You are on page 1of 2

>NC_011137.

1:5899-7440 Homo sapiens neanderthalensis mitochondrion,


complete genome
ATGTTCGCCGACCGTTGACTATTCTCTACAAACCACAAAGACATTGGAACACTATACCTACTATTCGGCG
CATGAGCTGGAGTCCTAGGCACAGCTCTAAGCCTCCTTATTCGAGCCGAACTGGGCCAGCCAGGCAACCT
TCTAGGTAACGACCACATCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTA
ATACCCATCATAATCGGGGGCTTTGGCAACTGACTAGTTCCCTTAATAATCGGTGCCCCCGATATGGCGT
TTCCCCGCATAAACAATATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGCTCGCATCTGCTAT
AGTGGAAGCCGGCGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAGCAGGGAACTACTCCCACCCTGGA
GCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAGCAGGTGTCTCCTCTATCTTAGGGGCCATCAATT
TCATCACAACAATTATTAATATAAAACCCCCTGCCATAACCCAATACCAAACGCCCCTTTTCGTCTGATC
CGTCCTAATCACAGCAGTCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTA
ACAGACCGCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAACACC
TATTCTGATTTTTCGGCCACCCTGAAGTTTATATTCTCATCCTACCAGGCTTCGGAATAATCTCCCATAT
TGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTATGGTCTGAGCTATGATATCAATT
GGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGAATAGACGTAGACACACGAGCAT
ATTTCACCTCCGCTACCATAATCATCGCTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACT
CCACGGAAGCAATATGAAATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTA
GGTGGCCTGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACGTTG
TAGCTCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCTTCATTCACTGATT
TCCCCTATTCTCCGGCTACACCCTAGACCAAACTTACGCCAAAATCCATTTCACTATCATATTCATCGGC
GTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCCTATCCGGAATGCCCCGACGTTACTCGGACTACC
CCGATGCATACACCACATGAAATATCCTATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATT
AATAATTTTCATGATTTGAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATA
AACCTGGAGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAGCCCGTATACATAAAATCTA
GA

>NC_001643.1:5321-6862 Pan troglodytes mitochondrion, complete genome


ATGTTCACCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTACTATTCGGTG
CATGAGCTGGAGTCCTGGGCACAGCCCTAAGTCTCCTTATTCGGGCTGAACTAGGCCAACCAGGCAACCT
CCTAGGTAATGACCACATCTACAATGTCATCGTCACAGCCCATGCATTCGTAATAATCTTCTTCATAGTA
ATGCCTATTATAATCGGAGGCTTTGGCAACTGGCTAGTTCCCTTGATAATTGGTGCCCCCGACATGGCAT
TCCCCCGCATAAACAACATAAGCTTCTGGCTCCTGCCCCCTTCTCTCCTACTTCTACTTGCATCTGCCAT
AGTAGAAGCCGGCGCGGGAACAGGTTGAACAGTCTACCCTCCCTTAGCGGGAAACTACTCGCATCCTGGA
GCCTCCGTAGACCTAACCATCTTCTCCTTACATCTGGCAGGCATCTCCTCTATCCTAGGAGCCATTAACT
TCATCACAACAATTATTAATATAAAACCTCCTGCCATGACCCAATACCAAACACCCCTCTTCGTCTGATC
CGTCCTAATCACAGCAGTCTTACTTCTCCTATCCCTCCCAGTCCTAGCTGCTGGCATCACCATACTATTG
ACAGATCGTAACCTCAACACTACCTTCTTCGACCCAGCCGGGGGAGGAGACCCTATTCTATATCAACACT
TATTCTGATTTTTTGGCCACCCCGAAGTTTATATTCTTATCCTACCAGGCTTCGGAATAATTTCCCACAT
TGTAACTTATTACTCCGGAAAAAAAGAACCATTTGGATATATAGGCATGGTTTGAGCTATAATATCAATT
GGCTTCCTAGGGTTTATCGTGTGAGCACACCATATATTTACAGTAGGGATAGACGTAGACACCCGAGCCT
ATTTCACCTCCGCTACCATAATCATTGCTATTCCTACCGGCGTCAAAGTATTCAGCTGACTCGCTACACT
TCACGGAAGCAATATGAAATGATCTGCCGCAGTACTCTGAGCCCTAGGGTTTATCTTTCTCTTCACCGTA
GGTGGCCTAACCGGCATTGTACTAGCAAACTCATCATTAGACATCGTGCTACACGACACATACTACGTCG
TAGCCCACTTCCACTACGTTCTATCAATAGGAGCTGTATTCGCCATCATAGGAGGCTTCATTCACTGATT
CCCCCTATTCTCAGGCTATACCCTAGACCAAACCTATGCCAAAATCCAATTTGCCATCATGTTCATTGGC
GTAAACCTAACCTTCTTCCCACAGCACTTCCTTGGCCTATCTGGGATGCCCCGACGTTACTCGGACTACC
CCGATGCATACACCACATGAAATGTCCTATCATCCGTAGGCTCATTTATCTCCCTGACAGCAGTAATATT
AATAATTTTCATGATTTGAGAAGCCTTTGCTTCAAAACGAAAAGTCCTAATAGTAGAAGAGCCCTCCGCA
AACCTGGAATGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAATCTA
GA

>NC_002084.1:1424-2960 Anopheles gambiae mitochondrion, complete genome


TCGCGACAATGATTATTTTCAACAAATCATAAGGATATTGGAACTTTATATTTTATTTTCGGAGCTTGAG
CTGGAATAGTAGGGACATCTTTAAGAATCCTAATTCGAGCTGAACTAGGACACCCTGGAGCATTTATTGG
AGACGATCAAATTTATAATGTAATCGTTACTGCTCATGCTTTTATTATAATTTTCTTTATAGTTATACCT
ATTATAATTGGAGGGTTTGGAAACTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCTTTTCCTC
GAATAAATAATATAAGATTTTGAATGCTTCCTCCTTCATTAACACTTTTAATTTCTAGTAGTATAGTAGA
AAACGGGGCTGGAACAGGATGAACTGTTTATCCTCCTCTATCTTCTGGAATTGCTCATGCTGGAGCTTCA
GTAGATTTAGCAATTTTTTCTCTTCATTTAGCAGGAATTTCTTCTATTTTAGGAGCAGTAAATTTTATTA
CAACAGTAATTAATATACGGTCTCCAGGAATTACATTAGATCGAATACCATTATTTGTTTGATCGGTAGT
TATTACAGCAGTATTATTATTATTATCATTACCAGTATTAGCAGGAGCTATTACTATATTATTAACTGAT
CGAAATTTAAATACATCTTTCTTTGATCCAGCAGGAGGAGGTGATCCAATTTTATATCAACACTTATTCT
GATTTTTTGGTCATCCAGAAGTATATATTTTAATTTTACCTGGATTCGGAATAATTTCGCATATTATTAC
TCAAGAAAGTGGAAAGAAGGAAACATTTGGAAACTTAGGAATAATCTATGCTATACTAGCAATTGGCTTA
CTTGGATTTATTGTTTGAGCTCATCATATATTTACAGTTGGAATAGACGTTGATACTCGAGCTTACTTTA
CATCAGCAACTATAATTATTGCTGTGCCAACTGGAATTAAGATTTTTAGTTGATTAGCTACATTACACGG
AACACAATTGACTTATAGCCCAGCTATATTGTGAGCATTTGGATTCGTTTTCTTATTTACAGTTGGTGGT
CTAACAGGAGTTGTACTAGCTAATTCATCTATTGATATTGTTCTTCACGATACTTATTATGTTGTTGCTC
ATTTCCATTATGTATTATCAATAGGAGCAGTATTTGCTATTATAGCAGGATTTGTACATTGATATCCATT
ATTAACTGGATTAACAATAAATCCAACTTGATTAAAAATTCAATTTTCTATTATATTTGTAGGAGTAAAT
TTAACATTTTTTCCTCAACATTTTTTAGGTTTAGCCGGAATACCTCGACGATATTCAGACTTTCCAGATA
GCTATTTAACATGAAATGTAGTTTCTTCTTTAGGTAGTACAATCTCATTATTCGCTATTTTATACTTTTT
ATTTATTATTTGAGAAAGTATAATCACTCAACGAACTCCAGCTTTCCCTATACAATTATCATCATCAATT
GAATGATACCATACCCTTCCTCCTGCAGAACATACTTATGCAGAGCTTCCTCTATTAACTAATAACT

>NC_002008.4:5349-6893 Canis lupus familiaris mitochondrion, complete


genome
ATGTTCATTAACCGATGACTGTTCTCCACTAATCACAAGGATATTGGTACTTTATACTTACTATTTGGAG
CATGAGCCGGTATAGTAGGCACTGCTTTGAGCCTCCTCATCCGAGCCGAACTAGGTCAGCCCGGTACTTT
ACTAGGTGACGATCAAATTTATAATGTCATCGTAACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTC
ATGCCCATCATAATTGGGGGCTTTGGAAACTGACTAGTGCCGTTAATAATTGGTGCTCCGGACATGGCAT
TCCCCCGAATAAATAACATGAGCTTCTGACTCCTTCCTCCATCCTTTCTTCTACTATTAGCATCTTCTAT
GGTAGAAGCAGGTGCAGGAACGGGATGAACCGTATACCCCCCACTGGCTGGCAATCTGGCCCATGCAGGA
GCATCCGTTGACCTTACAATTTTCTCCTTACACTTAGCCGGAGTCTCTTCTATTTTAGGGGCAATTAATT
TCATCACTACTATTATCAACATAAAACCCCCTGCAATATCCCAGTATCAAACTCCCCTGTTTGTATGATC
AGTACTAATTACAGCAGTTCTACTCTTACTATCCCTGCCTGTACTGGCTGCTGGAATTACAATACTTTTA
ACAGACCGGAATCTTAATACAACATTTTTTGATCCCGCTGGAGGAGGAGACCCTATCCTATATCAACACC
TATTCTGATTCTTCGGACATCCTGAAGTTTACATTCTTATCCTGCCCGGATTCGGAATAATTTCTCACAT
TGTCACTTACTACTCAGGGAAAAAAGAGCCTTTCGGTTATATAGGAATAGTATGAGCAATAATATCTATT
GGGTTTTTAGGCTTTATCGTATGAGCTCACCATATGTTTACCGTAGGAATAGATGTAGACACACGAGCGT
ACTTTACGTCCGCCACTATAATTATCGCTATTCCAACGGGAGTAAAAGTATTTAGTTGACTGGCAACACT
TCATGGAGGCAATATTAAATGATCTCCAGCTATGCTATGAGCTTTAGGGTTTATTTTCTTATTTACAGTA
GGCGGGTTAACAGGTATTGTCCTAGCTAATTCGTCCTTAGACATCGTTCTTCATGATACATATTATGTTG
TGGCTCATTTTCACTATGTGCTTTCAATAGGAGCAGTTTTTGCCATTATGGGAGGATTTGCCCACTGATT
CCCTTTATTCTCAGGTTATACTCTTAACGATACTTGAGCAAAGATTCACTTTACAATTATGTTTGTGGGA
GTAAATATAACTTTCTTCCCTCAACATTTCCTAGGTTTATCTGGAATACCTCGTCGATACTCTGACTACC
CAGATGCATATACTACCTGAAATACCGTCTCCTCTATAGGATCGTTTATCTCGCTTACAGCGGTGATGCT
TATAATTTTTATGATCTGGGAAGCCTTTGCATCCAAACGAGAAGTTGCTATAGTAGAACTTACTACAACT
AACATTGAGTGACTACATGGATGTCCCCCTCCATACCACACGTTCGAAGAACCTACATATGTGATCCAAA
AATAA