You are on page 1of 17

Fluorescent Protein Fusion Expression System

Box 1 | Product List Fluorescent Protein Vectors
Vector Name pmWasabi-C pmWasabi-N pmTFP1-C pmTFP1-N pLanRFP-C pLanRFP-N pLanYFP-C pLanYFP-N pmWasabi-C-Puro pmWasabi-N-Puro pmTFP1-C-Puro pmTFP1-N-Puro pLanRFP-C-Puro pLanRFP-N-Puro pLanYFP-C-Puro pLanYFP-N-Puro Cat. Number ABP-FP-WCNCS ABP-FP-WNNCS ABP-FP-TCNCS ABP-FP-TNNCS ABP-FP-RCNCS ABP-FP-RNNCS ABP-FP-YCNCS ABP-FP-YNNCS ABP-FP-WCNCS ABP-FP-WNNCS ABP-FP-TCNCS ABP-FP-TNNCS ABP-FP-RCNCS ABP-FP-RNNCS ABP-FP-YCNCS ABP-FP-YNNCS

Page
2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

MPORTANT NOTICE TO PURCHASER: These products may be subjects of pending U.S. and foreign patents. Allele Biotech grants academic/government research institutions a worldwide, non-exclusive, royalty-free, limited license to use this product for non-commercial life science research use only. Such license specifically prohibits the right to sell or otherwise transfer this product or its derivatives to a third party. Industry For-Profit Institutions: Institutions that wish to use this product are required to obtain a sub-licensing agreement from Allele Biotech. For more information please visit Fluorescent Protein Sublicense, or contact us via phone or email.

I

Vectors w/ Puromycin Resistance

or Research Use Only. Not for Diagnostic or Therapeutic Use. Purchase does not include or carry any right to resell or transfer this product either as a stand-alone product or as a component of another product. Any use of this product other than the permitted use without the express written authorization of Allele Biotech is strictly prohibited

F

Allele Biotech-Introducing Cost Effectiveness to Research

pmWasabi-CT (ABP-FP-WCNCS)
CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 mWasabi GFP ........ 653-1363 SV40 poly(A) Signal ........ 1529-1579 Ampicillin Resistance Gene ........ 2207-3067 pUC Origin ........ 3216-3858

C

Sequencing Primer: CMV-F and mWasabi-R(ABP-FP-WASRPRM)

Multiple Cloning Sites 541 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA R * L *
NheI

601 GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG T G S S N S V P Q A C G R L E A T M V S

BamHI

EcoRI

KpnI

HindIII

NotI

XhoI

661 CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC ATGAAGATCA AGCTGAAGAT >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1321 GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG TAA

pmWasabi-NT (ABP-FP-WNNCS)

CMV Promoter ........ 1-595 mWasabi GFP ........ 613-1320 Multiple Cloning Sites ........ 1321-1414 SV40 poly(A) Signal ........ 1560-1610 Ampicillin Resistance Gene ........ 2238-3098 pUC Origin ........ 3247-3889

N

Sequencing Primer: mWasabi-F(ABP-FP-WASFPRM) and SV40pA-R

601 CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC 661 ATGAAGATCA AGCTGAAGAT GGAGGGCAAC GTGAATGGCC ACGCCTTCGT GATCGAGGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 ACCGTTTACG AGATCGCCGT GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG
T S V G Y L E R I S A R XhoI V V A G R S N S S N T S D V KpnI G P M S D R E Q L A Y C K G NotI R

1321 TCCGGACTCA GATCTCGAGT CGGATCCTCG AATTCGGTAC CCTCTAGACA AGCTTGCGGC CGCTAA

BglII

BamH1

EcoRI

HindIII

Multiple Cloning Sites

pmTFP1-CT (ABP-FP-TCNCS)

CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 mTFP1 TFP ........ 653-1363 SV40 poly(A) Signal ........ 1529-1579 Ampicillin Resistance Gene ........ 2207-3067 pUC Origin ........ 3216-3858

C

Sequencing Primer: CMV-F and mTFP1-R(ABP-FP-TFPRPRM)

Multiple Cloning Sites 541 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA 601 GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG 661 CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC ATGAAGATCA AGCTGAAGAT >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 CATCGAGATC CTGAACCACG ACAAGGACTA CAACAAGGTG ACCGTTTACG AGAGCGCCGT 1321 GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG TAA

pmTFP1-NT (ABP-FP-TNNCS)

CMV Promoter ........ 1-595 mTFP1 TFP ........ 613-1320 Multiple Cloning Sites ........ 1321-1414 SV40 poly(A) Signal ........ 1560-1610 Ampicillin Resistance Gene ........ 2238-3098 pUC Origin ........ 3247-3889

N

Sequencing Primer: mTFP1-F(ABP-FP-TFPFPRM) and SV40pA-R

601 CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC 661 ATGAAGATCA AGCTGAAGAT GGAGGGCAAC GTGAATGGCC ACGCCTTCGT GATCGAGGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 ACCGTTTACG AGAGCGCCGT GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG 1321 TCCGGACTCA GATCTCGAGT CGGATCCTCG AATTCGGTAC CCTCTAGACA AGCTTGCGGC 1381 CGCTAA Multiple Cloning Sites

pLanRFP-CT (ABP-FP-RCNCS)

CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 LanRFP ........ 653-1366 SV40 poly(A) Signal ........ 1532-1582 Ampicillin Resistance Gene ........ 2210-3070 pUC Origin ........ 3219-3861

C

Sequencing Primer: CMV-F and LanRFP-R(ABP-FP-RFPRPRM)

Multiple Cloning Sites 541 601 661 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCCCTCT CCCAGCAACC CACGATTTAC ACATCTCCGG >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 CGTGTTCCGC AAGGTGGAAC TCAAGCACAC CAAGACTGAG CTCAACTTCA AGCAGTGGCA 1321 GAAGGCATTC CAGGACATCG CCGGCATGGA CGAGCTGTAC AAGTAA

pLanRFP-NT (ABP-FP-RNNCS)

CMV Promoter ........ 1-595 LanRFP ........ 613-1323 Multiple Cloning Sites ........ 1324-1377 SV40 poly(A) Signal ........ 1554-1604 Ampicillin Resistance Gene ........ 2232-3092 pUC Origin ........ 3241-3883

N

Sequencing Primer: LanRFP-F(ABP-FP-RFPFPRM) and SV40pA-R

601 661 1261 1321

CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCCCTCT CCCAGCAACC CACGATTTAC ACATCTCCGG CTCAATCAAT GGACATGAGT TTGACTTGGA AGGCAGTGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> CTCAACTTCA AGCAGTGGCA GAAGGCATTC CAGGACATCG CCGGCATGGA CGAGCTGTAC AAGAGATCTC GAGTCGGATC CTCGAATTCG GTACCCTCTA GACAAGCTTG CGGCCGCTAA Multiple Cloning Sites

pLanYFP-CT (ABP-FP-YCNCS)

CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 LanYFP ........ 653-1363 SV40 poly(A) Signal ........ 1529-1579 Ampicillin Resistance Gene ........ 2207-3067 pUC Origin ........ 3216-3858

C

Sequencing Primer: CMV-F and LanYFP-R(ABP-FP-YFPRPRM)

Multiple Cloning Sites 541 601 661 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCTCTCT CCCAGCGACA CATGAGTTAC ACATCTTTGG >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 GTTCCGTAAG ACGGAGCTCA AGCACTCCAA GACCGAGCTC AACTTCAAGG AGTGGCAAAA 1321 GGCCTTTACC GATGTGATGG GCATGGACGA GCTGTACAAG TAA

pLanYFP-NT (ABP-FP-YNNCS)

CMV Promoter ........ 1-595 LanYFP ........ 613-1323 Multiple Cloning Sites ........ 1324-1377 SV40 poly(A) Signal ........ 1554-1604 Ampicillin Resistance Gene ........ 2232-3092 pUC Origin ........ 3241-3883

N

Sequencing Primer: LanYFP-F(ABP-FP-YFPFPRM) and SV40pA-R

661 721

CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCTCTCT CCCAGCGACA CATGAGTTAC ACATCTTTGG CTCCTTCAAC GGTGTGGACT TTGACATGGT GGGTCGTGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1321 AACTTCAAGG AGTGGCAAAA GGCCTTTACC GATGTGATGG GCATGGACGA GCTGTACAAG 1381 AGATCTCGAG TCGGATCCTC GAATTCGGTA CCCTCTAGAC AAGCTTGCGG CCGCTAA Multiple Cloning Sites

pmWasabi-CT-PuroR (ABP-FP-WCNCSP)
CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 mWasabi GFP ........ 653-1363 SV40 poly(A) Signal ........ 1529-1579 PGK Promoter ........ 1657-2159 Puromycin Resistance Gene ........ 2242-2841 SV40 poly(A) signal ........ 2965-3191 Ampicillin Resistance Gene ........ 3841-4701 pUC Origin ........ 4850-5492

C

Sequencing Primer: CMV-F and mWasabi-R(ABP-FP-WASRPRM)

Multiple Cloning Sites 541 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA 601 GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG 661 CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC ATGAAGATCA AGCTGAAGAT >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 CATCGAGATC CTGAACCACG ACAAGGACTA CAACAAGGTG ACCGTTTACG AGATCGCCGT 1321 GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG TAA

pmWasabi-NT-PuroR (ABP-FP-WNNCSP)
CMV Promoter ........ 1-595 mWasabi GFP ........ 613-1320 Multiple Cloning Sites ........ 1321-1414 SV40 poly(A) Signal ........ 1560-1610 PGK Promoter ........ 1688-2190 Puromycin Resistance Gene ........ 2273-2872 SV40 poly(A) signal ........ 2996-3222 Ampicillin Resistance Gene ........ 3872-4732 pUC Origin ........ 4881-5523

N

Sequencing Primer: mWasabi-F(ABP-FP-WASFPRM)

601 CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC 661 ATGAAGATCA AGCTGAAGAT GGAGGGCAAC GTGAATGGCC ACGCCTTCGT GATCGAGGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 ACCGTTTACG AGATCGCCGT GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG
T S V G Y L E R I S A R XhoI V V A G R S N S S N T S D V KpnI G P M S D R E Q L A Y C K G NotI R

1321 TCCGGACTCA GATCTCGAGT CGGATCCTCG AATTCGGTAC CCTCTAGACA AGCTTGCGGC CGCTAA

BglII

BamH1

EcoRI

HindIII

Multiple Cloning Sites

pmTFP1-CT-PuroR (ABP-FP-TCNCSP )
CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 mTFP1 TFP ........ 653-1363 SV40 poly(A) Signal ........ 1394-1620 PGK Promoter ........ 1621-2123 Puromycin Resistance Gene ........ 2206-2805 SV40 poly(A) signal ........ 2929-3155 Ampicillin Resistance Gene ........ 3560-4420 pUC Origin ........ 4575-5194 Sequencing Primer: CMV-F and mTFP1-R(ABP-FP-TFPRPRM)

Multiple Cloning Sites 587 647 707 1247 1307 ATCCGCTAGCTCTAGACTGGATCCTCGAATTCGGTACCTCAAGCTTGCGGCCGCCTCGAG NheI XbaI BamHI EcoRI KpnI HindIII NotI XhoI GCCACCATGGTGAGCAAGGGCGAGGAGACCACAATGGGCGTAATCAAGCCCGACATGAAG ATCAAGCTGAAGATGGAGGGCAACGTGAATGGCCACGCCTTCGTGATCGAGGGCGAGGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> TTTGTGGACCACCGCATCGAGATCCTGAACCACGACAAGGACTACAACAAGGTGACCGTT TACGAGAGCGCCGTGGCCCGCAACTCCACCGACGGCATGGACGAGCTGTACAAGTAA

pmTFP1-NT-PuroR (ABP-FP-TNNCSP)
CMV Promoter ........ 1-595 mTFP1 TFP ........ 613-1320 Multiple Cloning Sites ........ 1321-1414 SV40 poly(A) Signal ........ 1560-1610 PGK Promoter ........ 1688-2190 Puromycin Resistance Gene ........ 2273-2872 SV40 poly(A) signal ........ 2996-3222 Ampicillin Resistance Gene ........ 3872-4732 pUC Origin ........ 4881-5523 N

Sequencing Primer: mTFP1-F(ABP-FP-TFPFPRM)

601 CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGACCACAA TGGGCGTAAT CAAGCCCGAC 661 ATGAAGATCA AGCTGAAGAT GGAGGGCAAC GTGAATGGCC ACGCCTTCGT GATCGAGGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 ACCGTTTACG AGAGCGCCGT GGCCCGCAAC TCCACCGACG GCATGGACGA GCTGTACAAG 1321 TCCGGACTCA GATCTCGAGT CGGATCCTCG AATTCGGTAC CCTCTAGACA AGCTTGCGGC 1381 CGCTAA Multiple Cloning Sites

pLanRFP-CT-PuroR (ABP-FP-RCNCSP)
CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 LanRFP........ 653-1363 SV40 poly(A) Signal ........ 1532-1582 PGK Promoter ........ 1660-2162 Puromycin Resistance Gene ........ 2245-2844 SV40 poly(A) signal ........ 2968-3194 Ampicillin Resistance Gene ........ 3844-4704 pUC Origin ........ 4853-5495 C

Sequencing Primer: CMV-F and LanRFP-R(ABP-FP-RFPRPRM)

Multiple Cloning Sites 541 601 661 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCCCTCT CCCAGCAACC CACGATTTAC ACATCTCCGG >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 CGTGTTCCGC AAGGTGGAAC TCAAGCACAC CAAGACTGAG CTCAACTTCA AGCAGTGGCA 1321 GAAGGCATTC CAGGACATCG CCGGCATGGA CGAGCTGTAC AAGTAA

pLanRFP-NT-PuroR (ABP-FP-RNNCSP)
CMV Promoter ........ 1-595 LanRFP ........ 613-1323 Multiple Cloning Sites ........ 1324-1377 SV40 poly(A) Signal ........ 1554-1604 PGK Promoter ........ 1682-2184 Puromycin Resistance Gene ........ 2267-2866 SV40 poly(A) signal ........ 2990-3216 Ampicillin Resistance Gene ........ 3866-4726 pUC Origin ........ 4875-5517 N

Sequencing Primer: LanRFP-F(ABP-FP-RFPFPRM)

601 661 1261 1321

CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCCCTCT CCCAGCAACC CACGATTTAC ACATCTCCGG CTCAATCAAT GGACATGAGT TTGACTTGGA AGGCAGTGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> CTCAACTTCA AGCAGTGGCA GAAGGCATTC CAGGACATCG CCGGCATGGA CGAGCTGTAC AAGAGATCTC GAGTCGGATC CTCGAATTCG GTACCCTCTA GACAAGCTTG CGGCCGCTAA Multiple Cloning Sites

pLanYFP-CT-PuroR (ABP-FP-YCNCSP)
CMV Promoter ........ 1-589 Multiple Cloning Sites ........ 591-646 LanYFP ........ 653-1363 SV40 poly(A) Signal ........ 1529-1579 PGK Promoter ........ 1657-2159 Puromycin Resistance Gene ........ 2242-2841 SV40 poly(A) signal ........ 2965-3191 Ampicillin Resistance Gene ........ 3841-4701 pUC Origin ........ 4850-5492 C

Sequencing Primer: CMV-F and LanYFP-R(ABP-FP-YFPRPRM)

Multiple Cloning Sites 541 601 661 ACGGTGGGAG GTCTATATAA GCAGAGCTGG TTTAGTGAAC CGTCAGATCC GCTAGCTCTA GACTGGATCC TCGAATTCGG TACCTCAAGC TTGCGGCCGC CTCGAGGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCTCTCT CCCAGCGACA CATGAGTTAC ACATCTTTGG >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> 1261 GTTCCGTAAG ACGGAGCTCA AGCACTCCAA GACCGAGCTC AACTTCAAGG AGTGGCAAAA 1321 GGCCTTTACC GATGTGATGG GCATGGACGA GCTGTACAAG TAA

pLanYFP-NT-PuroR (ABP-FP-YNNCSP)
CMV Promoter ........ 1-595 LanYFP ........ 613-1323 Multiple Cloning Sites ........ 1324-1377 SV40 poly(A) Signal ........ 1554-1604 PGK Promoter ........ 1682-2184 Puromycin Resistance Gene ........ 2267-2866 SV40 poly(A) signal ........ 2990-3216 Ampicillin Resistance Gene ........ 3866-4726 pUC Origin ........ 4875-5517 N

Sequencing Primer: LanYFP-F(ABP-FP-YFPFPRM)

661 721

CCGGTCGCCA CCATGGTGAG CAAGGGCGAG GAGGATAACA TGGCCTCTCT CCCAGCGACA CATGAGTTAC ACATCTTTGG CTCCTTCAAC GGTGTGGACT TTGACATGGT GGGTCGTGGC >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>

1321 AACTTCAAGG AGTGGCAAAA GGCCTTTACC GATGTGATGG GCATGGACGA GCTGTACAAG 1381 AGATCTCGAG TCGGATCCTC GAATTCGGTA CCCTCTAGAC AAGCTTGCGG CCGCTAA Multiple Cloning Sites