You are on page 1of 30

Accepted Manuscript

Amelioration of streptozotocin-induced type 2 diabetes mellitus in Wistar rats by


arachidonic acid

Naveen K.V. Gundala, Vegi G.M. Naidu, Undurti N. Das

PII: S0006-291X(18)30007-X
DOI: 10.1016/j.bbrc.2018.01.007
Reference: YBBRC 39180

To appear in: Biochemical and Biophysical Research Communications

Received Date: 26 December 2017

Accepted Date: 2 January 2018

Please cite this article as: N.K.V. Gundala, V.G.M. Naidu, U.N. Das, Amelioration of streptozotocin-
induced type 2 diabetes mellitus in Wistar rats by arachidonic acid, Biochemical and Biophysical
Research Communications (2018), doi: 10.1016/j.bbrc.2018.01.007.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to
our customers we are providing this early version of the manuscript. The manuscript will undergo
copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please
note that during the production process errors may be discovered which could affect the content, and all
legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT

Amelioration of streptozotocin-induced type 2 diabetes mellitus in Wistar rats by


arachidonic acid

Naveen KV Gundala1, Vegi G M Naidu 2, Undurti N Das1, 3


1
BioScience Research Centre, Department of Medicine, Gayatri Vidya Parishad

PT
Hospital, GVP College of Engineering Campus, Visakhapatnam-530048, India;
2
National Institute of Pharmaceutical Education and Research, Guwahati, India;

RI
3
UND Life Sciences, 2221 NW 5th St, Battle Ground, WA 98604, USA.
(Correspondence to: Undurti N Das at undurti@hotmil.com)

SC
Keywords:

U
Type 2 diabetes mellitus, streptozotocin, arachidonic acid, lipoxin A4, insulin, Wistar rats, anti-
oxidants, lipocaln2, cytokines, glucose.
AN
Abstract
M

Traditionally arachidonic acid (AA, 20:4 n-6) is considered as a pro-inflammatory


molecule since it forms precursor to prostaglandins (PGs), leukotrienes (LTs) and
D

thromboxanes (TXs) that have pro-inflammatory actions. Type 2 diabetes mellitus (type
2 DM) is considered as a low-grade systemic inflammatory condition in which circulating
TE

PGs and LTs are increased. Streptozotocin (STZ)-induced type 2 DM is used as a


model of human type 2 DM in which peripheral insulin resistance, increased plasma
EP

interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) and hyperglycemia occurs. In
the present study, we observed that oral supplementation of AA prevented STZ-induced
type 2 DM in Wistar rats by restoring hyperglycemia, plasma levels of TNF-α and IL-6;
C

adipose tissue NF-kB and lipocalin 2 (LPCLN2) and pancreatic tissue NF-kB and 5- and
AC

12- lipoxygenase enzymes to normal. AA treatment enhanced insulin sensitivity and


plasma lipoxin A4 (LXA4) levels, a potent anti-inflammatory molecule derived from AA.
These results are supported by our previous studies wherein it was noted that plasma
phospholipid content of AA and circulating LXA4 levels are low in those with type 2 DM.
In a preliminary study, we also noted that high-fat-diet (HFD)-induced type 2 DM in
Wistar rats can be prevented by oral supplementation of AA. These results suggest AA

1
ACCEPTED MANUSCRIPT

has anti-inflammatory and anti-diabetic actions by enhancing the production of its anti-
inflammatory metabolite LXA4.

Significance statement:

Type 2 diabetes mellitus is assuming epidemic proportions throughout the world. It is a

PT
low-grade systemic inflammatory condition. In a streptozotocin (STZ)-induced type 2
diabetes mellitus animal model we showed that oral supplementation of arachidonic

RI
acid (AA) can completely prevent hyperglycemia and enhance insulin sensitivity by
suppressing IL-6 and TNF-α production and restoring antioxidant status to normal. STZ-

SC
induced suppression of lipoxin A4 production was restored to normal by AA treatment.
These results suggest that AA may function as an endogenous anti-diabetic molecule.

U
In contrast to the general belief, our studies suggest that AA has anti-inflammatory
actions.
AN
Introduction
M

Type 2 DM is assuming alarming proportions across globe and is a major cause for
significant morbidity and mortality (1, 2). Hence, identifying molecules that could prevent
D

or reverse features of type 2 DM are urgently needed. Streptozotocin (STZ)-induced


type 2 DM is a well-accepted model that is useful for this purpose.
TE

Type 2 DM is due to peripheral insulin resistance as a result of low-grade systemic


inflammation as evidenced by elevation of plasma inflammatory markers IL-6, TNF-α (3,
EP

4) that could be due to increased activity of CD4, CD8, T and B lymphocytes,


monocytes and macrophages. As a result of this, enhanced production of nitric oxide
C

(NO), TNF-α, interferon, interleukins and PGs occur (5-9). Studies revealed that
AC

injection of streptozotocin (STZ) to experimental animals increases serum interleukins


and TNF-α levels (10) that enhances systemic inflammation and induces insulin
resistance, key features of human type 2 DM. In addition to an increase in inflammatory
markers (such as IL-6, TNF-α), augmented expression of pro-inflammatory genes
including NF-kB in pancreas, pancreatic β cells and adipose tissues occurs in type 2
DM (11, 12), which led to the suggestion that by regulating oxidative stress pathways
and suppressing oxidative and ER stress caused by cytokines or glucolipotoxicity in

2
ACCEPTED MANUSCRIPT

mouse and human beta cells could lead to restoration of glucose homeostasis and
insulin sensitivity (12). High plasma glucose itself induces expression of pro-
inflammatory genes such as cyclo-oxygenase-2 (COX-2) and enhances the production
of free radicals (13-15).

PT
Polyunsaturated fatty acids (PUFAs) and their mediators have a role in regulating
inflammation and consequently in the pathobiology of type 2 DM (16, 17). The COX

RI
metabolites such as prostaglandins act as pro-inflammatory mediators and LOX
products are anti-inflammatory in nature. The subtle balance between these mediators

SC
is essential in the regulation of inflammation. Previous studies showed that type 2 DM is
a low-grade systemic inflammatory condition (16-20).

U
Previously, we showed that PUFA-rich oils such as evening primrose (a rich source of
gamma-linolenic acid: 18:3 n-6), fish oil (a rich source of eicosapentaenoic acid: 20;5 n-
AN
3, EPA; and docosahexaenoic acid: 22:6, n-3, DHA) and ARASCO (a rich source of
arachidonic acid: 20:4, n-6, AA) can prevent alloxan-induced type 1 DM in Wistar rats
M

(21). Subsequently, we observed that of all the PUFAs tested, AA is the most effective
unsaturated fatty acid that protects RIN 5F cells from the cytotoxic action of alloxan and
D

alloxan-induced type 1 DM in Wistar rats (22-26). It is noteworthy that beneficial action


of AA against alloxan-induced cytotoxicity to RIN5F cells in vitro and type 1 DM in
TE

experimental animals cannot be abrogated by both COX and LOX inhibitors implying
that PGs, LTs and TXs do not have a role in this process (22-26). This was further
EP

supported by the observation that various PGs and TXB2 were found to be less potent
compared to AA in preventing alloxan-induced cytotoxicity to RIN5F cells and type 1 DM
C

in experimental rats (27, 28). These results suggested to us that either AA itself is
having the observed beneficial action(s) and/or is metabolized to products other than
AC

PGs, LTs and TXs to bring about its beneficial actions. Further studies revealed that
alloxan inhibits formation and release of lipoxin A4 (LXA4) by alloxan-treated RIN5F
cells in vitro and circulating levels of LXA4 are low in alloxan-induced type 1 DM
animals (26). In an extension of these studies, it was noted that LXA4 could effectively
prevent alloxan-induced type 1 DM in Wistar rats (26). These results led us to suggest

3
ACCEPTED MANUSCRIPT

that AA and LXA4 have anti-inflammatory actions and AA brings about its anti-diabetic
action by enhancing the formation of LXA4.

Since type 2 DM is an inflammatory condition and AA prevented alloxan-induced


cytotoxicity and type 1 DM (26), we next evaluated whether streptozotocin (STZ)-

PT
induced cytotoxicity to RIN5F cells and type 1 DM in Wistar rats can be prevented by
this bioactive lipid. These results revealed that AA is cytoprotective against STZ-

RI
induced cytotoxicity to RIN5F cells and prevents type 1 DM in Wistar rats (29). But, it is
not known whether AA can prevent STZ-induced type 2 DM and if so, what could be the

SC
mechanism of action.

The results of these studies suggest that AA can prevent STZ-induced type 2 DM in

U
Wistar rats by suppressing inflammation and enhancing the formation of LXA4.
AN
Materials and methods:

Chemicals: All reagents and chemicals were purchased from Sigma Aldrich Chemical
M

Company (St. Louis, MO, USA). AA was procured from Cayman Chemical Company
(Ann Arbor, MI, USA). Polymerase chain reaction (PCR) reagents were obtained from
D

Sigma. PCR primers were purchased from Bioserve (Hyderabad, India).


TE

Experimental animals: 3–4 weeks old Male Wister rats, procured from National
Institute of Nutrition, (Hyderabad, India) were used in this study. The animals were
housed at 250C room temperature with 12-hr dark and 12-hr light cycle. Animals
EP

weighing around 180 g were segregated into 4 groups: controls received PBS and
citrate buffer; diabetic group received only STZ; AA group received only AA; whereas
C

the teat group received AA + STZ. The animals received STZ and nicotinamide
AC

intraperitoneally and AA orally. Experiment was approved by Institutional Animal Ethical


Committee.

Induction of type 2 Diabetes mellitus: In male Wistar rats type 2 diabetes mellitus
was induced by Nicotinamide + STZ protocol. Freshly prepared 175mg/kg body weight
Nicotinamide in PBS was administered intraperitoneally. After 15mins of Nicotinamide
injection freshly prepared 65mg/kg body weight STZ in 50mM citrated buffer pH 4.5 was

4
ACCEPTED MANUSCRIPT

injected intraperitoneally (Fig. 1a). Freshly prepared AA in phosphate buffered saline


(PBS) was administered at a dose of 10µg/animal orally consecutively for a week and
once in a week for the whole duration of the study as described previously (29).

Fasting blood glucose was measured using Accu-Check blood glucose meter (Roche,

PT
USA) on 10th, 20th and 30th day from day 1 of the injection of STZ. The animals were
confirmed to have developed diabetes when the fasting blood sugar levels were

RI
>250mg/dL. Body weight was measured along with the blood glucose estimation. The
total period of the study was for 30 days from the day of the injection of STZ. On day 30,

SC
the study was terminated by sacrificing the animals to collect blood and various tissues
(liver, pancreas, spleen, kidney, and mesenteric adipose tissue) for further analysis.
Plasma, RBC and tissues collected were stored at -800 C till further analysis.

U
AN
Measurement of Oral Glucose Tolerance Test (OGTT) and insulin sensitivity
indices: On the last day of the study (30th day), after overnight fasting, an oral glucose
tolerance test (OGTT) was performed in all the groups of animals. After a basal blood
M

sample was collected (considered time point 0), the animals were challenged with an
oral glucose load (2 g/kg) given with a stomach tube. Further blood samples were
D

collected at 30, 60, 90 and 120 min from the retro orbital plexus of each animal. Plasma
TE

glucose levels were determined by using Accu-Check blood glucose meter (Roche,
USA). Area under curve (AUC) was calculated for the glucose and insulin collected at
various time points 0, 30, 60, 90 and 120 mins of OGTT. Insulin sensitivity index (ISI)
EP

was assessed by computing HOMA-IR, QUICKI (Quantitative insulin check index),


Matsuda, Belfiore indices. Homeostatic model assessment (HOMA) was computed to
C

know the insulin resistance and rest of 3 used for insulin sensitivity.
AC

Estimation of NO, LP, and antioxidant enzymes: NO, LP, and antioxidant enzymes:
SOD, CAT, GPx, and GST were measured in the plasma and various tissue
homogenates of all groups of the study. The methods followed for these estimations
have been described previously (22-29).

5
ACCEPTED MANUSCRIPT

Estimation of plasma LXA4: LXA4 was measured in the plasma samples of all groups
of animals of the study by enzyme-linked immunosorbent assay (ELISA; Oxford
Biomedical Research Company, MI, USA) per the manufacturer’s instructions (EA45).

Estimation of plasma insulin: Plasma insulin levels were estimated by ultrasensitive

PT
rat insulin ELISA kit (Crystal Chemical Inc, Belvidere, IL, USA) per the manufacturer’s
instructions (Crystal Chem, 90060).

RI
Estimation of plasma TNF-α: TNF-α was measured in the plasma samples at various
time periods of the study (days 10, 20, and 30 after the first STZ injection) by using

SC
Quantikine TNF-α Immunoassay ELISA kit (R&D Systems, Minneapolis, MN, USA).

Estimation of plasma IL-6: IL6 was measured in the plasma samples at various time

U
periods of the study (days 10, 20, and 30 after the first STZ injection) by using Rat IL-6
AN
ELISA Kit by Abcam (ab100772) Cambridge, USA.

Gene expression studies in pancreatic and adipose tissues:


M

Isolation of RNA and cDNA synthesis: Trizol reagent method was used to isolate the
RNA from homogenized pancreas and adipose tissues; cDNAs were then synthesized
D

by reverse transcription from 1 µg of total RNA using SuperScript First Strand Synthesis
TE

for qRT-PCR (Invitrogen). Both RNA isolation and RT-PCR were done according to the
manufacturer’s instructions.
EP

Semiquantitative PCR: The expression of genes P65 NF-kB, 5-LOX, 12-LOX, COX-2
and β-actin was studied by using semi quantitative PCR as follows: 950C for 2 min initial
denaturation; 950C for 30s denaturation; 640C, 540C, 600C, 690C and 52.50C for 30 s
C

annealing for P65 NF-kB, 5-LOX, 12-LOX, COX-2 and β-actin respectively; followed by
AC

720C for 30 s extension and 720C for 5-min final extension; and overall 35 cycles were
performed for pancreatic tissue.

In the adipose tissue, PCR was performed to study the expression of P65 NF-kB,
LPCLN2, and β-actin as follows: 950C for 2 min initial denaturation; 950C for 30s
denaturation; 640C, 630C, and 52.50C for 30 s annealing for P65 NF-kB, LPCLN2, and
β-actin, respectively; followed by 720C for 30 s extension and 720C for 5 min final
6
ACCEPTED MANUSCRIPT

extension; and overall 35 cycles were performed. PCR products were observed and
analyzed by electrophoresis on 1.5% (w/v) agarose gel in 1X TAE buffer at 100 V.
Quantification was performed by taking the ratio of gene of interest and β-actin and
calculated as percentage comparing with respective control. The details of primer genes
NF-kB, 5-LOX, 12-LOX, COX-2, LPCLN2, and β-actin are presented in Table 2. PCR

PT
was performed in Eppendorf 5331 Master cycler. Quantification of genes was done by
Major Science image analysis software.

RI
Statistical analysis: Experiments were performed using six animals per group. All the

SC
results are expressed as mean ± SEM. The obtained values were analyzed by paired t-
test with equal variance using Microsoft Excel statistical analysis tool.

Results
U
AN
Effect of AA treatment on plasma glucose and body weight in STZ induced T2DM
STZ induced T2DM was confirmed by measuring plasma glucose levels that was
M

>140mg/dl after 48 hours of induction and showed gradual and substantial increase
throughout the study. As shown in the protocol (figure 1A), AA was administered orally
D

from day 1 of the study for 7 consecutive days and subsequently once in a week till the
end of the study. It is evident from the results shown in Fig. 1B that AA treatment
TE

(p<0.05) prevented the development of DM by restoring plasma glucose levels and


body weight to near normal in STZ induced T2DM animals (fig. 1B). During the first 10
EP

days of the experiment blood glucose levels reached to 145mg/dl in STZ-induced type 2
DM animals whereas AA supplemented animals maintained blood glucose levels ~ 130
C

mg% (p<0.05 compared to control). STZ-treated type 2 DM animals showed persistent


increase in blood glucose till day 30 of the study. AA impeded (p<0.05) increase in
AC

blood glucose levels during the entire period of the study. AA treated animals did not
show any increase in body weight compared to STZ-induced T2DM animals (Fig. 1C).

AA attenuated production of proinflammatory cytokines in STZ induced type 2


DM animals

7
ACCEPTED MANUSCRIPT

Type 2 DM is known to be associated with low-grade systemic inflammation. Both IL-6


and TNF-α are increased (p<0.05) in STZ-induced type 2 DM animals compared to the
control (Fig. 2 C and D). This increase in the plasma proinflammatory cytokines
persisted (p<0.05) throughout the study period in STZ-induced type 2 DM animals
compared to control. In contrast, AA prevented (p<0.05) this increase in plasma IL-6

PT
and TNF-α in STZ-induced type 2 DM animals suggesting that AA has anti-inflammatory
actions.

RI
AA treatment enhanced insulin sensitivity and augmented production of lipoxin
A4 (LXA4)

SC
Insulin resistance and glucose intolerance are present in in type 2 DM. In STZ-induced

U
type 2 DM animals, plasma levels of insulin were found to be higher (p<0.05) compared
to control (fig. 2a). AA alone treated group showed no significant change in plasma
AN
insulin levels whereas AA treated STZ-induced type 2 DM group showed not only a
decrease in plasma insulin levels (p<0.05) compared to control but also a significant
M

decrease in insulin resistance and glucose tolerance (Fig. 3C). Furthermore, AA


treatment restored plasma LXA4 levels to normal in STZ-induced type 2 DM group
D

(p<0.05) compared to STZ-induced type 2 DM animals (Fig. 2b).


TE

AA decreased insulin resistance and improved glucose tolerance in STZ-induced


type 2 DM
EP

In those with type 2 DM, despite hyperinsulinemia hyperglycemia occurs due to


peripheral insulin resistance. In the present study, oral glucose tolerance test (OGTT)
C

showed the presence of insulin resistance in STZ-induced type 2 DM group (p<0.05)


AC

compared to control (Fig. 3c). Furthermore, the area under curve studies showed that
persistence (p<0.05) of insulin in the plasma after 2 hours in the OGTT study (fig 3d) in
STZ-induced type 2 DM animals. This persistence of plasma insulin in STZ-induced
type 2 DM animals was significantly (p<0.05) ameliorated by the AA (fig 3c and 3d). In
contrast, no significant change in plasma insulin and glucose levels was noted in AA
alone treated animals compared to control. STZ-induced glucose intolerance was
observed throughout the duration of the study, especially during later part of the study

8
ACCEPTED MANUSCRIPT

(day 20 and day 30 of the study) (Fig 1b). Both hyperglycemia and insulin resistance
were significantly (p<0.05) ameliorated by AA treatment in STZ-induced type 2 DM
animals (Figs. 3a and 3b).

PT
AA enhanced insulin sensitivity in STZ-induced type 2 DM animals

Insulin sensitivity was computed using HOMA, QUICKI, Matsuda and Belfiore indices.

RI
HOMA computation model was used to assess insulin resistance in STZ-induced type 2
DM animals. Table 1 shows that HOMA value was increased (p<0.05) to 4.89 ± 0.2 in

SC
the STZ-induced type 2 DM animals that is almost 6-fold higher compared to control
value of 0.83 ± 0.04, while AA alone treated animals did not show any change. In

U
contrast, AA significantly (p<0.05) attenuated insulin resistance to 1.73 ± 0.02 from 4.89
± 0.2 in STZ-induced type 2 DM animals. Similar significant changes in insulin sensitivity
AN
indices calculated using QUICKI, Matsuda and Belfiore models was noted in AA-treated
STZ-induced type 2 DM animals. In type 2 DM animals, QUICKI assessment showed a
M

significant (p<0.05) decrease in insulin sensitivity from control value of 0.30 ± 0.002 to
0.25 ± 0.001 (Table 1), while AA control did not produce any significant change. In
D

contrast, AA treatment restored insulin sensitivity to a significant degree (p<0.05) to


0.28 ± 0.005 in STZ-induced type 2 DM animals. Matsuda index assessment showed
TE

that STZ reduced (p<0.05) insulin sensitivity by 3-folds to 1.02 ± 0.01 in type 2 DM
animals compared to control 3.94 ± 0.14 (Table 1). AA significantly (p<0.05) increased
EP

insulin sensitivity to 2.28 ± 0.07 in type 2 DM animals. Even Belfiore insulin assessment
index showed similar significant increase in insulin sensitivity (p<0.05) in type 2 DM
C

animals from 0.29 ± 0.006 to 0.65 ± 0.032, while AA control animals did not show any
significant change compared to control (Table 1).
AC

AA restored STZ-induced alterations in the expression of pancreatic p65 Nf-kB


and 5- and 12- LOX genes to normal

It is evident from the results shown in Figures 4a and 4b that STZ significantly (p<0.05)
up regulated the inflammatory gene p65 Nf-kB that was suppressed by AA treatment
(p<0.05) in type 2 DM animals. It is interesting to note that STZ enhanced COX-2

9
ACCEPTED MANUSCRIPT

activity that was not suppressed by AA (Fig. 4B). This may suggest pro-inflammatory
action of STZ since increased activity of COX-2 can lead to increased formation of
prostaglandins and leukotrienes. AA restored to normal the expression of 5- and 12-
LOX genes in the pancreatic beta cells of STZ-induced type 2 DM animals that was
suppressed by STZ-treatment (p<0.05). The ratio calculated between 12-LOX and

PT
COX-2 as a measure of the balance between (anti- inflammatory activity vs pro-
inflammatory) showed that AA can tilt the balance more towards the anti-inflammatory

RI
side (Fig. 4b), suggesting that the net effect of AA on the pancreatic beta cells is to
suppress inflammation.

SC
AA suppresses inflammation induced by STZ by down regulating p65 Nf-kB and
LPCLN2 and up regulating 12-LOX in adipose tissue

U
Increase in the expression of pro-inflammatory genes p65 Nf-kB and LPCLN2 of
AN
adipose produces low-grade systemic inflammation in obesity and type 2 DM. It is
evident from the results of the present study shown in figures 4c and 4d that STZ
M

enhances the expression of p65 Nf-kB and LPCLN2 in adipose tissue to a significant
degree (p<0.05) that is suppressed by AA treatment (p<0.05). In contrast, STZ
D

significantly (p<0.05) down regulated the anti-inflammatory gene 12-LOX whose


expression is needed for the synthesis of LXA4 from AA in adipose tissue. AA treatment
TE

restored (p<0.05) the expression of 12- LOX in adipose tissue to normal in STZ-induced
type 2 DM animals (Figs. 4c and 4d).
EP

AA restores the balance between pro- and anti-oxidants altered by STZ


C

The data shown in Table 3 shows that STZ significantly (p<0.05) increased nitric oxide
(NO) and lipid peroxides (LPO) levels in plasma, pancreas, liver and adipose tissues
AC

and reduced (p<0.05) the levels of SOD and GPx in the plasma, pancreas and adipose
tissue, whereas significant (p<0.05) increase in the levels of catalase and GST in the
plasma, liver and adipose tissue was noted/ All these alterations in the anti-oxidants
were reverted to normal by AA treatment suggesting that AA possess significant anti-
oxidant activity.

10
ACCEPTED MANUSCRIPT

Discussion

The results of the present study support the hypothesis that AA mediated regulation of
inflammation reduces the incidence of type 2 DM. Our earlier studies had shown that

PT
AA and its endogenous LOX metabolite LXA4 prevent type 1 DM induced by alloxan
and STZ (26, 29). The results of the present study showed that oral administration of AA
can prevent STZ-induced type 2 DM in Wistar rats. The ability of AA to suppress the

RI
expression of pancreatic Nf-kB and adipose tissue Nf-kB, LPCLN2 and enhance 5- and
12- LOX genes of the pancreas and adipose tissue may account for its anti-diabetic

SC
action. In type 2 DM, insulin resistance and glucose intolerance is due to stress induced
by increased plasma levels of TNF-α and IL-6. AA restored plasma levels of TNF-α and

U
IL-6 to control in the present study that could be responsible for the restoration of insulin
AN
sensitivity to normal (see Table 1).

Inflammation can cause adverse metabolic events in every tissue. Dominguez H et al


M

(30) showed that blocking of TNF-α in type 2 DM decreased plasma inflammatory


makers but could not alter the systemic insulin sensitivity. However, when rheumatoid
D

arthritis patients were treated with TNF-α antibodies improvement in systemic insulin
resistance was noted (31). In another study (32) it was reported that when type 2 DM
TE

patients were treated with TNF-α antagonist, etanercept, an increase in insulin


sensitivity. In addition, IL-6 also has an important role in insulin resistance as well. IL-6
EP

blocks insulin signaling in the liver and muscle mediated by insulin receptor substrate by
enhancing SOCS proteins (4, 33-35) implying that blocking IL-6 secretion and/or
blocking its action may enhance insulin signaling Hence, it is important to block both
C

TNF-α and IL-6 signaling to improve insulin sensitivity in type 2 DM. The results of our
AC

study presented here showed that AA supplementation could suppress both plasma
TNF-α and IL-6 concentrations (Fig. 2) that may explain improvement in insulin
sensitivity noted (Table 1). One mechanism by which AA is able to achieve this
improvement in insulin sensitivity may reside in its ability to enhance LXA4 formation as
noted in the present study (Fig. 2B) that is known to have potent anti-inflammatory
actions by suppressing both TNF-α and IL-6 synthesis and secretion (4, 36, 37). In

11
ACCEPTED MANUSCRIPT

support of this statement we observed in the present study that AA restored plasma
LXA4 levels to normal in STZ-treated animals (Fig. 2B). In addition, AA effectively
restored blood glucose and plasma insulin values and anti-oxidants to near normal
levels (Fig. 1B; Fig. 2A and B; Fig. 3 and Table 3). These results are supported by our
previous studies wherein we observed that AA attenuated both alloxan and

PT
streptozotocin-induced type 1 and type 2 DM in Wistar rats (22, 25, 26, 29).

RI
Our previous work strongly supports possible role for LXA4, an anti-inflammatory
metabolite of AA, as a potent anti-diabetic molecule (26, 29, 38). Previously, Keane et al

SC
(39) showed that AA has an important regulatory and protective β-cell action and thus,
may be beneficial in type 2 DM that are in supportive of our observation that AA has
cytoprotective actions against the toxic actions of alloxan and STZ (22, 25, 26). In this

U
context, it is noteworthy that salicylate, an inhibitor of COX-2 enzyme, reduced
AN
glycosuria and blood glucose in alloxan-induced diabetic rats and patients with type 2
DM without causing any change in the liver-glycogen content, while normal rats showed
no alteration in the blood glucose levels to salicylate (40, 41). This beneficial action of
M

salicylate has been attributed to its inhibitory action on endogenous PGE synthesis and
led to the suggestion that PGE may impair insulin response to glucose (42). Recent
D

evidences suggest that salicylates enhance the production of LXA4 from AA via the
TE

enzyme 15-epi lipoxygenase (43, 44) and LXA4, in turn, inhibits the production of PGE
(44). Based on these studies and our current results, it is likely that AA deficiency leads
EP

to reduced formation of LXA4 and increase in PGE generation that ultimately leads to
pancreatic β cell dysfunction and onset of diabetes mellitus (perhaps both type 1 and
type 2 DM) and hence, the protective action of AA and LXA4 against DM (22, 26, 29,
C

38). This is supported by the observation that patients with type 2 DM have low plasma
AC

phospholipid content of AA (45) and reduced circulating levels of LXA4 (46).

12
ACCEPTED MANUSCRIPT

PT
RI
References

SC
1. Klonoff DC (2009) The Increasing Incidence of Diabetes in the 21st Century. J
Diabetes Sci Technol 3: 1–2.

U
2. WHO (2016) Global report on diabetes. ISBN 978 92 4 156525 7 (NLM
AN
classification: WK 810).

3. Dandona P, Aljada A, Bandyopadhyay A (2004) Inflammation: the link between


M

insulin resistance, obesity and diabetes. Trends Immunol 25: 4-7.

4. Das UN (2017) Is there a role for bioactive lipids in the pathobiology of diabetes
D

mellitus. Front Endocrinol (Lausanne) 8: 182.


5. McDaniel ML, Kwon G, Hill JR, Marshall CA, Corbett JA (1996) Cytokines and
TE

nitric oxide in islet inflammation and diabetes. Proc Soc Exp Biol Med 211(1): 24-
32.
EP

6. Pickup JC (2004) Inflammation and activated innate immunity in the pathogenesis of


type 2 diabetes. Diabetes Care 27(3): 813-823.
C

7. Pickup JC, Mattock MB, Chusney GD, Burt D (1997) NIDDM as a disease of the
AC

innate immune system: association of acute-phase reactants and interleukin-6


with metabolic syndrome X. Diabetologia 40:1286–1292.
8. Gopaul NK, Anggård EE, Mallet AI, Betteridge DJ, Wolff SP, Nourooz-Zadeh J
(1995) Plasma 8-epi-PGF2 alpha levels are elevated in individuals with non-
insulin dependent diabetes mellitus. FEBS Lett 368(2): 225-229.

13
ACCEPTED MANUSCRIPT

9. White V, Jawerbaum A, Sinner D, Pustovrh C, Capobianco E, González E (2002)


Oxidative stress and altered prostanoid production in the placenta of
streptozotocin-induced diabetic rats. Reprod Fertil Dev 14(1-2):117-123.
10. Govindaraj J, Sorimuthu Pillai S (2015) Rosmarinic acid modulates the
antioxidant status and protects pancreatic tissues from glucolipotoxicity mediated

PT
oxidative stress in high-fat diet: streptozotocin-induced diabetic rats. Mol Cell
Biochem 404(1-2): 143-159.

RI
U SC
AN
M
D
TE
C EP
AC

14
ACCEPTED MANUSCRIPT

11. Gokulakrishnan K, Mohanavalli KT, Monickaraj F, Mohan V, Balasubramanyam


M (2009) Subclinical inflammation/oxidation as revealed by altered gene
expression profiles in subjects with impaired glucose tolerance and Type 2
diabetes patients. Mol Cell Biochem 324(1-2): 173-181.

PT
12. Hasnain SZ, Borg DJ, Harcourt BE, Tong H, Sheng YH, Ng CP, Das I, et al.
(2014) Glycemic control in diabetes is restored by therapeutic manipulation of
cytokines that regulate beta cell stress. Nat Med 20(12): 1417-1426.

RI
13. Fujita H, Kakei M, Fujishima H, Morii T, Yamada Y, Qi Z, Breyer MD (2007)

SC
Effect of selective cyclooxygenase-2 (COX-2) inhibitor treatment on glucose-
stimulated insulin secretion in C57BL/6 mice. Biochem Biophys Res
Commun 363(1): 37-43.

U
14. Tsuruta R, Fujita M, Ono T, Koda Y, Koga Y, Yamamoto T, et al. (2010)
AN
Hyperglycemia enhances excessive superoxide anion radical generation,
oxidative stress, early inflammation, and endothelial injury in forebrain
M

ischemia/reperfusion rats. Brain Res 1309: 155-163.

15. Wu X, Zhu L, Zilbering A, Mahadev K, Motoshima H, Yao J, Goldstein BJ (2005)


D

Hyperglycemia potentiates H(2)O(2) production in adipocytes


and enhances insulin signal transduction: potential role for oxidative inhibition of
TE

thiol-sensitive protein-tyrosine phosphatases. Antioxid Redox Signal 7(5-6): 526-


537.
EP

16. Das UN (2013) Lipoxins, resolvins, protectins, maresins and nitrolipids and their
clinical implications with specific reference to diabetes mellitus and other
C

diseases: part II. Clin Lipidol 8: 465–480.


AC

17. Das UN (2010) Metabolic syndrome pathophysiology: the role of essential fatty
acids and their metabolites. Ames, IA: Wiley-Blackwell Publishers.

18. Das UN (2002) Is metabolic syndrome X an inflammatory condition? Exp Biol


Med (Maywood) 227: 989–997.

15
ACCEPTED MANUSCRIPT

19. Hameed I, Masoodi SR, Mir SA, Nabi M, Ghazanfar K, Ganai BA (2015) Type 2
diabetes mellitus: From a metabolic disorder to an inflammatory condition. World
J Diabetes 6(4): 598-612.

20. Esser N, Legrand-Poels S, Piette J, Scheen AJ, Paquot N (2014) Inflammation

PT
as a link between obesity, metabolic syndrome and type 2 diabetes. Diabetes
Res Clin Pract 105(2): 141-150.

RI
21. Krishna Mohan I, Das UN (2001) Prevention of chemically-induced diabetes
mellitus in experimental animals by polyunsaturated fatty acids. Nutrition 17: 126-

SC
151.
22. Suresh Y, Das UN (2001) Protective action of arachidonic acid against alloxan-
induced cytotoxicity and diabetes mellitus. Prostaglandins Leukot Essen Fatty

U
Acids 64: 37-52.
AN
23. Suresh Y, Das UN (2003) Long-chain polyunsaturated fatty acids and chemically-
induced diabetes mellitus: Effect of ω-6 fatty acids. Nutrition 19: 93-114.
24. Suresh Y, Das UN (2003) Long-chain polyunsaturated fatty acids and chemically-
M

induced diabetes mellitus: Effect of ω-3 fatty acids. Nutrition 19: 213-228.
25. Suresh Y, Das UN (2006) Differential effect of saturated, monounsaturated, and
D

polyunsaturated fatty acids on alloxan-induced diabetes mellitus. Prostaglandins


TE

Leukot Essen Fatty Acids 74:199-213.


26. Naveen KVG, Naidu VGM, Das UN (2017) Arachidonic acid (AA) and lipoxin A4
(LXA4) attenuate alloxan-induced cytotoxicity to RIN5F cells in vitro and type 1
EP

diabetes mellitus in vivo. Biofactors 43: 251– 271.


27. Sailaja Devi MM, Das UN (2004) Effect of prostaglandins against alloxan-induced
C

cytotoxicity to insulin secreting insulinoma RIN cells in vitro. Prostaglandins


AC

Leukot Essen Fatty Acids 71: 309-318.


28. Sailaja MMS, Das UN (2006) Effect of prostaglandins against alloxan-induced
diabetes mellitus. Prostaglandins Leukot Essen Fatty Acids 74: 39-60.
29. Naveen KVG, Naidu VGM, Das UN (2017) Arachidonic acid (AA) and lipoxin A4
(LXA4) attenuate streptozotocin-induced cytotoxicity to RIN5F cells in vitro and
type 1 and type 2 diabetes mellitus in vivo. Nutrition 35: 61-80.

16
ACCEPTED MANUSCRIPT

30. Dominguez H, Storgaard H, Rask-Madsen C, Steffen Hermann T, Ihlemann N,


Baunbjerg Nielsen D, Spohr C, Kober L, Vaag A, Torp-Pedersen C (2005)
Metabolic and vascular effects of tumor necrosis factor-α blockade with
etanercept in obese patients with type 2 diabetes. J Vasc Res 42: 517–525.
31. Gonzalez-Gay MA, De Matias JM, Gonzalez-Juanatey C, Garcia-Porrua C,

PT
Sanchez-Andrade A, Martin J, Llorca J (2006) Anti-tumor necrosis factor-α
blockade improves insulin resistance in patients with rheumatoid arthritis. Clin

RI
Exp Rheumatol 24:83–86
32. Stanley TL, Zanni MV, Johnsen S, Rasheed S, Makimura H, Lee H, Khor

SC
VK, Ahima RS, Grinspoon SK (2011) TNF-α antagonism with Etanercept
decreases glucose and increases the proportion of high molecular weight

U
adiponectin in obese subjects with features of the metabolic syndrome. J Clin
Endocrinol Metab 96: E146–E150.
AN
33. Shoelson SE, Lee J, Goldfine AB (2006) Inflammation and insulin resistance. J
Clin Invest 116:1793–1801.
M

34. Ortega Martinez de Victoria E, Xu X, Koska J, Francisco AM, Scalise M, Ferrante


Jr AW, Krakoff J (2009) Macrophage content in subcutaneous adipose tissue:
D

associations with adiposity, inflammatory markers, and whole-body insulin action


in healthy Pima Indians. Diabetes 58: 385–393.
TE

35. Choi SH, Hong ES, Lim S (2013) Clinical implications of adipocytokines and
newly emerging metabolic factors with relation to insulin resistance and
EP

cardiovascular health. Front Endocrinol (Lausanne) 4: 97.


36. Liu C, Guan H, Cai C, Li F, Xiao J (2017) Lipoxin
C

A4 suppresses osteoclastogenesis in RAW264.7 cells and prevents ovariectomy-


induced bone loss. Exp Cell Res 2017; 352(2): 293-303.
AC

37. Yang F, Xie J, Wang W, Xie Y, Sun H, Jin Y, Xu D, Chen B, Andersson R, Zhou
M (2014) Regional arterial infusion with lipoxin A4 attenuates experimental
severe acute pancreatitis. PLoS One 9(9): e108525.
38. Das UN (2013) Arachidonic acid and lipoxin A4 as possible anti-diabetic
molecules. Prostaglandins Leukot Essen Fatty Acids 88: 201-210.

17
ACCEPTED MANUSCRIPT

39. Keane DC, Takahashi HK, Dhayal S, Morgan NG, Curi R, Newsholme P (2011)
Arachidonic acid actions on functional integrity and attenuation of the negative
effects of palmitic acid in a clonal pancreatic β-cell line. Clin Sci (Lond) 120(5):
195-206.
40. Smith MJH, Meade BW (1952) The effect of salicylate on glycosuria, blood

PT
glucose and liver glycogen of the alloxan-diabetic rat. Biochem J 51(1): 18-20.

RI
41. Reid J, Macdougall AI, Andrews MM (1957) Aspirin and Diabetes Mellitus. Br
Med J 2(5053): 1071–1074.

SC
42. Giugliano D, Ceriello A, Saccomanno F, Quatraro A, Paolisso G, D'Onofrio F
(1985) Effects of salicylate, tolbutamide, and prostaglandin E2 on insulin
responses to glucose in noninsulin-dependent diabetes mellitus. J Clin
Endocrinol Metab 61(1): 160-166.
U
AN
43. Spite M, Serhan CN. (2010) Novel lipid mediators promote resolution of acute
inflammation. Impact of aspirin and statins. Circ Res 107: 1170-1184.
M

44. Poorani R, Bhatt AN, Dwarakanath BS, Das UN (2016) COX-


2, aspirin and metabolism of arachidonic, eicosapentaenoic and
D

docosahexaenoic acids and their physiological and clinical significance. Eur J


Pharmacol 785: 116-132.
TE

45. Das UN (1995) Essential fatty acid metabolism in patients with essential
hypertension, diabetes mellitus and coronary heart disease. Prostaglandins
EP

Leukotrienes Essential Fatty Acids 52: 387-391.


46. Kaviarasan K, Mohanlal J, Mohammad Mulla MA, Shanmugam S, Sharma T,
C

Das UN, Angayarkanni N (2015) Low blood and vitreal BDNF, LXA4 and altered
AC

Th1/Th2 cytokine balance as potential risk factors for diabetic retinopathy.


Metabolism 64: 958-966.

18
ACCEPTED MANUSCRIPT

Legends

PT
Figure: 1. Effect of AA on STZ-induced type 2 DM

RI
A) Experiment Protocol: After 7 days of acclimatization, type 2 diabetes mellitus was
induced by intraperitoneal administration of 175 mg/kg body weight of

SC
Nicotinamide followed by 65 mg/kg body weight STZ. All animals, except placebo
and diabetic control, received 10µg/ml of AA orally consecutively for 1 week and

U
once in every week till the end of the experiment.
AN
B) Blood glucose levels in animals: Blood glucose estimation was performed in all
animals once in 10 days until the end of the study. All values are expressed as
mean ± SEM. aP≤0.05 compared to 10th day control values, bP≤0.05 compared to
M

20th day control values, cP≤0.05 compared to 30th day control values, dP≤0.05
compared to 10th day STZ values, eP≤0.05 compared to 20th day STZ values,
D

f
P≤0.05 compared to 30th day STZ values.
TE

C) Body weight of rats treated with AA ± STZ: The measurements were taken once
in 10 days till the end of the study. All the values are expressed as mean ± SEM.
*P≤0.05 compared to untreated control, †P≤0.05 compared to STZ.
EP

Figure: 2. Measurement of plasma insulin, LXA4, TNF-α and IL-6


C

A) Plasma insulin levels were measured in all the animals at the end of the study.
AC

Insulin estimation was done by using ultrasensitive rat insulin ELISA kit (Crystal
Chemical Inc, Belvidere, IL, USA). All the values are expressed as mean ± SEM.
*P≤0.05 compared to untreated control, †P≤0.05 compared to STZ.
B) Measurement of LXA4 levels in plasma of all the groups of animals were measured
at the end of the study (day 30). All the values are expressed as mean ± SEM. *P≤0.05
compared to untreated control, †P≤0.05 compared to STZ.

19
ACCEPTED MANUSCRIPT

C) Plasma I-L6 was measured in all animals using Rat IL-6 ELISA Kit by Abcam
(ab100772) Cambridge, USA. IL-6 measurement was done in plasma collected once in
every 10 days till the end of the study.
D) Plasma TNF-α was measured in all animals. Quantikine TNF-α Immunoassay ELISA
kit (R&D Systems, Minneapolis, MN, USA). TNF-α measurement was done in plasma

PT
collected once in every 10 days till the end of the study.

RI
Vales in C and D are expressed as mean ± SEM. aP≤0.05 compared to the 10th day
control; bP≤0.05 compared to the 20th day control; cP≤0.05 compared to the 30th day

SC
control; dP≤0.05 compared to the 10th day STZ control; e
P≤0.05 compared to the 20th
day STZ control; fP≤0.05 compared to the 30th day STZ control.

U
Figure: 3. Area Under the Curve (AUC) calculation of glucose and insulin
AN
Estimation of plasma glucose and insulin was done using oral glucose tolerance test
(OGTT) and AUC concentrations were estimated for plasma glucose and insulin in all
the groups of animals by using Tapezoidal rule. All the values are expressed as mean ±
M

SEM. *P≤0.05 compared to untreated control, †P≤0.05 compared to STZ.


D

Figure: 4. Gene expression studies in pancreas and adipose tissues


Gene expression studies were performed in the pancreas and adipose tissues collected
TE

at end of the experiment. In pancreas, the percentage of change in the expression of


genes: 5 -LOX, 12 - LOX, COX-2 and Nf-kB were studied using semi quantitative
EP

polymerized chain reaction (PCR) method. The equality of sample loading was
confirmed by beta actin gene expression. Quantification of genes was done by Major
C

Science image analysis software. In adipose tissue the percentage of change in the
expression of genes: 12 - LOX, LPCLN2 and Nf-kB were studied using semi quantitative
AC

polymerized chain reaction (PCR) method. The equality of sample loading was
confirmed by beta actin gene expression. Quantification of genes was done by Major
Science image analysis software. All the values are expressed as mean ± SEM.
*P≤0.05 compared to untreated control, †P≤0.05 compared to STZ.

Table. 1: Insulin sensitivity index (ISI)

20
ACCEPTED MANUSCRIPT

ISI was computed by using HOMA-IR, QUICKI, Matsuda and Belfiore assessments.
Homeostatic model assessment was used to assess the insulin resistance whereas rest
all QUICKI (Quantitative insulin check index), Matsuda, Belfiore indices were used to
assess the insulin sensitivity. All the values are expressed as mean ± SEM. *P≤0.05
compared to untreated control, †P≤0.05 compared to STZ.

PT
Table. 2: Sequences of gene primers used in the semi quantitative PCR studies.

RI
Table 3. Concentrations of various antioxidants in tissue samples of various groups of
animals studied.

U SC
AN
M
D
TE
C EP
AC

21
ACCEPTED MANUSCRIPT

PT
RI
U SC
AN
M
D
TE
EP
C
AC

22
ACCEPTED MANUSCRIPT

PT
RI
U SC
AN
M
D
TE
EP
C
AC

23
ACCEPTED MANUSCRIPT

PT
RI
U SC
AN
M
D
TE
EP
C
AC

24
ACCEPTED MANUSCRIPT

PT
RI
U SC
AN
M
D
TE
C EP
AC

HOMA - IR QUICKI Matsuda Belfiore

Control 0.83 ± 0.04 0.30 ± 0.002 3.94 ± 0.14 1±0

STZ 4.89 ± 0.2 0.25 ± 0.001 1.02 ± 0.01 0.29 ± 0.006

25
ACCEPTED MANUSCRIPT

AA 0.82 ± 0.03 0.30 ± 0.001 3.95 ± 0.24 1.02 ± 0.008

AA + STZ 1.73 ± 0.02 0.28 ± 0.005 2.28 ± 0.07 0.65 ± 0.032

PT
Table. 1

RI
U SC
AN
M
D
TE
C EP

S. No Genes Forward Reverse Product


AC

Size

1 P65 Nf-kB 5’-CCTAGCTTTCTCTGAACTGCAAA-3’ 5’- GGGTCAGAGGCCAATAGAGA-3’ 71 bp

2 5-LOX 5'-GTGTCTGAGGTGTTCGGTA-3' 5’-AGTGTTGATGGCAATGGT-3’ 105 bp

3 12-LOX 5’-GGGCCACTGCAGTTCGTGA-3’ 5’-CGGCCTCTGCGCTCATC-3’ 120 bp

26
ACCEPTED MANUSCRIPT

4 LPCLN2 5’- 5’- 557BP


Nitric Oxide LPO Catalase
AGTAGGATCCCAGGACTCAACTCAGAACT
SOD GPX
AGTACTCGAGTCAGTTGTCAATGCATT
GST
Control TG-3’ 0.65±0.10 0.19±0.03 3085±178
GGTC-3’ 101.50±13.2 3781±771 61.96±1.27
STZ 0.81±0.50* 0.84±0.04* 3478±106* 93.73±7.78* 3659±744* 70.53±3.00*
PLASMA
5 COX-2 5'-TGCATGTGGCTGTGGATGTCATCAA-3' 5’-CACTAAGACAGACCCGTCATCTCCA-
AA 0.41±0.41 0.27±0.03 2739±202 99.23±9.32 5051±537 583 bp
61.46±2.40

PT
† 3’ † † †
AA + STZ 0.78±0.08 0.41±0.02 2848±208 102.33±5.89 4144±618 61.23±2.23
6 β Control
Actin 0.087±0.06 0.43±0.02
5’-TGAGCGCAAGTACTCTGTGTGGAT-3’ 3662±374 108.88±6.75 4193±492
5’-TAGAAGCATTTGCGGTGCACGATG- 42.14±1.68
617 bp

RI
STZ 1.36±0.06* 1.00±0.03* 3’
4412±276 101.35±8.8* 4281±742 62.44±3.07*

U SC
AN
Table. 2
M
D
TE
C EP
AC

27
ACCEPTED MANUSCRIPT

PANCREAS AA 0.71±0.05 0.33±0.02 3639±310 97.75±10.35 4070±710 52.24±1.83


AA + STZ † † † † † †
0.94±0.07 0.51±0.04 3979±296 111.06±10.8 4022±586 50.58±1.82
Control 0.96±0.08 0.41±0.02 2880±353 71.52±5.38 3100±472 41.40±2.83
STZ 2.23±0.07* 1.24±0.04* 2386±167 22.27±4.17* 2155±313* 32.25±1.98*
LIVER
AA 0.72±0.04* 0.33±0.02 2842±154 78.98±5.01 3272±400 44.95±2.03

PT
† † † † †
AA + STZ 1.11±0.08 0.58±0.05 2661±208 53.02±9.29 2840±440 44.69±2.52
Control 1.25±0.09 0.73±0.08 2786±248 69.23±6.45 6297±102 40.96±2.81

RI
STZ 2.36±0.08* 1.95±0.06* 4172±521* 48.64±6.20* 4810±202* 31.60±5.71*
ADIPOSE
AA 0.59±0.05* 0.93±0.07 2040±207 67.02±4.03 6040±748 31.48±2.12

SC
AA + STZ † † †
1.26±0.09 1.40±0.04 2955±394 62.86±14.8 6788±130 40.74±4.14

U
AN
Table. 3
M
D
TE
C EP
AC

28
ACCEPTED MANUSCRIPT

Amelioration of streptozotocin-induced type 2 diabetes mellitus in Wistar rats by


arachidonic acid

Naveen KV Gundala1, Vegi G M Naidu 2, Undurti N Das1, 3


1
BioScience Research Centre, Department of Medicine, Gayatri Vidya Parishad

PT
Hospital, GVP College of Engineering Campus, Visakhapatnam-530048, India;
2
National Institute of Pharmaceutical Education and Research, Guwahati, India;

RI
3
UND Life Sciences, 2221 NW 5th St, Battle Ground, WA 98604, USA.
(Correspondence to: Undurti N Das at undurti@hotmil.com)

SC
Conflict of interest: None

U
AN
M
D
TE
C EP
AC