
usual do desequfübrio de ligação é de que se trata de um efeito ção nas regiões com o mais alto grau de desequilfürio, porque
do fundador (ver Cap. 7) no qual a maioria dos cromossomos elas em geral estarão mais peito do sitio da mutação ancestral.
portadores da mutação da doença descende de um ancestral co- O gene CF foi isolado em 1989; após uma intensa séiie de
mum. O genótipo ancestral em marcadores no alelo mutante e investigações que ilustram a importância tanto do mapeamento
ao redor dele persiste em uma freqüência desproporcionalmente físico quanto do mapeamento genético . Primeiro, todos os ge-

A1 N B1

A2 N B2
1 1 1

t mutação ancestral

A1 CF B1

A2 N B2

oslociCFVA
estão bem
distantes

~ xxxr~:
A1 CF B1
1 1 "' 1
A2
1
recombinação recombinação
freqüente entre o rara entre o locus
locus A e a CF Be aCF

i
t
'
após muitas gerações

i A1 CF B1

A2 N B2

EQUllÍBRtO DE LIGAÇÃO ENTRE DESEQUILÍBRIO DE LIGAÇÃO


A MUTAÇAO CF E OS ALELOS ENTRE A MUTAÇÃO
EM UM LOCUS A2 CF B1 CF E O ALELO B1

A1 N B2

Fig. 8 .21 Uma explicação para o desequilfbrio de ligação entre um locus de doença. tal como a fibrose dstica. e um locus marcador
proximamente ligado As freqüências de haplótipos atingirão o equilíbrio se o locus marcador estiver distante o suficiente do locus da
doença para que ten ham ocorrido muitos crossings por muitas gerações. desde a época da mutação ..ancestral·' original Para marcado-
res muito proximamente ligados ao locus da doença, ocorreu pouca recombinação e. portanto. a distribuição de alelos observada nos
cromossomos com a mutação CF se assemelhará àquela presente no cromossomo quando ocorreu a mutação ancestral e não a distri-
buição atual de haplótipos na população
1 14 l MAPEAMENTO CÉNICO E O PROIETO DO GENOMA HUMANO

nes situados no intervalo de 500 kb de DNA tido como conten- liar autossômico dominante conhecido como câncer de cólon não-
do o gene de CF precisaram ser identificados. Foram usadas duas polipose hereditário (HNPCC) (ver Cap. 16). O nome HNPCC é
estratégias de identificação gênica: (1) a seqüência de DNA foi usado para distinguir esta forma de câncer de cólon autossômi-
examinada quanto às regiões conservadas durante a evolução, co dominante de outro distúrbio, a polipose adenornatosa fami-
pois as regiões conservadas mais provavelmente representam liar do cólon (FAP), na qual os pacientes desenvolvem decente-
genes, e (2) os fragmentos de DNA da região foram testados para nas a milhares de pólipos colônicos que sofrem transformação
ver se continham os segmentos que coil'espondiam a mRNA maligna (ver Cap. 16).
transcritos. Quatro genes foram identificados dentro do interva- A análise de ligação em famílias com HNPCC autossômico
lo que se sabia conter o gene CF por mapeamento de ligação. dominante imediatamente revelou que havia heterogeneidade de
Apenas um dos genes mostrou um defeito molecular nos paci- locus: algumas farru1ias, mas não todas, apresentavam ligação
entes com CF: uma deleção de 3 pares de bases na seqüência com o braço curto do cromossomo 2 (chamada de HNPCCJ),
codificante foi encontrada em cerca de 70% de todos os cromos- outras mostravam ligação com o cromossomo 3p (HNPCC2) e
somos CF nas populações da Europa setentrional, mas nunca nos algumas não apresentavam ligação nem com 2p nem com .3p. De
alelos normais neste locus. Desde 1989, mais de 900 mutações modo mais surpreendente, entretanto, quando os genótipos dos
diferentes que causam CF já foram identificadas em muitos gru- pacientes com a doença foram determinados tanto no sangue
pos étnicos ao redor do mundo (ver Cap. 12). quanto no DNA do tumor usando marcadores microssatélites em
2p e em outra parte, descobriu-se que o DNA do câncer conti-
CLONAGEM DE GENES DE DOENÇA PELA COMBINAÇÃO DA nha mais de dois alelos, muitos dos quais tinham tamanhos de
il~FORMAÇÀO FUNCIONAL E POSICIONAL: RETINllE PIGMENTOSA repetição em tandem não encontrados no DNA do sangue do
mesmo paciente. Estes numerosos alelos novos no tecido tumo-
A doença ocular hereditária RP ilustra uma outra estratégia para ral sugeriram que o DNA no tumor na verdade era instável e que
identificar genes de doença. A RP é um grupo de doenças herda- curtos polimorfismos de repetição em tandem por todo o geno-
das associadas à degeneração da retina que, a princípio, afeta ma não estavam se replicando fielmente durante a mitose. Tal
predominantemente os bastonetes fotoueceptores. As caracterís- instabilidade de microssatélite, mais bem discutida no Cap. 16,
ticas clínicas incluem visão noturna e periférica reduzidas nos tinha sido vista antes: em uma levedura defeituosa para um gene
primeiros estágios, mas a progressão para uma cegueira total é de reparo de mau pareamento de DNA chamado MSH2 (um acrô-
um resultado comum. A RP é a principal causa de cegueira nos nimo obscuro para o homólogo de mutS, um termo derivado da
seres humanos, com uma prevalência estimada de cerca de 1 em similaridade entre o gene de levedura e um gene de reparo de
4000 . Apenas com base em seu modo de herança, a RP apre- DNA bacteriano chamado mutS) .. Quando o gene humano mais
senta uma clara heterogeneidade de locus, pois 30% dos proximamente relacionado a MSH2 de levedura foi mapeado no
heredogramas podem ser classificados como ligados ao X, en- cromossomo 2pl6, o gene humano, também chamado MSH2,
quanto o resto é autossômico (25% dominante, 45% recessivo). rapidamente se tomou o principal candidato para a HNPCCJ. De
A RP autossômica dominante foi ainda subclassificada clinica- fato, os pacientes com HNPCC ligado ao cromossomo 2p eram
mente com base na idade de início e nos padrões diferenciais de heterozigotos para mutações que ínativam o gene humano MSH2 .
degeneração de cones e bastonetes. Como esta heterogeneidade clí- Os portadores de mutações MSH2 desenvolvem câncer de cólon
nica levantou a possibilidade de vários lo_ci responsáveis, os estu- quando sua outra cópia normal do gene é perdida ou mutada em
dos de ligação concentraram-se em poucos heredogramas grandes uma célula epitelial que reveste o cólon. O DNA nesta célula
em vez de em uma coleção de menores e revelar·am pelo menos 12 toma-se instável porque o reparo de mau pareamento durante a
loci distintos para as formas autossômicas dominantes de RP. divisão celular é perturbado, levando a várias mutações secun-
Em um grande heredograma irlandês, demonstrou-se uma li- dárias, algumas das quais inevitavelmente inativam genes impor-
gação muito próxima da RP com um locus marcador no braço tantes para o controle do crescimento celular (ver Cap. 16).
longo do cromossomo J. O mapeamento da RP autossômica A descoberta de mutações no gene MSH2 como uma causa
dominante no braço longo do cromossomo 3 sugeriu imediata- de uma grande porção de HNPCC (as famílias com HNPCCl
mente um forte gene candidato para o locus RP: o gene para ligado ao cromossomo 2p) quase imediatamente levou à eluci-
rodopsina, uma proteína crucial para a fotossensibilidade do dação da causa genética do HNPCC em outras farru1ias cuja
bastonete. O gene para rodopsina também já havia sido situado doença não estava ligada a 2p Sabia-se que o cromossomo 3p
no braço longo do cromossomo .3 e, portanto, as mutações neste era o local de outro gene humano, o MLH1 (homólogo ao murl),
gene podiam ser responsáveis pela RP nesta fanu1ia. De fato, uma que apresentava grande similaridade com as proteínas de reparo
única mutação de bases foi identificada no gene de rodopsina deDNA MLHI em leveduras e mutl em bactérias. A descoberta
nesta famflia, e mais de 100 outras mutações diferentes foram do papel de MSH2 no HNPCCI tornou o MLHI um forte candi-
subseqüentemente encontradas no gene de rodopsina em outros dato ao gene envolvido no HNPCC2. Esta hipótese foi rapida-
pacientes com RP. Em outras famílias com RP autossômica do- mente confirmada pela descoberta de mutações MLHI em
minante, o defeito herdado não co-segrega com os polimorfis- HNPCC2 (ver Cap. 16).
mos no locus de rodopsina. Nestas famílias, as mutações em
outros genes autossômicos são responsáveis, e vários destes ge-
0 E NFOQUE DE GENE CANDIDATO
nes já foram identificados
A içlentificação da rodopsina como o produto do gene su~jacen­
GENES DE DOENÇA CLONADOS PELA COMBINAÇÃO DA te a pelo menos uma forma de RP autossômica dominante e a
INFORMAÇÃO FUNCIONAL E POSICIONAL : CÂNCER DE descoberta de MSH2 e MLH1 como causas de HNPCC ilustram
CÓLON NÃO-POLIPOSE HEREDITARIO como os genes de função conhecida podem se tornar fortes can-
didatos a loci de doenças quando (1) a função do gene está de
Outro exemplo marcante de identificação de gene de doença bem- algum modo correlacionada ao que se sabe sobre a patogenia da
sucedido é ilustrado por uma síndrome de câncer de cólon fami- doença e (2) o gene candidato está mapeado na mesma região
MAPEAMENTO GÊNICO E O PROJETO DO GENOMA HUMANO 1 115

do genoma que o gene da doença. Uma variedade de métodos g,enes. A ênfase inicial do projeto foi em construir mapas de li-
para encontrar mutações (ver Cap 4) é usada para triar o gene gação física e genética de rodos os 22 al.!.ts:>.ss.i>~iTIQ"§.~gos crorilõs-
candidato para defoitos em um grupo de pacientes Compare o sornos sexu~s e em reunir..ªs.~gl~ç_õ_'?~~p~_rpostas de.êiOnes; ou
enfoque do gene candidato com a metodologia puramente contigs, que cobrem cada cromossomo de telômero·ã-tefóiiiero,
posicional usada para identificar os genes envolvidos na CF e na de modo a facilitar a identificação de genes, isolar e seqüenciar
DMD: nestes casos, o isolamento bem-sucedido dos genes res- o genoma humano inteiro.
ponsáveis não se baseou em nenhuma característica do gene que O número de loci mapeados no genoma humano aumentou
não a localização cromossômica. exponencial.mente desde o início da década de 1980. É possível
O sucesso do enfoque do gene candidato ilustra muito bem o que nenhuma descrição faça justiça à enorme quantidade de in-
valor do mapeamento gênico . O gene da rodopsina foi inicial- fonnações sobre os genes humanos descobertos e mapeados que
mente clonado e mapeado por motivos que não estavam relacio- rapidamente está se acumulando ao longo do Projeto do Gene-.
nados à RP; MSH2 e MLH1 foram identificados em função de ma Humano e outros esforços correlatos. Neste momento, as
seu papel fundamental na proteção da fidelidade do DNA durante estratégias de mapeamento genético e fisico contribuíram para
a replicação. Se estes genes não tivessem sido colocados no mapa o desenvolvimento de um mapa de genes humanos que agora
gênico, entretanto, é improvável que o defeito nestes distúrbios inclui mais de 6.000 genes mapeados. Para muitos g_~_l_l_~s ~11,vol­
tivesse sido descoberto tão depressa. O enfoque de gene candi- yidos em doenças humanas, os métodos de mapeamento podem
dato permite levantar e testar hipóteses sobre a causa de uma ser imediãtarnente traduzidos em testesãiagnõsticos parãOerêC-
doença hereditária com base no fenótipo da doença (nos níveis ção pre-sintomât1ea ou pte:õãfiir-Alemo1sso, à meêliêla"qüe-ós
clinico e celular), nas posições de mapa do locus da doença e do geiiesrêlêvantes -deaõeiiÇãsfôrêm clonados e caracterizados,
gene candidato e no papel das proteínas candidatas no tecido muitos por estratégias de clonagem posicional, espera-se que um
relevante. enonne aumento na compreensão da base moleculaLdas...doen·-
ças genéticas humanas venha a acontecer. Além do conhecimento
Seqüências Marcadas Expressas
dos genes_dé.cfoenÇas·
que foram mapeados e caracterizados, há
um número ainda maior de ESTs únicas mapeadas que represen-
O enfoque posicional do gene candidato para clonar um gene de tam genes adicionais que sabemos que devem ser transcritos em
doença requer que a função e a posição do gene sejam conheci- mRNA, mas suas seqüências totais são desconhecidas e suas
das, de modo que se possa avaliar se o gene é um locus candida- funções estão sendo pesquisadas. Finalmente, à medida que o
to razoável para a doença. Quanto mais genes forem conhecidos Projeto do Genoma Humano caminhar parª :;_í1a coriélusãp, .t9-
e mapeados, mais candidatos teremos uma vez que o gene da dos os cerca de 50.000 genes do genoma humano serão desco~
doença seja mapeado em um local do genoma. Além dos conhe- bertos pelõ.se.qüenciarrieiifo-dó DNA geriômico e sua seqüência
cidos, os genes mapeados citados em bancos de dados públicos, exata e posição de mapa serão conhecidas. Como ilustrado pelo
urna fonte suplementar importante de genes candidados aos loci enfoque do gene candidato·, o envolvimento de muitos destes
de doenças é a crescente coleção de seqüências marcadas ex- genes em uma condição inerente deverá se tomar aparente com
pressas (ESTs). As ESTs são seqüências parciais de cDNA ob- o tempo . Hoje em dia, grande parte do progresso tem sido feito
tidas por seqüenciarnento de clones, escolhidas ao acaso, de uma no que diz respeito aos distúrbios monogênicos, o que não é sur-
ampla variedade de bibliotecas de cDNA feitas a partir de mui- preendente, considerando-se a ênfase dos enfoques atuais na
tos tecidos diferentes (ver Cap. 4). Cada EST corresponde a um análise de heredogramas e detecção da ligação. No futuro, en-
gene transcrito e cada seqüência EST é suficiente para especifi- tretanto, é provável que mais progresso seja feito no que concer-
car (ou "marcar") o gene ao qual ela corresponde unicamente. ne à revelação dos componentes genéticos envolvidos em con-
dições tais corno a hipertensão, os distúrbios comportamentais e
Embora a maioria das ESTs contenha seqüências que correspon-
o câncer (ver Caps. 15 e 16). As estratégias de mapeamento
dem a genes desconhecidos e não-caracterizados, muitas têm
gênico, juntamente com métodos sofisticados para a análise i:ie
homologia de seqüência a genes conhecidos em seres humanos
heredograrnas, estão começando a ser aplicadas nestes e em ou-
e outros organismos, as quais fomecem alguns_ indícios quanto à
tros distúrbios mais complexos.
função. Os bancos de dados computadorizados de genética mo-
A aceleração do ritmo do mapeamento gênico e da descober-
lecular já contêm milhões de seqüências EST. À medida que
ta de genes de doenças depende de avanços tecnológicos cruciais
mais e mais ESTs são mapeadas, os genes aos quais estas ESTs
em duas áreas. Uma está no âmbito da biologia molecular. No
correspondem estão se tomando uma rica fonte de candidados Cap 4 e neste capítulo, discutimos as técnicas subjacentes aos
adicionais a se considerar quando um gene de doença foi mapeado
esforços para mapear e seqüenciar o genoma humano e desco-
na vizinhança. brir genes de doença (ver Quadro 8.3). Ao lado do crescimento
explosivo da tecnologia da biologia molecular, tem sido de igual
O PROJETO DO GENOMA HUMANO r! importância o desenvolvimento e a expansão dos bancos de da-
dos eletrônicos da infonnação genética de seres humanos e ou-
Os geneticistas humanos e médicos vêm identificando e tros organismos. Estes bancos de dados, e os programas para
mapeando genes há décadas. Entretanto, uma mudança radical análise e comparação de dados, permitem a integração de tipos
no enfoque "mapear o que puder" foi proposto em 1986 por díspares de dados, tais como a informação de seqüências de
Dulbecco, que sugeriu que se os cientistas realmente desejavam cDNA e genômica, mapas genéticos e físicos, estudos da estm-
COJ!!preenc!~ p~pel. dos genes_gQ_G.ãncer, sem mencionar os tura e função gênica, desciições de fenótipos de doenças e catá-
distúrbios genéticos em ge~al, o que eles tinham de fazer era logos de mutações responsáveis por doenças. A maioria destes
se üenciar todos·Õs·3 bilhões de pares de bases e encontra o- bancos de dados está diretamente acessfvel no National Center
des os genes. p s muita discussão e debate, nasceu o Projeto for Biotechnology da National Library ofMedicine, incluindo o
"cio-U-ehoma Humano, um esforço internacional para primeiro Online Mendelian Inheritance in Man, ou por links da homepage
mapeai:.e...e.Y.e.!!t.!-!l!..!Jne.nt~_SÇ!_qü~r1_çiar todos os estimados 2_Q.•OOO do National Human Genome Research Institute.
116 t MAPEAMENTO GtNICO E O PROJETO DO GENOMA HUMANO

Com o enfoque do Projeto do Genoma Humano no mapea- hyhridizaàon: Boris Ephrussi and chromosome transplantation.
mento dos genes humanos e no seqüenciamento, um mapa dos Gent:tics IH:l-8
cerca de 50 .000 genes humanos, incluindo a seqüência comple-
ta de pelo menos um genoma humano, estará disponível em bre- URLs para Bancos de Dados do Pro;ew do Genoma
ve O enfoque combinado de análise de ligação para situar um NHGRI bttp:!lu.~oJ.'W 11hgri.11ib gov Homepage of National Hu-
determinado gene para um distúrbio herdado em uma região cro- man Genome Research Insàrute. Up-to-date informarion· on
mossômica específica, seguido da clonagem posicional ou das the status of the Human Genome Project and access to detailed
estratégias do gene candidato para identificar o gene responsá- chromosome specific physical maps. Links to many other sites
at bup:llwww.nbgri 11ih gov/Dntnl
vel e estabelecer o defeito ou defeitos moleculares, continuará a NCBI bttp:l!u.'11."1i: 11cbi 11/111.nih gov. Nacional Center for Biotechnol·
gerar imensos frutos. ogy lnformaàon, a division of the National L.ibrary of Medi-
cine. DNA sequence reposicory for cloned genes, genomic
Referências Gerais seqoence, and expressed sequence tags.
OMIM http:llwww311cbi11/111.11ibgov/0111i111 Online vcrsion of
Grecn ED (2000) The Human Genomc Project ;md its impact on Mendelian lnheritance in Man. Ari online, searchable "knowl-
rhe srudy of human disease ln Scrivcr CR, Bcaudet AL, Sh· edge base" of human genetic disorders including clinica!
WS, Vallc D, er ai (eds) The Metaholic and Molecular Bases ,;f description, genctic data, and molecular characteriz.ation of
Inhcrired Disease, 8th ed . McGraw-Hill, Ncw York. known disease genes
1'vJcKusick VA. (1998) Mendelian lnhcrirancc in Man: C:ualogs of \.\!hitehead Gcnome lnstirute http://www-gmome wi 111it.ed11 .
Aucosomal Dominam, Autosomal Rcccssive, and X-Linked Phe- Genomc Center based at the vVhitehcad Institute ar the Massa-
notypes, 12th ed Johns Hopkins University Press, Baltimore chusetts lnstirute of Technology Physical conàg maps of ali
Terwilliger JD, Ott J (1994) Handbook of Human Gcnctic Link- human chromosomes
age. Johns Hopkins University Press, Balàmore. Cooperative Human Linkage Center bttp:llwvnuhlcorg. United
\;\'hite R (1998) Mlipping markers and genes in the human genomc States Genetic Mapping Program. Extensive database of poly-
ln Singer M, Berg P (eds) Exploring Genctic Mechanisms. Uni- morphic markers and genetic maps.
versit:y Scicnce Books, Sausalito, California, pp 171 - JOO Sanger Ccnter bttp:lhi:u'1J.'. fn11gC1:nc 11kl Large-scale sequencing
center at Sanger Center in Cambridge, England.
Généthon bttp:Ilwww.gmetbon.fi lgenctbo11_rn.bt111/. French Genetic
Referências Específicas aos Tópicos Particula1•es ;\<1apping Program. Extensive database of polymorphic markers
Collins FS ( 1997) Sequencing the human genome. Hosp Pra ctice and genetic maps
32:35-54.
Dulbccco R (1986) A turning point in cancer research: Scqucncing Problemas
the human genome Science 231:1055-1056 '
Gardiner K. Pauerson D (1992) The role of somatic cell hvhrids in I. Descobriu-se que o locus da doença de Huntington (HD) está proxí-
physical mapping. Cytogenet Cell Genet 59:82-85 · mamente ligado a um polimorfismo de DNA no cromossomo 4. No
Kerem B, RommensJM, BuchananJA, Markiewicz, D, cr ;11 (1989)
ldenrification of rhc cystic fibrosis gene: Gcnetic analvsis mesmo estudo, entretanto, a ligação foí excluída entre HD e o locus
Science 245: 1073-1080. · para o polimorfismo do grupo sanguíneo MNSs, que também está
McCmhy LC (1996) 'vVhole genome radiation hybrid mapping. mapeado no cromossomo 4 Qual é a explicação para ísso?
Trcnds Gcnet 12:491-493 .
The lnternational Human Scquencing Consortium (2001) Thc hu- 2. O desequílíbrio de ligação foí uma observação importante na clona-
man genome: Sequencing and initial analysis. Narure gem posicional do gene da fibrose cfstica. Fazendo correlações com
\.\'hite R, Lalouel JM (1988) Chromosomc mapping with DNA os Caps. 5 e 12 quando necessário, você esperaria encontrar dese-'
markers Sei Am 258:40-48 quilíbrio de ligação para uma doença autossômica dominante tal
Zallcn DT. Burian RM (1992) On the begínnings of somatic cell corno a HD? A neurofibromatose tipo 1? Por que sim ou por que não?

Híbridos de células somáticas

li Ili IV V VI VII VIII

Dados da transferência de Southem da questão 3

3. Os dados mostrados na figura acima foram obtidos com uma sonda o 0,00 0,01 0,10 0,10 0,30 0,40
de cDNA humano para o gene Q no mesmo painel de luôridos de
células somáticas roedor/humano analisados na Fig. 83 e no Qua- Valores lod (Z) -oo 23,4 24,6 19,5 12,85 5,5
dro 8.1. O que você conclui sobre o fragmento 1 na transferência de z.... = 25,85 em om.. = 0,05
Southem? E sobre o fragmento 2? Com relação ao Quadro 8 .l, onde
está mapeado o gene Q? Corno você interpreta estes dados?
Em um estudo subseqüente, uma grande família da Sicília com do-
4. A ligação entre um polimorfismo no locus de a-globína no braço ença do rim policístico também foi investigada para ligação com a-
curto do cromossomo 16 e a doença do rim policfstico autossôm.ica globina, com os seguintes resultados:
dorn!nante, uma condição comum e multiorgânica progressiva, foi
analisada em urna série de farru1ias inglesas e holandesas com os
seguintes dados: '
8 º·ºº 0,10 0,20 0,.30 0,40
Valores lod (Z) -oo - 8,34 -3,34 -1,05 -0,02
MAPEAMENTO CÊNICO E O PROJETO DO GENOMA HUMANO 117

Como você interpreta os dados neste segundo estudo? Que implica- vel pelo defeito ocular herdado na catarata de Coppock, um distúr-
ções estes dados têm para uso na informação de ligação no diagnós~ bio autossômico dominante. Os simbolos escuros no heredograma
tico pré-sintomático e na consulta genética? indicam os membros da família com catarata As letras indicam
haplótipos de DNA no locus polimórfico de -y-cristalino no cromos-
5 Os dados que se seguem foram obtidos em um estudo destinado a somo 2, detectado com um clone de cDNA O que você concluiria
testar a hipótese de que um defeito em um gene para 'V-cristalino, por este estudo? Que estudos adicionais deveriam ser feitos para
uma das piincipais proteínas do cristalino ocular, pode ser o responsá- confirmar ou descanar a hipótese?

li

Ili

IV
88

V
AC AC BC BD BD AC AB BC
Heredograma da questão 5

6. O heredograma que se segue mostra um exemplo de diagnóstico mo- 7. Na família descrita na Questão 6, o avô materno toma-se disponível
lecular na síndrome de Wiskott-Aldrich, uma imunodeficiência li- para teste de DNA e apresenta o alelo B no locus ligado. Como este
gada ao X, usando-se um polimorfismo de DNA ligado com uma achado afeta sua determinação da fase na mãe? O que você conclui
distância de mapa de aproximadamente 5 cM entre o locus sobre o filho afetado? Que outros estudos devem ser feitos para
polimórfico e o gene da síndrome de Wiskott-Aldrich, Qual a pro- verficar isto? Que diagnóstit:o você fruiu com relação ao atual diag-
vável fase na mãe portadora? Como você determina isto? Que diag- nóstico pré-natal?
nóstico você faria quanto ao atual diagnóstico pré-natal?
8. Quais são algumas das implicações em conhecer a posição de mapa
de um determinado gene para a genética médica? Em outras pala-
vras, por que mapear os genes?
9 Qual a região do genoma para a qual o mapeamento de híbridos de
radiação não é possível quando feito como descrito usando células
HPRT- de roedores? Como esta região do genoma pode ser mapea-
da pelos híbridos de radiação?

8 A
Heredograma das questões 6 e 7
!i!f~~~-F-~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Fundamentos de Citogenética
Clínica

A citogenética clínica é o estudo dos cromossomos, de sua es- tratadas com uma solução hipotônica para liberar os cromos-
trutura e sua herança aplicado à prática da genética médica. Há somos. Os cromossomos são então fixados, espalhados em
mais de 40 anos sabíamos que as mudanças microscopicamente lâminas e corados por uma de várias técnicas, dependendo do
visíveis no número ou na estrutura dos cromossomos poderiam procedimento diagnóstico que estiver sendo feito Elas então
responder por várias condições clínicas. Hoje em dia, a an~lise estão prontas para análise.
cromossômica, com uma resolução e uma precisão muitíssimo
melhoradas, é um procedimento diagnóstico cada vez mais im-
p~>rtante em várias áreas da medicina clínica.
Indicações Clínicas para a Análise
: Os distúrbios cromossômicos formam uma importan!e cate- Cromossômica
goria de doenças genéticas. Eles contribuem para uma grande pro- A análise cromossômica é indicada como um procedimento
porção de todas as perdas reprodutivas, malformações congêni- diagnóstico rotineiro para vários fenótipos específicos encon-
tas e retardo mental, tendo um importante papel na patogenia da trados em clínica médica, como descrito neste capítulo e no
malignidade As anomalias cromossômicas específicas são res- Cap. 10. Além disso, também existem situações clínicas ge-
ponsáveis por mais de l 00 síndromes identificáveis que, em ter- rais inespecíficas e achados que indicam uma necessidade de
mos coletivos, são mais comuns que todos os distúrbios mende- análise citogenética:
lianos monogênicos juntos. Os distúrbios citogenéticos estão
presentes em quase 1% dos nativivos, em cerca de 2% das ges- 1. Problemas de crescimento e desenvolvimento iniciais. Falta
tações de mulhe1es com mais de 35 anos que tiveram diagnósti- ou retardo do desenvolvimento, face dismórfica, malforma-
co pré-natal e em metade de todos os abortos espontâneos de ções múltiplas, baixa estatura, genítália ambígua e retardo
primeiro trimestre. mental são achados freqüentes em crianças com anomalias
Neste capítulo, discutiremos os princípios gerais da citoge- cromossômicas, embora não s~jam restritos a este grupo. A
nética clínica e os vários tipos de anomalias numéricas e estru- menos que exista um diagnóstico não-cromossômico defini-
turais observadas em cariótipos humanos. Algumas das mais tivo, a análise cromossômica deve ser feita para pacientes que
comuns e mais bem conhecidas anomalias dos autossomos e cro- apresentam uma combinação de tais problemas.
mossomos sexuais serão descritas no próximo capítulo. 2 . Natimorto e morte neonatal. A incidência de anomalias cro-
mossômicas é muito maior entre os natimortos (até aproxi-
madamente 10%) que entre os nativivos (cerca de 0,7%). É
INTRODUÇÃO À CITOGENÉTICA
também elevada entre crianças que morrem no período neo-
A morfologia geral e a· organização dos cromossomos huma- natal (cerca de 10%). A análise cromossômica deve ser feita
nos, bem como sua composição molecular, foram introduzi- em todos os natimortos e mortes neonatais que possam ter uma
das nos Caps 2 e 3. Para fazer uma análise cromossômica para base citogenética para identificar uma causa poss1Vel especf-
fins clínicos rotineiros, as células devem ser capazes de cres- fica ou, alternativamente, para excluir anomalias cromossô-
cer e se dividir rapidamente em cultura. As células mais pron- micas como motivo da perda. Em tais casos, a cariotipagem é
tamente acessíveis que atendef\! a estes requisitos são os leu- essencial para uma consulta genética apurada e pode dar in-
cóticos, especificamente os linfócitos T. Para preparar uma formações importantes para o diagnóstico pré-natal de futu-
cultura a curto prazo destas células adequadas para análise, ras gestações,
uma amostra de sangue periférico é obtida, em geral por 3. Problemas de fertilidade. Os estudos cromossômicos são
venipunção, e misturada com h~parina para evitar a coagula- indicados para mulheres que apresentam amenorréia e para
ção . Os leucócitos são coletados, colocados no meio de cul- casais com uma história de infertilidade ou abortos recorren-
tura e estimulados a se dividir. Após alguns dias, as células tes. Uma anomalia cromossômica é vista em um ou outro
em divisão são bloqueadas na metáfase com substâncias quí- genitor em uma proporção significativa (de 3% a 6%) dos
micas que inibem a formação do fuso mitótico, coletadas e casos nos quais há infertilidade ou dois ou mais abortos.
FUNDAMENTOS DE CITOGENÉTICA CLÍNICA ! 119

4 História familiar· Uma anomalia cromossômica suspeita ou chamadas de heteromorfismos. Estas variantes em geral são
conhecida em um parente em primeiro grau é uma indicação benignas e refletem diferenças na quantidade ou no tipo de se-
para a análise cromossômica em algumas circunstâncias. qüências de DNA satélite em um local específico ao longo do
5. Neoplasia. Absolutamente todos os cânceres estão associa- cromossomo .
dos a uma ou mais anomalias cromossômicas (ver Cap. 16).
A avaliação cromossômica na amostra apropriada de tecido Bandeamento R. Se os cromossomos receberem um trata-
(o próprio tumor ou a medula óssea no caso de malignidades mento especial (tal como aquecimento) antes da coloração, as
hematológicas) pode nos dar um diagnóstico útil ou uma in- bandas escuras e claras (bandas R) resultantes serão o reverso
formação prognóstica. das produzidas pelo bandeamento G ou Q. Especialmente quan-
6. Gestação em uma mulher com idade avançada .. Há um do se examinam regiões que se coram pouco pelo bandeamento
aumento de risco de anomalia cromossômica nos fetos con- G ou Q, o bandeamento R fornece um padrão que é mais fácil de
cebidos por mulheres com mais de 30 a 35 anos de idade (ver analisar que aquele fornecido pelo bandeamento G ou Q. Este é
Cap 18). A análise cromossômica fetal deve ser oferecida o método padrão em alguns laboratórios, particulannente na
como uma parte rotineira dos cuidados pré-natais em tais Europa.
gestações .
Um sistema uniforme de classificação cromossômica é inter-
Embora ideal para a análise clfnica rápida, as culturas de nacionalmente aceito para a identificação de cromossomos hu-
células preparadas de sangue periférico têm a desvantagem de manos corados por qualquer um dos três procedimentos de co-
ter vida curta (de 3 a 4 dias) . Culturas de longo termo podem loração mencionados, A Fig . 9.1 é um ideograma do padrão de
ser feitas a partir de uma variedade de outros tecidos (ver Cap. bandeamento de um conjunto de cromossomos humanos normais
8) . A biópsia de pele, um pequeno procedimento cirúrgico, na metáfase, ilustrando a alternância de padrões de bandas escu-
pode fornecer amostras de tecido que em cultura produzem ras e claras usadas para a identificação dos cromossomos. O
fibroblastos, os quais podem ser usados para uma variedade padrão de bandas de cada cromossomo é numerado em cada braço
de estudos bioquímicos e moleculares, bem como para a aná- do centrômero ao telômero, como mostrado em detalhe na Fig.
lise cromossômica. Os leucócitos também podem ser trans- 9.2 para vários cromossomos Usando este sistema de numera-
formados em cultura para formar linhagens celulares linfo- ção, a localização de cada banda em particular, bem corno as
blastóides que são potencialmente imortais A medula óssea seqüências de DNA e os genes dentro delas e o seu envolvimen-
pode ser obtida apenas por procedimentos relativamente in- to em uma anomalia cromossômica, pode ser descrita sem am-
vasivos de biópsia de medula óssea, mas tem a vantagem de bigüidade e com precisão.
conter uma alta proporção de células em divisão, de modo que Os cromossomos humanos em geral são classificados pela
quase não é necessária uma cultura Seu principal uso é no posição do centrômero em três tipos que podem ser facilmente
diagnóstico de malignidades hematológicas suspeitas . Sua distintos na metáfase (ver Fig 9.1): metacêntricos, com um
desvantagem é que as preparações cromossômicas obtidas da centrômero mais ou menos no meio e braços aproximadamente
medula são relativamente pobres, com cromos~omos pouco do mesmo tamanho; submetacêntricos, com um centrômero fora
resolvidos que são mais difíceis de analisar que os do sangue do meio e braços com tamanhos claramente diferentes; e acro·
periférico. As células fetais derivadas do liquido amniótico cêntricos, com o centrômero bem próximo a uma das pontas. Um
(amniócitos) ou obtidas por biópsia das vilosidades coriôni- quarto tipo potencial, telocêntrico, com o centrômero em uma
cas também podem ser cultivadas de forma bem-sucedida para extremidade e um único braço, não ocorre no cariótipo humano
a análise citogenética, bioquímica ou molecular. As células normal, mas é ocasionalmente observado em rean·anjos cromos-
das vilosidades coriônicas também podem ser analisadas di- sômicos e é um tipo comum em outras espécies. Os cromosso-
retamente, sem a necessidade de cultura (ver Cap. 18 para mos acrocêntricos humanos (cromossomos 13, 14, 15, 21e22)
maior discussão) . têm massas pequenas e distintas de cromatina, conhecidas como
satélites, ligadas a seus braços curtos por pediculos finos ( cons-
trições secundárias). Os pedículos destes cinco pares de cromos-
Identificação Cromossômica
somos contêm centenas de cópias de genes codificantes de RNA
Os 24 tipos de cromossomos humanos podem ser prontamente ribossômico.
identificados por vários procedimentos específicos de colora-
ção. Existem três métodos de coloração comumente usados que PROCEDIMENTOS ESPECIAIS
podem ser distintos entre os cromossomos humanos. No Cap.
2, examinamos os cromossomos corados por bandeamento Gi- Para situações particulares, várias técnicas especializadas podem
emsa (bandeamento G), o método usado com mais freqüên- ser usadas:
cia em laboratórios clínicos . Outros procedimentos usados em
alguns laboratórios ou para fins específicos, ou ambos, inclu- Bandeamento C. Este método envolve especificamente a
em os seguintes: coloração da região centromérica de cada cromossomo e outras
regiões que contêm a heterocromatina constitutiva: partes dos
Bandeamento O. Este método requer a coloração com qui- cromossomos lq, 9q e 16q adjacentes ao centrômero e a parte
nacrina mustarda ou compostos correlatos e o exame por mi- distal de Yq. A heterocromatina é o tipo de cromatina definida
croscopia de fluorescência. Os cromossomos coram-se em um por sua propriedade de pennanecer em estado condensado e de
padrão especifico de bandas claras e escuras (bandas Q), sen· se corar fortemente nas células que não se dividem (interfásicas).
do que as bandas Q claras correspondem quase exatamente às
bandas G escuras O bandeamento Q, bem como o bandeamento Bandeamento de Alta Resolução (também chamado de
e (ver seção seguinte), é particularmente útil para detectar va- bandeamento pró-metafásico) Este tipo de bandeamento é
riantes ocasionais na morfologia cromossômica ou coloração, realizado pelas técnicas de bandeamento G ou R para corar os
120 ! FUN DAMENTOS DE CITOGEN ÉTICA CLINICA

1
36 2
35 2 3
34.2 26
33 24
24 6 7 11
31 22 22
p 4 5 24 8 9 10
16 22 21 12
14
152 22 23 14 14
21 14 15.3 21
15.1 14 21.2 14
12 12 12 12
12 13 12 12 12
12
12 12 12 12
12 131 13 12
14 1 21
133 211 21
14 3 22
21
22 14 14
22 24 21 .3
24 22 21 23 22
24
q 26
31 31
24 23 23
31 26 1 28 33 25
33 24
26.3 31 2 242
32 28 35
32 32
41 34
34 34
43
36

X
16
17 19
2 20
222

:~18 ~1;!· ~2~- -2~~ -g; ;


13 14 15 13.2
p e::> y
C3 12 12

12 -~ -
11
12
- 11- .3 ~-
12 1
12 13.2 - 12 2 12
~
13.2 .~~;
12 •líli!
21 22 22 13.4 21
24
q 23
23
25
31 25
27

Fig. 9. 1 Ideograma mostrando o padrão de bandeamento G para cromossomos humanos na metáfase. com cerca de 400 bandas por
cariótipo haplóide Como desenhado. os cromossomos são tipicamente representados com as cromátides irmãs tão juntas que elas
não são reconh ecidas como estruturas distintas Os centrômeros são indicados pelas regiões em cinza-escuro separando os braços p e
q Por uma questão de conveniência e clareza. apenas as bandas O-positivas são numeradas Para exemplos de um esquema totalmente
numerado. ver a Fig 9 2 (Redesenhado de ISCN. 1995 )

cromossomos que foram obtidos em um estágio inicial da mito- que alteram ou inibem a síntese de DNA. Muitos sítios frágeis
se (prófase ou pró-metáfase), quando ainda estão em um estado são conhecidos como variantes herdáveis. O sítio frágil mos-
relativamente descondensado (ver Cap 2) O bandeamento de uado de modo mais claro como sendo clinicamente significa-
alta resolução é especialmente útil quando se suspeita de uma tivo é visto perto da ponta de Xq tanto em homens com uma
pequena anomalia estrutural de um cromossomo. Alguns labo- forma específica e comum de retardo mental ligado ao X quanto
ratórios, entretanto, usam o bandeamento pró-metafásico de em algumas mulheres portadoras do mesmo defeito genético
modo rotineiro, como mostram as Figs. 2..3 e 2.4. Os cromosso- (ver discussão sobre a síndrome do X frágil, Cap, 12). Em
mos pró-metafásicos revelam de 550 a 850 bandas ou ainda mais conjunto com os testes moleculares para detectar a expansão
em um conjunto haplóide, enquanto as preparações metafásicas da repetição CGG no gene FMRJ característico deste distúr-
padrão mostram apenas cerca de 450. Uma comparação dos pa- bio, a detecção do sítio frágil no cromossomo X é um procedi-
drões de bandeamento do cromossomo X em três estágios dife- mento diagnóstico específico para a síndrome do X frágil (ver
rentes de resolução é mostrada na Fig. 9..3 O aumento na preci- Fig . 12.28)
são diagnóstica obtida com estes cromossomos mais longos é
evidente.
Hibridização 111 Situ com Fluorescência
-- ~m.e>~F.'t:á.geis. Os sítios frágeis são espaços ocasionalmente Como introduzido no Cap. 4, o desenvolvimento das técnicas
observados em pontos característicos de vários cromossomos de hibridização in situ com fluorescência (FISH) para exami-
Para demonstrar os sítios frágeis, em geral é necessário expor nar a presença ou a ausência de uma determinada seqüência de
as células a condições de crescimento ou substâncias químicas DNA ou para avaliar o número ou a organização de um cro-
Fig. 9.5 A, Detecção de telômeros nas pontas de cada cromossomo por hi-
bridização i11 situ com fluorescência (FISHJ usando uma sonda repetida
1lAGGG As duas cromátides irmãs são evidentes pelo sinal amarelo de dupla
hibridização na ponta da maioria dos braços cromossômicos (Cortesia de
Stuart Schwartz. Case Western Reserve University and University Hospitais
of Cleveland l

Fig. 9.5 B. Cariotipagem espectral (SKY) Vinte e quatro sondas de colora-


ção cromossômica individual são marcadas com corantes fluorescentes
diferentes e usadas como uma coloração genômica total Os sinais fluores-
centes são analisados por um software sofisticado de imagem e armazena-
dos em um computador Para gerar a fotografia. o computador atribui uma
cor diferente a cada um dos 24 diferentes espe.ctros fluorescentes gerados
pelas sondas individuais de coloração cromossômica (Figura por cortesia
da Ora Amalia Outra National Human Genome Research lnstitute ) Nesta
metáfase de uma mulher 46,XX. apenas 23 cores estão presentes; a única
cor gerada pela sonda de coloração do cromossomo Y não é vista
Fig. 9.5 e. Análise cariotfpica espectral de cromossomos de uma linhagem celular de meduloblastoma Várias anomalias numéricas e
estruturais são evidentes e podem ser identificadas pela análise da imagem das 24 sondas de coloração cromossômica usadas O cari-
ótipo mostra tanto a imagem original (membro à esquerda de cada par) quanto a imagem falso-colorida (membro à direiia de cada par). na qual
cada um dos 24 tipos de cromossomos recebe uma cor diferente para ajudar a identificação visual (Cortesia de Amalia Dutra. National
Human Cenorne Research lnstitute l

fig. 9.5 D. Fluorescência tricolor de hibridização in silu para análise de espermatozóides humanos usando sondas repetitivas para o
cromossomo 18 (amarefo) . o cromossomo Y (verde) e o cromossomo X (vermelf10) Os dois espermatozóides haplóides à esquerda são mo-
nossômicos para estes cromossomos (um espermatozóide 23.X e um 23 Y) O espermatozóide do painel do meio é dissômico para o
cromossomo X (cariótipo 24,XXJ. enquanto o espermatozóide da direita é dissômico para os cromossomos sexuais (cariót ipo 24 XYl
(Cortesia de Terry Hassold. Case Western Reserve University School of Medicine. Cleveland )
46,XY Trissomia do 18 Trissomia do 21

Fig. 9.5 E Fluorescência multicor em análise de hibridização i11 silu de células interfásicas de liquido amniótico Painel da esquerda, células
46.XY (cromossomo 18 azul cromossomo X verde e cromossomo Y vermelhol Painel médio. célula 47.XX. + 18 azul. cromossomo X em
verde! Painel da direita células com trissom ia do 21 (cromossomo 13 em verde cromossomo 21 em vermelho) (Cortesia de Stuart Schwartz
Case Western Reserve Universit y e University Hospitais of Cleveland l

Fig. 9.5 F. Detecção por hibridização i11 situ com fluorescência de Fig. 95 G. Detecção por hibridização in situ com fluorescência de
uma translocação críptica em um probando com retardo de de- uma translocação balanceada en tre os cromossomos 11 e 16 usan-
senvolvimento. usando sondas especificas para o telômero do cro- do uma sonda de pin tura do cromossomo 11 (amarelo ) O cariótipo
mossomo 3p (vermelfio ] e cromossomo 11 q (verdel Uma transloca- é 46.XY t( 11 ; 16)(q24;q23) As setas indicam os produtos da trans-
ção não balanceada entre 3p e 1 1q não era evidente pela análise locação (Cortesia de Stuart Schwartz. Case Western Reserve Uni-
padrão de bandeamento .G, mas foi revelada por FISH As setas versity e University Hospita is of Cleveland l
mostram três sinais de hibridização em cromossomos 3p indica-
tivos de trissomia parcial de 3p. enquanto a ponta de seta mos-
tra apenas um único sinal de hibridização para 1lq indicando
rnonossomía parcial de l lq !Cortesia de Christa Lese e David
Ledbetter. University of Chicago l
Fig. 9.5 H. Fluorescência bicolor na análise de hibridização i11 silu de um
probando com a síndrome de Prader-Willi que demonstra a deleção de
l 5q 11-q 13 em um dos homólogos O sinal verde é a hibridização com o
DNA alfa satélite no centrômero do cromossomo 15 O sinal vermelho em
l 5q distal é uma sonda controle de cópia única O sinal vermelho de l 5q
proximal é uma sonda para o gene SNRPN. que está presente em um cro-
mossomo 15 (seta &ra11ca). mas está deletado no outro (seta escura) (Corte·
sia de Christa L.ese e David Ledbetter. University oi Chicago l

Fig. 9.5 1. Hibridização i11 situ de fluorescência combinada e análise de centrômero em um paciente 46.X.idic(X). com um isocromosso-
mo dicêntrico do X Os cromossomos são corados em azul com DAPI. um corante de DNA Os sinais verdes pareados indicam centrôme-
ros funcionais detectados com anticorpos contra uma proteína específica para centrômeros/cinetócoros ativos Os centrômeros do X
(vermelr10) são detectados por FISH usando uma sonda especffica de alfa satélite do X O X normal (com seu centrômero ativo} está à
direita Um X dicêntrico está à esquerda e tem dois centrômeros ativos. pois ambos os centrômeros coram-se com o anticorpo (Cortesia
de Anne Higgins Case Western Reserve University School of Medicine. Cleveland )
FUNDAMENTOS DE CITOGENÊllCA CLINICA ! 121

15 3
15 2 25
15.1 24
p 14 23
22
22 2 22.3
13 2 13.3 . 221 21
. 13í~ 23 3
232
21 .3 15 2 15.3 231
1T1 21.2 151 22
11 2 211 14
21 2 21 .2
12 12 13 21.1
13 1 11 2 rr:r 12 12
-11- 112rr:r
B~ 1p
12 11.21 11 ·1 1 .1
14 13
n~~~
11 22
14 1123
15 15 11 3 12
21 16 2 16.1 21 1 13
q . 163
22
21
~H 21 1
23.1 212