[TYPE  THE  COMPANY  NAME]          

VALIDATION  OF  MIR-­‐125B  PUTATIVE  TARGETS  INVOLVED  IN  LEUKEMIA
Internship  Report  

 

    Student:  Diu  T.T.  Nguyen   Duration:  January  –  June  2010   Supervisors:     Prof.  Harvey  F.  Lodish                                                                                                                      Dr.  Jan  M.  Kooter     Dr.  Marina  Bousquet                                                                                                                        Department  of  Genetics   Whitehead  Institute  for  Biomedical  Research                                Vrije  University  Amsterdam   9  Cambridge  Center,  Cambridge,                                                                              De  Boelelaan  1085,  1081HV   MA  02142                                                                                                                                                                Amsterdam    
    June  2010  
 

D.T.T.  Nguyen                                                

 

                                   MiR-125b in Leukemia  

  Contents
Abstract   Introduction   Materials  and  Methods   Results  and  Discussion   Differentiation  blockage  and  apoptosis  inhibition  of  32DCl3  and  HL60  cell  lines  by   miR-­‐125b  overexpression   Apoptosis  suppression  by  miR-­‐125b  in  HL60  and  32DCl3   Binding  sites  cloning  into  psicheck2  vector     Generation  of  binding  site  mutants     Validation  of  putative  targets  involved  in  cell  proliferation,  apoptosis  and  cell   signaling     DUSP6  and  ETS1   MAP4K2   PPP2R1B   Validation  of  putative  targets  involved  in  myeloid  differentiation                  SP1                  CBFB   General  discussion  and  conclusion   Acknowledgement   References   Appendix       3   4   7     15   16   18   19     20   23   27     29   32   35   37   38   39  

2    

D.T.T.  Nguyen                                                

 

                                   MiR-125b in Leukemia  

ABSTRACT   MiR-­‐125b   was   shown   to   be   overexpressed   in   leukemic   patients   carrying   the   chromosomal   translocation  t(2;11)(p21;q23),  which  resulted  in  blocked  differentiation  and  apoptosis  of  myeloid   progenitors   in   vitro.   This   was   hypothesized   to   be   the   cause   of   leukemia   in   these   patients.   The   mechanism   underlying   this   phenomenon   remains   to   be   elucidated.   The   aim   of   this   study   is   to   determine  the  direct  targets  of  miR-­‐125b  which  lead  to  differentiation  and  apoptosis  blockage.  In   my   first   internship,   six   putative   targets   were   selected   based   on   mRNA-­‐sequencing,   RQ-­‐PCR   and   bioinformatic  approaches,  including  DUSP6,  ETS1,  MAP4K2,  PPP2R1B,  SP1  and  CBFB.  To  validate   these  gene  candidates  as  real  targets  of  miR-­‐125b,  the  binding  sites  were  inserted  into  3’UTR  of   luciferase   reporter   gene   and   then   co-­‐transfected   with   miR-­‐125b   into   293T   cells.     Mutations   of   these   binding   sites   were   created   and   used   as   controls.   In   a   further   step,   miR-­‐125b   was   overexpressed   in   three   different   cells   lines,   namely   NB4,   HL60   (human   cell   lines)   and   32DCl3   (mouse  cell  line)  which  could  be  induced  to  differentiate  or  to  die  in  program.  Protein  levels  of   the   putative   targets   were   examined   before   and   after   induction   according   to   physiological   functions  of  the  genes.    The  results  revealed  that  CBFB  is  most  likely  a  direct  target  of  miR-­‐125b.   Since   CBFB   forms   complexes   with   Runx   protein   family,   which   is   essential   for   maturation   of   hematopoietic   cells,   the   down-­‐regulation   of   it   by   miR-­‐125b   could   explain   the   differentiation   blockage  observed  in  vitro.                            

3    

D.T.T.  Nguyen                                                

 

                                   MiR-125b in Leukemia  

INTRODUCTION   MicroRNAs  modulate  a  variety  of  cellular  pathways,  including  development,  differentiation,  cell   proliferation   and   apoptosis   (Bartel   2004;   Bartel   2009)   and   dysregulation   of   miRNA   expression   underlies  specific  oncogenic  events  in  human  cancer  (Calin  and  Croce  2006;  Esquela-­‐Kerscher  and   Slack  2006;  Garzon,  Fabbri  et  al.  2006;  Calin,  Liu  et  al.  2007)   In   a   previous   study,   Bousquet   M.   et   al.   showed   that   a   chromosomal   translocation   t(2;11)(p21;q23)  in  19  patients  suffering  from  acute  myeloid  leukemia  (AML)  and  myelodysplastic   syndrome   (MDS)   caused   a   six   to   ninety   fold   up-­‐regulation   of   miR-­‐125b   compared   to   healthy   individuals  and  leukemic  patients  lacking  the  translocation  t(2;11)(p21;q23)  (Bousquet,  Quelen  et   al.   2008).   The   gene   for   miR-­‐125b   is   located   on   chromosome   11   (miR-­‐125b-­‐1   locus),   but   it   is   unclear   how   the   t(2;11)(p21;q23)   translocation   leads   to   miR-­‐125b   overexpression.   When   miR-­‐ 125b  was  transiently  transfected  into  the  human  promyelocytic  leukemia  cell  lines  NB4  and  HL60   it   blocked   the   differentiation   of   these   cell   lines   upon   chemical   treatment.   It   is   noted   that   NB4   cells   become   mature   granulocytes   and   HL60   undergoes   monocytic   maturation   after   treatment   with  ATRA  and  DMSO,  respectively.  They  were  also  observed  to  have  endogenous  miR-­‐125b  up-­‐ regulated   at   the   very   end   of   cell   maturation.   Transient   transfection   of   miR-­‐125b   resulted   in   maturation  arrest,  shown  by  a  reduction  in  the  markers  of  terminal  differentiated  myeloid  cells   (CD11b,   CD14   and   CD15)   and   by   morphological   observation(Bousquet,   Quelen   et   al.   2008).   Recently,   miR-­‐125b   was   shown   to   inhibit   apoptosis   in   NB4   cells   upon   induction   of   apoptosis   with   camptothecin   (unpublished   data,   Bousquet   M.   et   al.).   These   properties   may   account   for   the   differentiation   and   apoptosis   blockage   in   leukemic   cells   in   vivo   by   miR-­‐125b(Bousquet   et   al.   2008).     Moreover,   miR-­‐125b   was   found   to   have   oncogenic   functions   in   prostate   cancer   where   it   was   found  to  suppress  bak1  and  induce  androgen-­‐independent  growth  of  the  cancer  cells  (Shi,  Xue  et   al.  2007).  It  was  also  described  as  a  negative  regulator  of  pro-­‐apoptotic  gene  p53  and  BMPR1B   associated  with  breast  cancer  pathogenesis  (Le,  Teh  et  al.  2009;  Saetrom,  Biesinger  et  al.  2009).     To  search  for  targets  of  miR-­‐125b  involved  in  leukemia  (AML  and  MDS),  in  the  first  internship  I   used   mRNA   sequencing   (next   generation   sequencing)   and   RQ-­‐PCR,   together   with   integrative   bioinformatics   approach   to   screen   for   putative   target   candidates.   To   this   end,   I   used   the   promyelocytic   cell   line,   NB4,   transfected   with   miR-­‐125b   mimic.   Six   genes,   namely   DUSP6,   ETS1,   MAP4K2,  PPP2R1B,  SP1  and  CBFB  were  found  to  be  down-­‐regulated  by  miR-­‐125b.  Among  them,   DUSP6,  ETS1,  PPP2R1B  have  been  demonstrated  to  play  roles  in  cell  growth  control  and  apoptosis   and  were  reported  to  be  down-­‐regulated  in  several  types  of  cancer  (Furukawa,  Sunamura  et  al.   2003;  Tamaki,  Goi  et  al.  2004;  Esplin,  Ramos  et  al.  2006;  Okudela,  Yazawa  et  al.  2009).  SP1  and   CBFB   are   both   key   players   in   hematopoiesis,   particularly   in   myeloid   maturation   (Clarke   and   Gordon   1998;   Hauses,   Tonjes   et   al.   1998;   Kundu   and   Liu   2003).   SP1,   a   universal   transcription  

4    

 Brad  Fletcher.  the  detected   changes   in   mRNA   level   do   not   always   and   necessarily   lead   to   changes   in   protein   level.   our   data   indicated   significant   decreases   in   mRNA   levels   of   these   two   SP1   down-­‐ stream   targets.  it  is   the  protein.  Wei  Tong  and  Dr.   CBFB   does   not   function   by   direct   interaction   with   DNA   but   forms   complexes   with   other   DNA-­‐binding   transcription   factors.  western  blot  was  finally  used   to  quantitate  and  compare  the  effect  of  miR-­‐125b  on  the  protein  level  of  the  putative  targets.  that  performs  the  ultimate  function  of  a  gene  and  second.T.  The  results   revealed  that  CBFB  was  the  most  likely  to  be  direct  targets.  Therefore.   such   as   HCK   and   CD11b   which   are   essential   for   myeloid   differentiation.T.   1998).   which   were   found  in  the  primary  study.   besides   the   NB4   cell   line.  were  infected  with  retroviral  vectors  expressing  miR-­‐125b.  32DCl3  and  HL60ER   stably  infected  with  vector  XZ  or  XZmiR-­‐125b  were  gifts  from  Marina  Bousquet.   NB4   cells   were   cultured   in   RPMI   1640   (Invitrogen)   supplemented   with  10%  fetal  bovine  serum.  Transient  transfection  of   5     .   there  is  a  possibility  that  a  decrease  in  mRNA  level  as  a  consequence  of  destabilization  by  miR-­‐ 125b  would  not  cause  any  change  at  the  protein  level.   through   its   binding   to   their   promoter   regions   (Hauses.  penicillin  and  streptomycin.   The   expectation   was   that   if   these   candidates   are   direct   targets.   Tonjes   et   al.   The   verification  of  the  function  of  miR-­‐125  by  this  assay  indicates  the  potential  of  being  a  direct  target   of  the  gene  but  does  not  guarantee  its  function  in  vivo.   This   internship   was   aimed   at   validating   the   six   putative   target   genes   of   miR-­‐125b.   32DCl3ER   and   HL60ER   were  generous  gifts  from  Dr.  however.  HL60  (human  cell  line)  and   32DCl3  (mouse  cell  line).  in  which  the  target  sequences  were  inserted   into   the   3’UTR   of   luciferase   reporter   gene   which   was   then   co-­‐transfected   with   miR-­‐125b.  For   this   purpose.   NB4   cell   line   was   purchased   from   DSMZ.  that  targeting  has  no  biological   significance   and   hence   is   not   worth   being   taken   into   account   in   attempt   of   deciphering   the   phenotypes  caused  by  miR-­‐125b  overexpression.   Runx   proteins.  L-­‐glutamine.  the  target  binding  sites  of  miR-­‐125  in  the  mRNAs   of  these  genes  were  tested  in  an  artificial  system.  293T  cell  line  was   purchased   from   ATCC.   Interestingly.  not  mRNA.   in   which   overexpression   of   miR-­‐125b   was   obtained   by   transient  transfection  with  mimics.   MiR   negative   control   #1   and   miR-­‐125b   mimics   were   purchased   from   Dharmacon.   In   fact.D.  respectively.  Nguyen                                                                                      MiR-125b in Leukemia   factor.  To  achieve  this  goal.     MATERIALS  AND  METHODS   Cell   lines   and   pre-­‐microRNAs.   they   could   explain   the   myeloid   differentiation  inhibition  and  apoptosis  suppression  observed  in  NB4  cell  line.     Cell   culture   and   transfection.   regulates   many   genes.   It  is  important  to  validate  a  real  target  of  a  miRNA  at  the  protein  level  for  two  reasons:  first.   It   was   reported   that   a   defect   in   CBFB   could   largely   prevent   definitive   hematopoiesis   and   lead   to   lethality   in   embryogenesis.  two  other  promyelocytic  cell  lines.

 5µl  of  Annexin  V  and  5µl  of  7-­‐AAD  were  added   to  100µl  of  cells  and  incubated  for  15min  in  the  dark.  Nguyen                                                                                      MiR-125b in Leukemia   miR  negative  control  #1  and  miR-­‐125b  (22.   cells   were   washed   twice   with   PBS   and   resuspended  at  1x106cell/mL  in  1X  Binding  Buffer.   HL60ER  and  32DCl3ER  are  cell  lines  expressing  murine  ecotropic  receptor.  HL60ER  were  cultured   in   IMDM   (GIBCO)   supplemented   with   1.   Constructing  3’UTR  gene  fragments  flanking  binding  sites  of  miR-­‐125b         6     .   8   hours   and   24   hours   of   induction.   Induction  of  apoptosis  in  HL60ER  and  32DCl3ER   To  induce  apoptosis  in  HL60ER.   Briefly.T.   the   transfected   cells   were   induced   to   differentiate   into   granulocytes   by   addition   of   ATRA  at  the  final  concentration  of  10uM  for  5  days.   10%   fetal   bovine   serum.  After  adding  400µl  of  1X  binding  buffer.   After   24h.  The  cells  were  harvested  for  protein  quantification  after  1.  the   cells  were  analysed  by  FACS.  using  Pulser  (BioRad).   these   two   cell   lines   carry   vectors  (XZ)  containing  miR-­‐125b  gene  and  GFP  as  a  reporter  for  selection.   Apoptosis  assay  was  performed  using  the  Annexin  V-­‐PE  apoptosis  detection  kit  (BD  Biosciences)   according   to   the   manufacturer’s   instructions.   32DCl3ER   were   grown   in   10%   fetal   bovine   serum.   The   rest   of   the   induced   culture   was   kept   until   day   5   for   FACS   and   morphological  analysis.  2  and  4   days   of   induction.  The  cells  were  washed  three   times   with   the   medium   without   IL3   and   then   resuspended   in   the   same   medium   at   5x105   cell/mL.   10%   IL3   (WEHI   media)   and   1%   penicillin   and   streptomycin  RPMI  (GIBCO).  day  2  and  day  4  after  IL3  removal.   For   32DER.D.   In   this   study.  Camptothecin  was  added  into  the  growing  culture  of  HL60ER  XZ   and   XZmiR-­‐125b   at   the   density   of   3x105cell/mL   with   the   final   concentration   of   10µM.5g/L   sodium   bicarbonate.   the   cells   were   washed   three   times   in   IL3   lacking   medium   and   then   resuspended   at   3x105   cell/mL   in   the   same   medium   plus   G-­‐CSF   at   the   final   concentration  of  100ng/ml.5uL  of  each  mimic  at  the  concentration  of  50uM)  into   NB4  cells  (3  x  106)  were  performed  by  electroporation  at  200V  and  950uF.  apoptosis  was  triggered  by  removing  IL3  from  the  medium.T.  which  allows  a  stable   gene   transfer   into   the   cells   with   murine   retroviral   vectors.   The  cells  were  harvested  at  day  1.   4   hours.   Induction  of  differentiation  in  32DCl3ER   To   differentiate   32DCl3ER   into   myeloid   cells.   The   cells   were   harvested   at   four   time   points   after   2   hours.

  E.1 R M4K2.   including   several   restriction   sites.2 R PPP2R1B F PPP2R1B R Oligonucleotide  sequence  (5’-­‐>3’)   taaCTCGAGATTTGCAGCATGCTTGACTTTACCA ataGCGGCCGCAGCTCTAAACTTTACACCACGAACA atgcCTCGAGgaagcaaagatggacttcagtg gcatGCGGCCGCGCCCTGGTTCTACTCTTACCCA taaCTCGAGACTCTGTACTCTGCCCTAGATTGT ataGCGGCCGCGACTTAGCACTGTTTTCCACTCTG atgcCTCGAGTTCAGGTTTTCAGGTTGCCCAT gcatGCGGCCGCCTGCAGCTTCCAGTATTCACAC taaCTCGAGAATGACCGCTTGTGGATCTGCA ataGCGGCCGCCGTCACATAGCTCATTGTAGCC taaCTCGAGAACTGCATGAGGATACGCTGGA ataGCGGCCGCTCAGCAGCAGAAACTTCTGCAG atgcCTCGAGACTCTTCGGGAGACATGTTGAG gcatGCGGCCGCTGGCCAAGTTATGAGCCAAAGC 7     .  selected  plasmids  were  digested  with  XhoI  and  NotI.T.T.  Hluc+  is  firely  luciferase   gene.  followed  by  DNA  sequencing.   fragments   surrounding   the   binding   sites   of   the   corresponding   genes   were   amplified   by   PCR.   coli   DH5α   was   transformed   with   the   constructs   and   plated   onto   semi-­‐solid   medium   containing   Ampicillin  for  selection  of  the  plasmids  containing  the  wanted  inserts.   The   multicloning   sites.  Nguyen                                                 a                                        MiR-125b in Leukemia                 Figure  1.1 F M4K2.   Using   primers   listed   in   the   table   below.  Primers  for  cloning  binding  sites.  which  plays  a  role  as  an  internal   control  of  the  assay.   The   PCR   products   were   cloned   into   the   reporter   vector   psicheck2   (Promega)   using   XhoI   and   NotI   (at   its   5’   end   and   3’   end   respectively).  To  confirm  the  presence  of   the  inserts.D.2 R M4K2.    Psicheck-­‐2  map   HRluc   encodes   the   Renilla   luciferase.  The  recognition  sites  of  XhoI  and  NotI  are  in  red   Primer  name   DUSP6 F DUSP6 R ETS1 F ETS1 R CBFB F CBFB R SP1.2 F SP1.     Table  1.2 F M4K2.   are   within   3’UTR  of  hRluc.

com/qcprimerdesign   (Table  2  .0  µL  dNTPs  mixture  (10mM  each)   and  PfuTurbo  DNA  polymerase  at  the  concentration  of  2.  it  was  chilled  down  to  4   oC  before  adding  DpnI  which  digested  the  non-­‐mutated  parental   DNA   templates.0  µL  of  primers  (10µM.  53  oC  for  1  min  and  66  oC  for  8  min.   designed   with   the   support  from  http://www.  First  mutagenesis  PCR  reaction  was  performed  with  50  ng   of  plasmid.  1.  forward  and  reverse).   After.   8     .T.5U/  µL.   The   digestion   was   incubated   overnight   at   37  oC   before   being   transformed   into   E.  Nguyen                                                                                      MiR-125b in Leukemia   TP53INP1 f TP53INP1 R ZNF148 F ZNF148 R APAF1 F APAF1 R APC F APC R STAT3 F STAT3 R PPP1CA F PPP1CA R PPP2CA F PPP2CA R   taaCTCGAGGTGTATCACATAATGCCTTGCCT ataGTTTAAACGCACTAATGGGTTAGTTACAGAC atgcCTCGAGTGGGTCTACATGCAAATGTGGT gcatGCGGCCGCTAGCACATTGGTACTCACTTCA atgcCTCGAGCATACCTTGTTGTACTGTTGGTA gcatGCGGCCGCTCATGAGGTCAAGAGATCGAGA atgcCTCGAGAGGCACTCTTGATGGTTAGGAA gcatGTTTAAACCCATCTCACCTCAAATACCAGA atgcCTCGAGTGGCCTTTTAGTGAGTAAGGCT gcatGCGGCCGCTTCCACAGAAACTCTGATCAGC taaCTCGAGCCAGATGATGGATTGATTGTACAG ataGCGGCCGCTGCGAGAATCCAGCTTTGACCT taaCTCGAGCAGTTTCTGGCATAGCGCTA ataGCGGCCGCAACACTGCAGTGCTCTTGTGCA Site-­‐directed  mutagenesis   Constructs  carrying  binding  sites  were  mutated  at  the  6-­‐nucleotide  sequence  complementary  to   the   seed   sequence   of   miR-­‐125b   using   primers   with   the   desired   mutation   .  Selected  plasmids  were  then  sequenced  to  verify  the  mutations.  then  22  cycles  of  95  oC  for  30s.  The  mixture  were  run  in  thermal   cycler  (BioRad)  at  95oC  for  30s.  The  principle  of  site-­‐directed   mutagenesis  is  illustrated  in  Figure  2.D.T.   coli  DH5α.stratagen.  1.

T.    Overview  of  site-­‐directed  mutagenesis  (source:  Stratagene)   9     .  Nguyen                                                                                      MiR-125b in Leukemia     Figure  2.D.T.

 Mixture  B   included   25µL   of   OptiMEM.T.  Mixture  A  contained  25µL  of  OptiMEM  (GiBCO)   and  1µL  of  Lipofectamin  2000  and  was  incubated  at  room  temperature  for  10  minutes.   Two  mixtures  were  prepared  for  the  transfection.2 RM SP1.  The  assay  was  performed  in  a  triplicate  for  each  construct  and  repeated  at  least  two   times   independently.   1µL   of   1µM   mature   microRNA   (miR-­‐125b   or   miRcontrol.2 Rm PPP2R1B FM1 PPP2R1B RM1   Luciferase  assay   One   day   before   transfection.   Non-­‐inserted   psicheck2   vector   and   miR-­‐125b   perfect   match   inserted   vector   were  included  into  all  of  the  experiments  as  the  control  of  transfection  and  proper  working  of  the   mimics.2 F dEL SP1.   293T   cells   were   seeded   into   96   well   white   plates   at   1-­‐2x104   cell/well.   Prior   to   the   transferring.2 R dEL M4K2.1 Fm M4K2.   10ng   of   constructs.  After  10  min.T.   when   the   cells   reached   a   confluence   of   60-­‐70%.D.   After   24h.     Oligonucleotide  sequence  (5’-­‐>3’)   gctaaacagtatattacctctgtataaaattctagtgtcacctcaaatgc gcatttgaggtgacactagaattttatacagaggtaatatactgtttagc cacaggctggcttctgttttattcatcgatttttttaaaaagtcaatcagaaa tttctgattgactttttaaaaaaatcgatgaataaaacagaagccagcctgtg Tggctcacagcctgtcacccacgtgactaccatcagttctgcc ggcagaactgatggtagtcacgtgggtgacaggctgtgagcca Cccacaccgtcttccttttccaactggcactc Gagtgccagttggaaaaggaagacggtgtggg Gggctccaccacctgcattccacgtggaagatccacagagacatc Gatgtctctgtggatcttccacgtggaatgcaggtggtggagccc Acaacgtgctgctgtcactccacgtgaaatccacgcacatctggg Cccagatgtgcgtggatttcacgtggagtgacagcagcacgttgt ctcatgtgaaaggggaatgtggaagccacgtgttaatgtagtggttgttttggtttt aaaaccaaaacaaccactacattaacacgtggcttccacattcccctttcacatgag 10     .   1%   L-­‐Glutamin   DMEM   without   Peni-­‐ Streptomycin)  were  added.    Primers  for  generation  of  mutated  binding  sites.  DEL:  Deletion.2 Fm M4K2.  M:  Substitution   Primer  name   DUSP6 F Del DUSP6 R del CBFB FM CBFB RM SP1.   they   were   used   for   co-­‐ transfection.  Dharmacon).1 Rm M4K2.  Nguyen                                                                                      MiR-125b in Leukemia   Table  2.  the  old  medium  in  the  wells  was  aspirated  by  taping  the  plate  onto  a  paper  towel  or   by   vacumm   and   50µL   of   new   medium   (10%   FBS.  mixture  A  was  added  to  mixture  B  and  incubated  at  room   temperature   for   20   min   before   they   were   transferred   onto   the   plate   containing   cells.2 FM SP1.

 Luminescence  was   measured   using   Dual-­‐Glo   Luciferase   kit   (Promega)   and   TECAN   luminescence   reader.  Nguyen                                                                                      MiR-125b in Leukemia     Figure   3.   The   mixture   was   shaken   at   RT   for   10   min   before   measurement.   0.5   mM   dNTPs   and   1µL   Superscript   II   reverse  transcriptase  (Invitrogen).  the  medium  was  discarded  by  inverting  the  plate.  The  mixture  was  incubated  at  25oC  for  10  minutes.  42  oC  for  50   11     .   Note   that   in   this   case.T.2   ug   random   primers.D.   shRNA   is   replaced  by  miRNA  but  the  mechanism  of  action  is  similar.   Total   RNA   was   isolated   from   miR-­‐125b   and   miRcontrol   transfected   cells   treated   and   untreated   with   ATRA.   Source:   Promega.  which  is  an  internal   control  of  transfection  efficiency.     Real   time   quantitative   PCR.T.   The   first   strand   cDNA   synthesis   was   performed   in   a   mixture   of   20uL   including   4ug   RNA.   Principle   of   Luciferase   assay.   After  48h  of  co-­‐transfection.   Reagent   2   (Renilla   luciferase   substrate:   buffer   as   1:100)   was   added   after   to   measure  Renilla  luminescence.  Renilla  luciferase  signal.  was  normalized  with  Firefly  luciferase  signal.  which  accounts  for  the  effect  of  miR-­‐125b   on  the  3’UTR  of  the  Renilla  gene.   0.   The   cells   were  lysed  by  lysis  buffer  in  the  first  reagent  of  the  kit  which  also  contained  substrate  for  Firely   luciferase   reaction   (internal   control).

D.  RQ-­‐PCR  primers   Primer  name   Apaf1 hF Apaf1 hR Stat3 hF Stat3 hR Znf148 hF Znf148 hR Etv6 hF Etv6 hR Ppp1ca hF Ppp1ca hR Ppp1ca mF Ppp1ca mR Ppp2ca hF Ppp2ca hR Ppp2ca mF Ppp2ca mR TP53INP1 hF TP53INP1 hR Tp53inp1 mF Tp53inp1 mR MLN51 hF MLN51 hR Actine hF Actine hR 18s mF 18s mR Β-actin mF Β-actin mR   Oligonucleotide  sequence  (5’-­‐>3’)   TTAGCTGCAGAAGCTGTTAGAG CAGTTTCATCAGAAGCCCAGAT AACATCTGCCTAGATCGGCTAG TTGCTGCAACTCCTCCAGTTTC TCCTCAAGGACTACAGTATGCA TGTAAGTCTACTGGCTCTCTGA TGAACCACATCATGGTCTCTGT GTCAGAAAGCAACTGATAGACG GTGCCAGCATCAACCGCATCT GCAGGCAGTTGAAGCAGTCAG CATCTGCAGAGCACATCAGGTT CATCATGGCACCAGCATTGTCA GGTGCCATGACCGGAATGTAG GAGGTGCTGGGTCAAACTGCA ACCAGCTGGTGATGGAGGGAT TTGCAGCTTGGTTACCACAACG CCACCCGTGGGACTGATGAAT GAGCAGCAAGAGCTGCAACATA AACTCAAGTGGTCCCAGAATGG GGGCGAAAACTCTTGGGTTGTT TAATCCCAGTTACCCTTATGCTCCA GTTATAGTAGGTCACTCCTCCATATACCTGT TCCCTGGAGAAGAGCTACGA AGGAAGGAAGGGTGGAAGAG GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGC GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT 12     .  cDNA  product  solution  was  diluted  20  times  with   water  and  5µL  of  the  diluted  solution  was  used  for  real-­‐time  PCR  reaction  with  SYBR  Master  Mix   (Applied   Biosystems)   and   the   following   primers   for   genes   of   interest   (designed   by   Diu   Nguyen.T.  Nguyen                                                                                      MiR-125b in Leukemia   minutes  and  70   oC  for  15  minutes.T.     Table  3.    After  that.   purchased  from  Invitrogen).

  Infected   32DCl3   cells   (1x105   )   at   day   5   of   GCSF   induction   were   spun   using   the   cytospin   (SHANDON)   at   500   rpm   for   5   minutes   on   a   glass   slide   and   then   dried   for   20   minutes   at  room  temperature.   50   mM   HEPES   [pH   7.T.  The  amplified  product  length   ranges  from  100  to  120  bp.  protein  quantification  and  Western  Blot   The   cells   were   harvested   and   lysed   by   ELB   buffer   (250   mM   NaCl.   Complete   drying   of   the   slides   was   followed   before   visualizing   under   microscope   AxioCam  MRc  (Zeiss).0].   50µg   protein   (in   supernatant)   was   denatured   by   NuPAGE   loading   buffer   (Invitrogen)   at   70oC   for   10   min.D.  Unstained   and  stained  untransfected  32DCl3ER  cells  were  used  as  a  control.  Infected  32DCl3ER  (5x105-­‐1x106)  cells  after  5  days  removal  of  IL3  and  addition  of   GCSF   were   washed   in   3   ml   of   2%   FBS   PBS   and   then   resuspended   in   50   uL   of   2%   FBS   PBS   containing   anti-­‐mouse   CD11b   coupled   with   PE-­‐Cy7   at   ratio   of   1:100.   the   slides   were   stained   with   Giemsa   solution   (Sigma-­‐Aldrich)   (1:20   solution   in   water)   for   15   minutes   and   washed   with   water   again.1%   Nonidet   P-­‐40.000   rpm   for   10   min. FACS  analysis.     For   western   blotting.             13     .  PPP2R1B  (Abcam).   The   cell   lysate   was   kept   on   ice   for   30   min   and   centrifuged   at   13.  Cytospun  cell  slides  were  then  stained  with  May-­‐Grunwald  solution  (Sigma   Aldrich)   for   5   minutes   and   washed   with   water   three   times.     Cell  lysis.   5   mM   EDTA)   containing   proteinase   inhibitor   cocktail   (complete   tablet-­‐Roche).   After   that.T.   0.     Morphological   analysis.   The   staining   mixture   was   incubated  at  room  temperature  for  30  minutes  in  dark  and  then  washed  again  in  2%  FBS  PBS  to   remove  all  of  spare  antibodies.   Western   Blots   were   probed   with   the   following   antibodies:   GCK   (MAP4K2)  (Cell  Signaling).  the  stained  cells  were  resuspended  in  500  uL  2%  FBS   PBS  and  analysed  using  Fluorescence  activated  cell  sorting  FACS  LSRII  (BD  Biosciences).  SP1  (Santa  Cruz)  and  CBFB  (Abcam).  Nguyen                                                                                      MiR-125b in Leukemia   Quantitative  PCR  was  performed  on  96  well  plate  using  ABI  7600.   The   supernatant  containing  total  protein  of  the  cells  was  stored  at  -­‐80oC  after  protein  concentration   being  quantified.  After  that.

   In  this  study.   Figure   4   shows   FACS   analysis   on   32DCl3ER   XZ   and   32DCl3ER   XZmiR-­‐125b   at   day   5   after   induction   with   G-­‐CSF   (as   described   in   Materials   and   Methods).T.                   A   Figure   4.  transiently  transfected  into  the  cells.   which   were   transiently   tranfected   with   microRNA   mimics.  Nguyen                                                                                      MiR-125b in Leukemia   RESULTS  AND  DISCUSSION   Confirmation  of  differentiation  blockage  in  32DCl3  cells  by  miR-­‐125b   In   the   previous   work.   In   this   histogram.T.D.   demonstrated   that   the   NB4   cell   line’s   ATRA-­‐induced   differentiation  was  suppressed  by  miR-­‐125b.   Confirmation   of   differentiation   blockage   of   32DCl3ER   XZmiR-­‐125b.   Note   that   as   miR125b  gene  is  incorporated  into  the  genome  of  32DCl3  cells  as  the  result  of  retroviral  vector   infection   the   expression   of   miR-­‐125b   is   constitutive   and   more   physiological   than   in   NB4   cells.   the   result  means  there  are  more  mature  cells  in  32DCl3ER  XZ  (red)  than  that  in  32DCl3ER  XZmiR-­‐125b   (green).  thus  the  level  of  CD11b  as  they  are  conjugated.   Bousquet   M.  The  second  peak   of  the  red  curve  indicates  a  CD11b  positive  population  in  the  32DCl3ER  XZ  while  there  is  no  such   peak   in   32DCl3ER   XZmiR-­‐125b.   we   confirmed   that   miR-­‐125b   had   the   same   effect   on   the   murine   cell   line   32DCl3.   Because   CD11b   is   a   marker   of   differentiated   myeloid   cells.   et   al.   Histogram   FACS   analysis   of   CD11b  (coupled  with  PE)  expression  on  NB4  transfected   with   miR-­‐control   (red)   and   with   miR-­‐125b   (green)   (A)   and   changes   in   morphology   of   May-­‐Grunwald   and   Giemsa   stained   cells   at   day   5   of   induction   of   differentiation   in   32DCl3ER   XZmiR-­‐125b   (C)   compared   to  32DCl3ER  XZ  empty  vector  (B)     14     .   the   horizontal   axis   represents   the   intensity   of   chromophore  PE  (Comp-­‐PE-­‐A).

  1998).   Camptothecin   promotes   apoptosis   by   inhibiting   Topoisomerase   I.  the  first   evidence   has   been   confirmed   with   three   different   cell   lines.   we   also   addressed   the   question   of   whether   miR-­‐125b   is   a   causative   factor   of   leukemia   or   in   other   words.  indicating  that  the  cells   overexpressing   miR-­‐125b   are   more   resistant   to   apoptosis   than   the   control   cells.  It  is  obvious  that  32DCl3ER  XZ  (Figure  4B)  is  more  differentiated  than  32DCl3ER  XZmiR-­‐ 125b  (Figure  4C).  Terminally  differentiated  myeloid  cells  are  typically  characterized  by   multilobulated  and  segmented  shape  of  their  nuclei  and  cytoplasmic  granules  (Sung.  the  removal  of  IL3  results  in  DNA  fragmentation  and   hence   cell   death   (Pommier.   Pourquier   et   al.   In   HL60ER.D.   NB4.   which   detect   apoptosis   and   necrosis   at   an   early   stage.   which   is   necessary   for   DNA   synthesis  In  IL3-­‐dependent  32DCl3ER  cells.  Nguyen                                                                                      MiR-125b in Leukemia   B   C     Figure  4B  and  C  show  the  results  of  cell  staining  (May-­‐Grunwald  and  Giemsa)  of  infected  cells  at   day  5  after  induction.   whether   miR-­‐125b   is   an   oncogene.   Apoptosis  prevention  by  miR-­‐125b  in  HL60  and  32DCl3     In   our   study.  Taken  together.   HL60   and   32DCl3.  Gao  et  al.T.   As   can   be  seen  in  Figures  5A1-­‐2  in  two  independent  experiments  the  proportion  of  Annexin  V  negative   cells  in  HL60ER  XZmiR-­‐125b  is  significantly  greater  than  that  in  HL60XZ.   A   gene   is   considered   to   be   an   oncogene  if  when  mutated  or  in  increased  expression  it  can  cause  (1)  differentiation  blockage  (2)   apoptosis  suppression  and/or  (3)  cell  proliferation  stimulation.  miR-­‐125b  inhibits  granulocytic  maturation  in  the  murine  cell   line  32DCl3.T.   HL60ER   and   32DCl3ER   cells   expressing   miR-­‐125b   at   stable   and   high   levels   were   forced   to   undergo   programmed   cell   death   by   adding   Camptothecin   and   removing   IL3   from   their   culture.  which  distinguishes  cell  death  by  apoptosis  (Annexin  V  positive)  and  necrosis  (Annexin  V   15     .     After   24h   of   induction   for   HL60ER   and   4   days   of  induction  for  32DCl3ER.  This  result  supports  our  data  of  the  previous  work  on  the  human  cell  line  NB4  and   hence  strengthens  the  hypothesis  that  miR-­‐125b  overexpression  blocks  myeloid  differentiation.   To   next   examine   whether   miR-­‐125b   prevents   apoptosis   and   promotes   cell   growth.  the  cells  were  stained  with  only  Annexin  V  or  Annexin  V  and  7AAD  (see   Materials   and   Methods   for   details).   A   clearer   picture   of   this   can   be   seen   in   the   case   of   32DCl3ER   cells   which   were   stained   with   both   Annexin   V   and   7AAD.   respectively.  In  the  case  of  miR-­‐125b.   2006).

 Nguyen                                                                                      MiR-125b in Leukemia   and   7AAD   double   positive).98%  vs  30.T.                         B1   Annexin  V   B2   A1   A2                           B3   B4   16     .   Figures   5B1-­‐4   show   that   the   percentage   of   double   negative   cells   in   32DCl3ER  XZmiR-­‐125b  (live  cells)  was  more  than  twice  as  much  as  those  in  32DCl3ER  XZ  (60.T.15%  and  60.36%).D.81  %   vs  27.

  2004.   Hauses.   Apoptosis   was  induced  by  adding  Camptothecin  (See  Materials  and  Methods)  and  after  24h.  respectively  in  their  3’UTR.  PPP2R1B.   B1-­‐B4:   FACS   dot   plots   of   two   independent  apoptosis  assays  on  32DCl3ER  XZmiR-­‐125b  and  32DCl3ER  XZ.   validation   of   these   putative   targets   by   luciferase   assay   and   western  blot  will  be  presented  and  discussed.  namely  DUSP6.  B1  and  B3  are  duplicates  of   the   cells   infected   with   control   retroviral   vectors   XZ.T.T.   These   genes   are   involved   in   cell   proliferation.   B2   and   B4   are   duplicates   of   the   cells   infected   with   retroviral  vector  XZmiR-­‐125b.   2009.  The  horizontal  axes  represent   Annexin  V-­‐PE  and  the  vertical  axes.                   17     500   400   .   I   used   mRNA-­‐seq   and   RT-­‐PCR   to   find   putative   target   genes   of   miR-­‐125b.    Apoptosis  suppression  by  miR-­‐125b  in  HL60  (A1  and  A2)  and  32DCl3  (B1-­‐B4)   A1-­‐A2:   FACS   histogram   of   two   independent   apoptosis   assays   on   HL60ER   XZ125b   (Red)   and   HL60ER   XZ   (Green).   Yang.   2010.  in  the  ORF  of  MAP4K2.   Selected   plasmids   were   confirmed   to   have   the   binding   sites   by   digestion   with   two   restriction   enzymes   whose   restriction   sequences   are   at   the   ends   of   each   insertion.   2003.   we   first   constructed   vectors   carrying   a   part   of   3’UTR   sequence   of   the   putative   targets  containing  binding  sites  for  miR-­‐125b.   The   horizontal   axes   are   Annexin   V-­‐PE   intensity   indicating   apoptosis   and   the   vertical   ones   are   the   number   of   cells   counted.  they   were   stained   with   Annexin   V   coupled   to   PE.   followed   by   sequencing   of   the   fragments.    Binding  sites  cloning  into  the  psicheck2  vector   To  be  able  to  do  luciferase  assays.  respectively.   2003).   This  resulted  in  the  identification  of  six  candidate  genes.   DUSP6/chk2.   1998.   Zhang.   SP1   and   CBFB.  ETS1/chk2  and   PPP2R1B/chk2  contain  all  three  and  two  binding  sites.  M4K2-­‐1/chk2   and  M4K2-­‐2/chk2  carry  the  first  and  the  second  binding  site.   Tamaki.2/chk2  carry  one  miR-­‐125b  binding  site  in  3’UTR  of  the  corresponding  genes.D.  Fragments  of  the  genes  flanking  the  binding  sites   were   cloned   into   3’UTR   of   the   Renilla   gene   in   psicheck2   (chk2)   vector   (Promega)   using   the   primers   mentioned   in   Materials   and   Methods.   In   the   following   sections.     In   the   first   internship.  which  allow  testing  whether  a  putative  gene  is  a  direct  target   of   miR-­‐125b.   Kundu.  MAP4K2.  7AAD-­‐PE-­‐Cy-­‐5-­‐5  which  indicates  necrosis.  ETS1.  Nguyen                                                                                      MiR-125b in Leukemia   Figure  5.   apoptosis   and   myeloid   differentiation   (Okudela.   CBFB/chk2   and   SP1.

 DNA   ladder  1Kb  plus.T...   M4K2.ttccaactgg ||||||||||||||||||||||||||||||||||||| |||||||||| tttacccagaacagtaacaacccacaccgtcttccttcagggatttccaactgg   SP1.   PPP2R1B.  Nguyen                                                                                      MiR-125b in Leukemia    Figure  6.     Generation  of  binding  site  mutants   Deletion   and/or   substitution   mutations   of   the   binding   sites   were   created   through   site-­‐directed   mutagenesis  (see  Materials  and  Methods)  using  primers  bearing  2-­‐4  mismatched  nucleotides  in   the  binding  sites  complementary  to  the  seed  sequence  of  miR-­‐125b..D.    SP1.  except  empty  psicheck2  vector  (the  band  at   lower  than  100  bp  in  this  lane  probably  is  the  fragment  between  two  recognition  sites  of  XhoI  and   NotI)   indicate   the   inserted   fragments   with   the   expected   sizes   suggesting   that   all   of   the   desired   binding  sites  were  cloned  successfully.  CBFB  XhoI/NotI  .  The  purpose  of  generating   mutated  binding  sites  was  to  provide  necessary  and  sufficient  evidence  that  these  sites  are  direct   targets  of  miR-­‐125b.   SP1   and   CBFB.  M4K2-­‐2  XhoI/NotI.  PPP2R1B  XhoI/NotI..T.  M4K2-­‐1  XhoI/NotI.2  Mut   tttacccagaacagtaacaacccacaccgtcttcctcttaagctttccaactg 18     .2  Del   tttacccagaacagtaacaacccacaccgtcttcctt..  In  this  study.  we  attempted  to  create  mutants  of  seven  substitution  or  deletion  mutants   of   five   putative   targets   DUSP6.agtgtcac |||||||||||||||||||||||||||||||||||| |||||||| tgtgctaaacagtatattacctctgtataaaattcttcagggagtgtcac right:  DUSP6  XhoI/NotI.   however.  I  was  unsuccessful  in  making  mutants  of  M4K2.      Cloning  miR-­‐125b  binding  sites  into  the  3’UTR  of  luciferase  gene  in  the  psicheck2  vector..     PPP2R1B  Mut aagccacgtgttaatgtagtggttgttttggtttttatttgctcaattttgtc |||| | |||||||||||||||||||||||||||||||||||||||||||| aagctcagggttaatgtagtggttgttttggtttttatttgctcaattttgtc   SP1.2  XhoI/NotI.  therefore  the  mutants  were  expected  to  abolish  the  effect  of  miR-­‐125b  in   the  cells.  ETS1  XhoI/NotI.  Left  to       Lower  bands  in  all  the  lanes  in  agarose  gel  (Figure  6)...   DUSP6  Del   tgtgctaaacagtatattacctctgtataaaattct.   due   to   difficulties   around  the  binding  sites..  Figure  7  shows  the  side-­‐ by-­‐side  alignment  between  mutated  and  wild-­‐type  binding  sites  (Blat)..  psicheck2  XhoI/NotI  and  DNA  ladder  1Kb  plus..

  In   addition.  it  can  be  concluded  that  these  two  genes  are  not  direct  targets   of  miR-­‐125b.  Nguyen                                                                                      MiR-125b in Leukemia   |||||||||||||||||||||||||||||||||||| | |||||||||| tttacccagaacagtaacaacccacaccgtcttccttcagggatttccaactg CBFB  Mut   aagtcacaggctggcttctgttttattcatcgatttttttaaaaagtcaa ||||||||||||||||||||||||||||| ||||||||||||||||||| aagtcacaggctggcttctgttttattcagggatttttttaaaaagtcaa   Figure  7..  The  interpretation  of  this  result  is  that   miR-­‐125b   has   no   effect   in   the   stability   of   DUSP6.  the  insertion  of  the  3’UTR  miR-­‐125b  binding  site  of  DUSP6  in  the  Renilla  gene  in  chk2   vector  did  not  result  in  a  decrease  of  Renilla  luminescence.  Del:  Deletion.2   1   0.  Kobayashi  et  al.T.  DUSP6  (has  one  miR-­‐125b  binding  site  in  its  3’UTR)  and  ETS1  (three  binding   sites  in  the  3’UTR)  were  shown  to  be  down-­‐regulated  by  miR-­‐125b  overexpression  at  mRNA  levels   in   NB4   cell   lines.2   0   Q-­‐PCR   mRNA-­‐seq   Q-­‐PCR   mRNA-­‐seq   miRctl   miR125b   A   undifferenqated   differenqated       19     .  apoptosis  and  cell  signaling   DUSP6  and  ETS1   In  the  previous  study.   The   decrease   in   DUSP6   mRNA   level   was   also   confirmed   by   RQ-­‐PCR   in   HL60ER   XZmir-­‐125b   compared   to   HL60ER   XZ.8   0.D.  Alignment  of  wild-­‐type  and  mutated  DNA  sequences  surrounding  the  putative  miR-­‐125b   binding  sites.T.6   0.4   0.   Validation  of  putative  targets  involved  in  cell  proliferation.   The   same   was   observed   with   ETS1   even   though   this  gene  was  predicted  to  be  a  miR-­‐125b  target  by  Targetscan  and  has  three  conserved  binding   sites  (Figures  8  and  9).2010  )     However.   ETS1   was   demonstrated   to   regulate   DUSP6   expression  in  ERK  signaling  pathway  controlling  cell  growth  (Zhang.  The  sequences  complementary  to  seed  sequence  of  mir-­‐125b  are  highlighted  in  yellow.  Therefore.   Relagve  DUSP6  expression   1.  Mut:   substitution.

 The  bars  represent  means  of  relative  expression  measured  from  three   independent  experiments.   C. Fold  change  in  mRNA  level  (mRNA-­‐seq  and  RQ-­‐PCR  data  from  my  first  internship)  in  transiently   transfected  NB4  cell  line.  Chk2  is  empty  psicheck2  vector  and  perfectM  125b  is  chk2  containing  a  sequence  perfectly   20     .  Data  is   represented  with  mean+/-­‐SE.  DUSP6  is  not  a  direct  target  of  miR-­‐125b.         B. Fold  change  in  mRNA  level  (quantified  by  RQ-­‐PCR)  in  stably  miR-­‐125b-­‐expressing  HL60ER.  Nguyen                                                                                                          MiR-125b in Leukemia   B   C     Figure  8.  The  error  bars  indicate  standard  deviation  of  the  means.     A.D. Luciferase  assay  of  3’UTR  of  DUSP6  carrying  one  binding  site  of  miR-­‐125b  and  mutated  binding   site.T.  n  =  2.T.

  B   21     .T.  The  error  bars  indicate  standard  deviation  of  the  means. Fold   change   in   ETS1   mRNA   level   (mRNA-­‐seq   and   RQ-­‐PCR   data   from   the   first   internship)   in   transiently   transfected   NB4   cell   line.   The   bars   represent   means   of   relative   expression   measured   from  three  independent  experiments.8   0.4   Relagve  ETS1  expression   1.2   0   Q-­‐PCR   mRNA-­‐seq   Q-­‐PCR   mRNA-­‐seq   miRctl   miR125b   A   undifferenqated   differenqated                         Figure  9.  Data  represents  means  of  relative  luminescence  units  +/-­‐  SE  of   two  independent  experiments  (n=2).4   0.             ETS1     1.6   0.  ETS1  is  not  a  direct  target  of  miR-­‐125b.2   1   0.T.  Nguyen                                                                                      MiR-125b in Leukemia   complementary  with  miR-­‐125b.     A.D.

  Our   RQ-­‐PCR   results   of   this   gene   in   stably   miR-­‐125b-­‐overexpressed   HL60ER   at   0   and   2   hours   after   induction   of   apoptosis   also   show   a   decrease   in   the   mRNA   level.   MAP4K2   MAP4K2   was   reported   to   be   up-­‐regulated   about   three   fold   during   normal   NB4   cell   maturation   to   granulocytes   (Yang.                         22     .T.  Chk2  is  psicheck2   without   an   insert   and   perfectM   125b   is   chk2   containing   a   sequence   perfectly   complementary   to   miR-­‐125b.  carrying  three  miR-­‐125b  binding  sites.   two   binding   sites   in  the  ORF  of  the  gene  were  inserted  separately  into  psicheck2  and  co-­‐transfected  with  miR-­‐125b   mimics  into  293T  cells.  Nguyen                                                                                      MiR-125b in Leukemia   B.   2003).   It   can   be   seen   from   the   Figure.  Because  of  a  lack  of  consistent  evidence  at  protein  level.   which   plays   an   important   role   in   signaling   pathways   and   cell   responses   to   stress.  HL60ER  XZmiR-­‐125b  (human  cell  line)  and  32DCl3ER   XZmiR-­‐125b   (mouse   cell   line).   there   was   a   clear   decrease  of  this  protein  in  32DCl3ER  XZ125b  compared  to  32DCl3ER  XZ  cells  (empty  vector).   is   modulated   by   miR-­‐125b.  It  is   hard   to   find   a   biological   explanation   for   this   result   having   in   mind   that   both   binding   sites   are   conserved  in  human  and  mouse.D.  namely  NB4  transfected  with  mimics.  Luciferase  assays  revealed  that  they  both  responded  to  miR-­‐125b  and  that   the   first   binding   site   (closer   to   5’UTR)   showed   a   great   effect   (luciferase   activity   decreased   by   more  than  50%  in  comparison  to  the  Chk  control)  than  the  second  site  (Figure  10C)   We   next   examined   the   protein   level   changes   due   to   miR-­‐125b   overexpression   in   different   cell   lines.   Zhao   et   al. Luciferase  assay  with  the  3’UTR  of  ETS1.   This   supports   the   hypothesis   that   MAP4K2.   The   western   blot   results   are   shown   in   Figure   11.   In   order   to   check   whether   or   not   MAP4K2   could   be   a   direct   target   of   miR-­‐125b.T.   Oddly.   It   was   observed   to   be   decreased   at   mRNA   level   during   differentiation   of   NB4   transfected   with   miR-­‐125b   mimics   in   our   previous   study.   Data   represents   means   of   relative   luminescence   units   +/-­‐   SE   of   two   independent   experiments  (n=2).  we  are   unable  to  conclude  whether  or  not  MAP4K2  is  a  direct  target  of  miR-­‐125b.   there   was   almost   no   significant   and   consistent   change   in   MAP4K2   protein   levels   in   transfected   NB4   and   HL60ER   XZ125b   compared   to   the   controls.

2   1   0.D.T.  Nguyen                                                   Relagve  MAP4K2  expression                                        MiR-125b in Leukemia   1.T.8   0.4   0.2   0   Q-­‐PCR   mRNA-­‐seq   Q-­‐PCR   mRNA-­‐seq   miRctl   miR125b                                   A     undifferenqated   differenqated   B   23     .6   0.

 Validation  of  MAP4K2  as  a  potential  target  of  miR-­‐125b.   The   bars   represent   means   of   relative   expression   measured   from  three  independent  experiments.  Nguyen                                                                                      MiR-125b in Leukemia   C     A. Fold   change   in   MAP4K2   mRNA   level   (mRNA-­‐seq   and   RQ-­‐PCR   data   from   the   first   internship)   in   transiently   transfected   NB4   cell   line. Fold   change   in   MAP4K2   mRNA   level   (quantified   by   RQ-­‐PCR)   in   constantly   miR-­‐125b-­‐expressing   HL60ER  before  and  during  apoptosis  induction.   C.     24     .  The  error  bars  indicate  standard  deviation  of  the  means.  Data  is  represented  with  mean+/-­‐SE. Figure  10.T.  n  =  2.T.D. Luciferase   assay   of   luciferase   constructs   containing   two   binding   sites   located   in   the   ORF   of   MAP4K2  (M4K2-­‐1  and  M4K2-­‐2).   B.  Chk2  is  empty  psicheck2  without  an  insert  and  perfectM  125b  is   chk2  containing  a  sequence  perfectly  complementary  with  the  seed  sequence  of  miR-­‐125b.  Data   represents  means  of  relative  luminescence  units  +/-­‐  SE  of  two  independent  experiments  (n=2).     A.

 GAPDH  was  used  as  a  loading  control.5   2   ctl   1.T.  The  bars  are  the  means  of  density  of  the  bands  from  two   independent  experiments. Western  Blot  of  MAP4K2  in  three  cell  lines  NB4.  The  error  bars  represent  the  standard  deviation  of  the  means.  HL60ER  and  32DCl3ER.D.  MAP4K2  protein  quantification       A.   25     .0.     B.5   0   NB4  -­‐RA   HL60   32D   miR125b     B     Figure  11.  Data  was  obtained  using  densitometry  on  blot   films  using  PhotoShop  CS4.  Nguyen                                                                                      MiR-125b in Leukemia   D2  of  transfection   D2  of  transfection   A       2.T.5   1   0. Relative  fold  change  of  MAP4K2  protein  in  miR-­‐125b  transfected/infected  cells  compared  to   controls.

 The  effect  of  miR-­‐125b  was  abolished  when  the  highly  conserved  site  (one  of  the   two  sites)  was  mutated  (Figure  12C).   that   could   not   explain   why   a   significant   reduction   in   protein   level   was   not   detected  in  HL60ER  XZ125b  after  induction  of  apoptosis  when  PPP2R1B  mRNA  dipped  at  30-­‐20%.   for   example   32DCl3.   Western   Blot   in   HL60ER   XZ125b   at   day   0   provided   more   evidence   for   PPP2R1B   being   a   real   target   (Figure   12D).   PPP2R1B   gene   encodes   the   beta   isoform   of   the   constant   regulatory   subunit   A   of   PP2A   and   has   been   found   to   be   mutated.   the   degree   of   protein   reduction   did   not   match   with   the   degree   of   mRNA   level   observed   in   NB4   and   HL60ER.   2006.  luciferase  assay  performed  with  a  fragment  found  in  the  3’UTR  of   the   gene   containing   both   miR-­‐125b   binding   sites   (7mer)   showed   a   reduction   of   luciferase   activity   by  about  55%.   Ramos   et   al.   Yeh.   It   is   necessary   to   repeat   the   same   validation   in   another   constantly   miR-­‐ 125b-­‐expressed   cell   line.   lung   cancer   and   breast   cancer   (Tamaki.  it  could  be  that  low  transfection  efficiency  and  unstable  level  of  the  mimics  in   the  cells  led  to  a  small  reduction  (about  30%)  of  mRNA  resulting  in  undetectable  change  of  the   protein.   This   gene   is   a   component   of   Serine/Threonine   Protein   phosphotase   2   (PP2A).   however.  involved  in  cell  cycle  control  and   growth   factor   signaling.   Apparently.   which   was   found   to   be   down-­‐regulated   at   mRNA   level   in   NB4   cells   after   transfection   with   miR-­‐125b.  Nguyen                                                 PPP2R1B                                        MiR-125b in Leukemia   The   next   target   candidate   to   be   validated   at   the   protein   level   is   PPP2R1B.   Esplin.   cervical   cancer.   However.   inactivated   or   deleted   in   many   types   of   cancers.   an   important   enzyme   that   down-­‐ regulates  the  mitogen-­‐activated  protein  kinase  (MAPK)  cascade.   such   as   colorectal   cancer.D.   2004.   compared   to   the   control.   Relative   PPP2R1B   mRNA   level   in   HL60ER   XZ125b   was   also   dramatically   decreased   by   more   than   50%   and   further   dropped   by   approximately  70-­‐80%  (2h  and  4h)  compared  to  the  controls  after  apoptosis  was  induced  in  the   cells  by  Camptothecin.   Hsieh   et   al.   to   be   able   to   draw   a   satisfactory   conclusion   of   whether  PPP2R1B  is  a  direct  miR-­‐125b  target.T.               26     .  indicating  that  PPP2R1B  is  potentially  a  direct  target  of  miR-­‐ 125b.     In  the  next  step  of  validation.   Goi   et   al.   Given   that   miR-­‐125b   overexpression   in   NB4   was   achieved   by   transient   transfection   while   in   HL60ER   it   was   obtained   through  infection.   2007).T.   the   western   blot   in   NB4   transfected   with   miR-­‐125b   mimics   and   HL60ER   XZmir-­‐125b   during   apoptosis   (Figure   12D).

  C.  Data  is  represented  with  mean+/-­‐SE  .     A.8   0.2   1   0.  Validation  of  PPP2R1B  as  a  potential  target  of  miR-­‐125b.6   0.4   0. Luciferase  assay  of  3’UTR  of  PPP2R1B  with  two  binding  sites  and  3’UTR  with  one  mutated  binding   site  (PPP2R1B  Mut1). Fold  change  in  PPP2R1B  mRNA  level  (mRNA-­‐seq  and  RQ-­‐PCR  data  from  the  first  internship)  in   transiently  transfected  NB4  cell  line.T.  Nguyen                                                                                      MiR-125b in Leukemia     Relagve  PPP2R1B  expression   1.2   0   Q-­‐PCR   mRNA-­‐seq   Q-­‐PCR   mRNA-­‐seq   miRctl                 B   undifferenqated   differenqated                           A   C   Figure  12.  n  =  2.D. Fold  change  in  PPP2R1B  mRNA  level  (quantified  by  RQ-­‐PCR)  in  constantly  miR-­‐125b-­‐expressing   HL60ER  before  and  during  apoptosis  induction.   B.  Chk2  is  empty  psicheck2  without  an  insert  and  perfectM  125b  is  chk2   27     .T.

    D2  of  transfection   D2  of  transfection     D.  namely  CD11b  and  HCK.  one  site  7mer  and  two  sites  6mer)  and  2  others  in  the   3’UTR  (one  site  7merA  and  one  site  6mer).  it  was  shown  to  be   decreased   at   mRNA   level   by   miR-­‐125b   overexpression   in   NB4   cells   during   RA-­‐induced   differentiation.  No  reduction  was  observed  in   NB4  transfected  with  miR-­‐125b  mimics  and  HL60ER  XZ125b  after  4h  of  apoptosis  induction.   there   are   several   binding   sites   of   miR-­‐125b   along   the   SP1   mRNA   sequence.     28     .    First.   Second.D. PPP2R1B  protein  levels  in  HL60ER  XZ125b  compared  to  the  control.  Nguyen                                                                                      MiR-125b in Leukemia   containing  a  sequence  perfectly  complementary  with  5’strand  of  miR-­‐125b.       Validation  of  putative  targets  involved  in  myeloid  differentiation   SP1   In  my  previous  study.   we   observed   the   consequential   down-­‐regulation   of   down-­‐stream   SP1   targets.T.  SP1  was  found  to  be  a  promising  miR-­‐125b  target.   including  4  sites  in  the  ORF  (one  site  8mer.   Third.T.  whose  regulation  of  transcription  is  typically  achieved  through   binding   of   SP1   to   the   promoter   regions.     Note   that   these   two   genes   are   essential   for   cell   differentiation.  Data  represents   means  of  relative  luminescence  units  +/-­‐  SE  of  two  independent  experiments  (n=2).

  SP1.    The  two  binding  sites  in  3’UTR  were  put  into   two  separated  clones.   Furthermore.  No  change  in  the  protein  level  of   SP1  was  observed  in  NB4  treated  with  RA  while  the  reduction  observed  in  32DCl3ER  XZ125b  and   HL60ER   XZ125b   was   not   significant.     1.2   0   Q-­‐PCR   mRNA-­‐seq   Q-­‐PCR   mRNA-­‐seq   miRctl   miR125b   undifferenqated   differenqated       A   29     .   luciferase   expression   was   recovered   significantly   when   the   site   was   mutated   or   deleted  (Figure  13B).  Nguyen                                                                                      MiR-125b in Leukemia   To  further  examine  the  possibility  that  SP1  is  a  real  target  of  miR125b  and  to  indentify  which  of   the  6  binding  sites  has  the  main  response  element  of  miR-­‐125b.8   0.   However.T.6   0.  a  fragment  containing  all  binding   sites  in  the  ORF  was  cloned  in  the  vector  psicheck2.2   Relagve  SP1  expression   1   0.D.   We   therefore   conclude   that   SP1   is   not   a   direct   target   of   miR-­‐ 125b  in  promyelocytic  cell  lines.2   (7merA)   responded   strongly   to   miR-­‐125b   leading   to   a   reduction   of   about   45%   of   luciferase   activity   (Figure   13B).   the   verification   by   Western   Blotting   did   not   support   conclusively   the   results   from   mRNA  quantification  and  luciferase  assay  (Figure  13C  and  D).  Luciferase  assays  on  the  ORF  binding  sites  altogether  and  the  second  site  in   3’UTR   showed   no   effect   (data   not   shown)   whereas   the   first   3’UTR   site.4   0.T.

6   0.4   0.T.8   0.4   1.  Nguyen                                                                                      MiR-125b in Leukemia   B       C     1.2   0   NB4  +RA   HL60   32D   ctl   miR125b       D   30     .2   1   0.D.T.

  Western   Blot   and   Protein   quantification   by   densitometry   shows   inconsistent   and   insignificant  reduction  in  SP1  protein  under  overexpression  of  miR-­‐125b.D.  TargetScan.   the   reduction   was   still   observed   when   the   cells   (NB4   and   32DCl3)   underwent   differentiation   (Figure   17A).     The  western  blots  strongly  indicate  that  CBFB  might  indeed  be  a  direct  target  of  miR-­‐125b.  Data  represents  means  of  relative   luminescence  units  +/-­‐  SE  of  two  independent  experiments  (n=2).   The   reduction  was  about  30%  in  NB4  at  day  2  of  transfection.   there   was   an   approximate   1.  PicTar  and   MiRanda   (Iorio.  The   protein   levels   were   compared   between   control   cells   and   miR-­‐125b   transfected/infected   cells   (NB4.   Based   on   the   mRNA-­‐seq   and   RQ-­‐PCR   data.   Kundu.  Nguyen                                                                                      MiR-125b in Leukemia   Figure  13.   2005).  Validation  of  SP1  as  a  potential  target  of  miR-­‐125b.   2000.  HL60  and  32DCl3)  before  and  during  differentiation.  The  hypothesis  therefore  would   be   that   miR-­‐125b   destabilizes   CBFB   mRNA   (in   both   undifferentiated   and   differentiated   cells). Luciferase   assay   with   miR-­‐125b   binding   site   in   3’UTR   of   SP1   and   its   two   mutations   (a   deletion   and   a   substitution).     We  cloned  two  miR-­‐125b  binding  sites  of  CBFB  (one  located  in  the  ORF  and  another  one  in  the   3’UTR)   separately   and   co-­‐transfected   each   clone   with   miR-­‐125b   into   293T   cells.  Kundu  and  Liu  2003. Fold   change   in   SP1   mRNA   level   (mRNA-­‐seq   and   RQ-­‐PCR   data   from   the   first   internship)   in   transiently  transfected  NB4  cell  line.   Interestingly.   suppressing   around   45%   of   luciferase   activity   (Figure   16A).     CBFB   Core   binding   factor   beta   is   one   of   the   two   putative   targets   involved   in   myeloid   differentiation.     A.     B.  Consistent  with  the  data  from  mRNA   quantification.T.  indicating  that  the  MRE  but  not  any  other  sequences   within  the  3’UTR  cloned  is  sufficient  to  respond  to  the  regulation  of  miR-­‐125b. and   D.   C.   Chk2   is   empty   psicheck2   without   an   insert   and   perfectM   125b   is   chk2   containing   a   sequence  perfectly  complementary  with  5’strand  of  miR-­‐125b.6   fold   decrease   in   mRNA   level   of   this   gene   in   miR-­‐125b   transfected   NB4   cells   before  induction  of  differentiation  (Figure  15).   Adya   et   al.   which   indicated   no   significant   change   after   RA   induction.  de  Bruijn  and  Speck  2004).  35%  in  HL60  at  day  0  after  infection  and   25%   in   32DCl3   at   day   0   after   infection   (Figure   17A   and   B).  2002.   Chen  et  al.   this   does   not   match   the   mRNA   data   (Figure   15).   31     .   However.   this   enormous   suppression   was   completely   disabled   when   only   two   nucleotides   in   the   MRE   (mirna   responsive   element)  were  replaced  (Figure  16A  and  B).   early   staged   progenitors   of   myeloid   lineages   and   mature   myeloid   cells   (Blake.   CBFB   protein   quantity   was   reduced   before   induction   in   all   three   cell   lines.     It   was  predicted  by  three  independent  miRNA  target  prediction  softwares.   The   explanation   for   this   could   not   be   that   the   gene   becomes   inactivated   after   RA   addition   because   CBFB   is   demonstrated   to   be   highly   expressed   in   hematopoietic   stem   cells.T.   The   site   in   the   ORF   had   no   effect   (data   not   shown)   while   the   site   in   3’UTR   was   clearly   targeted   by   miR-­‐125b.   Ferracin   et   al.   Interestingly.

T.  Q-­‐PCR  data:  n=3.T.2   1   0.   1.  mRNA  seq  data:  n=2.4   0.6   0.   A       32     .D.8   0.  Data  represents  means  +/-­‐  standard  error  of  the  mean   (SE)  normalized  to  control.  We  propose  that  CBFB  is  a  direct   target  of  miR-­‐125b  in  promyelocytic  cell  lines.   Because   CBFB   is   essential   for   myeloid   differentiation   (as   discussed   in   the   first   report).   mRNA   levels   of   CBFB   measured   by   mRNA-­‐seq   and   Q-­‐PCR   before   and   after   induction   of   differentiation  (normalized  to  Actine  and  MLN51).  Nguyen                                                                                      MiR-125b in Leukemia   subsequently   leading   to   a   decrease   in   protein   levels.4   Relagve  CBFB  expression   1.2   0   miRctl   Q-­‐PCR   mRNA-­‐seq   Q-­‐PCR   mRNA-­‐seq   undifferenqated   differenqated     Figure   15.   the   reduction   in   CBFB   protein   may   explain   the   blockage  of  differentiation  observed  in  NB4  and  32DCl3  cells.

T.T.  Empty  vector  (chk2)  and  vector   containing  perfect  match  sequence  with  miR-­‐125b  (PerfectM  125b)  are  used  as  controls.D.     D2  of  transfection   D2  of  transfection   D2  of  transfection   A       33     .  (B)  Alignment  of   wild-­‐type  CBFB3’UTR  and  mutated  CBFB3’UTR  with  miR-­‐125b.  Replaced  nucleotides  are  in  red.  Relative  luciferase  activity  is  presented  as   means  +/-­‐SE  of  n=2  independent  experiments  in  relation  to  controls  (n=1).  Nguyen                                                                                      MiR-125b in Leukemia   B     Figure  16.  (A)  Dual-­‐luciferase  reporter  assay  of  HEK293T  cells  co-­‐transfected  with  Luc-­‐CBFB3’UTR/chk2   or  Luc-­‐CBFB3’UTR-­‐Mut  and  miR-­‐125b  or  mircontrol  mimics.

 Reduction  in  CBFB  protein  level  under  the  effect  of  miR-­‐125b  was  observed  in  three  different   cell  lines  .013   P=  0.  Statistical  significance  of  the  difference  between  the   control  and  the  experimental  cells  were  performed  using  T-­‐test  with  p-­‐values  on  the  top  of  the  bars  of   each  group.11)(p21.2   1   0.28   P=  0.   Data  represents  means  of  relative  density  of  the  bands  on  western  blotting  films  +/-­‐  SE  of  three   independent  independent  experiments  with  NB4  (D2  of  transfection)  and  HL60  (D0).   validating   six   putative   targets   of   miR-­‐125b   which   were   found   in   the   first   internship:   DUSP6.   2008)   and   second.  and  of  two   independent  experiments  with  all  other  groups.6   0.   ETS1.  PPP2R1B.8   0.     GENERAL  DISCUSSION  AND  CONCLUSION   We   I   achieved   two   goals   of   the   project.17   P=  0.  32DCl3ER  infected  with  XZ  or  XZmiR-­‐125b  at  day  0.  HL60ER   infected  with  XZ  or  XZmiR-­‐125b  at  day  0  (triplicate).11   ctl   miR125b   B       Figure  17.   NB4  transfected  with  miR-­‐125b  at  day  2  after  differentiation  induction  with  retinoid  acid  (RA).2   0   P=  0.q23)   (Bousquet.  Nguyen                                                                                      MiR-125b in Leukemia   Relagve  CBFB  expression  to  GAPDH   1.T.D.T.4   0.   first   obtaining   more   in   vitro   evidence   to   support   the   hypothesis   that   miR-­‐125b   is   the   causative   factor   of   leukemia   (AML   and   MDS)   which   carry   the   chromosomal   translocation   t(2.     34     .11   P=  0.003   P=  0.(B)  Protein  quantification  by  densitometry  (B).  NB4  at  day  2  of  transfection  (triplicate).   Quelen   et   al.  SP1  and  CBFB.  (A)  Data  from  Western  Blot  in  three  different  cell  lines.   MAP4K2.   day  1  and  day  4  after  induction  of  differentiation  by  GCSF.

  they   were   predicted   to   be   miR-­‐125b   targets   with   highly   conserved   binding   sites.  Okudela.  Okudela.   In   the   primary   study.   together   with   the   evidence   that   mRNA   levels   of   these   two   genes   decreased  by  induction  of  the  microRNA  lead  us  to  think  that  these  genes  were  miR-­‐125b  direct   targets   (see   Results   and   Discussion).   by   which   it   is   possible   to   select   cells   expressing   miR-­‐125b.   (2009)   it   was   shown   to   block   apoptosis   in   this   cell   line   as  well.   the   reduction   of   the   messengers   was   not   large   enough   to   be   significantly   different   from   the   control.   Furthermore.  Sunamura  et  al.  I  propose  that  the  decrease  in   mRNA   levels   of   both   DUSP6   and   ETS1   could   be   the   result   of   the   regulation   of   some   up-­‐stream   direct  targets  of  miR-­‐125b.   this   may  not  be  the  case  of  PPP2R1B.  Yazawa   et   al.   However.  of  which  mRNA  data  from  NB4  indicated  that  about  40%  of  its   total   transcripts   were   degraded   by   miR-­‐125b.  2009)  and  ETS1  involved  in  a  variety  of   cellular  processes  including  cell  proliferation  and  apoptosis.  there  is  still   a   raising   controversy   of   whether   this   is   physiologically   relevant.  Nguyen                                                                                      MiR-125b in Leukemia   MiR-­‐125b   has   been   proven   to   possess   typical   features   of   an   oncomir..   However.   all   miR-­‐125b   target   sequences   in   the   six   gene   candidates   were   tested   in   the   luciferase   reporter   assay   and   protein   quantification   by   immunoblotting.  .T.     The   next   three   putative   targets.     In   this   study.  Yazawa  et  al.   Our   attempt   to   look   for   a   system   that   stably   expresses   miR-­‐125b   in   a   more   physiological   degree   led   to   the   modification   of   two   cell   lines.  Interestingly.   2009).   DUSP6   has   been   demonstrated   to   be   a   member   of   the   ERK   signaling   pathway   which   controls   cell   growth   (Furukawa.D.  2010  (unpublished).   in   unpublished   data   by   Bousquet   M.   when   it   came   to   protein   quantification   in   vivo   the   results   were   ambiguous.T.   PPP2R1B   and   SP1   all   passed   the   validation   by   the   luciferase   reporter   assay.     The   hurdle   in   accomplishing   a   physiological  overexpression  lies  in  the  inability  of  the  NB4  cell  line  to  harbor  a  retroviral  vector   carrying   miR-­‐125b.  The  data  from  FACS  analysis  and  morphological  observation  on   32DCl3ER   XZ125b   and   HL60ER   XZ125b   presented   here   strengthens   our   conclusion   from   the   previous  study  that  miR-­‐125b  inhibits  maturation  of  myeloid  progenitors  and  apoptosis.  Note  that  the  means  of  overexpressing  miR-­‐125b  in  these  experiments  was  through  the   introduction   of   an   immense   amount   of   mature   microRNA   directly   into   the   cells   through   electroporation.  Kobayashi  et  al.   The   modification   of   the   cell   lines   and   the   selection   were   done   and   will   be   described   in   detail   by   Bousquet  M.   MAP4K2.   In   HL60ER   where   miR-­‐125b   was   expressed   constantly.   miR-­‐125b   prevented   cells   from   developing   into   mature   granulocytes.  a  recent  study  revealed   that  ETS1  actually  regulates  the  expression  of  DUSP6  (Zhang.   However.   our   results   suggest   that   they   are   not   real   direct   targets  because  we  did  not  observe  changes  in  the  protein  levels.  2003.   HL60   and   32DCl3   into   the   ones   bearing   murine   ecotopic   receptors   on   their   cellular   membrane   (namely   HL60ER   and   32DCl3ER).   It   is   possible   that   in   the   case   of   MAP4K2   and   SP1.   which  allow  them  to  be  infectable  by  murine  retrovirus.  therefore  although  the  phenotypes  were  undoubted  and  impressive.   Later.  Another  advantage  of  this  method  is  that   the   vectors   also   contain   GFP.   when   up-­‐regulated   in   NB4   cells.   the   decrease   was   greater   (approximate   45%   at   day   0)   and   became   even   more   35     .   All   of   this.

  which   seems   to   be   more   sensitive   (Gururajan.  It  is  mostly  the  concentration  of  proteins  and  the  interaction  among   them  that  are  the  true  causative  factors  and  therefore.   It   could   be   argued   that   there   are   other   factors   affecting   translation.   but   the   quantification   by   western   blot   did   not   support   this.  Nguyen                                                                                      MiR-125b in Leukemia   dramatic   when   apoptosis   was   induced   (about   65%   after   2h   and   75%   after   4h   of   Camptothecin   addition).   a   recent   study   has   found   an   alternative   way.   There   is   another   important   point   that   needs   to   be   discussed   in   microRNA   target   studies   in   general  and  this  work  in  particular.  Yagi  et  al.   Shigesada   et   al.11)(p21.   if   only   half   of   the   normal   level   of   some   protein  is  enough  for  the  cell  to  perform  its  role  in  a  cell.q23)  translocation.g.  Haga  et  al.   Adya   et   al.  a  50%  reduction  of  that  protein  would   unlikely   to   have   a   biological   effect.   Colangelo   et   al.   Even   though   mRNA  levels  have  been  proven  to  be  very  useful  in  the  diagnosis  of  diseases  (e.  Nevertheless.  2003).   In   fact.   For   example.   2001.   Nevertheless.   even   a   huge   decrease   of   mRNA   makes   no   difference.  In  general.   flow   cytometry   using   chromophore-­‐coupled   antibodies.  cancers).   immune-­‐ blotting   has   been   the   only   choice   used   in   the   majority   of   the   microrna   targets   research.   2000.   the   cells   are   not   in   a   high   demand   of   the   protein   so   only   a   small   proportion   of   the   synthesized   mRNA   are   used   to   produce   a   basal   level   of   PPP2R1B   and   therefore.T.  This  review  also  pointed  out  one  reason  which   was   that   even   with   the   significant   development   in   the   technologies   used   to   measure   protein   quantity   over   the   past   few   years.   On   the   other   hand.  Blake.  Another  explanation  to  all  the  results  observed  in  these  three  putative  targets  is  the   technical  limitations  of  western  blot  (nonspecificity  of  the  antibodies  or  low  sensitivity).  1996.  their  quantities  should  be  studied  in  much   greater   detail   (Greenbaum.   Such   a   tremendous   reduction   in   mRNA   was   expected   to   result   in   a   drop   in   the   translation   yield   of   PPP2R1B.   Huang.   it   is   necessary   to   generate   the   same   phenotype   of   blockage   of   myeloid   differentiation   in   the   tested   cell   lines   by   siRNA  in  order  to  draw  a  firm  conclusion.   the   correlation   between   mRNA   and   protein   abundance   data   was   reported   to   be   low   or   limited   for   all   three  genes  (Greenbaum.T.  Colangelo  et  al.D.   Taken   these   points   into   account   when   considering   CBFB   as   a   real   target   of   miR-­‐125b.   To   the   best   of   our   knowledge.  if  the  detected  down  regulation  in  protein  level  is   small   but   statistically   significant.2010).  they   are  correlative  not  causative.  a  small   difference   between   the   experimental   and   the   control   samples   could   not   be   detected.   2003).   for   instance.   a   phenotype   caused   by   overexpression   of   a   microRNA   could   be   the   collective   outcome   of   small   changes   in   many   of   its   targets.   protein   quantification   and   identification   still   lags   behind   the   advanced   and   high-­‐throughput   techniques   used   for   mRNA   level   determination.     36     .   Kundu   and   Liu   2003)   supports   the   notion   that   CBFB   might   be   a   direct   target   of   miR-­‐125b   and   along   this   way   involved   in   the   origin   of   leukemias   characterized  by  a  t(2.   as   the   final   step   of   determining   true   targets.  the  correlation  between  our  data  and  the   physiological  underlyings  that  have  been  demonstrated  for  CBFB  (Sasaki.   the   question   is   what   magnitude   of   down-­‐regulation   in   protein   level   can   lead   to   a   change   in   phenotype.

  Jan   Kooter   for   helpful   lectures.  Shigesada.  G.  (1998).T.  (2006).  (2004).  G.  Slack  (2006).  biogenesis..  Victor  Yeh  and  Violeta   Rayon  for  their  proofreading  this  report  and  fruitful  discussion.  et  al."  Am  J  Pathol  162(6):  1807-­‐15.  "Comparing  protein  abundance  and  mRNA  expression  levels  on   a  genomic  scale.  Sunamura..   Esquela-­‐Kerscher.  M."  Genes   Chromosomes  Cancer  45(2):  182-­‐90.  D.  Fabbri."  Genome  Biol  4(9):  117."  Trends  Mol  Med   12(12):  580-­‐7.  "Potential  tumor  suppressive  pathway  involving  DUSP6/MKP-­‐3   in  pancreatic  cancer.  C.  and  S.   I   thank   Dr.  and  function."  EMBO  J  20(4):  723-­‐33..  R.   37     .  et  al.  et  al.  T.  M.  comments  on  the  report  and  a  great  friendship.  Gordon  (1998).  et  al."  J  Leukoc  Biol  63(2):  153-­‐68."  Blood  96(13):  4178-­‐84.   Bartel.   Bingbing   Yuan   and   George   Bell   with   their   help   on   gene   function   and   network  analysis.   Calin.   Whitehead   Institute   for   helping   with   mRNA-­‐seq   data   analysis.  "Dimerization  with  PEBP2beta  protects  RUNX1/AML1  from   ubiquitin-­‐proteasome-­‐mediated  degradation.  "MicroRNA  125b  inhibition  of  B  cell  differentiation  in  germinal  centers.."  Nat  Rev  Cancer   6(4):  259-­‐69.  "Ultraconserved  regions  encoding  ncRNAs  are  altered  in  human   leukemias  and  carcinomas.  I  thank   Sumeet   Gupta   and   all   the   staff   in   Genomic   Core   facility.  A.  G.  S.  C.  Adya.  I  thank  all  the  Lodish  lab  members  for  technical  support.  (2007).  Liu."  Nat  Rev  Cancer  6(11):  857-­‐ 66.       REFERENCES   Bartel.  E.  P."  Int   Immunol  22(7):  583-­‐92.  Tonjes.  (2000)..  C..  "Myeloid  cell  differentiation  arrest  by  miR-­‐125b-­‐1  in   myelodysplastic  syndrome  and  acute  myeloid  leukemia  with  the  t(2.  J.  K.   Clarke.  T.   Marina   Bousquet   for   all   the   techniques   teaching.  (2008).  A.  (2003).  N.  (2009)."  J  Biol  Chem  273(48):  31844-­‐52.  "The  glycine  90  to  aspartate  alteration  in  the  Abeta  subunit  of  PP2A   (PPP2R1B)  associates  with  breast  cancer  and  causes  a  deficit  in  protein  function.   Calin."  J   Exp  Med  205(11):  2499-­‐506.  P.  Haga.  M.   Harvey   Lodish   for   providing   me   with   the   stipend.  M.  "Myeloid-­‐specific  gene  expression.   Blake."  Cancer  Cell  12(3):  215-­‐29.  "The  transcription  factor  Sp1  regulates  the  myeloid-­‐specific   expression  of  the  human  hematopoietic  cell  kinase  (HCK)  gene  through  binding  to  two  adjacent   GC  boxes  within  the  HCK  promoter-­‐proximal  region..   Furukawa.  Quelen.  (2006).  daily  supervising  on  the  project.  P..  D.  M.  "MicroRNA  signatures  in  human  cancers.  (2003).  et  al.  (2001).   Esplin."  Cell  116(2):  281-­‐97.  A.  et  al.  Nguyen                                                 ACKNOWLEDGMENT                                        MiR-125b in Leukemia   I  thank  Nuffic  (Netherlands  organization  for  higher  education)  and  Vrije  Universiteit  Amsterdam   for   the   studentship..   advice   and   comments   on   the   report.  Croce  (2006).  M.  et  al.   Greenbaum.   Hauses.  "MicroRNAs:  target  recognition  and  regulatory  functions.  "MicroRNAs:  genomics.  "Oncomirs  -­‐  microRNAs  with  a  role  in  cancer.  L.  "Zebrafish  homolog  of  the  leukemia  gene  CBFB:  its  expression  during   embryogenesis  and  its  relationship  to  scl  and  gata-­‐1  in  hematopoiesis.D.   Garzon."  Cell  136(2):  215-­‐33.  et  al.  D.  et  al.  et  al.   My   special   thanks   to   Prof.  D.  "MicroRNA  expression  and  function  in  cancer.   Huang.   general   laboratory   support   and   a   great   supervision.   to   Dr.  R.  and  C.  mechanism.q23)  translocation.  Colangelo.11)(p21.   Gururajan.  G.  R.  and  F..T.   Bousquet.  C.  Ramos.

 et  al.  et  al.  (1998)."  Cancer  Res  69(18):  7459-­‐65.T.  Pourquier."  Biochim  Biophys  Acta  1400(1-­‐3):  83-­‐105.  P.  L."  Proc  Natl  Acad  Sci  U  S  A  93(22):  12359-­‐63.  Tenen  DG.  T.  T.  1993  Apr  15.   Saetrom.  "Down-­‐regulation  of  DUSP6  expression  in  lung  cancer:  its  mechanism   and  potential  role  in  carcinogenesis.  "Absence  of  fetal  liver  hematopoiesis  in  mice  deficient  in  transcriptional   coactivator  core  binding  factor  beta..  Y.  K.  S.  et  al.  (2009)."  Nat  Genet  38(11):  1323-­‐8.  "An  androgen-­‐regulated  miRNA  suppresses  Bak1  expression  and  induces   androgen-­‐independent  growth  of  prostate  cancer  cells.  "Gene  expression  profiling  during  all-­‐trans  retinoic  acid-­‐induced  cell   differentiation  of  acute  promyelocytic  leukemia  cells.  L."  Blood  Cells  Mol  Dis  30(2):  164-­‐9.   Kundu.  et  al..."  J  Mol  Diagn  5(4):  212-­‐21.  "A  risk  variant  in  an  miR-­‐125b  binding  site  in  BMPR1B  is  associated   with  breast  cancer  pathogenesis.  et  al.  et  al.  H.  L.  as  shown  in  figure  18A-­‐18C.  V.  et  al.   Le.   Sung.  P.  Nguyen                                                                                      MiR-125b in Leukemia   Iorio."  Genes  Dev  23(7):   862-­‐76.  (2009)."  Oncol  Rep  11(3):  655-­‐9.  B."  Int  J  Gynecol  Cancer  17(4):  868-­‐71.268(11):8230-­‐9.   Shi.  Scheibe  RJ.  Gao.  Zhao.  Y.  Yagi.  M.  “The  Sp1  transcription  factor  binds  the  CD11b   promoter  specifically  in  myeloid  cells  in  vivo  and  is  essential  for  myeloid-­‐specific  promoter   activity.  see  internship  report  1.  Z.  L.  Xue.  K.  (2009).  P.  et  al.  and  P.T.  S.."  Am  J  Pathol  175(2):  867-­‐81.  (1993).  (2003).   Pommier.   Tamaki.   Zhang.”  J  Biol  Chem.  C.  (2004).  Goi.  M.  Y.   APPENDIX   Searching  for  other  putative  targets   A  number  of  other  candidates  chosen  from  both  the  list  of  mRNA-­‐sequencing  data  and  literature   review  were  also  tested  by  RQ-­‐PCR  and  luciferase  assays..  (1996).  et  al.  T."  Proc  Natl  Acad  Sci  U  S  A  104(50):  19983-­‐ 8.  "Differentiated  cells  are  more  efficient  than  adult  stem  cells  for  cloning  by   somatic  cell  nuclear  transfer..   Sasaki.  Yazawa..  et  al.  Ferracin.  (2007).       38     .  Liu  (2003)..  Teh.  M.     Chen  HM.  et  al.  "MicroRNA  gene  expression  deregulation  in  human  breast  cancer."   Cancer  Res  65(16):  7065-­‐70.  "Dual  specificity  phosphatase  6  (DUSP6)  is  an  ETS-­‐regulated  negative   feedback  mediator  of  oncogenic  ERK  signaling  in  lung  cancer  cells.  Zhang  DE.  "MicroRNA-­‐125b  is  a  novel  negative  regulator  of  p53..  H.  X.  Pahl  HL.  (2007).  M.  et  al.   Yeh.  (2005).  Kobayashi.   Yang.D.   Okudela.  "PPP2R1B  gene  alterations  inhibit  interaction  of  PP2A-­‐Abeta  and  PP2A-­‐C   proteins  in  colorectal  cancers.  For  mRNA   sequencing  data  and  biological  pathways  of  these  genes.  Y."  Carcinogenesis  31(4):  577-­‐86.  S.  "Cbf  beta  is  involved  in  maturation  of  all  lineages  of  hematopoietic  cells   during  embryogenesis  except  erythroid.  (2006).  M.  "Mechanism  of  action  of  eukaryotic  DNA  topoisomerase  I  and   drugs  targeted  to  the  enzyme.  J..  Hsieh...  Biesinger.  "Mutation  analysis  of  the  tumor  suppressor  gene  PPP2R1B  in  human   cervical  cancer.

4   Relagve  expression     1.  which  is  considered  as  1  or  100%.   respectively.8   1.   The image cannot be displayed.   Fold   change   of   expression   of   three   genes.  The  blue  and  green  bars   indicate   the   expression   of   corresponding   genes   in   NB4   and   HL60ER   transfected   or   infected   with   miR-­‐ control.2   1   0.   under   miR-­‐125b   overexpression   at   different   time   points   during   apoptosis   induction.   all   involved   in   apoptosis. If the red x still appears.2   0   APAF1   ETV6   STAT3   ZNF148   HL60  miRctl   HL60  miR125b   NB4  miRctl   NB4  miR125b     Figure  18A. you may have to delete the image and then insert it again.  The  data  correspond  to  the  mean  from  two   independent  experiments.T.T.   Figure   18B. Restart your computer.  APAF1.   The   data   correspond  to  the  mean  from  at  least  two  independent  experiments.  ETV6.6   0.  Fold  change  of  expression  of  four  genes.4   0.  Nguyen                                                                                      MiR-125b in Leukemia   1. or the image may have been corrupted.  STAT3  and  ZNF148.  respectively.   PPP1CA.  The  red  and  violet  bars  represent  the  expression  of   corresponding   genes   in   NB4   and   HL60ER.  under  miR-­‐125b   overexpression.6   1. and then open the file again.D.  measured  by  RQ-­‐PCR  in  transfected  NB4  and  infected  HL60ER.   transfected   or   infected   with   miR-­‐125b.   39     .   PPP2CA   and   TP53INP1.8   0. Your computer may not have enough memory to open the image.   measured  by  RQ-­‐PCR  in  the  infected  HL60ER  and  32DCl3ER.

D.T.  thus.   no  result  of  luciferase  assay  is  available  for  it  here.  Empty  vector  (chk2)  and  vector  containing  perfect   match  sequence  with  miR-­‐125b  (PerfectM  125b)  are  used  as  controls.  The  binding  site  of  ETV6  was  not  successfully  cloned  into  psicheck2.T.     40     .  Luciferase  activity  is  reduced  significantly  with  the  binding  sites  in  most  of  the  genes  tested   by  RQ-­‐PCR  in  figure  18A  and  B.  Nguyen                                                                                      MiR-125b in Leukemia     Figure  18C.