
K. Banu Köse (50091012)


Human DNA topoisomerase I (70 kDa) in complex with the indenoisoquinoline AI-III-52 and covalent complex with a 22 base pair DNA duplex

1) Structure A) Primary

Sayfa 1 / 19





Bi h si s K Banu K s Chain D (DNA) 1AAAAATTTTTCGAAGTCTTTTT Quate nary ¥¤ Annotate PDB Quaternary Structure Asse £ Hetero Tetrametric 4 subunits of 4 distinct poly ers entities (5 molecules in total including ligands) ¦ S y  ¡   ¢ ly:1 6 / 19 .

§ § § § §§ § 91.Biophysics K.8% (516/562) of all residues were in favored (98%) regions.2010 d) Molecular Function of 1tl8 Synthesis and mechanism of action studies of a series of norindenoisoquino ine topoisomerase I poisons revea an inhibitor with a f ipped orientation in the ternary DNA-enzyme-inhibitor comp ex as determined by X-ray crysta ographic ana ysis. Sayfa 7 / 19 . Banu Köse (50091012) 22.10.

Stabi ization of such conformationa states resu ts in uncompetitive inhibition and exemp ifies the re evance of screening for igands and drugs that stabi ize ( trap ) these macromo ecu ar comp exes (DNA Topoisomerase I Inhibitors: Chemistry. This gene encodes a DNA topoisomerase. 88.2010 98. two camptothecins.2. 91. There were 9 outliers (phi. Maryland Chem.9) 407 ASP (-51.1. pH 6.7.Biophysics K. and one indo ocarbazo e) each interca ate between the base pairs f anking the c eavage site generated during the Top1 cata ytic cyc e and are further stabi ized by a network of hydrogen bonds with Top1. VAPOR DIFFUSION. and Interfacial In hibition/ Yves Pommiera/Laboratory of Molecular Pharmacology. temperature 289K © © Sayfa 8 / 19 .6) 638 LYS (-37.6. SITTING DROP. The interfacia inhibition paradigm described for Top1 inhibitors can be genera ized to a variety of natura products that trap macromo ecu ar comp exes as they undergo cata ytic conformationa changes that create hotspots for drug binding.3) DNA topoisomerase 1 is an enzyme that in humans is encoded by the TOP1 gene. This gene is oca ized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. National Institutes of Health. Bethesda. -51.7.3) 213 GLU ( Temperature 289. Center for Cancer Research. National Cancer Institute. 102. thus a tering the topo ogy of DNA. ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨¨ ¨ ¨ We demonstrate that five topoisomerase I (Top 1) inhibitors (two indenoisoquino ines.8) 236 GLU (-8. 121. 62.8%) regions.10. 2009) ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ ¨ e) Crystallization Experiments Method VAPOR DIFFUSION. psi): 202 LYS (83. Rev.0) 675 MET (86. SITTING DROP pH 6.5. 93.4% (553/562) of all residues were in allowed (>99. 133.2) 212 PRO (-56. This enzyme cata yzes the transient breaking and rejoining of a sing e strand of DNA which a ows the strands to pass through one another. an enzyme that contro s and a ters the topo ogic states of DNA during transcription.8) 724 LEU (65. 101.. Biology. Ammonium Su fate.0 Detai s PEG 8000. Banu Köse (50091012) 22.5) 467 SER (-1.2. MES.40.

Transcriptional enzymes must decide which of two complementary strands contains the correct information to copy. however. Today we will discuss the topology of DNA and tomorrow we will cover enzymes that can alter the topological state of DNA Sayfa 9 / 19      Cryst l t / Unit Cell Å Angle (°) = 90 94. at first appeared facilitated because genetic information is encoded t ice in the DNA structure.Bi h si s K Banu K s Length a= b= c= 2) The double-st ded st ucture of DNA has many implications for biological function.14 = 73. Transcription also involves transient unwinding of the DNA helix in a local region in order to be able to copy one strand.95 114.5 = DNA TOPOLOGY . the two parental strands must be separated and unwound to be copied. once on each strand. Replication.18 90 56. Metabolic events involving unwinding impose great stress on the DNA because of the constraints inherent in the double helix.

imagine a linear DNA 5200 base pairs in length.4 bp/turn). When the molecule is free in solution it will coil about itself in space as the two strands simultaneously twist about each other in order to return to equilibrium value of 10.10. The helices wind about each other in a right handed path in space.4 base pairs per turn. before its ends were joined. On the other hand. This supercoiling or writhing of circular DNAs was a result of the DNAs being underwound with respect to the rela ed form of DNA. Sayfa 10 / 19 . This is less tightly wound than the 10.Biophysics K.0 base pairs per turn in the Watson and Crick B-form DNA.2010 without changing its primary structure. there is an absolute requirement for the correct topological tension in the DNA (super-helical density) in order for genes to be regulated and e pressed normally. This is referred to as a rela ed circular DNA. Banu Köse (50091012) 22. DNA that is underwound is referred to as negatively supercoiled. When a linear DNA is free in solution it assumes a pitch which contains 10.4 base pairs per turn). There are actually fewer turns in the DNA heli than one would e pect given the natural pitch of DNA in solution (10. if the linear DNA were unwound 10%. If the DNA were in the B-form one would e pect the two strands of the heli to be wrapped around each other 500 times (5200 bp/10. then the DNA molecule would be under stress. DNA that is overwound also will rela and assume a supercoiled conformation but this is referred to as a positively supercoiled DNA heli . In order to understand the origin of supercoiling. In addition to the requirement to unwind DNA for replication and for transcription.4 base pairs per turn. These enzymes are called DNA topoisomerases. say 50 turns. Imagine a linear DNA in which the two ends become connected to form an open circle. Positively coiled DNA has its DNA helices wound around each other in a left-handed path in space. The total number of times one strand of the DNA heli is linked with the other in a covalently closed circular molecule is known as the linking number Lk.

Also if the path of the DNA heli were on the surface of a sphere (like the seams of a tennis ball or base ball) then the total Writhe can also be shown to be zero. Banu Köse (50091012) 22. The linking number is only defined for covalently closed DNA and its value is fi ed as long as the molecule remains covalently closed. allowing the intact strand to pass through the broken strand and then rejoining the broken strand. the Wr is always zero. Writhes Sayfa 11 / 19 . The linking number of a covalently closed circular DNA can be resolved into two components called the twists Tw and the writhes Wr. If the path of the DNA is in a plane. Unlike the Twist and the Linking number. 2.10. Lk = Tw + Wr The twists Tw are the number of times that the two strands are twisted about each other while the writhes Wr is the number of times that the DNA heli is coiled about itself in three-dimensional space. the writhe of DNA only depends on the path the heli a is takes in space. 4. Lk is always an integer since two strands must always be wound about each other an integral number of times upon closure. The linking number does not change whether the covalently closed circle is forced to lie in a plane in a stressed conformation or whether it is allowed to supercoil about itself freely in space.2010 1. The linking number Lk of a circular DNA can only be changed by breaking a phosphodiester bond in one of the two strands.Biophysics K. not on the fact that the DNA his two strands. 3.

This is due to the fact that the -OH group in the 2' position of the ribose would be sterically hindered in the B-form heli .e. Most of the DNA in chromatin is thought to be in the B-form.10. Banu Köse (50091012) 22.8nm pitch=3. but is formed at a lower hydration than B-DNA (i. The heli is wider. Sayfa 12 / 19 . and there is a very deep major groove. (Why?) A-DNA B-DNA pitch=2.6nm 11 base pairs/turn 10 base pairs/turn sugar=C3'-endo sugar=C2'-endo The planes of the bases are tilted 20 degrees to the heli a is. If synthetic RNA molecules which are complementary in sequence form a double heli they form an A-type double heli . However remember that naturally occuring RNA molecules are not normally complementary.<75% humidity). and a very shallow minor groove. The physiological relevance of the A-form of DNA is not established.2010 DNA GEOMETRY A-DNA / B-DNA When DNA fibres are formed at low humidity DNA assumes a less hydrated form. This too is a double heli structure. flatter and more compressed than the B-DNA heli .Biophysics K. Once again this structure was the result of X-ray difractioin from DNA fibres so the position of the base pairs is an average over the whole fibre. (A-form) This structure was determined at the same time as the B-form.

Biophysics K.10.2010 Sayfa 13 / 19 . Banu Köse (50091012) 22.

Biophysics K.2010 Sayfa 14 / 19 .10. Banu Köse (50091012) 22.

The crystal structure of the B-DNA decamer: shows there are: y y y About 10.2010 Oligonucleotide Structures More recently small.1 base pairs/turn An average helical twist of 35.34nm Sayfa 15 / 19 . Analysis of these crystalls has shown that DNA can have quite large local deviations from the canonical Watson and Crick structure and that these deviations appear to be dependent on the sequence of base pairs.6o An average rise/residue of 0. Banu Köse (50091012) 22. This contrasts with the fibre difraction patterns which only give an average picture for all base pairs. self-complimentary pieces of DNA have been co-crystallised and their stuctures determined by X-ray crystallography. These are true crystalls and the positions of each individual atom and base-pair can be determined.10.Biophysics K.

10. This is speculation however.. there may be a geometrical mechanism for recognition of sequence. some are C3'-endo. and pyrimidines the C3'-endo sugars. The heli is curved by appro imately 19o and not straight. However there are large variations from these average values for individual base pairs in the sequence. If the geometry of DNA changes according to sequence. Banu Köse (50091012) 22. It is thought these water molecules may provide a "spine of hydration" which stabilises the structure in the B-form and may be lost in the transition to A-form. Geometric variations apear to be sequence specific.Biophysics K. DNA is easily deformed.2010 These average values are quite close to the values for those for B-DNA determined from fibre difraction. (This is not easy to spot either if you have not had a lot of e perience looking at structures of this type. so it is not known whether the curve seen is due to natural conditions or an artifact of the crystallisation process. purines favouring the C2'-endo sugars. the AT pairs in the middle have a slightly different conformation to those ne t to the GC's). and does not have a precisely regular structure. A protein could initially recognise a particular sequence from the shape of the DNA it binds to. and some assume an intermediate conformation The base roll (angle to heli a is) varies Individual bases in a base pair have propeller twist Bases in a base pair are at a dihedral angle to each other The variations in geometry appear to be sequence specific. It is not possible to say if these water molecules are present in native DNA as fibre difraction does not enable water molecules to be identified. There is a row of tightly bonded water molecules in the major groove in the AT-rich region.) DNA helices are reasonably fle ible to bending about small angles. The conformation of a residue is also affected by what it's neighbours conformation is (i. such that: y y y y y y The rise/residue varies from 0.30nm to 0.42nm The helical twistvaries from 32o to 40o The sugar conformation varies. Use the mouse to rotate and zoom the image and convince yourself of the changes in propeller twist and dihedral angle. The changes in sugar conformation are not quite so easy to spot. some are C2'endo. Sayfa 16 / 19 .e..

10.Biophysics K. Banu Köse (50091012) 22.2010 Sayfa 17 / 19 .

(OPTIONS submenu) The Z structure was first shown in oligonucleotides.2010 Z-DNA The third and final geometry of DNA is that of the so-called Z-DNA..10. y y y y y BUT the heli is: Left handed 12 base pairs/turn Pitch is 4. If this structure displays the hydrogens-white dots.. Because the purines are "flipped" because of the 180o rotation the pyrimidines must also "flip" to keep the base pairing intact.use the pull down menu to turn them off.Biophysics K. This is sometimes seen when the sequence is of alternating purines and pyrimidines and was first seen in the structure of the alternating deo ynucleotide dCpGpCpGpCpG.5nm per turn Deep minor groove Little or no major groove This structure is formed by rotating the N-glycosyl bonds of G residues 180o with respect to their conformation in B-DNA. Sayfa 18 / 19 . and an anti-parallel double heli forms . However pyrimidine nucleotides do not readily assume the "syn" configuration because of steric hinderance between the o y group at position 2 of the pyrimidine and the atoms of the sugar. In Z DNA all of the purines are in the "syn" conformation and all the pyrimidines are in the "anti" conformation. Banu Köse (50091012) 22. METRY&source=gbs_toc_r&cad=4#v=onepage&q=DNA%20TOPOLOGY%20AND%20GEOMETRY&f=fa se http //www. have bound to some DNA e. This means that the B to Z structural transition can occur without any separation of the heli ore/exp ore. http //www. This form of DNA is only found in high salt concentrations.ebi. At least one DNA binding protein has been found which is specific to http // Banu Köse (50091012) 22. although antibodies raised to oligonucleotides of this structure.pdf             Sayfa 19 / 19   Source . It is not known whether Z-DNA is biologically significant.07/activities/O son-Wi ma/IMA_tutoria _1.1021/cr900097c http //www. because a high concentration of cations are required to maintain the stability between the phosphate backbones (which are in close pro imity to each other in Z DNA).org/doi/abs/ 8 http //books. Despite these quite drastic conformational changes it is topologically possible for the G bases to go syn and the C nucleosides to rotate 180o without breaking and reforming the hydrogen bonds.2010 In order to keep the base pairs intact the whole nucleoside (base plus sugar) has to flip 180o.ima.Biophysics K.

Sign up to vote on this title
UsefulNot useful