You are on page 1of 12

Ekspresi dan purifikasi …(Whinie dkk)

Ekspresi dan Purifikasi Protein Rekombinan Non-Struktural


NS1 Virus Dengue Serotipe 1 Strain Indonesia Pada Pichia Pastoris

C. S. Whinie Lestari1, Vanny Narita2, Tjahjani Mirawati Soediro3,


Agus Sjarurachman3
1
Puslitbang Biomedis dan Teknologi Dasar Kesehatan, Balitbangkes, Kemenkes
2
BPPT, Kemenristek, 3Fakultas Kedokteran Universitas Indonesia
Email: whinielestari@yahoo.com

Abstract
Dengue infection remains a public health problem in Indonesia. In the framework of the independence of
the national product, pursued research and development of raw materials that can be used for diagnostic kit
and vaccine candidates. The objective of this study was to express and purify recombinant proteins non-
structural NS1 dengue virus serotype 1 (DENV-1) of Indonesia strain (915 846) in Pichia pastoris expression
system with “halal” system that can be used for the development of diagnostic kits and vaccines. The dengue
virus serotype 1 strain Indonesia (915846) was used to construct the NS1 DENV-1 gene by PCR. Then NS1
DENV-1 gene cloned into the vector pPICZαB and transformed into Pichia pastoris yeast cells, then verified
with sequencing. Recombinant protein NS1 DENV-1 was secreted expression in P. pastoris. Characterization of
antigenicity was did by ELISA, Western Blot and purified by the method of metal-chelating affinity
chromatographic (MCAC) column. The recombinant protein with a size of 45 kDa secreted into the supernatant
of P. pastoris with methanol induction and purified. The recombinant protein can bind to monoclonal antibodies
and serum of patients infected with dengue virus serotype 1. These results indicate that the recombinant protein
NS1 DENV-1 strain Indonesia (915 846) can be produced efficiently in P. pastoris secreted expression system is
halal and still functional as an antigen that can be used for the development of diagnostic kits and vaccines.

Keywords: NS1, dengue virus, serotype 1, Indonesia strain, P. pastoris.

Abstrak
Infeksi dengue masih menjadi masalah kesehatan masyarakat di Indonesia. Dalam rangka kemandirian
produk nasional, diupayakan penelitian dan pengembangan bahan baku yang dapat digunakan untuk kit
diagnostik dan kandidat vaksin. Tujuan penelitian ini adalah mengekspresikan dan mempurifikasi protein
rekombinan non-struktural NS1 virus dengue serotipe 1 (DENV-1) strain Indonesia (915846) di sistem ekspresi
Pichia pastoris dengan sistem yang halal yang dapat digunakan untuk pengembangan kit diagnostik dan vaksin.
Virus dengue serotipe 1 strain Indonesia (915846) digunakan untuk membuat konstruksi gen NS1 dengan
metode PCR. Kemudian produknya di cloning ke vektor pPICZαB, ditransformasi ke sel yeast Pichia pastoris
kemudian diverifikasi dengan sekuensing. Selanjutnya protein rekombinan dilakukan ekspresi secara sekresi di
P. pastoris, uji antigenisitas dengan metode ELISA, Western Blot dan purifikasi dengan metode metal-
chelating affinity chromatographic (MCAC) column. Protein rekombinan dengan ukuran 45 kDa disekresikan ke
supernatan P. pastoris dengan induksi methanol dan dipurifikasi. Protein rekombinan tersebut dapat mengikat
antibodi monoklonal dengue dan serum pasien terinfeksi dengue serotipe 1. Hasil ini menunjukkan bahwa
protein rekombinan NS1 DENV-1 strain Indonesia (915846) dapat diproduksi secara efisien di sistem ekspresi
tersekresi P. pastoris yang halal dan masih fungsional sebagai antigen yang dapat digunakan untuk
pengembangan kit diagnostik dan vaksin.

Kata kunci: NS1, virus dengue, serotipe 1, strain Indonesia, P. pastoris.

(DENV-1, DENV-2, DENV-3, dan


Pendahuluan
DENV-4).1,2 Infeksi dengue masih menjadi
Virus dengue (DENV) ditularkan ke salah satu masalah kesehatan utama di
manusia melalui gigitan nyamuk yang dunia terutama di daerah tropis dan
telah terinfeksi terutama jenis nyamuk subtropis di kawasan Asia Tenggara,
Aedes aegypti dan Aedes albopictus. Virus Pasifik dan Amerika. World Health
dengue termasuk dalam genus Flavivirus, Organization (WHO) memperkirakan
famili Flaviviridae, terdiri dari 4 serotipe infeksi dengue di dunia berkisar 50-100

121
juta setiap tahun pada lebih dari 100 dan juga sebagai reagen untuk diagnosis
negara endemis dan hampir setengah dari cepat dengue.9-12 Epitop NS1 DENV yang
penduduk dunia tinggal di negara yang bersifat imunogenik berperan sebagai
endemis infeksi dengue.3-6 Pengendalian target antibodi untuk pengembangan
infeksi dengue merupakan salah satu vaksin maupun kit diagnostik cepat telah
program prioritas utama di bidang banyak dilaporkan.13-18 Studi
kesehatan di Indonesia. Rencana strategis pengembangan vaksin protein rekombinan
(renstra) Kementerian Kesehatan tahun NS1 pada beberapa penelitian
2015-2019 sasaran ke 2 adalah menunjukkan bahwa NS1 sangat
menurunnya angka kesakitan akibat imunogenik serta dapat menimbulkan
penyakit menular dengan salah satunya antibodi protektif dengan aktivasi
yaitu angka kesakitan DBD menjadi komplemen untuk membunuh target sel
kurang dari 49 per 100.000 penduduk, yang terinfeksi. 19-20 Protein NS1 efektif
sehingga diperlukan pendekatan baru tanpa menimbulkan risiko fenomena
untuk memecahkan masalah tersebut.7 antibody dependent enhancement (ADE)
yang mungkin disebabkan reaksi antibodi
Virus dengue merupakan virus
non netralisir terhadap protein struktural E
positive sense RNA rantai tunggal, dengan
virus. Protein NS1 dapat menginduksi
panjang genom 10.600 nukleotida,
kekebalan seluler dan humoral jangka
mengkode 3.400 asam amino yang terdiri
panjang.8,19-20
dari 3 protein struktural dan 7 protein non
struktural. Protein Non Struktural 1 terdiri Penelitian ini bertujuan untuk
dari 352 asam amino dengan berat molekul memproduksi protein rekombinan NS1
40-46 kDa. Ekspresi NS1 dalam pejamu virus dengue serotipe 1 (DENV-1) strain
dapat terikat membran sel atau Indonesia (915846) dengan sistem ekspresi
disekresikan dalam sirkulasi dan keduanya tersekresi di Pichia pastoris dengan sistem
dapat berikatan dengan antibodi spesifik yang halal yang dapat digunakan untuk
dan selanjutnya dapat mengaktivasi pengembangan vaksin. Sistem halal yang
komplemen. NS1 ditemukan bersirkulasi dimaksudkan adalah menggunakan bahan-
di serum pasien terinfeksi DENV, bahan reagensia yang bebas porcine,
menunjukkan bahwa sekresi NS1 dimulai sejak dilakukan isolasi virus
merupakan hal penting pada infeksi dengue menggunakan sel C6/36 hingga
flavivirus di tubuh manusia.8 Glikoprotein sistem ekspresi protein rekombinan. Isu
NS1 ada di seluruh flavivirus dan berperan halal merupakan salah satu isu penting
penting untuk replikasi dan viabilitas untuk negara Indonesia dan negara lain
virus. NS1 intraseluler terlibat pada fase yang mayoritas penduduknya umat
awal replikasi virus dengan retensinya muslim. Protein NS1 dengue yang
pada organel intraseluler dari sel terinfeksi dihasilkan juga dapat dimanfaatkan untuk
dan kemampuannya berinteraksi dengan pengembangan kit diagnostik dengue.
membran. Namun NS1 intraseluler yang Penelitian ini telah mendapat persetujuan
berhadapan dengan lumen retikulum etik (Ethical Approval) dari Komisi Etik
endotelial mungkin berperan secara tidak Penelitian Kesehatan Badan Litbang
langsung pada proses replikasi. Dimerisasi Kesehatan dengan nomer: KE.03.02/
juga merupakan prasyarat protein NS1 EC/4537 /2009, tanggal 24 Juni 2009 dan
keluar melalui jalur sekresi menuju nomer: KE.03.02/EC/5025/2010 tanggal
membran plasma, dan berdiam sebagai 17 Juni 2010.
protein virus yang unik pada permukaan
sel terinfeksi.9
NS1 digunakan sebagai antigen yang
penting bagi pengembangan vaksin dengue

122 Jurnal Biotek Medisiana Indonesia . Vol.5.2.2016:121-132


Ekspresi dan purifikasi …(Whinie dkk)

Metode TAGTCAACT3’ dengan posisi nukleotida


2409–2430 dan reverse primer:
Penyiapan virus dengue serotipe 1
5’TCTAGAGCTGCAGAGACCATTGAC
(DENV-1) strain Indonesia (915846).
TT3’ dengan posisi nukleotida 3446 -
Sel monolayer C6/36 (Cloned Sing’s 3464. Kedua primer dirancang memiliki
Aedes albopictus line) American type cell situs restriksi Not1 pada primer forward
line collection (ATCC, CRL-1560) pada dan Xba1 pada primer reverse. Protokol
media MEM dengan Earle’s salts dan L- PCR menggunakan enzim Platinum Taq
glutamin (Gibco cat no. 61100-061) Polymerase (Invitrogen cat no. 10966-
ditambah 2% fetal bovin serum (Gibco cat. 018). Campuran reaksi yang digunakan
no. 10100-139) diinfeksikan dengan adalah: 5 μl 10x PCR buffer,-Mg, 1 μl 10
DENV-1 strain Indonesia (915846). mM dNTP mix, 1,5 μl 50 mM MgCl2, 1 μl
Setelah diinkubasi pada suhu 28°C selama 10 µM primer forward, 1 μl 10 µM primer
1 minggu, sel kultur dipanen dan RNA reverse, 0,2 μl enzim Platinum Taq
virus diekstraksi menggunakan QIAamp® Polymerase (2 unit) dan 1 μl cDNA (400
viral RNA isolation kits (Qiagen cat. no. ng), kemudian ditambahkan air sampai
52906). Prosedur isolasi RNA mengikuti volume 50 μl. Reaksi PCR yang digunakan
panduan dari protokol kit yang digunakan. adalah denaturasi awal 94oC selama 2
menit; 35 siklus yang terdiri dari
Sintesis cDNA denaturasi pada 94oC selama 30 detik,
cDNA virus dengue disintesis annealing pada 55oC selama 30 detik, dan
menggunakan SuperScript® VILO TM ekstensi 72 oC selama 1 menit. Amplifikasi
cDNA Synthesis Kit (Invitrogen cat. No dilakukan pada mesin Thermal Cycler
11754-050). Komposisi reaksi mengikuti (Biorad C1000). Produk PCR selanjutnya
panduan yang terdapat pada protokol, terdiri dipurifikasi menggunakan Wizard SV Gel
dari 4 μl 5x VILO reaction mix and PCR Clean-up system (Promega cat.
(merupakan campuran yang sudah tersedia no. A9281) mengikuti panduan yang
di dalam kit, terdiri dari random primers, terdapat pada protokol. Gen sisipan NS1
MgCL2, dNTPs didalam dapar yang telah DENV-1 dan plasmid pPICZαB yang telah
diformulasi optimal oleh produsen), 2 μl disiapkan sebelumnya dipotong
10X SuperScript® enzyme mix (merupakan menggunakan enzym restriksi endonu-
campuran yang sudah tersedia didalam kit klease Not1 (Thermo scientific cat. no. ER
yang mengandung SuperScript®III RT , 0591) dan Xba1 (Thermo scientific cat.
RNaseOUT TM Recombinant Ribonuclease No. ER 0681) yang ditambahkan pada
Inhibitor dan sejumlah protein pembantu primer pengamplifikasi gen sisipan.
yang sesuai), 5 μl RNA (sampai 2,5 μg), Prosedur kerja dilakukan sesuai protokol
tambahkan DEPC-treated water sampai enzim restriksi pada kit yang telah
volume 20 μl. Kemudian diinkubasi di dioptimasi. Pemotongan dilakukan dengan
mesin thermal cycler (Biorad C1000) pada campuran reaksi berupa 600 ng DNA
suhu 25oC selama 10 menit, 42oC selama (masing-masing gen sisipan atau vektor)
60 menit dan penghentian reaksi pada suhu ditambahkan 1 μl dapar reaksi 3, 0,2 μl
85oC selama 5 menit. Not I (10 U/µl) dan DW hingga volume
akhir 10 µl. Campuran kemudian
Konstruksi plasmid rekombinan diinkubasi pada suhu 37 oC selama 1,5 jam
(pPICD1NS1) dan reaksi dihentikan melalui pemanasan
pada suhu 65 oC selama 10 menit. Hal
Amplifikasi gen NS1 DENV-1 strain yang sama juga dilakukan untuk
Indonesia (915846) dengan teknik PCR pemotongan enzim ke 2 yaitu dengan
menggunakan forward primer: menambahkan 1 µl dapar reaksi 2, 0,3 µl
5’GCGGCCGCACGACTCGGGATGTG Xba I (10U/ µl) dan DW hingga volume

123
akhir 10 ul. Gen NS1 dan plasmid Zeocin (100 µg/ml) pada suhu 30°C
pPICZαB yang telah dipotong dengan selama 3-5 hari. Untuk isolasi multicopy
enzim restriksi, masing-masing dilakukan recombinant, hasil transformasi diinkubasi
purifikasi menggunakan Wizard SV Gel pada agar YPDS yang mengandung 500
and PCR Clean-up system kit (Promega µg/ml Zeocin. Selanjutnya hasil
cat. no. A9281). Prosedur kerja sesuai transformasi dianalisa dengan PCR
dengan protokol pada kit. Gen NS1 menggunakan primer spesifik NS1, primer
disisipkan ke vektor pPICZαB dengan cara vektor AOX1 untuk mengetahui gen NS1
reaksi ligasi menggunakan enzim T4 DNA terintegrasi pada lokus alcohol oxidase
ligase (Invitrogen cat. No. 15224-017). promotor (AOX1) di kromosom P.
Prosedur ligasi dilakukan sebagai berikut: pastoris. Kemudian dilanjutkan dengan
perbandingan gen NS1 dengan plasmid penentuan fenotip yaitu dengan
PICZαB adalah 5:1. Reaksi dilakukan menumbuhkan koloni hasil transformasi di
dengan campuran 5x buffer T4 DNA replica-plate pada media minimal
ligase, 3 Unit enzim T4 DNA ligase dan methanol histidin (MMH) dan minimal
DW sampai volume total 30 µl. Reaksi dextrose histidin (MDH) dan diinkubasi
ligasi dilakukan pada suhu 16 oC selama pada 30°C selama 2-3 hari. Fenotip
16 jam. Ligasi berjalan melalui penyisipan methanol utilization-plus transformant
gen NS1 ke multiple cloning site plasmid (Mut+) adalah jika strain tumbuh dengan
pPICZαB di antara situs restriksi Not I dan normal pada kedua plate MMH dan MDH.
Xba I. Hasil ligase dipurifikasi Analisis dilanjutkan dengan sekuensing
menggunakan Wizard SV Gel and PCR untuk mengetahui susunan asam nukleat
Clean-up system kit (Promega cat. no. dan kemungkinan terjadi mutasi.
A9281). Kemudian ditransformasikan ke
dalam E.coli strain TOP10F untuk DNA sekuensing analisis plasmid
menghasilkan plasmid rekombinan. rekombinan dan P. pastoris rekombinan
Prosedur transformasi dilakukan dengan Plasmid rekombinan dan P. pastoris
metode electric shock menggunakan rekombinan dianalisa dengan sekuensing
electroporator (Bio-Rad GenePulser). metode Sanger menggunakan mesin
Hasil transformasi kemudian dianalisa sekuens automatis AB 3130 XL. Primer
dengan seleksi klon menggunakan metode yang digunakan adalah α-Factor : 5’ TA
isolasi DNA plasmid, digesti sesuai CTATTGCCAGCATTGCTGC 3’, 3’AO
fragmen restriksi, PCR menggunakan X1 : 5’GCAAATGGCA TTCT GACAT
primer spesifik NS1, primer vektor AOX1 CC 3’ serta sepasang primer spesifik NS1.
dan sekuensing. Plasmid rekombinan Selanjutnya hasil sekuen dianalisis secara
pPICZαB yang mengandung gen NS1 manual menggunakan software FinchTV
selanjutnya disebut pPICD1NS1. dan dibandingkan dengan sekuen asli NS1
DENV-1 strain Indonesia (915846).
Transformasi plasmid rekombinan ke
Pichia pastoris dan penentuan fenotif Ekspresi protein rekombinan NS1
Mut Media ekspresi yang digunakan
Plasmid rekombinan pPICD1NS1 adalah buffered glycerol-complex medium
dilinearisasi menggunakan enzim Sac1 (BMGY) yang terdiri dari yeast extract
(Thermo sientific cat. no. ER1131), (Oxoid cat. No. LP0021) 1%, peptone
kemudian ditransformasi ke Pichia (Sigma-Aldrich cat. no. 91249) 2%,
pastoris strain GS 115 dengan metode potassium phosphate (Merck cat. no
electroporasi (Gene Pulser-Biorad). Sel 104873) pH 6,0 100 mM, yeast nitrogen
yeast yang ditransformasi diinkubasi pada base (YNB) (Invitrogen cat. no. Q3009)
media agar YPDS yang mengandung 1,34%, Biotin (Sigma-Aldrich cat. no.

124 Jurnal Biotek Medisiana Indonesia . Vol.5.2.2016:121-132


Ekspresi dan purifikasi …(Whinie dkk)

B4639) 4x10-5%, glycerol (Invitrogen cat. DAB, 10 mL 1 x PBS, 10 µl H2O,


no. 15-514-029) 1%, sedangkan media kemudian dilihat pita yang terbentuk pada
induksi menggunakan BMMY yaitu kertas membran.
mengganti glycerol dengan metanol 1%.
Purifikasi protein rekombinan NS1
Sepuluh klon hasil transformasi yang
sudah diverifikasi, ditumbuhkan ke media Klon positif nomer 54 yang sudah
ekspresi selama 16-18 jam pada suhu 28oC dikonfirmasi mengekspresikan secara
dan kemudian inkubasi dilanjutkan selama tersekresi protein rekombinan selanjutnya
72 jam dengan induksi metanol 1% setiap diekspresikan sesuai protocol. Supernatan
24 jam. Sebagai kontrol, dilakukan juga yang mengandung protein rekombinan
kultur pada Pichia pastoris strain GS 115 selanjutnya di sentrifugasi untuk
yang tidak ditransformasi dan sebagai memisahkan dengan sel Pichia pastoris.
kontrol negatif pada transforman vektor Kemudian dipekatkan menggunakan
pPICZαB/GS 155. Amicon 10 kDa (Millipore), selanjutnya
dipurifikasi menggunakan ProBond
SDS-PAGE dan Western Blotting Purification System (Invitrogen). ProBond
merupakan sistem purifikasi metal
50 µl sampel dicampur dengan 50 µl chelating affinity chromatography
2x SDS-PAGE gel loading buffer (dapar (MCAC) yang mengandung resin ion
sampel), dipanaskan pada suhu 100oC nickel untuk menangkap protein
selama 10 menit kemudian diseparasi rekombinan yang sudah dirancang dengan
dengan 12% jel SDS PAGE pada mesin 6 x His tag pada bagian ujungnya.
elektroforesis vertikal (Biorad). Pita
protein diwarnai dengan Coomassie Blue
Pemeriksaan ELISA
R-250 dan ukurannya ditentukan dengan
membandingkan berat molekul standar Pengujian antigenisitas dilakukan
(Thermo Scientific cat. no. 26616). Pita juga dengan metode ELISA NS1 dengue
protein yang telah terpisah, ditransfer dari (Platelia). Antibodi yang digunakan adalah
jel poliakrilamid ke membran nitroselulosa antibodi monoklonal dengue yang
menggunakan mesin semidry transblot diproduksi di mencit. Protokol kerja sesuai
blot (Biorad). Membran dibloking dengan panduan kit. Reagen disiapkan pada suhu
larutan 3% BSA (Sigma-Aldrich cat. no. kamar sebelum digunakan. Larutan
A2058) dalam 1% PBS. Selanjutnya conjugate anti NS1 HRP didilusi 50 kali
membran diinkubasi dengan larutan serum dengan larutan diluent. Percampuran
Ig G dengue positif 1:1600 (koleksi dilakukan saat akan digunakan. Kontrol
laboratorium) dengan komposisi larutan positif, kontrol negatif, kalibrator dan
dilusi 0,5% BSA (Sigma-Aldrich cat. no. serum diencerkan dalam larutan diluent.
A2058) dalam PBS Tween 0,05%, Spesimen 10 µl didilusi dengan 1000 µl
diagitasi perlahan dan diinkubasi pada spesimen diluent. Dapar pencuci
suhu 4oC semalam. Setelah itu membran dincerkan 20x (1 bagian wash buffer + 19
dicuci dengan dapar pencuci PBS tween bagian aquabidest). Masing-masing 100 µl
0,05 % sebanyak 3 kali selama 5 menit kontrol, kalibrator dan spesimen yg sudah
dengan agitasi perlahan. Kemudian diencerkan dimasukkan ke dalam sumur
membran diinkubasi dengan antibodi ke 2 dan diinkubasi pada suhu 37oC selama 60
yaitu larutan anti human HRP-IgG (Sigma menit. Kemudian dicuci sebanyak 6x
Aldrich cat. no. A.0170) 1:100, diagitasi dengan dapar pencuci yang sudah
perlahan selama 1 jam. Selanjutnya dicuci diencerkan. Selanjutnya dimasukkan 100
dengan dapar pencuci sebanyak 3 kali µl campuran conjugate anti NS1 HRP ke
selama 5 menit sambil diagitasi perlahan. setiap sumur, kecuali sumur blanko, lalu
Terakhir direndam dengan substrat selama digoyang selama 5 detik. Plate ditutup dan
5 menit dengan komposisi substrat 6 mg diinkubasi kembali pada suhu 37oC selama

125
60 menit. Setelah itu dicuci kembali Plasmid rekombinan yang mengandung
sebanyak 6x dengan dapar pencuci. gen NS1 selanjutnya disebut pPICD1NS1.
Kemudian dimasukkan 100 µl TMB ke Kebenaran ada tidaknya plasmid
setiap sumur dan diinkubasi kembali pada rekombinan pada koloni diverifikasi
suhu ruangan selama 10 menit. Untuk dengan isolasi DNA. plasmid rekombinan
mengakhiri reaksi, ditambahkan 100 µl yang sudah tersisipi gen NS1 sehingga
stop solution ke setiap sumur dan berukuran 4.655 pb, sedangkan plasmid
digoyang selama 30 detik, kemudian hasil yang tidak mengandung gen NS1
reaksi dibaca pada mesin spektrofotometri berukuran 3,6 kb (data tidak ditunjukkan).
(Biorad-America) dengan absorbansi pada Selain itu verifikasi juga dilakukan dengan
450 nm. pemotongan plasmid rekombinan
Hasil menggunakan salah satu enzim yaitu Xba
I. Tampak pada gambar 1, di lajur 2-8
Hasil konstruksi dan verifikasi plasmid
adalah plasmid rekombinan pPICD1NS1
rekombinan pPICD1NS1.
yang telah tersisipi gen NS1 sehingga
Verifikasi dilakukan dengan metode berukuran 4655 pb. Sedangkan lajur 9
isolasi DNA, pemotongan dengan salah adalah plasmid tanpa NS1 yang dipotong
satu enzim restriksi dan PCR dengan dengan enzim XbaI dan lajur 10 adalah
primer spesifik NS1 dan primer vektor plasmid tanpa NS1 yang belum dipotong.
pPICZαB (AOX1) serta sekuensing DNA.

1 2 3 4 5 6 7 8 9 10

4655 pb
3600 pb

Gambar 1.
Verifikasi hasil kloning plasmid rekombinan dengan pemotongan enzim Xba I. Lajur 1:
marker 1 kb plus, lajur 2-8: plasmid rekombinan, pPICD1NS1, 4.655 pb, lajur 9:
plasmid pPICZaB yang dipotong enzim, 3.600 pb, lajur 10: plasmid
pPICZaB tanpa dipotong enzim.

Verifikasi juga dilakukan dengan sedangkan plasmid tanpa gen sisipan dan
metode PCR koloni dimana reaksi PCR kontrol negatif tidak ditemukan pita (data
sama dengan reaksi PCR gen NS1 sebagai tidak ditunjukkan).
cetakan dari koloni bakteri hasil Selain itu, dilakukan pula reaksi
transformasi. Hasil PCR ditemukan produk PCR dengan mengganti salah satu primer
PCR berukuran 1055 pb yang merupakan dengan primer vektor AOX1 pada daerah
plasmid rekombinan mengandung NS1, pengenalan di luar multiple cloning site

126 Jurnal Biotek Medisiana Indonesia . Vol.5.2.2016:121-132


Ekspresi dan purifikasi …(Whinie dkk)

plasmid. Reaksi ini membuktikan ada menunjukkan bahwa gen NS1 berhasil
tidaknya gen NS1 yang berhasil tersisipi disisipi dengan orientasi yang benar,
dan kebenaran arah orientasi sisipan. Hasil sedangkan lajur 3,5,7,9 adalah plasmid
verifikasi PCR pada gambar 2 di lajur 2,4 pPICZaB berukuran 592 pb.
dan 6 adalah plasmid rekombinan
pPICD1NS1 dengan ukuram 1647 pb yang

1 2 3 4 5 6 7 8 9

1647 pb

592 pb

Gambar 2.
Verifikasi hasil pengklonaan plasmid rekombinan dengan PCR menggunakan primer
vektor AOX1. Lajur 1: marker 100 pb, lajur 2,4,6: plasmid rekombinan
pPICD1NS1, 1647 pb, lajur 3,5,7,9: plasmid pPICZaB, 592 pb.

Beberapa plasmid rekombinan yang bahwa proses kloning berhasil sesuai


sudah diidentifikasi dan diverifikasi dengan yang diharapkan. Selain itu juga
menunjukkan adanya gen sisipan NS1 diperoleh hasil bahwa DENV-1 strain
selanjutnya diverifikasi lagi menggunakan Indonesia (915846) adalah genotipe IV
sekuensing untuk mengetahui runutan yang merupakan salah satu strain paling
nukleotida. Sekuensing plasmid umum mewakili Indonesia.
rekombinan dilakukan menggunakan
primer vektor AOX1 dan primer spesifik Transformasi plasmid rekombinan ke
NS1. Hasil amplifikasi dengan PCR dan Pichia pastoris dan penentuan fenotif
sekuensing NS1 DENV-1 strain Indonesia Mut
(915846) terletak pada nukleotida 2409 Koloni resisten Zeocin hasil
sampai 3464 dari genome DENV-1, transformasi dengan elektroporasi ke P.
berukuran 1055 nukleotida. Fragmen gen pastoris strain GS 115 menghasilkan
NS1 full length juga telah terinsersi di pichia rekombinan. Fenotif Mut+
vektor ekspresi pPICZαB untuk ditentukan dengan koloni yang dapat
menghasilkan plasmid rekombinan tumbuh normal di media MMH dan MDH.
pPICD1NS1. Setelah dibandingkan Integran multicopi diseleksi dari koloni
menggunakan software Bio Edit, sekuen fenotif Mut+ yang tumbuh pada
nukleotida gen NS1 DENV-1 dari plasmid konsentrasi zeocin yang ditingkatkan (500
rekombinan sama dengan (homologi µl/ml) pada agar YPDS. Hasil verifikasi
100%) gen NS1 dari isolat aslinya DENV- PCR dengan pasangan primer spesifik NS1
1 strain Indonesia (915846). Hasil DENV-1 diperoleh fragmen DNA dengan
sekuensing tidak ada satupun basa yang ukuran sekitar 1,1 kb (data tidak
mengalami mutasi, hal ini menunjukkan ditunjukkan). Hasil verifikasi PCR dengan

127
pasangan primer vektor AOX1 terlihat ada 2 pita yaitu yang berukuran 2,2
menunjukkan fragmen DNA berukuran 1,7 kb adalah gen AOX sedangkan yang
kb yang telah terintegrasi pada lokus AOX berukuran 1,7 kb adalah gen NS1 DENV-1
di kromosom sel P. pastoris (Gambar 3). (dapat dilihat pada lajur 2-4, 6-7 dan 9-10)
Pada transforman Mut+, hasil PCR akan

Gambar 3.
verifikasi transformant Pichia rekombinan dengan PCR menggunakan pasangan
primer AOX1. Lajur 1: Marker, lajur 2,3,4,6,7,9,10: Integran pichia rekombinan
GSD1NS1 Mut+ dengan 2 pita berukuran 1647 kb dan gen AOX1 berukuran sekitar
2,2 kb, lajur 5 dan 8: Integran pichia rekombinan GSD1NS1 Mut-
berukuran 1647 bp, lajur 11: kontrol plasmid tanpa gen
NS1 berukuran 592 pb.

Hasil ekspresi dan purifikasi protein 54 disekresi untuk menaikkan produksinya


rekombinan rNS1 DENV-1 strain sehingga dihasilkan ekspresi yang
Bekasi 2003915846 persisten. Analisis SDS-PAGE
Hasil identifikasi dan verifikasi yang menunjukkan jumlah yang besar protein
menunjukkan kebenaran orientasi gen rekombinan rNS1 dalam supernatan klon
sisipan NS1, serta hasil seleksi fenotip nomer 54. Hasil SDS-PAGE juga
Mut+ di media dengan konsentrasi zeocin menunjukkan beberapa pita protein yang
tinggi dilanjutkan dengan proses ekspresi tidak spesifik (data tidak ditunjukkan),
protein. Transforman yang sudah setelah dilakukan western blot hanya ada 1
diverifikasi, diinduksi dengan metanol pita spesifik sesuai berat molekul yang
untuk mengekspresikan protein NS1 dalam diharapkan (45 kDa).
pengujian skala kecil ke medium kultur. Hasil purifikasi protein rekombinan
Protein terekspresi dalam supernatan NS1 yang telah dioptimasi menggunakan
dideteksi dengan SDS-PAGE 12%. Sebuah metode ultrafiltrasi dan afinitas
pita protein spesifik 45 kDa dideteksi pada kromatografi menggunakan kolum MCAC
gel. Ekspresi protein rekombinan NS1 dan perkiraan kuantitatif menunjukkan
dilakukan dalam sistem ekspresi Pichia bahwa sekresi maksimum protein
pastoris strain GS115 fenotip Mut+ dan rekombinan adalah 4,5 mg dalam 1 liter
telah diperoleh hasil yang optimum dengan supernatan, diperoleh setelah 72 jam
induksi methanol 1%. Sekresi ekspresi induksi dengan methanol 1% (Gambar 4).
protein rNS1 diperoleh terbanyak dari
transforman koloni nomer 54. Klon nomer

128 Jurnal Biotek Medisiana Indonesia . Vol.5.2.2016:121-132


Ekspresi dan purifikasi …(Whinie dkk)

Gambar 4. Protein rekombinan NS1 purifikasi yang dideteksi dengan SDS-


PAGE 12%. M: marker berat molekul protein. Lajur 1: supernatan hasil
ekspresi protein rekombinan NS1 di Pichia sebelum purifikasi. Lajur
2 dan 3: hasil purifikasi protein rekombinan NS1
dengan ukuran 45 kDa.

Hasil uji antigenisitas protein NS1 DENV-1 dapat berfungsi sebagai


rekombinan rNS1 DENV-1 strain antigen sesuai dengan wild type-nya. Hasil
Bekasi 2003915846 dengan metode Western Blot protein rekombinan NS1
ELISA dan Western Blot. menggunakan serum pasien terinfeksi
DEN-1 sebagai antibodi menunjukkan
Hasil pemeriksaan ELISA dengan respons antigen yang dapat dideteksi
kit Platelia Dengue ELISA NS1 Antigen dengan berat molekul 45 kDa (Gambar 5).
menunjukkan bahwa protein rekombinan

Gambar 5.
Hasil western blot protein rekombinan NS1 menggunakan serum pasien terinfeksi
DEN-1 sebagai antibodi. M: marker berat molekul protein. Lajur 1 dan 2 protein
rekombinan NS1, lajur 3 dan 4 kontrol negatif Pichia dan PBS.

129
Ekspresi dan purifikasi …(Whinie dkk)

Diskusi dapat melisiskan sel yang terinfeksi virus


dan akan mengurangi jumlah virus serta
Penyakit dengue disebabkan oleh
mencegah keparahan penyakit. Protein
empat DENV yang secara genetik dan
NS1 juga memiliki banyak epitop sel B
serologi berbeda (DENV 1-4) yang
dan sel T yang dapat dijadikan sebagai
bersirkulasi secara endemis di beberapa
target untuk pengembangan kit
daerah dan menyebabkan pola 8,11, 23
diagnostik.
epidemiologi yang kompleks. Di
Indonesia, beredar ke 4 serotipe virus Pada studi ini digunakan sistem
dengue dengan genotipe yang bermacam- ekspresi Pichia pastoris (methylotropic
macam sehingga jika akan yeast) yang memiliki keuntungan
mengembangkan vaksin maupun kit kombinasi dari sistem ekspresi prokariotik
diagnostik maka perlu menggunakan (level ekspresi yang tinggi, mudah untuk
strain lokal yang dapat mewakili secara menaikkan skala produksi, media
umum di Indonesia. DENV-1 yang pertumbuhan yang tidak mahal) dan
bersirkulasi di Indonesia adalah genotipe I eukariotik (kapasitas membawa modifikasi
dan IV.21 DENV-1 strain Bekasi post translasi seperti glikosilasi, formasi
2003915869 kandidat vaksin, masuk ikatan disulfida dan proses proteolitik).
dalam genotipe IV, sehingga mewakili Selain itu, P. pastoris adalah organsime
salah satu strain Indonesia. Infeksi oleh yang tidak patogen, sehingga protein
salah satu serotipe virus memberikan rekombinan yang diekspresikan di
proteksi terhadap serotipe tersebut tetapi dalamnya bebas dari pirogen, toksin dan
tidak pada serotipe lainnya. Infeksi komponen virus, sehingga aman untuk
sekunder atau tertier dengan serotipe yang penggunaan di manusia.18
berbeda dihubungkan dengan bertambah Plasmid yang digunakan pada
beratnya penyakit yang merupakan penelitian ini adalah plasmid pPICZαB.
pengembangan teori peningkatan infeksi
Plasmid pPICZαB yang aslinya dirancang
oleh sistem imun (antibody dependent dan dikonstruksikan dengan sebuah sinyal
enhancement/ ADE).22 peptida, multicloning site dan sekuen
Protein non struktural 1 (NS1) terminal transkripsi dari gen polihistidin
berpotensi untuk pengembangan vaksin sehingga berguna untuk ekspresi
karena tidak tergabung dalam struktur eukariotik dari gen asing. Sinyal peptida
virion sebagai pengganti protein struktural diinkorporasi untuk fasilitas sekresi dan
untuk menghindari peningkatan respons poly(His)-tag untuk proses purifikasi dan
imun yang melibatkan antibodi dari deteksi fusi protein NS1. Elektroporasi
protein E yang menjadi perantara ADE. digunakan untuk meningkatkan efisiensi
Selain itu anti NS1 yang terbentuk dapat proses memasukkan plasmid rekombinan
mengaktifkan komplemen untuk ke dalam sel yeast. Seleksi fenotip Mut+
melisiskan sel yang terinfeksi DENV. dari transforman sangat penting dilakukan
Protein NS1 juga memicu respons imun untuk memilih transforman dengan level
seluler sel T CD4 dan CD8 dengan ekspresi yang lebih tinggi. Protein yang
memproduksi IFN-γ, TNF-α, TNF-β dan dipilih untuk diekspresikan pada penelitian
kemokin termasuk makrofag pada ini adalah protein NS1.
interaksi antigen yang mempresentasikan Pada penelitian ini telah dihasilkan
sel terinfeksi DENV untuk melisiskan sel konstruksi plasmid rekombinan NS1
terinfeksi. Namun antibodi yang dihasilkan DENV-1 dan protein rekombinan NS1
oleh protein NS1 tidak dapat mencegah dengan berat molekul 45 kDa dengan
virus menginfeksi sel, karena protein NS1 level produksi hingga 4,5 mg dalam 1 liter
lebih berperan pada imunitas seluler, supernatan, yang telah diverifikasi dengan
sehingga diharapkan antibodi tersebut isolasi DNA, digesti, PCR dengan primer

130
Ekspresi dan purifikasi …(Whinie dkk)

NS1 dan primer AOX, dengan sekuensing. tersekresi yang cukup tinggi dari protein
Pada Hasil sekuensing menunjukkan rekombinan rNS1 DENV-1 strain
kebenaran orientasi sesuai dengan wild Indoneisa (915869) telah diperoleh di P.
type NS1 DENV-1 genotipe 4 strain pastoris dengan induksi methanol 1%.
Indonesia (915869) dan tidak ada satupun Proses produksi dengan sistem tersekresi
basa yang mengalami mutasi. Pada jel di Pichia pastoris ini memudahkan
SDS PAGE masih terdapat 1 pita lain purifikasi. Protein rekombinan yang
selain pita protein target, sehingga masih dihasilkan memiliki antigenisitas dan berat
membutuhkan proses pemurnian lebih molekul yang mirip dengan protein virus
lanjut yaitu dengan menurunkan pH dengue wild type nya. Produksi protein
pencucian sebelum fase elusi diantaranya rekombinan rNS1 DENV-1 strain
pH 6 – pH 4, atau juga melakukan elusi Indoneisa (915869) yang efisien dan
menggunakan imidazole dengan beberapa fungsional di sistem ekspresi tersekresi P.
konsentrasi. Hasil pemeriksaan protein pastoris merupakan sistem yang halal dan
rekombinan rNS1 dengan menggunakan berpotensi digunakan untuk penelitian
kit ELISA NS1 Dengue Platelia adalah pengembangan kandidat vaksin dan kit
positif tinggi dengan rerata 11,08 dan diagnostik.
standar deviasi 0,4. Hasil Western Blot
menggunakan serum pasien terinfeksi Saran
DENV-1 sebagai antibodi juga Perlu dilakukan penelitian lanjutan
menunjukkan respons antigen yang dapat menilai karakterisasi imunogenisitas
dideteksi dengan berat molekul 45 kDa. protein rekombinan NS1 DENV-1 strain
Hasil ini menunjukkan bahwa protein Indonesia (915846) untuk mengetahui
rekombinan rNS1 yang dihasilkan reaksi silang terhadap ke empat serotipe
memiliki antigenisitas sesuai dengan wild dengue. Jika ternyata dapat memberikan
type-nya. Protein NS1 DENV telah reaksi silang terhadap ke empat serotipe
dilaporkan berhasil diekspresi pada sistem dengue, maka hanya diperlukan satu
mamalia dan baculovirus namun kurang serotipe protein NS1 saja untuk
sesuai untuk ekspresi skala besar karena pengembangan selanjutnya.
hasilnya sedikit.11 Produksi protein
rekombinan rNS1 DENV-1 strain
Ucapan terima kasih
Indonesia (915869) di sistem ekspresi
tersekresi Pichia pastoris menunjukkan Terima kasih kami sampaikan
hasil yang relatif tinggi dan cukup stabil. kepada Badan Litbangkes, Kemenkes yang
Proses produksi dapat dilakukan dengan telah mendanai penelitian ini dan kepala
sistem halal menggunakan seluruh Pusat Biomedis dan Teknologi Dasar
reagensia yang bebas porcine. Sehingga Kesehatan yang memfasilitasi penelitian di
sistem ekspresi protein di P. pastoris ini laboratorium imunologi PBTDK. Kami
dapat diaplikasikan juga untuk proses juga menyampaikan terima kasih kepada
pengembangan vaksin dengan antigen lain, Dr. Agung Eru Wibowo, M.Si., Apt
khususnya bagi negara yang sangat sebagai Kepala Laboratorium Teknologi
memperhatikan isu halal termasuk Farmasi dan Medika, BPPT Serpong yang
Indonesia. telah memfasilitasi sebagian kegiatan
eksperimental di laboratorium serta rekan-
Kesimpulan rekan yang turut membantu yaitu Siti
Mariany Saragih AMAK, Dodi Irawan
Hasil penelitian menunjukkan bahwa S.Si, Wahyu Hidayati S.Si M. Biomed dan
protein rekombinan NS1 DENV-1 strain Aris S.Si.
Indonesia (915846) dapat diproduksi
secara tersekresi di sistem methylotropic
yeast Pichia pastoris. Level ekspresi

131
Daftar Rujukan systematic bioinformatics approach for
selection of epitopebased vaccine targets. Cell
1. World Health Organization (WHO). Dengue Immunol 2006; 244(2): 141–47.
Guideline for Diagnosis, Treatment, 14. Falconar AKI. Antibody responses are
Prevention and Control. New edition. generated to immunodominant ELK/KLE-
Switzerland: WHO Press, 2009. Type motifs on the nonstructural-
2. Gubler DJ. Dengue and Dengue Haemorhagic glycoprotein during live dengue virus
Fever. Clinical Microbiology Review 1998; infections in mice and human: implications
11(3): 480-96. for diagnosis, pathogenesis, and vaccine
3. World Health Organization (WHO). Global design. Clin Vaccine Immunol 2007; 14(5):
Strategy for Dengue Prevention and Control 493-504.
(2012-2020). Switzerland: WHO Press, 2012. 15. Falconar AKI. Monoclonal antibodies that
4. World Health Organization (WHO). Situation bind to common epitopes on the dengue virus
update of dengue in the SEA Region. type 2 nonstructural-1 and envelope
Switzerland: WHO Press, 2010. glycoproteins display weak neutralizing
5. WHO-SEARO. Comprehensive guidelines for activity and differentiated responses to
prevention and control of dengue and dengue virulent strains: implications for pathogenesis
haemorrhagic fever, (Revised and expanded. and vaccines. Clin Vaccine Immunol 2008;
Ed). New Delhi, India: World Health 15(3): 549–61.
Organization, 2011 16. Falconar AKI, Young PR, Miles MA. Precise
6. World Health Organization (WHO). Dengue location of sequential dengue virus
and severe dengue. 2012. subcomplex and complex B cell epitopes on
http://www.who.int/mediacentre/factsheets/fs the nonstructural-1 glycoprotein. Arch Virol
117/en/. Diakses pada tanggal 15 Desember 1994; 137: 315-26.
2014. 17. Wu HC, Huang YL, Chao TT, Jan JT, Huang
7. Kementerian Kesehatan. Rencana Strategis JL, Chiang HY, King CC, Shaio MF.
Kementerian Kesehatan tahun 2010-2014, Identification of B-Cell Epitope of Dengue
Keputusan Menkes RI, nomer HK Virus Type 1 and Its Application in Diagnosis
03.01/160/1/2010. Jakarta: Kementerian of Patients. J Clin Micobiol 2001; 39(3): 977-
Kesehatan, 2010. 82.
8. Wu SF, Liao CL, Lin YL, Yeh CT, Chen LK, 18. Yao ZJ, Kao MCC, Loh KC, Chung MCM. A
Huang YF, Chou HY, Huang JL, Shaio MN, serotype-specific epitope of dengue virus 1
Sytwu HK. Evaluation of protective afficacy identified by phage displayed random peptide
and immune mechanisms of using a non- library. FEMS Microbiology Letters 1995;
structural protein NS1 in DNA vaccine 127(1-2): 93-8.
against dengue 2 virus in mice. Vaccine 2003; 19. Chaturvedi UC, Shrivastava R, Nagar R.
21: 3919-29. Dengue vaccines: Problems & prospects.
9. Flamand M, Megret F, Mathieu M, Lepault Indian J Med Res 2005; 121: 639-52
J, Rey FA, Deubel V. Dengue virus type 1 20. Costa SM, Freire MS, Alves AMB. DNA
nonstructural glycoprotein NS1 is secreted vaccine against the non-structural 1 protein
from mammalian cells as a soluble hexamer in (NS1) of Dengue 2 virus. Vaccine 2006; 24:
a glycosylation-dependent fashion. J Virol 4562-64.
1999; 73(7): 6104-6110. 21. Mulyatno KC, Yamanaka A, Yotopranoto S,
10. Wang X, Huang X, Wang S. Study on Konishi E. Vertical transmission of dengue
immunity of dengue virus and dengue vaccine virus in Aedes aegypti collected in Surabaya,
development. Front Biol China 2009; 4(2): Indonesia, during 2008-2011. Jpn J Infect Dis
125-128. 2012; 65(3): 274-6.
11. Zhou JM, Tang YX, Fang DY, Zhou JJ, Liang 22. Hombach J. Vaccines against dengue: a
Y, Guo HY, Jiang LF. Secreted expression review of current candidate vaccines at
and purification of dengue 2 virus full-length advanced development stages. Pan Am J
non-structural glycoprotein NS1 in Pichia Public Health 2007; 21(4): 254-60.
pastoris. Virus Genes 2006; 33: 27-32 23. Zhang W, Chipman PR, Corver J, Johnson
12. Chuang YC, Wang SY, Lin YS, Chen HR, PR, Zhang Y, Mukhopadhyay S, Baker
Yeh TM. Re-evaluation of the pathogenic TS, Strauss JH, Rossmann MG, Kuhn RJ.
roles of nonstructural protein 1 and its Visualization of membrane protein domains
antibodies during dengue virus infection. J by cryo-electron microscopy of dengue virus.
Biomed Sci 2013; 20(42): 1-7. Nat Struct Biol 2003; 10(11): 907-12.
13. Khan AM, Miottob O, Heinyb AT, Salmond
J, Srinivasand KN, Nascimentod E, Marquesd
ET, Brusica V, Tanb TW, Augustd TJ. A

132 Jurnal Biotek Medisiana Indonesia . Vol.5.2.2016:121-132