You are on page 1of 7

Lista 1

Carboidratos
1. Defina: a) Aldose; b) Cetose;
2. Como são classificados os carboidratos segundo o número de monômeros
interligados? Dê exemplos para cada classificação.
3. Quais são as funções dos carboidratos?
4. Represente a fórmula de Fischer para o gliceraldeído. Escreva a fórmula de Fischer
para uma D-aldopentose e D-cetohexose qualquer. Indique quais são os carbonos
assimétricos de cada monossacarídeo e o número de estereoisômeros possíveis.
5. Defina e dê exemplos de epímeros.
6. O que são hemiacetais e hemicetais?
7. O que são piranoses e furanoses?
8. O que são acetais e cetais?
9. Qual o tipo de ligação entre os monossacarídeos? Defina e exemplifique.
10. Descreva as características (unidade, ligações, estrutura da molécula) dos
polissacarídios de amido e celulose.
11. Por que podemos digerir amido, mas não celulose?
12. O que é carbono anomérico? Por que um monossacarídeo na forma cíclica possui
dois outros isômeros, o α e o β?
13. Diferencie homopolissacarídios de heteropolissacarídios.
14. Como se denomina o polissacarídeo comum na superfície externa de células
animais? Qual é a sua função na fisiologia destes seres vivos?

Lipídios
1. Defina o que são lipídios e quais as principais funções biológicas desempenhadas
por estas biomoléculas.
2. O que são ácidos graxos? Explique como se dá a nomenclatura destes compostos.
3. Explique como o comprimento da cadeia hidrocarbônica e o grau de insaturação
desta influem, respectivamente, na solubilidade e no ponto de fusão destes
compostos.
4. Como é feita a classificação dos lipídios?
5. O que são triacilgliceróis? Mostre esquematicamente como é a estrutura destes
compostos e os tipos de ligações envolvidas.
6. Explique quais as vantagens destas moléculas como armazenadoras de energia,
quando comparadas, por exemplo, as moléculas de carboidratos.
7. Cite as principais classes de lipídios estruturais de membrana. Qual a principal
diferença entre elas?
8. O que é o colesterol?

Proteínas
1. Qual a importância das proteínas nos seres vivos?
2. Qual a unidade formadora das proteínas?
3. Represente um dipeptídeo e a ligação química envolvida nessa molécula.
4. Qual a importância da seqüência de aminoácidos em uma proteína?
5. O que são proteínas conjugadas?
6. O que são grupos prostéticos?
7. O que são metaloproteínas, lipoproteínas e glicoproteínas? Onde podem ser
encontradas nos seres vivos?
8. Explique os 4 níveis estruturais que uma proteína pode ter e as ligações e
interações que ocorrem em cada nível.
9. Que tipo de estrutura secundária assume as proteínas colágeno e queratina?
10. Diferencie proteínas globulares de fibrosas. Dê um exemplo de proteína fibrosa e
um exemplo de proteína globular.
11. O que é desnaturação protéica e quais as condições para que esse processo
ocorra?
12. O processo de desnaturação protéica é sempre irreversível? Explique.
Ácidos Nucléicos
1. O que são ácidos nucléicos?
2. Quais são os diferentes tipos de ácido nucléicos?
3. Quais são as funções dos ácidos nucléicos?
4. O que são nucleotídeos? Qual a sua constituição?
5. Qual a diferença entre um nucleotídeo e um nucleosídeo?
6. Como se classificam as bases nitrogenadas constituintes dos nucleotídeos?
7. Quais são as bases nitrogenadas constituintes do DNA?
8. Quais são as pentoses constituintes do DNA e RNA, respectivamente?
9. Explique a estrutura do DNA.
10. Como se dão as ligações entre os componentes de um nucleotídeo?
11. Como se dá a ligação entre os nucleotídeos em um ácido nucléico?
12. Como se dá a formação das pontes de hidrogênio em uma estrutura 3D do DNA?
13. Qual é o nome da forma predominante da dupla hélice do DNA?

Lista 2

Enzimas, Cinética, Inibição e Regulação Enzimáticas


1. Definir enzima, substrato e sítio ativo.
2. O que são enzimas?
3. Quais as características de um catalisador?
4. Defina energia de ativação.
5. Identifique os componentes de uma reação enzimática.
6. Conceitue cofatores e coenzimas, descrever sua importância e exemplificar.
7. Como as enzimas se classificam? Exemplifique cada classe
8. Descreva as regras gerais de nomenclatura de enzimas.
9. Explique as teorias de modelos reacionais enzimáticos.
10. Descreva os fatores que alteram a atividade das enzimas.
11. Comente as características de um gráfico que mostre a influência do pH na
velocidade de uma reação catalisada por uma enzima.
12. Mostre como a temperatura pode influir sobre as reações catalisadas pelas
enzimas.
13. Demonstre esquematicamente a influência da concentração de substrato sobre a
atividade enzimática quando em (a) alta concentração de substrato e (b) baixa
concentração de substrato.
14. O que é o poder catalítico de uma enzima e como pode ser determinado?
15. Explique o que é e como se dá a estabilidade dinâmica de uma enzima.
16. Conceitue velocidade máxima de uma reação enzimática e relacione com
saturação da enzima pelo substrato.
17. Conceitue Km e relacione com a afinidade da enzima pelo substrato.
18. A enzima E possui especificidade pelos substratos A e B. A partir do gráfico abaixo
responda por qual dos substratos a enzima possui maior afinidade. Justifique.
1/v A
B

1/[s]

19. Descreva os tipos de inibição enzimática.


20. Conceitue enzimas alostéricas. Descreva a estrutura e o mecanismo de ação
destas enzimas.
21. Conceitue centro alostérico, efetores positivos e negativos e homotrópicos e
heterotrópicos.
22. Explique a regulação alostérica por retroinibição
23. Fazer o gráfico vo x [S] para concentrações de enzima E e 2E.
24. Fazer o gráfico vo x [S] sem inibidor, na presença e na ausência de inibidores (a)
competitivo e (b) não competitivo.
25. Fazer o gráfico vo x [S] de uma reação catalisada por uma enzima alostérica, sem
efetuador, na presença de efetuador positivo e de efetuador negativo.
26. Quais os principais mecanismos de regulação da atividade das enzimas?
27. Definir regulação enzimática por modificação covalente.
28. Considere as seguintes reações enzimáticas em série (via metabólica), onde as
letras são os metabólitos e os números são as enzimas.

Na reação catalisada pela enzima 2, quem é o produto e quem é o reagente?

29. Os seguintes dados experimentais foram obtidos durante o estudo da atividade


catalítica de uma enzima.

a partir desses dados, determine através da análise gráfica, os valores de Km e Vmax


para esta enzima.

30. A partir dos dados abaixo sobre uma reação enzimática, faça o gráfico da
transformação de Lineweaver-Burk e determine o tipo de inibição.

31. A atividade de uma enzima hipotética na hidrólise de um substrato neutro não é


afetada pelo pH, no intervalo de 6 a 8. No entanto, esse mesma enzima apresenta-se
ativa noutros valores de pH, quando se emprega um substrato alternativo. Para cada
valor de pH, o enzima originou gráficos de Lineweaver-Burk lineares, e os valores de
KM e de Vmáx foram calculados.

pH KM Vmáx
(mmolL-1) (molL-1min-1)
8.0 1.1 75
7.5 1.3 80
7.0 2.0 77
6.5 4.2 83
6.0 11.0 75

Qual é o significado de a atividade do enzima não ser afetada pelo valor de pH,
quando se usa um substrato não carregado, ao contrário do que acontece com um
substrato carregado?
32. Sabendo-se que a uréia (CO(NH2)2) pode ser decomposta em CO2 e NH3, um
estudante interessado em obter NH3 rapidamente, a partir de uréia, preparou uma
série de tubos e incubou-os a 30°C por 10 minutos. Após este tempo, dosou a amônia
nos tubos. A composição dos tubos (com volume de 1 mL) e os resultados de suas
dosagens foram:

a) Por que não houve formação de NH3 no tubo 9?


b) Qual a velocidade da reação (em μMoles/min) nos tubos 5 e 8 ?
c) De quê dependeu a velocidade de reação neste experimento?
d) Qual seria o resultado se a dosagem de amônia fosse feita 48 h de incubação?
e) Faça o gráfico de V0 versus [S] e determine a constante de Mickaelis-Menten (KM).

BIOENERGÉTICA
1. Explique por que o ser humano é um sistema aberto.
2. Quais são as propriedades termodinâmicas que ocorrem durante as reações
bioquímicas? Defina e explique cada uma delas.
3. Qual é a relação entre a energia de ativação e a velocidade de uma reação?
4. Qual é a relação entre a variação da energia livre padrão e a constante de
equilíbrio?
5. O que é potencial de fosforilação? Quando ocorre?
6. Nas reações bioquímicas, como atuam os pares redox e quais são as formas de
transferência de elétrons?
7. Explique o significado metabólico das reações que funcionam próximas ao equilíbrio
(ΔG ~ 0) e das reações que atuam distantes do equilíbrio (ΔG = 0).
8. Descreva as maneiras pelas quais um processo exergônico pode promover um
processo endergônico.

CADEIA DE TRANSPORTE DE ELÉTRONS E FOSFORILAÇÃO OXIDATIVA


1. Definir fosforilação oxidativa.
2. Qual a função metabólica das coenzimas reduzidas (NADH e FADH2)?
3. Indicar o número de ATP sintetizados para cada NADH e FADH2 oxidados.
4. Citar exemplos de processos biológicos que utilizam ATP.

Lista 3

GLICÓLISE
1. Por que a glicólise é uma via metabólica praticamente universal?
2. Explique as relações da glicólise com outras vias metabólicas.
3. Quais são as moléculas que atuam como intermediários na glicólise?
4. Quais são as duas fases da glicólise? O que ocorre em cada uma delas?
5. Quais os passos irreversíveis da glicólise?
6. Descreva os mecanismos que regulam a atividade da fosfofrutoquinase.
7. Considerando o número de moléculas de ATP consumidas e formadas, estabelecer
o saldo final de ATP na degradação de uma molécula de glicose pela via glicolítica.
8. Quantas moléculas de piruvato se formam a partir de uma molécula de glicose?
9. Considerando o número de moléculas de ATP consumidas e formadas, estabelecer
o saldo final de ATP (balanço energético) na oxidação de uma molécula de glicose
pela via glicolítica.
10. Considerando o número de moléculas de ATP consumidas e formadas,
estabelecer o saldo final de ATP (balanço energético) na oxidação de uma molécula
de lactose pela via glicolítica.
11. Explique como ocorrem os controles a longo e curto prazo durante a glicólise.
12. Descreva de que forma a frutose, a galactose e a manose entram na via glicolítica.

OXIDAÇÃO DO PIRUVATO
1. Cite os possíveis destinos do piruvato.
2. Explicar o mecanismo de formação de acetil-CoA a partir de piruvato (complexo
piruvato desidrogenase).
3. Quais são as duas enzimas complementares que integram também o complexo da
piruvato desidrogenase.
4. Citar exemplos de tecidos ou organismos onde ocorre fermentação lática, acética e
alcoólica. Em que condições glicose é oxidada à lactato?
5. Explique como é leveduras de cervejaria e panificação fermentam glicose em etanol
e CO2.

VIA DAS PENTOSES FOSFATO


1. Quais são as fases da via das pentoses fosfato e o que ocorre em cada uma delas.
2. Explicar como é que pentoses-5-fosfato são recicladas em glicose-6-fosfato em
termos de rearranjos dos esqueletos carbônicos das moléculas intermediárias.
3. Citar a localização celular da via das pentoses.
4. Mostrar a importância biológica da via das pentoses.
5. Sugerir a razão pela qual a via das pentoses é muito mais ativa no tecido adiposo
do que no tecido muscular.
6. Como se dá o controle da via das pentoses fosfatos?

CICLO DE KREBS
1. Por quais outros nomes é chamado o ciclo de Krebs? Por quê?
2. Quantos ATPs, NADH e FADH2 são formados com a oxidação de:
a) glicose
b) piruvato
c) acetil-CoA
na Glicólise e Ciclo de Krebs?
3. Defina acetil-CoA. De quais moléculas e vias metabólicas ela pode ser originária?
Qual a sua importância no ciclo do ácido cítrico?
4. O que é a respiração celular? Quais são os seus estágios? Explique-os.
5. Explicar como é o ciclo do ácido cítrico em termos de rearranjos dos esqueletos
carbônicos de suas moléculas intermediárias.
6. Quais as etapas do ciclo do ácido cítrico que regulam o fluxo do ciclo?
7. Explique como o ciclo catalítico pode suprir precursores para outras rotas
metabólicas sem diminuição dos seus próprios intermediários?
8. Quais as funções do ciclo de Krebs?
9. Quantas voltas no ciclo de Krebs são necessárias para transformar os 6 carbonos
da glicose em CO2?

GLICONEOGÊNESE
1. Definir gliconeogênese e citar exemplos de compostos gliconeogênicos. Citar o
tecido responsável pela gliconeogênese.
2. Por quê a gliconeogênese não pode ser considerada como a via glicolítica ao
contrário?
3. Comparar as três reações irreversíveis da glicólise com as reações de
gliconeogênese que as substituem, quanto a reagentes, produtos, enzimas e
coenzimas.
4. Indicar a localização celular das enzimas da via glicolítica e da gliconeogênese.
5. Descrever as alterações do metabolismo de carboidratos provocadas por jejum
prolongado.
6. Por que o metabolismo do lactato tem um papel fundamental no desempenho de
atletas em provas de caráter altamente aeróbio, por exemplo uma maratona?

METABOLISMO DE ÁCIDOS GRAXOS


1. Como os ácidos graxos são transportados no organismo? Como e onde se dá a
ativação do ácido graxo?
2. O que é beta-oxidação?
3. Considerando uma volta da beta oxidação, qual o produto formado?
4. Compare em rendimento energético, a degradação total de um ácido graxo com 18
carbonos e três moléculas de glicose.
5. Onde se dá a degradação de um ácido graxo dentro da célula.
6. O que são corpos cetônicos? Em que condições são formados?
7. Como a degradação do ácido graxo é regulada?
8. Explique o complexo da ácido graxo sintetase.
9. Compare a β-oxidação, com a biossíntese do ácido miristoil (C14) quanto aos
seguintes aspectos. Responda na forma de tabela.
a. Composto de partida
b. Localização intracelular das enzimas que catalisam as reações de ambos os
processos.
c. Coenzimas de óxido-redução utilizadas.
d. Carregador de grupo acila
e. Forma em que as unidades de carbonos são removidas ou adicionadas.
f. Saldo de ATP (considere a oxidação até CO2 e H2O)
10. Qual o papel do citrato na regulação do metabolismo de carboidratos e lipídios?
11. Considere o metabolismo básico estudado. O que acontece com o metabolismo de
lipídios e carboidratos após um jejum prolongado?
12. Quantos ATPs são produzidos com a oxidação completa até CO2 e H2O de um
ácido graxo saturado contendo 22 carbonos?
13. Qual a função da carnitina no transporte de lipídeos.
14. Por que dietas ricas em lipídios geram mais energia quando comparadas com
dietas ricas em carboidratos?
15. Quais as diferenças entre as vias biossintetizante e oxidativa do ácido palmítico?

METABOLISMO DE ÁCIDOS NUCLÉICOS


1. Explique o dogma central da biologia. De que forma ele foi ampliado?
2. Explique o processo de replicação (duplicação).
3. Explique o processo de transcrição.
4. Explique o processo de tradução.
5. Qual é a principal enzima envolvida na síntese de (a) DNA e (b) RNA?
6. Por que a replicação do DNA é um processo semi-conservativo?
7. Qual a diferença do processo de replicação do DNA entre procariotos e eucariotos?
8. Qual a diferença entre as etapas de iniciação durante a replicação e a transcrição?
9. Como se dá a etapa de terminação do processo de replicação do DNA em
eucariotos e procariotos?
10. O que é primer?
11. O que é um promotor?
12. Em que sentido se dá a replicação do DNA? Como é possível fazer a cópia da
outra fita de DNA?
13. O que é códon?
14. Explique o código genético.
15. Onde se dá a síntese protéica em (a) procariotos e (b) eucariotos?
16. O que é fita codificadora?
17. Qual o papel do mRNA nos processos de transcrição e tradução?
18. Quais são as diferenças fundamentais entre os processos de replicação e
transcrição?
19. O que é o processamento pós-transcricional?
20. O que é transcrito primário?
21. Qual a diferença entre o processo pós-transcricional em procariotos e eucariotos?
22. O que é o splicing do mRNA?
23. O que são regiões codificadoras?
24. O que são introns e exons?
25. O que são códons iniciador e finalizador?
26. A seqüência de aminoácidos de uma proteína é determinada pela seqüência de:
a) pentoses da molécula de DNA
b) pentoses da molécula de RNAm
c) bases da molécula de DNA
d) bases da molécula de RNAt
e) bases da molécula de RNAr
27. A tabela abaixo mostra a trinca de códons e o seu aminoácido correspondente na
síntese de proteínas.

De acordo com esta tabela, escreva a sequência de aminoácidos que correspondente


ao mRNA listado abaixo.
5` – AUGGUAGCCCAUAGAUGUUAA – 3`