O IOAN NANET,A DEscrFnîun TATNELE EREDrrAlrr

LUCIAN GAVRILA
VOL.

I

,:l

CoPErtA dE EPAI}TINONDA TIOTIU

Blank page intentionally inserted

4

PREFATA

Nu eristd un alt domeniu al biologiei atit d.e dinamic co. cel lor sncinn de a scrte a &r,te dp Genetied, este' fmrt'e d,ificild, cdci, m,enfinerea tn acfumlitatn docurnentdrii reprezintd, o adeudnatd cursd. conhw-crwtnmetru, dabele stiingifice, unele de rutinó,, iar altele foarte noi, sau chinn nebdnuite pnd deunózi, apdrînd Tnintr-ttm adeadmt fenonterL de aualangd
ala

gemeticii.

inf o,rmnpictrtald.

'Iotodatd, fenvmenul ereditar este ertrem de compler, iar .;tiinîa ereditd{ii reprezin,td, un dameniu în care trecerea de la tezd la antitezd. ;i sintezd,, într-o desfdgurare profund dialecticó, es'te un loc cornun. Ultimul deceniu o însemnat W$i errcrmi în aprofunzdo"r'ea stttdiu,lui fenomenului ereditur. Datele mai u,echi despre replicarrea semiconseruotiud a ADN au fost cornpletate cu rnod,ele noi, dem.anstrînd,u-se realitabm unei replicdri segmenfune, discanySinuu. A fast demonstrató, transmitureo, inf ormnfiei ,erediture de la,^tRN la ADN, aducîndu-se astfel u"n s.erios 'omendoment la dogmn centtwld a biologiei rntoleculare. Saau ob$inut rezulfute rem.arcsbite în stadiul structurii ,rn^oleculotre a .cromozomului de tip eucario't, bsndarea crarnozomnld reprezentînd o ue'ritv'bild ,,Ao'r-nbd cu origenK penh'u citogeneticd. S-o dooedit cd, genele prezintd, secuen{e codificatoore. trsnscrise ;i traduse ;i secuenfe intercalate printre secuen{ele codificatmre ;i care sînt transcnse dar nu sînt traduse, genele ansînd d,eci o structurd m,ozaimtd,. De asemenea, Ia baci;eriofagi, s-a demnnstrnt fenam,enul acoperirii de Eene. S-au descifmt proprietófile gemelor sdritosre pi s-a elobstwt ipoúem ootcoEenrei. Rezultute dc el:cepÍie ou f ost obfinute îmtr-un domnniu nou al g,enetùcii mn'lecu.Inre, cel ol mnnipuldrii de Eene cunoscut ;i sub d,enumirm de dhginerie g'eneticd. Cu oicasta Genetica capdtd nebúnuite implimiii de ordin ;tiinlific, econotnic, social, polùtic Ei chinr m,aml, im wuele reslizdri epoele din dorneniul ingineriei genetice pot fi comptnte ca gwndmte ;i insolit cu

r

mdrelia pa1i,lor tui Armstrong pe lund,. $tiinfd, cll Wofunde ezonan,te umnniste, Genetica demonstreazd unicifu.úeo fincúrui ittdir;i.d umnn, irepetabilitatea .so spafio-temporard. Totodnú., genetr,ca aduce în discu[ie, de dnta aceasta pe temeiuri materialist-cLialecti,ce, eristenfa unui desbin. $i acest destin se nLb mc;te destin genetic. EL se împline;te cu rígo'we matema;ticd", fdrd a euea însd implacabilitatea destinului ulnfln dl;in mitología greacd.

Conceputd. dupó rrn plan original, cortea de fatd reprezhrtd. o încercare, ùt linútele uttui spaf,iu redus, de a da cititorului o imngine integrald asupra fanom,enului ereditar. În intenlia auborilor a sta't pe d:e ,o fxtrte pre'zentorca cît mai catn, pletd a datelor clqsice si a datelor m.oderne priuittd fenornenul eredit'ar ca ;i o încqcare de interpreffire a datalor dc gvneticd, clasicd, formnld, prin dntele geneticii mo'leculare. Euide,nt, e&rtea de fald este urn din tariantele posíbile. Pentru docum,enture ne-ant folosit de posibilttdfile pe care ni le-.au oferit biblioteca Facultd,tii de biologie a Uniuersitd'fii din Bucunegti, bibliotem d,epartarnentului de Biolngxe gi Bíochimie al Uniuersitdfii Haruo,rd (S.U.A.) precum ;i scltimbul initerrwlional de lucrdri ;tiinfifiee, ostÎet încît auborii au auut posibilitwtea de a consulta ntulte tuqdri originale de geneti,cd, cla= sicd sau m.odernd. Autorii erpúmd gratitudine tuturor ,acestor institufii ;i tuturor celor care le-au oferit, pe o cale sau alta pasibititatea documentdrii. Bibliografia este sel.ectiud, gi totodatd. cugnind,e luqdrile principale deuqrite clnsice sle genetici,i f,orunnle ;i rrualeculnre. Din ntotiue de spf;iu nu s4 realizat o pennanentó eorelare o citdrii în tert a autorilor cu Ubliografin firnld. Lucrarea se adreseazd. speeiali;tilor în geneticd, stud'enfilor facultd.,tilor de biologie, medicind ;i agronomiie precurn 9i prof esorilor de biologie ;i etexilor de liceu. De osemsnea, ea pmte fi consultatd de oricine este interesat în descifrarea miw,u;Iosului fenomen ereditor, cuno;tinfele despre eredifute fdcînd Wrte in' tegrantú din ceeo ce se poate numi formnlia intelectuald a omului modern.

AUTORII

CUPRINS

CAP. f. Suhstratul rnaterial al ereditàlii l. Delinirea ered.itdlii. 2. Delinírea substratului chimic aI ereditdlii

3.

Sl.tuctura acizilor nuclcici.

I I ll
18
1B

3.1. 3.2. 3.3. 3.4.

3.6. Cantitatea de ADN gi informalia ered.itarà 3.7. Sinteza replicativà a ADN CAP. II. Struetura ARN qi transcrierea genetleú

3.5. Exceplii de la structura bicatenarà a ADN

Structuri tautomere

Scurt istoric Structura primarà a ,{.DN Structura secuudarà a ADN

l8
.

22 30 32 33 35 50 50 52 57

l. Generalildli 2. Transcrierea geneti,cà 3. ARN nnseger 4. ARN ribozomal 5. lnN d,e tronsfer 6. I RJV nuclear eterogen. . 7. A RN crontozontal 8. IRN ttiral 9. Reuerstranscrieyea
CAP. III. Organizarea materialului ereditar l. Organizarea uiralà -

6l

66 73
74 74

76 79 79 82 82
85

2. Organizarea

cclul,ar d

2.1. Organizarea procariotà. 2.2. Organizarea eucariotà
2.2.1. Organizarea genelor eucariote 2.2-2. Structura electronomicroscopicà acromatinei gi a cromozomului eucariot 2.2.3. Complexul sinaptinemal

88
104 106 109 109

4,

3.

Caracleri,stici,le

Procariote-Eucariote, o comparalie 5. Genomul extranuclear

organizdrii eucariote

.

lll

CAP. IV. Codificarca biochimieà'gi expresia genieà

116 116

l. Generalitàli . 2. Cod,ul genetic 3. Catacteristicile codului genelic

ll7

123

4.

Biosinteza proteinicd 4.1. DesfAgurarea proc'esului de biosintezó

proteinicà. 129 4.1.1. Inifierea catenei polipeptidice l3l 4.1.2. Alungirea catenei polipeptidice 137 4.1.3. Terminarea catenei polipeptidice 140
organizarii qi funcgionóril factorllor oreditnri
145
146 117 148 stud,iutr

f28

cAP.

V. Caraeteristleile (genelor)

l. Ciclul de tiald la organismele superíoare . 2. Caraateristicile genetice ale meiozdi
mald)

3. Localizarea genelor pe cromozomi 4. Descifrareo naturii genomul.ui (gcnotipului) prin

fenotil>ului (analiza geneticd) (Genetica factoriald. sau for4.1. Ivlonohibridarea . 4.2. Dihibridarea 4.3. Bxceplii de la raporturile mendeliene de segregare 4.3.1. Dominanla incompletà sau semidorninanla 4.3.2. Supradominanla 4.3.3. Codominanfa 4.3.4. Alele multiple (polialelia) 5. Factorul Rh 6. Variantele electroforetice ;i semnificalia lor 7. Interacliunea genelor
.

r49
152

r5B
167 167 168 168 169

t74
177

t79
181

B. Complementaritate genicd 9. Gene inhibitoare .
10. Gene epistatice.

ll. Gene duplicate cu e.fect cumulatíu 12. Penetran!à. gi expròsiuitate genicà 13. Determinismul genetic aI ciracterelor cantitatfue
11. Gene

182 183
185

15. Pleiotropia

letale . .'

.

186 189 193
195

B

t
1

I

)

Capitolul I

SUBSIRATUI, MATERIAL AL EREDITATII
Motto:'
Spirala este esenfa vie{iir
Goethe

,

1. DEFINIREA ERBDITATII

Îrncà din anul 1863 Spenoer defineEte ereditatea ca fiind proc€sul cìare detenminà asemànar€a dintre pàrinli Ei descenden{i. IJlterior, la 1885, A. Weis,mann în{elege prin eredita't'e ,,'ttransferuù de Ia o genera,,lie la al'ta a unei substanfe cu o constitu{ie molecularà definità36. Prin ac+easta Weisrnann devan:seazà cu aproape trei sferturi de veac, conceptia modernà despre, o bazà molecularà a ereditàtii, iar oonc€ptul sàu de pl asrnrt gerrnirwt't u d, cu ierarhia strl.c t ur al -f unclio nralà determi nanfi-biofsri-idnrúte-ide, este comparabiù cu cnncephll actual asupra ierarhiei sistremului eredi'tanr care pornegte de la perechea de nucleotide qi ajunge Ia genarTr. Astàzi prin ereditate se înfelege conservarea specificitàlii unui sistrem ibi'olqgic dat, în tÍa:npuù reproducerii s,al€, conservare care asirgurà oon,tiuruul în evolufie, legàtuna organicà dintne generafii, adicà asemànairea dintre acesúea. Totodatà, pe Iîngà coarlinutul 'evolutiv, apare ca fenomen biologic fundarnentaln stà,r€,& de neas,ernànane, de discontinuitate evolutivà, adicà vEriabilitatea, eea mai generatà lege a naturii. Cele douà procese, conservatismul ereditar qi vari'abiùitatea ereditarà sînt douà ùaturi inseparalbile ,car,e definesc unitatea dialeeticà a organismu-

* Acest panseu al celebrului autor al lui Faust po'ate fi luat, în lipsa uneia exacte, drept definifie a vie{ii. Geniul marelui poet a pàîn.mod cert Viata se ,aflà într-o g,alaxie de formà spiralà, iar macromoleculele din interactiune'a càrora irumpe triumfàtorare Viata au li ele în esen!à o fitrucfurà spir.'alà. (L. Gravrilà - Simpozionul, Prognese gi Perspective în biologie: Progrese în Genetica molecul.arà Bucuregti, g
truns esenfa viefi,i, de vreme ce Tem,a, singur,a planetà pe care sàtàguiegte

aprilie

1981.

r
lui viu. Fieoare organism are propria sa eredi,tate înscrisà codificat în s,tructuri moleculare specifice sub formà de irrformatie ereditarà. Cu studiul ereditafii Ei variabilitàtii se oeupà $tiinfa Ereditàtri numità încà Gsslgriss. Ea studiazà meoanismele înregisúràrii, reduplicàrii qi modificarii imforrnafiei ereditar,e precum $i aie fun,cfi,onràrii m,aú,eria,lnrlui enedirtar în conr,r.u*luL proceseil.or rbiosintetice din organi:srrt car,e conduc I'a ,contur,ar€a

cliferitelor caracteristici a,ie arcestuia. Cuvîntul eredita,t,e este de origin:re 'latinà (lueredibas =- a rno$teni) qi sem'nificà trransmiterea din gen,era{ie în g'Enerafi'e, ou a unor caractere cai ata,re, ci a, capacità{ii. de a dezvoita aceste caractere la d,escend'enfi. Cuvîn'tul Geneticà, dat acestei gtiin{e de càtr,e W. Batesor, în 1905, provime de la ,,grec€scul genrtao care înseamnà a d,a naEtere, a gen'era. Principiile de 'bazà ale Geneticii au fost formulate în anul 1865 de càtre Gregor N{endet în {ucrarea ,,tJtber die Pflan,zer:r hyb'riden6t Ei au la' bazà, conceptul de factcri ereclitari (gene) de naturà materialà. Etre au fos,t elaborate' în urma unor exp€rienfe de hilbridare efectuate îrn,tre diferite soiuri d'e mazàre. Fàrà a cunoaqte care este natura chirnicà ,r factorilor ereditari, Mendel a starbilit, prin in'terpretarea corectà a nezultatelor ,experi,errfelor de hibridare, prin analiza fe,notipi,cà, indirectà a factoril,or ereditari, dubtl artà cle analiza statisticà. comportamentu[ acestor factori ereditari în conrrdifionare,a qi transmiterea ca,racterelor eredi,tare. lli,tate pentru m,ai 'bine de trei deceurii, principiile elaborate, de Mendel au fost con'firrnat,e ia începutu'l secolului nostru, dovedindu-,s,8 a fi universal valal:ile în lumea vie. Mendel trebuie astfel consldena,t fondatorul celei rnai moderure qtiinfe biologice Geneticai. Legînd factorii er,edi,tari ,mend.elieni de c'roln,o zomi qi dezvol,tîn'd principiile memcleliene de ereditah, qcoala iui Morgan a e'lucidat clesfàqurarea f enomenului eredit'ar la nivel celular, ,constatÍnd,u-se ,exis'tenla unui comportam,ent identi,c al factorilor ereditari rn€n;delieni qi al cromozomil'or î'n tirnpui diviziunii celulare. Ràmin,ea încà n,edescifratà natura chinnicà a faatoriùor eredi,tari. Deqi în arnul 7924, Feulgen Ei Ross'enbeck ,eviden liazà,, printr-o metodà selectivà de colorare cu leucofux,inà prezenfa la nivelul nucleulrui cel'ular qi ,al croln,ozormilor a acid,ului dezoxi,ritbourucl'eic (ADN) nu s-ai putut s'tabiili urici,o ,relaf;ie dintre acas,tà surb stan!à Ei fac'torii ereditari, a càror 'localizare pe cromozorni fusese clar dernornstratà de Scoal,a lui Morgan"
10

2. DEFINIT3EA SUBSTRATULUI CHIMIC AL BIBEDITATII

În pr,ocesul de transrni'tere a carac,terel'or ereditare de la o genera{ie la, alta nu are loc o transmitere ,ca atar,e a unui caraoùer. Bste de neimagiurat ,bunàoarà transmiterea la nivel'ul zigotului uman a ,,ochilor albaEtri(. Dar la nivelul acestui zigot ,roeva" a'fost trans'rris qi acest ,,cevar(( va face ,cE î'n dezvoltanea ulterioaià a embriou:ului uman sà aparà nnaurifest caracterui ,,ochi a',libaEtri((.' Ce este acest ,,oeva66 Ei ca,re sînt proprietàlile sale? Fàcînd o paralelà între legil,e fizicii Ei le,gi'tàfi'le feno'menului eredita'r, E. Schródingep, în 1943, devansînd conceplia modermà molecularà despre ereditak, a ajuns la concluzi:a cà gen'el,e 'îEí pàstr'e à,2à struotura lor de-a lungul generaliilor, deoarece cr'omozomu'l în cane e'le se aflà, repre zintà un fel de cristal sta,bil aperiodic, compus dintr-o succesiune de elemente izomerice, caracùe'rizate de peruuneur{à gi a càror naturà exactà eete de fapt.,legatà de codul genetic. Trei trepte ,experimentale au dus la descoperirea a,celui f,cevars adicà a subs,tratului material al ereditàtii care s-a dovdit a,fi s'ubstanta chimicà macrcrmolecularà ADN. Primp, treaptd, este repr,€tentatà de experienfele medicului englez Griffitllr, efectua,ùe în 1928 cu agpntul pneumoniei Diplocoecry . pneur:rnùrnipp sau pneumococ. Aceastà tbacùerie se prezin,tà, su,b forma a douà tipuri diferite: qnul virule'nt qi încapslllat, altul nevirulent Ei neîncapsulat. Caracterele de virulent, qi nevirtr'lent sî'n't ereditare adicà se transurrit constan't d,e la o gengrat-le celuùarà la aLta fi,pqt virulent a fiost oro,tat cu ,,Slt deoar€€, crescut pe agar formeazà, colonii netede (în englezà sm,ooth-- neted). Celu,lele sale sînt, înconjurate de o capsulà formafta din polizaharide specifice încît existà pneumococi, de diferite tipuri serologice
i

Tiputr nevirulent nu pr,ezi,ntà capsulà Ei for,rne azà pe a€ar col'onii rugoase. El a fost notat cu ,,Rtt (rough - ,aspru). Îm mod spourrtan form,a S se poa,te trans;forima prin mutalie în form,a R cu o frecventà foart'e micà dar niciodatà nu are loc mutalia spontanà în sensul .R->S. Rezul,tà deci cà prin mutalie naturalà tipul R provenit din diferitele tipuri serologice aile,lui S poate fi Rr, Rrr, Rrrr. Injectînd la Eoareci pneumo,coci cu diferite variante experimentale, Griffi'th a constatat cà: 1. Tipul viruleurt ,,S* produce rboala Ei animalele mor;
11

Sr,

S11,, Srrr.

r
lente de pnreumococ. Experienla a t'ost riguru,s efectua€n excluzîindu-,se posirbili'tatea învierii celule'lor de tip S omorlte prin

3. Tipul ,nevinulent ,,R( 'n-u produce boala; 4. Dacà la aeelaqi $oarece se injectEazà simultan tipuriie dirn variantele 2 Ei 3 animalul pr.ezínl,i,boala Ei 'moar,e. Din ssremenea animale s-au putut izola celule vii capsulate qi deci 'viru-

boala;

2. Tipul virul,ent ,,Sn ornorit

prin fierbene nu produce

fierbere, încît s-8 impus o singurà concluzie: celulele vii 'ale tipului R nevirulent în amestec cu celulele moarte ale ti:pului S se transfo'rmà în celule viru,lente. Fenom,enul a fost numit T RAIVSFOR MARE GEN ETIC 4.. Transformarea geneticà se desfàEoarà cu pne'cizie, pàstrîndu-se tipul serologic inifial: dacà în amstecul iniectat ,au intrat celule de tip Sr omorîte prin fierbere qi celule Rrr vii, din animale !-or putea fi izolate celule de tip 51 vii qi cetrule Rn. Dintr-uo asemerlea arnestec ,nu vor putea fi izolate celule de ti,p S ttt sau Sr rr. Acest lucru ar fi posibil numai în urma unui fenomen de mutafie spontanà, dar un assrn€nea eveninrent esùe pe de o parte foarte rar qi necesità P€, de al'tà parte un timp cu mult rnai îndelungat decît dureazà experienfa de 'mai s:tls. Celulele virulente de tip Sr renrtate prin tnansformarea c€Iulelor nievir"ul€nte de ti,p Frr aflate în prezen{a celulelor S omorîte prin fierbere 'trsnsmi,t cu fidelitsb, în'generafiile celu-r
lar.e ulteiioane, caracùenrl de virul,en!à. Transformar,sa arìe astfel carac,ter permanerr,t, virulenta fifuld înscrisà în 'baza eteditarà a
c,e1,,u,1e1or

sà determine tra'nsform'area geneti,cà prfur cr-ll'tivarea cel'ulelor de tip ,,R" în mediu lichid la care au fost adàugate extracte filtrate obtinrute din Liza, celulelor de tip ,,S".

Rrt. Griffift nu a puhrt da o expLicatle csrespunzàtoare acestui pruces de transforrnare geneticà, dar el are un merit de,osebit deoarec€ l-a sernrnralat penúru prirnar datà, iimputsionînd lumea qtiintificà la elucid,area mecanismul'ui sàu. A doua treaptú în elucidar€a mecanismului transformàrii est,e reprezentatà de experientele lui Al'loway efectuate în 1932 Ei de experienfel,e lui Dawson qi Sia din 1937. AceEtia au r.euEit

Deqi nu au precizat natur,a agentului transformant aceEti autori au putut astfel excliude implicarea materialului capsular în pnoces,ul transformàrii. Tnebuia càutatà aità substa,rrfà cu pr'opri etàti transfortn an'te . A trein trmptd qi c€a d'ecisivà în ,elucidarea naturii agentului transformalrt ,este repnezentatà de experienlele americanilor O. T. Avery, C. M. Macleod qi M. MacCarty al'e càror rg2u,ltate
L2

culare, Etiin!à prin care biologia secolului XX qi a celor ct U vor unna se va înscrie ca un domeniu rerrolu-tionar al qtiintelor naturii. Descoperirea lui Avery qi colaboratorilor sài declanqeazà o febrilà aetivitate în toate labora,toarele lumii, Se demonstreazà ro,lul transfor,matrr't aL ADN qi la alte bacùeri.i apoi Ia plante qi anima'le, fenomenul ,tmnsformàrii dewnind în cele din urmà e cale prin care este transforrnatà dirijat ereditatea in cadrul ingineriei g'ene,tice. O altà dovadà a rolului geuretic al ADN ra l€prezentat-o descoperir,ea conjugórii fucteriene de càtre Irederberg gi Tatum în 1946. Acesta este un proces na,tural prin care ADN al unei bacterii este direct transferat unei atte rbact'erii. Bacteriile se deos,e'besc dupà tipul sexua't. Astfel sint bacterii de tip sexuat mascul clesemnate F+ qi d,e tip sexuat fernel, desemnate F- între el,e fiind un tra,nsfer unidir,ecfional de material gearetic de la F+ l,a F-. Capacitat'ea d,e a transfera gene o au numai acele bacterii care posedà un factor ereditar numit frctor de fertilitute (F). Aceasta repnezintà tot o moleculà ADN, localizatà ln citoplasffià, adifionalà cromozomuiui bacteria,n principal. El se poate integra în cromozomul, principa,l devenind ceea ce se numegte u,n episom. În stare integratà faetorul F conferà bacteriei capacitate,a de a transfera cu o frecventà înal'tà gene la tipul femel
13

dezoxiri,bonucleazà (errzimà ce hidroLíze,anà rnolecula polimericà de ADN) aratà cà extrashrl îqi pierde proprieúatea transfonm€uî.tà. Era dovada peremptorie cà agentul transformant este ADN, Prin aaeas'ta s-a pus piatra de ,tqmelie Ia zidirea g,enetici'i rnole-

sint publ.icate în 1944 într-s lucrare devenità clasicà. În aceastà lucrare se aratà ,cà în urma cultivàrii eelulelon de tip R ftl pnercrtta ADN înaùt purificat, extras de la celulele de tip S se poate obline o transforro,arìe efectivà a cehrlelor rrevirulenrte R în celule virulente, S. Descoperirea era suprinzAtoare (Wabon a numit-o ,,bomba( lui Avery) pe fondul tmei' gîndiri dogmatice dominatà de acceptar'ea generalà a ideii cà sulbstantele pnoteinice au rol de rnateri'al ereditar, f,apt ce a fàcut ca '1a' început chiar lui Avery sà-i viarà ,greu sà creadà în propri,a sa descoperire epocalà ! Di,n aceastà eauzà, reznrltatele unei asemenea experienfe trebuiau verificate riguros prin efeetuarea diferiúelor teste. Astfel, testele senoLogice au ,el"iminat posi'bilitatea contaminàrii 'extracfului de ADN cu polizaharide. Testele proteolitice, în Llrma càrora extraetul îEi pàstra activiùatea transformantà au eliminat posibilitatea ca proteilrele sà fie irnplicat,e înr, fenomenul transf,or,màrii. În sfîrEit, ;tes'tul de drrgestie cu

$i as€rn€rr€a tulpini au fost desemnate Hfr càci tra,nsferînd genele cu o mare frecven!à determimà totodatà o inal'tà frecvenfa de reeorn,bi,nare a gemelor în popul'afia [bacterianà considera'tà. Tnansferul de gene se face într-o manierà ,unicà, s'ecvenfialà qi orientatà, pe ,baza sa stabilindu-se ordinea genelor pe cr€mozomul bacterian (cartare,a geuricà) qi totodatà s-a conchis cà ,acesúa are forrnà circularà. Conjugarea baot'erianà explieà rolul pe care î1 are ADN în ereditate, statutul sàu d,e substantà eredi'tarà. ,În annrl L952, N. Zinder qi J. Ledenber,g descoperà transferul de gene între diferite tulpini bacùeriene mediat prin transduc{ie fagicd. Bocteriofagii sînt virusuri ale bacteriilor descoperit'e încà din 1917 de cà'tre d'Here1le gi cane se ,mai nurnesc simplu fo,gr.Fagii se multiplicà în celulele bacteriene lizîndu-le (ciclul liúic) sau îEi integre azà ADN lor în cromozomul c,elulei 'bacteri'ene (-ciclul lizogen). Ciclul litic Ei ciclul lizogp6l sîrnt rever-si-

biLe. Integrat în cromozomul bacterian La iegiree din acesta ADN fagic poate smulge gene baeùeriene pe care sà le trans(Ftg. 1). În aceln+i an, A. H,erfene la, o al'tà tulpiurà
'bàcteriaura
+--+ SUfftune
5t

presiune alt'ernariL

lA Z( phe + lrp, qet- nis- I

A

22

(Ohe- f r P- mef r 'lis+,

atI dpdr prototrofr
Ftllru
de

protof rof i ( phe+ trF+ nef+ hts+ )

plasate fiecare într-un bral separat al tubului Davis de forma literei It. Brafele sînt separate printr-un filtru d.e sticlà care nu permite schimbul de celule dar permitè trecerea mediului lichid dintrun-un braf în celàlalt, astfel' cà cele d.ouà tulpini sînt de fapt crescute pe un acelagi med.iu. Formele prototrofe apar numai în bralul care confine tulpina LA22 nu însà gi în acela care confíne tulpina LAz. Cu alte cuvinte un ,,agent filtrabíI" (FA) activ genetic apare legat de tulpina LAZ care poate produce prothtrofi La22. S-a d.ovedit cà ageutul filtrabil este de fapt un fag temperat care a trecut odatà cu mediul de culturà prin filtnr de stidó de tulpina LAz la tulpina LA22 pe care o lizogenizeazà,, transfedndu-i genele de tip sàlbatic (poe+, trp+) d,e la tulpina nelizogenó LAZ gi transformînd-o astfel într-o tulpina prototrofà. Acest fenomen d.e trecere a unor gene de la o tulpinà bacterianA la alta imediat d.e fagi s-& numit transducfie fagicà. F*gul transductant a fost desemnat Prr.
T4

Douà tulpini auxotrofice de Salmonella typhimuri%ffi, LA22 qi LAZ au fost

Fig. î. Experienfa de transducfie efectuatà de Zinder gi Lederberg în

1952.

i.

o'p-

.. 32
fonto.r,o f.tgicó

p ce rntró în ADtl
S ce intró ín
ProtetnEls
copsrdeu

rta
[tà.

'

35

$i
ZO-

;ta pe
ìg_

/-- , -bGCterie"

tuate de Hershey qi Chase (1952). a.b. - radioactivitatea însofegte numai ADN qi se deceleazó" în interiorul celulei; c, d. - radioactivitatea însofegte numai proteinele gi nu apare în interiorul celulei bacteriene gazdà.

Fig. 2. Demonstrarea rolului genetic al ADN prin studii

autorad.iografice efec-

shey Ei Martha Chas'e, demo,ns'tre azà. rolutr în ereditate a,l ADN fagic, excluzînd totoda;tà orice implicalie dir,ectà a proteinelor in fenome,nul 'ereditar (Fig. 2). Fagii pàtrund în celula bacteri,anà unde s,e mu:ltiplicà pe sea,ma componentelor celul,ei gazdà qi apoi, în urrna lizei celulei bacùeriene se elibereazà noiil.e particule fagice. Bacteri'ofagii au a1càtuire foarte simplà. Ei prezin'tà o capsidó, proteinicà cane încon'jurà u,n miez de ADN. Auú'orii au f'olosit bacteriofagi de 'tip T2 ca're conlin coa 400/o ADN $i 6A0/a proteine. Capsida proteinicà, î,n interiorul càreia s,€ aflà ADN form,e azà, capul rbacteriofagul'ui care se continuà cu ,o ,,coadà33. Cu ajutorul eozii, 'bacteriof,a,gul se ataEeazà la peretele celu,lar aI celulei bacteri,€n€, coada avînd la partea sa distalà o placà h,exagonia[à cu gas€ spini scurfi qi nurnenoase fibrile Ei posdà activita,te li'zozimicà prin care peretele celulei baeteriene este dizoivat local. Pe a,ceas,tà cale ADN fagic este injectat în rnt'eriorul celul,ei bacteriene, înveliqul proteinic a,l fagului ràmînînd la exterior sub for,mà de ,,fantomàí fagicà. Prin experienfe
15

I
de marcare cu izotopi radioactivi, Hershey Ei Chase au demurstrat carre este funcfia ADN (Fig. 2). Comptrlen,ùele bacteriofag{ilui au fost marcate ,f rînd, proteinele capsidei cu 3qS qi 32P. 35S Ei 32P diferà în intensÍ;tntea energiei ra4DN fagie cu diafiilor B pe care le emit fiind u$or de distins. Cu asémenea bacteriofagi marcali au fost infectate culturile ,bacterien,e. Prin urentrifugare au fost î,ndepàrtafi bacteriofagii urea'taqatt iar prin agitare puùernicà s-au putut separa ,,fantomre,le6s fagice. Cînd s-au marcat pruteinele cu 35S s-a eonstatat cà ùrtre AO qi g7o/o din 3qS este asociat cu fracfiun,ea proùeinicà a ,,faurtomelors fa-

cît Ei penrtru sinteza prote,inelor virale. Aceste douà cate,gorii de experienfe d,e ,transformare Ei de infecfie fagicà au demonstrat faptul, cà ADN-'utr reprczintó, mnfurinlul gtenetzc, substratul chimic al ereditdfii, otît ls, uirusuri cit fL la sistemele Aiobgice celulare. Dat fiind faptul cà uurel,e virusuri rùbouiru,suril"e pr,ezintà ca rniez de acid nucLeic acidul ri,bonucleic (ARN) s-a pus în mod firesc problema cin'e îndeplfureqúe, în acest caz rolul de material ereditar. Experienlele lui Fraenke,l-Co,nrat, Singer Ei Williams pe d'e. o par,te Ei ale lui Gi,erer qi Schrarnm pe de alta, desfàqurate, între 1955-1956 au adus dovezi sigure, dupà care la ri,bovirusuri ARN viral. îndepliureEte rol de material er.editar (Fig. 3). Aceqti autori au lucr,at'ctl virusuù rnozaicului tutunului (VMT) oare are formà cilindricà în interior aflîndu-se ARN (60/a) ce ,este înconjurat de proteinà (94o7o| avî,nd o lungime de 300 pm gi o 'làfime de 15 pm. Pe cale chirnicà proúeina viralà poa'te fi separatà de ARN. Cele douà compon,ente pot fi astfeL in,ocul,a,te separat la plante de tutun. S-a constatat cà proteiura viralà nu estre capabilà d,€' a determina infecfia vira,là pe cîn,d ARN viral are'
caracùer infec{i,os.

ADN, dupà 30 minuúe rezultà panticule vira,le întregi care conlin atît acid nucleie cît qi pnoteirÌe. Rezultà cà ADN conline toatà furforrrnafia eredi,tarà, atît pentru propria sa sintezà

gice. Cînd s-a marcat ADN cu 3ZP s-a consta,taú cà cea mai mare parte a radioactivitàtii apare în interiorul celulei bacteriene. S-a tras concl,uzÍa cà îilr. timpul ilrfecfiei fagice ùr celula gazdà nu pàtrunde întreg lbacteriofagul ci numai ADN-uI sàu. Ac€sta stà Ia tle;za rnultiplicàrii fagului cu aparifia de noi partieutre f'agice. identice cu eea inifialà. Deqi în celula gazdà pàtrunde doar

Cînd Gi'erer gi Sc,hramm au fol,osit ARN pur izolat de la VIW| spre a infeota pla,nte de tutun, BU constatat cà se produce
16

3. STRUCTURA ACIZ,ILOR }IUCLBICI
3.1. SCURT ISTOR,IC

Acizii nucleici sînt acizi ,orga'nieí car'e aonfin f,osfor, r'sprezerr-tînd substante macromoleculare din grupa,biopolimerilor.
Descifrarea structurii ADN a fost îndelung pregàtita. În anul 1868, studentul elvelian de numai 24 d,e ani, F. Miescher descoperà în nucleii celulelor prele,vate din plrroi uman, ,c8 dealtfel qi în lapfii d,e somon qi sperma altor animale o substan!à cu un înalt confinut d,e fosfor pe care a nu'mit-o nucleinrt Ei pe care, în 1872, 'c considerà a fi materialul genetic activ at spermatozoizilor. Mult timp aceastà idee nu a fost îmtbràliqatà de iurnea biologilor. Abia îrn 1939, Astbury Ei Caspersson, în cadrul celui de-al VII-le,a Congnes de Geneticà, vor avansa ideea cà acizii inucleici ar servi ca matrifà pentru siurteza proteinelor, asigurînd reproducerea materiei vii. În 1899, R. Altmann identificà în mucleina d'e d'rojdie o substan!à macromo,lecularà pe care a numit-o acid nucleic. În anul 1909, P. Leven,e aratà cà acidul nucleic de drojdie oonfine patru baze aza,tate: odenina, gunnina, citozinn qi unacilul precum Ei acid fosforic qi o pentozà riboza. În 1930, ac'elagi autor anaIiz.eazà cornpozifi,a chimicà a acidului nucleic din 'timus Ei constatà cà acesta cornline adnnind,, guanind., citozind qi timind, ca baze azotatn precum Ei acid fosforic Ei d'ezstirùbozd. La acea vreme, ,acidut care es,te nucleic de la drojdie a prinit denumirea de acid riborw"cleic (ARN) i,ar c.el din timus de vigel a fost numit acid timonucleic, de fapt acid dezoriribonucleic (ADN).
3.2. STRUCTURA PRIMARA

A ADN

cleotid;e. D'e aceea acizii nucleici se numesc polinucleotide, adicà polim,eri de nucleoticle. În anul 7952, Todd a s'talbilit ;tregà-

Unitàlile structurale al,e ADN, rnonomeri, se numesc nr,t lbazà,

lei ADN. U,n nucleotid este alcà'tuit dintr-o
mroleculà de dezoriribozd, Ei

turile chimice dirr-tre co,rnponentel'e de

ale nlacromolecu-

un rest fosforic. Bazele a:zofra,te sînt de tip organic, relativ hidrofobe. Ele sînt de douà feluri : purinice adenina (A) Ei guanina (G) Ei ptrimidinice citoziura (C) Ei timina fI). Nucleul purinic este ,un dublu heterociclu al1B

bazà, anotatà, o

t

H C

N,/ùc/r\
HCs.#Ò-Fig.

[ ;lr /
Nil
g

à..

N r'Hr ,,r49\c/\ ''l il cH

HC

f.. ,-C--. ,/ NN
H

HzN

ril /'c\^-

E di|/ \cz \
nJ

n \.,

NH

4,

Nucleu purinic.

Fig. 5. ddsnina.

Fig. 6.

Guanína.

càtuit din 4 a'tomi de ar'ot (N) Ei 5 atomi de, carbour (C) (Fig. 4). Adenina este o 6.aminopurinà- (Fig. b), pe cînd guanià"-este 2-amino, 6-oxipuri,na (Flg. 6). Nucleul pirimidinic este un heterociclu aroma,tic alcàtuit din 2 atomi de azot qi 4 atomi de carbon (Fig. 7). Timina este o ?,6-dioxi, 5-*gtilpirimidina (Fig. B) iar citozina este o 2-oxi, 6-armiuropirimidfutà (Fig. 9). Bazele azota,t'e A, G, T, C, pred.ominà în ADN de Ia marea majoritate a speciilor. În unele cazuri însà, 'bazele azotate obignuite pot fi ilrlocuite de unii derivatt ai lor (Frg. 10-13). Astf€I, la grîu circa tlq din resturile citozinà apar ca 5-metilcitozinà, care are pnoprietàli de îrnperechere asernànàtoare citozinei. Acest derivat al' citozinei apare qi la alte gramin@, 6ealtfe'1 Ei la mamif'ere. "* [,ar fagii de tip T ai ,bracteriei Escherichia co:|,i, (8. coli,) citozima este întrocuità compleú ou 5-hidroximetilcitozina care de regulà este conrjugatà cu gil.ucoza. De asemenea, la unele virusuri se aflà 5-hidroxirneti'1uraci,lu1, iar la unrele lbacterii se aflé O-metilpurinà. Purinele qi piri,midinele oomfin dutble legàturi sau legaturi conjugate, din care cauzà ele se po't pnez'enta sub forme chimice.
o

x/ù
htc

C

tl \

cH :il 3-'C H

**[' -f -cHl
1,.-*'cH
H

ll r

NHr
lL y1

iil

2 \..cH,

C

N

or-*-ci-i'
Fig. 9. Citozina.-

Fig. 7. Nucleu
pirimidinic.

Fig. 8. Timina.

19r

6- netrlaninopurìna
[-t N

2

-

anrnopurina
htpoxanfina

-c Hl

v

NA*zri

N

\r

{
A nalcai

HzN-L-*
ai
edentfrèí

Jt-*A_)
H

rrí
\
N
n tralog

al guaninet
al

Fit.

10. Analogi

nopurina gi 2-emlnopurine.

si

adeninei

:

&metilami-

Fig.

guanineí; hiporentina.

I

î. Amlog

ura c ilul

5-bronouracil r \.

o

''o

5-

\

fl uorouractÍ

\o

**r\Br'
*
A na

o^d "'
logi ai uret'iluluì

Al
;
S-fluorouracil"

HN

)ly,

Fig.

'12. Analogi

ai uracilului. Uracilul ;

S-bromouracil

5

-nettlcrfoztnà

5

-

hid

r ox t n e ! t i c : !' o z ì n

i

5 - b ro moc

tloz;n

t

NHr
IL

NJ

H2

0

L)
NH

N*

cHr

N

LcH2oH

oLJ
Analogì aì citozinei

,,4.'/ vN

N,ry* lil

NHr l'

.Fig.

13.

Analogi al citozinei. S-metilcitozinà; S-hidroximetilcitozinll; S-bromocitozinl,.

20

diferi.te, cun,oscute sub d'enumirea cle structuri fut^ttompre. Astrnucleel,e, structurale ale macrornoleculei ADN se caragùerizeazà, ,atît printr-o mare stabilitate structuralà, cît Ei prin posibilitàti de a se prezenta sub variante structurale. Asemeneà àspecle c'o,ntra'dictorii stau l'a baza dialecticii fenomenului ere-

fel,

di tal'.

i,ntre acidul fosforic qi grupàrile hidroxi'lice (oxidrilice) al'e glucidului din pozifiile 3' gi 5', avind loc esteri,ficarea a douà grupàri hidroxilice al'e restului f'osforic:
R1
I

Purin'eLe Ei pirimidi'nele pot r'ealiza legàturi chimice cu pentozele. Atomii de carrbon ai pentozel'or sînt num€'rotafi l' , 2' , 3', 4' gi 5'. Cat'bonul I' a,l pentoz,ei ,s,e leagà cu a'tom'ul dre azot din pozifia 1 al pirimidinei sau cu ato'mul de arnt dfur pozifia I al purinei. Prin intermediul restului fosforic s€ rsalizeazà 'lqgàturi între caflbonul 5' al dezoxiriibozei unui nucleotid qi carbonul 3' al dezoxiritbozei nucl,eotidului urmàtor, forrnînd{"r-se serii lungi de asemen,ea legàturi 5'-3' sau 3'-5' în cadru,l polimerului care stau la baza structurii primare a'maeromol,eculei ADN nepresent'atà de ro catenà polinucleotidicà de 'lungime variabilà, specificà fiecàrei specii. fuegà'turile 5'-3' sau 3'-5' r,eprezintà legàturi internucleotidice fosfo-diesterice poval,en'te, realizate

o
C)

_-P-OH
I

I

o
I

R2

pe s'eailt& lor realizîndu-se o structurà f,iniarà, nepr€zen,tînd o adevàratà coloanà vertebralà a monocatenei ADN. În structura macr,omoleculei ADN iur,trà patru tipuri principale de nucleotide: dezoxiadenozintrifosfat (dATP), dezoxitimidimtrifosfat (dTTP), dezoxigu'anozintrifosfat (dGTP) qi dezoxicitidintrifosfat (dCTP). Cînd se asamibLeazà, în monocatena po,linucleotidicà acreste nucleotide ràmîn sub formà de dezoxinucleotid-5'-monof'osfat.

Legàturile, fosfodiesterice sînt foarte puternice' Ei deci stabile,

Nucleotidul prezintà o regiune specificà, ,r€pnezentata de baza arntatà Ei o regiuure nesp€cificà reprezentatà de dezoxiri-

2l

r
r

bozà Ei res,tul fosforic. În cadrul macr,omol'eculei, pun{ile fosfodiesteric,e s€ stabilesc î,ntotdea,una între aceleaEi grupàri care sînt grupàri nespeci,fice, ceea ce conferà acestei pàrti a rn,a,cromolec'ulei o mare regu,laritate, respectiv uniformitate, ce caracterizreazà, ,toate ,moleculele de ADN, d,e, oriee provenien!à ar fi. Nu acelaEi lucru s€ poate spune despre bazele azotat€, care repreziultà r,egiunea specificà a nucle,otid,elor, a càror înqiruire de-a lurrgul catemei pol,inucleotidice variazà de la o m'oleculà de ADN ,La alta, adicà de la o specie la alta qi aceastà orînduire, secverrfà de 'baze, az,otate, specificà fiecàrei specii, r€prezintà modul în care ,este înscrisà, (surb formà codificatà ibiochimic) îr .^ macromoleflila ADN infonnatia geneticà ce dirijeazà r,ealiza-i rea diferitelor caractere ereditare.

3

3 STRUCTURA SFCUNDARÀ A ADN
:

Pen,tru d'escifrarea struchrrii secun dare a, ADN au fost f olosite metode precum spectrofotometria, rezonanta m,agneticà nuclearà, albsortbfia în ultraviolet, crofrnatografia î,n raz,e X etc. Difrac{ia îm raze X a dat cel,e mai bune rezultate în d'escifrarea structurii secundare a ADN. Primele cer,cetàri privind descifrarea structurii ADN prin analíza imaginilor difracfiei în raze X au fost într,eprinse de càtre Astbury în anul 1938. În acelaEi an Astbury qi Bel,l ,arr aràta,t cà macromolecula de ADN ane ro structurà fibrilarà, iar pe axa sa Lun,gà bazEle azotaúe stau perpendicular, între d,ouà baze azobte vecine fiind o distanr!à de 3,4 A. Cele mai bune imagini ale difracliei în rare X sînt însà otbfinute în periroada 1950-1952 de càtre M. H.F. Wilkins Ei Rosatlind Franklin. Principiul difracliei în raze X este urmàtorul: un fascicul, de raze X trece priurtr-o substan'tà Ei cade apoi pe o placà fotografi,cà. Dacà substanta prezimtà un aralrja,m,ent ner,egulat a'l unitàfil'or sale structurale r,azele X votr produce pe pJ.aca fotograficà o patà centra'là repnezentînd pozilia fascicului principal. Dacà subr-rnitàfile substanlei prezintà u,n aranja,ment ordonat, razel,e X vor fi d.eviate îm anumite direclii rnai mult decît în alúele. Dacà aranjamentul subuni'tàlitor preziurtà un mode,l ce se repetà regulat, pB placa fo,tograficà vor apare benzi foarte distincte între care 'existà spalii fo'arte clane. S-a constatat cà ADN care provine de la sun$e f'oarte difurite produce prin difraclie în taze X un model de benzi foarte clar qi aproape Ídentic
22

ceea ce deno,tà aranj,amentul ordonat al rnonomerilor în cadnul, macrornoleculei ADN. Ma,i m,ulú, modelul de difracfie în raze X a sugerat cà macromolecula ADN ar,e o struchrrà helicoldaià (Frg. 14). De o deosebità importa'n!à în elucidarea structurii secundare a ADN s-au dovedit a fi cercetàrile lui Chargaff dful 1950, prin care ,s-a stahilit, contnar pàreril,or oomune dominate de con-

rq

A

f O fi

----

)

.Fig. 14. Structura secunsari a ADN Stlonstantele fizice ale mactomoleculei.
23

ceplia ,tetranucleotidului lui Levene (macr'omoleculà ADN/1a toate speciile rezultà printr-o repetare uniformà a celor pa,tru nucleotide), cà cele patru baze azotate principale care, 'intrà în stntctura ADN nu sînt prezente în propor{ii e,gale la diferiùele specii. Mai mult, el a staibilit r€gula echivalenfei dupà care ,t,otdeauna cantit'atea de adeninà (A) este ega'tà cu ace€a a timinei fI) iar canti,tatea de guaninà (G)-este "Suta cu ac€ea a citozirrei (C) de unde rezultà un raport T/A-C/G foa'rte diferirte precurn Mgcofu:ctqium tubercrrtosis ansium" Soccharomryces cereuisine, Bos tantrus sau Homn sopnens. Aces:te constatàri cunoscute qi surb denumirea de legile lui Charga,ff au reprezentat un punct de sprijin de mane importantà pentru ,elaborar,ea ideii împerecherilor de baze, piatrà de temelie a modelului propus de Watson Ei Crick în 1953 pentru structur,a secundarà a ADN. Pe de altà parte studiile de hidrolizà, urmatà de s,epararea cromatograficà a bazelor azotate Ei estimarea lor cantitativà în spectrofotometrie în u'ltraviolet, efectuate de càtre Chargaff gi colaboratrorii în 1949, au aràtat cà ADN d,e la cele patru specii menfionate anterior are o compontie în baze azotate foarte diferi,tà, raportul A + T/G + C fiind foarte variabil la aceste organisme, independent de lesutul sau de individul de la care este ex,tras ADN Tabelul î Compozlfin tn baze a AIIN Specia
Om (spermà)

alrlclc
31,0
29,7

Proporfia în

u/o

31,5

19,1

18,4

Arici de mare
Drojdie Mycobacterium tuberculosis Escherichia coli Virusul Vaccinia Bacteriofagul Ta d.e E. coli

Somn (lapfi)

29,l
32,t
32,6
14,6

20,8
t7 ,7 18,8

24,4
17,7 17,4

32,8
31,7 26,1

l5,l

29,5 32,6

23,9 29,9 32,6

34,9 24,9 20,6
18,2

35,4
25,1

20,3 16,6*

* S-hidroxímetilcitozinà
nis,me (ta',belul

Apar varia{ii mari în raportul A+T/G+C la di-ferite orga-

un exces de A + T fa!à de G + C. Varia{iile acestui raport nu sînt întîmplàtoare. Raportul A + T/G + C este specific fiecàrei
24

nr. L). L'a plante,le Ei ani,malele

superi,oare apare

fiind ,mult mai apropiat la rorg€Inismele înmdite filogenetic. Sintetizînd în mod magistral date,le ecumulate în literatura de specialitate, bazafi Ei pe ,experienlel'e proprii incluzînd tnod,elarea molecutrarà, în anul 1953, Watson qi Crick au propus modelul de structurà bicateurarà a ADN (Fig. 14). unanim BCceptat, reprezentînd una dintre cele mai mari descoperiri din istori,a Etiinfei, pentru care autorii au primit pr.emiul Nobel. Mod,eluL propus de Watson gi Crick se deos€tbea radical de modelul ,tricat€rr,àr propus de Linus Pauling qi Corey în care baz'ele erau dispuse la exteriror Ei în care nu existau forte care sà asigure stabilitatea structurii tripiu catenare, iar unele distanfe uan der Waals ,erau prea mici (Wabon $i Crick, 1953). I)e asemenea Watson qi Crick aÌu adus argumente qi îm,potriva mod'eiului tot tricatenar propus de Fraser, înaintat spre pu,blicare chiar în perioada în care apànea lucrarea 1or. Ei au propus modelul de structurà ibicatenarà, în cane fiecare catenà helicalà s,e ràsucneqte în jururl aceleia$i axe virhrale Ei 'constà dilr grupe fosfodiesterice care unesc nesf,urile B-D-dezoxiribofuraltozice cu legàturi 3', 5'. Am,bete catene sînt orientaùe dertral, dar s€cv€nfele a'tomilor in cele douà catene sînt ori,en,tate în dir'ecfii opuse. Bazele se aflà spre interiorul helixului iar grupele fosfat în afarà. Zahàrul este perpen'dicular pe bazà. Structura, prezin'tà repetifii (pasul eìicei) dupà fiecare 10 resturi pe fiecare catenà, adicà dupà 34 A, existînd cîte un rest (baza) pe fiecare catenà la fi'ecare 3,4 A. Distanta aùomuLui d'e fosfor fatà cl,e axa fiibrei este de 10 A. Fiind dispuse la exterior, gnrpàrile fosf,at sînt uEor accesibile' cationilor. Aceasta ,este o structurà deschisà Ei con{inutul sàu de apà ,este mare. Planurile lbazelor sînt perpendiculare pe axa fibrei. Ele 'sînt r.rni'ùer prin pun{i de hidrogerÌ, formînd perechi specifice de b,az'e càci to'tdeau,na are lroc uÈirea unei baie purinice cu una pirimidinicà Ei viceversa. Astfel, ADN se prezintà ca ,o suibstan!à ma'cro,molecularà rbicat,enarà, adicà alcàtuità din d,ouà lan{uri polimerice (catene) ràsucite ;plectonemicul unul în 'jurul celuilalt dupà un ax vir'tual, rezul'tîurd structurà 'bic,aten,arà he[i'coidalà numità dublu
speci.i,

dubtutui helix,este de 204 avînd un pas (spirà) spirà a dublului helix ADN cuprinde cîte 10 nucleotid'e, ceea ce înseamnà cà dimensiu,nea fiecàrei baz.e este de 34 4..
Fiec,ar,e,

nttK*-^t*t

de 3,4 A. C,e[e d'ouà lanfuri polinucleotidice sînt antiparalele, adicà la unu,i legàturil'e f,osfodiest'erice, s,e r,ealizeazà între C 3' al dezoxi25

7
rirbozei unui nudleotid $i C 5'

dezoxtribozà

---v 1 a sugerat realizarea G/C:

legàturile fosfodiesterice se rearlizeazó, în seos, inver-s C 5' Q 3' . Rapor,tu.l A/T -

al dezoxiri;bozei nucleotidului vecin, pe cî,n'd la niveflul celuilalt lan! polinucleotidic

ciîosinà

guaninà

''

I

delr.ri ri boz6

dczoxiribozà

Fig.

gi G : Q eare stau la baza structurii bicatenare a ADN.

Ei funcfionarea rnaterialului ereditar. Astfel, A se dovedeEte a fi complementarà lui T iar G lui C, adicà hazele purinrice prezintà complementaritate chi'mico-spafiatà pentnu cele primidinice, iar bazele pri,midiuricre' prezimtà compleme'ntaritate pentru cel'e purinice (Fig. 15). Asem€in,€,a perechi d,e baze prezin'tà dirnensiuni egal'e conferind ma,cromolecvulei. ADN un diametru uniform pe toatà lungim,ea sa. O împerecher,e purinà-purinà sau pirimidinà-pirimi'dinà ar depàqi sau ar fi mai, mica faF de diametrul de 20/^ cît are în mocl nor"m,al dub,l'url he[ix ADN lipsimdu-l de reg'ulari'tate. Îm'perecherile cle barn se realizeazà prin intermediut u:rror punli de hicirogen, douà între A qi T qi trei între G qi C. Î,mperecherile sint, re-

15. Perechile specifice de

bazà

A:T

unor împ'erecheri, d'or,'eclite a fi real'e Si prin modelare molecularà, între A $i T r'espectiv G gi C. Împerecherea de baze azotate are la bazà principiul compl€mentarità{ii, cel mai de seamà în organizarea

ciproce:

A-T, T-A

respe,ctiv

G-C, C-G.

Dar legàturile de hidrogen joacà un rol foarte important în reacfiile biomoleculelor, formîndu-se Ei dezorganizîndu-se cu uqurintà fàrà a necesita surse energetic'e speciale, avînd totodatà rol esen{ial în reacliile car,e imp,licà recunoaqterea de, structuri compleurrentare cum ar fi replicarea, tra,nscrierea Ei repararea ADN ca Ei în traducerea me,sajului genetic. Structura bica'tenarà a ADN prezintà de regulà o mare stabilitate' rizicà, asi.guratà pe verticalà d,e' punlile fosfodiesterice intraca,tenar,e, iar pe orizontalà de punfile de hidrogen intercatenare qi de stivuirea (stacking) perechil,or de baze ,a'zatate în cadrul dub'lului helix, 't,oa,t,e acestea fàcînd ca ADN duhlu-catenar sà aparà ca o structurà CIarecum rigidà, para26

cristalinà. Caracteristicile structurale finale ale ADN dublu-catena'r sînt dictate însà de moieculel'e de dezoxiribozà care se aEazà cu ,oxirgenul inelului orientat în sus Î,n cadrul unei catene qi ,orienta't în jos în' cadrul catenei complemen,tare. Din eauza acestui aranjament opus al moleculelor de dezoxiri'bozà în cele douà catene Ei d'eoarece zahàrul 6e leagà la o pozitie exc€ntricà a b,azei az'otate, întreaga mroleculà de ADN este obligatà sà se ràsuceascà, sà se spiraliz'eze, rezultînd nu o s'tructura dreaptà bicatenarà ci una spiraiatà dublul h,eli,t, în care fiecarre p,ereche succesivà de baze azotate se întoarce cu 36 " în direcfia acelor',de ceas,onnic, dublul helix fàcînd u,n úur complet (360o) 1" fiecare X0 perechi cie ,baze. Structura polimericà a macromoleculei ADN permite înscrier',ea în aceasta, sub formà codificatà, a unei cantitàfi de informaiie geneticà teonetic nelimitatà. Nu,màrul, permutàrilor posi{bile este de 4n, în ,car,e n reprezin'tà numànrtr nucleotidelor de-a iungul u:n,ei catene ADN. Cunoscînd cà cele mai rnici virr.'suri au în ADN cel pu{in 1500-3000 nucl'eotide, aceasta fiind limita inferioarà dirnensionalà a genom,ului pentru sistemele biologice, pute'm a:vea im,aginea enormei diversi'tàti informa{iornaie a siste,melor 'ereditare din lumea vie, Ei ne ptrtem explica, de c€ este ,posiibll ca fieca,re specie sà ailbà pnopria sa infonmafi,e ereditarà, rdiferità de a altor specii. Rece,nt douà eohipe de cercetàùori, una americanà condusà de A. Rich de la Massachusetts Institute of Technology, gi alta ol,and ezà (J. H. van Boom qi Gijs van der Marel) de ,la Uni\rersitatea din Leyda au descris la nivelul unor polinucleotide sintetice de tip p,oli d (G-C) duplexuri ADN cu spirala orientatà se,nestrLt (ADN de stîn*ga) avînd conformalie dife,rita de ADN ,normal cuno,scu't ca ADN de dreapta. ADN de stî,r\ga prezintà aceeaEi regularitate internà, 'aceleaqi asocieri de baze az,otate ca Ei ADN de dreapta, dar Ei unele difer,ente stnrrchrrale consid'erabile. Astfel, în ADNT de stînga grupele fosfat se dispu,n, nu dupà uin traiiect rectiliniu, ci dupà 'un tra'iec*t îm zLg-zag, ADN de stînga, numindu-,se Ei ADIV-Z. În ADN de stîng,a perechile rd'e ibaze sînt expuse mai spre exteriorul dutbl,ului helix Ei pasu[ elicei c,uprinde, nu 10, ci doar 6 perechi de b,aze, din care cauzà, forfe'le de stivuire sînt mai mici iar molecula cle ADN-Z apar,e mai fragilà, avînd un dia'metru ceva ma,i mic. Plasarea perechilor de bazre' ,azo'tate mai spre ,exteriorul rnacromol,eculei ADI.{-Z face ca su,bstanlele reactante sà interacfion,eze rnai usor cu ibazele azotate. Dacà a'ceste su'bstante sînt can27

l

r
I

cerig€re, ADN-Z poate sà condilioneze transformarea rnal,ignà a celulei. StructurA de fip ADIV-Z poate sà aparà în anurnite condifii chiar în cadrul structurii normale de ADN nativ l'a nivelul unor anlunite segrnente ale acestuia. Conformafii sen,estreau fost descrise la nurn,eroase polinucleo* tide sintetioe de 'tip pali-d (GC), poli-d (GC) sau poti-d (AC). poli-d (GT). Se aratà cà structura sen,estrà este accesiibilà oricàrui segment de ADN cu o s'ecven{à de 'baze alter'native purinà-pirimidiurà (Arnott Ei colab., 1980). I)escoperirea, confcrma{iei senestre a ADN extinde eno'rm limitele structurilor $ecundar,e cunosc,ute pentru duplexurile ADN. El,e pot fi implicate în multe aspecte referitoare la schi,rnibàrile conform,afiona'le ale duplexu'lui ADN în replicare, dena,turare, transcrier,e. Regiunile dextre Ei s,enestre dintr-o moleculà de ADN pot fi separate dcar de 2 nucl.eotide. P'e baza datelor de structurà a ADN se poate deduce funclia sa de rnoleculà informafionalà Ei se poate defini unitatea funcfionalà de transrnitere a caracter,el'or ,ereditare care a fost numità gènd,. Genq, reprezùntd lLn se'gmeflt, o por[iune din lnfrerom,alecula de ADN la tost'e sisternele biologice sau de ARN (l,a ribo'uirusuri) de lungime uarinbild care define sub farmd codificatd informn{ia ereditard ce dirije'azd, sinteza unei ca'tene po,lipeptidice. Gena c,on{ine în m'edie între 900 Ei 1500 perechi de nu'cleotide. Peste arrrumite limite de temperaturà (într'e 63aC .9i 100'C) stabilitatea legàturilor de hidrogen cedeazà avînd ioc desfacerea dublului heiix. În c'eLe douà catene complem,entare, fenomen ,numit clenaturare termicà. Cea mai scàzutà ,temperaturà de denaturare cunoscutà este' 65"C qi se Înregistreazà în cazul den,aturàrii polinucleotidului sintetic poli d (A-T). Dacà amest,ecul monoc&t,€n€lor r,ezultate din denaturarea dublului helix de ADN se ràceqte brusc ele rà'mînd permanen,t separate' gi un asemenea ADN se llumeq.te ADN denntLdtr'at. Dacà amestecul de rnonocatene se ràceEte lemt, treptat, are loc o reasocier,e a catene'tror cu refacerea legàturilor de hidrogen di,ntre el,e, r,estaibilindu-se structura bicat'enarà a ADN. Acest fenom,en s-a numit rennturareq ADN (Fig. 16). Temperaturà de denaturare p,oate constitui un indiciu indirect privind prooentul d,e baze azotate din struct,ura ADN. thir ADN în care predominà perechile A-T, între care existà 2 punfi de hidrogen, v8 prezent,a o temperaturà de denaturare mai micà deeît un ADN în' care predo,minà perechite G-C care, prezentÎnd trei punfi de hidrog€D, sînt mai rezistente la dena2B

Af,
a H

il

cíe'cturare

-

AD I{

r &4: j:
AR N ir,rlerenicn

z,"qJ qnr

gj:

ADN

Fig. 16. Denaturar_ea.gi renaturarea aDry (A). Denaturarea gi hibridarea molecularA (B).
"toC*C
100

BO

Hycoba cterrun phlei

60

40

Fit.

aefurare a ADN de la diferite surse, avînd un confiuut variabil G+C (dupA J. Marsrur $i P. Doty, 1959).

17. Temperafura de

de-

?0
0

29

Fturare, nec,esitînd pentru aceasta o temperaturà mai ridicatà (Fig. 17). Prinr denaturare-r€rrsturare se pot rea,liza hibrizi ,moleculari între ADN ,ce provine de la diferite specii, putîndu-se aprecia gradul de înrudir,e dintre specii pe criterii rnoleculare. Astfel, dacà renaturarea ADN homolog e,ste teonetic de 1000 , renaturarea ADN heterol'og (ce provine de la specii diferite) esúe în fr-rrrcfie de apropierea filogeneticà a speciilor (7So7o între ,om Ei maimuta Ei 250/o în,tre om Ei goar,ece, bu'nàoarà) Hilbrizi moleculari pot fi realizali Ei între ADN Ei ARN, iar cînd aceastà hibridare se realiz eaz,à, in si;tu, se pot loca,liza pe cr'omozomi genele care dirijeazà sinteza diferitelor categorii d,e ARN celular.
3.4. STRUCTURI TAUTOMERE

Prin deplasarea unor atomi de hidrogen de la un atom de azot sau ,oxigen d'e la o ,grupare l,a alta a nucleului purinic sau pirimidinic, fenomen numit migcare tautomerà apar formele tautomere ale inelului purinic sau pirimidinic care 'trec de la
l-l
I

NJ-H
I

NH

1;':-/'-\C/\ rll

illr'Hà Cì'.-1 rr/C\
r,l
roe

\
/
NH

**r'

C \C

ti

-N

HC\ ,/\-,t'
NNH

tl \.u

Adentna :f orna antnOJ
ra

Adentna ( forp; tmíno,

c-cH" %,'cx t'
O:C
t

ó?''/

,e''aÚtúA

OH
I

-T

il

I

--'>

\ ./cH
NH

i lL,, o=i\ ,/cH
NH
tautomere.

y/ \ c-c H.J

l^ \r,

Itnt. ) {rornA: cetonrca)

Ttornà ( forn.: enoliciI

Fig. 18 Structuri
30

forma amino (NHz) la forma imino (NH). AceIaEi lucru se întîmplà ctr atornii de oxigen legali de atomii C6 ai guaninei qi timinei cane au în mod normal forma aeto (C:O) qi care În urma miqcàrii tauto,mere trec în forma enolicd (C-OH) (Fig. 18,
MiEcarea tautornerà creeazà posibilitatea împerecherii gresite de baze azotate de tip A-C qi G-T, fenomen care poartà în sine ca'uzele apariliei de mutafii spontane (vezi procesul mutagen).
19).

/(
N

A ( oornalà

4/

,W,ì -

antno

)

w
o

')n,n,

í-- .
NHz

.-

-''

rv

N

Hz.

6 (nornalà ceto)

G4 (f orna rarà enattrè )

NH

1/\
t,---r/

,0
C r4ornalé anino) Cf

,N

\r
inino;

r f orna rarà

Fig. I 9. Tranziliile tautomerice d.e la formele comuue, stabile ale bazelor azotate (A, T, G, C) la formele rare, tautometice (A*, T*, G*, C*).
31

3.5. EXCEPTIE

DE LA STRUCTURA BICATENARA A ADN

eficace pe structurile bicatenare de ADN. S-a tras aoncluzia cà ADN de q X174 este monocatenar, adicà s€r prezintà în mod n,ormal ca structurà primarà, apàrînd ca o mol'eculà ci,rcu'larà de ADN mornocat'enar (Fig. 2q. O situa{ie asemànàtoare s-a evidenliat gi la atli bacteriofagi precum q^R Ei StB. Asomenea cazurí în care ADNT se prezintà îm s,tare naturalà ca strucfurà monocatenarà ne sqgerc azi cà de fapt la toaùe sistemel'e tbiologice ar fi po'sibiià înscrierea informaliei ereditare în structuri monocatenare. Starea dublucatenarà nativà a ADN Ia covîrgitoarea m,ajoritate a 'sist,em,€1,or biologice este o stare redutantà, r'eiteratà. Dar cum înseEi s,tructurile monocatenare devin în timpul replicàrii structuri dutblu-catenaffi', însea,mnà cà natura a avut o anumità ,,rafiune( de a-gi baza realizarea fenomenului ,ereditar pe structuri dublu-catenare. Dealtfel natura face un foar,te interesant joc de duplicitate, începînd d,e la pereehea de'baze azot'ate specifice, structurile du'blu-catenare, structurile cromozomale bicroma,tidice, existenîa structuril,or sernicnomati-

Cercetàrile lui Sinsheimer (1959) efectuate la bacteriofagut g XL74 a:u aràtat cà ADN la acest virus prezin,tà o structurà care nu se încadreazà în modelul de structurà bicatenarà. ,El nu prezintà o structurà complementarà, fiind atacat de càtre losf odiester'ozo, extrasà din E. col;i, acliunea acnestei enzime fi,iurd in-

Fig. 20. Bacteriofagul OX 174. a. particule fagice intacte colorate cu ecetat d,e uranil ; b. cromozomal circular (ADI{) moîlocatenar de OX 17 4 (dupà Finch, Dressler gi Wolfson, din Goodenough gi Levine, 1971).
32

dice qi contiqruînd cu existenta a d,ouà seturi de cromozomi în garni'ttrra diploidà (numàrul, d,e cr,omozomi variazà 'd,e la 1 la precariote tra cel pufin 2 (Ascorris megaloceplwla uniuq,tm,s) sau 4 (HWlopappus gracilis compozità) qi ajurgfnd la ordinul a B, 10, 20,100 qi mai mu,lfi la al,ùe eucariote (Lima-de-Fari.a însà, consiclerà cà oric,e celulà 'eucariotà are de fapt nevoie doar de 3 crornozomi: un autoz'o,m pe care sà fie plasat'e majoritatea g€n'elor, un cromo zom de sex care sà intervinà în determinarea s,exului qi un cromozom organizator nuel'ear eare sà posede, genele nucleolare) apoi douà sex,e separa,te, implicînd douà tipuri Ce gameli diametral ,opuse qi terminînd cu larg raspînditele cazuri d,e simetrii ale naturii (sà luàm doar fiin@ timanà, doi ,ochi, douà urechi, douà nàri, douà mîini, douà pícioar€, . . , e,te . . .). Complernentaritatea apare ca o condi{ie esenlialà în desfàgLlrarea multor fenomene ale naturii. În cazuL ADN, complementaritatea catenelor din structura dublu-catenabà est'e esenfiaià în procesele de replicare Ei transcriene, iar 'existenta a clouà caten,e apare ca o ,,grijà( a naturii de r asigura ,transmiterea fidelà a informaliei ereditare în condiliile în carre fenomenul mutagen ar afecta urr-à dintre cele douà catene. Dacà muta{ia afecteazà o structurà monocatenarà gansa d'e a transmite fidel irnformafia ereditarà este practic nmlà, p€ cînd în cazul structurii dublu-catenare aceastà qansà este de 500/* Dealtfe}, vom vedea cà în cazul reparàrii 'leziunilor din ADN induse de mutageni, integritatea uneia dintre cele douà catene ale dublului helix ADN devine esentialà, condifie sine qua non a reuqitei repaieirii. Este d,e la' sine înleles cà aceas'tà ,,gii;à" a ADN, spre a-$i asigura înd'eplinirea funcfiei sale, ru are nimic d'e-a faoe ' ''' :l cuaspeót"d,eteléologie.
3.6.

c.$urarEA

DE aDN gr TNFoRMATTa EREDTTARA

da Feulgen-Ross'enbeck). Cantitatea dp ADN este specificà fiecàrei specii, €a menfinîndu-se consta,rftà de Ia o generafie celularà ia alta. În ciclul celular (perioada dintre douà diviziuni succesive alcàtuità din in,terfazà Ei mitozà) se r,emarcà o.trecere a cantitàtii de ADN de la ,o valoare considera'tà diploidà .tipicà pentru fiecare specie (2 C) gi care se înregistreazà ,1a' sfîrEitul diviziunii nuclear€,' cînd nucleii fii trec în interf azà; la dubla3 - Descifrînd tainele ereditóiii, vol. I

Canr' fuuu relativà de ADN poate fi apreciatà citofoto,metric prin anatifa nucleilor interfazici colonafi cu leueofuxinà (meto-

33

rea ac,6tei cantitàti de ADhT (4 C) în timpul interfazei. La urmàtoarea diviziune nuclearà prin intervenlia aparatului mitotic cantitatea dubtà (4 C) de ADN va fi distrirbui'tà echilibra,t în c,elulele fiice, acestea primind o aceeaEi canti'tate diploidà (2 C) de ADN. Mitozn apare astfel ca un mecarrism ,bi'ologic fundarnental car s asigurà constanta cantitativà a ADN-ului în succesiunea g'enerafiilor celulare. Nlitoza apare astfel ca e permanen:tà legàturà între trecut Ei prezent, asigurînd transmi,t,erea unei aceleiaEi' cantità{i de informalie geneticà de la celula ma,mà la celulele fi.ice (Gawilà Ei Dàbalà, 1975). S-a mai constatat cà în gamefi (celule sexuale) cantita'tea .le ADN este r'edusà la jumàtate fa!à de can,titateia dipl,oidà car,acteristicà speciei considera,te (2 C). Din aceastà cauzà, gaffielii sînt haploizi (cantitatea de ADN:lC). Totodatà s-a constatat cà în gameti numàrul de cromozomi,est,e redu's Ia jumàtate fa!à de celulele somatice (toate celelalte celule a1e organismului. Prin unirea gamefil,or de sex opus, în pr,ocesul fecundàrii, s,e restabileEte cantitatea, n,ormalà de ADN caracteristicà speci'ei date (1C + 1C=:2C). Ga,melii apar în urma unei diviziuni celulane de tip specia'l numità meiozd,, aceasta fiind de fapt o diviziune de reducere (îniumà'tàtire) a numàrului de cromozoml Ei t,otodatà a cantitalii de ADI.I. Meioza apare ca u,n mecanism compensatoriu al fecundàrii, obligatoriu la or€anismele cu reproducere s'exuatà care previne màrir,ea exponenfialà a cantitàtii de ADN, ce ar avea loc în condiliile unei fecundàri a gamelilor a càrror cantitate de, ADN nu ar fi redusà la jumatate comparativ cu celule,le somatise. ADN-uI se caracterízeazà printr-o nemarcabilà c'onstan!à cantitativà riguroasà dea lun,gul generaliilor c.elulare, ceea ce n,u 'este eazul altor com,ponente macromoleculare atre' celulei (proteine, acizi ribonucleici etc.) care prezintà varialii canti"tative evidenùe nu numai de-a lungul generaliilor celulare dar ehiar în cadrul diferi'ùelor ce'lule ale aceluiaEi organ'ism ia un m,ome,nt dat. Recent, s-au adus multe date în sprijinui unor exc,epfii de ]E rqgula cronstenlei valorii canrtitaúive a ADN, în ciclul celular, rearlizînd'u-se vari,alii aùe cantitàlii de, ADN prin mecanisme de replicare diferenfiatà a ADN (Nagl, 1978, 1979). Prin experirenle de marcar,e cu izotopi radioactivi (1tr3, CI4, P31 s-a constatat, cà radioactivitatea odata încorporatà în macromoleeula de ADN (de exemplu timidina tritia'tà timidina H3 este încrcrporatà în' ADN în locul timinei fiind un precursor al acesteia) nu o mai pàràseEte atîta timp cît celula trà34

ieSte, c€ea ce înseamnà cà, odatà sintetizatà, rnacromolecul,a de ADN nu ma'i este dezagregatà spr€ a fi resinrtetizatà. Aceasta înseamnà cà spre deosebire de alte oomponente macromoleculare

prfu:tr-o,rnare stabilitate. Urmàrind cin,etica' renaturàrii ADN-ului denaturat car€ aparline la specii diferite se coxLstatà cà cu cît specii'le sint rnai apropiate filogenetic cu atît proeenúul de refacere de strtreturi dublu-catenare este rnai mare, ac€;asta deoarrece speciile a'propiate din punct de vedere fiL,ogenetic prezintà într-o proporfie mai mare succesiuni similare de baze azotatn în macromolecula lor de ADN, adicà pr,ezintà u,n anumit fond de informafie ereditarà co,nnunà. Acest fapt ne face sà gîn'dim cà ,evolufia speciilor s-a desfàqurat în principal la nivel molecular.
3.7. STNTEZA REPLICATIVA

care sqrferà turnover rapid (degradare Ei resintezà ,cu sctrirnib continuu de ,atomi) macromolecula de ADN se caracterizeazà,

A ADN

Deoarece ADN confine informatia geneticà a celulei, sinteza sa este unul dintre cele mai importante evenimente din via,fa

Realiza,tà prin intervenfia unui cornplex aparat errzimatic, sinteza ADN este o reaclie de tip repficativ, fiind ,rrnicul caz din lumea biomoleculelor în care o substantà îqi dirijeazà prcpria 'sa sintezà. Complexul de replicare care include aparatul enzimatic Ei molecula, de ADN în replicar'e se num'e$te repli-

acestei,a.

to%ouotura

tbic,anrtenarà se dov'edeqte €ù avea implicafii ,biologice dintre ,cel,e mai profunde, dar prezintà Ei un foar,'te iqLteresant punet de dezbatere filozoficà ea expl,icînd, cel pulin în parte, unele dintre misterele vielii. In uirso, sintez,a aeí,zilor nucleici (ADN gi ARN) s,e d.esfàqoarà în trei etape: a) stnteza precursorilor nucleotid'elor purinice qi pirimidinice adicà a acidului uridilic Ei a acidului inozinic (Frg. 2I); b) sirnteza nucl,e,otidelor propriu-zise care intrà direct în alcàtuirea macromoleculelor acizilor nucleici (dezoxiadenozintrifosfat (dATP), dezoxiguanozintrifosfat (dGTP), dezoxicitidintrifosfat (dCTP) qi dezoxiti'midintrifosfat (dTTP) pentru ADN; ad'enozintrifosfat (ATP), guanizintrifosfat (GTP), citidintrifosfat (CTP) qi uridinúrifosfat (UTP) pentm ARN;
35

Acid uridilh ( UMP,

f u'io;n

lrilosfot ( Uf P) tritosfot (CTP)

Citidin

lnterconrersb pirimidinnudeotldicó

Ì Dezoxitimidin trifosfat (dTTP)
I

2 É.

Dezoxicitidin trifosf ot (d CTP

)l=
I

!cr
Guonosin

trifosîot

Dezoxíguonosin

lo
I

(GTP)

lnFrcqrversie
prrh-rruc.leo-

trifosfot (dGTP).
Dezoxiodenozin

Adencín trrfosfot (ATP)

trifosfot

(dATP)

i
l
t

Acid inosinic ( IMP)

Fig.
t

2l

. Cóile bioslntezei nucleotidelor.

c) polirn,erizarea ordona,tà a nucleotidelor într-o secventà camplementarà unei matrife (dupà modelul semiconserl'ativ) sub cataliza unor enzime polimerazice celulare. Sinteza in uitro a ADN a fost realizatà de càtre A. K,ornberg, I. Lehma'n,n, M. J. Bessman Si E. S. Simms în 1'J56, în sisterne acelulare folosind un echipamern't enzimatic polim,erazic extras de la E. coli (ADN potimeraza I sau enzirna lui Karrlberg) în prezenfa ionilor Mg++ $i a unei matrile ADI{ înaitpoiimerizatà. Sinteza in uitro a ARN a fost realizatà pentru prima Catà de càtre Marianne Grunberg-Manago Ei Severo Ochoa de La Universitatrea din New York, în anul 1955. Pentru aceasta au folosit un sistem ,enzimatic ARN polimerazic, ionii metalici ,bivalenli (Mg++) Si un segment ADN ca matri!à. Mecanismul de replicare ssmiconseruatiud, a ADN pr€:supune separarea ca,tenelor complementar,e prin desfacer,ea punlilor de
36

unui noi

hidro'gpn, fiecare catenà servind drept matri!à pentru sinteza catene, complementare, refàcîndu-se a,stfel structura bicatenarà a noilor macromol,ecule ADN care vor avea astfel cîte o cat,enà veche Ei alta nou sintetizatà,. Acesta este modelul sernicanseruatiu de replicare a ADN. Prima dovadà experimentatà în spriiinul m,odelului semiconservativ de replicaró a ADN este aclusà ia nivel cromozomaì de càtre H. Taylor (1957, 1958) în sistemele eucariote qi în acelagi timp, la nivel molecular', de càtre meselson qi Stahl (1958) în sistemel'e procariote (8. coli). +vr Incà din anul 1950 Srvift aràtase cà replica'rea ADhl în celulele eucariote este restrînsà doar la inteif azà, la un stacliu pe care Flowarcl qi Pelc l-au numit stadiu ,,So', separat cle ctiviziunea pr,ecedentà printr-un stacliu G1 (de gol sintetic) qi urmat de trn stadiu G2 în care, de asemer€a nu se mai sintetize'azà ADN. G1 este f'oarte varia,bil durînd de La 3-4 ore, la zile, sàptàmîni qi luni, depinzînd de tipul de celulà gi starea fizioiogicà (Gavrilà gi Dàbalà, 1975) . G2 este mult, mai constant, clurînd 2-5 or,e iar S clureazà 7 ore. Pregàtirea nucleului pentru re-B plicarea A.DN se face . în Gt, fapt demonstrat de expuner,e,a, prin transplant a nucleilor, Ia citoplasma celulelor aflate în Gr (nu qi în atte f.aze) care aratà cà ace;ti nuclei i,ntrà de îndatà î:n stadiul,S, de sintezà a ADN. În 1957 Taylor, W.oods $i }lughes au efectuat experienfe ,autoradiografice la cromozomii cle Vicia faba, folosind timidina tritiatà (3H) precursor al timinei. Radicelele crescute pe mediu cu timidinà au pr,ezen,tat crorrt:o-3g zomii uniform rnarcali pe toatà lungimea 1or. Ele au fost apoi transferate pe rnediu fàrà timidinà tritiatà (mediu ,,rece'(). Iì,adicele au frost tra,tate cu colchicinà pentru a fi prevenità formarea fusului de diviziune astfel cà produgii replicàrii fiecàrui crom,ozom ràmîn unili la nivelul centromerului. S-au efectuat preparate citologice pentru cromozomi dupà un ciclu cle diviziune, dupà douà cicluri etc. Cînd au fost analizat'e autoi'acliografic aceste preparate, autoradiogramele cromozomiior" clin radicele cultivate pe m,ecliu cu timidina tritiatà prezentatr ambele crornatide marcate radioactiv (FiS. 22). Cînd s-au efectuat preparate din raciicele cultivate pe rnediu radioactiv qi apoi transfera.te pe mediu neraclioactiv (fàrà timidinà pentru -lH), un singur ciclu celular (o si;ngurà diviziune). cromozomii din aeeastà a doua rnetaf azà, statrn'ochineticà cl'e clupà mal'care prezentau o cromatidà rnarcatà qi alta nemarcatà. Aceasta a fost prima dovadà experim'entalà certà în sprijinui modelului serniconservativ de replicare a ADN. El a fost dovedità gi la alte organisrne veg€tale pi:ecurn Crepis gi Belleuolia. Dar ela
37

r

:/
a
doua

duprcare ctt :[:#,!;:::í;3 lintdinà frÌtrafà dupà marceie

(anbele cranalide narcaf e )

c,tpticare ràri linrdinà frifíatà

nefafaú
re

drp;

sf afncchineticà
mdi'ca

'

( o c í'ona f ,,Cà rna rcafí si a rf a na narraté I

Fig. 22. lVIodelul replicórii semiconservative a cromozomuiui eucariot
(Taylor, Woods gi Hughes, 1957)

(duplt

d,ovadà inclirectà a replicàr:ii ADN, prin care de 'fapt s,e dovedea replicare,a semicons,ervativà a cromozomi'lor. Dovadà directà, la ni.vel m,olecular, a replicérii semiconservative a ADN a fost adusà în 1958 de càtne Mese,lson Ei Stahl, prin experienfe de transfer izotopic (FiS. 23). Autorii au crescut pentru multe genera{ii ceLular.e E. col,i pe mediu în car'e în

o

Mode(e de obsorbfre UV dupò

centrilugort
-

lnbrptltqre
in tcrm6É deruptrcore

totogrcfterit tn
UV

Aspcctut.

ccmiatìserntivó

:ffi
Crenerofic
ADN
f
1

J
^ /\,r!
(1958)

!,octerii trons-

extros din

r:rote

cu lltN

pe mecíu

Fig.23. Reqrezentarea graficà a experieufet lui Meselson Si Stahl

: u$or'i"S;tilr J" ;^ó:Tffi*i:t(til

ffi ilHPir#r.-

.L - light heavv

3B

sursa, de anlt (NHrrCl) iurÉra nu azotul normal' 11'N ci iz t,opul sàu greu 15N, astfel cà în macromolecula ADN atomii cle N erau r€prezentanli de 15N. În prealabil s-au fàcut cercetàri de ultracentrifugare qi s-a constatat cà ADN cu 1r'N bande azà diferit (mai sus în tubul de centrifugà) fata de ADN cu 15N care hande azà la un nivel inferior, spre fundul tubului de centrifugà. Dupà cre$terea bacteriei pe mediu cu 15N pentru rnult,e generafii, celulele sînt transferate pe mediu cu t4N pentru a desfàgura un singur ciclu de diviziune (a càrui duratà era precis deterrninatà 90 minute). S-a extras ADN Ei s-a ul'tra'centrifugat. S-a c,onstatat cà a,cest ADN ,bandeazà la un nirtel intermediar în,tre 14N qi 15N. Cu alte cuvinte acesta era un ADN hibrid, în care o catenà prezenta ca atomi de N, azotul normal 14N iar catiena complementarà prezenta izotopul greu al, acestuia l5N. Dupà douà generafii celulare d€ 'la transfei pe mediu cu 14N se constata cà prìopor{ia de ADN hibrid 14N 15N scade la jumàtat,€, cea,laltà jumàtate fiind repr€z€ntatà de ADN cu 14N, dupà trei generalii raportul dintre' cantitatea de ADN hibricl qi ADN c,u 14N este de 1 : 3 q.a.m.d. (Mode1 semiconservativ de replicar€ s ADN propus de càtne, Wafuon gi' Crick în 1953)" Mod'elul semiconservativ de replicare a ADN asigurà o continuitate a fenomenului ereditar, càci cele douà noi' molecule bicatenar'e de' ADN sîn,t identice pe de o parte între ele, iar pe de altà parte sînt identice cu uurcromolecula inilialà (parentalà) de ADN ca,re $i-a ,,topit(( iidentitatea în sinteza rnoleculelor fiice. Primul eveniment a} replicàrii ADN ,este desfac,erea, separ,area catenelor complementare aLe dublului helix din care cauzà molecula de ADN }'a punctul de replicare are formà de U, aceastà structurà fiind,,, numità bifurcagie de replicere. ADN este replicat cu ajutonil unui complex multienzimatic nurnit' ,,aporat de rep1icare66. Ansamb,lul de evenirneur,te care realizeazà, replicar,@ ADN a fost conve,nfi,onal îrnpàrlit în inifierea, continuarea Ei terminairea replicàrii, etape care se pot întîlni Ei în sinteza altor 'rnacrornolecule informafionale' (ARN Ei pro'teine). ADN natural se aflà sub formà de structurà ter{iarà, structurà în car€, el este superspiralizat. La eucari,ot,e tururile superspiralizate din ADN liniar rezultà în urrna asocierii sale cu proteinel,e bazice, hist;one; pe cînd la procariotele, Ia care macromolecula ADN ,este circularà, tururile superspiralizate sîn't formate prin intervenlia unei enzime speciale care s-a nu,mit ADN Eirazn, aceasta aclionînd chiar din, m,omentul replicàrii. Tururile superhelicale pot sà aparà Ei'ca rezultat aI desfacerii (desfaquràrii) dublului helix în
39

r
tirnpul replicàrii. Din cauza vitezel mari cu care ar€ loc. desràsuci{ea dublului helix în fata bifurca{iei d'e replicane, rnai ales ia moleculele :ci,rcular, .închise rse forrae azà o supe,rspiralizare, astfel cà o ,etapà' necesanà, în replicarea ADN ,€ste ,îftd,o.'. pàrtarea structurilor terfiare superspiializate, În scast, ,proces intervin enzime care, ralaxeazà, tensiunea de ,,:ràsucire, ,prin crestat"ea unei catene înaintea 'bifurcafiei gi astupapea ;acestei crestàturi dupà ce s:-a reaLizat relaxarea. Aceste erìZime, s:€ru numit enzim,e de crestore-,ast'ttpw€, descrise atît la procariote cît qi ia eucariote. S-a mai descris Ei ,enzirna Al)N=topoízorneTazQ, o enzimà care introcluce ,o crestàturà morl,ocatenarà tranzitorie în duplexul ADN, oferind astfei LtR pivot pentru clespi=
raliz.area

Pentru desfacerea, ,punfilor" de hidrogen dintre ca'tenele corn,plementare în veder,ea replicàrii inlervine o enzinrrà destabilizatoal"e a dublului helix care a fost numità unusindszd., Catenele compl,ementare separate funcfiori.eazà ca rnatrifà pentru sinteza de noi cate'ne complementare. Nucleotideie 5'* trifosf at libere din mediu se aliniazà pe matri{à, împerechínclu-se cu bazele complementare d,e pe aceasta cu italbilirea unor Punli cle hiCrogen. Enzima ADN polimerozq dependen,tà de ADiV catalizeazà formaiea legàturilor covalente : fosfodies, terice dintre nucleotidele învecin",ate. Inilial a fost descrisà €rrr zima polim,erazicà. ADN polimnraza I sau enzi'ma tui Kot*rtberg ca avînd rol esen{ial în replicsr'e, dar cercetà,ri ulterioarq au stalbilit cà ea intervine ,nu*ui într-,o etapà ulterioarà a pr.ocesului ar'înd rol esenfial în sinteza rep.ara,torie. As tàzi estg urnanim acceptatà, interve'ntia în etapele inifiale a;le,. neplicàr:ii ca Er în alungirea catenei nou sintet íz,a'te a enzim,ei polim,erazice dese,m;natà ADN pol,imeroaa III. Toate enzimele polimerazice eu capacitatea de a alungi numai catene polinucleotidice deja existent,e,,rlu însà'Ei de a initia sinteza ,,de no'vott ,a unei cate,ne. Pentru aceasta ele rl€ce-r sità un elem'ent ajutàtor prin car,e se: primeazà (i,nifiazàl o as,ern€rr,ea sintezà. În calitate de primer poate fi folosi,t ,un mic segment de ARN lung de cîteva nucl,eotid'e. De aceea primul e'v"eniment în replicare dupà destabilizarea (,,topirea{t) dubtrului heiix este si'nteza prin in,tervenfia enzimei ARN pattmerazd, 'a unu$ ARN primer. Acesta oferà ADN polimerwzei un capà't 3'-OFI liber al càrui nuclmtid,este împerecheat cu,o bazà oornplementarà din matrifà. Acurn, ADN pcttimero,za, catalizeaz,& reacfia de cond,ensare a acestei grupe 3'-OH a prim,erului ,$i a gr.upei 5'-f,osfat a', primului nucleotid 5:-trifosfa.t a,l.iniat pe
,

superhelicelor.

:

ì

40

i
I I
I

rnatritrà,'',cui realizarea primei ,le,gà'turi covalente f,osfodiesterice. Replicarea ,ADN este ,astfef ini{iatà. Are loc alungirea noii catene, ;capàtul ,3f-OlI al fiecàrui, nucle,otid aliniat servind de fiecare datà ca prim,er, din care eauzà catena de ADIV nou sJntetizatà' se mai numeqte Ei ADN primer. Proeesul continuà pînà 'ce es.te f,olosità întreaga matri!à avînd loc sinteza cîte unei caterr-e complementare matri$el'or cu forrnàr€a, . €t douà rnolecule fiice identice de ADN. ' Toate' ,ADN pólimerazele dependente de ADN pot cataliza adàugarea de nucleotide Ia o càtenà primer numai ca ràspuns (în virtutea eomplementaritàtii bazelor azotàte) Ia secvenla d,e baze pe'care or gàsesc pe o a doua catenà, batena matri!à. Astfel daeà un grup 3'---OH lib,er de pe o catenà primer stà 'opus un'ei tirnine pe catena matri{à (ternplate) polim eraza va, permite atagdrea numa,i a unui dezoxiadenozintrifosfat (dATP) la ca,tena ,pfim€r chiar dacà dCTP, dTTP qi dGTP se aflà fur :mediu. Cîttd în mediul de reactje' sé aflà un 'ànnestec confínÍnd ADN ,polimeraze gi nucleo ztd-trifosfafi împreunà cu fragrnente dE ADN; ''aceste 'fragrnente pot servi atît ca primer cît qi ca rn6itfità,. . , Polaritatea opusà a catenelor-matri{à, 3'-+5' a uneia Ei 5'+3' a celeil,alte a, ridicaú problema existentei ,a douà polimeraze cane sà dirijeze potiùerizar€a, rtna în- direclia 5':r3' , alta în 'directia' 3'+5i, Aici s-a înregistrat dilema centralà a replicàrii ADN dat fiind faptul cà nu au fost descoperite douà enzime' p-olimeraziee care sà polimeriz'eze în direcfii opuse. Cercetàri' recente au stabilit însà cà în repliea,re intenvine o singurà enzimà esen{ialà , ADN polimereza III, car,e are specificitate de direc{ie, nu de se,cven!à de nucleotide. Astfel, ,aceastà enzimà se deplaseazà numai în direcfia 3'-+5' pe anlbele catene-rna,tri!à, determinînd polimerizarea noilor catene (replicilor) numai în direc{ia 5'--+3'. Comportamentul polimera'zei III nu este în acord cu m'odelul ini{ial d'e replicare propus de Kornbefg, în qare s,e acorda rol ,esenfial enzimei ADN polimeraza, I, enzimà care ar fi determinat o sintezà continuà a noiIor catene.' Experienle1e de fftfrrcare pulsatorie (pentru scurt !imp) cu timidi'na tritiatà ef'ectuate de càtre Okaiaki Ei colab. fntr-e ,19:59-1970 au adus dovezi ,pentru existenta unui model discontinuu de r,eplicare în care, noile catene sînt sintetizate pe segmente mici cleotide, cpre'apoi sîn! urrile prin punli fosÎodiesterice eovaLente ,Frip 'aetivitatéa enzimei, ,ADN-ligwo în segmente mai mari qi în ultimà instan{à:,reZUltà,'o'catenà continuà nou sintetizatà,
; r. -.' a. '
'

I I I
I

I

4t

replieà a matri{ei (complem:enta'rà ,ac'esteia). În aces.t caz, sinteza fiecàrui fragment Okazaki este prim,atà d,e urr segm,ent d.e ARN primer sintetiza't prin intervenfia ARN polimerazei. Dupà sin,teza fragmentului O,kazaki, ARN primer este excizat. Golul ràmas în urma exciziei este umplut prin activiúatea polim'erazei f. La 'nivelul ,bifurcafiei de replicare sinteza fr,agmentului Okazatki se continuà de pe o catenà pe cealaltà, ADN polflmeraza III sàrind de, pe .o ca'tenà pe cealaltà Ei det'ermi,nînd plimeriza,rea pînà ce întîIneqte originea ,replicàrii în cazul primului s,egment replicat sau bariera segmentului ADN deja r,epJicat în cazul urmÉúoarelor segrnente replicate. În ,acest caz intervine o ,enzimà grtdonuclewicd, care deterrninà o incizi.e ,rnon,ocatenarà în segmentul ADN nou sintetlz.at ce s'e continuà de pe ,o catenà pe cealaltà în urma càreia apare un capàt reactant S'-OH fàcînd ca procesul de replicare sà s,e continu€, iar bifurca{ia de replicare sà se deplas,eze secvenfial de-a lungul întregii matrife avînd loq o progresivà desfàEurare a dubluluihelix (Fig. 24A). Acesta este modelul ,,cufitului qi furcul,itei" propus de R. Barzilai qi C. Thomas ca o variantà a modelului pr'opus d'e Okazaki qi colafboratorii în ca,re în cadrul sintezei
A
?

B

3'

,"/

5'

3',

t'/ y,,/
r
ctt I

g

tit 5'
3;

1'j 3'l
3'f

'lt

"5{

Fùg. 24A. Replicarea ADN dupó mod.elul Okazaki-Kornberg. Se prezintà o secvenfà de evenirnente (a-d) de despiratizaÍe 9i de replicare segmentat5- la nivelul bifurcafiei uuui dublu-helixADN.ADN-polimeraza catalizà;sinteza ADN numai în direcfia 5'-+-3', d,eplasîndu-se pe ambele catene-matrifó d.oar în direcfia 3'-;-5', sórind., 1a nivelul hifrrcafiei de pe o catenó pe celattà, a) Despíralizarea dublei-elice (blocurile negre reprezintó puncte de inifiere a segmentelot Okazaki putînd fi scurte fragmente de ARN-prímer). A gi B reprezintà catenele-matflla. b) Pe mà,sura despiralizàrÍi, o po$iune din catena B ràmîne tenporar sub formà înonocatenaró pînà ce o nouó moleculà de ADN polimerazó pàtnrnde la nivelul bifurca$iei spre a umple golul. c) ADN polimeraza determinà pe catena A (catena hdding B (tagging

: "**;,:1!fi#;fl:r ;nHffiJf

,:**,*,:ffi:'

:

42

discon'tinue se sintetizeazà segmente scurte de ADN ataEate la matri{à numta,i prim intermediul punfilor de hidrogen. Dupà o scurtà perioadà de sintczà, pe una din matrife, un segment monocatenar al, celei de-a doua catene parental,e (matri!à) stà expus. Intenrine o & doua molec,ulà de, ADN pol'im,erazà. la nivelul bifurcafiei qi copiaz.à acest sqgment expus al celei de-a douà ''maf'rite''în direcfie invensà fata de prirna matri!à (data fiind plari'tatea lor opusà) dar în aceeagi direefie ehimicà permisà, adicà 5'+3' ca pe prima matri!à. Mode.lul de replicare discontinuà propus de Okazaki a fost unanirn aca€ptat qi s-a dovedit a fi aplicabil la toatq siste,mele biologice. Este posi'bil ca repficarea pe o caùenà sà fie înaintatà (sau unires segrnentelor Okaraki sà fie mai rapidà) iar pe caterur comple,mentanà sà fie rnai întîrziatà (Fig. 248). Replicarea este' reac{fa' cea mai importuntà din lumea vie Ei desfàqurarea ei cade, dupa cum este Ei firesc, sub incidenla unui strict control celular. Controlu,l este efectuat la mai rnulte nivele. L.a, nivel molecular existà mecanisme care asigurà oorecfia repli,càrii càci o bazà azntatà, greEit î,mperechea,tà cu b,aza complementarà din ma,tri!à face ca desfàqurarea polimerizàrii sà nu fie continuatà pîd c€ nu este îndepàrta'tà baza aaotatà gregit împerechsatà. La beza unei asemenea activitàti de corecfie stà re pare activitatsa ADN polimerazei f. Greqetile de încorporare datorate acfir.rnrii unor agenfi mutageni sau iarefieaciúàîii în corecfie a ADN polimerazei I stau l,a baza unuia dintre ,mecanisme,le de apari{ie a m'utafiilor. Dacà la ,:ptrocariote (bacteriii , astilLomicete) replica,rear nu sste restrînsà la o f.azà, anume a, 'ciclului' celular, €B fiind potenlial continuà în condilii optime de'mediu pe parcursul întregutui ciclu :celular, la eucgriote replicarea este restrînsà la o f.azà, b,inó delimitata a ciclului celular plasatà în interf azà. Ei care a fost numità fazo de sinúezd ,S. Durata fazei S este variarbità nu nurnai 1,& diferitele specii dar Ei în cadrul aceluia$I individ la nivelul celulelor afliate în difeite stadii de dezvoltar,e, fiind mai scurtà în stadiile timpurii ale em,briogene zei fatà de celulele somatice diferenfiate. I),e as€rr€nea faza S prernergàtoare meiozei este foarte lungà comparativ cu aceea din ciclul mitotic. Cnornozornii euca,riotelor reprezintà totodatà structuri complexe în care ADN este permanent complexat cu proúeine bazice de tip histonà. Replic,ar€,a, cromozornului eucariot se realiznazà, asincron nu num,ai între diferiti cromozomi n@mologi ai comple'm,entu'lui cromozomal al unei oelule dar chia,r la urivelul
43

Ftla.xarea

AI)N-

J finN
T
tte

loooitomerat grretà)
toroftint rtP' 3''5')

lirerò

SrpiìiJft3

cafenelo,c

Í -

aheiiwlui A0N {fr0P)

Probrn

desbÚi lita foars

Frt,nîld (frùlîutd rin':tî

'n

, ''(nrornlhr molr/ - n"o"'na dna 8J fi

ARtí

Pnmen A tl N

E

longerea,t2/erter

,toliate,'du

-

('P

* fltt; l{ ilt tt H ; e x tt:;utfea Í,t Slalîh'P'súm€rttù t'ì
l'8 tl

pilìnenta

!

î,0*tderra tovalcnti I

ttle nei

-l. i.Èb

t Dtt

liyn

Sryerspinali

I

taret

0/1/

Fig. 24. B. SCHEX,IA COM?LEXULUT ENZTMATTC CARE pAnrrcipìt. /N REPLICAREA ADN.' pentru simplificare se aratà" în detaliu doar sinteza catenei. succesoare (,,lagging") eare, spre ,deosebire de catena directoare (,,lea-

3' -fr-,1,/;i,:r":,:í:
5*

J $,'(,ii,í,.7).,,J;\

l't-^).íol"r-r-,

9irg")
coli.

In dreapta schernei se redà d,enumif,ea proteinei sau enzimei particlpante în ,replicare, iar în stînga se trece funclia pe care aceasta o ind.eplinette. În parantezI- este trecntà denumirea enzimelor sau proteinelor detectate la bacteria'F..
Relaxarea ADN este neeesarà spre a permite înaintarea bífurcafiei tlo repli-' 9a1e, îngreunatà de torsionarea duplexului circutar ADN. Aceastà torsionare este îndepàrtató prin ac!íunea unor enzime care au capacitatea cle a introduce crestóturi monocatenare tranziente în duplexul ADN eeea ce perrnite rotatia liberà în

are o direcfie de sintezà opusó direcfiei de migcare a bifurcaliei de replicare-

schimbàri în conformalia macromoleculei ADN. Topoizoyneya,za, are d.ouà subunitàti ce constituie un tetramer. Una din aeeste subunitófi funclioneazi ca topoizirnerazà- propriu-zisó adicà ca enzímà de relaxare, fiind sensibilà la acid nalidixicun foarte eficient inhibitor al replicàrii ADN, pe cînd cea d.e a d.oua subunitate

jurul celeilalte catene. Aceste enzime s-au nurnit inifial swivelazà (pivota za,l , enzirnà de crestare-închiclere, enzimó de relaxare a ADN sau unwind,azd, dar acum poartà numele de topoizomerazd, ADN, însemnînd enzimà ce deterninìl

a topoizonerazei acfioneazà ca ADN girazd, sau proteinà, omega, introd.ucînd tururi superhelicale în ADN nou sintetizat. Hel'icaza ADN realizeazà separarea catenelor prin ruperea punfilor d.e hidrogen folosind energia provenitó prin defosforilarea ATP dependentó d.e ADN.

44

unuia qi aceluiaqi cr:orn,o z,o,m. Crom'ozomul eucariot este deci o structurà multirepliconicà, prezentînd la nivelul sàu mai multe puncte C,e ini{iere ,a replicàrii. tlu,bermann qi Riggs (1968), extragnnd ADN din celulele ,,Hela(i marcat pulsatoriu, au màsurat lungimile varia'te ale seqmentelor marca'te pulsatoriu reuEind sà calculeze cà viteza de repii,care este de L pm/minut (la E. eoli aseasta este de 30 1rm/minut). IJn cromoz,om 'uman de lungime medîe ane circa 30 000 um ADN iar cromozomul eucari,ot are a singurà moleculà de ADN. Dacà neplicarea ar fi iniliatà la un capat al er,omozomului qi s-,Br desfàEura secventral spre celàlalt capàt ar fi necesare 500 ,ore pentru replicar,ea ADN al unui crorn,ozom. Dar se gtie cà replicarea are loc în 6-8 ore. Aceasta a adus încà c clovadà cà la eucari,ote cromozomul ,are un numàr mars de unitàli de replicare de lungimi diferite cu un aornportament retrativ independent în replicar,e (Fig. 25). Distribufia produEilor cle replica,r,e (cr,ornozomii fii) se realizeazà, La eucariote prin intervenlia unui complex mecanism mit,otic care este strict controlat ereditar. Replicarea ADN este supusà unui control riguros, la nivel molecular, dar €a cade
<Helicaza de E. coli se numegte protcina

ADN în direcfia 3'* -5' îndepàrtînd catena complementaró, pé cînd helíca.zc III
se deplaseaz[ în direcfia 5'+-3' avînd. aeeeagi acflune. Acfiunea este facilitató de prezenfa proteiuelor neenzimatice unafindoze

re/, qi ea se deplaseazó pe monocatena
lor complementerll

topire a duplexului ,.tDN. Aceste proteine asigutó stabilizatea monocaterer lor spre a putea servi ca matrife. Sinteza fragmentelor Okazaki este iniliatà prin sinteza unui ARN prirner catalizatà de enzima ADN primaza (ARN polimeraza) prod,us al genei dna G care acfioneazà sinergie cu produsul proteinic al genei dna B. Proteina dna B este o AîP- azd depend,entó de ADN care se deplaseazà pe matrife folosind energia eliberató priu defosfotilarea ATP. Ea marche az6, la anumite distanfe pozifiile
ne
d.e

FIDP)

sau protei-

pentru sinteza primerului de càtre ADN primazà,, din care

Dupà primare se realizeazà, elongarea catenei (polimeizarea uucleotidelor) sub catalíza ADN polimerazei lff. Elimiuarea primenrlui ARN se face sub acfiunea RNceai I{ sau a activitàfií exonucleazice 5' a ADN polimerazni f.Golul rAmas dupà excizia primerului este umplut prh acfiunea polímerizatoare a ADN polivnerazei f . Intervine apoi ADN ligaza care tealizeazà, închiderea covalentà a catenei (unirea prin punti fosfodiesterice a fragmentului Okazaki recent sintetizat cu cel preced.ent, realizind.u-se astfel treptat sinteza unei catene urtice catena nou sintetizatà sau replica). Dupó teahzarea replicàrii intervine ADN giraza sau proteina omega spre a conferi moleculei fiice d.e ADN starea supespiralizati, stare care este normalà, stabilà, fiiud. cerutà se pare d.e funcfiorarea sa în replicare, transcriere gi recombinare (Dupà WACKERNAGEL, 'W'. 1980 Replication (in :) Progress in Botany, Springer-Verlag, Berlin, Heidelberg, NewYork, 154- 170). 45

tor mobil".

caazà, s-a

numit ,,proîno-

F
. ount r [ -" " lernrnàll
puncf
ca
-

terninal
nui.,

gún cl t ^rninal

unilaf ea de I untlatea dP t FreplicarelT'-repticare Z -1 calena nou stnlelizatà

,

t

l#.r

;îffilF

,-ÉSffit*'

25. Modelul lui Huberman gi Riggs (1968) d,e replicare a, ADN eucaîiot. Sînt reprezentate douA unitAfi de replicare adiacente care apar ad.esea $í în imagi nile autoradiografice ale fibrei de cromatfutà. Cele douà unitàfi de replicare desemnate I gi 2 au fieeare cîte un pnnct de inifiere a sintezei ADN 11, respectiv fr, la nivelul càroîa se corctituie în timpul replicàrii buclele de replicare {ochi de replicare) corespunzAtoare. Fiecare unitate de replicare are un punct terminus indicat prin baie transversale. a) Inainte de reptcare. b) Replicarea a început în unitatea 1 dar nu încà. în uuitatea 2. c) Replicarea este completà ùr unítatea 1 ti a început în unitate a. 2. d) Replicarea este completó în ambele unitàfi. e) Dublu-helixurile fiice separate în punctul terminal comun dar sînt încé unite cu segmentele ad.iacente. În d.reapta se îeprezintà, schematic , ,grainuritre" obser-

Fig.

vate în autoradiografie.

Si sub incidenfa un,or semnale venite din citoplasmà. În urrna ulÌ,or fuziuni cel,ulare dintr,e celule a'flate în S Si GL are loc o sintezà prernaturà de ADN în nucleul aflat în GL urmatà de oondensar,ea prematurà a cr,omozomilor. Condensarea crornatinei crom,ozomale poate duce la aooperirea $i deci la reducer€a numàrului unor punct,e de inifiere a replicàrii. Cr'omatina cond,ensa,tà numità heter'ocr,omatinà prrezintà o replicare tardivà în faza S comparativ cu cromatina difuzà eucnomatina.
:

I

i I i

46

I
F

t

t

L

de ini{iere la ,eucariote. Replicarea ADN este însofità gi de sinteza d,e proteine histonice. Cei mai important este însà reglajul genetic al replicàrii. La eucariote existà un control i"ntracromazornnl aI rephcarii. Tofi repliconii dintr-un cromozom eucariot, avînd dimensiuni diferite, trebuie sà funcfioneze în cadrul aceleiagi perioade S din inberfazà, repliconii de la nivelul heterocromatinei (bogatà în AT) funclionînd spre sfîrgitul acestei perioade S, ,pe cind cei d,e la nivelul eucromatinei (bogata în GC) funcfioneaza la începutul acesteia. Cromozomul Y de drosofilà, care este în cea rrrai mare parte heterocromatic, se replicà mai tîrziu fa!à de ceilalfi cromozomi gi acest lucru este valabil Ei atunci cind are loc trarrslocarea unor pàrfi ale sale în cromozomi ,eucrotnatici. Acreasta înseamnà cà pàrlile cromoz,omului Y confin informafia care regleazà timpul replicàrii 1or. La eucariote replicarea ADN nuclear Ei extranuclear este reglatà gi Ia nitselul celular. Pentru replicarea ADN este necesarà enzima tirnidinkinnzd. care este sintetizatà înainte de mitozà qi este hidrolizatà sau inactivatà dupà realizarea repiicàrii. Sinteza ADN inceteazà cînd s-a atins nivelul 4 C, ceea c€ presupu,ne un mecanism fin de control celular al replicarii ADN. În dezvoltarea timpurie a ovulelor are loc replicarea nuclearà fàrà a avea loc replicarea celularà. Toate cazurile de endoreduplicare, poliploidie Ei polinemie aratà absenfa unei diviziune nuclearà sau celulara. coordonàri replicare ADN Faptul cà replicarea ADN este dependenta de factori citoplasnatici este demonstrat de constatarea cà nucleii dfun neuronii adulli nu sintetizsazà ADN ln mod nor,mal. Daca însà
17

ADN are capacitatea de a exercita un anumit autocsrrtrol ai replicàrii sale, prin care este prevenità reactivarea secvenlelor de inifiere imediat dupà ce acestea au funclionat în r-.eplicare. În acest proces de autoc.ontrol un rol esenfial se pare cà îl au diferitele fracliuni de ADN saúelit (secrien!,e simple de ADN, dar înalt repetate localiza'te de regulà la nivelul regiunilor centromerice) dar mai ales ADN cu secvenfe mijlociu repelate, incluzînd secvenf,ele repetate cu simetrie rotatorie inversà numite palindroarne de tip ABC XY C'B'A', precum gi (AT) de vreme ce ADN satelit nu se afla Ia secrrente poli toate speciile. -Un rol esenfial în replicarea ADN îl joacà sinteza ARN sub cata"liza ARN polirnerazei, acest ARN condifionind inifierea repl.icàrii ADN, fiind se pare vorba de un ARNm

acesti'nuclei sînt transplantafi în ovule activate partenogenetic ale.aceleiaqi specii, in aceEti nuclei are loc replicarea ADN la numai o orà de la transplantare. De asemenea, cînd nuclei din blastula medie care sintetiz,eazà ADN sint transplant'ali în ovocite in creqtere care nu mai sintetizeazà ADN, nucleii transplantali înceteazà sinteza ADN. Cînd 1à celulele ,,HeLa" se asociazà experimental nuelei qi citoplasmà din stadii diferite ale ciclului celular sinteza ADN este iniliatà numai dacà nucleii din G1 sînt piasali în citopiasma aflatà în faza S. S-a tras conluzia cà citoplasma S trebuie sà oonlinà unul sau mai mu1!i factori care promoveazà sinteza ADN nuclear. Este posibil ca aceqti factori citoplasmatici sà aibà origine nuclearà. Replicarea ADN este reglatà de asemenea la niuelul ,tesuturilor gi organelor. Sînt date. dupà care evenimentele desfà$urate la nivelul rnembranei nucleare pot influenla sinteza ADN nuelear. Desfàqurarea mitozei, frecvenla diviziunii, orientarea fusului mitotic, incapacitatea anumitor cromozomi sau pàrti din cnomozomi de a se distribui în timpul miùozei, frecvenla reoqmbinàrii mitotice ca qi distribufia cromozomilor în meiozà în urma sinapsei cromozomale sînt controlate genetic. Antplif icarea genícd. sau extrareplicarea anumitor segmente din ,$rrori, in special a genelor riibozomale, se desfàgoarà atît în celulele diploide cît qi în celulele endopoliploide ducînd la sinteza unui ADNr amplificat, labii metabolic, fiind degradat dupà ce Ei-a îndeplinit funcfia de transcriere (sinteza AIINr). Reoent, Mihàescu Ei Gavrità (1980) au evidenfiat fenomenul de amplifioare a genelor ribozomale în celulele de rnamifer în culturà infectate cu adenovirus, tratate în prealahil cu tioacetamidà. Uneori ADN amplificat nu este transcris aga cum este cazul cu ADN de la nivelul pufelor insectelor Scinride sau dacà este transcris, ARN sintetizat nu este transportat în citoplasmà, aoest ADN arnplificat, r,epetitiv, l.,ocalizat de regulà la nivelul regiunilor heterocromatice ale genomului putînd juca în principal rol reglator. Hormonii animali gi fitohormonii pot juca un rol important în determinarea unei replicàri diferenliate a ADN. Cromomerele cromozomului eucariot al càror ADN suferà o replicare amplifioa€ de ADN s-au numit arnpliconi. Amplificarea ,si sub48

în celulele suspensorului embrionar de la Phoseolzs se aflà cromozomii politeni, la nivelul càrora apar,e un fenomen de amplificare genicà a ADN satelit. În acelaEi timp apare un

replicarea nu sî:rt fenomene alternative, ci coexistente. Astfel,

fenomen de subreplicare a segmentelor ADN car,e cuprind genele ribozomale. Conlinutul total de ADN nuclear apare însà ca un multiplu al valorii diploide.

{ - Desclfrlnd taiuele ereditàlii, vol. I

F

Capitolul
STBUCTURA ARN

II

$I

TBANSCBIEREA GENSIICA

1. GENENALTTATI

zatà în proeesul replicàrii

ADN are douà funclii pri,mare: funclia autocatalitica, realisaùe gi

în procesul de sinteza de molecule specifioe, în spetà proteine. Dacà ADN reprezintà substanfa macromolecularà cu fiurclie primarà ereditarà, ARN este implicat în realizarea decodificàrii informafiei ereditare care are loc în procesul de biosintezà proteinicà, cînd secvenla de nucleotide din ADN este mai întîi transcrisà în ARN mesager gi apoi tradusà în secvenla de aminoacizi a catenelor polipeptidice. Incà din anul 1952, A. Dounce a aràtat pentru prima da,tà cà ADN îqi îndeplineqte funcfia heterocataliticà în douà etape: transcrierea qi traduCa qi ADN, ARN este o substan!à rnacromolecularà, polimer al unor ribonucleotide, avînd de regulà structurA monocatenarà. Axui principal ai monoca'tenei este reprezentat de o ooloanà glucidofosforicà ia care sînt ataEate hazele azotate (Fig. 26). Ca pentozà, în ARN intrà D-ribozo care spre deosebire de 2-deoxi-D-riboza din structura ADN, are patru grupàri hidroxil. Bazele azotate din ARN sînt douà Tsurinice Adeninn qí Guanirn qi d.ouà pirimidinice Citozina qi Uronil. Deci locul timinei este luat ín ARN de uracil (U) care prezintà complementarita,te pentru adeninà. Legaturiie fosfodiesterice creeazà o anumità polaritate a monocatenei ARN care va prezenta un capàt 3' Ei altul 5'. ln structura ARN, în afa,ra rbazelor tipice ma'i pot intra Ei alte baze, unele modificate dintre car€ oomun este nucleotidul pseudouridina qi dihidrouracilul mai frecvente în u,nele tipuri de ARN. În cazuri foar,te rane, în structura ARN indrà Ei timina.
50

fu,nclia heterocataliticà realizatà

cerea mesajului genetic.

ccdtut

Jt 'N- -l.l)^ O-P-O-Cl+

ó t

s' *.\ ,--*-ill
I

Adeninè

J' t'..1

oGP-o-cH,

\-i4 I I Hc-coN ? ot ,è. -A- citozinó 'NNHr

d' ir...l I\-,4
II

ì

?

rN',/\Nu

Gucni;rè.

''r-lrJt'A*oé-*" ó,
À

(l!
O

Àr tf"-ì*

Urocil

o'É- o - Ct*j*-N'c-'o

ri
00H
I

-p-

O-CHe

ót

j*,ó,u'r'

Fig. 26. Formula chimicà a uaui poliribonucleotid,

Spre deosebire de ADN, ARN prezintà o mare heterogenitate structural-f uncf ionalà. Degi în general structura ARN este m,onocatenarà, acesta poate prezenta prin pliere în urma potrivirii de secvenfe complementar,e, regiuni bicatenare l,a nivelul càrora apar perechi de baze azstate unite prin punli de hidrogen. Unele riibovirusuri prezin,tà în mod normal ca miez de acid nucleic ARN bicatenar cum este cazul reovirusului. De asemenea diferitetle tipuri de ARN celular înspecial celribozonwl qi
51

F

l.

de transfer pot prezenta regiuni bicatenare, separate de regiuni

Datà fiind structura principial monocatenarà a A.RN proporfia de baze complementare A-U Ei G-C nu realizeazà de regulà raportul unitar. Monocatenele ARN au formà liniarà, nefiind încà decelate molecule circulare de ARN. Numàrul de nucleotide ce intrà în structura diferitelor tipuri de ARN variazà între 75 qi 10.000. Se pot distinge douà categorii esenlial diferite de ARN: AIIN uiroZ materialul ereditar al ribovirusurilor Si ARN celukr molecule care intervin in decodificarea informa{iei ereditare qi traducerea sa in secvenle aminoacidice în procesul de biosintezà proteinicà celularà. ARN uiral. Este ARN care ca Si A"DN este inzestrat cu funclie geneticà primarà qi anume funcfie de depozitare a informatiei ereditare Ei transmiterea sa în generafiiile virale succesive prin replicare. Se întîlneEte la unele virusuri vegetale, (\IMT), la unii bacteriofagi (Qf3, R 17, MS,;), unele virusuri animale (polio, virusuri poliedrale citoplasmatice de la insecte etc.). Cantitatea de ARN viral reprezintà I0/o din greutatea particulei virale cum este cazul virusului influenza sau 6olo î,n cazul VMT. De regulà ARN viral este monocatenar (VMT, virusul gripal, polio, fagi Qp, R17 ; F2) sau bicatenar cu catene corr*pì.ementare (reovirus). ARN celular. Acest tip de ARN nu codificà informalie geneticà qi este sintetizat pe matri!à ADN, adicà transcrie informatia geneticà. Niciodatà î,nsà ARN celular nu îndeplinegte funcfie de matri!à pentru pr"opria sa sin'tezà, deosebinclu-se principal de ADN sau de ARN viral. El îndeplineqte însà func{ia de primnr în replicarea ADN. 2. TIìANSCRIEBEA GENETICA
Transcrierea geneticà reprezintà un prooes complex desfàqurat în mai multe etape, în care pe matri!à de ADN se sintetizeazà. mon,oca'tene ARN, asigurindu-se transferul informaliei genetice de la ADN la ARN. În cadrul procesului enzima numità AP"N polimerczd, dependentà de ADN recunoaqte secvenle specifice de pe- matrila ADN gi catalizeazà polimerizarea unor ribonucleotide trifosfat libere, aliniate pe matrila
52

monocatenare.

in virtutea complementaritàlii de baze azotate de tip A-U, T-A, G-C, C-G, primul partener a1 perechilor fiind lrerze azotate di,n ADN, al doilea fiind baz,e 'azotate ce .sînt incluse in catena polirilbonucleotidicà. Matrifa Ei catena poliriADN

bonucleotidicà nou sintetizatà formeazà un hibrid molecular ADN-ARN temporar, prin intermediul pun!ilor de hidrogen din'tre bazele compl.ementare. Ca substrat pentru ARN polimerazi servesc cei patru ri,bonucleotidtrifosfati ATP, GTP, CTP Ei UTP. ARN polimeraza, spre deosebire de ADN-polimerazA are capacitatea de a inilia sinteza ,,de novos a unei catene polinucleotidice fàrà a neoesita prhTter. Cel mai bine studia,tà este ARN polimeroza bacterianà. ARN polimeraza bacterianà este o enzimà compl'exà alcàtui,tii din 2 su'bunitàti a, o su,bunitate B, o subunitate $' Ei factorui alosteric o. Ba are o greutate molecularà de 495.000 daltoni. Holoenzima se poate separa în miezul enzimatic gi factorul o. Factorul o este factor de inifier,e, ,el fiind acela care recunoaEte ,o secvenfa specificà din ADN (promot'ord), condi{ion'înd form,area comptrexul,ui ADN-ARN polimwazà,. Dupà inilierea sintezei ARN factorul o se desprinde de pe holoenzimà Ei se poate asocia cu un alt miez'enzimatic càruia îi oonferà specifitate pentru matrita ADN. Procesul de transcriere cuprinde ca qi în cazul replicàrii. ADN o fazà de ini{iere a catenei ARN, o fazà, de elongane Ei o fazà de terminare a transcrierii. Fiecare fazà se desfàqoarà prin inlervenlia anumitor factori de inifiere, de elongare qi de terminare. ARN polimeraza esùe dependenta de ADN, ceea ce înseamnà cà ea func{ioneazà numai în prezenla matritei ADN. Caiena din duplexul ADN care funclioneazà ca matrifà în sinfeza ARN, care 'este deci transcrisà, se numeEte catend sena. Procesul de inifiere a ,transcrierii pnesupwre mai întîi preinifierea în care are loc formar,ea unui complex molecular ADN.ARN polimerazà, enzima recunoscînd prin facúorul 6 o sec.ientà specificà din matrifa ADN cu care se asociazà intim. Urmeazà apoi formarea complexului de iniliere propriu-zisà a transcrierii Ei în care este iniliatà polimerizarea secvenlialà a ribonr-rcleotidelor cu desfàSurar€a alungirii catenei polirlbonucleotidice (ARN), prin formarea de punli fosfodiesterice succesive. Transcrierea poate fi prezentatà astfel: ATP -i- GTP

+

CTP

+ UTP :

matri!à ÀON - ARN ARN polimerazà

+ PPt (pirofosfat)
53

Creqterea catenei ARN are loc prin formarea punfilor fosfodieterice succesive în direc{ia 5'-> 3', adicà prin* adilia unui ribonucleotid-5'-fosfat la capàtul 3'-OH al ri,bonucleotidului precedent.

Formanea punfilor fosfodiesteriae (alungirea catenei ARN) este catalízatà de miezul enzimatic al ARN polimerazei. Ribonucleotidul inifiat 5' al unei catene ARN este de obicei un ribonucleotid trifosfat purinic (ATP sau GTP) care îgi pàstr€szà toate grupele fosfat. Aceasta înseamnà cà în rnatri!à, l,a situl de iniliere a transcrierii diferitelor catme ARN se aflà fie dezoxitimidinmonofosfatul, fie dezoxicitidinmonofosfatul, ceea ce înseamnà cà o glupare de pirimidine în ma,trita ADN a,r putea c,onstitui situl de ini{iere a transcrierii ARN, recunoscut de càtre transcriptazà prin facùorul o. Situl dín ADN la care se atageazà ARN polimeraza qi a càrui secventà este recunoscutà în rnod specific de factorul o s-a numit pro,motor. El reprezintà o regiune micà dfur matrita ADN de pîlrà la 50 nucleotide lungime, localizatà imediat înaintca genei sau grupului de gene a càrei informa{ie geneticà hrelbuie transcrisà în ARN. De refinut cà secvenfa promotorului nu este transerisà în ARN. Studiimd inifierea transcrierii ARNm specific pentru enzirna p-galactmid,azd., Gilbrt qi Maxarn au staibil,it în 1973 secvenfa de baze din punctul de inifiere a sin* tnz,ei ARNnz care este urmàtoarea:

5',..... TGGAATTGTGAGCCGATAACAATTTCA
3',

I

3'

Inifierea sinúezei ARNnz pentru F-golnftozidnzd este indicatà prin sàgeatà. Se poate cons'taú.a cà s;ec'venfa de baz"e, corespunzàtoar,e sitului de iniliene a transcrierii este bogaúà în perechi A-T. Inilierea transcrierii poate fi ur-hirbatà în mod specific de anti,bioticul rifampicinà la procariote sau a-amanitinà Ia euoariote. $i alti factori sînt impl,icafi în controlul inifierii transcri'erii, cel mai important pentru bacterii fiind factorul proteinic CRP (proteina rreceptoa,ne a cata,bolitului) numità încà factor CAP care reprezintà proteína receptoare a AIVIP ciclic, acest nucLeotid monofosfat ciclic avînd rol important qi multiplu în, reacfiile biochimice lega,te de deoodificarea informaliei genetice. Aibsenfa CRP sau chiar a AMP ciclic duce Ia descreEterea vitezei de initiere a transcrierii qi ca urmare a sintezei ARN.
54

bioticul streptolidigina, care ar'e afinitate pentru ARN polimerazÀ, inactivînd-o. Aaelaqi efect are acliuniea acúinomiciÍtzi D. Terminarea si;ntezei ARN esúe dírectà, condilionaÉ de întîlnirea de càtre compl,exul tripartit de ,transcriere ADN miezul enzimatic al ARN polim,erazei ARN nàscînd, a unui sit de tgrminare din cadrul secvenlei -ADN ce este transcrisa cu eliberarea catenei ARN adicà a transcriptului qi dezorganizarea complexului de transcriere. Transcriptul ARN începe la capàtul sàu 5' cu o aga-numità sectsenló ghid sau cozducdtmre (leader) care poate avea pînà la 150 de ibaze $i include qi complementul operatorului (vezi reglajul genetic) sau al unei pàrli a
aeestuia.

Desfàqurarea ,transcrierii (elongarea catenei ARN) se realizeazi cu o vitezà, de 60 ntrcleotide pe secundà, dar viteza de transcriere poate fi influentatà de lnsàqi secvenfa car,e tnebuie transcrisà, acesta fiind chilar un rnecanism de reglare a franscrierii. ElongaÍea catenei ARN este inhibatà specific de catre anti-

nar€ q (rho) care este alcàtuit dín 6 subunitàli identice aranjate în cerc gi care are capacitatea de a se lega Ia ARN pli.marozó. spne a înceta transcrierea la nivelul unor bariere naturale al.e transcrierii care apar în ADN reprezentate de secvenfe specifice de nucleotide localizate fie în cadrul secvenfei unei gene, fie intre gene adiacente. Sinteza ARN se desfàqoarà polarizat. Transcrierea începe la capàtul 3'-OH al matrifei ADN qi sin3'. Rezultà deci, cà teza ARN se d,esfàEoarà în direcfra, 5' -+ atrila gi transcriptul sînt antiparalele. În vederea transcrierii are loc ,o desfacere localà a dublului helix ADN î:r zona ce urmeazà a fi transcrisà qi apare astfel a$a-numítul ochi, de fiqrnsqie:re. Pe màsurà ce transcrierea se desfàgoarà, în urma se reface structura dublu-catenarà a ADN Ia parametri sài inifiali. Desfaoerea localà în transcriere poate fi folosità Si în rreplicarea ADN. In uiuo transcrierea este ,asimetricà adicà doar una din cele douà caúene ale dublului helix ADN serveqúe ca matri!à pentru sinteza ARN. Dar acest lucru nu însea,mnà cà în toate cazurile una gi aceeaqi catenà ,a ADN este activà î,n transcriere ian cealaltà este inactivà. Pentru o genà datà sau un grup de gene (vezi operonul) o catenà ADN este activà în transcriere iar caterra complementarà inlactivà, pe cînd, pentru altà genà sau alt gnup de gene aceeaqi ca0enà ADN poate fi inactivà iar catena complementarà poate fi activà în transcrier,e. Dar dacà un
55

T,erminanea transcrierii însà poate avea l,oc prin intervenfia unui factor proteinic care a fost desem,nat factorul de termi-

sqgrnent al unei catene ADN este activ în,transcriere segmenfirl corepunzàtor de pe catena oomplementarà este în mod ,determinat inactiv î:r transcriere. Altfel s-ar sintetiza douà ,transcripte care prezentînd oompl'ementaritate ar duce la formare de structuri bicatenare ARN, de regutà inaetive în dirijarea sintezei pro0einice. Faetorul o joacà rol esenlial în selocfia catenei active; càci în absenfa sa miezul enzimatic al ARN polimerazei nu prezintà specificitate de secventa Ei catenà, putîndu-se l,ega la orice secven!à a oricàreia dintre cele douà catene ale ADN. În prezenla factorului o însà, ARN polimeraza capàtà capacitatea de a recunoagte secvenfa specifieà de p mtena selÉ ce trehuie transcrisà. În naitocondrii s-a stabilit existenfa r,rnei transcrieri gen,etice sirnetrice, am'bele ca,tene ale ADN mitocondrial fiind ac"tive în transcrie're, dar int'ervine Ei aici un mecanism specific car',e degrad.ea,zà rapid unul din cele douà transcripte. rnesaEer policistronic, adicà care conline transcrisa informafia g_enetiqS pentru mai multe proteine, sistemele dc transcrierg $i de traduc€re fiind intirn cuplate (FiS. 27), f.apt care Du se. evi-

I"a procariote produsul imediat al' transcrierii s-.ecvenfelor din ADN ce specificà sinteza diferitelor proteine este un ARN

E
8-,..
6f;"':r::r
Fig. 27. Transcrierea gi traduceîea mesajului genetic la procatiote sînt
rt'l ,'. .,:'

freev'efiLt

56

ientiazà la eucariote unde transcrierea are loc în nucleu iar t:aducerea mesajului genetic are loc în ciúoplasmà, la nive-u. ribozomil.or. La eucariote pr,oduEii imediali ai transcrierii sint mult mai mari decît produEii maturi astfel cà ei sînt supugi unor prelucràri posttranscripli,onale prin care sînt pe de ..' prrte modificate unele baze azotate (metiiare, acetilare etc.) -'r sint ,excizate anumite secvenle de baze azotate iar uneori a:iugaie unele secvenle specifice de ,baze (adenilare). În urma ai-€s[oi prelucràri posttranscrip{ionale, ARN rrlesagter frrea.ffsor e:::ariotic clevine un ARN masager mnnocistronic ma,tur care jeline informalia ce specificà o singurà catenà polipeptidicà. !: :'eglarea transcrierii intervin factori inductori Ei repnesori :ine evidenfia{i mai ales la procariote. La eucariote transcrierea -lDli din cromozomi este dependentà de starea decond'ensatà i:::erfazicà a cromatinei, starea condensatà a cromozomilor mi:c:i,-'i sau a heterocromatinei nepermi!înd transcrierea ADN. În ',-elelea transcrierii la nivelul cromozomilor condensali ar,e loe r.l:r proces d'e deslînare localà, cu aparilia de ptle sau inele fuJbiani în cazul cromozomilor politeni de diptere. Sinteza -lRN ale loc pe parcursul întregii interfaze qi continuà gi în piofazà cind inceteazà, reîncepînd în telofazà. Din 'aceastà cauzà s-.ì tras concluzia cà ea este condilionatà de integritatea mem'branei nucleare Si a nucleolului. Aceasta poaùe fi justificai pentru sinteza ARN riboz'ornal, nu Si pentru alúe categorii de ARN. Mai sigur este cà sinteza ARN este condili,onatà de
s:area difuzà, deconderr.satà a cr,omatinei. Prcpor{ia din ADN la bacterii care este transcrisà 'este de o:'C:.nul a B0-1000/o pe cînd la eucariote aceasta este mult mai mi-'à \2-2007r) Ei este dependenta de tipul celular qi de organismul considerat. Transcrierea la eucariote nu este cuplatà ri--i :emporar qi nici spalial cu traducerea mesajulúi genetic. Transcrierea a fost vizualizatà electr,onomicroscopic atît la p:ccariote cît qi la eucariote (FiS. 28 A, B, C) d,e càtre Miller 1; coia'b. (1970). Difelitele categ,orii de ARN celular intervin în etape speci!:ce aie decodificàrii informaliei ereclitare. S: pot distinge mai multe tipuri de ARN celular: ARN rnescger', ARN ribozomal, ARN de transfer, ARN heterqen qi -{iìN cromozontal. Primele trei tipuri de ARN celular intervin diret-c în procesul decodificàrii. 3. ARN mesager (ARl{m) a mai fost numit ARN d,e inforn:.aiie. If.oleculele cle ARNm sînl componente centrale în expresir genelor structurale. ARNrn reprezintà 20/s din ARN ce37

(,

co

/ /'\

/

/
,/

ARN

tolrmcrozo

AON

fj
o geno

g$)q"*--:aDN .'/ strrl .Jc rnrtrere Gl tr3f,scrlpt'cr f '. ,' aìn -

$
vrz rbrte

I

I

ARN m

( Nu

sirrt

polrpeptrdele sr ARI'it)

Fig, 28. l. Transcrierea geneticà. la procariote. Interptetate dúpó electronografie.

Fig. 28. B.

(a) - ulr fragruerrt de ADN de ,8. col,i avînd atagate molecuÍe ale enziurci ARN-polinrerazei qi ribozonri; (b--c) - diagranazouei de initiere a trartscrierii cu red.area deplasórii secventiale a ARNpolimerazei spre stînga determinînd sinteza de ARNzra pe mattifa enx. La aceste molecule de ARNm. se atageazà tibozomii, la cape-

tele lor 5', traducînd secvenla sa polinucleotidicà într-o secventà de
aminoacizi a polipepticlelor pe màsurà ce aceasta se tleplaseazà spre capàtul ,,în ciegtèró" 3' al mesagcrului; (d) Degradatea ARNm începe cu- capàtul 5' gi astfel ru ruai *:rl"r?."r"qarea de ribozomi care se disa'

.
srl

lo)

tèrnlnot s'l
de

nroleculo deARN

(br

ot l

tnitlere-ARN '

,d

;1 î.

)

Fig. 25. C. Trauscrierea la eucariote. (a). Electronogtafia unei secvenf€ ADN în-procesul de trauscriere în ovocita de Triturus airidescens. Moleculele de A'RN transcrise pofnesc radiar din axa ADN. La intersecfia unei catene ARN 9i axei ARN polimeri,zó b-f. Secvenfa de evenimente redatà diagramatic care duc segment ADN. (b).O moleculó de ARN polímerazà ($l) se ataqeazà [a un sit de iniliere pe o secven!à d.e ADN ce trebuie transcrisà la un moment dat. (c). Molecula de eRN polimerazà se deplaseazà,pe catena ADN
d.e

ADN se ailó un grauul proteinic dens care cel mai probabil teprezintó molecule

la transcierea unui

ttanscriind-o întt-o secvenfà ARN. Dupà ce polimeraza + I s-a d.eplasat pe un anumit interval, se atageazà polimeraza * 2 la situl de inifiere gi lucepe_ 9i ea transcrierea, g.a.m.d.. asifel ca pe cînd molecula de ARN asociatà cu ARN poJirneraza, nr. I reptezintó o secvénfó complementaú" la aproape întreaga lungime a unei catene ADN, celelalte asociate cu ARN polimerazele 2, 3, 4 etc. sìnt proeste eliberató împre' gresiv mai mici. La termina*i$'ffT'i'ii

irlilJ;J:-eraza

luL,ar, avînd duratà scurtà de via!à. El tra,nscrie informafia geneticà de pe un segment al unei catene a dublului helix ADN aonespunzàtnr unei gene care trebuie sà funcfioneze la un moment 'dat Ei funcfioneazà. ca m,atri!à pentru sinteza sa- &gmentul din ADN care serveEte ca matri!à pentru sinteze ARNnt poate cor,espunde la o genà sau la mai multe gene care delin informa,fia geneticà pentru sinteza unor proteille sau enzime
59

înrudite ce controleazà un acelaEi caracter sau rnrervln
aceeaEi cale metatboiicà.

în

Dimensiune'a diferiteior: molecule de ARNrn este în functie de màrirnea mesajului pe care ît poartà, adicà corespuncle secvenlei de baze a diferitelor gene pe care le transcrie, gene care au la rîndul lor dimensiuni foarte diferite Ei care specificà în consecin!à catene polipeptidice de lungime varia'biià. As'tfe1, cons'ta,nta de sedimentare a diferitelor moleculre cle ARNrn cle ia acelaEi organism variazà între B S qi 45 S. ARNrn pentru ovalbumi'nà cuprinde cca 1890 nucle,oticle. llnul dintre cele mai mari tipuri de ARNnz est,e cel pentru fibroina firului' de màtase din glanda posterioarà de Bambyr

lor, 1979).

mori. Acest ARNnz are constanta cle sedimentare de 32 S (Tay-

Durata de r,ta!à a ARNrn la procariote este de 2_.1 rninute" De îndatà ce au f,ost traduse, moleculele de ARNnr sînt distrtrse, evitîndu-se astfei aÌteràriie posibile clin structura sa ceìre ar cluce Ia modificarea mesajului genetic gi la sinteza cìe proteine modificate, sau la traducel'ea unui ARNnr care nì-r este în eonformitate cu cerinfele de mecliu celnlar care se -.chlrnbà rapid de la o perioadà de ti'rnp la alta. Cele rnai multe tipuri de ARNm prezintà la capàtul 3' al monoca,tenei o secven!à poi[ (A) care este adàugatà posttranscr'lpfional gi este implicatà în conturarea duratei de via!à a AF!.N'r. . Complexul enzima'tic care clegradeazà ARNm procariot, are capacitatea de a distinge diferitele tipuri de ARNnx pe cir,re ie degradeazà în mod specific, degradarea fiincl cupiatà cu tr"a'clu* cerea mesagerului. La eucariote, la care ciurata de via!à a celulei este mai mare +i durata de via!à a ARNnz este mai mare, de cca 1-4 ,ore. Atît la procariote cît Ei la eucariote existà situalii ín care ARNrn are o duratà de via'!à mai mare. Este cazul celul,eior" cle Bacillus cereus irnduse sà devinà spori în care ARNnr clureazà cca 6 ore Ei reticuiocitelor mamiferelor în care 900/o diri sinteza proteinicà este reprezentatà de sinteza hemoglobinel i:rr cînd .se maturiz'eazà, pierd spontan nucleul, nemaifiind der.:i \ireo matri!à pentru sinteza ARI{nz pentru hemoglo;binà. Cu toate aceslea, sinteza hemoglobinei este continuatà pe seama ARNrz sintetizat' încà din s,tadiul nucleat Ei care persistà Ei funclion ettzà rnulf timp (cîteva zile) dupà ace,ea. În cazul dormanlei adoptatà de mul.te ouà 1a anirnale qi seminlele de plante, ARNrn este menlinut într-o for:mà stabilà pentru luni qi chiar a,ni.
60

-

gura traducerea mesajului genetic. De regulà, la eucariote ARNm este monocistronic Ei transcrie gene care dirijeazà sinteza de polipeptide. Aceste gene sînt de regulà reprezentate de secvenfe unice, nerepetate din ADN. ARNnz eucariotic se sintetizeazà sutb forma unui precursor heterogen numit qi ARN nuclear he,terogeru care are o ,greutate moiecularà de 5 X 105 107 daltoni. S-a mai numit pre-ARNnz. Precursorui ARNm este supus prelucràriior posttranscripfional'e în cadrul càrora vor fi eliminate nueleotide, de la capàtul 5'aI moleculei Ei totodatà vor fi adàugate la capàtul 3', 50-200 resturi adenilat formînd un segment de acid poliadenilic care cond.i{ioneazà durata de via!à a ARNm La procariote ARNm reprezintà copia exactà a secvenlei genice,, fàrà a-i lipsi anumite segmente. La eucariote în cazul unor gene apar por{iuni (secven{e interpuse sar-r spa{iatoare în cadrul secvenfei genice codificatoare) care sînt ,transcrise în ARNrz dar nu sîtnt traduse. O situalie sirmilarà apare în cazul unor virusuri anirnale. Asertenea secvenle spaliatoare apar în genele pentru catena f3 a hemoglobinei, h genele pentru imunoglobulinà, ovalbuminà qi în genele ARNú Ei ARNr. Secvenlele spaliatoare sînt implicate se pare în reglarea activitàfii genice. Ele pot fi transcrisp în ARNrn, dar ulterior sînt excizate. Este admisà Ei posibilita,tea ca la eucariote ARNrn sà fi,e sintetizat segmentar, segmentele fiind ulterior unite într-o monocatenà unicà de ARNnz în care nu sînt incluse qi secven{ele spafiatoare. 4. ARN ribozomnl (ARNr). ARNr r'eprezintà cca 800/o din ARN celular total qi intrà în structura ri'bozomilor care ;sînt
61

Moleculeie de ARNrn cu durata lungà de via!.à, cum sînt Ei cele din ovulele de ,broascà care sînt pàstrate multe Ìuni înainte de a fi traduse, sînt protejate fa!à de atacul enzimelor depolimerizatoare ribonucleaze prin asociere cu categorii speciale de proteine. Asemenea asocieri ARNrn proteine la eucariote care apar înainte de trece,rea ARNrn din rnucleu în citopiasmà unde se asociazà cu ribozomii sedii a,le sintezei proteinice au fost numlte informozomi-sau informnfere. La bacterii, genele aflate în raport de contiguitate gi înruclite rnelabolic (legate de aceeagi cale metabolicà) formeazà o unita'te reglatoare care s-a numit operon. Ele sînt transcrise într-un ARNm policistronic ce poartà mesajul genetic pentru mai multe proteine. La scurt timp de la inilierea sintezei ARNrn bacterian, ribozomii se ataqeazà la aceasta Ei se deptaseazà de-a iungul sàu în urma ARN polinterazei, spre a asi-

particule ribonucleoproteinic,e implicate în biosin teza proteinicà. Ribozomii confin 40-600/o ARNr qi proteine tbazice ribozomale. Ri:bozomii apar în citoplasma tuturor celulelor procariote gi eucariote avînd un diametru variabil. de 140-230 À. Proteinele ribozomale în numàr total de 53 la procariote Ei 70-80 la eucariote se leagà de ARNr prin legàturi necovalente, migurînd stabilitatea structunalà a ribozomului permi!înd totodatà ataqarea altor tipuri de ARN la riibozom. Prin ataqa,r'ea de ribozomi pe monocatena ARNrn se pàstreazà, conformafia monocatenarà a acestuia propice decodificarii traducerii mesajul.ui ,genetic. Ri'bozomii se ataqeazà la, ARNrn formînd poliribeotrri sau polizarni, între ei fiind o distanfà de 50-150 À. Ribozomii procariotelor au constanfa de sedimentare 70 S (subunitali 30 S gi 50 S) pe cînd cei eucariotici citoplasuratici au constanta de sedimentare B0 S (subuniffifi 40 S Ei 60 S) fàrà ca ri'bozomii eucariotici sà constituie un grup uniform ,,80 S6c càci greutatea lor moleculara variazà de la 3,9 X 106 daltoni la plante la 4,55 X 100 la mamifere, sohimrbarea masei rirbzomale bazîndu-se în special pe variafia dimensiunii subunitafii mari ribozomale (60 S) de Ia 2,4 la 3,05 X 100 daltoni, variafle ca,re este cleterminatà de varialia cantitativà atît, a ARNr cît qi a proteinelor ri,bozomal,e asociate. Subunitatea rirbozomalà micà (40 S) a ri'bozomul.ui eucariot nu s-a schimbat aprecia,bil în cursul evolufiei eucariotelor. Ri'bozornii organitelor celulei eucariote, cloroplastici qi mitocondrial,i sînt de tip procariot avînd oonstanta de sedimentare 60-70 S. Prin scàderea ooncwttrafiei ionilor Mg2+ sub 0,35 ffiM, riibozomii bacterieni disociazà în subunitàtil,e 50 S qi 30 S. Greutatea molecularà a prroteinelor bazice structurale ribozomale este de 25.000-26.000 dattoni. Proteinele ribozomale sînt heterogene fiind descrise douà categorii, urla S, corespunzàtoare su,bunitàlii ribozomale mici qi alta L c\orespunzàtoare subunitàlii ribozomale mari. Fiecare categorie de proteine ri;bozomale are rnai multe fracfiuni Sr-Szr gi L1-L32. Ia, eucar:iote fracfiunile celor douà categorii de proteine ribozomale sî,nt mai numeroase. Ele sînt esentiale în funcfionarea rirbozomilor. Proteinele riibozomale Lt Qi Lp au proprietali contractile qi se pare cà sînt implicate în translocarea aminoacizilor în timpul sintezei proteinice. Asamblarea ribozomului realizatà l,a rrivelul nucleolului este, cel pulin ùr parte, ur proces autodire4ionat, deci nedireclionat de alte structuri celulane pneexistente. Sînt date dupà care unii ribozomi pot fi specific mesageri, cu funclie informalio62

@ "^6(=ù

p6fi
@>"'
are loc atagarea subunitàlii 50 S.

^D9
dupà care

Fig. 29. Ciclul ribozomului. Subunitatea 30S se asociazà cu ARNrz

nalà. Se pesupune cà ARNr posedà in uiuo un mesaj tradus, specific pentru sinúeza proteinel'or ribozomale (Rieger qi colab., 1968, 1976). Interesant este cà ritbozomii ca qi cromozomii eucariotici sînt organite celulare, lipsi'te de memibrane deiimiùante, care prezintà totoda,tà spre deosebire de alte organite a1e celulei _- irn ciclu caracteristic de organizare Ei desfacere în vederea funcfionàrii. Existà astfel un ciclu ri'boz'omai (Fig. 29) (vezi Ei sinteza proteinicà) Ei un ciclu cromozomal (vezi .organizarea geneticà).* În celulele eucariote care sintetizeazà proteine pentru secrefie-export, majoritatea ribozomilor sînt eta$ati la nembranele reticuiului endoplasmic prin intermediul subunitàtilor mari 60 ,S: Rirb62o*ii lirberi neatagafi la membranele reticulului endoplasmic sintetizeazà pruteine care ràmîn în citoplasma celulei. Se admite cà în acest proaes de seleclie de cà'tre ribozomii ataqafi sau neataqa'F la reticulul endoplasmic a unui ARNrn particular spre a fi tradus, un ro1 important î1 joacà secvenla lider din ARNrn ce poate fi recunoscutà în mocl diferenliat de càtre cele douà tipuri de ribozomi. De asemenea, proteinele destina,te nucleului sînt sintetizate pe ribozomii citoplasmatici neataga{i la neticulul endoplasmic. Dupà sintezà, acest'e proteine sînt pompate sau suctiornate în nucleu. Se admite cà Ei la procariote ARNrn ce codificà proteine speciale sînt traduEi în locuri speciale qi prorbabil de càtre ribozomi speciali. As,tfel, la Bacillus sinteza proteazei neutrre, care este secretatà în mediu, afie loc pe ribozomi localizali la periferia celulei. În subumitatea ribozoma'Ià micà intrà ARNr de tip 16 S la procariote Ei 18 S la eucariote.
+ Reunirea stùunitàfi'lor ri,bozomale spre a constitui particuie ribofuncfionale este aleatorie, ceea ce înseamnà cà reciclarea subunitàlilor ribozoma,le într-o nouà rundà de sintezà nu presupune asocierea aceloraqi subunitàfi care au constituit ribozomii func{ionali ai
zontatre

rundei precedente.

63

F
În subunitatea ribozomalà mare intrà ARNr de tip 23 S la procariote qi 28 S ta eucariote. Atît la procarioùe cît Ei la eucariote asociat subunÌtàtii ribozomale mari mai intrà qi un tip aparte de ARNr, care are constanta de sedimentare 5 S. În plus, la eueariote, s-a descris gi un alt tip de ARNr care are constanta de sedimentare 7 S qi care intra în componenla subunitàtii mari a ribòzomului, existînd la eucariote deci 4 tipuri de molecule de ARNr (Wool,
1e7e).

ARNr' (pre-ARNr) care, dupà transcriere, sùrt supuse, prelucràrilor posttranscriplionale. Acestea includ pe de o parte metilar:ea resturilor rirbozà la cca 5oA dintre nucleotide, deterrriinînd diferenlieri calitatíve în func{ia catenelor poliribonucleotidice, iar pe de altà parte clivar,ea unor secvenle (eliminarea) ducînd la reducerea lungimii pre-ARNr gi delimitarea unei rnolecule mature de ARNr. Dupà pr,elucrarea posttranscripfior,ra'là structura primarà mronocatenrarà a ARNr poart.e suferi cqrúorsionàri spaliale cu realizarea de regiuni bicatenare gi cu aparifia unor modele spaliale caracteristice. Genele (ADNr) pentru cele trei caúegorii de ARNr sînt dispuse în'tandern (policistroni) în ADN (genom) gi sînt tnanscrise în ordinea 16 S 23 S la procariote. Aceste gene apar de asemenea strîns lincate, Ia eucariote fiind dispuse în'ordinea 18 S pre-ARNr unic care are o:constantà qi - 28 S transcrise ca un de sedimentare 45 S. Acesta va fi separat prin prelucràrile posttranscriptionale ulterioare în cele trei tipuri de ARNr matur. La eucariote, genele pentru sinteza ARN 18 S. qi 28 S s'e afià în regiunea orgwuizator nucleolard (NO) Iocalizata la nivelul constricliilor secundar,e implicate în formarea nucleolului. Rezu1tà cà aceste gene ri'bozomale sint gene nucleolare. EIe sînt r,egiuni vital,e ale genomului de vreme ce mutantele de Xenopzs desemnate D-nr.r fur stare homozigotà tripsite de nu'crleol nu sînt capabile sà sintetizeze ARNr gi mor. Genele pentru ARN 5 ,S, prezente qi ele în copii multiple la eucariote sînt neLincate cu celela,lte gene ri'bozomale, fiind distrirbui.te pe diverEi cromozomi, în spetà în regiunea teiornericà a lor. Deqi nelincate cu genele ri'bozomale LB S qi 28 S, genele ri'bozomale 5 S sînt transcrise coordonat cu genele pentru ARNr 18 S Ei 28 S. S-a constatat cà prezenla ARN 5 S în subunitatea mare a ribozomului este esentialà în funclior.ar€a normalà a rÍhozomului în sinteza proteinicà.
64

Toate m,o1,ecu1e1,e de ARNr atît la procariote cît qi la eucariote s'e sintetizeazà sub formà de molecule precursoare de

ARNr din cloroplaste gi mi,tocondrii prrezintà greutàfi molecuiare mai mici decît molecrrlele c€respunzatoa,re din citoplasrnà.

Nu se cunoaqte deocamdatà cane este firncfia particul,anà a ARNr. Se admite cà bazele neîmperechearte din ARNr ar participa, intr-un fel sau altul (posiibil tot pe principiul complementaritàtii qi for'rnàrii de punfi labile de hidrogen) la interacliunea cu oelelalúe oategorii de ARN celular spr€ a deoodifica mesajul genetic purtat de ARNnz. Are loc o al,iniere corectà a diferitelor tipuri de ARN c'elular cerutà de o fidelà traduoere a informaliei genetice într-o secvenfà corectà de amînoacizi pentru sinteza unui polipeptid norma'l. Un rol prfurcipal în realizarea acestei alinieri revine ionilor de magneziu (Mg2+1 care joacà de asemenea un rol important în asamblarea unitàfilor
ribozomale.

Existà diferenle semnifica,tive în structura ribozomilor la procarioúe Ei eucariote, diferenle care formeazà ceea ce WooI (1979) a denumit dilema centrald, a rùbozomalui. Astfel, ribozomii eucariotici sînt apreciabil mai mari decît cei procariotici, conlinînd un numàr mai mare de proteine ribozomale (cca 80, fa!à de 53 l,a procariote) qi au o mol'eculà în plus de ARN. Totodatà moleculel,e de proteine rilbozomal,e Ei de ARNr sînt mai mari la eucariote fa!à de procariote. Diferenla în dimensiune este un paradox deoarece ribozomii eucariotici îndeplicantonarea sinrtezei pr,oteinice nesc aceeagi funclie generalà oa +i ri'bozomii procaniotici. Se admite ca peurtru a ju.stifica aceste diferente dimensionale la ri,bozomii eucariotici trebuie desooperite funclii noi. Unele proteine ribozoma,le suplimentare pot fi specializate pentru inúeracfiunea cu reeeptorii din reticulul end'oplasmic numili ribophorine I Ei II, altele pot fi implicate în reglar,ea mai complexà a traducerii ARNm. Necesitatea suplimentarà pentru anumi'te proteine ribozomale, neimplicate în biosinteza proteinicà poate fi determinatà de panticularitàlile biogenezei organitului: proteinele ribozomale sînt sintetizate în citopiasmà qi tra,nsportate în urucleol uurde sînt asamiblate în subunità!ile ri'bozomale prin atagarea lor la precursorii ARNr pe cind acegtia sînt încà tr,anscriEi de pe ADN ribozom,al. Pre-ARNr va trebrui prelucrat qi ARNr 5 S'transcris din alte situri în nucleu trebuie sà fie î:rcorporat în subr:nitatea mane ribozomalà. Cele douà subunitàfi rirbozomale tnebuie transportate din nuctreu în citopl,asmà. În acrest prooes extrem de complicat de transport bidirecfional nucleu citoplasmà ar putea fi implicate proteinetre ribozomale suplimerrtar,e ale rirboS - Descifrind tainele ereditófii, vol.
I

65

subunitàlilor ri,bozomale ca qi
plasmà.

zomului eucariot. Ele de ase,menea pot participa la asamblarea în 'transportul lor spre cito-

Proteinele ribozomale ale organitelor celulei eucariote mitocondriale Ei cl,oroplastice sînt codificate în ADN nuclear qi sintetizate pe ribozomi citoplasmatici. Din aceastà cauzà la eucariote cu mitooondrií qi cloroplaste sînt sintetizate în citoplasmà circa 200 de proteine riibozomale care trebuie distribuite în nucleol, mltooondrii qi cloroplaste. Cum se reaùizeazà aceasrtà distritbufie nu se cunoaqte. S-ar puùea ca toate aceste proúeine só fie fil,trate prin cele trei organite, fiecare relinînd grupul corect de proteine ribozomale. S-ar putea ca proteinele suplimentare ale ri,bozomilor eucariotici sà condilioneze ele însele aoeastà distriibuire. În sfîrqit, nu poate fi exclusà nici posibilitatea ca proteinele ri,bozomale suplimentare de la rihozomii eucariotici sà nu a,ibà ,o funcfie specialà sau sà nu îndeplineascà nici ofuncfie. Existà mutanfi de Bocillus suúilis qi B. megateúum rezistente la ttriostrepton qi ca,re sînt lipsi{i de proùeina ribozomalà L 1L Mutantul de Ia prima specie spre deoserbire de acelra de la a doua specie de BacilZzs nu prezintà nici un fel de deficientà. Concluzia care se desprinde este cà proteina L L1 la B. wbtilis. mu îndeplineEte \n€o funcfi,e ribozomalà sau în sinteza proteinicà, dan nu poaùe fi orclusà posi,bilitatea ca rolul sàu sà fie preluat de al,te pr,oteine ri'bozomale prezente la acest mutant. 5. ARN de transfer (ARNí). A mai fost numit qi ARN solubil (ARNs), ARN accegttor de aminoacizi sau AIÌN adn@r. Sînt molecule adaptoare sau de racordare la care se ataqeazà diferiti aminoacizi carìe sînú transferafi la ribozomi în timpul biosintezei proteinice. Ac'este moiecule de racordare se atageaza la rîndul lor în mod specific la grupàrile cetonice qi aminice libere de pe monocatena ARNrz pe principiul împerecherii complementare de hlazr azotatn cu formarea unor punfi temporare de hidrogen. ARNú foacà rol cheie în ,biosinteza pr'oteinicà. Perntru fiecare aminoacid existà ce1 pufin cîte o moleculà specificà, diferità de ARNú. Greutaúea mol.ecularà a ARNf este de circa 25.000 daltoni avînd o oonstantà de sedimentare de 4 S. Lungimea molecutrei ARNú este de 73-90 nucleotide. Reprezintà 7A-150/o din cantitatea totalà de ARN celular. Ca gi ARNr, ARNú nefiind purtà'tor de mesaj genetic are, spre deosebire de ARNnz o duratà de via{a mare, prrezentînd o stabilitate metabolicà mare, diferitele molecule ARNú putînd fi reciclate de nenumàra'te ori. Capàtul iiber 3' al monocatenei se
66

úerminà la toate tipurile de ARNú cu secvenfa CCA pe cînd la oapàtul, li'b,er 5' se aflà secvenla terminatà în G. Moleculele ARNf prezintà o mare stabilitaùe rneta,bolicà cane derivà tocmai din prezenfa guaninei (pG) Ia capàtul 5' al monocate'nei sale. Aceasta faoe oa ARNú sà nu fie supus aga cum este supus ARNrn digestiei enzimartioe, ,gua,nfura stabilind punti de hidrogen cu ,Lraza opusà din ttrlpina dublu-catenarà a structurii trifoliare a ARNf. ARNú conline qi unele nucleotide areo iqnuiúe pnecum acidul inosinic (I) care poartà purfura hipoxamtilra gi care nu formeazà aceleaqi per,echi de baze azotate ca oele formate de A Si G. Alte nucleotide neobiqnuite aflate în ARNú sùrt acidul l-metiliinosisric (I-) acidul l-metilguanú,lic (G-) gi acidul NlN-dimetilguami,lic (G-) la care, prezenta gmpàrilor mgtil determinà formanea de perechi cu oricarre aùte tb,aze azotate. Tot ca bazà, neobiEnuità intrà în ARNú gi aeidul pseudouridilic (ìf) la care inelul pirimidilic uracil este ata$at lra ribozà nu prin azotul sAu N1 ca în acidul uridilic normadt ci prin carjbonul sàu 5. Acidul ,riiboti,midilic (T) esúe de asemenea o riibonucleotidà neorbiqnultà ce intrà în ARNú qi care este LegaÉ de convertirea uracilului în timfurà în urma unei metilàri a uracilului la C 5. Mai existà Ei o altà bazi'neorbi.qnuità în ARNú qi anume acidul d[hidrouridilic (Ui) sau DHU) în care uracilul poartà hidrogen suplimentar la C 5 qi C 6. ln realitate dihidrouracilul nu este o pirimidinà deoanece legàtura dintre C 5 gi C 6 nu este o punte durblà ci, uina simplà. Nucleotidele neobiqniuite nu pot fi introduse în pnecursorul ARNú în timpul transcrierii, prin nici un mecanism de împer,echere de baz.e complementare. Ele apar în urma modificàri,lor posttaranscriplionale a nucleoúidelor norm,ale, deja prezente în pre-ARNú. Prin plierea monocatenei rezultà rqgiuni dublu-catenare în zonele ùr car,e ,bazele azatat'e se împenecheazà compl,ementar cu formar,ea d,e punfi de hidrog'en. Din ara,nfamentul spatia,l al regiunilor bicatenare qi a1 r,egiunilor monocatenare rezultà o structurà secundarà care este cunoscutà ca m,odelul frunzei d'e trifoi (FiS. 30). Structura secundarà ,bidimensionalà po.ate fi la rîndul ei supusà plierii sprc a da o str-ucturà terliarà tridimerr.sion,alà caracteristicà de forma li'terei T (Fig. 30c). În structura unor tipuri de ARNú inúrà gi inosina (I) mai ales în secvenla antioodonului pen'tru codomii serinei (UCU), leucinei (CUU), pr,olinei (CCC), argtrinei (CGC), izoleucinei (AUA) ,etc., în care inozina (I) intrà în pozifia 3 antiparalelà (deci pozilia L în citire dir,ectà). Neputfndu-se împereehea, bazele metilate deiimiteazà regiuni'le bioatenare ale monocatenei.
67

I
lr'
6 .ogót'/ 3oH , daq:l9roa o ordmcrddu -brllul èlu
G

(b,
hollt al f ia&:rt

@eG\

u c6o

9c
ù
bÈlo
U

i?!ota

mitrf:.ftú!)

l,r'nr' irlCl

hrt

oHq.

'iG "l' {s ru
ù
G2o

l9 ig'a g\ r, i, u i,rq,.!r É ln lg' Ir'
hU

.€m UA 6mA àl
lc)

A

Fíg. 30. Structura ARNI. (a). Secvenfa celor 76 nucleotide din macromolecula de ARNI pentru alauinà de la drojdie prezentatà în modelul birlirnensional al fnrnzei de trifoi. Se indicà cele patîu bucle majore incluzînd gi bucla anticodonului ca.re are secve[ta A-A-A gi care se pottivette prin complementaritate cod,onului din ARNz fenilalaninà U-U-U. Bazele încercuite cu linii continui ocupà
aceleagi prclzílii

sÎnt: lU: DihU: dihid.rouridina, Y:pseudouridina, mx : nucleotide metilate ti î - timina (un uracil metilat în pozifia 5 în inelul pirimidinic). (b). Diagrama schematicà care indicó maniera în care ARNtFtea poate fi ràsucit spre a produce unele dintte relafiile fizice observate între diferitele pàrfi ale moleculei. Liniile subîiri indicà punfile de hid.rogen ce apar între baze în cadrul structurii tertiare pliate. (c). O reprezentare trid.imensionalà a ARNú redatà dupó studii

în toate moleculele de ARN care au fost analizate pînà in prezent. Bazele încercuite cu linii înherupte sînt .ìiferite la alte tipuri de ARNf. Numerotarea bazelor începe de la capótu1 5'. Nucleotidele aeobignuite gàsite la ARNú

de difracfie în raze X.

I

Descifrarea secvenlei de baze din structura primarà monocatenarà a ARNú pen,tru alaninà la drojdie precum qi a structurii sale secundare c€nfiguraîia spatialà cu negiuni monoca,tenare qi bicatenare - au permis lui HolLey $i colaboratorilor sài sà

-

68

frunzei de trifoi pentru aceastà configuralie spafialà eare s-a dovedi,t a fi valalbil pentru úoate tipurile de ARNú. Pentru aceastà realizare Holley a fost distins cu premiul Nobel. Folosind datele de secvenfiere a ARNú pentuu ala.. ninà extras de La drojdie, Khorana qi colaib. au nealizat pe cale chimicà, prima sintezà a unei ,gene, gena care dirijeaza sinteza ARNú pentru alaninà. ARNf se sintetizeazà pe maúri!à de ADN prin intervenlia ARN-polimqoaei qi apare mai îrntîi ca moleculà pr,ecursoare care, dupà transcriere, este supusà prnlucràrilor posttranscripfionale. Moleculele precursoare la ARNú ca Ei la ARNnz prezintà la capàtul 5' o secven!à suplimentarà numità secvenla conducàtoare sau din cap (leader) iar la capàtul 3' altà secverr!à suplimentarà numità secven{a din coadà (troiler). De as€rnenea, precunsorul ARNú pnezintà secvenfe interpuse in cadnul secvenlei care va constitui seeventa ARNú matu'r funcfional. Printre prelucrarile posttranscripfionale unele deùerminà excizia unor nucleotide din pre-ARNú sub acfiunea' enzimei RN-aeò P (P de la precursoare) pe cînd ,altele determinà adi{ia la capàtul 3' al monocatenei a-secvenlei 5' NìCf A 3', implicatà în aminoacilarea ARNú. Implicarca secven!,ei CCA în amivezi sinnoacilarea ARNú (atagarrea aminoacidului activat teza proteinieà) a fost dovedità în experienle de îndepàrtare a acesteia folosind fosfodiestntaza, din venin de qarpe care aclioneazà numai asupra acestui capàt monocatenar ,al moleculei ARNú. ARNú lipsit de secvenla CCA de Ia capàtul 3' pierde capacitatea de a accepta aminoacizi. Capacitatea acceptoare pierdu,tà a unui ARNú tratat cu fosfodiesterazà poate fi redobîndità dacà acest ARNf deficient este pus lntr-un amestec de reacfie care confine o enzimó specialà (terminaltransferaza) ce are capacitatea de a ,adàuga nucl,eotide terminaie fàrà a necurge la împerecherea complementarà de baze cu o matri!à polinucleotidicà qi substraturile sale CTP qi ATP. Alte prelucràri posttranscriplionale sînt cele care realizeazà modificarea chimicà a unora dintre nucleotidele ràmase. Printre modificàrile ehimice mai importante sînt metilarea gi formarea pseudouridinei. Modificàrile chimice ale nucleotidelor obiEnuite (incluse în ca,ùena pre-ARNú în timpul transcrierii sale de pe matrila ADN) care due la convertirea lor în nucleotide neobiEnuite sînt cataliza,te de enzime speciale existente atît Ia procariote cît gi 1a eucariote. O astfel de enzimà convertegte grupul NHz de pe carbonul 2 al acidului adenilic din pre-ARNú în grupul OH
elab,oreze modelul
69

F
creind astfel un rest inozinà la un.ele situri ale catenei preARNú. Atrt€ enzime transferà grupul nretil (enzimele se numesc în cqnsecinfa metilaz,e) la hipoxantinà, guaninà sau uracil din pre-ARNú spne a da I*, G', G- sau T. În sfîrqit, alte enzime rearanjeazà legàturile dintre inelutr pirimldinic qi ri,bozà spne a converti uracilul în pseudouracil sau spre a hidrogena inelul, convertind uracilul în dihidrouridinà. Asemenea prelucràri posttranscripfionale au putut fi sfirdiate Î,n cazul microinfecliei nucleului de drojdie de ,bere în ovocita de broascà. Prelucràrile posttranscriplionale implicà în cazul precursorului ARNú (pre-ARNú) pentru tirozinà de la drojdie, elimin:rrea secvemfelor inrùerpuse din pre-ARNf (descrisà prirna datà de càtr.e Goodmatr Ei colarboratorii în 1977), excizia secvenlelor suplimentarè 5' Leader $i 3' trailer, adàugarea secventei CCA la capàtul 3'. Toate aceste prelucràri au loc în nucleu. Tot în nucleu mai sînt modificate, în cazul ARNú pentru tirozinà de la droidi,e sintetizat în ovocite de broascà microinjectate cu nucleu .de drojdie, cel pulin Sapte ribonucleotide înain,te ca ARNú sà fie transportat din nucleu în citoplasmà (Melton Ei colab., 1980). Aoeste modificàri ce duc la formarea în pre-ARNú a 5 metil-citozinei (m5C), 1, metil-adenozina (-lA), pseudouridina (rÍ) 9i dihidrouridina (DHU) apar în nucleu. O singurà modificare apare în ciúoplasmà qi anume a guaninei. S-a constatat cà modificàril'e apar într-o ordin'e pnecisà, strictà, cane 3e coreleazà cu schimbàrile din dimensiunea precurff)rului ARNú deterrninate de eliminarea secvenlelor leoder qi trailer. Astfel, de înd,atà ce secvenf"a leader este eliminatà Ei este adàugat 3'CCA, U din regiunea antioodonului este modificat în pseudouridinà (tY). Determinarea secvenfei ADN corespunzînd Ia 4 din cele B gene ARNú pentru tirozinà (ú ADNúyr) de la SacchmwnVces cereuisiae a condus l,a consta,tarea cà aceste gene ARNú pentru tirozinà conlin o secven!à interpusà de 14 baz'e adiacente anticodonului car'e nu este prezentà în ARNú rnatur qi deci ea este eiiminatà în cadrul prelucràrilor p'osttranscripfionale. Maturarea precursorilor ARNú diviza'tà în mod oonvenlional în douà proc€se separate reduoerea dimensiunii Ei modificarea de ibaze reprezintà u,n proces unic, càci cele douà aspeote sînt inúim legate, desfàqur,flndu-se conoentr,an't. Succresilrnea ordonatà a etapelor de prelucrare posttranscripfionalà a ARN în general qi a ARNf în'special, sugereazà cà enzimele de ma^uurafie care condilioneazà transformanea pre-ARN îrr ARN matur au capacitatea, unele de a recunoaqte precursori cu sec70

sînt înralú redundante. Teoretic ,ar trebui sà fi,e un numàr de 64 tipuri diferite de ARNf care sà traducà m,esajul genetic (vezi codul genetic). Au fost izolate în stare purà aproape toate tipurile de ARNú, iar la pesùe 20 dintre ele a fost stabilità secvenla de nucleotide a monocatenei (structura primarà). Genele pentru ARNf ca gi c,ele ribozomale sînt prezente atît Ia procariote cît gi ia eucarioúe în copii multiple (40-80 la procariote, 32A-14A0 la eucariote), în unele cazuri fiind distribuite grupat în genom formînd aqa-numitii clasteri. Fieca,re aminoacid are cel pulin un ARNú specific care intervine în activarea sa în cadrul biosintnrei protcinice. Uneori, acelagi aminoacid poate fi activat de douà tipuri, diferite de ARNú care s-au numit ARNf isooccepúori. Specificarea unui aceluiaqi ,amfuroacid de douà tipuri de ARNú ar fi o màsurà elaboratà în cursul evoluliei de a asigura realizarea biosintnzei proteinice în condifiile în care ]a nivelul unuia dintre ARNú isoaccepùori s-a manifestat felomenul mutagen.

venF 5' leadq, iar aitele de a recunoaqte gi accepta ca suíbstrat pre.ARN fàrà aceastà secventà 5' leader. Este posib,ii ca în aoeas'tà capaciúaùe de recunoaqtere sà joaoe un €utumit rol qi secvenfele interpuse. Ar trelbui sà fie un numàr de cel pulin 61 tipuri de A-RNÚ care sà traducà mesajul genetic (vezi eodul genetic) qi care ar corespunde celor 61 aodoni sens din ARNrn. Ta E. coli sînt 30-40 tipuri diferite de ARNú specificagi de gene limitat redundante. La eucariote, genele pentru ARNf

Fiecare moleeulà de ARNú prezintà rogiuni specifice de interacfiune cu alte molecule, negiuni, în care nu apar împerecheri de ,baze prezentîndu-se ca bucle Ia nivelul càrora bazele sînt expuse avînd posibili,ùatea interacliunii cu alte elemente. Astfel, secvenfa CCA de la capàtul 3' al moleculei ARNú este implicatà în ataEarea aminoacidului corespun zàtor la molecula ARNf, h vederea transportului sàu. Fiind aceeaqi la toate moleculele ARNú, secvenfa CCA nu este implicatà în specificitatea a,taEàrii aminoacidului la ARNú. Molecula ARNú prezintà însà o regiune care conferà specificitate ARNú prin care acresta r,ecunoatte în mod specific un aminoacid dat. Aceastà regiune es.te variabilà la diferitele tipuri de ARNú. De asemenea, molecul'a ARNf mai prezintà o regiune de recunoaqtere a ri'bozomului reprezentatà de prima buclà din modelul frunzei de trifoi, alcàtuità din 7 baze neîmperecheaúe, numità bucla TìI'C, precum qi o rcgiune de recunoaqtere a codonului din ARNm, regiune care s-a numit

7l

F
anticodon sau nodoc (opusul lui codon) qi car,e este formatà, ca gi eodonul din ,trei bazp, ,azotate (tripleta). Ea se aflà în 'bucla antioodonului. Regiunea anticodonului este specificà fiecàrui tip de ARNú gi ea courdifioneazà recunoagterea cprectà a codonului din ARNrz cotrespunzàtor aminoacidului purtat de ARNf gi- care este specificat (codificat) de càtre oodonul din ARNm. Între prima buclà qi bucla anticodonului se aflà o buclà micà numità ,,ciot6'. Recunoas.terea codonului de càtre antioodon se bazeazà pe principiul complementaritàlii bazelor azotate de tip (A U A
codon

don etc.) care se asociazà tempor,ar prin formarea unor punfi d,e- hidrogen. Codonul qi anticodonul sînt ,orientate antipar,alel

- 321

U A U anticodon; C G A codon

12 3

L23 G C U antico- 321 -

(5'-t3' codonul, 3'+5' anticodonul).

malà structural qi funcfional. Dar, potrívit ipotezei oscilàrii (u:obble) elarboratà de Crick în 1960, une'ori un flntlpit tip de ARNf are capacitateoa de a recunoaqte prin ,anticodonul sàu mai mul{i codoni (triplete) care însà se deos,ebesc doar prin cea de-a treia 'bazà,. însearnnà cà in cad'rul internelafiei codòn-anticodon, esenfialà în d,escifrar,ea, decodificarea (traducerea) mesajului genetic transcris în ARNrn, primele douà perechi de baze prezintà o mai mare specificitate a împerecherii pe cînd c,ea de a treia capàtà caracter oscilant. Astfel U aflat în conformitate cu antiparalelismui imperecheril,or cle ,baze pe primul loc în secvenfa anticodonuiui (altfel, ea ocupà tot locul trei în acesta dacà consideràm orientarea generalà de la stînga l,a dreapta) poate sà se împerecheze cu A dar Ei cu G afiate în codonul ARNrn ca cea de a treia'bazà. Tot astfel G din antioodon poate recunoaqte, în aceleaqi condifii tipologice atît C cît qi u, iar hipoxantina poate recunoaEte u, c si A aflate în pozilia a tr,eia în codon. Nu acelagi lucru este pentru C qi A a,flaúe în pozifia ulrtimà (considerînd sensul gen,eral stînga+dreapta) în an,ticodon. Acesùea nu pot recunoa$te qi nu se împereoheazà decît cu bazele oomplementare conespunzàtoare a,flate în a treia pzí\ie în codon qi anum,e

Împer,echerea corectà codom-anticodon condilioneazà plasaîn catena polipeptidicà oe se sintetizeazà. ,a unui aminoacid dat Ia l,ocul corespunzàtor, sintetizîndu-se astfel o proteinà norr.sa

GqiU.

72

enzimà activatoare specificà pentru fiecar,e amimoacid. Inifierea tuturor catenelor polipepti'dice (tradueerii mesajului genetic) se realiznazí, prin intervenfia aq€Fnumitului ARNú i,nifiator. Aoesta este ARNú ce transferà N-formilm'etionina (ARN/M"') l,a ,bacterii, virusuri, mitocondrii qi cloroplasùe qi ARNú ce transferà metionina (ARNtue\ la eucariote. Func{ia ARNú este în esen!à legatà de decodificarea mesajutui genetic. Dar ARNú mai poate juca rol qi în alte procese celulare, mai ales la baeterii cum ar fi negl,area activitàlii genelor (operoni) care dirijeazà sinteza unor aminoacizi, transportul unor aminoagizi necesari formàrii punlilor interpeptidice din perelii celulari ai bacteriilor, sin'teza am.inoacilfosfatidilglicerolului, adilia terminalà a resturiior aminoacizi la proteine etc. În cazul în care Eenel,e pentru ARNú suferà mutatie se sintetiz.eazà ARNú la care este alteratà specificitatea de recunoaqùere de càtre ,antioodon a codonului corespunzàtor datorità modificàrilor ce apar în bucla antic,odonului sau adiacent eÍ.. IJn asemenea ARNú va putea sà recunoascà codoni rLonsens sau missens, care condilione'azà fie terminarea la'nfului polipeptidic în primul caz, fie încluderea în lanful polipeptidic a unui aminoacid necor,espunzàtor datorità modificàrii prin substitufie a secvenlei de bazà în cel de-al doilea caz. ARN nuclear heúerogen gi ARN crornozomnl. La eucariote se mai descriu qi alte d,ouà tipuri de ARN celular. Esúe vorba de ARN nuclear heterog'sn Ei ARN cromozsmnl. 6. ARN nuclear heterogen (ARNhn) reprezintà o clasà de molecule ARN cu greutate molecularà variarbilà într,e 105 qi 2 X tÙz daltoni cu dur,ata de via!à scurtà (5-10 minute) fiind instabil. metabolic. ARNhn repî'ezintà cca 3olo din totalul ARN oelul'ar. Fiiurd sintetizat pe matrila ADN are o compozifie de ibaze eomplernentarà ADN. Are un con{inut G + C de cca 4A-450/o cu mult mai mic decît cel aI ARNr care este de cca 700/0. Est€ localizat î:r afara nucleolului. Din ARNhn derivà, în urma prelucràrilor posttranscripfional,e ARNzn, din care cauzà, ARNhz s-a mai numit ARN prernesager sau pre-ARNrn. Partea din ARNhn care nu nepnezintà ARNnz este transcrisà de pe ADN care prezfurtà secvenle repertate de nucleotide qi care se pare cà sînt implicate în me73

Cea de a patra buclà din modelul frunzei de trifoi conline 6-12 tbaze neîmperecheate. Ea s-a numit bucla dihidrouracilului, fiind implicatà în legarea ARNú la o,minmrilsintetozd,

7
canisme de reglare. Aceastà parte a ARNhn poate prezenúa o conformafi,e caracùeristicà sub formà de ac de pàr numità structurà lwirpin qi care se formeazà prin împerecheri intracatenane de baze complemerrtare. 7. ARN crarLozatnol (ARNc). Este un tip de ARN complementar unor secvenfe specifice din ADN cromozomal al eucariotelor. O parte din acest ARNc reprezintà molecule precursoare ale ARNzn, ARNr, gi ARNú. ARN crorìoZohd, pe de altà parte se cr,ede cà reprezintà o categorie de ARN celular legatà de interacliunea ADN-proteine càreia îi conferà specificitate de secven!à, acest tip d'e ARN legîndu-se covalent I'a proteinele cfomozomale histone. Greutatea molecularà a ARNc ,este mai micà decît c€a a ARNú càci cuprinde doar 30 pînà La 50 rrucleotide. Confine pînà la 270/o dihidrour,acil. Nu se $tie încà dacà ARNc este într-adevàr un tip aparte de ARN celular sau repr,ezintà un produs de degr,adare a ARNhn. Sînt date dupà care ARNc intervine în,tr-un mod specific în reglarea activitàtii genice la eucariote, avînd efect derepresor asupra geurelor represate prin complexar,ea ADN cu hisúonele. B. ARN airol. La unii fagi oa Ei la unele virusuri vegetale Ei animaie miezul de acid nucleic este reprezentat de ARN, PUttàtor în aoest oaz de informafie geneticà primarà din cane cauzi se mai numeqte Ei ARN geneti,c. ARN uiral poate fi mon,ocatenar (bacteriof,agii Fz $i R17, virusul moz,eicului tutunului, virusul gripal qi polio). Reovirusurile au ARN 'bicatenar. Moleculele ARN sînt liniare, niciodatà circulare. ARN airal îndeplineqte atît rol de matrifà pentru replicarea sa în veder,ea multiplicàrii panticulelor viraie cît qi rol de ARN rnesryer pentru sinrteza de proteine virale specifice. Genomul viral ARN îndeplineEte deci o funclie dublà, gen'omul qi tran-

scriptul fiind într-un anume sens unul qi acelagi lucru gi aceeaqi enzimà numità replimzd, sau tronscriptazd,, de fapt o ARN polimerazà servind atît funcfia de replioare cît Ei funclia de transcriere. Cel mai bine studiat este ARN al fagilor QP $i R17 la care s-a realizat secvenflenea nucleotidelor în cea rnai mane pa,rte. Astfel cromozomul fa,gului R17 alcà,tuit dintr-o monocatemà ARN conline cca 3510 mucleotide, purdînd informafia pentru sinrteza a 3 proteine Ei ràmînînd încà 580 nucleotide, primele 100 urucleotide de la oapàtttl 5' nefiind niciodatà traduse în pr"oteinà ca dealtfel nici cele 50 nucleotide oare pneced capàtul 3'. Capàtul 3' al catenei confine secvenrta 5' . . . CCA CCCA-3' qi se
74

PPP

G

PPP

A
U

^ "

U
A

pr,"r",;;;;i
t+t

REPL'T A2 A

G:C A:U U:A c =G 6=C U:A
A

G

PPP

A,
U

L .+[, (a tena -naîrtlà)

nrptirazi

(-)

u
A

A,

c
AoH

A--U c =G ::U:. ,OHV. A
\----w.-J

A
C

A
5

RF

'

^l J

ARN progen

Fig. 31. Replicarea ARN viral. RF - forma, replicativA dublu-catenaró. admiùe cà aceastà secven!à este recunoscutà specific de càtre enzima replicazà. Pe parcursul secventei ARN apar posi'bilitàîi de împerecheri complementare intnacatenare cu formare de structuri buclate de tip hairgnn, structuri impliaate în conferirea de stabilitate monocateil]ei ARN în timpul infecfiei, în împacheúarea sa într-o formà mai c€mpactà în capsida fagicà. În vederea sintezei proteinelor virale moleculele de ARN viral,, acfi'onînd ca ARNnz se ataqeazà, la rirbozomii celulei gazdà formînd poliri'bozomi. Im,ediaú dupà injectarea ABN viral în celula gazdà Ei legarea sa de riib,ozomii celulei gazdà este sintehzatà ,e!ìzima ARN sinfu,tazd (ARN-re plicozd) care catalizeazi formarea unei c:atene complem,entare nealizînd astfel replicarea ARN viral (Fig. 31). Dacà se considerà oatena inifial'à, care pàtrunde în celula gazdei drept ca;tena ,,*tt ea se,rye$te ca matri!à pentru sinteza caùenei complernentare ,-u pe principiutr împerecherii de baze complementare cu formarea de punfi cle hidrogen, realizîndu-se pemtru un anumit timp o structurà bicatenarà ARN numità tormd replicatiud, (Rtr'). Au loc a,poi multe runde de replicare ale formei replicative bioaúenare. Unele din catenele + nou sinúetizate acfioneazà ca ARNnr dictînd sinteza de replicazà qi pr'oúeine ale capsidei. Alte oatene f , dar nu este exclus ca Ei unele din acelea cìare au participat la sinteza pro75

dovetlite pînA ln prezent; linia subfire continuà - lagganismul special de transfet de informaJie

Fig. 32. Dogma centralA revizuità a biologiei moleculare. Diagrama redà relaliile de transfer de informafie dintre mecromoleculele informafionale: liniile gtoase - re-

latii

liniile întrerupte - transfer de informafie nedovedit pînà îu prezent.

verstranscriete) care are loc in celulele infectate cu oncovirusuri ;

de la ARN la ADN

(re-

teinicà, devin împachetaúe în capsida proteinicà a noilor particule fagice, corrrstituind cromozomul viral. Iatà deci cà avem aici de-a faoe cu o dualitate în care aoeeaqi rnoleculà de ARN viral poate funcliona atît ca materi,al genetic cît qi ca ARNm. 9. Reuerstmnscrierea. Pînà acum ,aîn analizat tnansferul informaliei genetice de la ADN la ADN in procesul replicàrii ADN de l,a ADN la ARN în procesul transcrierii gi de Ia ARN la ARN în replicarea ARN viral. Pînà în anul 7970 a dàinuit ideea, cristalizatà în a{a-numita dogmrt 'a biologiei mpleculare (Fi'S. 32), potrivit càreia transmiterea informafi,ei ereditare se f,ace unidirecfional în sensul ADN--*ARN-+proteine. În anul 7970 Temin gi Mizutani pe de o parte gi Baltimore pe de alta au descris o ADN polim,erozd dependentà de ARN izolatà din uirionii virusurilor onoogene ARN (ri,bovirusuri oncpgìene din farnilia Retrouirifue) Si din celule infectate cu asem€n€,ar virusuri ca gi din celule transformatre malirgn. Aceastà enzimà ar€ capacitatea de a transcrie ARN natural sau sintetic qi de a sintetiza astfel, folosind ca matri!à ARN, o c€pie oomple'mentarà ADNc. Este deci o violare a dogmei centra,le a biologiei moleculare càci în acest caz ernzima ADN-polimerazd,, dependentà de ARN, condifioneazà transferul informaliei genetice de Ia ARN l,a ADN. Din aceastà oauzà a fost numità inuertazd, reuertazd sau reuerstranscriptazd i,ar procesul sintezei unei oopii ADN pe ma'trità ARN s-a numit inverstranscriene sau rwqstranscriere. Reverstranscriptaza folosegte ca substrat dezoxiribonucleotid-trifosfafi, este depende,ntà de o matrifà ARN Si pentru reacfia de polimenzarc ureoesità un ARN gnim,er cu rol de a inifia sinteza catsnei ADN la oare se leagà printr-o legàturà
76

covalentà fosfodiesúericà. De as€imenea enzima necesiúà pentru r'e'acfia neverstranscrierii ioni bivatlenfi de Mg qi Mn. Drpà adàr,rgarea primului dezoxiribonucl'eotÍd la gfupul 3'JH al primerului ARN, reacfi,a de reverstr,anseriere se desfàgoarà prin adàugarea succesivà de dezoxiriboqlucleortide, oane se împer'echeaaà cu 'bazele comple'rnentare din matrila ARN, între dezoxiribonucl'eotide statbilindu-se legàhrri oovalente fosfodiesterice. Monocatena ADN astfel sinúetizatà, copie a matrilei AFIN, formerazà cu aceasta,, prin interm,ediul punlilor de hidrogen dintre bazele oomplemenùare o structurà tbicaúenarà hi,bridà ARN-ADN, Intervime se parre o ribonucleozd. H care hidrolizeazà. ARN dirrr hilbrid astfel, ca mourocatena ADN poate servi ca matri{à pentru sinùeza unei catene complem'entare. Rezultà un ADN bicaúenar purtàtor de informalie geneticà viralà qi carìe se poate inf,egna în oromozomrul. oerlrulei gazdà sub fonn,a a oeea ce a fost numit prwirus. Fàrà a duce la \in oelulei infectaúe, pB oalea reverstranscrierii, celula gazdà este însà transformatà malign. La un momeurt dat, sub influenfa diferitilor faotori mutageni, fizici, chimici sau rbio,logici (infectia cu {rn alt virus) provirusul ADN se desprinde din cromozomul gazdé qi poate transcrie molecule de ARN viral, asi'gurind astfel multiplícarea virusului oncogen. ADN proviral se integreazi în cromozomul gazdà în regiuni, om,oloage, inùegrarea fiind oondifionatà de o enzimà numità integrazd. pe cînd în excizia sa pe lîngà inúegr,azà intervine qi o erciào,nazd. In'tegrarea gi excizia ADN pr,oviral sînt în esmrfà fenomene reoombinatorii de tip rupere-reunire (vezi recombinarea geneticà). Virusurile oncogene prezihtà un genom repreuen'tat de ARN rnonocatenar avînd o constantà de sedimentare de 78 S, care cuprinde patru gene simbolizatn g@g, onc, i.rw qi poZ. Gena gog specificà proteineLe virale interure avînd ca produs primar o proteinà cu masa molecularà de 76 000 dalúoni. Gena otzc specificà o proùeinà implicatà în inducerea tramsformàrii maligne a celulelor în creqtere. Gena inu esbe legatà de sinteza glicoproúein'ei de la suprafala înveliqului virio.nului, iar gena pol specificà sinteza inve'rstnanscriptaa,ei (reverstranscriptaz'ei).

În 1969, Huebner gi Todaro au elaborat ipoteza oncogenei, potrivit càreia toate celulele contin în ADN o uirogend, adicà ,o genà oare oonfime informafia geureticà a urnui virus incluzînd qi ,aceea pentru transformarea malignà a celulei gazdà, adicà
77

cu ADN gazdà dsa lun€ul generafiilor celulare. În mod normal oelula a elaborat mecarrisme de represi,e a virogenei. Cînd mecanismul de represie este alterat virogena se exprimà qi duce prin activitate'a onoogenei la transformarea malignà a celulei. Alteranea meoanismului de represie apare în urma ac{iunii diferililor agenti fizici, chirrici sau biologici. Desi'gur virusurile onoogene pot fi ribovirusuri (ARN) sau dezoxiriibovirusuri (virusuri ADN). Reverstranscrierea este î'nsà specificà ribovir'usurilor oncogsne.

oncog€na. Virogena este replicaità qi transmisà odatà

Capitolul

III
MH}ITAR

ORGANIZAREA MATEEIALT]LI]I

Sisùemel,e biologice cuprind douà tipuri fundamentale de organizare Ei e,nume orgonizorea ui,w'ld qi orgm,iznrea celulord,. La rîndul sàu orgamizarea celularà cuprinde douà tipr:ri divergenùe de ,organizare: organizarea procariotà Ei organiza,rrea eucariotà, precum qi un tip intermediar, organizarea ntezwriotd (Gavrilà, 1978).

1. ORGANIZAREA

VIBALA

Asupra concepttrlui de virus a fost etraborat neoent un excelent studiu critic (7nrnea, Ei Herlea, 1974). Statutul particular af sisternului viral poate fi desprins de expresia aforisticà a lui Lwoff care în 1957 afirmà cà ,,virusurile pot fi oonsiderate ca virusuri, din cauzà cà virusurile sînt virusurir(. Virusurile se caracùeriznavÀ prin existenta în structur'a lor a unui singur tip de acid nucleic (fie ADN, fie ARN, niciodatà ambele tipuri d,e acid nucleic). Virusurile nu cresc, DU se divid qi nu posedà aparat enzimatic pentru produoere de energie. Prin aceasta virusurile se deosebese esenfial de toate celelalte sisteme bioLogice existente actualmente în natura. Dar virusurile pot fi oonsider,aúe toúuqi sisteme biologice prin faptul cà ele pr'ezintà caracterlstici structunale qi dimensiunri cpnstanùe, pot suferi rnutafii qi recomibinane geneticà qi pr'eziurtà o ontogenezà, precisà în care pe seama materialului biologic ail celulei gadà, materialul lor genetie dirijeazà formarea noilor particule vira,le, asigurînd astfel perpetuarea lor. Viruzurile au orgranizare acelularà. Particul,a viralà com79

pletà numità oirion sau virusul infeclios matur reprezintà o unÍta,te de structurà qi funcfie atcàtuit dintr-un îmveliE proteinic capsida $i un miez de acid nucl,eic. Miezul de acid nucleic este reprezentelt de ADN la d.ezoúriboairusuri qi de ARN I'a ribatirusuri. Acizii nucleici virali nu sînt asociafl cu pr,oteine cu exceptia unor cazuri îur care se descrie exisùenfa în interiorul capsidei a unei proùeine implieatà în împachetarea (supraspiralizarea) acidului nucleic viral obligat sà fie cantonat într-un spa{iu foarte restrîns. Alte tipuri de proteine virale ,,interne( au rol enzimatic (replieaza sau reaerstrans*i.pfuza
de exemplu).

tea infecùa o al.úà specie de bacterie, ba mai mul.t prezintà pretulpinà de E. eoli. O singurà exoepfie se impune a fi amintità. Este vonba de virusul PIV? care infecteazà peste 40 de specii, diferiúe de planrte Ei chiar o insectà. În afarà de virion, virusul se mai poate afla sub formà de vinus vegeú,artiv crorespunzînd eromozomului viral aflat liber în citoplasma celulei gazdà în ,timpul mul'tiplicàrii sale sau sub formà de provirus cînd este integr,at în eromozomul gazdà. în cazul dezoxiri,bovirusurilor, ADN poate fi dublu-catenar (liniar sau circulan), sau monocatenar, circular. Acesta din urmà devine dublu-catenar în timput nepticàrii. La ri'bovirusuri precum ,ba,c,teriofagii 8p, Rn pi fz, VMT, unele vimsuri 'animal,e (influ'enza gi alt poliomelit€i) ARN este monocatenar qi devine dublu-c,atenar în timpul replicàrii. Reovirusul are un ARN duiblu-oatenar chiar atr:nci cînd es,te în stare de virion. virusurile planúelor au în gener,al un ARN duiblu-c'atenar. La reovirus qi alte virusuri animale genomul viral este segmeùltat adicà ARN esúe rreprez*ntafi prin mai multe piese de z4,R.fú bicaúenar. Genomul ARN al virusului gripal ,este disc,onúiuruu. El este monocaùenar si format din g fr,agmente avînd o greutaúe molecularà cuprinsà ùrtre 105 gi 106 dalúoni realizînd o m,asà molecularà de 5,5 X 106 dalùoni.
ferfur,!à pmrtru o ,anumità
80

Miezul de ,acid nucleic viraù. se mai numegte crarnozo'm uirol. Virusurile sînt par,azilt obligali de nivel gearetic, deoarece virusurile, nu se reproduc de sine stàtàtor, ci ele se reproduc pe searna componentelor oelulei ,gazdà dupà planurile anhitecturale furscrise în informa{ia ereditarà viralà depozitatà în miezul de acid nueleic ADN sau ARN. Datoriúà acestui fapt marea majoritate a virusurilor rnanifestà o înaltà qi striotà specificitate de gazdà: un virus oe infecteazà Eseherichia coli bunàoarà, în mod normal nu va pu-

Virusurile gripale, paragripale qi rabdovirusurile se numesc virusuri cu catenà negativà deoarece ARN-ul lor nu are funclie mesagerà, $i pàtrunzînd în oelula gazdà,, nu poate induce sinteza proteinelor virale specifice, din asemenea virusuri neputîndu-se extnage ARN viral infectant. În particulele virale ale acestor virusuri existà enzima transcri,ptazd care asigurà transcrierea unei catene ,,*tt pe catena inilialà ,,-sc. Transcrierea qi replicarea ar putea fi reaLizatà de aceeagi enzimà ARN trarrscriptazà,, sau enzima de transcriere este modifica,tà prin adilia unei proteine din celula gazdà astfel cà ea d,evine o
Dimensiunea genomului viral variazà între 3000 nucieotide qi peste 10 000 nucleotide, codificînd între 3 Ei 10 proteine cu o secvenfà de cca 140-160 arnin,oacizi. Bacteriof,agii ARN reprezinti unele dintre cele mai mici virusuri avînd cca 3300 nucleotide care cor,espund la 3 gene priurcipale, douà specificînd proteine structurale al'e virusului iar a tr,eia specificînd ARNreplicazà.

Adenovirusurile mai mici prezintà o macromol,eculà d,e ADN sub formà circularà atît la nivelul virionului cît gi în forma sa replicativà, pe cînd în cele mari, la nivelul virionului, ADN se prezintà ca o moleculà filamentoasà lungà de 6 pm Ia fagul qzg ee infecteazà bacteri,a Bacillus su,btilis gi de 47-52 pm la fagii de tip Tz $i Ta ai bacteriei E. coli. Virusul variolei aviare are o moleculà de ADN lu,ngà de 93 pm. *FÀglI l. al bacteriei E. coli ,ar,€ o moleculà de ADN lungà de 16 pm qi care prezintà la oapete prelungiri monocatenare din care cauzà aceste ca,pete sînt ,,lipicioase6r sau ,,adezivea, adicà au secvenfe oomplementare pe seama càrora molecula bioaúenrarà linianà de ADN se circuLanzeazi in aitro ca qi în timpul cînd se aflà în celula b,acterianà. $i fag'ii Tz, Ta, Te $i T7 pr,ezintà secvenle terminale repetate în moleculele limiare dublu-caten'are de ADN dar ele se aflà la n,ivelul unor regiuni dublu-catenare, neputîndu-se realiza circularizarea. Forma circularà protejeazà macromol,ecula ADN de atacul

sintetaza.

De regula însà la nivelul ADN viraù nu se aflà secvente repetate de baze. Se cronstatà cà virusurile car,e au acid nucleic reprezentat de o moleculà monocatenarà în virioar aceasta devine dublucatenarà în timpul replicàrii. Monocatena reprezintà rnesagerul Ia fagi pnecum QF qi f2 oar€, patrunzînd în celula gazdà poate fi
$ Descifrtnd tainele ereditàfii, vol.

exonucleazelor.

I

81

7
direet tradusà de maqinària de sinte'zà proúeinicà a celulei gazdà. În aL,te cazuri, caúena caÌre pàtrunde reprezintà complementul mesajului, aqa cum este cazul lui p X 174. În aoest @2, neplicarea rnonocaùenei este primul eveniment qi numai dupà aceasta aparatul genetic este disponibil pentru tra,nssriere. În ,eoncluzie se po,ate spune cà informafia geneticà a virusurilor se aflà codificaúà în cnomozornul viral care este neprezentat fie de ,q,,DN, fie de ARN gi care se aflà sub formà de m'olecule liniare sau circul,ane rbicatenare saru monocatenare. Moleculele monocatenare d,e ADN sau de A.R,N ,capàtà în timpul replicàrii formà bicatenarà, reprezentînd inúermediari r,eplicativi sau forme replicative.

2. OBGANIZAREA CELULABA
organizarre celularà. Organizarea celularà a nepnezentat o etapà

Toate sistemele biologice cu excepfia virusurilor pnezin'ta

esenfialà în organizarea qi evolufia ma'teriei vii care a oferit enorme posibilitàti qi perspective evolutive. Deosebirea principalà dintre virusuri Ei celule courstà în faptul cà niciod,atà o particulà viralà nu va pute,a da naqtere direct la alte douà particule virale prin diviziune. În cazul celulelor, oricît de simple ar fi ele, chiar arflate la limita superioarà dimensiogi ricketiile, ,nailà a particutreilor virale, cum sînt 'micr,oplasmele multiplicarea presupune diviziunea unei celule preexistente prin care nezultà douà celule fiice identice. La berza, multiplicàrii celulare stà o finà coordona,re între replica'rea ADN qi distribu{ia produqilor de replicare în celulele fiice prin interverrfia unor mecanisme specializafre qi extrem de diversificate. Toaúe celulele au de asemenea ambel,e tipuri de acizi nucleici qi un sistem propriu de sintezà proteinicà. În cadrul organizàrii celul,are se deose,besc douà tipuri oarprocariot gi eucariot qi un úip dinale de onganiz,ar'e geneticà intermediar mezocariot.

-

2.1. ORGANIZAEEA PROCABIOTA

Aoest tip de orga,nizare car,acteriz,e,azà. bacteriile, actinomicetele qi al'gele albastre-verzi ururnite incà cianobacterii, prezentînd toàte atributele sisùemului biologic oelular, inclusiv auto82

r,eproduoerea si morfogeneza autonomà. Materialul ior ereditar este reprezentat de o moleculà circularà dublu-catenarà de ADN care se mai numeqte crom ozom bacterian. Cor,espondentul m,orfologic a'l crorîozcmului circular bacterian este Àucleoidul bacterian care prezintà la nivel ultrastructural ca Ei geuoforul algelor alibastre-verzi fibrile fine de ADN care au un diam,etru de 25 A lGavrilà qi Tàciurà, 1978). Nucleoidul bacterian nu este separat fa!à de citoplasmà, de càtr,e o structurà mem,branarà, astfel cà aoeste organisme nu au un nucleu ,adevàrat. Materialul genetic nu esté închis în,tr-un spafiu genertic definit, astfeL cà r,àporturile sale cu citopl,asma sînt directe. La procariote relafia- ADN-cromozom este de toúalà omologie. cromozomul bacterian cuprinde, urr set complet de determinanli genetici (gene) ai tuturor caracterelor unei celule bacteriene, pentru me,taibolism energetic, biosinteze c'elulane, creqtere qi diviziune ca gi penúru regl'area activitàlilor intracelulare. ADN bacúerian nu se asociazà de regulà cu proteine tbazice histonice. Date recente indicà prezenla, la bacteria E. coli Ei ],a cianobacteriile Annbaena qi Aplwno&psa, asociate la ADN, a unor proteine 'bazice d'e tip hisùonà cu greutate moleoularà micà de 10.000 dalto,ni. Structura supercpiraliza;tà a ADN bacterian este menlinutà de càtre ARN. Cnomozomul circular bacterian reprezintà suportul fizic al unicului grup de înlàn{uire a genelor, toate genele bacteriene fifurd úransmise în bloc la descemden{i. El reprezinrti cea mai rDBr€ mol,eculà descrisà pînà în prezent în'tr-un sístem ibiologie cuprinzînd un numàr de coa 2000-3000 de ,gene. Are un perimetru de 1400 pm. Circularitatea cromozomului bacterian îl pnotejeazà fafà de acfiunea depolimerizatoare a unor enzime precum dezoxiribonucleaza. Date asupra circularitàtii cromozomului ibacteria,n au fost obfinute, prin urmàrirea proc€sului de " conjugare bacterianà. S-a constatat astfel cà în cadrul acestui pnoc€s transfenrl, de gene de Ia celula donor l,a celula receptor se face cu o secvenfialitate precisà qi determinatà în rtimp (Jaeob qi Wollman, 1961). Ulùerior Cainns (1963) aduce dovezi ooncludente electronomicrpsoopice qi autoradiografice care probeaeà, circularitatea, cnomozomului baetrerian. Toate ibacterlile, cu o posibilà excepfie a bacteri ' Psqud,omonos, prezin,tà cromozom circular. Se cunoagte încà putin despre organizarea unor asemenea inele de peste 1000 pm lungime, aflate în celul,e a càror lungime nu depàEeqte l-2 pm. Crom,ozornul ,bacterian pnezin'tà un punct de ataqare pe membrana celularà, iar atagarea aceasta reclamà sintezà proteinúcà. Sînt date dupà cane
83

situl de ,ataryare la membrana celularà corespr:nde unei negiuni dim cromozomul bacterian bogatà în secvenle A-T. De regulà fiecare celulà tbacterianà are un singur cromozom dar fur cazurile cînd replicarea cromozomului nu este urmatà de diviziunea celul,ei pot apare 2-4 cromozomi. Dar aoeqti cromozomi multipli nu aduc o informalie geneticà suplimenúarà, ei reprezentînd copii identice ale crromozomului original. Condifia normalà a celulei bacteriene este haploidia, càci ea prezin,tà un
singur set de determinali ereditani (gene). în ,afara cromozomului circular suportul grupului principal de gene în citoplasma celulei bacteriene se pot efla una sau mai mulùe structuri eneditare adifionale, extracromozom,al€ (separ:ate fizic de cromozomul principal) confilrînd fiecare coa 0,5-2010 din ADN total al oelul,ei, cane au fost numite plasmide. Ele se replicà indepemden,t de cromozomul principal bacterian qi sint moqtenite sta,bil. Ele sînt r,epliconi tipici. Plasmida (termen introdus de Lederberg, fur 1952) reprezi,n'tà o moleculà circularà de ADN ',bicatena'r, mult mai micà 1lo/o) co,mpanativ cu c\ea a cromozomului ibacterian. Plasmida poartà 6-10 geille fiind de f,apt un cromozom bacterian miniatural. 'Ca exemple de plasmide pot fi considerafte factorul de ser (F), Jactorul de rezistm.fd la ontibiotice (R), factorul colícinogeni,c (col), fagti temperafi cum ar fi fagul î,, care în stare de profag, se integre'azà in cnomozomul gazdà tot astfel precum se poate integra qi factorul F. În stare integratà asemenea structuri ,poartà numel,e de episomi. Unele plasmide au fost numiúe conjugoni, datorità proprietàfilor de a se comporta ca factori determinafi ai conjugàrii, fiind tr,ansmisi'bile de la o c'elulà la a'l'ta în procesul oonjugarii. Datorità tra,nsferului de plasmide de la o celulà la ,alta ,ca gi a pierderii spontane a unora dinrtre ele, celula bacterianà se aflà într-o stare permanentà de variabilitate genotipicà asigurîndu-se astfel o mai bunà qi uruanlatà adaptare a acestora la mediul lor de via!à. Datà fiind implicarea plasmidelor în fenomenele de rezisten!à la antibioticre, studiul 1,or a càpàtat un mare impuls în ultimul timp cînd au apàrut tulpini ,bacterie'ne multipiu r,ezisten,te. Dar în prezenú studiul plasmidelor bacteriene este intensificat qi prin ace'ea cà aceste structuri moleculare s-au dovedit a fi excelen{i càràugi ai unor fragmenúe de ADN euoariot, reprezentînd un fe} de ,,cal trnoiams prin care
84

est'e introdus

purtàùor

zizului ADN recombinant.

intr-o celulà bacterianà un fnqgmenú d'e ADN al unei gene eucarioùe. Esúe vor"ba de realiTÀrea aqa-

2.2. ORGANIZABEA EUCARIOTA

Cu exceptia bacteriil,or, aetinomioetelor gi cianobacteriitlor, toate sistemele hiologioe celulare au materia,lul ereditar îndelimitat de pr'oc€nrucleul chis intr-un spafiu genetic sele fuurdameartale ale citoplasmei prin intermediul unei membrane duhlà electronooptic qi prevàzutà cu pori (anuli) prin car,e se realizeazà schimbul reciproc material-informa{ional
nucleu-citoplasmà.

La nivelul nucleului m,aterialul ereditar este organiz,at într-o substan!à numità cromntind.. Aceasta r,eprezintà forma interfazicà a un,or stnrcturi oaracteristice care la eucariotele superioare apar doar îur timpult diviziunii nucleare qi care s-au numit cromnzqrni. Cromatina prezintà douà stàri funclionale alternative qi reversiibile: euqomntinn qi hetqocromnti,na. Eu.b,azici

cromatina prezintà proprietàli de oolorare normale cu color,anfii qi un ciclu de c'ondensane súandard (condeursare în diviziune; deoondensare în inrùerfazà). I;a nivelul r€ucrromartinrei de regulà se aflà secvenle unice d,e ADN. La nivelul eucromatinei ADN se replicà timpuriu, la începutul fazei S. Eucromatina reprezintà partea activà genetic (în rtranseriere) a cnomatin'ei inùerfazice, la nivelul, sàu aflîndu-se c,ea mai mare parte din protefurele nonhistone cane oondifion'eazi func{ionarea materialului ereditar in replicare sau transcriere. Hetenocromatina prezintà un ciclu atipic de condensare (alociclic) reprezentînd cromatina care esúe condensatà qi în interfazà, apàrînd sub formà de cnomooentri. La nivelul sàu replicarea ADN este întîrziatà,. Esúe inactivà în transcrier,e qi suferà sulbreplicare. Heúerocromatina constitutivà, localizatà în regiuni specifioe al,e cromozomilor cuprinde ADN, care prezintà secvenfe repetate de nu,cleo,tide. Prin heterocromatinizarea diferenfiatà a eucromatinei rezultà heùerocrornatina facultativà. Heterpcromatina se c€lor€:azà, în tot timpul cicluluÍ celular din care cauzà se spune cà ea mamifestà heteropimud, pozitivà. Între eucromatinà si heterocromatfurà apar diferenlieri qi la nivelul structurii fizice. Astfel, pe cînd eucromatina are ea
85

elemente ulrtnastructunale pnedominante fibrel,e nucleohistonice de cirea 100 A dia,rretru, la nivelut heterocromotinei ,se af]à fibre nucleohistonice de 250 A, deoareoe aoesúea apar mai coilldensate, mai oonrtractante, de unde qi r'eacfia lor Fzulgen-pozitivà mai in'tensà. Dacà euctomatina cuprinde genetre majore, heterocromatina prezintà mai ales funcfii reglatoare oontrolînd activitatea genelor din eucrpmatinà qi raùa muta{iei, moditicînd specific acliunea unor gene, penetran{a, expresivitatea gi specificitatea 1or. Rolul structural a,l heterocromatinei este legat de stabilizarea structurii centr'omericre qi a capetel'or cromozomului (telomer,e), de împerecherea cr,ornoZomilor în naeiozà, contrplul schimbului reciproc de gene între cr,omozomi omologi (crossing-over). Rolul funclional al heúerocromatinei este legat Si de controlul transportului substaurlelor prin membrana nuclearà ca gi de contnolul diferentierii celul,are. Cel. mai evident rol al heterocromatinei este legat de inactivarea (represia) activitàlii genice în mecanismul compensa{iei de dozà. Se disting trei categorii principale de heterocromatinà: heterocromntínd constitutiud, prezemtà tot timpul qi în toti- nucleii celulelor unui organism fiind looalizatà în regiuni specifice ale cromoz,omilor iar în nucleul interfazic se poaùe aglomera într-o masà cromaticà evidentà numità crornocentru; heúerocromatind facultutiad, legatà de oompensarea dozei de gene la oele douà sexe ale mamiferelor prin care unul, dintre cromozomii de sex X este inactivat genetic prin heterocromatinizar,e, realizîndu-se un echilitbru între genele sexlincate la cele douà s'exe la mamif,ere; heterouomntinn condtensatd, distribuità diferenfiat de la tesut la lesut, apàrînd în cursul maturàrii celulare printr-un proces care hlocheazà,o anUrrrità informa ie geneticà în anumite oelule. Diferiúele úipuri de heterocroma'tinà constitutivà pot fi evidenfi,ate prin metode m,oderne de colorare a cromozomilor metaf,azici in care se produe experimen'tal regiuni d,iferenfiat oolorate sau fluorescenúe care apar sub forma unui model de bandare specific fiecàr''ei specii qi identic pentru cr,omozomii omologi. Sînt douà aategorii majone de m,odele de bearzi: bandnre C eviden{iatà prin eolorare cu Giemsa dupà r:n pretratament specific cu alcalii qi acest m,odel de bandar.e evi86

denfi,azà heterocromatfura oonsúitutivà aflatà de o parte gi de alta a oentromerului; bondure G reprezentind zonele heterocnomatice in'tercalare dispuse deci de-a lungul bralului crornozornului qi care se evidenliazà în urma unui pretratament cu tripsinà (hidroLi'zà sau denatunare enzima'ticà) qi apoi colorare cu Gi'emsa (bamdare G propriu-zisà) cu quinacrinà fluorescentà (benzi Q). Deocamdatà nu existà o explicat,ie cuprinzàtoare a naturii chimic'e a bandàrii cromozomale. Compozifi,a chimicà a cnomatinei, respectiv cnomozomilor eucariotici este reprezentatà în special din ADN qi histone aflate în pr,oporlii apnoximativ egale. Îm plus se mai arflà cantitàti variaúe de proteine nonhistone Ei o micà cantitate de ARN, ca gi lipide, polizaharide Ei ion'i metalici precum Ca+* qi Mg*f , ultimele compo,nente putînd fi eventual cont,ami-

nanfi oelul,ari. ADN cromozomal formeazà componenta esenfialà structuralà qi funcfionalà a cromozomului eucariot. Date reoente deun cnomozom mons,treazà echivalenfa o moleculà de ADN euoariot, stabilindu-se astfel universaùitatea rel,a{iei atît la virusuri gi procariote cît $i la eucari,oúe. La eucariote ADN pnezintà trei tipuri distincte de secven!à: secvenle unicre sau nerepetate, secv'enfe mitlociu repetate qi secvenle înalt repet'ate. Secvent€le mijlociu nepetate sînt secvenfe simple cu lungimea de 100-500 perechi de ibaze care sînt nepeúaúe de 102 pînà la 104 ori ce se furterpun între secvenle unice, nerepetate.

de

Sewenfele înalt repetate sînt secvenfe simple, repetate 106 ori. În urma denaturàrii, ADN cu asemenea secvenle prezinta o vitmà mare de reasociere a monocra,tenelor spne a forma structuri bica'tenare (renaturare) ceea ce nu apare în cazul ADN eu secvenfe unice sau ADN viral qi procariot. ADN re,petitiv se aflà de regulà în regiu,nile heterocr'omatioe dispuse la oapetele cromozomului eucariot (tel,omere) sau în regiunea centromerului. ADN repetitlv este de regulà inactiv transcripfiona,l.

ADN cu secvenfe mijlociu (intermediar) re'petate cuprinde par,te genele ribozom,ale qi pentru ARNú qi oonstituie subsúratnl fizie al arnplificàrii (reitndrii) genice. ADN cu sesvenfe unice, nerepetitiv, cuprinde informafia geneticà pentnt slnteza di,feritelor proteine celulare.

ln

8T

Cantitatea de ADN repetitiv variazà de la 20 la 800/o dfu.r totalul ADN. La unele specii secvenfele înalt repetate sînt reprezentaùe de 6-13 perechi de baze gi în acest caz prin ultracentrifugare în gradient de CsCl sau sucrozà asemenea fracfiune de ADN îna,lit repetitiv se separà ca o bandà aparte de frac{iunea principalà de ADN, formînd oeea ce se numegte ADN satelit. Genomul eucariot apare ca un genrorr d,e tip intuspers în care secvenfele unice alterneazà, cu secvenle înalt sau mijl'ociu
repetate.

nuclear poa'te codifica proteine. La Drosofila, pe baza unor ana:lize genetioe qi biochimice exacte s-a estimat un numàr minim de 5-10 000 de gene structurale. La animale toate lesuturile pr,ezintà un set comun de gene funclional.e de ,,întnefinere( d,e citeva mii de tipuri diferite pe lîngà a,lte cîteva mii sau multe rnii de gene ,active ce f un clion eazà, dif erenfiat. La plante numàrul de gene active este estimat de la 3-4000 la drojdie la 13-14 000 Ia pàtrunjel 9i orz, pînà la 27 000 la tutun. Asemerrea date au o valoar,e pur orientativà.
2.2

ADN mirjlociu nepetitiv codificà informalia pentru sinteza ARNr, ARNú, ARN 5S qi histonelor, dar funcfia ADN înalt repetitiv nu este pe deplin erxplicatà. Se admite cà acesta ar reprezenta o încàrcàturà excesivà a genomului, 'un rbalast evolutiv, dar mai ales ar interveni în reglarea diferitelor funclii genetice, în conservarea formei cnomozomilor, ar servi în spafierea genelor, ca dealtfel $i în crearea de noi gene. ADN repetitiv diferà de restul ADN prin conlinutul sàu mai mare în G -p C sau mai mare în A + T. Organismele eucariote superioare, ptrante gi animale conlin în genomii lor o cantitate de ADN suficientà spre a codifica mai mult de 1 000 000 de proteine diferiúe. Dar sînt date co{rrvergente spr€ concluzia cà mumai o parte din între,gul genom

I.

ORGAN IZAREA GEN ELO R EU CARIOT E

Dezvoltarea tehnologiei ADN reconxbÍnanú care a permis cloîn oeluil.a 'bac,ùerianà a drrs la aprofuardarea cunoEtinlelor privind organizarea genel,or euoario'te. Pe aceastà cale s-a stabilit cà genele eucanio'te au o structurà mozatcatà, în care secvenfele lor oodificato,are respectiv regiunile
narea de gene eucariote
8B

care vor fi în final tr,aduse î:r secvente de arninoacizi nu sînt continui ci sînú intrerupte de secvente de inserfie sau de intercalare netraduse, numite cu un termen general ADN silenfios. Cel mai bine studiat caz de organizare a unei gene eucarioùe care se încadreazà, îur aces,t tip este gena pentru ovalhuminà, o proteinà din albuEul de ou. În acest caz, s€cventa genicà codificatoare a secvenlei de aminoacizi din ovalhuminà este sepanatà de 7 regiuni neaodifica'toane de lungimi vaniabile interpuse în oadrul secvenlei oodifieaú,oare gi separînd-o pe aceasta în mai mulùe segmemte. Secvenga codificatoare de baze car,e va fi exprimatà, deci tradusà în secvenfa de aminoacizi este deei divizatà in regimni care au fost numite de càtre Gilbert (1978) ertroni, sau eÍùni pe cîn'd regiunile interpuse, neoodificatoane, transcrise în ARNm dar netraduse în proteinà s-au numit introni. Asemenea organizare genicà a fost eviden$atà Ei la alte geme precum: gene pentru ARNú de Ia drojdie, gene pentru histone, gene pentru ARNr de la drosofilà, gena gnobinei de iepure Ei Eoareee, genele imunoglobulinei Ei genele mitocondriale de la drojdie. Se pare cà asemenea organizare este cvasiubicvitarà Ia' eucariote. Gena F-globinei de la goarece prezintà douà inserfii, una de 116 Ei alta de 642 perechi de baze. Gena B-globinei de iepure pnezintà 'o ,organiz,ate asemànàúoare cu ac€ea de Ia gena F-Slobinei de goarece cu excepfia secvenlelor d'e inserfie care prezintà'o puternicà divergen!à evolutivà. În cazul genelor pentru hemoglobinà qi ovalbuminà intronii cuprfnd secvenle unice sau de pufine ori r,epetate, genele structunale fiind repr,ezentate ca regulà de secvenle unice, n,erepetate de ADN. În cazuL geurelor hemogl'obinei s-a demonstrat 'transcrierea intnom.ilor în ARNnz precursor (pre-ARNm) sau ARN heterogen (hnAP.N) care va fi supus pnelucràrilor posttranscriplionale spre a d,a naEùere ARNrzl mntur cel care va fi:ncfiona ca mesager în sinteza proteinei. În cadrul ARNrn matur qi fun,cfional în traducere nu mai apar secvenfele intronice, ceea oe îmseamnà cà ele sînt excizate ùr oadrul prelucràrii pre-ARNnz. Preluerarea posttranscripfi'onalà a We-AP"Nne se re'alizeazà surb acfiunea unor enzime specifi,o€, de tipul RN-azei P. ,care taie, excizeaza intronii qi apoi, atrùe enzirne, 'posúbil de tipul ligazei ARN numite de alùoire, lipesc extronii spre a genera ARNnz mahr (Herdeld gi Kiper, 1.979). În cadruL prelucràrilor posttranscripfionale al,e preARNrn intrà Ei poliadeniL,anea sa la capàtul 3' gi mod'ificarea
B9


€ronr
AON jntroni
L

t2

Geno

ovolbum in ei

3/.5
3,

c0E
5.--

FFe ARNm.

I
3'

g6o,enp

rièrl

?m Gppp

oosttron*notio- -VrX
thatri

t)oúodcritoreo to Y! ; t(t .31 nEtilorco aoniloq 'bl.tlotco.crcizb intronibt C sudoreo exonilor) ciftelc hdrcó trrnimeo eronilor 11-7; +i o irrroóto? (A 6) h nunib alc n$Fotide

o Pra.lnlm Y/7Dn

lw t

W
trzz?
UAA
Tc|minorcg

r8z

tîo(hrctr

tíg.

33. OtgqnlTassa genel ovalbuminei.

chimicà posttrarnscripfio,nalà a nucleotidelor prin metilare suib actiunea unor enzime specifice metilaze. Aoeastà metilare se ad'mite cà are ,loc la nivelul exonitor care astfel dervin rezis'tenti la acfi,unea enzimelor exonucleazioe. Eorzimele de clivare ,actioneazà asupra secvenfelor intronice cu,re nu au suferit metil.area qi asffe1 au ràmas sensibile Ia enzimele de clivare. Se neraliz,eazà, apoi trnirea segme'ntelor exo{rice sub actiunea unor enzime specifice de 'legare sau altoire (splicing). Modelul acesta (Fig. 33) admite cà regiunile codificatoare din pne-ARN care vor de* rleni adiacente în cadr,ul ARNnz vor fi aduse în nemijlocità cronti,guitate prin ibuclarea secvenf elor intronice. Regiunile exo nice eontigui vor fi u,nite ,covalent, printr-o reacfie de ligare
90

nilor Ei unirea exonilor din pnecursonrl ARNm (pne-anNm) o oa'tegorie de molecule mici, discrete, stajbile de ARN mic nucl"eor (snRNA) a càror lungime variazà între 90 qi 220 nucleotide. Acest ARN nuclear mic este asociat cu proteine formînd partibule mucleare mici ribonucleopnoùeinlioe (snRNP). Pe bciza observafiil'or cà secvenfa de nucleotide de Ia capatul 5' al unei ss€ilreo€e categorii de sn RNA prezintà complementaritate cu joncliunile introni-exoni de la diferite tipuri de ARNnz pentru insulinà de qo,bolan (5' Exon CAGGUAUGU + Intron
CUACUUCCAGG Exon 3') catena ò2 a imunoglobulinei, catena B de gl,obinà de Soarec€, ovalbumina de gàinà gi firbroina firului d,e màùase de la Bmnbyr, aoeqti oeroetàbor,i ,au impl,icat snRNA în excizia intnonilor qi unirea exonilor spre a forma ARNnr mntu,r, În ultimut timp se conferà intronilor anumite roluri funcfionalre în prelucràrile pne-ARNnz. S-a stabilit cà gena miúooonflrialà pentru citocrpmul b de Ia drojdie are Ei ea o structurà rnozaicatà cu exoni qi introni. Mutafia poate afecta a'tît regitrnea exonicà cît Ei cea intronicà, ,evidenfiindu-se peste 200 muta'nte care au afectatà gena ci,tocromului b. Mutafia atît la nivelul intronilor cît Si la nivelul exonilor duce la alterarea structurii gi fun$iei citocromului b. Dacà nntr-o experien{à de compl'ementa$ie geneticà participà la încruci,$are o tulpinà A cu mutalia la nivelul exonului qi o tulpinà B cu ,rnutafia la nivelul intr,onului (ambele tulpini incapabile de a simtetiza citocnom b qi de a fermenta gluooza) la nivelul zigotului apare oomplementalia Ei se realizeazà, sinteza citocromului b func{ional. Slonimski a demonstrat cà exonii n,ormali furnizali de celula de tip B cu mutalie intronicà servesc la si,nteza citrocromului b în zigot iar intronii normali furniza{i de c,elula tip A, cu mutalie exonicà, furnizmzà informafia geneticà neoesarà alipirii exonilor în ARNrn matur. S-a stabilit astfel, fàrà echivoc funcfia intronilor în lipirea exonilor. Echipa lui Slonimski considerà cà intronii servesc ca un ,,model de asamblare( spre a permirte enzimei (enzimelor) de clivare qi unire sà realizeze excizia intromilor Ei legarea exoni1or. O porfiune din intr,on oferà o secvenfà-ghid care formeazà cu alte elemente oomptrementare din pre-ARNrn o structurà tranzitorie capabilà de a menfine adiacente extremitàfile exo91

l,ntracateararà. Bruclarea reglunilor intronioe, excizia lor qi ligar'ea ul.terioarà a regiunilor extronice apar oa rezultat al interproteine. acfiunilor compl,exe acid nucleic gi colab. (1980) au implicat în excizia introFl,eoent, Lerner

urilor alàturafi. Ori, mutafia la nivelul intnonilor îm,piedicà formarea de asemenea structuri rtranzittorii. Este positbiil oa smvenfa ghid sà fie oferità de acele molecule mici de sn, RNA despre care s-a vorbirt mai înafurte. Existà Ei ipoteza cà intronii codificà ,,proteimele mesagere(, diferite de cele codificate de exoni. Aceste proteine au fost tbotezaúe ,,ARN-motltrazeK. Se admite cà primul intron furmizeaz.à o proteinà de alipire, ARN-matutaza, pe cînd ceilalli furnizeazà ,,secven{ele-ghid66 ale ARN. Proteinele mesagere sau proteinele-m ar avea o secvenfà de amino'acizi care la un capàt numit globul eronic este hidnofilà, iar la celàlalt capàú, coresprmzînd la intron, este hidroftrbà, prinzîndu-se de anvelopa nuclearà, Iàsînd capàtul hidrofil (g1obu1 exonic) liber. În procesul de traducere a mesajului, rihozomul se ,asocia,zà cu exonul nr. 1 din ARNrn qi îmcepe sà se formeze o catemà polipeptidicà identicà la un, capàt cu globul'ul exonic al proteinei-rn. Aceasta porfiune a proteinei-nz ar servi în inúlierea ea,tenelor identice polipeptidice sintetizate pe ribozom prin traducerea aceleiaqi molecule de ARNnz. Se mai admite cà anvelopa nucleara confime enzimele necesare prelucràrii pre-ARNrn, ma,i ales cele necesare exciziei intronilor Ei alipirii exonil,or în ARNnn martur care va fi trecut în ciùoplasma. Aceste ipoteze nu se exclud gi mai degrabà se completeazà. Este de relilrut cà aceastà structurà mozaicatà a genelor eucariote este specificà lor qi este legatà de separarea celor douà proc€se esenfiale ale decodificàrii informaliei €reditare, transcrierea Ei traducerea în spalii diferite, primul în nucleul, al doilea 1n ci'toplasmà. Trec,erea mesagerului prin mernbrana nuclearà este obligaúorie qi aceastà trecere se dovedeEte a fi un proces foarte complex. R,eoent s-a constatat cà gena insulinei umane conline douà secvenf,e de interealare, una în cadrul regiunii transcrise Într-un segment netradus 5' al ARNzn qi alta care întrerupe regiunea codi'ficatoare C-peptidicà (Bell Ei colab. 1980). Compararea genelor insulinei urnane Si de $oarece araúà existenla de regiuni potenfial reglatoare în cadrul segmentului de ADN ce precede gena sugerîrrd cà forma ancestralà a genei insulinei a avut douà secven{e de intercalare. Dealtfel, la mamifere s-au descris douà tipuri de organizare a genei pentru insulinà: g,ena pentru insulinà la om qi qobolan II prezintà douà secvenle interpuse pe cînd gena de qobolaqr I are o singurà secven!à interpusà. Semnifica{ia acestei organízàn a genelor eucariote este deosebità. Se admite cà prezen$a secvenfelor interpuse (introni)
92

a putut accelera evolutia càci a perrnrs construlrea de noi proteine din segmente ale genelor deja existente (Eaton, 1980). Potrivit acesùei ipoùeze, secautlele codificatoare (eroni) cor,espumd pàrlilor func{ionale ale proúeinei. Trebuie precizat cà la procariote ADN necodificatnr (silenfio's) nu apare în interiorul genei ca la eucariote, ci între gene. ADN al cromozomilor eucariotici este replicat semiconservativ qi bidirecliona\ fiecare cromozom avînd numeroase unitàfi de replicane (cca 2-10 X 104 pe eelulà), care sînt aranjate în tandem eare funclioneazà asincrpn gi a càror lungime vaúarà între 20 Ei 70 pm. Replicarea ADN cromozomal se desfàEoarà mult mai îarcet decît a ADN bacterian avînd o vitezà de 0,52,0 pm/minut, fa!à de 30 pm/minut cît este la bacterii. FteplÍcarea ADN eucariotic neeesità sintezà proteinicà simultanà.

Membrana nuclearà joacà un rol important în inifierea Ei desfàgurarea replicàrii. Asociat cu ADN cromozomal qi interacfionînd cu grupele fosfat ale acestuia prin forfe ionice qi electrosta'tice se aflà proteinele cromozomale histonice care au caracter bazic prin care sînt neutra,lizate grupele acide fosfat. La eucariote existà o cerin!à strictà ca ADN nou sintetiza,t sà se asocieze cu histonele astfel încît sà formeze complexe urucleohistonice. Acest fapt este demonstrat de intima asociere a sintezei ADN qi a histonelor în aceeaEi fazà S a cicluiui ce-

cromatina constitutivà centromericà, este bogat

ADN ce se replicà timpuriu este relativ boga,t în G + C pe cînd cel care se replicà tîrziu, de ,obicei fiind localiza,t în hetero-

în

A

+î.

lular. Histonele nou sintetizate se ooncentreazà în vederea asocierii cu ADN nou sintetizat în imediata veciinàtate a bifurca-

Histonele joacà pe de o parte rol structural în menlinerea Ei controlul conformafiei cromozomului eucariot în ciclul celular, în spiralizarea qi condensaxea cromatinei, iar pe de a,lta în reglanea,genicà grosierà care duce Ia diferenlierea de modele de represie genicà cu specificitate de,lesut în timpul dezvoltàrii. Histonele aclioneazà astfel ca r€pr€s,orii generalizafi ai actività{ii ge'nice càci, condilionînd condensarea cromatinei Ei superspiralizarea ADN, determinà inhibifia stericà a transcrierii în aceastà stare cond,ensatà ADN neputînd funcfiona ca maúri!à
93

liei de replicare

I
în transcriere, numai cr,omatina difuzé prezentînd
,o intensà

activitate de matrifa. Au fost descrise 5 tipuri de histonà simbolizate Hr Hza, Hzb, H3 Ei Htt. Dupà oompozifia în aminoacizi se deosebesc histone rbogate în argininà (HB fi H4), hisùone bogate în lizinà (Hr gi Hzb) gi histone cu confinut aproxima'tiv egal de argininà Ei lizinà (Hza). În structura cromatinel aceste fracliuni histonice, cu exceptia H1 intrà în cantitàli echimolar,e. Studiile de secvenliere fl aoestor fracliuni histonice au evidenfiat lipsa unei specificitàti de lesut a I'or dar mai ales înaltul conservatism aI secvenlei lor cu exceplia francfiunii HL car€ prezintà o mai mare variabilitate. S-a realír*r't o im,agfure simplistà în ceea ce priveEte conservatismul sewenfei hisúonelor miezului nucleozomic H*, Hzb, Hs gi H4. Astàzi s-a neurunfat la ideea cà aceste francfiuni histonice sînt înalt conservate (Isen'berg, 1979). În cadrul fiecareia dintre cele ciurci clase de histone Ht, Hza, Hzb, Hs 9i Ha secvenfa de aminoacizi poate prezenta anumite varia{ii. Exlstà deci subtipuri ale aoestor clase hist'onice, fie în embriogenezà, fie în timpul maturàrii unor oelule specializ,ate. Variabilitatea histonei H1 se datoreqte modificàrilor pos,ttraducàùoane. Variabilita'tea celorl'alte clase de histone se baz,eazà. pe divergente evolutive semnificative. În cadrul unei clase particulare de histonà existà suibtipuri care au struc'turi primare diferite. Histona Hzb reprezintà un hibrid ,evolutiv càci la ,aoeasta cca prima treime a moleculei este varialbilà, restul fiind foarte puternic conservatà. Hisùona Hs de la vitel Ei plante prezintà divergenle de secven!à fa!à de H3 de la Tetrahymenn gi drojdie. Ha de la vifel diverge fa{à de Ha de L'a Tetrah'gmena. Aoeste divergenle sînt insà mul't mai mici oomparativ cu cele ale altor proteine, astf,el cà histonele H3 Qi Ht, trebuie încà sà fie oonsiderate ca proteine înalt conservate. Histonele H3 qi Ha au pantea,bazicà amino qi partea globularà carboxil. Pr,esiunea selectivà a conservat regiunea globularà, în parte din necesitatea inúeracliunii hisúomà-histonà, aceste imteracfiuni avînd I'oc între regiuni globulare. Nu se cunoaqt'e de ce ,8u fost conservate qi pàrfile bazice. Este posibit ca aceste pàr{i baziee sà fi fost oonservate în vederea staloilirii interacliunii cu ADN car€ aPBr€

La Sacchnrom,gces ce/rwisiae se aflà patru clase de histone dar nu se gtie dacà este qi histona H1. Mai mult, histonele H2o H2b qi H3 de la aceastà drojdie se deoseb,esc de clasele cor,espondente de histone de la plante Ei animale. H3 de drojdie de
94

ca substan!à acidà.

exemplu preziartà o mai mare mobilitate pe geluri de aciduree Ei nu posedà nici cisteinà gi nici metioninà. Micronucleii de Tetrahgmena au numai clasele histonice Hya, H2b gi Ha, fiind lipsite aparent de histonele H3 gi Hr. În cromatina ciupercilor se aflà histone care se deose,besc fa!à de cele de la alte euoariote, eritrociúele nucleate de pàsàri confin o singurà fracfiune histonicà desemnatà F2C i'ar în spermatnznizi celule foarte specializate care nu sintetizeazà. ARN sau proteine locul histonelor este luat de protamine (proteine foarte ,bogate în arginiarà). Rolul histonelor în represia genicà generalà este demonstrat chiar Ei prin acest caz al eritrocitelor nucleate de pàsàri, al càror nucleu este nefunclional, ADN-uI sàu fiind represat prin interacliunea cu histona FzC sau H5. Mamiferele au ales o altà alternativà evolutivà a acestei represii enuclearea eritrocitului matur. Histonele sint supuse unor modificàri posttraductoare (postsirr,tezà) qi anume metilare, acetilare qi fosforilare. Prin acetilarea resturilor aminoacilice din histonà este reglatà interac{iunea histonelor cu ADN, permifînd funclionarea acestuia ca maúrità în transcriere. Alte modificàri sfurt implicate în realizarea complexelor nucleohisùonice dintre ADN nou sintetizat, gi histonrele nou sintetizate sau în modificarea spiralizàrii cromozomale, ea qi în alte feuromene (schimbàri în activitatea cromozomalà în tfunpul ciclului celular sau diferenfierii, menlinerea conforrnafiei corecte a histonelor fata de ADN). Fosforilarea H1 în special a fost implicatà în condensarea cromozomilor, Schinrbàrile în organizarea structuralà a cromatinei sînt necesare peu:tru progresarea eiclului cromozomal (eondensare-decondensare) Ei se crede cà sînt reglate î:r special prin modificarea proteinelor cromozomaJ.e precum fosforilarea, acetilarea, metilarea Ei poli (ADP-rihozil)-area. Fosforilarea histonei H1 este se pare cel mai important factor care regleazà condensarea cromozomalà (Matsumoto qi colab., 1980). Forma fosforilatà a H1 este deci implicatà în inifierea condensàriii cro'mozomale. Activitatea H1 fosforilate este strîns corelatà cu activitatea mitoticà ,a celulelor iar fosfokinazo histonei H1 este imptícatà în ini{ierea mitozei. Rolul specific al'variatelortipuri de histone în structura qi funclia crornatinei este încà neprecis stabilit. O modificare a Hxo sub forma de A2a apane a fi preferenlial localizatà în regiuni inactive ale gmomului. S-a mai descris Ei metil'area Ei rirbozilarea histonelor, fàrà a se cunoaEte semnificalia acestor modificàri.
95

Genele pentru diferitele fracfiuni histonice sînt prezente în mai mulrte cupii per genom gi rele pot fi dispuse fur úandem pe acelaqi segment ADN. Repetivitatea genelor pentru histone este :erutà de necesitatea unei sinteze bogate de histone într-un interval scurt de timp ce corespunde fazei S cînd ane loc gi sinteza ADN. Histonele sînt sintetizate în citoplasmà qi apoi traarsferate în nucleu. Cînd este blocatà sinteza proteinicà d,ar nu qi a ADN, histonele parentale se leagà numai la wrul dintre duplexurile fiice. Sinúeza histonelor este intim asociata cu sinteza ADN. Cînd sinteza ADN este ,blocatà, sinteza histonelor soade rapid, deoar,eoe poliribozomii mici asoeiafi cu ARNn pentru histone, satre este de tip 7 S-g S, sî:rt preferenlial dezorganizagi. Numai histona H5 din eritrocitele de pàsàri nu se sintetizeazà coordona,t cu sinteza ADN. Ea este sintetizatà în ti,mpul maturarii eritrocitelor, proba'bil spre a bloca majoritatea genelor nucl,eare, làsînd funcfionale doar cîteva, in spetà genele hemoglobiurei aviar.e. Cea mai importantà canacteristicà a genelor pentru histone este gruparea lor sùfnsà, lincajul strîns dintre genele ce dirijeazà sinteza tipurilor de histonà (Kedes, 1979). Cele mai intens studiate sînt genele histonice de la drosofilà, dar mai ales de la ariciul de mare. Ele au fost clonate în celula bacterianà prin tehmica ADN recombinant. Genele penrru histone s-au d,ovedit cà, pe lîngà lincajul l,or în tandem în ordinea H4, Hs, H2a, Hzb, Hr, ele sînt repetitive, printre singurele gene codificat,osr,e de proteine care sînt repetitive. Regiunile codificatoare ale gemelor histonice sînt interdigitate cu secvenle spa,tiartoa,ne necodificat'o,arne. Prin hlbridare ARNnz histone (9 S) cu ADN de arici de mare, s-à aràtat cà genele pentru histone sînt reiter,ate de cîteva su'te de ,ori în genomul de arici de mare. S,ecvenfe).e codificatoare sînt bogate în per,echi GC, pe cînd secvenlele spafia'toare sînt bogate în perechi AT. Secvenlele codificatoar,e pentru hisùone r,eprezintà 0,20/o din ADN úotal d,e arici de mare, pe cînd secvenfele spafiatoare reprezintà 0,50/o din gen,omul haploid. La numeroase specii de arici de m'are s-a reugit alcàtuir.ea hàrfilor unitàlilor de repetilie a genelor pentru histone. S-a demonstrat pàstrarea topologiei (loca1izàrii gi iungimii) regiunilor spafiaùoare. La Drosophi,la melanogw,ster, genele pentru histoure se carteazà în regiunea 39 D-E din braful stîng al cromozomului 2. ARNnr. pentru histon,e de arici de mare, marcat radioactiv, hirbrideazà în aceeaqi regiune. La oh, genele pentru histon,e au fost cartate pe cromozomul 7, banda negativà G1 q 34.
96

Genele pentru hlstone de
sofi1à.

dif,erirtà de aceea a genelor hisrtonelor de

la drojdie au o organizare cel'a

arici de m'are gi dro-

În afara histonelor, în structura cromaúinei mai intrà gi pro., teinele nonhistone numite tncà hqtone, inoorect numite proteine acide deoarece punctul izoelectric al lor variazà din zona acidà pînà în zoma bazicà. Ele reprezintà enzime ale metabolismului cromozomal cum ar fi ADN polimeraza, AII,N polimero,za, NAD sintetnza, nucleosidtrifosfateza, apoi diverse alte proteine cu-caracter acid precum molecule proteinice implicate în activita0ea genieà, activatori qi represori ca gi alte proteine cromozomale. Proteinele nonhistoniee sînt sintetizate în citoplasmà Ei apoi transferate în mucleu. Ele sînt foarte variabile, heterogene, atît ca structurà cît gi ca funcfiune, preze,ntînd o vrfiezà mult mai mare de sintezà $i de degradare (turnovt) comparativ cu histonele. Greutatea lor molecul,arà variazà între 10.003 qi peste 150.000 de daltoni pe cînd a histonelor este circumscrisà în limitele a 10.000-20.000 dalto,ni. Proteinele nonhistonic,e se caracùerizeazà, prin specificita,te de lesut gi specificitate de speci'e. Aceste proteine sînt implicate în reglajul fin aI activitàlii genice, din intenacfiunea lor cu histonele rezultà derepresia unei gene date qi transcrierea pe s,egmentul corespunzàtor din ADN. Ele pot ileteracliona nu numai cu histonele dar gi cu ADN Ei ARN. Zonele din genom active în transcriere sînt mul't mai ,bogate în pnoteine nonhistone clecît cele inactive în tramscriere. Aoel,agi lucru este valabil pentru celule Ei lesuturile tn care au loc sinteze active gi care prezintà o cantitate mai mare de proúeine nonhis'tonice. În reglarea transcrierii gemice un ro1 important ît foacà fosforilarea pnoteinelor nonhistonice. Prin aceastà modificare a proteirnelor nonhistonice histonele pot fi scoase din complexele nucleohistonice ale unui segment dat din genom, làsînd posibilitatea ca gena saru genele din acea regitr,ne sà fie transcrise
Definàtori ai informa{iei ereditare, cromozomii sînt în numàr, màrime Ei f,ormà caracteristici fiecàrei specii. Totalitatsa cromozomilor unei celule formeazà oomplementul sàu crpmozomal numit încà genaffu Numàrul de cromozomi al oricàrei celule somatice la indivizii ce se reproduc pe cale sexuatà este dublu (dipl,oid) fa!à de complementul crom,ozomal' al eelulelor reproEi deci sà func{ioneze.

ducàtoare (gamefi). La microscopul optic crom'ozomii apar ca structuri sferice sau baghetiforme, cu dimensiune variabilà între 1 qi 30 pm.
/ - Descifrînd tainele ereditàfii, vol.
I

97

ce rezultà. Cromozomii omologi au aceea.gi structurà qi funclie (poartà acel'eagi g€{ne, aceea;i informafie 'ereditarà). Omul are de exemplu în gernitura diploidà a tuturor celulelor somatice cîte 46 de cromozomi, dintre care 23 de provenien!à maternà qi 23 de provenienfà paternà. Aranjamentul cromozomilor, prin dispunerea lor ordonatà în per,echi de cromozomi, considerînd numàrul, forma, màrimea qi orice altà caracteristicà specificà complementuL cromozomal al u,nei specii sau linii celulare duce la ob{inerea cariotipului acelei specii sau linii celulare. Cariotipul uman a fost stabilit în anul 1956 de càtre Tjio qi Levan, a fost standandizat prin conferinlele de la Denver, Londna qi Chicago gi definitivat ulterior, pe baza studiului rn'odelelor de ,bandare (colorare diferenfiatà a cromozomilor) la Conf,erinta de la Paris din anul t971. Metodele de 'bandare au permis nu numai identificarea exactà a omologilor din cadrul fiecàrei perechi de cromozomi, care se poate face cu o anumità dozà, de relativitate datorità subiectivismului cercetatorului qi prin metodele clasice dar, pe baza oomparàrii modelului de benzi al omologului matern qi al omologului de origine paternà, s-€u putut stabili rnodificàrile exacte, structurale, ale cromozomilor, modificàri' care au stat la ,baza evoluliei cariotipului ce a însofit evolulia speciei sau stau la ba,za diferitelor maladii numeric Ei mai ales structuralcromozomale. În cadrul fi'ecàrei perechi de cromozorni, modelul de benzi trebuie sà fie identic la cei doi omologi în condilii normale. Cari.otipul uman este a1càtuit din 22 perechi de autuzomi (cromozomi identici la ambele sexe) gi o pereche de cromozomi de ser sau heterozonti, identici sau omologi la fem,eie (XX) qi ureidentici, neomologi, nepurtînd aceleagi gene 1a ibàrbat (XY). Cromozomii dirr per,echile 13, L4, 75,21 Ei 22 sînt crom'ozomi organizatori nucleolo,ri (NO) din care cauzÀ, sînt afirmafii dupà care la origiu:e, specia umanà ar fi un pemtaploid. Maimulele
98

La organismele c€ se r.'eproduc pe cale sexuatà în cornplernentul cr.omoznmal cromozomii se a'flà sub formà de pereche, fiind doi cîte doi omologi, la mivelul fiecàrei perechi un cromozom fiind de origiare paternà (adus de spermatozoid în timpul fecundàrii, la formarea zigotului) iar aiúul fiind de origine maternà (adus de ovul la nivelul zigotului). Din unirea garniturilor haploide ale garnefil.or î:r procesul fecundàrii se reface în zrgot o garniturà diploidà oare prin diviziunile mitotice *succ€sive ale acestuia va fi transmisà fiecàrei celule a organismu-

lui

drrtnopoide au un cariotip asernànàùor oarecum oelui uman. Cimpanzeul, cel mai apropiat de om are 48 de crpmozomi Ei se admite cà dintr-o specie oomunà au putuú deri;va specia umanà qi primatele prin remanieri numerie qi structural cromozomale de tip fu,ziune-fisiune csntricd sau qrrcuploidii. Prezenla unui crornozom suplimentar în perechea 21 condilioneazà un sindrom foarte grav a:1, tri.somiei 2t sav rrlùngolisntul. Aproape toate anomaliile numerice care af'ecteazà cromczomii sînt corelate cu aparilia de grave sindroame cu defecte fizice gi psihice.$i aber,a{iile structural eromozomale sînt extrem de grave. Delelia parlialà a bra{ului seurt al cromozomului din perechea a 5-a condilioneazà, sindromul cri-Cu-chat (tipàtul pisieii) cu înapoiere mintalà a copilului Ei moarte prematurà. În leucemie este de asemenea implicatà o translocalie între cromozomii I Ei 22. Studiul cari,otipului este deci de interes major atît la plante cît Ei la animale incluzînd omul. La porumb existà o garniturà dipl,oidà de 20 cromozomi care alcàtuiesc 10 pereehi. Deci îri fiecare celuià se aflà douà seturi identice de crornozomi. Crcinozomii de la nivelul unui set sînt însà neomologi, sînt diferili ca m,orfologie qi dim,ensiune, puntînd Ei gene diferite. La'organismele diploide informalia ereditarà apare astftì tedundantd. Crganizarea multicr,omozomalà a genomuluir eucariot este rerutà gi de particularitàlile realizàrii reeomhinàrii genetice la eucariote cu implicafii în oonferirea unei mai mari flexibi,litàti evolutive. Cromozomul eucariot prezintà douà unitàfi structural,e longitudinale care au fost numite cnomntide, libere pe toatà lungimea crornozomului cu excepfia unei. regiuní care s-& numit cons'tric,tie primnrd I,a nivelul càreia este loc,alizat centro,m'qul, o zonà. specializatà a cromozormului pentm atagarea sa la fibrele fusului de diviziune. Reginrnea centromericà constà din nurneroas'e fibne cromatice, aqezate laturà pe laturà, ce pot treoe de la un bra! la ,altul croma'tidei (fibre intercromatidice). Morfol'ogia cromozomului eucariot este determfuratà de plasar,ea constricliei primare de-a lungul acestuia. Astfel, cromozomul este m.etacent-ric, pnezentind douà brafe egale cî,nd oentnomerul este localizat în pozifie medianà. Cînd centromerul este plasat în afara regiunii mediane apar douà 'brafe cromozom,ale in,egale Ei cromozomul se numeqte suAmatrcentric. Cînd centromerul se aflà deplasat spre un crapàt al cnomozomului apar douà ,brate inegale dintre care unul foarte lung gi altul
99

foarte scurt, izodiarnetric gi cromozomuL se numeqte subtelocentric. În sfîrgit, aùunci ,cînd centromerul se af1à pe capàtul crom,ozomului, deci terminal, existà un singulbra! cromozorqlal

La nivelul cromatidei au fosi descrise filamente spirale, reciproc încolàcite care s-au numit cronl,o'trem,e qi care prezirrtà din I'oc în 1'oc îngrogàri care s-au numit cromomere. Cromomer,ele conf'erà cromonemei un aspect moniiiforrn foarte evident în tirnpul profazei din mitozà, dar mai ales din meiozà, ar,anjamentul qi numàrul cromomerelor fiind o caracteristicà
de specie.

Ei cromozomul se numeEte telocentric.

Structura bicromatidicà a cromozomului eucariot metafazic este caracteristicà perioadei cuprinse între aparilia cromozomilor la debutul, diviziunii nucleare gi sfîrEitul metafazei. La nivelul fiecàrei cromatide-surori din cromozomuL m,et,af.azic se aflà cîte un du'blu-helix ADN. Monomemia sau uninemin cromozomului eucari'ot a fost dovedità pentru prima datà autoradiogra,fic în 1957 de càtre Taylor gi colaib. (1957) Ei apoi prin cercetàri rbiochimice pe ADN din cromozomii de drosofilà de càtre Kavenoff qi colrab. (1973). AceeaEi uninemie apare în cromozomul anafazic echivalent de fapt cu o cromatidà a cromozomului metaf.azíc. Ipo'teza unin'erniei cromozomu'lui eucariot este susflnutà de dovezi ,biochimice, ultrastructurale si genetice. Recent, Okada Ei Comings (1979) au evidenliat la nivelul cromozomilor metaf azícl de hamster chinezesc tratali cu acetat de arnoniu 4M qL întinqi pe s,uprafa{a apei distilate, existenfa unei organizàri de un ordin mai în,alt a ADN, care în urma unui asenrenea tratameurt este eliberat sub forma unor serii regulate de rozete conectate de porliuni liniane de ADN numite interrozete. Lungimea medie a regiunii în care moiecula ADN capàtà oonfiguralia de r,ozetà este de 14 pm care este apropi,atà de lungimea medie de 10 Fm a ADN cromomeric din cromozomii politenici de drosofilà. Segmentul interrozetà are o iungime medie de 4,2 pm. Proteinele matrixului nuclear nehistonice care includ qi cantitàli semnifica'tive de octind qi tubulind sînt iemplicate în formarea rozetelor. C'ea mai lungà piesà de ADN descrisà în nucieii eelulelor umane are 22.0A0 1rm. Tayl'or Ei Hozier (1976) au stabiiit cà unitatea de replicare la celulel'e ovariene de hamster chinezesc este de 4 [m lungime, ceea ce implicà cca 550.000 situri de iniliere în nucleul diploid (2.200 000 um : 4 Fm). Complementul uman diploid con{ine 6,9 X 10-12 gm de ADN. Împàrlind aceastà valoare cu 3,L4X10rs gm/prm de dubiu heiix ADN se
100

calculeazà 2,2 metri (2.2A0.000 pm) de ADN per nucieu ciipì,oid uman (Bahr, 7977). Caracteristic pentru eucariotele evoluate este existenla unui ciclu cromozomal numit ciclul condensdrii Ei decondewórii qornozorrnllui. Cromonemele sau cr,omonemata cel.e douà fibrile longitudinale ale cromozomului euoariot - prezintà proprietatea de a se spiraliza mai mutrt sau mai pulin (spiralizare eromozomalà) ceea ce determinà varialii în forma cromozomilor în timputr ciclului celular. Spiralizar,ea cromonemelor este însolità de condensar.ea cromozomului, procesul a,tingîncl maximum în metafazà cînd cromozomul prezintà cea mai constantà morfologie. În timpul diviziunii cromozomul apare sub forrna sa transportoare, formà cerutà de o repartizare echilibratà a informa{iei ereditare în celulele fiice. Dupà realizarea acestei repartizàri care are loc în anafazà gi desàvîrEità în telof,azà cromozomul trece de la forma transprortoare la forma sa funcfionalà în cadrul nucleului interfazic. În forma funclionalà cromozomul atinge gradul maxim de spiralizare a cromonemei,or, însoliúà de decondensarea qi desigur pierderea individualitàlii cromozomului. Materialul cromozomilor se va organiza sub înfàtiqarea cromatinei interf azice. Se pare cà cloar cromonemele îqi pàstreazà continuitatea atît la nivelul cromozomilor cît qi la nivelul, nucleului interfazic. Se cunosc puline iucruri despre cauzele qi, mecanismele spiralizàrii qi despiralizàrii cromozomului eucari'ot. Cercetàritre din ultimul timp pun pe seama fosforilàrii proùein,elor cromozomale histonice, în spe!à à Hr eondensarea cromatinei la debutulr diviziunii. Nucleul inùerfazic este metalbolic activ, la nivelul sàu avîncl loc intense sinteze ale componentelor majore ale celulei gi în primul rînd sinteza ADN gi a proteinelor cromozomale histonice. Durblarea eantitàlii de ADN esùe o condilie necesarà desfàquràrii mitozei Ei impune diviziunea. Cînd replicarea cromozomilor nu este urmatà de diviziunea nucleului qi ulteri,or a citoplasmei iau naEtere diplocrorrtozomi, cromozo'mii fii neseparîndu-se în ciouà celule fiice, rezultînd o eelulà care este endoploidà avînd o cantitate dublà, sau corespunzînd la un multiplu aI cantitàlii dipl'oide de cromozomi, depinzînd de numàrul de cicluri de replicare desfàqurate fàrà interpunerea mitozei. Un caz interesant este oferit de celulele glandelor saÌivar,e de diptere în care endociclurile duc 1a formarea cromozomilor politeni. Prin politenie se înfelege desfàEurarea de runde multiple de replicare a cromozomilor, fàrà ca cromatidele
101

fiice sà se separe în nuclei

dicul;ar pe iungimea bralului cromozomal. Cromozomii politeni reprezintà astfel forma interfazicà a cromozomiLor obiqnuifi la nivelui càr,ora s-au desfàEurat multiple runde cle replicare. Dirnensiunea unor as,emenea cromozomi ,este de peste 200 ori mai mare ca a cromozomilor obiqnuili din care derivà. Deoareae are Ioc un pioces de împerechere somaticà 'a cr,ofiìozomilor omologi în timpul politenizirií lor, numàrul cromozomilor politeni aparent reprezintà iumàtate din acela ai cromozomilor obignuili. Din asocierea intimà (împerecherea) la acelaEi nivel a cnomomei'elor iclentice ale celor doi omologi rezultà un model de bandare specific fiecàrei specii, pe baza càruia se poate alcàtui o cariare citolog'icà a gen'el,or, admi!înd cà fiecàrei benzi îi corespunde o genà. În anumite regitini benziie (cromomerele) prezintà o dispunere laxà, deslînatà a fibrilelor, rezultînd structuri caracteristice care s-au numit puf e, iar cele car€ au o extindere mai mare au fost nurnite inele Balbiani. La nivelul aces0or structuri a fost evidenliatà prin experienfe autoradiografice cu 3H-uridinà, desfàqurarea unei intense transcrieri ge* netice. În cursul dezvoltàrii ontogenetice pufele apar într-o anumità ,ordin,e, indiciu cà ar'e loc o activare diferenliatà, eqalonatà a geneior, în funclie de necesitàtile de moment ale celulei. Cromozomii poiiteni au fost descriEi gi la angiosperme, protozoare, în unele celule transformate maiign. La plante cromozomii. politeni nu sînt împerecheafi, prezentînd o structurà granularà, fàrà a prezenta benzi distincte. Cromozomii politeni apar în celulele înalt diferenfiate care nu -se mai divicl gi deci care reprezintà punctul terminus al unei iinii celulare date. Astfel, cromozomii politeni nu vor mai r.eveni niciodatà la forma o,biqnuità, celulele în care se a,flà (de exemplu cele clin glandel'e salivare ale larvelor de diptere) funclionînd foalte intens într-un moment precis circumscris al o,ntogeniei dupà care mor (glandele salivare ale ,adultului se dezvoltà ulterior din celule care ,au crornozomi obignuifi). Polite,nia ajutà tocmai în realizarea unei asemenea funclionàri la parametri metabolúci maximi. În timpul meiozei în nucleul ovocitei primare, mai al,es la batracieni dar si alte verterbrate qi nevertebrate s-a descrÍs un tip special de cromozomi care apare mai ales în stadiul de dira2

reaiizeazà o -structurà cr,omoz,omalà politenicà în care alúerneazà ,henzi clare qi benzi întunecarte dispuse transversal, perpen-

fii

dif,erili. Ràrnînînd asociate ele

ploten pr,elungit. Acest tip de sromozomi numit larnPbru.sh (în perie de sticlà cle lampà) este specífie acestei faze Ei este reversibil. càci în fazele ulterioare ale meiozei el revine la forma tipicà de crornozoml

zi la Drosaphila. Dimen;iunea CIromozomului lampbnsh poate depàEi pe aceea a cromozomului politen ajungînd la 1 m,rn, dar diametrul sàu este foarte subfire. Din cromomerele sale stnt pnoiectate lateral bucle în perechi avînd diferite forme qi dimensiuni (Ftg. 34). Aceste bucle au o axà finà reprezentatà d,e ADN $i din ea sînt proiecta,ùe flbre eare sînt acoperite de un matrix c€ este alcàtuit din ARN gi proteinà.
Aflîndu-se

spe'cificà acelei specii. Acest tip de cromozomi apane qi în spermatogene-

' ..tl

Fig. 3a. Cromozomi ,,iampbrush" din ovoeite de Tritutus uiridescens. Ei reprezintà bivalenfi (cromozomi omologi) qi deci douA

stucturi bicatenare d,e ADN

regiuni strîns spiralizate-cromomerele.

prezentînd

meioze se înlelege un bivalent, adicà doi cromozomi omologi împerecheali. Bucia lateralà apare în acest caz ca unitate de iransóriere. Fiecare buclà apare asimetricà în sensul cà la nivelul uneia dintre inserliile sal,e în cromomerà este finà qi lipsità de fibre reprezentînd capàtul sàu gol, urud, de la care se remarcà un gradient de lungime al Íii:relor ce sînt proiectate din buclà, ia început scurte Ei de','enind progresiv mai lungi pe màsurà ce se apropie de eelàlalt capàt al buclei unde se inserà în cromomerà. Este posibil ca la nivelul capàtului gol sinteza ARN sà fie blocatà sau asimetria sà aparà ca un rezultat ai polarizàrii formàrii buciei. Buclele sînt considerate a reprezenta modificàri reversibile al'e structurii crornozomale la nivelul unor gene active, acest fapt fiind
cà fiecare cnomozom lernpbrush neprezintà de fapt
103

în mijlocul profazei primei

gi de reducerea sau anularea lor atunci cind se cu inhitbitori ai transcrierii genetice. La unele ur'oCele (salamandrà de exemplu) din unele bucle care sînt omoloage pufelor cromozomilor politeni, se desprind continuu structuri circulare care confin ADN qi care reprezintà nucleolii extracromozomali, rezulrtafi în urma unuí proces de extrareplicare care se numeqte amplificore genicd. Printr-o asemenea extrareplicare, cantitatea de ADN se màreEte considerabil, uneori depàEind chiar ca'ntitatea de ADN a cromozomil,or îndemonstrat
ac{ioneazà,
EiEi.

chere,a omologilor (în primul caz este vorba de o împeredrere somaticà, în al, doilea de o împerechere norma'là meioticà).

pufare

uD,eI€ asemànàri cum

Între cromoz,omii politeni gi cromozomii larnpbrwh apar ar fi amplificarea genicà, fenomenul de
respectiv ,buclare, structura cromomericà, împere-

Marea deosebire din'tre aceste douà tipuri particulare de cromozomi, dar de excepfionalà importantà în înlelegerea fenomenului ereditar, este cà în eazul cromozomilor politeni, spre deosebire de cromozomii la,rrtpbrush, transformarea (rnetarnorfozal este ireversi,bilà. tri nu vor mai reveni la forma rrormalà, tipicà a cromozomilor obiqnuili ci funcfioneazà într-un stadiu critic al vielii celulei, respectiv individului (stadiul larvar III) cînd sînt necesare sinteze de proteine, nespectiv enzime ale glandetor salivare. Dupà îndeplinirea rostului 1or, celul,ele glandelor salivare se autolizeazà qi odatà cu ele Ei crornozomii politeni. uriaqi Cromozomii tmnpbru,sh, dupà ee îqi îndeplinesc funcfia tor de sintezà inteursà de ARNr revin, începînd din diochinezd. qi mai ales în me'tof'azo I a meiozei, la forma normalà de bivalenfi asigurînd continuitatea geneticà în linia germinalà.
2.2.2. STT|UCTU

RA ELECTRONOMICROSCOPrcA A CROMATINEI $r A cRoMozoMuLUr EucARror

Cercetàrile de microscopie electronicà asupra cromatinei interfazice € qi a cromozomului metafazic au stabilit cà unitatea de structurà a cromatinei eucariote este nucleosomul, o structurà periodicà, repetitivà de hisùone qi ADN. Fibra de cromatinà este flexirbilà $i pe ea se aflà particule sferice dispuse precum màrgeiele într-un girag. Nucl'eosomii se aflà deci atît în
104

cromatina interfazicà, cit Ei în cromozomul metafazic, în eucrornatina qi heterocromatinà, pe aceastà bazà putîndu-se ,explica continuitatea structuralà la nivel celular a materialului genetic la eucariote. Particula nucleosomalà are un cliametru de 70-110 A. Nucleosomul este alcàtuit dintr-un octamer histonic în care intrà în cantitàli egale fracliunile histonice H2a, Hzb, Hs gi Ha dar în dublu exemplar. Octamerul histonic ar.e o greutate molecularà de 110.000 daltoni. El se asociazà cu ADN de lungime corespunzînd la 200 perechi de ,baze. ADN stà l,a periferia octamerului înfàqurat ca o superhelice platà (Fig. 35). Între particulele nucleosomice se aflà de asemenea ADN, lung de 1,83 nm, neasociat cu histone. Nu se qtie încà cum participà fracfiunea hist,onicà H1 la structura cr'omatinei. În ciuda unor deosebiri de vederi privind forrna qi dimensiunea nucleozomului, numàrul de perechi de baze ,asociate acestuia Ei lungimea ADN intercromozomal este cliar cà nucleozomul este o unitate de bazà a cnomatinei eucariote. Dimensiunile sale sînt de 70-1,25 A, formà de disc (se mai numeqte gi platizom\ sau sfericà, fiind înfàquna't de 2 ,orí Ei jumàtate într-o dispozilie încr.elità de o lungime de ADN care are 140200 de perechi de nucleotide. Dupà Gottesfeld Ei oolaboratorii (1975) num'ai portiunile inactive ale ADN sînt orgal'li,ciecsl-, nizate în nucleozomi. Histona H1 este implicatà în superspiralizarea nucleo--l zomilor qi a ADN internucleozomal qi împachetarea lor în fibra de cromatinà (Rahr. i977).
t I
I I I I I

I

Fig. 35. Relafía dintre structura ADN, oligomeri
diametru este suptaspbalizat în interiorul subuni-

l,-"^ l3LsA
I
I

Q

histonici gi fibtile de cromatinà de diferite dimen-

siuni (grosimi). Duplexul ADN de circa 25 L
tófilor cromatinei (NUCLEOZOM.I cu un pas (îuà1fime) de 504, spte a da o fibrà de 100 A. aga cum apare la microscopul electronic. Întregul complex nucleohistonic este din nou spiralizat (înfagurat) cu uu pas de 500 A qi o razó d.e 130 A spre a da o flbrà d.e 200 A *t. cum se vede la 'nicroscopul electronic. Potliunile (întind.erile) de ADN liber dintre nucleozomi în mod normal sînt mai lungi
decît este aîAtat îu aceastA schemìl.

i
I
I t

l i
!

50

loo*-!Èl
200 A

I ':ti
i

105

ln fibra de cromatinà ADN se aflà sub forma superspiralizatà raportul lungime ADN : lungime fibra de cromatinà fiind de cca 30 la 1. Nucleozomii sînt mesllinufi în fiibra de cromatinà prin cooperarea proteinelor specifioe cum ar fi histona H1, nonhisbonele Ei proteinele contr,actile. Cînd celula trece prin stadiul postreplicativ G2 aI ciclului ceiular, cele dor-rà fibre replicate în stadiul precedent de sintezà S al interfazei se condenseazà sprc a forma jumàtatea unui cromozom (cromatida), pliindu-se în cromatide surori. Fiecare cromozom este pliat într-o oonfiguralie specificà în metafazà. Structura electronornicroscopicà a cromozomului eucariot relevà natura fibroasà a fibrei nucleohistonice care nu prezintà capete iibere. Cercetàri recente efectuate de càtr,e Loemmlú de la Universitatea Princeton din New Jersey aratà cà 'organizarea cromatinei în cromozomul metafazic are la bazà o re{ea de proteine nonhistonice. Îndepàrtînd histonel'e qi majoritatea proteinelor n,onhistonice din cromozomii metafazici umani a ajuns la constatarea cà ADN cr,omozomal ràmîne într-o structurà organizatà qi compactà care apare ca un miez central ce prezintà morfologia cromozomilor metafazici intacfi, fiind înconjurat de un halou de ADN. Structura miezului central este dezorganizatà, în urma tratamentului moderat cu tripsinà. Prroduqii de digestie au fost analizali electroforetic. S-au evidenliat peste 30 fracliuni de proteine nonhistonice. Aceste ceroetàri aduc date noi referitoare la structutra cromozomului eucariot Ei ,aratà cà aceasta se bazeazà, în primul rînd pe existenta unei matrice de proteine nonhistonice care eonferà cnomozomultri metafazic forma s,a caracteristicà. Aceste oercetàri urmeazà sà fie confirmate.
2.2.3. COMP LEXU

L

SINAPTIN EM AL

electrondensà numità spaliu de împereehere. Regiunea centnalà ane o là{ime constantà de 1000 A, reprezentînd qi distan}a din106

În meiocite apare ca structurà caracteristicà prezentà doar la eucariote cotnplerul sinaptinemal (C. S.) descris pentru prima datà, în-1956, de càtre Moses. C. S. este,o stmcturà tripartità (Fig. 36) eviden{iatà numai eleetronomicroscopic, prezenùînd douà componente laterale Ei o regiune centralà mai putin

Fig. 36. Complexul sunaptinemal (CS). A. în spermatocitele de

turA directà cu membrana nuclearà, r 48.000 (dupà Maillet gi Foillot,

Philaenus spumariws se remarcó dimensiunile complexului sinaptinemal în absenla materialului cromatic. Màrire r 78.000. B. complexe sinaptinemale n:,ultiple, în lega1965).

cromozomii omologi în pa.chiben, indiferent de lungirnea cromozomilor omologi qi conlinutul de ADN din aoeEtia. În regiunea centr,alà se aflà elementul central, care are 200 A d;ametru. Spaliul dintre regiunea centralà Ei eiemen'tele laterale €ste traversat de filamente fine. La làcuste Ei asoomicete, componentele laùer,al,e apar cq o structurà ba,ndatà cu o periodicitate de apnoximativ 100 A. Cromatina crom.ozomiloi omologi vine în contact cu elementele laterale ale C. S., pe întreaga lor trungime. Ambele capete ale bivalentului sînt ataqate la membr,ana nuclearà prin tel'omerele 1or. La formele la care în pachiten apare o distribulie în ,buchet a bivaien{il'or, ambel'e capete ale bivalenlilor sîn,t atasate într-o regiune restrînsà a rnem,branei nucleare, adiacentà centriolului. Formarea CS începe cu sinteza unei componente laterale în spaliul dintre crornatideiesurori ale fiecàrui cromozom leptotenic (încà aflat sub formà de univalent, neîmperecheat cu omologul sàu) gi capetele fiecàrui cnomozom leptotenic (avînd între cromatidele sale un element lateral), sînt ataEate la membrana muclearà. Are loc alinierea relativà a cromozomilor om,ologi pe un spafiu de cca 3000 A, fàrà a se cunoagte mecanismut Érin care Àe realizeazà aceastà împerechere prea}abilà a omologll,or. Elemen'tele laterale ale c. s. ce aparlin omologilor se asociazà avînd lroc asamblarea C. S. care determinà o împerechere foarte exactà, cromomerà la cromomerà, punct la punct a crelor doi cromozomi omologi cu f,ormarea 'bivalen{ilor. Pmtru asamb}anea c. S., elemen-

tre

fi7

C. S. mediind schimbul dintre moleculele de ADN ale omologilor. C. S. apare ca o structurà ri,bonucleopr,oteinicà. Aceastà aser'{iune se bazeazà, pe rezultatul digestiei enzimatice cu DNazd care dizolvà cromatina bivalentului fàrà a altera structura complexului sinaptinemal. Rezultà cà ADN nu este un component major a1 C. S., Putînd fi pnezent însà în cantitàli imfime. In schimb, ribonucle,aza dezorganizeazà regiunea centralà gi cea mai mare parte a elementelor laterale. Prezenfa componsntei proteinice în C. S. este dovedità de rezuitatul digestiei cu enzime proteolitice (tripsina). Elementele laterale dau reac{ii citochimioe care indicà prezenla în ele de proteine bazice de tip histonà, r,egiunea centralà dînd reacfie ciiochimicà diferità de aceea a elementel,or 1atera1e. Existà unele afirmalii dupà care ADN ràmas nereplicat în faza S premeioticà qi replicat în zigoten (Stern gi Hota, 1969, Hota qi Stern, 197I) ar media împerecherea cromoz,omilor omologi d'ar dupà al{i autori (Westergaard Ei Wettstein, 1972) însàEi componenta lateralà a C. S. poartà informa{ia pentru împerecherea sit 1a sit a cromatidelor cromozomilor omologi.

semnuL citologic al schimbului intercromozomal (cr,ossing-over),

tele lateraLe ale fiecàrui omolog suferà o transpozilie dintre cromatidele surori spre exterior, depì.asare determinatà de rotirea cromatidel,or surori fa!à de componenta lateralà. Este posibil ca componenta centralà a C. S. sà derive din elementel,e laterale omoloage prin existenfa unor fibrile dar Westergaard Ei Wettsùein (L971, 1972) admit cà elementul central al C. S. ar fi sintetizat în nucleol de unde migreazà la Locul de unire a elementelror laterale. În diplotenul tîrziu C. S. se dez'organizeazà iar omologii sînt respinqi de l,a nivelul bivalentului fàrà însà a se separa, ràmînind unili la nivelul chiasmelor

xuri ADN. Dupà uneLe ipoteze ar exista gene care codificà sintnza unor proteine alosteriee de imperechere, capabile sà se ataqeze la anumite secven{e cle nucleotide. Ar exista douà tipuri de asemenea proteine de împerechere, unele caracteristice regiunilor e.ucromatice, alt,ele caracteristice regiunilor heterocromatice. Dupà altà ipotezà, ar exista gene de fuziune care ar dirija sinteza unor proteine de împerecher'e bivalente specifice celor doi cromozomi omologi ai fiecàrui bivalent. Acesùe gene ar fi derivat printr-un crossing-over inegal între cromozomi omolo.gi.
T.OB

Complexele sinaptinemale mediazà formarea de heteroduple-

3. CARACTBRISTICILE ORGANI.ZAR,IT EUCARIOTE 1. Închiderea materialului ereditar într-un spafiu genetic reprezentat de nucleu. 2. Asocierea permanentà a ADN gi histonelor cu formarea fi,brelor nucLeohiston iae. 3. Prezenfa a trei clase de secven!à în ADN: secvenfe unice, secven{e moderat r,epetate Ei secvenle înalt repetate. 4. Dif,eren{ierea a douà stàri funclional'e ale cromatinei eucromatina qi heterocromatina. 5. Evo1u{ia unui ciclu de condensare Ei decondensare a cromatinei. 6. Organizar,ea unui fus de diviziune eare asigurà repartizarea echilibratà a produgil,or de replicare. 7. Specializarea la nivelul cromozomului a unei regiuni de atagare la fibrele fusului de diviziune centromer (cineùochor). B. Organizarea nucleolului ca structurà intranuclearà specializatà în sinteza ARN riboz,omat. El este asociat cu regiunea or,ganizator nucleolard, (N. O.) a unuia sau a mai multor cromozomi. 9. Aparifia unui centri.ol cilindric cu formula ultrastructuralà I X 3 fiiamente, implicat în organizarea fusului de diviziune.

4. PROCARTOTB-EUCARIOTE, O COMPARATIE Procariotele prezintà ADN necomplexat cu proteine bazice hisùonice (cu unele exoeplii E. coli, Anabaena, Aphonocapsa). ADN procariot nu prezintà secvenfe repetate (excepfie gene rib,ozomale prezenbe în cîteva copii). Nici ADN viral nu prezintà, secvenle repetate de baze cu exceplia fagilor din grupa T parà (Tz, T4, T6) al càror cromozom prezintà repetilii de baz,e la fiecare capàt. Procarioùele nu au materialutr ereditar încadrat întru-un spaliu genetic defi,nit. Cantitatea de ADN este mult mai mare Ia eucariote, corespunzînd unei cantitàfi mai mari de informalie eneditarà (tabelul 2).
109

Tabelul 2 Datc crntitatlve prlvlnil genomul vlral 9l eelular](ilupà J.E. Taytor)

fagul

pX t74 fagul T
),

Polioma

0,00158 0,00186
7

1

fagul T 4 Vinrsul Fowlpox

0,0122 0,0172

I I

I

0,0520t6 0,0930t6
0,45

I I

E. coli Lark E. coli Cairns
Chlamydomonas

x l0-r x x x
10-r 10-r

1,530 1,400 10,200 6.12
15,64

3
1,8

Drojdie
Neurospora

4,6
2,5 22,0 53 0,45 0,45 0,18 0,20
0,7

10-t

Angiosperme

Raphanus sstiYun Vicia faba Lílium longfflorum Xanthorhize Aquitegia Drosophlla melauogaster
Chironomus

850,00

I
6

7.480
18.020
153 153

t2
r8
7

Neverte-

61,2 68,0

btate

pallidivittatus Pegti (specii diferite)

Dípnoi: Protoptenrs
Lepidosireu

-2,8

238-952
17.000 42.160
1.666

50 124 4,9 24,6 94,5

Vertebrate

Amphibia Bufo
Salamandra

l3 l3
t2

8.364

Plethodon Necturus maculosus Reptile

32.130

Ord. Squamata Ord. Crocodylia
PAsàri Matnifere-hamster Om

2,1-2,3 2,9-3,1
3,5 3,0

g,t-4,2

986-

7t4-782
1054 1428

18-23
2t
23

1054-

I I90
1.020

110

Eucariotele conlin de cca sute de mii de ori mai mulú ADN decît virusurile gi de mii de ori mai mulrù decî,t bacteriile. -tixistà însà mari varia{ii cantitative chiar în cadnrl aceluiaqi grup de organisme eucariote. Drojdiile ibunàoara, eucariote tipice, conlin o cantitate de ADN nu cu nurlt mai mare decît bacteria E. coli, pe cî,nd în nucleii unor dinoflagelate se aflà mai mult ADN decît la om. Nru existà deci o relafie simplà, d,irectà între cantitatea de ADN qi aceea d,e informafie ereditarà. (ADN nerepetitiv). 5. GBNOMUL EXTRANUCLEAR

La eucariote, în afara nucleului se aflà molecule informalionale de ADN oanton'ate la nivelul unor organite specifice precum mitocondri.ile qi clwoplastele ca Si în kinetozomii, de la ciliate, granulii bazali ai flagelilor organismel,or flagelate qi kinetoplastele de la Trggnnosamidre. Din ace,astà cauzà celula eucariotà apare ca o strucùurà multigernornicà î:r care, alàturi de un genom nuclear existà cel pufin al{i doi genomi diferifi genomul cloroplrastic specifie celulei vegetale extranucleari Ei genomul mitocondrial, comun cel.ulei vegetal.e qi animale (Fig. 37), ADN orgamitelor, localizat în matrixul acestora, prezintà. un aspect ultrastructurafl. simitlar aceluia al, nucleoidrilui baeterian sau cionobacterian, în car'e se r€m,arcà o retea tridi-

z o
o
o

IU

t c fD I

.îl

slendard

Fig. 37. Fractiunile de ADN
gracil,is.

(a) Bandarea care apaîe în tubul de centrifugà care conline ADN de Euglena gracilis
(centru gi dreapta) gi ADN de fag SP 8 folosit ca standard (stînga). (b) Analiza spectrofotometricó ln ultraviolet a be[zilor. Banda cu densitatea 1,743 corespund.e ADN martor SP 8. Banda
principaló

celular delaEuglena

(J

(,

s
6

= )
.g
-o

foiitocondrie

ADN

/ADN
c

c

loroplastic

din centru corespunde ADN nuclear. ADN mitocondrial bandeazà la 1,691 iar ADN cloroplastic bandeazà la 1,686 (greutate molecularó 9,2 x:106 d.altoni).

.o

14

o
r.69r ì.0c6

greu

dens;latee(9

crf) uîot 111

fibrile fine de ADN cu orientare randomizatà, avînd un diametru de cca 25 A. Înseamnà cà gi în acest caz este vorba de lipsa asocierii ADN cu histonele. De regulà. ADN extranuclear se prezintà ca molecule circulare bicatenare de ADN, dar gi sub formà de moleeule liniare. ADN extranuclear se replicà dupà modelul semioons'ervativ qi relativ independent de replicarea ADN nuclear avînd echipament enzimatic propriu de r,eplicare gi de transcriere. Organitele celulei eucarioùe, cloropl,astele gi mitocondriile, prezintà un sistem autonom de sintezà proteinicà echipament enzimatic propriu cu ribozomi specifici de tip procariot (70 S) qi cu ARNú specific. Existà însà o strînsà independen!à între funclionarea genomului nuclear Ei a celui cioroplastic sau mitooondrial. ADN mitocondriatr este o structurà circulrarà dublucatenarà care are o greutate molecularà ce varlazà, între 1X 107 Ei 5X107 daltoni. EI are o dimensiune mai mare la ciuperci, pr'otiste gi plante superioare. Mamiferele au un genom mitocondrial mie de 1 X tOt daltoni. I"a drojdie, ADN mÍtocondrial are 5 X 102 daltoni ceea ce corespunde Ia 75 [<ilo,baze. PrÍmele gene cane au fost desemnate a codifica cCImponente ale maEinàriei de sintezà proteinicà miùoeondrialà au fost desemnate gene sg7, $i el.e includ genele pentru ARNr qi ARNú mitooondrial (Tzagoloff Ei Macino, L977). La Soccharom,yces cereaisine s-au descris cel pu,Ln 30 tipuri diferite de ARNú mitooondrial. Numàrul toùal de specii izoaccepùoare de ARNú este în acord cu ipoteza usobble (vezi codul genetic). La Socclwromgces nu este necesar importul de ARNú citoplasmatic pentru sinteza proteinicà pe ribozomi mitocondri,ali. La Tetrahgmena însà numai ARNú pentru leucinà, fenilalaninà, triptofan qi tirozinà sînt sintetizati pe matrifà de ADN mitooondrial, restul fiind importafi din cit,oplasmà, avînd origine nuclearà. Aminoacil sintetazele mitooondriale, factori de inifiere a sintezei protein'elor în mitoeondrii Ei cele mai mulùe proteine ri'bozomale sînt produgi ai genelor nucleare sinte'tizati pe ribozomi citoplasmatici. Mutafia ,,pokytt de la Neurospora cmsso apare ca rezultat al absenlei unei pr,oteine specifice a subunitàfii ribozomale mici (30 S) a ribozomilor mitooondriali. Aeeastà pnoteinà a fost desemnatà uar I qi este codificatà de o genà mitocondrialà. A doua cl,asà Ímportantà de gene mitocondriale a fost desemnatà genele mit Ei crodificà pnoteine ce funcfioneazà în tnansportul electronilor qi fosforilarea oxidativà. Mutaliil'e mit afecteazà
mensionalà de

tL2

trei complexe ale membranei interne, eitocromoxidaza, coenzima QHz-citocrom c, reductaza Ei ATP-a,m oligomicin sensibilà.

Din totalul a nouà prot'eine sintetizate în mitocondrii qase s-au dovedit a fi specificate de ADN mitocondrial. S-au descris trei grupe de complementafie mitocondrialà ori 7, ori 2 Ei ori 3 care intervin în codificarea subunitàlilor citocromoxidazelor sfurtetizate în mitocondrii. Mutafiile din grupul de complementatie cob sînt deficiente în ciùocromul b. Un grup de mutante mitooondriale deficiente în ATP-azd desemnate pho 2 prezintà leziuni în componenta proteolipidicà a ATP-azei. La S. cereuísioe mutantele citoplasmatice spontane ,,petite66 prezintà unitàli genomice mitocondriale în care un segment excizat al genomului parental de tip sàlbatic (normal) a fost amplificat în tandern. Acest segm.ent excizat devine unitatea repetatà a genomului ,,petite66. Acest genom ,,petite( la rîndul sàu, deqi produsul unui eveniment mutafional poate suferi cieI,efii care duc la genomuri ,,petite( secundare, avînd unitàli repetate mai scurte (Gaiiland qi colab., 1980). Studiul mutante1or spontane ,,petite( aratà cà în mod frecvent capetele segmentului excizat corespund la secvenfe scurte ale genomului de tip sàlbatic care sînt extrem de bogate în GC. Astfel, clu,sterii. (grupàri masive) de GC sînt localiza!í în segmente lungi ,bogate in AT. Repetifii de secvenle s-au dovedit a fi prezente atît la niveLutr clu,sterilor GC cît qi a spapiatorilor AT, ceea ce face pnobabilà posibilitatea ca excizia sà se realizeze prin'tr-un mecanism de recombin'are nelegitimà cu specificitate de sit, între secvenfe omoloage. Combinarea metodelor de eartare geneticà qi de cartare fizicà a dus la cartarea markerilor mit- Ei de rnezisten!à la antibiotice din genomul mitooondrial de la S. cereaisine. Pe oalea analizei co-retenfiei qí co-delefiei alelelor mutante fur Ei din ADN mitooondrial al mutantel'or peti.te (qJ Ei a analizei produqilor de recomrbinare (analizà gen'eticà) din încmciqàri bi- qi trifactorirale, s-a sta{bilit circularitatea hàrfii genetice mitocondri'ale, unicul grup d,e lincaj genic mitocondrial avînd ca suport fizic molecula circularà dublu-eatenarà de ADN mitocondrial. G'enele ribozomale mitocondriale Ei pentru ARNú mitocondrial au fost cart"ate priur hitbridarea acestor produgi eu fragmente de ADNmt de la tipul sàiibatic $i de la tipul p- $teti.te) gener,ate prin restrielie cu endonucleaze de restricfie.
8 - Descifrind tainele eredità|ii, vol. I 113

Harta geneticà mitooondrialà evidenfiazà o oonsiderabilà dispersie a genelor care ooclificà funcfii înrudite. Cele trei gene structurale car,e codificà citocromoxidaza sînt separate d,e secvenfe care conlin genele sgn qí mit. Geurele ARNr, ARNú qi ATP-caei sînt de asemenea distribuite împràqtiat în tot genomul mitocondrial. Aoeastà distribufie specificà a genelor mitocondriale eltiminà posibilitatea expresiei lor ooordonate contr'olatà prin simteza unui ARNrn policistronic, gsnele mittooondriale, spre deosebir,e de oele de procariote, apar a fi transcrise individual, caracteristicà specificà qi genelor nucleare euoariote. Clor,oplastul plantelor superioare conline un numàr mare de molecule circulare, identice cu ADN cu o greutate moleculiatrà de cca 9 X tOz da,l,toni. Fiesarc nro.lpculà oonline furformafia geneticà totalà a orgarnitului (Bórner, 1980). Ca urmane, numàru1 de copii ale fiecàrei gen,e cloroplastice per celulà poate ajunge 1a cîteva mii, depinzînd de numànr,l de cloroplaste per celulà Ei de cel al moleculelor de ADN per cloroplast. Cu ajuùorutr endonucleazelor de restricfie s-a stabil.it harta fizicà s, ,g€Doffiului clonoplastic qi au fost cartaúe genele pentru ARNr, ABNú, subunitatea mare a frracliunii proteinice I gi pentru unele polipeptide neidentificate. S-a stabilit cà genele ARNr sînt localizaúe în cadrul unor r'egiuni cu secvente repetate din ADN (in cadrul a douà repetifii inversate la spanac, porum,b qi Chlotrydommtas gi în cadrul a trei repetifii în tandem mai mici.7a Euglenn). Pe ribozomii cloropl,astici sînt sintetir.ate mai mult de 90 po'lipeptide distfurcte, incluzind gi subunitaúea mare a fracliunii proteinice I (ce participà în cataliza enzimaticà a fotosintezei), trei surbunitàli ale factomlui de cuplare CFt doi factori de elonga{ie qi ciúocromii. Un numàr mare de proteine clonoplastice sînt si,:rtel:zatn pe riibozomi citoplrasmatici qi includ enzime ale ciclului Calvin, enzimele sintezei pigmentului ADN polim erazal polipeptidel,e tilncoidelor qi memrbra,,nele anvelopei cloroplastului. Polipeptidele sînt evident sintntizate în citoplasmà, ca precursori avînd ,o secven{à semnal. Aceastà secven{à adifionalà permiùe transportul specific prin anvelopa cloropiastul,ui dupà care este eliminartà. În membrana anvelopei cloroplastului se aflà receptori specifici pentru secvenla semnal a moleculelor pr,ecursoare, facilitînd trecerile prin membranà. Recen,t, au fost izolafi crùÍLmomi cloroplnstici intacfi de la alga Euglenn ca qi de Ia numer,oase plante superioare Ei s-a
114

constatat cà aceEtia sînt circulari, avînd o circumferifà de cca 45 [rh, ceea ce cor'espunde la cantitatea de ADN de la fagii
T2 sau Ta.

S-a oonstatat cà genele cloropLastice care codificà diferitele enzime sau proteine ce participà în fotosintezà sau în morfogeneza organitului sau ,genele mitocondriale ai càrnor produgi dirijeazà sinteza unor enzime ce intervin în lantul transportorilor de electroni sau a unor protein,e structurale suferà mutafie gi recombinare. Ele alcàtuiesc ca Ei la pruoariote un singur grup de înlànfuire. Cercetàri de hibridare molecularà au demonstrat lipsa unei omologii între ADN nuclear qi ADN extranuclear. O analogie mai mare apare între ADN extranuclear qi ADN bacterian sau ciano'bacterian, de unde s-a tras concluzia cà organitele celulei eucariote ar fi derivat prin endosimbioza unor stràmoqi de tip prooariot bacteriile pentru mitooondrii, cianobacteriile pentru cloroplaste (Gawilà, 1978). Existà gi alternativa ca celula eucariotà sà derive prin transformar€a progresivà a celulei procariote, organitele citoplasmatice ale celulei eucariote provenind prin transformarea mem'branelor tilacoide Ei prin compartimentaiizarea genomului inifial în genom nuclear, mitocondrial, cloroplastic etc.

Capitolul IV
CODIFICAREA BIOCHIMICA SI EXPRESIA GENICA

1. GBNERALITATI

Gena reprezintà un segment din macromotrecula ADN a càrui secven!à de nucleotide deline, sub formà oodificatà biochimic, informalia geneticà necesarà pentru sinteza unei catene polipeptidice. Aceastà informalie este transmisà în prooesul de transcriere unei monocatene ARN car€ poartà astfel mesajutr genetic ce dirijeazà includerea în catena polipeptidicà a
aminoacizilor cor'espun zàtorí. Secvenfa genicà codificaúoare este precedatà de ,o secven{à necodi.ficatoare de circa 50 nucleo'tide care s-a numit regiune promotor, r'eprezentînd situl de aùaqare a ARN polimerozei în vederea transcrierii. De as€rt€rlea în cadrul genei se mai aflà o rqgiune implicatà în r'eglarea transcrierii genei qi care a fost numità regiune operatoare. Uneori douà sau mai multe gene care defin informafia geneticà ce dirijeazà sinteza unor enzime ce intervin în aceeaqi cale metabolicà pot avea acelagi promotor qi acel,aqi operator. În acest caz asemenea gene sînt tr,anscrise sub forma unui tr,anscript comun care poate fi apoi clivat în diferite caúene ARNrn purtàtoar,e al,e mes,ajului genetic pentru fiecane catenà polipeptidicà. Gene1e care delin inf,ormafia geneticà pentru sinteza polipeptidelor se numesc gene structurale. Tr.anscriptele 1or reprezentate de ARNrn sînt traduse în pol,ipeptide. Genele car'e delin informalia geneticà pentru sinteza ARNr se numese gene ribozqmnle. Transcriptele lor nu sînt traduse. Conversia (traduoerea) mesajului genetic din limbaj de acid nucleic construi,t din cele patru nucleotide într-un limbaj pro116

teinic, construit din cei 20 aminoacizi principali este mediatà
de un sistem de codifioare-decodificare cunoscut sub numele de cod genetic. Aceastà conversie se realizeazà la nivelul riibozomiqi are ioc prin participarea lor iocul sintezei proteinice celor trei categorii principale de ARN celular: AItNm, ARNú qi ARNr. Ideea prof'eticà a lui E. Schródinger din anii L944-t945 despre natura relafiei dintre actzii nucleici Ei proteine formulatà în termeni de codificare biochimicà s-a dovedit realà Ei cristaiizatà sub denumirea dogmei centrale a biologiei molecul.are elaboratà în anul 1956 d,e càtr,e Crick. Dogma centralà a biol'ogiei molecular,e a admis transferul unidireclional al informafiei genetice ADN + ARN -> pr,otein,e. Ulterior, descoperirea reverstranscrierii a adus coreclii dogmei centrale a biologiei moleculare, demonstrînd posibilitatea unui transfer invers de infor,mafie geneticà de la ARN l:a ADN.

2. CODUL GENBTIC
Codui genetic repnezintà un sistem biochimic prin care se dintre acizii nucleici Ei pr,oteine. Relafila dinrtre muúafia uurei gene Ei blocarea unor eùape specifice aie unui lan! meta,bolic 1a Neurospora a fost stabilità înainte de 1944 de càtre Beadle gi Tatum su,b formula metapolipeptidd foricà: o gemd, o enzirnd. Colineoritatea gend, a fost ulterior d,emonstratà în numer'oase cazuri. Astfel, în 1957 Ingram Ei Husit au aràtat cà hemoglobinele de tip A qi S au o structurà primarà car,e diferà printr-un singur aminoacid (fig. 3B). Hemoglobina S este ,o hemogl,obinà mutantà. S-a tras concluzia cà mutafia a alter:at pozilia nucleotidelor la nivelul genei iar aceastà al,terare a fost tr'adusà printr-o alternare a poziliei unui aminoacid în catena polipeptidicà. Veridicitatea colinearitàtii nucle'otidel,or de Ia nivelul genei cu aminoacizii de la nivelul oatenei polipeptidice a fost demon;stratà experimental de càtre Yanofsky în t964. Anaiizînd mutantii armotrofi de E. coli induqi prin iradiere UV, deficienli în proteina A a triptofansintetazei, proteinà care reprezintà o catenà polipeptidicà de 267 aminoacizi, autorul a constaùat cà în pozili,a 2t0, mutanta A2s ,at€ arginina iar mutanta Aa6 are acidul glutamic pe cînd tipul normal prezintà în pozilia respectivà glicin,a. Pe
sta'bileEte relafia

Itr

HbA
t,4 .

HbS
-Y\./ ti\ /.-.\

153 i-11,

dà}i,3 d""t %o* I

i9&\ ()

/

ts

Fig. 38. Comparatia cromatogramelor peptid.elor produse prin digestie cu tripsna a hemoglobinei normale 6ffe; gi h.e-moglobtnei din celule falóiforse (I{bs) din care teiese modifiss3sa ln pozifia peptidei 4.

aeeastà tlelzà, s-a tr,as comcltuzia cà o schimbare în secvenfa de nucleotide determinà înlocuinea unui aminoacid cu altul, de unde dovada oolinearitàfii nucl,eotide anninoracizi, respectiv o colinearitàtii genà-proteinà. fur an'ul 1952 Doumce $i apoi în anul 1954 Gamow, bazafi pe desooperirea lui Astlbury gi Bell din 1938 care au constaúat prin ceroetàri crisúalografice cà spaliul dintre urucleotide l,n ADN este aproximativ egal cu spa{iul dintre aminoacizi în ca,tena polipeptidicà, emit ipoteza potriviú càreia secvmfa, lùniarà de nueleotide d,in ADN determinà secventa liniarà a arninoacizilor din catenele polipeptidice ale moleculelor proteinice. Gamow a analizat s'tatlstic relafla dintre polinucleotide, reprezentînd cuvinte lunagi scrise intr-un alfalbet cu patru iiùere (cele paftru ibaze azotate) gi poli,peptidice, reprezentînd cuvinte lungi scrise într-un alfabet cu 20 litere (reprezentate de crei 20 amin'oacizi prineipati). Dacà seevenfa de nucleotide din acidul urucleic determinà secven{a de aminoacizi dilr polipeptidà se pune problema relafiei dintre cele 4 herze azota'te gi cei 20 aminoacizi principali în termeni de determinare cantitativà: cîte baz,e azotate determinà un aminoacid? Dacà se' admiúe cà o singurà bazà azotatà deùerminà (specificà sau codificà) un singur aminoacid atunci în virtutea relafiei 4L:4 nu vor putea fi specifica{i decît 4 aminoaqzi. Tot astfel eombinàri de cîte douà 'baze azotarte, potrivit rela!Íei 42:16 sînt instrficiente spr,e a specifica toti cet 20,ami118

noacizi principali. Doar combinàri de cîte 3 baze azotate (43 - 64) pot sà ofere posibilitatea specificarii tuturor celor 20 aminoacizi principali qi sà mai ràmîmà încà qi alte posibilútàti
suplimentare de specificare. Relalia nucleotide-amin,oacid a fost dovedità experimental studiindu-se mutafiile induse de càtre acidul nitros la VMf,. a càrui capsidà constà din 2L50 catene polipeptidice ideurtice, fiecare confinînd cî'te 158 amimoacizi. Mutatiile indtrse de càtre acidul nitros sint tmnzifiii de tipul A. + G sau C -+ U (vezi, mutageneza). În urma aparifiei acestor mutalii la nivelul nucieotideloldin ARN genetic al, \[VIT, care îndeplíneqte qi rul de ARNrn, apar modificàri qi în catena polipeptidicà. Aceste modificàri sînt de tipul unor substitufii de aminoacizi: Prolinà -> Serinà -+ Fenilalaninà sau Prolinà -> Leucinà - Fenilalaninà. S-a dedus cà Prolina esúe specificatà de un codon la care ceÌ pu{in douà nucleotide sînt fie A, fie C. Tranzifia A -+ G sau Q + U a unei,a din ac,este nueleotide trebuie cà genereazà codonul Serinei, respectiv pe acela aI Leucinei. În oodonul Fenilalaninei ambele mucleotide trebuie sà fie G sau U. Pe seama unor deducfii asemànaùoare qi a analizei variantelor hemogtobinei umane, Nir,enlberg a descifrat în 1961 codul genetic. Efectuîndu-se studii genetioe €supra mutantelor induse cu proflavinà la bacterinfagul Ta s-a dernonstrat experimental cà unitaùea care codificà un aminoacid este tripleta de uruclEotide care s-a numit codon. Asemenea studii în care s-au aplicat teste de recombinare cu tipul sàlbatic au conrdus la ooncluzia cà în urm,a acfiunii proflavinei are loc fie adifia, fie delefia de baze din secvenfa polinueleotidicà. Astfel, existà mutante inifiale nota,te convenlional cu ,,-(ú qi mutante naturale de reversie notate cu ,,f c. O secventa initialà, normalà de nuclieotide va fi citità din trei îrr trei baze azotatm spre a dirija de fiecar,e datà plasarea fur lanlul polipeptidic a unui aminoacid. Dacà se admite cà secventa de nucleotid,e reprezentind cadrul de citire începe sà fie citità dintr-un punct fix, delefia unei singure perechi de urucleotide va duce la schimbarea tuturor tripletel,or, modificînd cadrul de citire Ei atunci în oatena polipeptidicà r'or fi încluqi cu totul alfi aminoacizi decît în cazul normal' Are loc citinea greEità a aodului. Astfel, dacà cadrulr
119

normal de cirtire est'e GACG. GAG. GAG. GAG, insmlia uniui singur C Ia nivelul sàgefii va determina urmàtorul cadru de citire: GAG. GAC. GGA. GGA. etc. Tot astfel dele,tia lui A va produce de aseme,nea schimbarea cadrului de citire GAG. GAG. GAG. GAG Ei atunci secvenla de triplete va fi GAG. GGG. AGG. AGG. etc. În ambele cazuri este sehim,bat totalmente cadrul de citire mai ales dacà asemenea alrteràri se produc la începutul genei. Se sintetizeazà o proteinà anormalà, mutantà sau
nefunclionalà. Dacà în urma mutafiei, dupà ce a avut loc inilial o delefie a unei perechi de baze azotate, va avea loc adifla unei alte perechi de baze ,azotate îur porliuni 'adiacente a,le aceùeiagi gene se poate restabili ordinea ur'ormalà a nucleotidelor (se reface cadrul de citire) Ei ea va fi citità normal. Astfel, considerîqrd polinucleotida GAG, inserlia lui C urrnatà de delelia lui A va refaee cadml normal de citire, va avea loc o citire corectà a sa $i se va sintetiza ur-r polipeptid normal:

GAG. GAG. GGA. GGA. GGG. GAG. GAG... chiar dacà cîteva triplete pe portiunea în care se realizeazà aditra qi dele{ia vor fi modificate. Delefia sau adilia uneia, a douà sau a patru pereehi de nucleotide nu reface ordinea normalà a nucleotidelor respectiv a codonil,or qi are loc sinteza unei proteine mutante. În anul 1961 Nirenbeng qi Matthey pe de o parte qi Ktrorana pe de alta, folosind ARNrn sintetizafi artificial ce aonfineau o secven!à cunoscutà de nucleotide, au r,euEit sà sintetir,ez,e i.n uitro diferite polipeptide în sisteme aceiulare care oonlineau ribozomi, factori proteinici necesari pentru sinteza polipeptidicà precum qi tot setul de ARNf. S-a analizat apoi oompozilia polipeptidelor sintetizate. Astf,el cînd au folosit un homopolimer poLiribonucleotidic format numai din uracil @oli U) a fost sintetizatà in uitro polipeptidul polifenilalanina. Astf,el, s-a demonstrat cà tripleta UUU specificà aminoacidul fenilalanina. Cînd s-a f,olosi;t poli-C s-a sintetizat polúprolin,a. Poli-A determinà sinteza polilizinei. Numai poli-G nu a putut fi verificat inifial càci formeazà între nesturile guaninà puntl de hidrogen care determinà aonformafli spaliale multicatenare spirale la care rirbozomii nu s,e pot ataEa. Ulteri,or s-a stabilit cà GGG codificà glicin;a. Experienlele de verÍficare a proprietàtilor de oodificare al,e polimeritror au fost oontinuate luîndu-se ùr considerane oopolimeri. Pe aceiastà bazà. s-a stabilit cà poli A-G deùerminà încorporarea lizinei într-o catenà polipeptidicà
120

'

peptidicà a alaninei, argininei gi prolinei. O secvenla repetitivà CUCUCU determinà sinteza unui polipeptid în care leucina alberneazà cu serina. Au fost folosifi ,aPoi oopolimeri cu 2 ,baze azota,te in proporfii diferite qi cu 3 rbaze azotate diferite reugindu-se sinteza de polipeptide artificiale în care erau incluqi divergi aminoacizi. Prin asemenea experienfe s-a putut de'termina direct relalia de specificare a aminoacizilor de càtre nucleotide. Dar prin ele nu se putea stabili ordinea nucleotidelor în cadrul tripletelor. Pentru aceasta a fost sintetizat artificial un ARNm alcàtuit din douà nucleotide diferite dar la care se gti'a care este ordinea acestor nucleotide. De exempliu s-a oonstruit un ARN,rn artificial de tip UGU-GUG-UGU-GUG etc. qi s-a constatat cà el dirijeazà sin,teza unui polipeptid în care cisieina alterneazà cu valina" Pe aceastà cale s-a putut determina experimental ordinea nucleotid,elor celor mai multe triplete. Ulterior, pe ,baza unor tehnici sofisticate care au inclus hidroliza ritbonucleazicà a ARNrn, ultracentrifugare,a fracfionatà Ei electroforeza I'izaùelor, cromatografia pe hîrtie cu stabilirea Jingerprinú-urilor diferitelor oligonucl'eotide,'analiza spectrofotometricà în ultraviolet Ei analiza ,,de vecinàtates prin care se poate stabili p'ozllia radicalilor fosforici s-a putut deterrnina ordinea nucleotidelor în diferitele triplete. În studiul codificàrii bi'ochimice a fost apliaatà Ei metoda ARNú fixali pe ribozomi sub inidentificàrii aminoacizilor fluenla unui codon cunoscut. Aceastà metodà ca Ei cel,elalte prin care s-a descifrat codul genetic s-au bazat pe constatarea cà ionii Mg++ în ooncentrelie mare împiedicà disocierea ribozomilor 70 S în subunitàtile sale Ei permit acestora sà inilieze traducerea fàrà oodonul inifiator AUG. Astfel, în 1964, Nirenberg a sintetizat trinucleotide cu secven{e de baze cunoscute, acesfea au fost asociate cu ribozomii Ei s-a urmàrit care dintre ARN' se leagà l,a un ras€ít€o€a complex. De exemplu, trinucleotidul 5' GCC 3' legat la rirbozom a determinat ataqarea la oompiexuÌ. format doar a ARNf pentru alaninà dintr-un amestee de diferill ARNf. Tot astfel, 5' GUU 3' aclionînd ca A-RNrn, determinà Legarea la ribozomi doar a ARNú pentru valinà. Pe aceastà cale s-a putut stabili direct semnificafia de codificare a fiecàrui codon. Astfel, s-a rezolvat semnifica{ia d'e codificare a trei izomeri UzG: UUG-leucinà; UGU-cistenà; GUU valinà. Folosind aceastà cal,e s-a reuEit descifrarea în totalitate a codului genetic. Crick a sugerat aranjarea codonilor într-r-rn tabe'l c,ane sà reprezinte grafic oodul genetic. Semnificatia acestui

pe cînd poli C-G determinà încorporarea într-o catenà poh-

t2l

tofansintetaza de E. coli, qí proúeina \lAdT. Mutafiile de su'bstitufie afecteazà de regulà o singurà nucleotidà din catena polinucleotidicà. O mutafie de substitulie care apane cu mane frecvenfà la hemoglobfura umanà duce la înlocuirea valinei cu izoleucina. Cum valina este codifica'tà de GUU ian izoleucina de 1 A 2U s-ra, tras eonehrzi,a eà ,ordinea nucleotidelor îm tripleta izoleucineí este AUU, codonul va}inei devenind prin sutbstitufia G cu A codonul izoleucinei. Printr-o anafizà de acest fel s-au putut d,ovedi experimental raporturile de oodifi@ne gi s-a descifrat oodul genetic (fig. 39). Cea mai ,neambigua validare a codultui ggnetic stalbilit prin experienfe
q
J 3)

tabel pentru Biologie este cpmparabilà cu ,8c€€è a tarbelului periodic al elementelor pentru Chimie. Au fost studiatc de asemenea mutafiile car€ determinà substitufia unor aminoacizi dÍn mol.ecula unor proteiure birrecunoscute ca sesvenfà de alninoacizÍ cum sînt hemoglobina, trip-

J O

, c
a

c.od.onii îlor$rerur, eare

GIr-NII' - glutarnlna; Gly : glicina ; Mct : metionina; Phe : fenilalanina; Pro : prollne i Scr : serÍna; Tht : treonina; Tr! : triptofan; Tyr : ttrozite; Yol : ynlilg. Codonii ocr*, amber V ofal desemnafi cu un ceîc îregru dnt
nu specificó nici un ntninoacid, teprezentînd. codoni terrnii{

Fig. 39. Reptezentarea codului genetic ARNza. Codonii se formeazl ponrind din centnr spte periferie. La periferia cercului sînt dispugi sminsa,gizií codlficafl de eodonii corespunzàtorl. Ala : alanina; Ary : argininl; AsP : acid aspartlc; lsy'-Nlfr : ssParagina; Cys : cisteina; Gkt : aciil glutanric;

natori ai catenei polipeptidice. Codonii desemnafi cu us, triuaghi sînt codon' tniliatori ai catcnei (AÙG gi GUG). Cu un pétrat sint dese'.'nali alinoacizii codificali de codoni tltferiti care se deosebesc dupé prima bazé.

t22

donii care specificó dilerifi aminoacizi d.intr-un fragmenl at proteinei interne & capsldei. Secvenfa d.e nucleotítle din ARNllerRlT ca gi cea de a,minqsqizi 6in proteina capsidei au fost însé total stabi[te, lenaîcindu-se colinearitatea nucleotlde-arnheagizi 9i în acelagi timp veridicitatea codonilorflstabilifi prin experiente inclirecte (dupó Goodenough & Levine, 1974).

Fig. 40. Un fragmsn! rlin ARNz de R17'cu co-

,"u

Ir cr, i A
meljU

/u' <U _

À

i\ tn. 'c\
Ù)

Al
g
A.

Lu rir [c In !U [c serl C Lr, iU rgiG iC

[L ;sn i A In |-A tr,'ulU

li-, - LT

'.C

u l.r. tJ J Ci
A.rlo'.

,

I

lire
iren
lara

U

_l

i.J_j

i-:-J

!

G-l

c

c it'e GJ. Al .A lasn cl
C
c

Ul AI

lillo ''" Lu
in uitro a fost r,ealizatà prin
teza proúeinei capsidei.

.-, f-G

Ul

cr

|te,"

compararea secvenfei de ,aminoacizi din pnoteina capsidei fagului R17 cu secventa de nucleotide a ARNnz de .R17 în r,egiunea moleculei care dicteazà sinSeevenfa teoreticà, stabilità prin experiente in uitro s-a consúatat a eorespunde exact cu secventa de amirroacizi din pr'oùeina capsidei (fig. 40.)

3. CARACTERISTICILE CODULUI GENETIC

Sînt posibili 64 de codoni sau tripleùe potrivit relaliei Dintnc aoestia doi sînt eodonii de inifiere gi anume AUG $i GUG, care mareheazà începuhrl uo€ii caterte polipeptidice. Ei deterrninà initienea oatenei polipeptidice prin fureorporarea formilmetioninei la E. coli qi metionfurei la eucarioùe. Alti trei codoni nu oodificà nici un aminoacid (sînt oodoni
43

:64.

t23

nonsens), ei indicînd însà sfîrgitul unei catene polipeptidice (codorú sfop). Acegtia sînt codonii ocru- UIAJ{, arnbrd: IIAG qi azw: UGA. Codonul UGA separà genele în cadrul unui mesaj genetic policistronic. Codul genetie are cinci canacùeristici esenfiale: este universal, neacoperit, fàrà virgule, degenerat gi ambiguu. Caracterul de uniuersalitate al codului genetic ne aratà cà r:n anumit codon codificà un acelagi amimoacid. la orice organism, indiferent de treapta evolutivà pe care se aflà, de la virusuri pî,nà la om. Prin mutafle codul genetic il'tu se sehimbà; este schimbatà informalia ereditarà, iar în traducerea acesteia într-o proteinà mutantà funclioneazà acelagi cod care functjoneazà Ei în traducerea informaliei er'editare normale de la tipui normal (sà,l'batic). Universalitaùea codului geuretic a fost demonstratà experimental în cazul sintezei proteinice desfàgurarte în sisteme ,acelulare provenite de la ,bacterii qi mamifere sub influenla unui aeeluiagi ARN,nz sintetizat ,artificial, cînd se oblin aceieaEi proteine, indiferent dacà sistemul aoelular este provenit de la bacterie sau de la mamifer. Hemoglobina de iepur,e a putut fi sintetizatà artificial folosindu-se ribozomii qi ARNnz din reticulociùe de iepure gi ARNú de E. coli. Experienfele de inginerie geneticà (prin care gene de la m,amifer pentru insulinà, pentru hennoglobirlà, pemtru hormonul de cre$tere, pentru o?Lgiotensittd, II precum qi g,ene ritbozomale sau pentru histonà de la arici de mane qi drosofilà au fost introduse în celula rbacteriarrà E. coli) au aràtat cà poate fi dirijatà sinteza de produqi ge,nici specif,ici eucariotelor, folosindu-se aparatul tbarcterian de traducere ribozomul. Este dovad,a clarà a universalitàlii codului genetic. Dar, pro'ba,bil cea mai evidentà dsmourstrare a universalitàîii oodului gernetic a fost realizatà de J. Gurdon, care a puri,ficat ARNnz pentru hemoglo,binà din reticulocite de iepure gi I-a injectat în ovocite de b,roascà unde aparatul de sin0ezà proteirnicà, de traducere a mesajului gen,etic al broaEtei sintetizeazà he,mogl,obinà stabilà de iepure, chiar dacà celulele ovocitare nu simtetizeazà niciodatà hemoglobinà. Mesajul genetic al oricàrui sistem biologic poate fi tradus de maginària de traduc€re a .oricàrui alt sis'trem rbiologic. Codul genetic este deci universal. Neacoperirea cod,onitor. Codonii succ€sivi, vecini, în oare se organrz,eazà,,o secventa de nuoleotide a ,unei gene ce specificà o proteinà da,tà nu se aooperà, nu-qi împrumutà nucleotide, nu au nici o nucleotidà comunà. Ei reprezintà unitàti de codi-

t24

ca aceqtia sà se suprapunà. Douà caracteristici ale codonului genetic sînt foarte importante în traducerea mesajului genetic. Este vorba de degenerarea qi arnbiguitatea codului genetic. Carocterul de degenerare a codului genetic ne aratà cà in unele cazuri un acel,aqi aminoacid este specificat de mai mulfi codoni. Astfel, feniltala,nina este specificatà de UUU dar gi d'e UUC. Serina este specific'atà de 6 oodoni: UCU, UCC, UCA, UCG, AGU, AGC. Tot astfel leucina este codificatà de 6 codoni: UUA, UUG, CUA, CUC, CUU, CUG. Dar codonii în care predominantà este guanin,a (ce determinà aparilia de structuri secundare) sînt de regulà ineficienli în biosinteza proteinicà. Diferi{ii codoni care au însà primele douà nucl.eotide identice pot specifica acelagi aminoacid. $i aminoacidul argininà este codificat de 6 triplete. Numai metionina gi triptofanul sînt codificali de cîte un singur codon (AUG respectiv UGG). Ambiguitstea codului genctic este redusà. Ambiguitatea înseamnà recunoaqterea de càtre antioodonul dintr-un ARNú a mai multor codoni din ARNm Ei deci posibilitatea ca un codon sà specifice mai mulli aminoacizi. Astfel codonul AUG este recunocut atît de càtr,e antictdonul' lui rtFtNúmer (cînd este în interionrl mesajului cadrului de citire) cît Ei anticodonul lui ARNúrme' (cînd este I.a începutul oadrului de citire). Tot la fel, codonul GUG poate specifica atît formilmetionina cînd este la începutul cadrului de citire cît gi valina cînd este în interiorul mesajului. Amin,oacizii cu proprietàfi structurale similare au tendinfa de a avea codoni înrudifi. AEa se face cà acidul aspartic qÍ acidul glutamic prezintà codoni similari GAU gi GAC în primul caz, respectiv GAA Ei GAG în al doilea caz. Tot astfel aminoacizii aromatici fenilalanina, tirozina qi triptofanul sînt codificali de triplete care încep cu U. Se admite cà aceastà proprietate de oodificare a fost stabilità în decursul evolufiei, ea prezentînd avantaje errolutive càci înlocuirea prin mutalie a unui aminoacid cu altul în catena polipeptidicà este cu atît mai pufin dàunàtoare cu cît aminoacizii înlocuifi au proprietàli
725

îrcar'e de sine stàtàtoare, nesuprapuse. De asemenea, între sfîrEitul unui codon Ei începutul codonului urmàtor nu existà spalii sau nucleotide. Codui genetic este agadar fàrà virguìe, lipsind semnalele speciale care sà marcheze sfîrgitul unui codon qi începutul codonului urmàtor. La fagul cp X 174 gene diferite, adiacente însà îgi împrumutà nucleotide sau codoni fàrà însà

5'

Acfl
ARNrn
( codoni)

Anticcdoni drn
AFìr\{i

Fig. 41. Decodificarea informaliei ered.itare

ritatea qi antipolaritatea tripletelor rtin ADN, codonilor din
ARNza.gi a anticodonilor din ARNú).

(complementa-

mai asemànàtoare, ceea ce face ca proteina mutantà sà poatà

Crick a elarborat ipoteza oscildrii (utobbte) spre a explica ambiguitatea. Astfel, U aflat în pozifia a 3-a în tripleta anticodonului, la capàtul 5' al acestuia se poate împerechea atît cu A cît qi cu G. Astfel, primel,e douà nucleotide sînt cele rnai semnificative $i mai exacte în codiîrcare, pe cînd cea de-a treia bazà a codonului este oscilantà. Flexibilitatea celei de-a treia baze a unui codon a prezentat de asemenea avantaje selective minimalizînd consecinfele erorilor. În cadrul interacfiunii codon-an'ticodon (fig. 4l) interaclioneazà mai întîi nucleotid,a capàtul,ui 5' al codonului cu nucleotida capétului 3' al anticodonulrui. În al doilea rînd interaclioneazà nucleotidele plasate la mijlocul codo'nului qi anticodonului. Dupà Criok, se admite cà, odatà împerecheate primele d'ouà baze, cea de-a treia bazà, din codon Ei anticodon prezintà o oarecare oscilalie în împerechere. Astfe1 baza purinicà inoszrzo (I) car€ prezintà proprietàli strueturale asemànàtoane guaninei se aflà în unii anticodoni qi se poate împerechea în mod normal cu citozfura (C) din codonul ARNrn. Cînd însà I ocupà pozilia a treia in anticodon ea se poate împerechea cu U sau cu A aflate în pozifia a treia în codonul ARNrn. Asemenea împerecheri de baze se numesc perechi de boze oscil.onte (wobbl,e). O moieculà de ARNú ce ar€ ataEatà serina qi avînd anticodonul
L26

fi încà funclionalà.

ARNm pentru serinà UCC, UCU, qi UCA. Tot astfel U plasat în pozifia a treia în anticodon se poate împerechea atît cu A cît gi cu G plasali în pozilia a treia în eodonul ARNrz. Regulile,,wobbler pentru împerecherea codon-anticodon atestà existenfa a numai 54 anúicodoni care sà se împerechgze cu 61 codoni deoarece baza A nu se aflà miciodatà în prima pozitie a anticodonilor. Absenfa lui A din prima pozifie a tutur,or an,ticodonilor cunoscufi se crede cà este rezul,tatul acfiunii dezsrninazei anticodonale care schimbà adenina la hipoxan'tinà, antiaodonii care încep cu inozina (I) fiind caracteristici aminoacizilor care sînt codificafi de mai mult de doi codoni aqa cum este valina (Jukes, 1977). Absenla unui antioodon IAA penúru femilalaninà se explicà prin elúminarea sa din cauza letaiitàlii càci s-ar putea ,,împerechea greqit( cu UUA (teucinà) qi cu atfi oodoni ce specificà cu totul,a$i aminoacizi. Jukes apreciazà cà mai curînd dezaminarea anticodonukri gi nu ,,oscilarea( explicà de ce nu se întîlnesc 61 tipuri de ARNú. Unii anticodoni din moleculele ARNú confin baze modificate în pozifia I, altele decît hipoxantina. Asemenea modificàri màrese oscilarea codon-anticodon fàrà insa a genera ambiguitate în îurcorporarea amilroacizilor în timpul sin'tezei polipeptidice. Eaolugia cod,ului. Universalitatea codul'tri genetic la organismele acttrale este un indiciu pe de o parte a vechimii sale, iar pe de alta cà e} a ràmas, neschimbat în cursul evolugiei. S-au emis douà ipoteze cane ar explica aceste aspecte: ipoteza ster*shimicà gi ipoteza accidentul,ui înghefat. Ipoteza stereoelti.micd admite existenfa unei relafli sterice dintre codon, respeetiv anticodon qi arninoacidul specificat. Stebilitatea evolutivà a codului ca gi struetura sa au derivat din stereochimia preordonatà a elementelor saùe. Ipotem accidenhúui înghefat admite cà structura codului genetic a evoluat prin hazard dar, din momentul în care în celula ancestralà comunà ,tuturor formelor prezente actuale au fost stabilite relaliile exacte de codificar,e, acestea au devenit vitale, încît o evolufi.e ulterioarà a codului a devenit imposibilà. Orice mutalie în relafiile de codificare a devenit letatà pentru individul biologic l,a care ac€asta a apànrt. Prima ipotezà nu es'te probatà de experienlele în care alanina ataqa,tà la ARNú pentru cisteinà a fost inclusà în catena pol,ipeptidicà în locul cistein,ei. Aceasta aratà cà aminoaeidul nu este ,,vànat( de codonul din ARNrn în etapa de asamblare a polipeptidutui. Sînt date care araúà cà aminòacidul'nu este re721

3'-AGf-5' va interacgiona cu codourii

înainte chiar de apari\ía aminmcil-ARNt sinbetazelor, ca,re au înaltà specificitate ca Ei înainte de aparifia însàgi a adaptorului ARNú. Sinteza proteinicà 1a început, dupà Crick qi Woese a fost un pnoces imprecis, desfàgurat cu un grad scà2t de speeificitate funclionalà, în proteinele protoorganismelor putînd intra oricare dintre amin,oacizii unui gnrp care sirr-t similari structural. De exemplu, unul qi aoelaEi codon ar fi putut specifica alanina qi glicina, ,al'tul treonina qi serina. În oodonii tripleli ambigui primitivi numai primele douà nucleotide participa în realitate în procesui, de recunoaqtere. Ulterior, cea de a tneia urueleotidà a fost inclusà în procesul de recunoajqtere deqi la un nivel mai scàzut de specificitate decît cea admisà prin ipoteza

lui. Este însà foarte prdbabil ca asemenea nelafii stereochimice sà fi fost de mare importanfà în etapa timpurie ,a istoriei vielii

cunoscut de càtre anticodon în etapa de activare a amrnoacidu-

oscilàrii. Ipoteza accidentului înghefat este pe de o parte dificil de respins Ei pe de altà parte gr,eu de sprijinit cu date actuale.

4. BTOSINTEZA PROTEINICA.
Proteinele joacà un rol cheie în meta,bolismul ceiular. Însàqi func{ia materialul,ui ereditar este condifionatà de funcfionarea proteinelor cu rol enzim'atic sau structural. Enrzimele participà la replicarqea ADN gi ARN, la transcrierea genetica etc. Proteinele structurale intrà în structura cromatinei, în componenla membranelor, a altor componente oelulare qi participà la asamblarea însàgi a ribozomilor. Toate r,eacliile chimice din celulà sînú cartalizate de regulà cle ,enzime. Enzimele proteine tipice participà în însàqi sinteza proteinicà. Ast- cîteva sute de molecule de diferite proteine sînt necesare fel, pentru sinteza unui sin,gur lan! polipeptidic. Este o reînnoità povarà pentru celulà sà sintetizeze o catenà polipeptidicà, dar ea este cerutà de o traducere exactà a mesajului genetic. Proteinele sînt polimeri de aminoacizi. Toli aminoacizii, cu exceplia prolinei, au o structurà de bazi comunà, prezentînd un radical R, o grupare COOH Ei o grupare NHz. Prolina are doar gruparea COOH Ei un atom de N inclus in radical. Unii arninoacizi sînt b,azici (iizina, arginina qi histidina). Lizina poartà un rest NHz în cadrul radicalului.
L2B

Acest rest are tendinfa de a accepta protoni devenind Alfi aminoacizi sînt acizi purtînd la nivelul radiea'lului-NHt. resturi COOH care au tendinla de a pierde protoni. Existà Ei amin,oacizi aromatici care prezintà inele nesaturate de carbon în radicaiii lor. Doi aminoacizi poartà un atom de sulf în radical (cisteina, metionin,a). Legarea aminoacizil'or între ei (polimerizarea) se face în urma inter,acliunii grupu,lui a-NH2 al, unui a,tninoiacid cu grupui a-COOH al celui de-al doilea aminoacid cu elirberarea unei

OH ilt molecule d,e apà. Se formeazà, o legàturà peptidicà A-C-N-.

Prin polimerizarea aminoacizil'or rezultà o ca,tenà polipeptidicà

care are un schelet de N qi C sub formà de zig-zag analog scheletului glucido-fosforic al catenei polinucleotidice cu radicalii R

proiectafi în afarà într-o manierà alternativa. Distribuirea liniarà a aminoacizilor în caúena polipeptidicà reprezintà stu:uotura primarà a potrifptídei oonsideratà. fn a,numite condilii fiziologice, de temperaturà sau de pH ,Er€ ioc interacfiunea diferililor aminoacizi din catena polipepticlicà prin intermediul unor punti de H, al, unor legàhrri bisulfidice (S-S) clucînd la configuralii spafiale bi- sau tridirnensi,onaie. Prin punîi de hidrogen dintre aminoacizi vecini rezultà o structurà secundarà regulatà numità aonfigura{ia u-helix, ai càrei modei a fost elaiborat pentru prima datà de càtre 1,. Pau-. Iing înainte de 1940. Proteinele pot fi alcàtuite dintr-o singurà catenà polipepticlicà (mioglo,bina, histonetre, ADN-polimeraza etc.) sau din 2, 3 sau n catene polipeptidice în care caz ele prezintà o str"ncturà cuaternarà. Astfel, hemoglobina ,este alcàtuità din patru catene polipeptidice separate numite globine, douà catene cú Ei douà cate'ne B, rasociate într-un mod complex. ARN polimeraza de E. coli este o proteinà oligomericà alcàtuità din 6 subunitàli polipeplidice.
4.1. DESFASURATiEA

pnocnsur,ur DE BrosrnrnzÀ

I'ROTEINICA

Ribozomii joacà un rol esen!Íal în ibiosin't'ez.a proieinicà, adicà în decodificarea informafiei genetice. Ei condili'oneazà interacfiunea speciflcà, codon-onticodun, fapt evidenliat prin eln$ - Dr:;cifrind tainele ereditatii, vol. I 129

perient€ în care s-a urmàrit ac{iunea streptomicinei. S-a constatat cà acest antibiotic poate altera procesul de decoriilicare a ARNnr. Streptomicina reduce de trei ori rata de încolpcrare a fenilalaninei în polifenÍi'alaninà cînd se folosegte un sistem acelular de sintezà proteinicà în care în calitate cle AIìirTr:i. est'e utilizat poli-U. Reducerea ratei de încorporare rr fenilai.aninei este însà înso{ità de încorporarea leucinei (CLTTJ), izoleucinei (AUU), tirozin,ei (UAU) qi serinei (UCU). Con:luzia e.ste cà prezenfa streptomicinei permite altor tipuri de ARNú, altele decît ARNú legitim pentru fenilalaninà sàr ràspundà Ia codonii tlUU în traduc€rea ARNm poli-U. Citirea greqità a codului genetic este determinatà de interacliunea streptomicinei cu ribozomii din am,esúecul d.e re,ac{ie a sistemului acelular de sintezà proteinicà. Situl de acliune al streptomicinei este subunitatea ribozomalà 30 S, fapt dovedit de experiente de asamblare a particulelor ri'bozomale din subunitàîi 30 S de la tipul mutant re zistent la streptomicinà gi subr.rrnitàti 50 S de Ia tipul nornnal sensirbil. Asemenea ribozomi sub acfiunea streptomicinei nu condifioneazà o citire greqità a mesagerului genetic. Nomura a efectuat experienfe de disociere a subunitàtilor 30 S extrase de Ia bacterii rezistente qi de la ,bacúerii sensi'bile la streptomiein^à qi a separat proteinele ribozomale din aceastà subunitate (21 proteine ribozomale S) prin eL,ectroforezà,. Dupa 6ceea a reconstituit suibunitati rirbozomale 30 S prin amestecarea de variate combinafii ale celor 2L de proteine ribozomale S cu molecule de ARNr 16 S. Subunità{ile 30 S reconsti,tuite au fost amestecate cu subunitàîi 50 S gi au rezultat ribozomi care au fost folosifi în sisteme acelulare de sintezà proteinicà. Nomura a constatat cà sensibilitaúea sau rezistenla ribozomilor reconstituili la citirea greqità indusa de streptomicinà a mesajului genetic confinut de ARNnz depinde în întrqgime de faptul dacà o singurà proteinà ribozomalà S, qi anume proteina ribozomalà S12, derivà de Ia subunitàti 30 S a'le rbacteriilor streptomicinosensi'bile sau streptomicino nezistente. La formele sensi,bile ia streptomicinà, acest antitbiotic se combinà cu douà situri din ARNr 16 S blocînd sinteza proteinicà. Tulpinele rbacteriea-re rezistente la streptomicinà au proteina Srz modificatà, ceea ce face sà fie ascunse cele douà situri de legare a streptomicinei. Dovada, suplimentarà cà proteina ribozomalà S12 participà în procesul de recunoaqtere codon-anticodon a fost adusà de constatarea cà unii supresorÍ nonsens care sînt eficienfi ]a tipul sàlbatic, normal streptomicino-sensitbil sînt ineficien{i la mutan$ii streptomicino-rezistenfi. Secven]ier'ea aminoacizilor pro130

teinei ri'bozomale Srz a evidenliat faptul cà la tiput str,eptomicino-rezistent apar substítufii de a,minoacizi în pozifiile 42 sau 87. Iatà deci cà o simpla substitutrie de aminoacizi în oatena polipeptidicà Srz interferà cu fidelitatea cu car€ oodonii ARNm sînt împerecheafi cu anticodonii ARNú în procesul deoodificàrii mesajului genetic. Desfàqurarea procesului de biosintezà proúeinicà presupune inifierea, alungirea qi terminarea catenei ca qi în cazul sintezei polinucleotidelor
4.I.I. INITIEREA CATENEI POLIPEPTIDICE
arnin,oacid N-terminal qi terminùrd cu un aminoacid C-terminal. ARNrr, care poartA mesa{ul peurtru sinteza unei catene po-

Catena polipeptidicà ,este sintetizatà treptat înoepînd cu un

lipeptidice qi care deci dicteaza secventa de aminoacin a acesteia este citit stadial de càtre aparatul de sinúezà protefuricà, cîte un codon la fiecare moment, începî:rd de la capà,tul 5' spre capàtul 3', fiecare oodon fiind r€cunoscu,t de catre antioodonul cor,espunzàtot din ARNú, aoesta din urmà purtînd un aminoacid corespunzàlot codonului dfut ARNm. Zamecnik gi Hoaglancl au ajuns la concluzia cà prima etapà în biosin,tez,a proteinicà este activarea aminoacizilor cu ATP catalizatà de càtre enzime orninoaeilsinúetnze specifiee fiecàrui aminoacid. Ac,este enzime au fost descoperite de càtre Paul Berg de l,a Standford University. Ele se mai numesc amino-orcil-ARNú-sizúefuze qi reprezintà factorii celulari care ,,cunoscc eodul genetic, deqi însàgi secvenla lor Ce aminoacizi este codificatà în ADN. Aminoacizii nu se ataqeazà direct la matrileùe ARNmciprin interrnediul ARNú care repr,ezintà o moleanld adaptmre de racordare specificà, recunoaqterea oodon-anúicodon avînd loc pe principiul împerecherii de baze complementare cu f,ormare de punli temporar,e de hidrogen. AtaEarea aminoacidului la adaptor ,este catalizatà de enzima amirwacilsintetozd care foloseEte e'nergia rezultatà prin hidroliza ATP. Enzima se ataEeazà tra gruparea lateralà a aminoacidului (fiecare aminoacid are enzima sa specificà de activare) Ei Ia molecula adaptorului (bucla a patra a dihidrouracilului). Aminoacidul, (AA) se combinà la început cu ATP. Înúre fosfatul din AMP qi grupul carbonil al aminoacidului se realizeazà. o legàturà (-P-O-C-) sta,bilà, rezultÌnd produsul intermediar AA "., AMP. Acesta se leagà ferm de enzima activatoare pînà ee se întîlneEte cu o moleculà
131

de ARNú specificà, corespunzàtoare amirroacidului re-cpectiv. Între riboza adenozinei terminale a gruparii CCA de la capàtuÌ 3' a,l ARNú gi gruparea canboxilicà a aminoacidului se stabileîte
o legàturà sub cataliza aceleiaqi enzime aminoacilsintetaza Energia pusà 1a dispozilia -acestei legàturi de càtre ATP va fi folosità în formarea legàturii pepti-

covaltentà, macr@rglcà.

dice.

Evenimentele de activare a aminoacidului pot
prezentate:

fi

astfel re-

r
II

AAl +ATP
(AA,

aminoacilsintetaza

(AA,

- AIIP)Er*@-@.
AAr

- AMP)+ARlrll

aminoacilsintetaza

- ARNtr+

AMP.

fenilalaninà) intervine ARNú sintetazn pentru fenilalaninà care face ca prin hidrolizà prolina sa fie eliminatà. AmÍnoacil-ARNt sintetrc,a este la rîndul sàu recunoseutà (sau recunoagte) bucla dihidrouracil a ARNú, care este diferità la diferitele tipuri de ARNf de unde qi explica{ia specificitàfii arninmxil-ARNf-sintetozd-ARNú.

Legatura AA ARNú de tip (-C-O-C-) se stabileqte între riboza acidului aderrilic terminal aI, grupàrii CCA-3' gi grupul carbonil al aminoacidului. Iatà de ce aminoacidul nu trebuie sà ajungà niciodatà pe matrifa ARNm. El trelbuie numai sà se ataqeze corect la un ARNú corespunzàtor l,ui. Dacà are loc ata$area gregità a unui aminoacid la un ARNú care nu îi este specific (de exemplu prolina se atageazà la ARNf peurtru

Degi exista mai multe tipuri de ARNú pentru un acelaEi aminoacid, din cîte se cunoaqte pîlrà acum exista doar o singurà aminoa,cit-ARNú sintetvzd pentru fiecare aminoacid. Aminoacilarea ARNú catalúzatà de aceste enzime trebuie sà fie controlatà cu extraordinara precizie càci o încàrcar',e gre$ità a unui ARNú eu un aminoacid necorespunzator lui are aceeaqi valoare ca mutafia, fiind inserat tn catena polipeptidicà ln creqtere un aminoacid gregit (Sdrimmel, 1979). A devenit astfel clar cà ARNú este implicat în reglarea expresiei genice càci concentrafia de aminoacil-ARNú serveqte ca semnal, pentru intrarea sau scoaterea din funcliune a diferitelor gene, intervenind în tnanscrierea genicà la un sit dintre promotor gi prima genà siructuralà (vezi reglajul genetic). Deoarece sinte732

taeele eatalízeazà aminoacilarea ARNf ele sînt direct sau indirect irnplicate în reglarea expresiei anumitor gene. Ataqarea unui aminoacid la ARNf specific este evenimentul în cursul càruia informalia din acidul nucleic este confruntatà cu aminoacidui pentru prima datà. Froblema recunoaqterii aminoacid-ARNú este încà departe de a fi clarifîcatà. Ea este însà extrem de precisà cle vreme ce schimbarea numai a unei baze azotate din secvenla ARNú afectcazà proprietàlile de recunoagtere ale acestuia. Bucla GTìI'CG a ARNú se împerecheazà prin baze cu o -secventà complementarà din ARNr 5 S qi aceasta pare a fi regiunea responsabilà pentru ataEarea la ribozom a ARNú încàrcert cu aminoacidul activat. Lungimea constantà de I'a capàtul 3' al ARNú la bucla opusà a frunzei de trifoi se presu-CCA fi în legàturà cu pozi$ionarea corectà a aminoacizilor în pune a vederea formàrii punlilor peptidice. A treia etapd în inilierea sintezei pr.oteinice se desfàEoarà pe ribozom. Acesta are suprafefe specifice de legare stereoctrimicà corespunzàtoare a ARNm, a AA-ARNf gi a lanfului polipeptidic în creqtere. Rirbozomul asigurà de a$a mani,erà asocierea acestor elemente astfel încît anticodonul sà poatà recunoagte codonul corespunzàtor ducînd astfel la o corectà descifrqre a mesa$ului genetic. Nu se Etie exact care din componentele ribozomale (proteine ribozomaie sau ARNr) îndeplineqte rolul esenfia'l în înlesnirea apoziliei corecte a ARNnz gi a ARNú, dar recent s-a stabilit cà proteina ri,bozomalà contractilà 51 are capacitatea de a determina deplierea ARNn in vederea interacfiunii sale cu rirbozomii, legînd apoi ARNnr la subunitatea 30 S (Blumenthal Ei Carmichtetr, 1979). Ea se leagà ln ribozom la capàtul 3' al ARNr 16 S, dar în ribozomi activi ea se aflà la un sit diferit. Avînd o greutate molecularà micà (70.000 daltoni) se admite cà proteina 51 func{ioneazà, în conformalie alungità. Descifrarea mesajuiui genetic determinà traducerea sa într-o secven!à de aminoacizi asambla{i într-o cat,enà pol,ipeptidicà. Înainùe de a începe sinteza polipeptidului riibozomul se disociazà în subunitàlile sale sub aefiunea factorului de inifi,ere fF.1. ln cadrul formàrii complexului'de ini{iere ARNrn se leagà de subunitatea ribozomalà 30 S prin secvenfa sa Leader care nu este tradusà. Apoi are loc asamblarea particulei ribozornale funclionale prin atagarea subunitàlii ribozomale mari 50 S. Aminoacil-ARNú se asociazà cu subunitat,ea 50 S a ribozomului. Subunitatea 50 S are douà situri: unul a fost desemnat
133

situl amirwacil (A) qi în el pàtrunde aminoacil-ARNf corespunzàtor codonului din ARNm recunoscut, prin anticodonul din ARNú qi al doilea sit a fost des,emnat situl peptidil (P) aare acceptà moleculele de ARNú numai dacà au trecut prin situl aminoacil, (complexul aminoacil-ARNú trecut prin situl' A suferà probabil modificàri conformalionale care permit acceptarea sa in situl P). Ini{i'er,e,a propriu-zisà a catenef lpolipeptidice are loc atunci cînd situl A aL unui ribozom expune reacliei de recunoagtere codon-anticodon acel codon de inifiere AUG din ARNrn. Acest codon de iniliere corespunde primului .aminoacid din catena polipeptidicà. Sitlrl A este ocupat în iniliere de un ARNt pen,tru formilmetioninà la pr.ocari,ote sau metioninà 1,€r €ucariote, care prirn anitioodonui sàu 3' UAC 5' recunoaqte codonul iniliator 5' AUG 3' din ARNrzr.. Acest ARNI are ataEat aminoacidul formilmetioninà respectiv metioninà. Dupà recunoasterea codon-anticodon, ARNú care are ataqat primul aminoaci.d al catenei potipeptidice se deplaseazà În sittll P, miEcare realizatà prin înaintarea ARNrn prin ri,bozom sau in.rer:., prin înaintarba ri,bozomului pe ARNm (miqoare de transla!ie), ceea ce face ca situl aminoacil, sà vinà în dreptul urmàtorului codon din ARNrn. Se înlelege cà miEcarea de translafie se face de fiecare datà pe o distan!à ce corespunde la un codon. Toate catenele polipeptidice înoep cu aminoacidul metioninà. La procariote toate catenele polipeptidice incep cu N-formilmetionins, car€ este astfei un aminoacid ,blocat de grupul formit. Dupà sinteza pofipeptidei, grupare,a forrmil poa'te fi eliminatà. Metionina .este specifica,tà de codonul 5'-AUG-3' din ARNzzz, recunoscut de anticodonuL din ARNt'er si acest {ftxr1met este un ARNf de inilier,e. Principiui citirii codonului de càtre anticodon est'e urmàtorul: dacà un codon din ARNrn este 5'-UUG-3' el va fi recunoscut de càtre un, anticodon din ARNú scris în dir,ec{ira inversà adicà

3'-AAC_.5'. Atît metionina cît qi formilmetionina au ca anticodon 5'CAU-3'care se va împerechea cu codonul 5'-AUG-3'qi

acest oodon AUG reprezintà codon de ini{iere. Deqi codonul AUG poate fi localizat Ei în interiorul monocatenei ARNm, ARNf de iniliere (iARNt'"') are afinitate rr-umai pentru codonul AUG localizat la capàtul monocatenei ARNm, sau acest codon de inifiere este clispus pe un segment din ARNTa a). o structurà secundarà proeminentà de tip buclà (lwirpin)" În cadrul inilierii (fig. 42) evenimentele se deruleazà. astfel: o subunitate ribozomaià micà imteraclioneazà cu un codon ds
134

lormor€o complcrufui
cle

inilicrt

ilctori

ARNtr-md) '

dc initìtfe ARNm

@

ologoco subunitòtiì

ARNÍ'm't î; situt pcptidil ínsotitó or
deplosorro r'r5oromutui AFNm

tronslocotio

J sit omhoocil

corc vineîn iitut

t go?co ARNi'u
dcchngotic)

# l\

(blori

-

o
Fig. a2. Schema sintezei proteinice. Decodificarea mesajului genetic începe eu cítirea codoaului de iniliere.{.UG de cAhe ARNf'-tt Si se terminà cu codonul de terminare UAA. Codonul AUG în mod obignuit nu este plasat exact la capAtul 5' al ARNmr ci el este precedat de un rrurrAr de alte nucleotide, dar el ocupà o pozilie specifica pe cateua ARNzr putînd fi recunoscut. Tot astfel codonul tenniuator UAA nu este îu mod obligatoríu ultimul codon din macromolecula AR.Nza. TJneori aceeagi moleculà ARNz posedà mai mulli codoni de iniliere gi
codoni terminatori condifionînd sinteza mai multot catene polipeptidice.

În

cazul

135

--.--_.--.-----. ce conline pcptido
tq sttui
P

tronscriereo ARNte

r la€oreo fiotaculc; aRnrtFt"

continuorco etop?loî grecedentc pcntru f iccore codon ARNm Pînó cc tsta otins codonul tcrmrnoîor (UAA, UAG, UGA)

"firl

A*

tlr

@,iu f.met
dlsoctcr?o rìbolomutra

+

etiberoiso
coteF€'r oolixDddrce

5ffi f"
I
.>

I

Itî tb" t.incr

\
,

tCu

o
ARì{rz
nare,

t lr|cl

care specificà prote'ruele triptofansintetazei la E. coli, codonul de termlpeglnl gena trp B cstc pattial folosit drept codon de inifiere pentru gena trp A (UGAUG). Transferarea aminoacil-ARN, din situl A în situl P este însofltl de s schimbarea conformatiei spafiale a moleculei sale (dupà Strickberger, lg70).

ini{iere AUG qi cu un iARNt*et, caîe poartà deci metionina. Se formeazà u,n complex metioni,I-t-ARNfo AtlG numit compler, de ini[iere: Formar,ea oompJexului de initiere implicà intervenfra a trei factori proteinici de inifi,ere care au fost desemnafi IFL, IF2 gi 1F3. Rolul exact al acestor fac"tori nu este cunoscut. IF3 împiedicà asocierea subu,nitàfiùor ribozomale 30 S qi 50 S, cînd ribozomul nu este angajat în sinteza proteinicà. Bner,gia ne136

c€sarà în inifiere este eliberatà prin hidroliza u,nei molecule de GTP car,e este qi ea considera,tà facùor de ini{iere aúunci cînd se leagà la fmet-ARNú fàrà a fi hidrolizat. Complexul de inifiere se asociazà apoi cu o subunitate ri,bozomalà mare (reac{ie care necesità potasiu), rezultînd ribozomul funcgional (70 S la procariote qi B0 S la eucarioùe). Din asocierea ARNr-ARNrn se delimiteazà în subunitatea mare a ribozomului douà situri ominoacil (A) Ei peptidil (P). În momentul asam;blàrii particuiei ribozomale funcfionale ARNm este relinut într-o adînciturà rezultatà din pozilia ceLor douà subunitàli rirbozomale. ARNm expune în situl A codonul iniliator AUG oare va permite pàtrr:rrderea în aeest sit a ARNú inifiator JMet ARNtt^"t. IFz aclioneazà apoi ca translocozd. care ca'talizeazà translocafia fmet O**1tmet Ei regiunea corespunzàtoare codonului AUG din ARNnz din situl A în situl P. Reacfia necesità energie eliberatà din hidr'oliza GTP. Translocarea elibereazà situl A care va pUtea agc€p1s alt AA ARNú corespunzàtor noului codon din ARNrn. Astfel, ARNú funclioneazà nu numai ca un càràug de aminoacizi la ribozomi dar Ei ca mol'eculà adapùoare care secvenliazà aminoaeizii în catena polipeptidicà potrivit instmcfiunilor date de ARNnz.
4.7.2. ALU N GINEA CATEN

EI POLIPEPTIDICE

De îndatà ce a avut loc ini{ierea ca,úenei polipeptidice prin alinierea codonului iniliator AUG cu antioodonul metionil iARNún''"' gi formarea unei particule rib,ozomale complete, activà în sinteza proùeinicà, situi P al ribozomului este ocupat de iARNúmeriar situl A este liber sà primeascà al doilea aminoacil ARNú cor€spunzàbor celui de-al d,oilea codon din ARNm. Palticula ribozomalà se deplaseazà pe monocatena ARNm, care îgi expune astfel succesiv codonii spre a fi r'ecunoscu{i de anticodonul diferi{ilor ARNú. Legarea aminoacit-ARNf la situl A este catalízatà de un factor proteinic ? care foloseqte de asemenea energia eliberatà de GTP. La nivelul sitului P, grupul, a-COOH pàràseqúe legàtura cu ARNú qi formeazà o legàturà peptidicà cu grupul a,-NH2 al aminoacidului legat de ARNú intnaú în situl A. îrecerea aminoacidului de la legàtura cu ARNú la legàtura peptidicà se realize'azà, prin intervenfia enzimet, peptidiltrmsfemzd, legatà
137

de subunitatea mare a ribozomului. Form'area legàturii peptidice este catalizatà de enzima peptidilplimnrazd, sau aminoacid-polim.erazd. localizatà pe subunitatea mare a ribozomului, Se formeazà un dipepticl, iar ARNf din situl P ràmîne fàrà aminoacid Ei pàràsegte ribozomul, al doilea ARNú purtînd d,oi aminoacizi unili printr-o legàturà peptidicà (un rest dipeptid) trece din situl A qi intrà în situl P. Aceastà trecere din situl A în situi P, condifionatà de formarea legàturii peptidice a ARNú se numeEte úronslocaf,ie (fie. a2). Ea 'este m'ediatà de un factor proúeinic numit G a càrui acfiune este dependentà de 'energia eliberatà prin hidroliza GTP, ca gi de o notaibilà modificare conformalionalà a structurii rib,ozomului. Totodatà ri,bozomul se deplaseazà pe ARNrn pe o distan{à echivalentà cu un codon. Noul codon va ajunge la nivelul sitului A, unde va pàtrunde un nou aminoacil ARNf cu un anticodon corespunzitor. Pe màsurà ce ribozomul se miEcà în direclia 5'-+3', de-a lungul catenei ARNrn'are loc alungirea catenei polipeptidice qi totodatà descifrarea mesajului genetic din ARNm. Cer cetàrile lui Fritz Lipmann au aràtat cà în procesul de asamblare a aminoacizilor intervin trei tipuri diferite de proteine care s-au numit fo,ctori de elongofie gi au fost desemnafi EF-'Lu, EF-?" qi EF-G. Acegtia sînt compon,ente structurale ale ri,bozomului qi se ataEeazà la particula ribozomalà maturà doar în faza de funcfionare a aoesteia în asamblanea aminoacizilor in catena polipeptidicà. La E. coli, EF-T, Ei ET-T, reprezintà 50/o din proteina solubilà Ei participà în transferul aminoacil-ARNt La situl aminoacil al ribozomului. Factorul EF_?, faciliteazà 'formarea unui complex dintre f,acúorul EF-T", aminoacil-ARNú qi GTP. Ribozomul care poartà un peptidil-ARN't, în situl sàu P acceptà acest complex la situl sàu a,minoacil. Cînd are loc formarea ì.egàturii peptidice EF-T" este eliber,at iar GTP este hidrolizat spre a da GDP qi fosfat cu ,eliberare de energie. Factorul EF-G participà in tr,,anslocarea (miqcarea d.e transla{ie) a ARN'm pe ribozom spre a fi expus urmàúorul aodon in situl A. Transl,ocarea implicà consum de enrergie derivatà din hidroliza unei molecule de GTP în GDP Si P. Elongarea însàqi a eatenei polipeptidice nu necesiúà energia eliberatà prin hidroliza GTP, de'oar,ece energia liberà înmagazinatà în legàtura aminoacil-ARNf este suficient de mane spre a conduce la formarea puntii peptidice. GTP acfioneazà agadar ca urì factor alosteric a càrui combinare cu proteina EF-T" determinà o modÍficare conforma138

lionalà a factorului EF-T, care permite amino-actl-ARNú sà se lege I'a situl ribozomal cerespunzàtor. Dupà e}ongarea catenei polipeptidice nàscînde, GTP este hidrolizat fàcînd ca EF-T" sà revinà la conformafia inilia1à qi sà se desprindà de pe ribozom. Iatà reacfiil'e în care factorii de elongalie sînt implica{i în alungirea catenei polipeptidice (Blumenthal gi Carmichael,
1e7e):

EF EF EF EF

-

T,, . GTP

I

aaAF.N,

s

EF'

Tu . aaARN, . GTP

f

-

Tn

. aaARNr'

GTP

ribozom

+EF-T,,.GDP+PP

5 ribozom . aaARN, *

To . GDP + EF - T, $EF - Tu . T" -f GDP T. . T. + GTP rsEF - T"' GTP + EF - T".

Viteza de polimerizare a aminoacizilor este de 15 aminoaclzi pe secundà. Dupà ce un ri;bozom a tradus aproximativ 25 codoni capàtul 5' al ARNrn devine liber spr€ a forma un al doilea complex de inifiere qi un al doilea ribozom începe miqcarea de-a lungul catenei ARNnz, determinînd siurúeza unei a doua catene polipeptidice, apoi un al treilea, al patrulea ri-

multor ribozomi la catena ARNm rgzultà o structurà numità poliribuotu Structura poliriibozomalà condilioneazà sintez.a simultanà a numeroase ca'terne poUpeptidice care au dirnensiuni diferite la un moment dat, în funcfie de distanfa pe care fiecare ribozom a parcurc+ de la capàtul 5' spre capàtul 3' al. catenei ARNm. sajului (sinteza proteinicà) au loc simultan, Ei înainte ca sà se ùermine sinteza AIlNrn, capàtul sàu 5' devine asociat cu ribozomul spre a forma un compler dc i,nifiere (fig. 42b). La euoariote transcrierea are troc în nucleu iar tr'aducerea în citoplasmà unde se aflà ribozomii. Existà o specificiúate a activitàlii ribozomilor în sinteza proteinicà care ar reprezenta o modalitate de reglare a activitàfii genelor la nivelul traducerii. Astfel, în sistemele de sintezà proúeinicà in uitro (aceiularà) se consta,tà eà ribozomii izolali din oelulele interfazice sînt mai activi decît cei izolali din celule aflate în diviziune. În c,elulele hepatice, ribozomii ataqafi la reticulul endoplasmic
139

bozom q.a.m.d Prin ataEarea mai

La procariote transerierca (sinteza ARNnt) gi traducerea me-

s€rvesc pentru sinúeza proteineloor serice pe cînd cei liberi servesc la sinteza proteinelor hepatice specifice neserice.

Alurgirea catenei polipeptidiee poate fi schematizatà astfelr

AA1

- ARlill * AA, - ARNú'# - GTP - ARNI2 + ARI{lr.

AA1

-

AA2

-

Atagarea ribozomilor la monocatena ARNrn facilit eazà, piistrarea structurii liniare, monocaterrar,e a ARNnz, favora,bila unei citiri corecte a mesajului, unei decodificàri corespunzàtoare. Îrr'- cazul în care pe parcursul catenei ARNnr apar regiuni dublu-catenare ribozomii le desfac spre a permite o
corectà selecfionare a AA^,i.{RNú.

Lungimea moleculelor ARNnz este heterogenà, depinzînd dr màrimea mesajului genetic purtat. Ia E. coli màrimea medie a ARNrn este de 900-1500 nucleotide purtînd un mesaj cìar€ corespurì.de la catene polipeptidice de 300-500 aminoacizi. În sinteza histidinei intervin 10 enzime. Aoestea sînt sintetizate sub directia unui mesaj purtat de o singurà molecull de ARNnz.
4.L,3, TERMIN

AREA CATENET POLIPEPT IDICE

Cînd ribozomul în deplasarea sa pe ARNnz întîlneEte în slcodon terminator la care nu mai ràspunde nici un tip de aminoacil-ARNú are loc înrcerúamea sirutezei caùenei polipeptidice càci un asemenea oodon nu este neclu'r.oscut de niei un anticodon ARNf, prezenfa sa în situl A aI ribozomului blocînd adàugarea oricàrui alrt aminoacid la caùena poiipepti,dicà. Codonii UAA, UGA Ei UAG sînt codoni terminntori. Un,eori existà nu un singur codon terminator ci doi cod,oni termin,atori succesivi spre a asigura cà sinteza catenei polipepti'dice se terminà în punctul corespunzàtor. Terminarea catenei polipeptidice este un proces activ qi nu se datoreqte simplulul fapt cà un codon nu poate fi citit. Codonii terminator:i (sfop sau nonsens) spre deosebire de codonii sens care sînt citili (necunoscufi) de diferitele tipuri de ARNú sînt recunoscufi de càtre factori proteinici numili Ei factori de eliberare. Semna1ele de terminare repnezentate de cei trei codoni terminatori (nonsens) sînt recu-

tui A un

140

noscute de

TF-.R1 r€cunoagùe codonii UAA qi UAG, TF-R2 recunoa$te codonii UAA qi UGA. Codonul UAA (ocru) se pare cà este cel mai eficient codon terminator, pe cînd UAG (arnber\ Ei UGA (opal : qzuy) ar reprezenta semnale accesorii care sà asigure cà terminanea nu equeazà. UAA gi UAG asigurà terminarea eficientà a traducerii la bacterii în propor{ie de 1000/o.UGA este rareori mai eficient de 980/0, iar la codonii terminatori ,,leakys sla,bi, adicA un terminator aparent gregit citit ca un codon ce specificà um amfuroacid, efi,cien{a terminàrii esúe scazutà dar semnificativà. Aceasta duce la alungirea eatmei polipeptidice dincolo de aodonul de termiinare. Codonul terminator interacfiorneazà, cu factori proteinici care au fost notrali cu R, creînd,u-se un compler R-codon tenninator-ribozom care blocheazà alungirea în aontinuare a oatenei polipepticlice. Terminarea implicà formarea ùr situl A a u'nui complex ce include fF-& sau TF-R2, codonul ter:rnfurator UAA qi ribozomul. TF-RB acfioneazà atunci enzimatic ia nivetul sitului P spre a separa grupul canboxil al a,minoacidului C terminal de l,egàtura sa cu ARNú printr-o hidrolizà, eliberînd peptidul. Blocarea sitului A face ca,polipeptida completà só ràrnînà esterificatà la ARNú finat care ocupà situl P. Factorul proteinic Tî-R3 va rupe aceastà bgaturà, facînd ca sa fie eliberafl dim ribozorn atît catena potipeptidi,cà cît qi ARNú. Totodatà are loc dlsocierea riibozomului în sutbuuritàtile sal,,e mare qi micà, proces mediat de factorul lF3 implicat dupa cum s-a vàzut qi în medierea formàrii compl,exului de inifiere. În prooesul de berminare a catenei polipeptidice au fost implicate qi proteinele
ribozomale L7 $i Lrz. Sinteza proteinicà esùe îns'ofità de a.ga-numiúul ciclu ribozamnt (îig. 43). Mai întîi are loc asam'blarea rirbozomului din sub.unitàlile s'ale. Pînà în anul 1967 s-a crezut cà subunitàlile 30 S qi 50 S ale ribozomului sînt p€rfiranr€nt cuplate spre a forma un ri,Lmzom matur 70 S dar, din acest an, s-a stabilit cà subunità{ile ribozomale se asociazà doar atunci cînd sînt active în sinteza proteinicà. De îndatà oe a fost tradus mesajul genetic din ARNm Si s-a terminat sinteza caúenei polipeptidice, ribozomul se disociazà de pe ARNnz, subunitàlile ri,bozomului se separà Ei eie îqi iau a$i parteneri (30 Sr * 50 51 30 52 + 50 S2 într-un eiclu de sintezà Ei 30 Sr * 50 52 respectiv 30 Sz + 50 Sr în urmàtorul ciciu de sintezà. Prin experienfe de marcaj cu izotopi grei Ei radioactivi, Wlesels,on a aràtat natuna efemerà tranzientà a cuplàrii de subl4',.

(ÎF-&, TF-Rz Fi TF-R1).

trei factori proteinici (enzimatici) de

termfurar,e

() r uet"tn,vat

Q

GLp,

I ltet

tRN,rl

(\i r)

8r
i

l

J0
,5,

it:

WJ
J

,.:17!^,-

-rY*
j

Alt.! m

,,

--)

{ -:h^ Yiiir
,,nr,-,OnO,\j{f/
tF lu
;,H\'m
7os,

{-Èn \,.!./lr:';/tl

lerminorea cotenei poLpeptiúc:
Produs prdein'rc

,,Foqlodde eliberore

I z'-GTP EF-ts ( tr'c" i\6tp+P I sinrezo, " coknei

Fal,pcptidÌce

s ch e m

a

o ng oi ó r n

n il,iii!i "r,ìi!,iirt
"

t

Q

t

to

r

ri b

uo mo r e

Fig. 13. schema *ffirm:t$;;;ff3;1i,n o.r

rrbozornare

unitàti rÍbozomale in constituirea de particule ribozomale matune, funcfionale. În timpul inifierii ane loc legarea faetorilor de inifiere IF-l , IF-z $i IF-3 la subunitatea 30 S. Inifierea mai nec€sità ARNú formil,metionil la ,bacterii sau ARNú-metionina Ia euoariote, ARNnz asociat subunitaÉi 30 S,
GTP. Aceste cCIrnpooeote alcàtuiese aSa-numitul c.omplex de inifiere. Complexul de inifiere se comrbinà cu o subunitate rirbozomalà 50 S spre a forma un rirbozom funcfional 70 S. Proeesul este însotit de hidroliza unei molecule d'e GTP din care rezultà energie avînd loc $i eliiberarea facúorilor lF. Se desfàEoarà apoi translocalia ribozomului reprezentînd deplasarea ribozomului de-a lungul ARNnz pe o distanfà ce oorespunde cu fie(:are miqcane la trei nucleotide (oodon). Tnanslocalia rilboz,omului este un proc.es aetiv oare nec,esità energie pusà la dispozilie prin hidroliza GTP precum qi intenvenfia unui foctor G numit factcr de trarulonfi,e. Siturile de irrteracfiune cu G qi GTP se aflà în subunitatea ri;bozomalà mare. Pentru realizarea transtrocatiei riibozomale, ARNú deacilat (lipsit de aminoacid) trebuie
142

sà fie expulzat din situl P, peptidil,-ARNú trebuie sà se deplaseze din situl A in situtr P, iar ARNm trebuie sà se deplaseze pe subunitatea ri'bozomalà micà ast'fel, încît sà poatà expune urmatorul codon în situl A. Dupà parcurgerea înfuegii moLecule de ARNm, ribozomul se disociazà în subunitàfile sa1e. La o nouà reconstituire de particule ribozoma,le, subunitàlile ribozomale se pot schimba între ele. Reciclarea necesità un faeùor cle iniliere numit fontor de disociere ríbazomald ce menline poiirirbozomii, inhilbà disocienea subunitàfilor ri'bozomale înaimte d,e a fi disponiibil mesagerul, condifioneazà, intràrile cantitati'u'e a1e subunitàfilor mani în polirirbozomi, permite acumularea de subunitàli ribozomal,e în loe de acumulare de particule ribozomal,e uniee qi este cerut de legarea ARNrn la
ri,bozomi.

CONCLUZII

Î,n procesul de biosintezà proùeinicà se realir.eazà, decodificarea informaliei genetice. Procesul de biosintezl proteinicà este extrem de oomplex qi implicà recunoasúeri pe bazà de complsmentariúate dintre acizii nucleici, fur care ro1, esenfial ane relafia codorr-anúicodon. Întreg procesul de biosintez,à, proteinicà se desfàqoarà prin intervenlia unui numàr mare de alte proteine cu caracter enzimatic sau care funclioneazà in calitate de f,actori de recunoaqtere (inifiere, elon'gare, terminare). Este o refurnoiúà povarà pentru celulà cînd îqi sintetir,eazà o caùenà polipeptidicà, càci pentru aceasta ea pune î,n funcfiun,e un numàr incompararbil mai rnare de alte proteine. În celulele procariote cu ARNnz de scurtà duratà de via{à reglarea expresiei genelor apare în principal Ia nivelul transcrierii (vezi reglajul genetic). La Eucariote cu ARNnz de duratà de via{à mai lungà, expresia genicà este controlatà atît la nivelul transcrierii, cît qi a traducerii. Reglarea traducerii în aoest eaz are loc in parte în timpul inifierii catsrelor polipeptidice, ceea ce explicà de ce factorii de inifiere eucariotici sînt mai numerogi qi mai complicafi str.uctural decîú omologii tror proeariotici (Oc}roa S. qi de Haro, 1979). Pe cînd aparatul de furifiene proeariotic oonstà di,:r 2 sau 3 faetori de inifiere, cel eucariotic imphca cel putin 7
143

sau B asemenea factori. Faetorul proeariotic IF-7, care mijloceqte legarea metionil-ARNú inifiaùor, constà dinrtr-o singurà catenà polipeptidicà cu greutatea molecularà B0 000-90 000, iar factorul de recunoagtere ,a ARNnz IF-3 constà dintr-o catenà polipeptidicà cu greutatea molecularà de 23 000 dal,toni. Faetorul de ini{iere eucariotic e IF-2 este eompus din 3 subunitàfi cu greutate molecularà com,binatà de 150 000 daltoni, iar /F-3 are nu mai putin de 10 subunità{i care dau o greutate molecularà totalà de 500 000 daltoni. Controlul tr,aducerii la eucariote implicà interven{ia proteinkinaz.,elor care, atunci cînd sînt activate înhibà traducer,ea. Se cunosc douà mecanisme majore ale oon:tr'olului traducerii la eucariote. Primul controLeazà inilierea catenei polipeptidice prin blocarea funcfionàrii factorului de ini{iere e IF-*Z, blocare care este realizatà prin fosforilarea uneia dintre cele trei subunitàli ale sale. Aceastà fosforilare este catalizatà de proteinkinaza. Al doilea urecanism de b}ocare a traducerii implicà degradarea ARNrn pe calea activàrii unei endonucleoze prin intermediul unei oligonucleotide c€ are o structurà neobiqnuità ppp A 2' p 5' A 2' p 5' A. Aceastà nucleotidà este sinúetizatà din ATP sub acliunea tot a unei protein-kinnze. Anumite oligonucleotide mici, afl,aùe în celulele eucariote, formate aparenú în urma digestiei endonucleazice a ARN celular pot afecta traduoerea Ia nivelul elongafiei caùenei. EIe pot, fi implicate în tranzilia de la o stare donmantà sau liniqtità la o stare activà ca în emergenfa din criptobiozà, a artropodului Arternia salina sau în fecundarea ovulului. Bl'ocarea func{iei e IF-Z qi degradarea ARNnz dupà cunogtinlele actuale inhibà traducerea într-o manierà neselectivà. CercretàriLe viirtoare vor ad.uoe noi daùe asupna unor cài se lective de modular€ a traducerii diferi{il,or mesageri, ca qi asupra rolului fosforilàrii proteinelor ribozomale qi factorilor ce intenrin în biosinteza proteinicà, allii decît e IF-z. Recent s-a descoperit o proteinà stimulatoare a e IF-2 des€mnràtà ESP, car,e determinà ca e IF-2 sà formeze un complex ternar cu GTP qi ARNú metioni,l inifiaúor. Aoest aomplex ternar se leagà la o subunitate 40 S a ribozomului eucariotic dînd uraqtere la un complex de iniliere în care intrà Ei ARNrn. În urma fosforilàrii subunitàlii mici a e /F-2 este blocatà furterac{iunea e IF-Z cu ESP $i astfel nu se poate forma complexul ternar de inifiere, fiind inhi'batà în consecintà traducerea (Ochoa Ei Haro, 1979).
144

Capitolul V

$I

CARACÎERISTICILE ORGAI{IZARII FUNCTIONaRU FACTORILOR EREDTTARI
(GENETOR)

ereditàfii. La organismele procariote funclionarea gi transmiterea fae'torilor eneditari prezintà un tablou mai putrn complex comparativ cu organismele eucariote. Ciclul de vÍafà al organismelor prooariote este simplu. Reproducenea lor se realizeazÀ prin diviziune celularà, neexistînd diferenfieri celulare majore. Existenta unui singur cnomozom-genofor substratul fizic unic al tuturor genelor pe cìare le prezintà o-cel,ula procariotà, faee ca de regulà fiecare genà sa fie prezentà într-un singur exemplar, într-o singurà c"opie, în genomul prooariot. Ea se va exprima deci liber în fenotip, în funclie de necesitàfile de moment al'e, celulei (vezi reglarea activitàlii genice). La eucariote lucrurile sînt oeva mai complicate. Existenfa mai multor genofori crpmozomii creeazà premisa prezenfei în genotipul unei celule, respectiv individ, a mai multor copii ale acel.eiaqi gene, adicà a unor stàri alternative ale acesteia. Comportamentul factorilor ereditari depinde nu numai de' aspecte legate de meoanismul reglàrii activitàfii genelor, dar qi de oomplexitaùea organizàrii genomului eucariot qi de prezenfa unei gene date, în aceeaqi celutà, în c.'el putin doua stàri
al,ternative.
tQ - Descifrîud tainele ereditagi, vol. I

Cel care s-a oeupat pentru prÍma datà de probiema organizàríi gi funcfionàrii faetorilor ereditari, stabilind caracteristicile lor a fost Gregor Mendel, pàrintele Gerreticii Etiinfa

145

1. CICLUL DE

VIATA LA ORGANISMELE SUPERIOARE

Organismele eucarioúe se pot reproduce fie pe cale asexuatà (vegetativ lia plante, somatic la animale) fie pe cale sexuatà propriu-zisà, cu diferenliere de sexe opuse, mascul Ei femei. Reproducerea asexuatà se realizeazà, cel mai adesea pe calea diviziunii celulare la eucariotele inferioare, unioelulare (al,ga Chlorella bunàoarà) sau prin diferenfiere de org€me de reproducere vegetativà, Ia plante. Eucariotele, mai a}es cele superioare, se car,acterizeazi însA prin reproduoerea sexuatà tipicà, în oare s,e difererrliazi anizogamefi gamefi diferifi morfofizi,ologic ovulul la arrimale gi oosfera la plarnte, penúru sexul femel, spermatozoidul Ia animale gi nucleul spermatic (derivat din diviziunea nucleului generativ rezulrtat în urma diviziunii nucleului haploid al micr,osporului ,gràu,nciorul de pol'en) pentru sexul mascul. În ciclul-de via{à la organismele cu reprodueere sexuatà alterneaza 'o f"azà, s,exuatà (gametofiticà) qi a fazà vegetativa (sporofiticà). La animalele superioare precum Drosophila Ei omul, faza sexuatà este reprezentatà doar de celulele din linia germinalà cane produc gamefii. Ele sînt di$oide (2n), se diferenfiazà din celulele liniei somatice prin diviziuni mitotice succesive încà din primele faze ale emrbriogenezei Ei doar ele vor suferi meioza sprc a deveni garne,fi. Plantele nu posedà o linie germinalà. La plantele care se repnoduc pe cale sexuatà, în floare, reprezentînd o parte a sporofitului, u,nele celuie vor fi induse spre a se difermfia în megasporofit la sexul femel qi microsporofit la cel mascul qi aceste oeiule vor suferi meioz'a. În unna meiozei rezultà rnegaspori (ovulul) Eí microspori (polenul) care se divid mitotic spre a produce ceea ce se cheamà ga,rnetofit. La plantele inferioare (talofite) ,gametofitul ,este foarte dezvoltat pe cînd sporofitul este redus. La plantele cu flori în special angiosperme, ,gametofitui este foarte redus pe cînd sporofitul (reprezentînd planta întreagà) este foarte dezvoltat. În pr,ocesul de fecundafie din unirea ovulului cu spermatozoidul respectiv a oosferei cu nuc121 spermatic, se reface garnitura diploidà de cromozomi, rezutrtùrd oul sau zigotul diploid car,e, prin diviziuni succesive va g€nera un nou organism. Meioza Ei fecundarea sînt ferromene
compensatorii.
146

2. CARACTERISTICILE GENETICE AI..E MEIOZEI

ploid 4C. Dupà prima diviziune meioticà rezultà douà celule care au o cantitate diploidà de ADN (2C) qi cu mumàr de cromozomi redus Ia jumàùarùe (n). Acresúe oelule suferà ,o a dor.l,a diviziune mei.oticà qi vor da patru celule cu cantitate haploidà de ADN (1C), dar cu acelaqi arumàr de eromozomi redus la jumàtate (n), În prima diviziune meioticà, anume în gnofom. acesteia evearimentul cel mai important esùe sinapsa crpmozomilor omologi cane condifioneazà reducerea aparen'tà a numàrului de cromozomi. Cromozomii ibicromatidici avînd o crantitaúe 4C de ADN (duplicafi) se asociazà în perechi, pe bazà de omologie, formind bivatenfli. În metafaza primei diviziuni meiotice fiecare bivalent se aqazà in placa metafazicà, astfel ca unul dintre cromozomii omologi sà fie deasupra, iar cel,àlalt dedesubtul planului ecuatorial al acesteia. Aceastà agezare a cromozomilor omologi oe alcàttriesc bivalenfii condifioneaza o disjuncfie (segregare) ordonatà spre polti a cromozomilsr omologi, di'n fiecare bivaJent unul diurtre omologi migrtnd spre un pol (deci într-un gam,et), celàla,lt în mod obl,igaúoriu, Iegic de,terminat, migrînd spre polul opus (într-un alú garnet). Din prima diviziune meioticà nezulrtà doi nruclei fii, fiecar.e avînd un numàr de cnomozomi reprezerrutind jurnàtate din gamitura diploidà a celulei somatice. De asemenea, acesti nuclei au o cantitate de ADN redusà la jumàtate fafà de cantitatea de ADN a nucleului interfazie de dinainte de meiozà. Prima divizir:ne meioticà este redu{ionalà. Nucleii haploizi rezul,tafi din prima diviziune meioticà suferà, fàrà a mai avea loc o sintezà interfazicà de ADN, o a doua diviziune meioticà care se desfàqoarà dupà mecanismul mitotie tipic, cu clivarea longitudinalà a centromerului Ei migrarea spre poli nu de cnomozomi bicromatidici ca în prima diviziune meioticà, ci de cromozomi monocromatidici. A douà diviziune meioticà desàvîrgeqte astfei qi reducerea cantitàtii de ADN, care de 1a 2 C ajunge ùa 1 C, canrtiùate specificà gannefilor haploizi. Iau n,a9úere

lulelor reproducàtoare. În cadrul ei, dupa o singurà runda de neplicare a ADN se desfàqoarà douà diviziuni nucleare succesive. În urma replicàrii ADN, o celulà 2n cu o cantitate 2C de ADN va dobîndi o cantitaúe dublà de ADN de nivel tetra-

Meîoza este diviziunea celul'arà cane duce

la formarea

ce-

147

patru nuciei hapl'oizi ca rezultat a douà diviziuni meiotice sucCeluiele organismelor diploide care se reproduc pe cale sexuatà, prezintà douà seturi de cromozomi, unul provenind de la mamà, adus la nivel.ul zigotului de càtre ovul, altul provenind de la tatà, adus la nivelul zigotului de càtr'e spermatozoid. Fiecare set de cromozomi este atrcàtuit di,r: crom'ozomi neomologi, neasemànàtori. În cadrul complementuluii diploid însà, doi cîte doi cromor,omisînt asemànàtori adicà omol,ogi, unul fiind de provenien[a maternà iar altul de provenienta paternà. Asemenea cromozomi ornologi poartà aeeleagi gene în loci oorespunzaúori qi prezintà aceeagi morfologie. Astfel', star,ea diploidà a organismelor eucario,te implicà existenla locil,or omotogi qi a genelor alele; cel pufin cîte douà gen'e din genotipul organismului eucariot controleazà acel'aqi caracter. In timpul meiozei aceEti cromozomi omol'ogi se împereeh eazà,, formînd bivatenfii. În împerecherea omologiior un rol esenfial revine compl,exul ui sinaptinemal.
cesive.

3. LOCALIZAREA GBNELOR PE CITOMOZOMI

În anul 1903 Sutton a starbilit relalia dintre comportamentul crornozomilor în meiozà (segregare) pe de,o parte qi disjunctia (asortarea) independentà a genelor pe de altà parte, fapt care a stat la baza elaboràrii teoriei cromozomale a ereditàfii
S-a putut constata cà o genà nu poate sà corespundà la un cromozom întreg de vreme ce oricare .organism, fie el, procariot (unde existà un si,ngur cromozom) fie eucariot posedà mai multe gene decît cromozomi. Singura posibilitate ràmînea 'ca pe un singur cromozom sà se afle mai mutrte gene care sînt lincate sau înlànluite. S-a stabilit cà fiecare genà ocupà o anumità pozilie (toczs) strict determinatà pe cromozom Ei cà pe cromozomii omologi alel,ele unei ,gene ocupà pozilii corespunzàtoare. Mai exact alelele unei gene ocupà acelaEi locus pe cromozomii omologi. Ulterior pozilia ocupatà de o genà pe cromozom a fost asimilatà cu gena ca atare, încÎt atunci cînd se vorbeqte de un locus genie se înlel,ege gena propriu-zisà,. Piuralul de la locus este loci. Genele plasate pe un acelaqi cromozom manifestà tendinfa de a se transmite înlànt-uit I,a desce'n'denfi, în virtutea faptului
148

de càtre Morgan qi Ecoala sa,

în

1919.

cà ele sînt fizic înlànfuite, iar cnomozomul este trecut ca entitate integrà, discretà, din celula inifialà îan celulele fiice. Pe de ,aùtà parte, genele care sînt localizatn pe diferifi crorn'ozomi (pe cromozomi neomologi) nefiind înlànfuite segnegA independent unele de altele càci qi perechil,e de cromozomi în anafaza primei diviziuni meiotice (AI) segnegà independemt unele de altele. Dacà dintr-o pereche datà de crnomozomi, crornozomul de origine maternà migreazà spre un pol, în mod legic determinat cromozomutr de origine paúernà migreazà spre polul opus. Dar, considerînd o arltà peredre de cromozomi, ru es'te o'bligatoriu sà migreze spne polul spre cane a mi'grat din prima per,eche cromozomul matern tot, cromozomul de origine maternà. Astfel, spre poli, în nuclei fii, rezultali din prima diviziune meioticà, vor mlgra cr,omozomi de ori,gine diferità, mate'rnà qi paternà, migranea fiind un evem.iment determinat stohastic, probarbilistic. În asemen€a nuctrei vor apar€ constelalii genetice de cromozomi, respectiv de gene diîerite ca origin'e (materne qi paterne), ca provenienfà, de cele care au fost la genitori. Aceste concluzii au fost desprinse însà dupà ce s-a studiat fenomenul ereditar la nivel ceL,ul,ar. Dar, îna,inúe de a fi cunoscute mecanismele in,time ale meiozei qi implicarea cromozomitor în ereditate, Gregor Mendel, studiind hibridarea la mazàre, a ajuns la concluzii care îEi pàstreazà în total,itate valabiliúaùea qi astazi, astfel cà el, càlugàrul augustin Gregon Memdel, nàscu't la Heinuendorf (Cehoslovacia) în t822, este aonsider,at fondatorul qtiintei er.editàlii.

4. DESCIFRAREA NATURII GENOMULUI (GENOTIPULUI} PRIN STUDIUL FENOTIPULUI (ANALI7,A GENETICA) (GENETICA FACTORIALA SAU FORMALA)
Cercetàrile lui Mendel se deosebesc radical de ceie ale predecesorilor sài (cei mai reprezentativi fiind Knight, Goss, Ch. Naudin) prin trei elemente de n,outate: modul de a privi experienla qi de a alege materialul potrivit, introducer,ea discoartinuitàfii qi folosirea maril,,or populalii, oeea oe permite exprimarea nezultatelor prin numere Ei pr,elucrarea lor ma'tematicà, ca qi folosirea un.ror simrboluri simple pentru desemnarea fac.torilor er,editari de naturà corpusculanà, prin care devine posi149

meîncetat d,ialog diurtre experiment Ei teorie, dintre experimentator qi experienfa sa. Noua metodologie, prelucrarea statisticà Ei reprezentarea simbolicà impu,n ereditàlii o logicà internà. Cu Mendel, interpretarea fenomenelor biologioe dobîndeqte dintr-o datà rigoare matematicà. Gîndirea sa a fost o gîndire revolufionarà. EI a. ajuns la concl,uzia cà tràsàturil,e (caracterele) ereditare ale unui individ sînt distincte, fiecare transmi!îndu-se ca unitàli separate de l,a pàrinti la descendenli mu direct, aqa cum credeau predecesorii sài, ci indirect, prin intermediul unor factori ereditari. Astfel, deqi un individ poate sà posede mii de tràsàturi distinete care alcàtuiese individualitatea sa, fiecare din aceste tràsàturi sînt controlate de càtre unitàli ereditare sau factort eredifuri oare au un caracter discret (în sens de distinct din punct de vedere fizic). Mendel a stabilit cà ereditatea urmeazé legi simple qi exacte pe baza càrora poaùe fi prezis comportamentul oricàrui factor ereditar care dirijeazà un anumit caracter. Moqtenúrea caracùerelor se face dupà reguli foarte exact'e,

bil un

Prin experien!à dar Ei intui{ie genialà, Mendel a statuat cà diferitele caractere a}e unui organism dat sînt determina,úe de factori ereditari de naturà materialà, localizali în nucleul eelular, fiind in dozà dublà în celulel,e somatice gi în dozà simplà în celulele reproducà'ùoare (gamefi). Prezenfa factorului ereditar în doza dublà a fost probabitr sugeratà lui Mendel de participarea a doi incliviei diferifi la uraqterea unui singur individ la organismele c€ se reprodue pe ca,le sexuaità. Este acum uEor pentru noi sà apreciem cà aceastà situafie corespunde cu ac€ea a numàruiui de eromozomi sau a cantitàlii de ADN, dar Mendel nu qtia acest l,ucru, deoarece la vremea cînd a elaborat tezele sale mu se d,escoperise nici cnomozomii, nici ADN, nici meioza. Mendel a mai stabilit cà factorii ereditari în celul,ele somatice fiind în doz.à du'blà se aflà su,b formà de pereche sau cum a definit el cu terrnenul grecesc sub formà de alele. Acum qtim cà factorul ereditar mendelian este o genà qi cà gena poate exista sub forma a douà stàri alternative, numite alele din care una este dominnntd (A) gi alta rece'siud (a)" Aceste douà Súàri ,aù,ternative ate aceleiaqi gene sîn,t rezulrtatul posi,bil al mutafiei bidirecfionale: A, ' a. Existenfa genelor poarte fi sesizatà numai cînd ele determinà un caracter ce poate sà aparà sub douà stàri al,ternative. Abia atunci vom putea qti cà existà o genà care, într-o anumità stare determinà o anumità
150

matematice.

formà a caracterului considerat (ibob neted în cazul formei bobului de mazàre) qi într-o altà stare determinà cealaltà formà a caracterului (bob zbîrcit). Cele douà alele ocupà acel'agi locus pe o pereche datà de cromozomi omologi. Astfel, dacà alela A se aflà pe cromozomul cle origine maternà, într-un anumit sit sau locus, p€ cromozornul omolog de origine paternà, ùl acelaqi locus se va afl,a fie gena ,,Att, fie ale,la sa ,,a6t. Situarea alelelor poate fi qi reciprocà, ,,Att pe cr,omozomul de origine paternà qi ,,a( pe cetr de origine maúemà. Într-un alt locus pe aceeagi pereche de cromozomi omologi se aflà altà genà ,,Btt prezentà sub forma alelelor ,,Bs qi ,,bs. Genele A Ei B, fiind plasate pe acelagi cromozom se transmit de regulà împreunà la descendenfi. Pe celelalte perechi de cromozomi se aflà alte gene (X, Y, Z etc.) qi transmiterea lor la descendentr nu este legatà direct de transmiterea genelor A Ei B. Gena A prezentà cu alelele sale A gi o în ace,laqi locus pe ,cei doi cromozomi ,omologi poate determina variafia expresiei fenotipice de regulà a unui singur caracter. Prezenfa unei gene sub forma a douà stàri alternative (alele) poaúe fi comparatà cu un întrerupàtor electric care prezintà douà stàri posibile, alternative: închis în acest caz lumina este stinsà; - deschisEiEi în acest caz lumina este aprinsà. - exemplificàm din experienlele lui Mendel. EI a efectuaú Sà hibridàri de mazàre. Mazàrea prezintà mari avantaje pentnt studiul comportàrii factorilor eneditari (genelor) deoarece este o planta autogamà (fiecar'e plantà produae atît polen cît qi ovuie) qi prin autofecundare se pàstreazé nealteratà puritatea geneticà. Din aceastà cauzà mazàr,ea prezintà multe soiuri pure 'care se d,eosebesc tranqant între el,e prin caractene contrastante ,bob verde; flori roqii ,bob zbîrcit; bob galben (bob neted port pitic etc.) car,e se mai numesc fl'ori al'b,e; port înalt - earacùere alelomorfe qi- care pot fi o'bservate cu uEurin!à. Pugi ritatea geneticà a unui soi este d'ovedità de faptul cà prin ,out,ofecundare se pàstreazà nealterate caractercle sale, adicà se transmit fidel, neschim,ba;te, de-a lungul generafiilor, dînd o ,d,escenden!à uniformà qi asemànàtoare formei inifiale. Pe de altà parte, un soi impur genetic va da naqtere prin auúofecundare la o desoendentà neuniJormà, ad.icà va segrega.
151

4.1. MONOHIBRIDAREA,

Încnrciqind un soi pur de mazàre cu bob neted, cu un soi pur de mazàre cu bob zbîrcirt Meardel a ,oblinut în prima generafÍe (F1) organisme hibride cane prezentau feno,tipic (exteriorizau) doar caraeterul de boib neùed. Experien{a de încruciqare ln car'e se ia în considerafie doar o pereche de canactere aletomorfe se numegte experien!à de m,onohibridare. în al doilea an, a cultivat rboabel.e hitbride dirl Ft làsînd pl,antele sà se autopolenizeze Ei a oibfinut cea de-a doua generafie (Fz) de plante. în ,acest cazp lîngà plante care fàceau boabe uretede au apàrut qi plante care fàceau boab,e zbîrciúe. Deoarece în prim,a generafie, dintre cele douà caractere contrastan,te neted-zbîrclt, s-a manrife,stat doar caracúerul de bob neted, Mendel a numit acest caracter, caracter dominanú, iar factoruL ereditar care îl determinà l-a considerat factor ereditar dominant qi l-a simbolizat cu litera mare ,,Ao. În acelaqi timp caracúerul de bob zbîrcit, neexprimat în Fr, a fost consid'erat oarracter reeesiu, iar factoml care ît determinrà a fost considerat factor ereditar recesiv qi a fost n,otat cu litera micà ,,at'. În virtutea celor spuse pînà acu.m, experienta de hibridare a luí Mendel poate fi astfel scheuratizatà (fig. 44). Analiza femotipicà a celei de-a doua generalii (Fz) a aràtat cà proporlia dintne plantele cu iboabe netede gi pl,antele cu boabe zbîrcite era de 750/o neted la 250/o zbîrcit, sau simplificat de 3:1. Aoesta a fost numit rraport de segregare Ei s-a, cofrstatat a fi aproximativ acelaEi în toaúe experienlele de hibridare de acest tip. Analiza genotipicà judecatà dupà feno'tip gi bazatà pe inrtuilie a sugerat eà existà trei categorii diferite genotipiee de organisme AA, Aa qi aa. Aparilia doar a douà caúegorii fenotipice de organisme în cadrul unei popul'a{ii în care probabilistic apar patru posibilirtàli de combinare a gamefilor i-a sugerat lui Mendel cà în cazul structurii genotipice Aa se exúerioriaeazà qi ca în oazul hllorizilor din F1, doar carastenrl" dominant. Probabilita,tea aparifiei caracterului dominant esùe de 3/4, íar a oelui recesiv este de l/4, de unde raportul fenotipic de segregare 3:1, oel genotipic fiind de 1 AA:2 Aa: 1 oo. De
152

PARINTI fGenitorii' -*Hc'r czrgol recesiv botr zbkit'
Meroz cr

isepororeo toctonlrr er€drl.rír ín gometi drfecrlr I

Gomei'

Él

PRìMA
(hitrrcel

GENERAIIE (Fl)

I II I \_y

orEor-,sme t00Tohererozigote

rtil
,

"/?

x

ii' ú
Gomeir

'ol
I

o >-:
frt
50Vo 75%o

il
24o,6

tD frr;
l---_--

A

DOUA

GENERATIE (Fzl)

hofiozrgot domrnonte heterozigote
bob neted

Seg.egore drpó, z Jlo homozrgot recesive J SenotiR I l, 2,1l:
25o4bob zbîrcil
'l

'l

j

Segregore dr.rpó, lfenotrp (3 neted: t zuîrcrt )

Fíg. 44. Monohibridarea

(segregarea
ereditarí).

sau separarea factorilor

fapt, rezultatele experimentale oblinute de Mendel privind raportui fenotipic de segregare în cîteva experiente sînt redats în tabeiul 3. sà consideràm cîteva aspecte legate de oomportamentul factorilor ereditari. Factorul éreditar A este dominant. El condilioneazà un caracter dominant, caracter care se manifestà în toate generaliile, indif,erent dacà intrà sau nu alàturi de factorul ereditar recesiu în struc"tura geneticà (î,n genotipul) celulei, respectiv organismui consi'derat. EI se exprimà în- fenotip atît cînd se aflà în d,ozà du'blà (AA) cît gi atunci cînd s,e afló
153

Tabel nr. 3 Raportul lcuotiplo de segregare în erperienlele lui lùIendel

Genitori (Pórinfi) Plante de bob neted x Plante cu bob zbîrcit Plante cu bob galben x plante cu bob verde Plante cu flori rogii x Plante cu flori albe plante cu póstAi verzi x plante cu póstài galbene

Fl bob neted

F2

lnaport dr segfegaîe
I

5471

plante cu
boabe

2,96: I

uetede
1850

plante cu
boabe zbîrcite
galbene verzi. 3,01 3,15

bob galben

6022
2001

:I :I

flori

rorsii

pàstài verzi

705 224 428

rogii
albe

t52

vetzi
galbene

2,82: I

geneticà AA este homozigo'tó Ao es,be heterozigotó. Factorul eredita'r a este recesiv. El condilioneazà un caraeter recesiv EÍ nu se poate exprima atunci cînd intrà în structura genotipului alàturi de factorul ereditar dominant (A) la formele heterozigote (Aa). Se spuo,€ cà Ia organismele heterozigote dominanla poate sà mascheze genotipul. La organismele homozigote recesive (aa) fenotipul refl,ectà genotipul. Factorul ereditar recesiv nu se manifestà decît atunci cînd se aflà în dozà dublà, adieà este plasat pe ambii cromozomi omologi, stare care se numegte hòmozigotd recesiud (aa). O singurà situalie se cunoaqte în care în mod normal factoml ereditar recesiv se exprimà atunci cînd se aflà în dozà simplà. Este cazul factorilor erreditari plasali pe cromozomii de s€x Ia masculul de drosofilà sau mamifere. Formula cromozomalà a sexului mascul în aeeste cazuri este XY. Cei d'oi cromozomi de sex nu ,alcatuiesc o pereche, nefiind omologi. Dealtfel ei nici nu Be împerecheazà, intim pe toatà lungimea lor în meiozà. Cromozomul Y poartà foarte puline gene priqrtre care qi cele care intervin în masculinizare. Cromozomul X este un cromozom activ genetic. El poartà mulùe gene. Dacà o genà de pe crqmozomul X se aflà în stare recesivà (a), ea se exprimà fenotipic chiar fiind în dozà simplà, càci pe cromozomul Y, urefiind omolog cu X, nu se poate afla niciodata alela sa dominantà (A). Aceastà stare, în care gena recesivà ,,a35 s,e exprimà fenotipic, chiar cînd se aflà într-un si,ngur exemplar se nu,meste
d"omirwnúd pe cînd structura geneticà
154

în dozà simplà (Aa). Structura

stare de hemizigolie. Hemizigolia poate apare gi la organismele aneuploide monosomice la car.e lipseqte unul din crornozomi unei perechi de cronnozomi. Un alt aspect legat de f'actorii ereditari mendelieni se referà la segregore. În procesul hibridàrii, factorul ereditar dominant nu se amestecà cu factorul eredita,r rec€siv. Fii'nd de naturà corpuscularà, aceEti facùori numai coexistà în genotipul hibrid, se alàturà, fàrà însà a se contopi. Factorul ereditar dominant nu determinà nici o alterare a factorului eredi'tar recesiv, ci numai nu-i permite exprimarea sa fen,otipicà (î1 ,,dominàs). Acest lucru este dovedit de reaparifia factorului ereditar reoesiv în generalia F2. Raporturile dintre factorÍi ereditari, dominant Ei recesiv sînt mai degrabà raporturi funclionale, cel reoesiv neputÎnd fu'ncfiona î'n prezenfa celui dominant, sau produsul sàu de sintezà este acoperit de produsul specificat de fact,oruL domina,nt.

Reaparifia factorului recesiv în F2 a sugerat lui Mendel fenomenul de segregare. Segregarea factorilor ereditari se suprapune segregàrii cromozomilor omologi din bivalenli î,n timpul meiozei. Fiecare din cei doi cromozomi omol,ogi conline fie factorul ereditar ,,A((, fi,e factorul ereditar ,,as a,ja încît prin separarea lor spre poli opuqi, aceEti factori ereditari vor fi separati qi ei în nuclei diferili respectiv în gamefl diferifi atît la pàr'intele de sex femel cît Ei la pàrintele de sex mascul. Cîncl într-o ce1ulà se aflà douà alele (Aa) acestea vor fi distribuite egai în gameli. Din cei patru produgi ai meiozei (gameti) doi vor primi 'alela ,,Att $i alîi doi alela ,,as. Raportul de segregare alelicà este 24:2a sar simplificat 1:1. Acest fenom'en de segregare, disjunclie sau dezbinare a factorilor ereditari se numegte principiul, segregdrii sau prima lege a lui Mendel. Ea statueazà cà dacà orgarnismele pot fi pure din punct de vedere genetic (homozigote domirnante AA sau homozigote recesive oo) sau impure di'n punct de veder",e genetic (heterozigote Aa), gamelii sînt legic puri din punct de vedere genetic prin faptul cà, derivînd în urma divizunii meiotice, cînd are loc reducerea numàrului cle cromozomi respectiv separarea factorilor ereditari, ei confi,n fie f,ac0orul ,eneditar A, fie factorul ereditar o, nici,odatà, în condilii normrale, ,arnbii faet'ori er,edirt'ari. Principiul segregànii (s,eparàrii f,acùoriior erreditari)

tn.(,

oo<2, AA<1)

*

aplicà în cazul factorilor ered.itari

plasali în acelagi locus pe cromozomi omologi.
155

nismele homozigote de cele heterozigote. Reducerea heterozigoliei Ei creEterea homozigofiei are mare irnportamta î,n practica amelioràrii. D,e exemplu, fenomenul cle heterozís (vigoare hi'bridà) are la bazà,, ca mecanism genetic, constitufia 1000/o heterozigotà, a organismelor hibride. Inseamnà cà acest fenomen se manifestà cel mai intens în prima generafie. În celelalte g'enerafii prin sqgregare se redute graAul de heterozrgofie qi implicit valoarea heterozisului. Totoda(.à segreganea are importan!à practicà în o',blinerea de forme homo-

Considerînd fenomenul segregàrii, se constatà cà dacà în F1 org'anismele rezulta'te din încrucigarea a doi geniùori puri genetic (soiuri pure sau linii pure) sînt TAAo/o h,eterozigote, datorità fenornenului de segregare, procentul organismelor heterozigote se reduce, cu fiecare generalie la jumàtate (fig. 4b) astfel cà teoretic, dupà circa B generafii, în populalia respectivà predominà organismele homozigote. Prin autopolenizarea organismelor homozigote rezultà doar organ,isme homozigote conform sehemei di,n fig. 45. Prfur autofecundarea organismeior heterozigote a,re loc segregarea oaracterel.or. Aceasta este o cale de a deosebi orga-

,/-1,
tY
I

F1 (orsantsnp t00o/o hpteroz:ú:tFt

l(

Aufofecu ndare segregà )

?5"/"

l7j",/o 17.90/o

ì5o/o

l?,5o/o '/

{5"h

2

5 a/"

Fig. 45. Schema

red.ucerii heterozigofieí

fiecare generalie de autofecundare (autopolenizare).

qi cregterii homozigofiei cu

156

consangoínizate) din a caror încrucihibrizi simpli care, la rîndul lor, prin încruciqare dau hibrizi dubli. Aceste aspecte genetice stau la baza ob{inerii liniilor consangvinizate, a hirbrizil,or simpli Ei dubl,i de po-

zigote

gare se-oblin,

linii prrîe (linii

de tip incest, mamà-fiu, tatà-fiicà, sorà-frarte etc. încît nu se obline o puritate absolutà a liniilor consangvinizate. De asemenea segregarea are mare importa.n!à în sfatul genetic. O maladie ereditarà umanà, determinatà de o genà recesivà care s-a manifestat la bunici, sare peste o generafie (pàrinti) qi se manifestà din nou la copii. În funclie de naturà dominantà sau recesivà à g€n€i qi de fenomenul de segregare se poate stabili riscul de aparilie a'bolii. Cazutr acesta în care un element (alelà) al perechii de factori ereditari este complet do,minant iar celaLalt element, este complet recesiv se numèqte dominn:nfd completd. În cadrul sàu, în genenal uru se poate spune, judecînd dupà fenotip, dacà un Índivid este homozi,got sa,u heterozigot pen,tru alela dominantà. Genotipul unui individ care prezintà fenotip dominant poate fi úotuqi determiurat dupà fenotipurile qi frecvenfa lor analizate la desaendenlii pe care acesta îi produce în urrtà; încrucigàrii sale cu un individ homozrgot recesiv pentru acea pereche de faetori ereditari. Aceastà încruciqare se numeEte test cross. Fenotipurile Ei frecvenga lor la desoendenlii rezultafi din test cross oorespund tipurilor qi frecvenfelor genotipice ale gamelilor produgi de organismul al càrui genotip este necunoscut. Cînd individul test'art a avut unul dintre pàrinfi sau stràmoEi recesiv pen'tru perechea de factori er,editari analiza,tà, test crossul se mai numeg"te back cross sau retroînuucigare. Dominanfa face ca numàrul claselor fenotipice sà fie mai mic decît numàrul claselor genotipice. De as€menea dominanfa cauzeazà, regresia, adicà pàrhfii care sînt fen<vtipic extrsmà pentru un caracter cantitativ (productivitate) dau descendenfi care sînrt în medie mai pulin extremi. Deoarece dominanla mascheazà prezenla geureJ.or recesive, o încrucigane dintne doi indivizi de acelaEi fenotip (de exemplu cu blana neagrà, culoarea fiind un caracter cantitativ A) luafi la întîmplare poate produce descenden{i de culoare deschisà (a). Acoastà tendin{à a pàrinlitor (A} care feno,tipic sînt extreme, de a da descendenli care nu sînt
extreme se numeqte regresie. La orga,nismele polipl,oide fenomenul de s,egregare este rnai cornpltoat, în sensul cà raportul de sqgregare este de 35 A :7 o,
L57

rumrb, floarea soarelui etc. La animale consangviurizarea se realizeazà.

prin încruciqàri

deci frecvenfa cu care apare organismul homozigot recesr'v foarte micà (tabelul 4)
Tabelul 4

,este

zlgote AAAA x

Rozultatul lneruelgúrll a douú organlsmc poli' plolde reprezentin.l ttntl pure genctlo (homo(AAaa x AAaa)
aaaa)

in a

doua gonorafio

IAA IAAAA I n^o^"
4AAAa

Itoea". lAAaa +eaaa |

lAAaa
4Aaaa

laaaa

Cind se considerà perechi d,e factori ereditari ptasali pe crornozomi diferifi se constatà cà apar aspecte n,oi ale comportà-

rii

acestora.

4.2. DIHIBRIDAREA

Mendel qi.a propus sà urmàr,eascà modul cum se transmiù simultan douà perechi d'e factori ereditari: una cane determinà f'orma bobului (A:neted; wùbîrcit) Ei alta care determinà culoarea bobului (B-galben; b:verd€). Pentru aoeasta a încruciEat un soi pur cu bo,abe neted'e Ei gal'bene (AABB) cu un soi pur care prezenta boabe zbîrcite qi verzi (aabb). Asemenea experien!à de încruciqare în car,e se iau în considerafie douà perechi de caractere se nume$te dihibrid&re. ln prima ,gtsneragie a oblinut ,o populafie hibridà pentru am,bele caracter,e (AaBb), care prezenta caracùer,ele de rbob neted Ei galben, ceea oe îns€@rnnf, cà acestea sînt caracter,ele dominante, cele de bob zbîrcit 9i verde fiind deci canacùere recesive. Pentru a obline a doua generalie a làsat sà se autopolenízeze plamtetre dubluhibride din prima generalie dupà schema din fig. 46. Analizînd tabelul, numit în unele lucràri mai vechi în mod sugestiv ,,gahul cornibinàrilor mendeliene(( sau tabelul lui Punett se consbatà cà prin segregarea facboriùor erreditari î01 meiozà derivà patru cartegorii distincte de game{i rnaseuli qi tot
158

atîtea de gam'efi femeli. În procesul de fecundare are loc unirea pe bazà de probabilitate a gamelilor mascuùi cu cei femeli, adioà fiecare gamet mascul. (sau femel) are Sanse egale cu ale oelorla'lfi 3 de a se uni cu fiecare din gamefii de sex opus. Rezultà 16 posibilitàli de comdominan!à-recesivitate, oriunde se întîLnesc factorii ereditari dominanti A respectiv B va fi exprimat în fenotip caracterul respectiv (neted sau galben). Cîrrd ei sînt prezenS simultan în acelaqi genotip, vor

pÀtjttli o +

6AMÍIi

F1

relaliei

binare, respectiv 16 coantbinalii de factori ereditari. În virtutea

,@j@"
F2

AB
AB AAB B

Ab
AABb

aB

aÌ)

AaBB ìAaBb

fi

exprimate fenotipic atît caaB Aa BB AaBb aa3il laarr racterul rneted cît qi canac"terul ab AaBb Aa bb aaBb aa bb gal'bern. Caracterele reaesive vor fi exprimate feurotipie doar în cazul în oare factorii ereditari Fig a6. Dihibtid.area (Segregarea inperechilor recesivi (o qu b) nu sînt în pre- dependeutà aereditari). de factori zen\a factorilor ereditari dominanfi corespunzàbori (A qi B). Din analiza celor 16 combinàri de factori ereditari se constatà'
urmàtoarele
:

Ab AA Bb

AAbb AaBb

jealr

9/16 prezínti simultan ambii factori dominanli @B) condi' lionînd expresia caracterului neted gi galben; 3/16 prezintà un factor ereditar dominant { altut recesiv ' óondilionînd dezvoltarea unui caracter dominant gi a altui baracter recesiv (l Ó _ bob neted gi verd'e) ; 3/16 prezintà celàlalt_fa-ctor ereditar dominant 9i pe celàlalt recesiv (aB : bob zbîrcít ;i galben) ; 1/16 prezintà. ambii factori ereditari recesivi condilionînd. exprrmarea fenotipicà a caracterelor recesive de bob zbîrcit gi neted. De fapt, în experienla sa, Mend.el a obligut -în F, 556 de plante diirtre care-315 au produs boabe neted'e ;i ga-1b^e19, 108 6oabe netede gi verzi, l0l boabe zbîrcite 9i galbene 9i 32 boabe zbîrcite gi verzi.
159

Deoarece probabilitatea apariliei unui caracter dominant este de 314 iar a unuia recesiv este de ll4, gi probabilitatea apariliei simultane a douà evenimente înd.epend.ente este egalà cu produsul probabilitàtii apariliei lor separate (individuale) este u;or sà desprindem de unde rezaltó"raportul de segregare 9:3 :3:1. Probabilitatea apariliei lui A este de 3/4, a lui B tot de 314, a lui a de ll4iar a lui D tot de l/4. Probabilitatea apanlíei simultane a lui A gi B este de 314 x 314 :9/16.

AB Ab :
aB

314

x 314 - 9116 bob neted pi galben 314 x U4: 3/16 bob neted gi verde

:314 x ll4 3116 bob zbîrcit gi galben ab: ll4 x ll4: l/16 bob zbhcit gi verde
De fapt raporturile rezultà din desfacerea expresiei

G^+:i,)*(+" *ioJ.
Admi!înd cà P reprezinti probabilitatea evenirnentului X (gamefi nerecombinali) iar q probabilítatea evenimentului Y (gamefi recombinali) respectiv contaprobabilitatea evenimentului X (l-P) se poate calcula frecvenla apanliei recombinàrilor în caz;ri, unei încrucigàri dintre organisme dublu heterozigote (AaBb x AaBb). Rezultà patru tipuri de gameli femeli gi patru tipuri de gameli masculi. Dintre acestea, douà sînt nerecombinante (AB gí ab) gi douà sînt recombinate (Ab Si aB). Probabilitatea apariliei unui eveniment este egalà cu raportul dintre numàrul cazurilor favorabile ;i numàrul cazurilor posibile. Probabilitatea apariliei sirnultane a douà evenimente este egaló cu produsul probabilitàlii apariliei lor separate. Probabilitatea X- P:+.
Probabilitatc'a

I{

:I:;t

I

p

+I:li
'z -

Frecvenla gamelilor nerecombinali
Frecvenla gamefilor recombinanli

Q:l -p; - +a
g

p

-1 -

q

T

d
Zt

Pentru a calcula probabilitatea de aparilie a unui anumit tenotip se proce deazó" astfel : pentru fenotipul Ab :

(t r(
e'

pt, p(l-p),p(l-p)
4' 4 ' 4

pr+p-p'+p-pr :_: p(2-p) 2p-p' _
4 4
4

r(

160

din tabelul

Tot astfel se procedeazà' în vederea calculàrii probabilitàfii de aparilie a celorlalte fenotipuri (AB, afl;t aó) folosind datele
5.

Analiza fenotipicà a indivizilor din generalia Fz a aràtat cîteva aspecte import,ante privind comportamentul factoril,or €r€ditari. În primul rînd s-a dovedit încà o datà realitatea segregàrii factorilor ereditari. Dar mai importantà este aparilia unor categorii noi de indivizi. Astfel, în clihi,bridare s-a pornit de la clouà tipuri de plante: cu bob neted Ei galben (AB) gi cu bob zbîrcit Ei vei'de (cb,) gi în F2 au apàrut pe lingà aceste douà tipuri iniliale încà d'ouà tipuri care prezenitau un caracter de la un genitor Ei ait caracter de la celàlalt genitor. Avea loc deci 1a descendein{i o dezbinare a cuplurilor de caractere parentale. Si,ngura explicalie plauzútbil,à era urmàtoarea: La nivelul hibridului din prima generalie (AaBb) perechea de factor:i ereditari care determinà forma ,bobului (Aa) segregà independent de perechea de factori ereditari care determinà culoarea bobului (Bb) Ei astfel se creeazà posibilitatea probabilisticà a asortàrii independente a factoriior ereditari astfel încît în acelagi g'amet va putea trece un factor ereditar de la o pereche Ei un factor ereditar de ia ceaialtà pereche (fig. a7). Acegti gameli se ,numesc game[i recombh,a[i. Dacà ,n'u ar fi o segregare independentà a cetror douà perechi de factori ereditari, aiunci ar lua naqtere doar douà categorii de gameli qi anume rgamelii nerecom,bi,nanli AB gi ab care ar condiliona formarea a douà caúegorii de organisme cu bob neted Ei galben
AABBO t

X aabbd

Fig- 47.

dentà a perechilor de cromo-

Segregarea indepensegregaîea

fàgurîndu-se în meiozà., Ia fot-

(disjunctia) independentà a perechilor de factori ereditari, evenimente caîe se presupun reciproc Ai se suprapun, desmaîea gamefilor.
I

zorni însolità de

I -

Descifrînd tainele ereditófii, vol. I

161

(t)

t9
Gamefi

Tabehtl Probabllltàflle de aparlflo a dtferltelor fenotlpurl

5

\

AB

Ab

aB

ab

o\ó
a\

(?)
ABAB

r*)
ABAb

{;)
ABaB

(?r
ABab
p)

AB

t?)
Ab

I -p
2

1-p_(l-p)'

p p(l-p)

I -p

oo -2

P ._:

p(l -

ABAb

AbAb

AbaB

Abab p
2

t;)
aB

p 1-p 224

:- p(l -p)

p p_p2 224
AbaB

ppp2 224
aBaB

l_-p_p(l-p)

ABaB

aBab

(*l
ab

1-p_p(l -p)

ppp2 224
Abab
p

p p_p2 224

P.

L:-P:qO-P) 224

ABab

(?t

I -p
t

L___r_(l-p):

I -p

p(l -

p)

2

f-!r
2

p p(l-p) 24

(AB) $i cu ibob zbîrci,t qi ve,rde'(ab), adicà s-ar pàstra ú,ipurile inifiale, paneurtale, de organúsyne.* Cunoscînd cà în meiozà ar,e loc disjuncfia independentà a perrechilor de cromozomi omologi gi qtiind cà factorii ereditari sînt plasati pe cromozomi, este ugor de tras concluzia cà pentru a segrega ind,ependent unra de al,ta, cele douà percchi de fac[ori ereditari Ao Ei Bb tre{buie sà fie plasate pe ,pe'rerohi diferite de cromozomi. Segregarea independeu:tà a douà pereehi de factori ereditari, respeetiv de caracúere în care apare naportuL de segnegare 9 :3 :3 : 1 poate fi uqon redusà la segr,eg€ulea a douà cara'cúere aleilomorfe, dacà se considerà segregarea separatà a fiecàrei perechi de caractere. Astfel, oonsiderînd pe,redrea Ao, fàcînd abstractie de perechea, Bb r,aportul de segrqgare va fi
_t_

9.3 16'16 3l

t2 - - pentru factorul I 16^
4

gi

-t_ t6'16

l6

pentru factorul 6I sau simplificînd. va

fi

deci

3.1 14

adici 3A la \a

absúraclie de perechea Ao.

Situalia este identicà pentru perechea Bb, cînd se face

Peutru a càpàta o anumità" certitudine, mai exact pentru a se asigura statistic cà segregarea este o lege, Mendel a aplicat testul chi-pdtrat y2 l, ! în care se introduc valorile agteptate potrivit raportuloi à" sgregare stabilit în alte experienle (9: 3 : 3 : l) gi valorile care se determinà în experienla curentà
actualà.
independentà a perechilor de factori ereditari imporqi în prac.tica a,melioràrii face oa din or,ganisme dubùuihet€n:ozigote de tip {AaBb, prin ,autofecund'are, sà se oblinà pe lîngà orìgriulisÍtele d,ublu homozigote inigiale (AABB qi aabb) noi categorii de organisme dublu
bantÈi

-

* Disjuncfia

homozigote (AAbb pi aaBB) ca qi al,te oategorii homozigatn pentru o singu,rà pereche de caractere (A,abb sau aaBb). Aceste,a, alàturi de onganismele recombinante, pot sA reprezinte obiective irnportante în progr'amele de ,ameliorare.
163

Astfel, dacà într-o experienfà de ttp AABBXaabb se obtin urmàtoarele daúe (tabelul 6)
Tabelul 6
Caleulul lui

It pontru Eogrogatoa ln F, a raportului g: 3: 3: I
AB
2834 2808 26 676 4,24

Valcri
observate (0)

Ab
920 936
16

Total
951

a;teptate
Diferenfa dr Dr
e

(e)

936

(d:0-e)

t5
225

256

4,27

I

0,21

valoarea Lui Xz de 2,75 pentru cele 3 grade de libertate (4 clase fenotipice 1) corespunde l,a o probarbilitate de tr'ansgresiune care este mai mare de 0,30 dar mai micà de 0,50 (p inseamnà cà din 100 de repetàri ale - 0,50 - 0,30). Aceasta unei experienfe date, la 30 pînà la 50 dintre e1e vor apare devieri probaibile de la naportul 9 :3 :3 : 1, egale sau mai mici decît cele observate. Cum valoar,ee, lui p esùe clar mai mare de 0,05, rezultatel'e observate pentru raportul 9 : 3 :3 : 1 sint în acord cu oele agteptate pentru asortrarea independentà a d,ouà perechi de alele. Repetabilita,tea 1,or cu o as€menea frecven!à nu se poate datora întîmplarii ci mai curînd qqor cauze intrinsece a desfàEuràrii me'c,anúsmului ereditar la nivelul c,Blulei dupà anumite legi ,exacte. Astfel, segregarea apare Ìegic determinatà gi statistic asigura:tà. Considerarea caracteruiui statistic al fenomenului ereditar se bazea'zà p'e admiterea cà fiecare dintre produqii meiozei (gametr) prezintà qansà egaià de a participa în procesul de fecundare. Marile evenimen'te genetice se desfàEoarà însà în meiozà. Cea de-a doua lege el,aboratà de Mendel gste legea esortdrii sau. disjwtcfiei indepenlnnte ,a perechilor de factori ereditari (gene) qi se referà la gene oare sînt plasate pe cromoz,omi
Niciodatà gaarrefii nu vor fi Aa, Bb, ABb etc. decît numai în cazurile anormale, rare cînd are loc nondisjunclia meioticà a cromozomilor oare este însofità în consecin!à de nesegregarea factorilor ereditari. Cînd se fac încruciqàri între douà soiuri
164

neomologi.

pure, luîndu-se în oonsiderare tnei perechi de factori ereditari (AA, BB, CC X dn bb cc) tabloul segregàrii este mult mai cornp1ex. Asemenea experien?e se numesc experienle de trih,ibridare. Se 'oblin cîte B tipuri diferlte ca genotip de gamefi atît masculi cît qi ferneli Ei r,ezultà 64 de oombina{ii dînd un r,aport de segregare de 27:9:9:9:3:3:3:1, ceea oe înseamnà cà frecvenfa de aparilie a formelor homozigoùe este proporlional rnai redusà decît în monohibridar,e sau di'hi'bridare. Segregarea independentà a per',echilor de fac'tori ,ereditari, respectiv a perechilor de cnomozomi r,eprezintà în sin,e un mecanism de recornbinare genutied, intercromozomnld. Acest tip de re oombinare geneticà carac bertzea'zà, doar organrismele eucariote càci doar ele conlin mai multe grupe de lineaj, r'espectiv mai mulfi cromozomi neomologi. Recombinarea inúercrom,ozomalà reprezintà segregarea de cromozomi întregi în' meiozà care determinà segregare,a de gene nelincate adicà de perechi de alele localizate în cromozomi n,eomol,ogi. Fenomenul disjuncliei independente a per,echilor de cromozomi respectiv a perechilor d,e factori ereditari este de fapt un fenomen predeterminat de ag€Zarea rand'omizatà a om'ologilor din bivalenli fa!à de planul ecuatorial al plàcii metafazice. În virtutea acestui fapt, prorbabilitatea ca toli cromozomii de origine maternà de la nivelul tuturor bivalenfilor sà se aEeze deasupra planului ecuaúorial sau toli cromozomii de origine paternà de la nivelui tuturor bivalenlilor sà se aEeze sub planul ecuatoriai al pl,àcii metafaziae este egalà cu pr'obabilitatea ca aceEti cromozomi de origini diferite sà se aqeze unii deasupra, allii dedesubtul planului ecuat'orial. Asemenea agezare randomizatà a cromozomilor d'e origin'e maternà qi paternà fa!à de planul ecuaúorial al p1àcii metafazice în metafaza I condilioneazà distribu{ia independentà a perechil,or de cromozomi, respectiv de factori ereditari spre poli în anafaza I. Din aceastà cauzà este corectà interpretarea în termeni de predeterminare pe care o dàm fenomenului de disjuncfi'e independentà a perechilor de faetori ereditari. În absenfa urir€i asemenea predeterminàri factorii ereditari de origi,ne maternà (AB) ar migra totdeauna la un pol,, pe cînd cei de origine paúernà (ab) ar rnigra ia po1ul opus, rezulúînd doar douà tipuri de game{i (AB, respectiv ab), neexistînd posibilitatea apari{i,ei de gameli recombinanfi, (Ab Ei oB). Distribulia polarizatà,a crom,ozomilor particulari ia un pol al fusului de diviziune are l,oc foarte r,ar qi duce la o asortane ner,andomizatà $i 1a o segr,egare nerandomizatà de markeri ge165

netici. Sqrqgarea independentà a perectrilor de f'ac"tori' u€ditari respectiv a pereohil,or de cromozomi cane asigurà necombinarea geneticà intercromozomralà face ca probatbilitatea ca doi garnefi sà fie 'asemànàtori sà fie,foante micà. Astfel, cunsiderînd omul, catre aret în gamitura diploidà 46 cromozomi, iar în gamefi 23 de cromozorni gi adrnifînd cà în fiecare cîorlozóm s-ar a,fla doar o genà, proba,bi,litatea oa doi gamqi sà fie iden'tici grenotipic este o" (;)- iar ca doi indivizi um.mri sà fie
identici genetic este de

(+ft.

Aceasta reprezintà o probabili,tate

extrecn de micà qi este posibil ca în populalia umanà de la originile sale sà nu fl exisùart doi iqldivizi asemànàtori. Ercepfie ar pu,tea sà facà gemenii monozigoli care pot avea o constelalie identicà de faretori, ereditari nucleari dar qi în acest caz pot sà aparà diferenle în oonstelatia de facùori ereditari extranucl€ari (rnitoctndriaùi de exemplu), distribuirea mitocondriilor în timpull diviziunii fiind mai pufin echilibratà. Distri'bulia echili,bnatà a fagtorilor ereditari nucleari este asigunatà de mecarnismul mitotic de diviziune. Dar probabilitatea ca doi indivizi ai unei specii daúe sà fie identiei este qi mai micà dacà luàm în considera{ie faptul cà pe fiecare cromozom n'u se sflà o singurà genà ci mai multe gen€. Consideirînd spe.cia uma,nà rei,ese cà fiecare individ este o enrtiúste geneticà irepetabilà. Cercetàrile lui' I\ttendel, au pus pia'tra de temelie a Geneticii. Publicate într-o rwistà de sla,bà circulafie sub titlul ,,Versuche ùber Pflanzenhybriden( el.e au fost date uitàrii. Savanlii timpului erau încà cu a'tenfia îndreptatà spre teoria lui Darwin asupra originii speciilor prin seleclie naturalà, uitind de alte descoperiri tot atît de geniale. Se spune cà Meurdel nu a avut loc înr seool,trl lui. Elr a fost pur Ei simplu mutat în secolul nostru. Destinul luii qtiinfific a fos'ù qi mai dramatic dacà ne gîndim cà Menilel a murit cu Bîndu} cà ceea ce a descoperit el s-ar putea sà nu fie o realitate a naturii. Acest fapt s-a datorat efectuàrii unor ercperiernle de hi,bridare Ia Hùerupdwrn, plantà apomicticà, cane nu are deci o meiozà ti,picà qi, cum este qi firesc, nu s-{a supus legilor mendeliene a,le eredi;tà{ii. Cercetàrile lui Mendel a'u revolufi,onat bíologia. Pentru prima datà, dupà 23 de secole, era dàrîmatà concep{ia lui Hippocrate despre transmiterea directà a caracterelor de la, pàrinli
tra descendenli. 166

Rel'uaúe 1o alte plante qi la animal,e, legile descoperite de Meerdel privind comporrtarea factorilor ereditmi s-au dovedit tmiveml aplioabile, iar excep(iile nu au fàcut decît sà currfirilre rqula, extinzînd qi' dezvoltînd concep,m lui Mendel despre crndita,te.
4.3. EXCETTII DE LA BAFORTURILE MENDELIENE DE SEIGBEGARB

CAZUBI PABrICUTIIRE DE ENEDITAÎE
1.3J-.

NMTNANTA INCOMPLETA SAU SEMTDOMTNANTA

Corrtns, redescoperitorul legilor lui Mendel a,làturi de Tschermak qi Hugo de Vries, încruciqînd un soi de Miruhilis jalng cu ftro.ri roqii (AA) cu 1rrì, soi cu flori aìXbe (aa) a oblinut în prima genera$e tritbridà (Aa) doar plante eare fàoeau flori noz. Prin autopolerrizaîeà, acestora (Aa X fu) a ob.tinut în F2 un raport de segregare diferit de cel mendelian obí$nuit (3 : 1).

Amta a fos't de 1 : AA :2 Aa : I u. Dupà cum se vede, în acest
îotu toz
alb

2s%

50% 25%

rapÉul de segrcgare Senotipicà corespunde cu raportul de segregane fenotipicà, iar homozigo{ii dominangl (AAJ se exprimà fenotipic diferit (rogu) de heterozigoli (roz). Gena A n,u se marrifestà ca, totatr dominrantà asupna lui ,d' iar ,pf' nu se ilnanifestà ca total, recisivà fatà de A. Cele douà gene se nranifesG cu intensi,tat€ egalà. Fenomenul s-a numit dominsnPd
caz

incompleúò sau sqnidsrnirwr4d. Î'n experienfele pe maeàre era o domirran!à completà qi segrqarea in acest Gaz s-a numit segregame de tip Piswn. La Mirabiùls este vorba de o dominanfà incompletà iar segrqgarea sra numit de tip Zm càci fenomenul a fost prima datà observa,t lia porumb prin încruciEarea un,ei varietà{i' cu 'boabe albastre cu o varietate cu rboabe albe din caFe au ie.qi,t plante hi'bride cu boabe violacee. Tot astfel din încrucigarea unor gàini cu penaj negru cu gàini cu penaj ,alb, rezultà gàini de Andaluzia care au penajul al,bastrui. Cum gàinile de Andoltnùs, (cu penajul albàstrui) sînt impure genetic (,hihride) ele segregà în fieoare generafie, din care cauzà n-a fost posibilà crearea unei, r'a$e de gàini cu penajul albàstrui. La om, cel' mai cunoscut exemplu de dorninanfà incompletà este oel al anemiei falciforme. Gena muta,núà s conditioneazà
r67

sinteza unei forme mutante a catenei 0 a hernoglobinei qi facc ca sà aparà hemoglobinra HbS în loeu1 hemoglobinei normale HbA. Indivizii hom,ozigoli s/s de regulà mor înainte de maturitate, prezentînd anemia falciformà. Heterozigolii Sis sînt viabili qi prezintà eritrocite f,aiciforme, dar anemia 1or nu este atît de severà ca la indivizii s/s, prezentînd numai tultburàri de respiralie ia altitudini mari, unde oantitatea de oxigen e redusà. Cînd hemogiobina unor asemenea indivizi este analizatà electroforetic se constatà cà aceasta oonfine carntitàli echimolare de catene normale gi de ca'tene muùante {3. Acesta ar fi un caz Ce codominnnfd, dacà se considerà ,,fe,notipul in vitro((. Aceast,a înseam. nà cà ambeie gene S gi s funclion e'azà cu aproximativ aceeaEi eficien{à. Dominanfa lui S este incompietà, dar adesea se considerà cà cele douà alele S si s sînt codominante.
4.3.2. SU P RADOM INÉNTrr

Cînd fen,otipul heterozigotului (Aa) depàqeqte prin caracteristicile sale cantitative ambii genitori homozigoli se înregistreazó. fenomenui de supradominanfd. Supnadominanfa s-a înr,egistrat în cele mai multe cazuri în care se ran,aliz eazi màrilecesirrà (zp) iar gena care determinà culoarea ro$ie, norm,alà a ochiior este dominantà (tn+).În stare hetenozigotà fu:+/tr.:) se constatà o creqtere notabilà a cantitàtii de pigmenfi (în speci,al a sepiapterinei) atît fa!à de homozigolii cu .oohii aùbi (u/u:) cît Ei fala de homozigolii normali (u+/ut+1
mea, pr,oductivitatoa qi via,bilitatea descendenlilor. De. exemplu, la Drosophila, gena care deterrninà culoarea albà a ochiLor este

În cazul codominanfei genotipul heterozigot dà nagtere la un fenotip diferit fafà de ceie det'errninaúe de genotipuriie ,homozigote. Aoest fenomen se înregistreazà qi în semidominanfà (dominan{à incompletà). în cazul codominanlei însà, spre deosebir,e de semidominan{à, genele alele ,nu au raport de dominan!à sau recesivitate, ele fiind dominante fafà .de, alte gene
168

dintr*o serie de mai multe alele, dar codominante uura în raport cu ceaùaltà. De exempiu, la om grupele sanguine au un determinisiu genic'polialelic. Grupa sanguinà A are formula genotipicà 14^ homozigot dominant sau l l0 heterozigot. Grupa sauguinà B are determinismul genetic LÍIB respectiv
Grupa sangvinà 0 are determinismul genetic 1010. În toate aceste cazuri alelele I ;i lB se manifestà ca dominante fa!à de alela /0 care este recesivà. Cînd. însà cele douà alele dorninante se întîlnesc în genotipul indivizilor cu grupa sangvinà AB, care are deci formula l^lB, nici una dintre ele nu manifestà dominan!à sau recesivitate f.a!à" de cealaltà. Ele codominà . fl c9.1d!!io-neazà. apurt.fia.,unui nou fenotip (gtop.* sangvinà AB) diferit de cel al pàrinlilor (mama grupa sangvinà A, tata - grupa sangr;i1[ B sau viceversa). Un exemplu tipic de cod,ominan!à es'úe locusul esterazei-î de la Drosophila melonogaster. Una din cele d,ouà alele ale ecestei gene pr,oduce o formà F ce migreazà rapid (fcrst rnigrattng) pe gelul electroforetic iar cealaltà alelà produce o formà S a enzimei esterazice, ce migreazà îneet (slous migroting). Analiza extractelor din indivizi heterozigofi, desemnali F/S aratà cà cele douà tipuri de enzimà sînt prezente în cantitàfi tga,le. Prezcnfa unei proteine nu are vreun efect aparent asupra eantitàlii sau activitàtii eeleilalte enzime. Asemenea enzime se numesc ismime. Majorita'tea wozlrnelor sînt d eterminate printr-o interacliun e al,elicà de tip codominan!à, gi ele se pun în eviden!à în extracte celulare nu prin analizà fenotipicà propriu-zisà a întregului org'arrism càci indivizii F/F, F/5, S/S nu pot fi deosebili dupà tenotip, ci doar prin analizà electroforeticà, tipuriie homozigote prezenúînd o singurà bandà electroforeticà pe cînd tipul hetenozigot prezintà douà ,benzi, una F, alta S.
ALELE LTIPLE (POLTALELTA)
FlÙ.

4.3.4.

MU

Alelele reprezintà alternative ale ace,leiagi gene, controì.înd expresii diferite a,le aceluiaqi caracter. În urma mutaliei genei de tip sàlbatic care de reguià este dominar,rrtà (A) apare alel,a sa reeesivà (o). Mutafia este mult mai rarà în sens invers
169

Genele la organismele diploide se aflà sub formà de pereche (alele) Ei sînt dispuse în, acelagi locus F cromozomi' omologi. Fiecare din crei doi cromozomi ,omologi ai unei perechi va oonline î,n, ,locusul corespunzàtor doar cîte o alelà dintr-o pereche de a'lele ,ale unei gene, fie A, fie a. Niciodatà cel,e douà alele nu vor fi plasa,te (suprapuse) în aceleqi locus, pe acelaqi cromozom. Proc,esul de mutalie s-a desfàEurat progresiv în timp qi el a dus mai întîi la aparilia din gena inilialà A a alelei sale reces,ive ,,at6. Dar într-o altà etapà, din ac€eaEi genà inifialÈ A, & putut deriva alela,q care controleazà o altà expresie a raceluiagi caracter. Mutalia genei A, desfàEuratà înx diferite sensuri a determinat aparilia unei serii de alele 'c1, @' o3 . . . ant care controleazà varia{ia expresiei aoeluiaqi caracùer. Asemenea gene poartà numele de polialele sau otrele mttlbiple. Seria h, o2, as. . . an este o serie polialelà. Toate aceste alele ocupà acelaqi locus pe cromozomii omologi. Aceasúa nu înseamnà cà toate alelele vor fi plasate în acelaqi timp, într-un singur locus pe perechea de cromozomi omologi. Fenomenul polialeliei este un fenomen populafional, ceea ce înseamnà cà la unii indivizi ai populafiei considerate, pe o perectre de cromozomi omologi se aflà într-un ltocus precis delimitat perechea AA; la alti indivizi pe areeagi pereche de cromozomi omologi, în acel,aqi locus, se va afla pe'rechea are, la alfii ortla q.a.m.d. La indívizii heterozigoti pe tln crornozom omolog, înúr-un locus dat se va ,afla alela dominantà A, íar pe celàla1t cromozom omolog, în acelaEi locus (locus corespunzàtor) se va aflta fie alela r,ecesivà a1, fie ale,Ia re-

(a-+A).

Cazul citat la codominan!à este în acelaEi :timp un caz de polialelie. Cele úrei gene IA, Iu $i 70, ocupà acelaqi locus pe cromozomii omologi qi oontroleazà variafia grupei sangvine în populafia umanà, fàcînd ca unii ilrdivizi sà ai,bà grupa saqgvinà A, alfii grupa sangvinà B, al,tii grupa sangvinà AB qi af{ii gru-

cesivà a2'etc.

Existà un principiu fundamental al imtrnoltogiei potrivit càruia urÌ orgarrism, în condilii normale, ru va produoe anticorpi împotriva sa. Astfel, dacà una di,n,trre proteinel'e produse d,e un organism este antigenul-P, atunci anticorpul anti-P nu se va produce în serul aceluiaqi organism. Eri,trocitele umane prezintà antigene, pe cind serul sarugVin oonfine anticorpi. Cînd serul de la un individ cu grupa sangvinà A se amestecà cu eritrocitele de la un individ cu grupa sangvinà B, apare r.eacfia de aglutinare. Tot la fell se înf;implà cînd serul de Ia indivizi cu
170

pa sangvinà 0.

grupa B se amestecà cu eritrocitele de la indivizi cu grupa sangvinà A. Pe de altà parte, amestecul de ser qi de celule de la acelaqi imdivid, sau mai exact de la indivizi care au aceeaqi grupà sangvinà nu determinà ooa,gularea. Aceste ràspunsuri' diferite sînrt determinaùe de o clasà de antigene localiaa'tà pe suprafafa eritrocitelor. Astfel, alteùa dominantà fé' specificà antigenul A qi anticorpi anti,-B, alela domi,nanúà 18 specificà antigenul B Ei anticorpi anti-A, iar alela recesivà 10 mu specificà nici o structurà anúigenicà. Analiza biochimicà a eviden{iat, faptul cà antigenul A este o o-N-acetil-D-galactozaminà, atagatà de un gl,icolipid sau glieoproteinà, aflnte la slrprafala eritrocitului. Antigenul B es@ o o-D-galactozà. Persoanele cu grupa sangvinà A au enzima a-N-acatilgoloctolm.núltransfetwn care ata$eazà galactozamin'a la l,ipidul sau proteina de la suprafafa eritrocitulr.ri. Persoanele cu grupa sangvinà B posedà q a-D-galncbsilhwtsfeonzd care a,taqeazà galactoza la compugii de pe suprafafa eritrocitului. Pensoa^rrele cu grupa sanrgvinà AB au amrbele tipuri de antigene qi deci ambele tipuri de enzime, apar€nt în canúitàti echirnolare (alelele Io Si IB sînt codominante). Serul persoanelor cu grupa sangvimà AB nu oonline antioorpi an'ti-A, nici, anticorpr anúi-B, din cane cauzà persoanele cu Brupa sangvinà ,48 sînt primitori r,uliversal.i de transfuzii
de sînge.

Alela -10 nu condilionazà sinteza weunei enzime gi persoanele cu €rupa sangvinà 0 nu prezinrtà antigene A qi urici anrtigene B. Eritrocitele lor sfurt n€utne, dar în serul lor se aflà atît antiaorpi am.rti-A cît qi anticorpi anti-B. Pentru deùeeùarea celtor patru fenotipuri se folosegte neactia de a,glutimarre (fig. 48) cu douà tipuri de antiser (anticorpi) anti'A gi anti-B, conf,orm ta'beùului 7. Ier,anhi,a dominanlei celor trei atele este ,(7o : 18) > l0 (tabet S). De regulà o alelà necesivà (precum este atela l0) care specificà o pnoteinà fur,activà es,te rarà comparativ cu alela sa dominantà (aqa cum sînú alelele fA sau 1"). În cazulr acestor alele însà rapare o @(c€pfie de la regulà, càci persoanel,er cu grupa sangvfurà 0 sflnt muLú mai frecvente în popul,afia umanà decît persoanele cu alto grupe sangvine, ceea se înseamnà cà frecvenla genei I0 în populafia um,anà este marne. Existà o anumità distrirbufie geogrraficà a grupelor sangvine în populafia umanà. Cea mai constantà disúritbufie o are grupa B. Frewenfa cea mai mare es,te înrqisùratà în Asia cenùralà gi este de 25-300/c. De aici, frecvenfa drescnegtc în toate di-

t7t

Donor (cnhgerc)

G-,ps
Singe

,Je

("€Ù

1i + F

,í€\ *_ */

)

rol it
L_

__l
genele celulare.

Fig. 45. Acfiunea serului de la peîso&ne cu gnlpe sangvine v.Àriite (receptori)asupra d.iferitelor tipuri de eritrocite (donori).
Aglutinatea celuleloi indicó reacfia anticorpilor serului cu anti-

'
Roaegia de aglutinare

Tabelul
sangvlnG

7

in stabilirsa eelor patru fenotipuri ale grupel

,ArA
tAr0

sau

Galactozamina
(A)

anti-B I B, AB

A9i0

t&" "^t tBto

Galactoza
(B)

anti-A I A, AB
nici un tip
anti-A *

Bqio
(primitor

Galactozamina

(a)+

A,B,ABgi0

Galactoza (B)
toto

Níci ua tip

A,B9i
AB

f anti-B

Numai de la (donator uni
sal)

L72

Tabclul g Btabllirea grupelor sanguine ale eopiiilor rezultafi ùn eAsàtorla unor persoenG su rllforito grupe sangvlne Ee laeo dupú urmAtoarea sehemA: Grupa sanguinó lfenotip) Formula
genotipicà

a pArinfilor

posibilà
1010

Formula genotipicà a copiilor

0x0 0xA 0xB
OxAB

(f enotinur) | "ron" t copiilor i

f

sanguinà

x x y

1010

lolo X lic,lAj --"--l
rîtn *- iArn 1010 la10
1010'à:

I loio I raro lal0
I

lAlo gi
lBlo

l.olo

Asau0 Bsau0 AseuB
A

X lBlB
1B1o

Éf'--U:r
lala x lal-{
1"r"
lalo x lalo

1o1o'

lBio $i lolo
1 1o gi lAIA
1n1o

r_lg
lBlB
1BlB,
1B1o 1B1o

lalArSi lAlo lAlA:gf lolo
IAlB
e1e1B qi.1B1o

lala x

Asau0 ----_ AB
AB, B A, B, AB, O
AB, A
B B

AxB

lalo x
14,10

1a1A

1 ;

lA,lB, lAlo. 1810. 1o1o ?talB, lAlo

1B1Bl y,1B1B

;a'1410 tBto x lBlo 1B1B I 1a1n lBlrry talB É1a x lAlB
1B1B-

lals | tola 9i ltlo

I ltlE, lplo: ,i lolo I t^tt qi lBtB I tAlB, tnt., latl tBla I lap, IAÉJBIB

Bsau0
AB sau B AB, B, A A, B, AB

recîiile, a,jungînd în Franfa qi Anglúa 1a 5-t00/0, iar în populatiile naturale ale Australiei $i Americii de sud este foarte
micà sa'u nulà. De asemenea, o distrirbufie asemànàto,are se înregistrcazà în Africa, unde fnecvenfa gen'ei 18 este oe€, mai mare îrl Congo, de unde descreqte în toate direcfiile. Gena 7o, prezintà frecvenla cea mai mare în Europa de Vest, Australia qi unele zone din America de Nord. Modelul sàu de distribulie este mai universal, dan mai putin regulat. O frecven!à mai mare a sa se înregistreazà în populafiile diil) Tibet, la boEimanii din Africe de sud, pigmeií din Congo, negîii din Fitripine Ei unele populalii din sudul l,rÀdi€n.

L73

mai frecventà in toatà trumea, dar cea mai apare în populafiile natunale din Ameftratt^à frecven!à rica (indien,i americani), în r-urele regiuni al,e Afriqr" Au^stralia gi Orierrùnl mijlociu. În Europa €8 €lue o frecventa de 5l4go7r. Unele triburi de indieni americani prezintà fiecventa de 100f^ a genei 10. Altele au o frecven!à de 490/o I0 Si 1tt/o IA sau
Gerra I0 esúe
cnea

(750/o)

În cazul càsàtoriilor A X 0, B X 0 sau AB X 0, in ca,r'e fe0 apare o r,educ€re cu 250/o a niumàr-ului de oopii cu grupa sangvinà A sau B. Indivizii cu gralpa sarlgvinà 0 produc in terul sangvin anticorpi A qi B.- fo timpyl, vieÉi intrau-terine, unele celule sangvine de tip A, formate de fo'eiusul A, intrà în circulafia sangvinà a mamei (mai ales fur timpul naqterii cînd se rupe p}acenta) qi acfioneazà ca rr,tigene care stimuleazà producerea de antioorpi anti-4. La naq'"terea urmàtoare anticoipii formafi în tirnpul sarcfurii preoedente trec
meira are grupa San€viftà în, circulafia sangvinà a

B7o/s 10 Ei L3o/o 74.

fàtului, producîndu-i moarteaAsemenea Asatorii dintre femei cu gl:upa 0 qi rbàr'bafi cu alte grupe sangvfure se numes c AB0-incom'patibile. niistg de asemenea o corelafie directà dintre grupa sangvinà 0 Ei incidenta uloerulnri duodenal, persoanele cu grupa, saqgvinà 0 prezentînd o probabilitate de 400/o mai mate d:e a face boale, fa!à de persoanele cu celelalte grupe sangvine. .au mai fost descrr$i qi atli loci georici ce sÈcificó qi La om alte antigene ale grupelor sangvine. AEa sinú detenminan$ti genici M, N gi Rh.
5. FACTORUL Rh

;i

Stud.iindu-se asemànarea imunologicà dintre sîngele uman cel al maimalei Maccacus rh,esus, s-a constatat cà serul iepuriior imunízalí cu, eritrocite de maimu!à dà o puternicà reaclie de aglutinare a eritrocitelor la un numàr mare de oameni. S-a admis cà oamenii pot conline un factor responsabil de aceastà reaclie, factor desemnat Rh, de la denumirea speciei de maimufó. Ulterior s-a dovedit cà factorul este ereditar gi reprezintà alelele rh+ (Rh) ;r rh (Rh- ) ale aceleiagi gene implicate în determinismul reacfiei imunologice. Alela d.ominantà rh+ (Rh) condifioneazi reacfia de aglutinare, pe cînd. alela recesivà rh (Rh-) nu determinà reaclia de aglutinare. Oamenii pot avea d.eci Rh pozitív ;i Rlz negativ. Cînd cuplurile parentale sînt homozigote, nu apar probleme de aglutinare gi descendenlii se nasc normal. Complicaliile apar însà atunci cînd tata are Rlt, pozítiv iar mama
174

R

h-

Rh-

ei
t\

Rh+ Rh+

of

Rh- Rh+

(coPii hetcrozigolil

x Rh. Rh- o /\ + /\ 50%Rh+ Rh( nn Pozitivdar
62Ss7s2i

Rh+ Rh-

ol

50'/o

Rh-Rh-

(Rh negativl

gati )

Fig. a9. Transmiterea factorului Rh.

sangvinà a mamei gi d,eterminà aici formarea de anticórpi antiRh.- Anticorpii apoi pàtrund în circulafia sangvinà a fàtului. Viala acestui, dacà e vorba de prima sarcinà nu este periclitatà, dat.fiind faptul cà titrul anticorpilor nu este prea ridicat. Prima nagtere se desfàgoarà normal. La a doua nattere însó, embrionul heterozigot (rh+rh- ) d,eterminà gi de aceasti dati, prin prezenla factoruluí rh+, sintezà d.e anticorpi anti -rh în organismul matern. Titrul anticorpilor antí-Rh sintetizali la a doua nagtere se adaugà aceluia realízat la prima nattere, dublîndu-se. Mama este imunizati îa!à, de antigenul rh+ de la sarcina precedentà prin anticorpii deja prezenlf în corpul sàu. Dar acegti anticorpi pàtrund în circulalia sangvinà a fàtului gi, fiind în cantitate mare, determinà o puternicà reacfie de aglutinaîe a eritrocitelor fàtului. Aceastà reaclie de aglutinare stà la baza malad.iei eritroblastosis foetalis, în urma càreia fàtul moare. Accidentele d.e eritroblastozi pot fi prevenite fie prin transluzli masive de sînge prin care se înlocuiegte o parte din sîngele matern, reducîndu-se astfel titrul anticorpilor, fie prin scoaterea fàtului cu mult timp înainte de termenul na;terii (corespunzînd perioadei în care titrul anticorpilor cregte exponenfial) gi cregterea lui în incubator. Sînt încà d.ispute privind natura locusului Rh. Unii admit cà este vorba de un singur locus genic cu mai multe alele, pe
L75

Rh negativ fig 49. În acest caz se nasc copii heteroziggli (rh* rb+ xih- rh- - rh+ rh-). La prima sarcinà, antigenul specificat de factoral rh- al fàtului heterozigot pàtrunde în circulalia

ca gi în populaliile indiene ale Americii ;i Australiei. Alela rh+ are o distribulie mai neregulatà, prezentînd totodatà mai multe tipuri. De exemplu, tipul .RZ0 sau cDe are o frecven!à d.e 5o/o în populaliile europene, chineze, indiene americane gi aborigene australiene ;i 600/" 1a negrii africani gi pigmei" IIn alt típ, Rh 1 sau CDe are o frecven!à de 55% în popuialia europeanó, Sí 600/" în populaliile asiatice, 58% în populalia de aborigeni australieni gi numai 25% în populaliile africane gi indiene americane. Persoanele cu Rh negativ produc anticorpi fa!à de celulele rogii Rh pozítive, dar nu are loc gi o reaclie reversà. Un interesant fenomen de polialelie a fost descris la Drctsophi,la melanogaster, la care díferitele nuanle a1e culorii ochilor sînt determinate de o serie polialelà. Astfel, tipul sàlbatic are ochi de culoare rogie, nuanià determinantó. de gena dominantà 7p1*. Diferitele nuanle ale culorii ochilor, aitele decît culoarea rogie, se manifestà recesiv fa!à de culoarea rogie a tipului normal. Aga sînt culoarea coral, determinatà d.e alela ú, culoarea sîngerie (blood,), determinatà de alela ubl, culoarea eosinà (trf), ciregie (cherry - wù), honey (ú), buff (u\, tinged (ut), pearî (rú) Si iaory (zai). Alela u este recesivà fa!à de toate aceste alele, descrise mai sus gi determinà în stare homozigotà (ulu) culoarea albà (uhite) a ochilor la drosofilà, ea condilionînd absenla oricàrui pigment pentru culoarea ochilor. Celelalte alele conditioneazà" producerea unor cantitàli variabile de pigment, ele fiind recesive fatà de alela u+ dar dominante unele fa!à de altele, ordinea descrescîndà a dominanlei fiind I
19* nW@ *U)bl ->Uc ->ZlF -*Wi *Wbî -->,tyt -*W0 *Uti

cînd allii consid.erà cà în determinarea acestei reaclii de tip antigen-anticorp intervin mai multe gene strîns lincate (sistemul c d t), fiecare cu o a1elà dominantà gi alta recesivà. Alela recesivà rh este cea mai frecventà (55%) în populafia bascà a Spaniei. În Europa, frecvenla genei rh éste de-4}o/o, în Africa de 23o/o iar la negrii americaní 28%. Ale1a este foarte pulin frecventà sau chiar absentà în populalia chinezà gi japonezà

*tD.

Culoarea ochilor la om este tot un caracter determinat prin alelism multiplu. Seria polialelà în acest caz redatà în sensui descregterii dominanlei este urmàtoarea:
*Eó

(ochi negri) -> E3t (ochi càprui-verzui) -> Eb, (ochi albagtr: Eb- E3t (ochi negri cu reflexe verzui)

176

6. VARIANTELE ELECTROFOREIICE

$r sEMNrncaTIA LOR
Blectroforeza s-a dovedit a fi o metodà foarte utilà în studiul genetic al populafiilor, în starbilirea relafiilor interalelioc

ductor constà din tampon menlinut într-un mediu de susfinere hîrtia de filtru, acetat de celul'ozà sau gel agar, amidon sau poliacrilamidà. Moleculele id,em'tice migreazà cu aceeaEi rartà qi dupà o perioadà datà de 'timp se vor ooncentra într-un acelaEi punct în mediu formînd o bandà distinctà, bine delimitatà. Datorità structurii sale particulare în aminoaeizi, fiecare protei,nà are pe de o parte o formà gi o dimensiune caracteristicà, iar pe de alta o încàrcàturà electricà netà pontivà sau negativà. Într-un cîmp electroforetic, are loc o separare clarà a diferitelor tipuri de mol,ecule proteinice. Mobilitatea electroforeticà reprezintà un criúeriu fenotipic de studiu al structurii genetice qi variabilitàtii, iar puterea sa de rezolufie este atît de mare încît pot fi decel,ate diferen(,e dintre douà peptide de ordinul a numai un aminoacid. O proteinà consta dintr-o singurà catenà polipeptidlcà (rnonomm), din douà ca'úene polipeptidiee (dimu\, din trei (trimer), patru (tetrarner) sau mai multe catene polipeptidice (maltim^er). Fiecare caúenà polÍpeptidicà este sintetlzatà de cîte o alelà. O proteinà multimericà poate fi formatà din catene polipeptidioe identice sau neidentiee. Dacà are loc omogenizarea drosofilelor omorîte într-o solufie tampon Ei omogenatul este supus electroforezei, se poate studia modelul ,el,ectr,oforetic aI unor enzime cum ar fi enzimel,e esterazice specificate de locusul est-6. S-a cons,tataù cà anumite stocuri de musculife diferà prin mobitri'tatea electroforeticà a esterazelor, uneùe prezintà esteraze c€ se deplaseaza rapid într-o unitate datà de timp, formînd o rbandà numità ,,Fs de la cuvînúul englez ,,fastc. Genotipul unor asemenea musculile este considerat a fi FF. Alúe stocuri de muscutrife au un tip de estqozd-6 care se deplaseazÀ încet în aoeeagi perioadà de timp, formînd o ba,ndà numitA ,,S( (de I'a slow) avînd genotipul, SS. În urma unei încrucigàri FF X SS rezultà în F1 indivizi heterozigofi (FS) care prezintà ambele modele electroforeponos precum
1,2

qi în studiul fenotipului, la nivel molecular. Principial ea se bazeazà pe faptul cà moleculele care pnezintà o anumità încàrcàturà electricà, suspenda,te într-un mediu aonductor de electricitate vor migra în cîmpul electric spre polii acestuia, în func{ie de natura încàrcàturii lor. Mediul con-

-

Descifrînd tainele ereditàfii, vol. I

T7T

)

sau subunitàti Produse de fiecare alelà (fig. 50). Rezulità cà duPà modelul el,ectroforetic, enzima este' direclra de razà-6 este o proteinà moii,|íirii"" !' s F.s iíóteiàùor nom,ericà. Faptul cà ln heFenot ip F terozigoli apar ambele mo6 enotip F F FS , ' .ss dele electroforetice corespUnZà,toare atît, alel,ei, F Fig, 50. Reprezentarea diagramaticà a fenotipurilor bectroforetice privlnd euzima cît Si alelei S înseamnà cà esteraz6 6 la D. T9*ogaster (din esùe vorba de o rela{ie de Levine, 1973). codominanfà dintre cele douà alele. Studiuù electroforetic al fosfatazei, a,lca,liiure la drosofilà a rrelevaù aparifia în F1 a unei tbenzi, de morbilitate intermediarà FS care repr"ezintà de fa,pt o proteinà hi,bridà. S-a apreciat cà enzima este un dimer care ln súare homozigoúà este reprezentatà de caúene polipeptidic,e identice, pe cînd în: stare hetenozigotà poate fi, formatà fie din subunitàfi identioe, fi,e diù subunitàfi neidentice. De asemerf.e,a formarea unei benzi inùermediare, suplimeinrtare bénzii F gi ,benzii, S, indicà exist'enfa unei rel,a'fii de oodominanfia dintro alele. Desooperirea unei a,lele O oane oondilion'eazÀ a,bsenla oricàrei ,benzi' ,pe eoloama electroforeticà indicà existenfa, în de,terr:ninismul genetie al fosfatazei alcaline, ,a unei serii polÍalele (4 s $i o). Din com'binrafia S X O r,ezultà ur fenotip SO în cane se manifestà un fenornen de dominan!à inr,complertà. Electr,oforeza a deveurit astfel r-nr- €xc€lent mij[oc de decetrar,e indirectà a genotipului prin auraliza fenotipului la nivel molecular. Tot un caz de polialelie se întîlnegte gi în determinismul genetic al culorii blànii la iepuri de casà 9i a fost evidenliat prin încrucigàri dialele între iepurele albino (rt) complet lipsit de pigment melanic, himalaiai (chù) de culoare albà, dar cu extremitàtile de culoare neagrà gi chinchilla (t',ù) de culoare gri gi tipul sólbatic (CC) de culoare neagrà. Alela C este dominantà fa!à de toate celelalte alele (tabelul 9). ferarhia dominanlei este

!!

+

tice Pentru enzimà, n€fiind o combinalie dintre diferi,ùe r:nitàfi Proteiniee

Cebùc.
L78

Tobclul 0 Scrla dc alele pentru plgmontaÉa

blànll la lepurl

Fenotipuri
negfu Chiuchilla

Genotiputi posibile
CC, Cúh, 66h, Cc
cch Càh

gri

deschis

Cch dah,

CghC

himalaian albino

chcL, chc
cc

7. INTERACTIUNEA GENEI,OR

raporturiile mendeliene. Perechiùb de gene car'e interacfioneazà, nu ocupà 'acrelaqi looq^s .pe cro'Inozomi omol,ogi, ci ele sînt plasate fie fur [oci di'ferifi pe aÉ€la$i cromozomi sau în cromozomi diferiti, neomoLogi. Ase,menea gene sint nea,lele. Interacfiunea genelor nealele poate schimba uneori felurile fenotipului fàrà a schimba numàrul fenotipurilor. De asemenea cînd. douà perechi de gene nealele afecteazà acelagi caracter, numàrul fenotipurilor poate fi mai mic decît numàrul genotipurilor. Genele nealele pot interacliona contribuind prin catenele polipeptidice pe care le specificà 7a alcàtuirea unei molecule complexe care servegte ca produs genic funcfional. Holoenzima transcriptazei de la E. coli (arpB'oor) este codificatà de 5 gene nealele d, p, p', ar gi o . Tra fel, enzima lactic dehidrogenazl de la om gi alte animale reprezintà un tetramer (ArBr), cele patru catene polipeptidice fiind specificate de d.ouà gene nelincate A gi B, care cod.ificà catene d,e aceeagi lungime, d.ar care au secvenle diferite de aminoacizi. Se pot produce cinci tipuri de molecule de lactic ilekidrogenozd, care diferà în reaclia 1or fa!à de diferite substraturi An, ArBr, ArB, gi Ba. Tati deci cà d.oi loci produc în mod normal 5 produgi funcfionali. Se cunosc, însà gi alele rare ale locilor z{ ti B gi indivizi hibrizi care pot forma f2 tipuri diferite de lactic dehidrogenazi. Un al treilea

Sînt numeroase cazurile în carre p€rrtru exteriori,zarea unui singur carasùer colaboreazà mai multe perechi de g,ene d'in inúeracfiunea càrora pot apare în F1 oaractere cu totul noi, iar în F2 apar allte rapor-Luri de sqgregare ce se, ab,at aparent de la

t79

locus C codificà o altà polipeptidà care intrà în alcótuirea enzimei lactic dehidrogenazó, din testicule gi spermatozoízí, crescînd numàrul potenfial de lactic-dehidrogenaze diferite ce se pot forma în lesuturile germinale. în acest caz interacliunile genice apar imediat dupà traducere, înainte ca produsul genic sà fie plrs în circuitul metabolic. Diferifi loci nealelici care codificà acelaqi produs sau un pr,odus similar se numese izoloci. Nonalelele de la nivelul izolocilor se numesc izogene. În cazul enzimei lactic dehidr,ogerLaza pot interacfiona trei izoloci spre a produce mai multe izoenzime similare lactiedehidrogenazice care s-au numit isozime. Izol.oci sub forma a douà perechi de gene duplicate sînù impiicafi în determinar€o pigmentafiei pielii la om qi a cariopsei la grîu ca Ei a pigmentaliei unor flori. Tipurile de ARNú gi ARNr pot fi codificate de izoloci. La E. coli se par'e cà existà gene unice pentru fiecane tip de ARNú. La drosofila existà circa 60 izoloci pentru ARNú reprezentînd circa 750 gffi€, localizate în circa 100 si,turi în tot genomul. Existà deci în medie circa 12 izol,oci pentru fiecare tip de
ARNú.

Un caz de interacliune a genelor fàrà a se modifica raportul, de segregare, dar care duoe la apari ia de fenotipuri noi a fost întîlnit la încruciqarea dintre rasa de gàimi Wgandotte cu creasta tip ,,trandafirs qi rasa de gàini Bruhmns cu creasta tip ,,m,azàre66. Cele douà caractere sînt dominante fa!à de tipul ,,creastà simplà36 întîlnit la rasa Leghortt. Bateson gi Punnett au admis cà tipul de creastà ,este determinat de intenacfiunea a douà gene nealel,e R 9i P.

x rrPP Wyandotte Brahmas
RRpp
RrPp creastà ,,nucà" Din interacliunea genelor doRrPp x RrPp minante R gi P apare un nou 9/16 RP creastà ,,nucà" fenotip-creasta ,,nucà." iar 3/16 Rp creastà ,,trand.afir" din interacliunea genelor re3/16 rP creastà. ,,mazàre" cesive lri !. apare alt nou fe1/16 rp creastà simplà notip, creasta simplà.
180

Se cunosc însà qi oazuri de interae{iune genicà în care are loc atît schimbarea raportului de segregare cît qi aparifia de fenotipuri noi. Acestea sînt complem.en'taritatea, epistazia Ei polimeria.

S. COMPLEMENTARITATE GENICA Este fenomenul prin care, din interacliunea a douà sau mai multe gene nealele rezutrtà o expresie fenotipicà diferità de aceea determinatà de fiecare g,enà în parte. Genele comple-

mentare pot fi dominante sau recesive. Se deosebe$te o complemeultaritate dominantà qi o complementaritate recesivà. În eazul complementaritd.lii dominante este vorba de o interacliune dintre gene nealeie în care exprirnsreà unui anumit caracter necesità prezenla concomitentà a douà sau mai multe alel,e dominante. Astfel, Bates,on gi Punnett au încrucigat douà varietàli de Lathyrus odoratru cu flori albe qi au oblinut în F1 plante cu fl,ori r,oqii. Aceste plante din F1, auúopolenizate au dat o descendentà în F2, oar€ a segregat în raportul de 9 roqii la 7 alibe. Simbolizatà, experienla aratà, astfel:

AAbb x albà
F,
AaBb
AaBb roFr

aaBB
albà,

x

AaBb

*9/16 AB I
3lt6
3116 aB

rogii

\7 albe t1rc au I

Ab I

Pentru apa,rifia culorii roqii a petalelor, este necesarà interaefiunea a douà gene nealel,e dar în stare dominantà, A Si B" Toate oombinafiile în care în stare dominantà apare doar una din aceste gene nealele oondi{ioneazà culoarea albà a petaLelor. De asemcnea, culoar€a al'bà este determinatà qi de alelele recresive ale aceslor gene nealele. Abaterea de lb raportul mendelian de segregare este numal aparentà. Altfei, chiar qi acest fenomen de comptrementaritate confirmà tegite mendeliene ale segregàrii.
181

genicà a fost observat cînd s-a studiat ereditatea formei capsulelor de la ,traista ciobanulnri (Ch:pselln bu;rsvl-paseor*). Încnrcis,îndu-se o varietate cu capsulà ùriunghi,ulara cu o uarietate cu capsul,a ovoidà se ob{in în F1 plante cu crapsule triuqghiulare. Ín Fz apare un raport de segTegare de 15/16 pliante cu capsula ,trir:,nghiularà qi l/16 pÌ,ant€ cu capsula ovoida. Simbolizínd experienfa se poate scrie:
.

Existà qi o cornplemcnfuritate rer,esi,uó, in sare manifestarea unui a,numit caracter ,necesità prezenfa ooncomittsntà a douà sau mai multe gene nealele, recesíve. Acest tip de interacfiune

triunghiularà |

A1

ArAsAz x

àraràz3z

Fl

ovoidà Ar er As aa triunghiularà

F2

Lini,a (-) A2) fie a celei recesive (a1 sau a2). Rezul,tà cà pentru a se exprima caracterul de cupsulà ovoidà, tr.ebuie sà interacfioneze douà gene nealele in ltare reoesivà (q $i oz). S-a co,nstatat cà aceastà plantà este un tetraploid prezentínd nu doi cîte doi cromozomi omolqgi, ci patru cîte patru cromozomi omologi pmrtru fiecare pereche, din care catrzà s-a creat lrosilbilít'atea duplicàrii genirce prin poliplloidie, rezultf,,nd gene similare ca acfiune 'dar care sînt, nealele situate în, iloci diferi{i, moqtenindu-se ind,ependent.

| t6 àr ?r àz 4z Ì l/16 ovoidà semnificà prezenfa, fie a alelpi dominante (A1 sau
1/

I autolrclenizare Ar-A'-ì 3ll6 Ar - &z &z i tSTtS triunghiularà 3/16 ararA2e/16

9. GENE INHIBITOARE SAU INÎERACTIUNE DOMTNANTa $r RECESTVa
Gene inhiibiúoare domin'ante au fost observate la mumeroase organisme. La pàsàri, din încrrrciqa,rea rasei, Leghortl (penaj alb), cu rasa Wgwdoúúe (penaj alb) se obtine în generafía Fr pàsàri cu penaj altb, ia'r în genenalia Fz'rezultà o proportie de
182

13 alh :3 colorat. Acest raport care apare ca o excepfi,e de 'la sqgreganea mendelianà se datoreqúe faptului cà rasa l"qlwrn cu pen;aj alb posedà, î,n ac''elaqi timp, gena dominantà C (de la

colour), care determinà culoarea neqgrà qi o genà inhibióoare care, în stare dominantà, supreseazà rnanifestar@ gerrei C. Rssa Wyandott€ posedà gena c (alela recesivà a geurel domimanrúe C) care determinà în fenotip absenta pigm€nitatiei qi gena i, alela reoesivà inactivà în supresia genei, C. fn îrncruciqàri cu rase cu penaj colonat, rasa Leghúm se comportà ca domina,ntà pe cînd rasa Wyondotte * comportà ca recesivà. Indivizii de culoare al,bà apar în toate cazuri,le în ca're es'te prezentà gern I ca qi în cazurile în care este prezentà alela recesivà c. Indivizii cu penaú colorat apar numai în cazul în care gerlrù C scapà de con'trolul genei I qi este alàturi de gena i. C C I I l-eghorn alb x ccii Wyandotte alb F. C cli (alb) 9/16 CcIi alb I 3/16 c c I i. " F, 3/16 C cii 1t_- - ^" arb : 3 nesru negru

f

1116ccii alb

I,t I

I

10. GENE EPISTATICN

Cînd douà sau mai mulJte gene acfioneazà asupra acelnriaqi caraoter, o genà poate mascra efectul celeilalte gene, cam în ac€ea$i màsurà ln oare efectul unei gene recesive esúe mascat de alela sa dominentà. Aoest fenomen prin care o genà poate masca sau supres,a efectul altei gene nealel,ice (situatà într-un a1i0 losus) a fost m'umit epistazie. Gena epistaticà este o genà ce aparfine u,nei perechi de alele, care împiedicà m,anifestarea alelei domilrante dinúr-o altà pereche de altele. Gena supresatà poartà numele de Eend" hipastaticd. Fenomenul de epistazie este implicat în aproape ,toaúe tipurile de interaclitine genicà. Domínanfa implicà supresia genicà intra-alell7ci (mascarea expresiei umeii aleLe recesive de càúre alela dominantà din aoeùagi I'ocus). trpistazi;a cuprinde su,pnesi,a genicà iruter-alelicó (masoans pe care o exercità u,n locus genetic {rsupra expresiei ,unui alt locus genic). Raportul feno,ti183

pic clasic de 9 : 3 : 3 : 1 observat l,a desoendenfii unor pàrinfi dihibrizi se modificà datorità epistaziei În raporturi care repre-

zintà cornbinalii ale acestuia. Gena epistaticà poate fi dominantà sau recesivà. a) Gene epi,stutice dominante (12 : 3 : 1) Fenomenul epistaziei dominante a f'ost observat la o încruciEare între Auenn tatua cu boabe negre qi Auena satiua (ovàz cuitivat) cu h:oabe galbene.

AABB

(boabe negre)
F1

x
I

aabb (boabe galbene)

AaBb boabe negre ,, AABó negrc La/
Aabb

F2

3 aaBb

cenugii

I

aabb galben

CeIe 12 oombinafii care conlin gena dominantà, A, în stare homozigotà sau heter.ozigotà sînt de culoare neagrà; 3 combinafii care au gena dominantà B în stare homozigotà sau heterozigotà qi nu confin gena A sînt de culoare cenuqie iar o combinalie cu genele recesive ob pruduce boabe galfbene. Din eele de mai sus rezultà cà gena dominantà A împiedicà expresia genoi dominante B ce determinà cul'oarea cenugie qi este deci epistaticà pe cînd gena dominante B, a càrei acfiun'e este înhibatà, este hipostaticà.

b. Gene recesiue epi,statice (9 : 3 :4) Un exemplu de epistazie recesivà ni-l oferà ,er,editatea culorii blànii la anumite rase de cîini. La încruciqarea o douà rase de cîini, una homozigotà albà cu una -homozÍgotà maron, se obfin în F1 numai descendenfi de cul.oare neagrà. Încrucigàrile indivizilor din F1 au produs descendenît în raportul de segregare I negru : 4 alb : 3 maron, ceea c€ se poate demonstra ln diagrama de mai jos:
184

B

Bcc (alb)
F1

x
t

bbCC (maron)

BbCc (negru)

I F"Î
1

bbcc alb-.---

Bbcc alb-------.-bbCc Íl3.roo:3 4

RbCc negrú

J

:

9

În acest caz, alelele B qi b produc culoarea neagrà Ei respectiv maron, dar numai în prezenla alelei dominante (C) de la un alt locus. Pentru a distinge aceastà inter,acfiune de o relafie dominantà qi recesivitate, se spun€ cà. cc este epistatic fa!à de B sau b,' adicà homozi'gofia alelei c previne formarea oricàrui pigment, indiferent de alelrele pentru alte culori. Efectul pe care alelele cc î1 au asupra lui B poartà numele de epistozie
recesiud.

11. GENE DUPLICATE CU EFBCT

CUMULATIV (9 :6

: 1)

Dacà condilia dominantà (fie homozigotà, fie heterozigotà) la unul din loci (dar nu la amîndoi) produce acel,aqi fenotip, raportul de segregare în F2 va fi 9 :6 : 1. De exernplu, trnd'e sînt implicate g'ene epistatice în producerea anumitor substanle cum ar fi pigm,enlii, g'enotipurile dominan'te de La fiecare l,ocus pot fi considerate ca producînd în mod independent o unitate de pigme,nt. Astfel, gen,otipurile A-bb qi aoB produc fiecare cîte o unitate de pigment, avînd deci acelaqi fenotip. Genotipul aabb nu produce pigment, dar în gen,otipul A-B- efectul es,te cumulativ Si in consecin!à vor produce douà unitàli de pi;gment (o
cantita0e du,blà). Se poate constata cà atr:nci cînd epistazia opereazà între doi Loci genici numàrul feurotipurilor ce apar la descendentii ruror pàrinti dihibrizi, va fi mai pufin, de patru deqi segregarea are

Ioc pentru douà perechi de gene cu efecte fenotipice diferite. .A.ceasta se datoreqte mascàrii efectului unei gene de càtre cealaltà, generalia Fz confinîrnd numai trei clase fenotipice în loc de patru iar în cazul oomplrcmentaritàfii arumarul claselor fenotipice se reduce la douà aga ctun reztrltà din úahelul 10.
185

Tabchtl
Ccle gase útpurl de rapoÉurl eplstatiee

10

Genotipurile

elslslr
fnteracfíune dominanta gi recesivà

Gene duplicate cu efect cumulativ

Erprimarea în, fantotiP a genelar

12. PENETRANTa $I EXPRESIVITATE GE0ÙICA

de-mediu. În interac{iunea oomplexà genotip-mediu, genotipul deùerminà limiùele între care só poate manifesta fenotipul. În feno,tipuli a doi indivizir oe apartin ,aceleiaqi specii pot sà aparà diferenle, rru rmrnai debermina,te de n,atura genelor, naúurà care poate fi dominantà sau reoesivà, ci Ei de varialia aourdiliilor de mediu. Mediul deci poate influen;fa raportul, fenotitpic de segregare. O genà prezentà la toli indivizi'i fu o anumità oatqgqrie óenotipicà în anumite oondifii de me'diu poate sà s,e exprime în fenoúip la ùoli indivizii, caz în care se spune ca mani està o penetraor!à completà s,au de 1000/0, dar în al'te oondilii de qediu, d'eqi pneze,ntà la tofl indivizii, ea nu se manÍfesta 'decît la unii di'n'tre ei gi în acesú oau se sprute cà o as€nr€{ogà genà
186

Genotipul reprezintà totatitatea factorilior ereditari (genelor) pe care o specile, un individ îi preziortà îm struchya sa gelneticà (gen,om). Aceste gene se manifestà în afiumite conditii de mediu. Din interac{iun€a genotipul'ui cu mediul rezultà feulotipul, care reprezintà to'talitateia caract€nelor $i însuqirilJor (morf'ologic€, hioehimice, de comportament etc.) pe care un organism le prezintà I'a un moment dat, in oondílii determinrate

are o penetranfa incompleta sau are o penetran!à sub L000/0. Prin penetrantà se întelege deci frecvenfa cu care o genà sau o combinafie de gene este exprimatà feno'tipic. De exemplu, genele care au fost analizate de Mendel (4, B etc.) prezinrtà o penetnanfà completà, ele manifestîndu-se la tofi indiviziÍ purtàtori ai lor, pe cînd genele care condifioneazà, rezistrenla sa,u sensibilritatea la bolli au penetran!à redusà, irroompletà, deoarece ele nu se exprimà la ,to!i indivizii, ci doar Ia ,aoeia cane au f'ost supuEi unei infec{ii oaracteristice (aoeasta reprezenthd o anumità condi[ie de mediu). Penetranta este un fenome,n de tip ' totul sau nimic: penetran{à completà sau penetran{à incompletà. Un ex'emplu foarte convinrgàtor de penetran{à nù-l oferà cazul a doi gemeni monozigrof,, deci care au aoeeaEi structurà genotipicà,'dar lal care la unul, gerìa perrtru ,,buzà iepure6s esùe penetrantà (se exprimà în f'enotip) iar la celàlal,t este neperetrantà (nu se exprinnà în
fenotip). Penetranfa incompietà caracterizeazà multe gene dominante. Schizofrenia este determinatà în unele c,azuri de douà gene domiurante cu penetran!à incompletà. Influenla me'diul,ui se exercità nu numai asupra numàrului de indivizi care exprimà în fenotip o arÌumità genà ci qi asupr,a Írltsnsitàtii exprimàrii în fenotip a acelui caraeter, aspect cane se numegt'e erpresiuitate gen'icó. Oda,tà ce gena este penetrantà ea va man,ifesta frecvent varialiuni în expresia sa fenotipicà. De exemplu, polidactiùia la om, determinatà de o genà dominrantà, prezinúà expresivitàfi degete suplimentare la picior, pidi,ferite: mîini normale cioare normale deget'e suplimentare la mînà, polidaetil.ia apail:E l,a mîna dr'eaptà dar nu la stîurga, la stînga dar nu la dreapta, sau la am'bele mîini qi picioare etc. În condilie heterozirgotà (Pp) gena polidactirliei are o peuretramfà de mai pufin' de 7000/o càci uneori ea nu reuqeste sà producà vreun efeet fenotipic detectabil. Nepenetranla unor gene înseamnó, 00/o expresivitate. Datorità condifiilor diferite de mediu, aceeagi genà poate produce sfecte foarte evidente la unii indivizi în timp ce la al,!i indivizi efecte abia vizibile. Gena recresivà ?rg ca,re determinà caracterul de aripi vestigiale la drosofiilà prezintà o expresivi'tate diferità în funcfie de t87

temperafurà: la temperatura oamerei apar arlp1 vestigiale dar eare se pot apropia de dimensiunea aripilor normale, pe cînd la temperaturi scàzute apar aripi vestigiale propriu-zise (extrem de mici, rudimente de aripi). Mediut intrauterin la mamif,ere, chiar pentru gemeni monozi,gofi poate fi foarte variabil, din punct de vedere al poziliei ocupate de gemeni în uter, aI conexiunilor placentale ,si acestea pot afecta diferit expresivitatea genel,or 1a cei d'oi gemeni. Varialia expresività{ii unor gene se poate datora însà Ei influenfei unor aite gen,e cdr€ se numesc gene modificatoore, dintre care unele sînt reducdtmre, slàbind expresia fenotipicà a altei gene neal,ele, iar altele sînt amplificatoare, întàrind expresia fenotipicà a unei alte gene nealelice. Penetranla qi expresivitatea pot altera raporturile cunoscute de segregare Ei sà determine ca ades,ea fenotipul sà nu exprime fidel genotipul. Primul care gi-a dat seama de irnportanfa mediului în expresia genicà a fost Wilhelm Jahonnsen, cel care de fapt a introdus qi noliunile de genà, gmotip Ei fenotip. Existà qi cazuri de imitalie fenotipicà numità fenocopie. In aeest caz un ac,elaEi caracter poate fi produs de alele diferite dar care aclioneazà în medii diferite. Indivizii care diferà genotipic Ei oane sînt diferili în acelagi mediu pot deveni fenotipic similari cînd condiliile lor de rnedir.l diferà. Asffel, tulpini de E. coli his+ gi his- cr,esc Ei respectiv nu eresc pe mediu de cul'turà lipsit de histidinà. Dar tulpina hts- va putea creEte ca Ei tulpina h.is+ dacà mediul de culrturà eonfine histidim'a. Astfel o oelulà his- pe un mediu de culturà care oon{ine histidina este o fenocopie sau o imita{ie fenotipicà a unei celule his+. Tot astfel un individ uman car,e suferà de diabet m,aladie ereditarà care determinà producerea unei insuline anormale dacà ia insulina sub formà de medicament va deveni o fenocopie a persoanelor genetic normal,e pentru gena insulinei qi care nu iau insulinà. Existà qi ca:zuri de fenocopiere a caracterel,or anormale. Astfel, embrionii umani normali ai càror mame au folosit talidomida se vor dezvolta în copii cu diferite rr,ralformafii care imità (fenocopiazà) persoane anormale ce suferà de maladia er,editarà focomelin cauzatà de o singurà g,enà mendeli,anà în condilie homozigotà.
lBB

13. DETERMTNISMUL GENETIC AL CARACTBRELOR CANTITATIVE
Cercetàrile lui Mendel s-au referit la analiza unor caractere discrete, discontinui, care se încadr'eazà în clase discrete de tip neted zbîrcit; gal,ben verde. Johansen a cerceta't însà modalitatea de transmitere ,a un,or caractere ce pr'ezintà variabil,itate continuà, cunoscute drept caractere cantitative. El a lucrat tot pe o planrtà autogamà ryí anume pe fasole. Dintr-un lot initial el a seleclionat L9 boabe de fasole, fiecare avînd o greuta,te specificà qi le-a cuitivat spre a obline 19 linii de fasole, care în virtutea faptului cà fasolea,este o plantà auúogamà erau pur,e* qi în ceea ce priveqte caracterul greutàlii. Din fiecare linie de fasole a selectat apoi boabele ceie mai usoare qi boabele ceie mai grel,e pe care le-'a cultivat separat. În fiecare an a ales din descendenla boabelor ugoare, pe oele mai gr,ele pe car'e de asemenea le-a culrtivat separat. Din cele 19 linii pure d,e fasole sînt reprezentate grafic doar liniile 3, 11, 13,qi 17 (fig. 51A). Comparînd aceastà di-qtribulie cu distribu{ia greutàfii 'boabelor la genitori, în mod surprinzàtor acestea erau simil,are Astfel, o plantà ieqità din boabe de 150 mg aparlinînd iiniei a 3-a dà naqtere prin autofecundare la descendenfi ale càror boa,be au o greutate rnedie de 200 mg afiatà între limitele 150 Ei 250 mg. O situafie asemànàtoare se înregistreazà în celelaite linii. Johansen a atribuit greutatea rnedie a boabelor ca datorîndu-se constituliei geurotipice, pe cînd variafiii'e pozitive sau negative fafa de aceasta ca da,t,orî,ndu-se fluctuafiilor de mediu. Din suprapunerea u,nei multitudini de cunbe de distributie det tNi/,, : LiiilAlí LiNi...î Llti,iAl2
I I

'i

ctifoíectJnilare
|

lir
t.
1"

ù
I

,j;-'.a.:,:a.i;i-'a.ii-

..

,.--\ ,/ -/ --l--:----')v y'.._.-__::*- ,./ -,--\-1*)>'i 5C 2-',; ?tC 1,50 500 55A 5C0 55C (AC 750 80 0 85{}
î r,:
!

"rfafecundare a;ttofprundare rl f'l

I

i4i r A

B ;-t,.i.n

i L 0R i.ì\t,.r,r

Fig. 51. A. Selecfia celor patru
+

Johansen (explicatii în text).

linti în

experieula lui

game hcrnczigote.

Linia purà reprezintà totali,t'atea descendentilor unei pi,ante aut&189

Toisf

ributie

?00

900

Fig.51. B. fneficienfa selecfiei în cadrul liniilor pure (explicafii în text).

termi'natà de sienotip a rez{.rltat o aurùà a distribu{iei nor,male a frecven!,elor (fig. 518). Aceastà experientà ,a demonstrat cà dife,ritel€ condi{ii de mediu pot produce diferen{,e fenotipice îartre irudivizi, dar aceste diferenle nu se rnoqtenesc. Greutatea boa'belor de fasole apare ca un caracter cantitativ care prezinrtà o variabiUtate de tip continuu, oecilînd de la o lraloare minimà la una maximà în cadrul unei populafii
date. Johansen' a tras din experien!.ele sale o cvncluzie cu importan{A rna,jorà pe rtru pnactica amel,ioràrii plantelor qi anima-

pentru

intensitatea culorii roqii la florile de mazàre (de la nosu deschis la rogu închis). Nilsson-Ehle a sta,bilit prrn experier,r,{e de hidridare la grîu cà în determinúsmul culorii ,boabelor intervin trei perechi de gene neale,tre care condi{ioneazà sim'teza trnei eantità{i anumite de pigment. Îrrcruciqînd un soi de grîu cu boabe roqii (AA, BB, CC) cu un, soi cu boabe albe (w, bb, cc) în F1 se obfin plan,te cane formau boabe de culoare rogie (AoBbcc). Prin autofeeundarea indivizilor din Ft a oblinut în F2 un raport g€neral de sqgr€gare
190

aceas'ta, refel'i'ndu-se la caracteristicile de produc$e) gi anume cà selecfia este ineficieortà în cadrul liniilor purc. Selecfia este eficientà numai in cadrul unei populatii heterqgene (cele 19 linii de fasole luate în ansarnblu). Dar cercetàrile sale nu au oferit o rezolvare fll privire Ia natura genotipuri-lor care stau la 'baza celor 19 linii pure diferite. Observa{iile efectuate de suedezul Nilsson-Ehle (1910) au aruncat o lumina Ei asupra acestei probleme. Încà din 1906, Yule sugerase ca variafiile cantitative continue ar trrvea la bazà o multitudine de gene individuale al càror efect se cumuleazà, este aditiv. Asemenea idei avusese qi Mendel cînd a fost pus în situafia de a explica varia{iile în

lelor (caracterele cantitative fiind de o excepfio,naH wrloare

mtrlativ (aditiv) fie. 52.1 Se deduce eà aparifia ctrlorii roqii este determina,tà de trei perechi de gene urealele cu efect curnul,ativ ,AA, BB CC, iar culoarea aIbA de alelele lor cn, bb, cc. NilssonEhle a tras concluzia ca numàrul total al alelelor domina,nte a celor trei perechi de gtene determinà graduJ de pigmentare. Cu alte cuvinte
fiecare genà dominantà poate fi oonsideratà cu o conúribu{ie de o dozà }a culoare rogie iar efecttrl fiecarei doze este qwl qi oúitia. L,àsînd Ia o ,pafte a tneia pereche de g€ne, se poate

d€ 63 rosii la I atbà. Dar culoarea rosie prezeruta dif€r'ite nuanfe, sugcrînd existen{a unei sqgrqari pentnr trei gen€ echivalente cu efect cu-

O

I

I
I 20)

calcula probabilitatea de a obfine 0, l, 2, 3 qi 4 doze ale a,lelelor domina,nte din încrucigarea AaBb X AaBb aga cum rezulta din fig. 53.
Fig, 52.

Observafiile facute de Nilsson-Ehle pot fi explica,te prin prezenfa genelor duplicarte, svînd în vedere faptul cà grîul este o plantà hexa-

alb #r0s"

ploidà, La care, deci, fiecare locus este reprezenrtat pri,n 3 perechi de alele, ceag ce distinge însà aceste rezulta,ùe de cazurile simple de complemeurúaritate recesivà este faphrl cà, îrr* arLresnfa dominanfei, seglegrarea nu d,uce la aparifia a numai douà clrase fenoti,pice, ci caracterul culoarea boa,belor se comportà asemanàtor unui caracter ca-ntitativ.
191

în cazul douó soiuri de gîîu ce difetà prin ttei, petechi de gene care determinó culoarea boabelor. Distribulia frecvenfei culorilor este prezentatA în histogramA (dupA Strickberger, 1976).

încruciglrii

Segregarea caracterelor

a

Penlru

A

Penlru B

I

Pentru A îi

Numàrul B

tciol

ct.,doze"o"' dómtnonte

Probóbir\lolcO

totclà

AA=)c

=1/t ., <i-'-- -Bg5=t/z

--oo

AABB: %e .\ 4qg6:70 =\
AAbb = '46

..-

/.

(roiu locrte inshis)

Vs

=%

-86 =llu Aa-1!z "'l-ad-r/z \o o=h
aa -=.,

,, Aabb:'rB,-,-r./
raBB-'/',s/ -\ a."0: t1s --')
aabb:t/re

^.:t :1/c Aagb

:

\>
t-

3(ro?c ?rcr,'s)

11,

./ 21ro9u)
l(roguPot)
0 (olb )

oAt

.-E à=1/': */ -1 g6=1,/t

L/s lt /ts

o6=y,.

Fig. 53, Segregarea caracterelor-'îtr cazul încruciqórii unei varietàfi de gdu cu Rapoît de segîegare: l5 (l : boabe ro$ii cu o varietate de grîu n"lal"nilialbe. Prezenla fiecàrei gene se faee simlità în schimbarea gradatà a fenotipului, genele cumulîndu-qi efectele par{iale. Ideea unui efect de aditivitate cantitativà a genelor asupra fenotipului (adesea numità ereditate can'titativà) a fost o idee r,evolufionarà, ea furnizînd baza genotipicà pentru curba normalà adesea gàsità la varia{iile caracter,el,or cantitative cum ar fi înàlfirnea, greutatea, culoarea etc. Williams (1964) prezintà un interesant exemplu de polimerie aCitivà la porumb, al càrui endosperm are o constitufi'e triploidà (rezultat din feeundarea nucleului secundar al sacului embrionar care este 2 n de càtr,e unul din nucleii .spermatici (n). Relalia dintre numàrul dozelor din gena Y, care eondilioneazà culoarea galbenà a endospermului Ei conlinutul în rzitamina A al ac,estuia $i gena A care determinà culoare,a albà a endospermului este redatà în tabelul 11.
Tabalul
11

cH'XlHil""l'T#:#"Hl*l,"Ji"ffi
(dln
Doze d.e Y
0

Giosan gi SAdescu, 1972)

l'fff"'

Genotipul

Vit. A (unitàti
la gram)
0,05 2,25 5,00 7,50

I
2

vyv yvY
YYY

YIrY
1,92

Se cunosc foarte multe cazuri de pol,imerie cu situa{ii similare celor descrise rnai sus, dar pro,babil cea mai famiiiarà este ace€a a pignentatiei pielii Ia om în care participà cel pufin patru pereehi de gene (gene cuadruplicate). Presupunîndu-se

prins între 0 Ei B. Cazul siurplificat aI pigmeritaliei pielii la orn este redat de formulele genotipice PLPLPyP, pentru negri i Pt/rPrlp, pentra mulatri tipici ;i Pt:!t/r?, pentru albi, din care rezultà cà în d.eterminismul acestui caracter cantitativ (d.eterminat în uitimà irstan!à de cantitatea de pigment melanic sintetizaté, în melanofori) intervin douà perechi de gene nealele PrP, îi Pr!, 9i cà intensitatea pigmentaliei este cu atît mai mare cú cît mai rnulte alele d.ominante intrà într-o constitulie genotipicà datà. Din càsàtoria unui negru (PtPlPzPr) cu o femeie a1bà (ft|tfrfr\ reaa.Ttà" copii mulatri. Din càsàtoria a doi mulatri (PtptPrp, x x PTPLPT?,) u^ rezulta o descend"entà în care aparg o segregare într-un raport diferit de cel mendelian în caatl dihibridàrii 9i anume 1 negru (PLPÌzPz) 4 mulatru închis (PLPtPzPz sau PrPrPzP),6 mulatru tipic (Pt?tPrfr), 1 alb (!rqrfr?r). Se poate deci conchide cà bazele geneticii mendeliene pot explica- ereditatea caracterelor cantitative (care se prezintà cu o varialie continuà) prin acliunea unui numàr mare de gene (polimerie sau poligenie).

plà a fiecàrei alele dominante, se cun'osc n,ouà cl,ase diÎerite de pigmenta{ie în care numàrul genel,or donninante este cu-

dorainaarfa genelor care produc pigmentafie Ei aditivitatea sim-

14. GENE I..E[ALE

În 1905 geneticianul francez Cuénot a studiat o varietate de goareci cu blgn1 galbenà. în contrast cu ;oarecii ctl blanà cenugie ce reprezintà tipul sàlbatic. Prin încrucigarea goarecilor galbeni cu ;oareci cenugii dintr-o linie purà, el a observat un iaport de segregare 1 : 1. Aceasta sugereazà cà alela pentru blàna galbenà este dominantà asupra alelei pentru blana cenugie, În urma încruci;àrii între ei a goarecilor galbeni, Cuénot a regàsit descendenfii galbeni gi cenugii în raportul 2:1, o deviere clarà de la propò4ia mendelianà de 3: 1. Aceasta 1-a dus la concluzia cà goarecii galbeni sînt het"erozigo!í. Raportul de
t$ - Descifrind tainele ereditófii, vol.
I

193

segregare de

2: l, în loc de 3: I arati ci dispàrut gi anume homozigotii dominanfi.

l/4 din indivizi au

Y/Y
neviabili
25%

v/+

Y/+
galben
/l

x
50%

vl+

galben agouti
25%
Cy)

vl+

+l+
la

Segregarea genei pentru culoare galbenà încrucisare Yl+ X Y/+

qoarece, într-o

De fapt, raportul t:2:l este transformat în raportulr 2:1 prin moartea clasei homozigote gal'bene în uter.. Tr,elbuie de rnemarcart cà gena Y esùe dnrnùwttú pri'n efectel,e fenotipice asupra culorii; blànii, în plus ea esùe gi nacesiaó în efectul lierùal, deoarece alela trebuie sà fie homozigotà penrtru a determina moartea fàtuliui. Se spune cà g€na Y este dominrantà vizibil gi recesivà letal. Efecte'le aoesúei gene sînt, plei.otropdce adicà gena are un efect fenotipic multiplu asupra culorii Ei asupra viabilitàfii. În afa,rà de I'etalitatea de dominantà, în narturà se întîlneq,te q,i o letuli.ffie de recesiaitute descoperità de Baur (1930) Ia Anúirrhinrtm mnjus var : cruireq. 'În urma autofecundàrii are loc în F1 urmàtoarea segregar€: L/3 plantre cu frunze verzi,, l/3 ptanrtre cu frunze verde-pal' qi 1/3 plante cu frunae galbene, aga cum rezultà di,n, ta,berlul 12.
Tùclul
'12

Letalltatoa ds reoeslvitato la Antlrrhinum

cenotirurl

Fenotipul

cc
Cc

verde (normal)
verde pal (aurea)

cc

gAbui (letal)

Cantita'tea de clor,ofilà le Antirrhiurum esúe controlata de càtre o genà recesivà irreornpletà care manifestà un efect le'tal în stare homozigotà qi un efect fenotipic distinet în stare heter.ozigotà.
194

Penetranla genelor letale fie recesive fie dominante poate sà vari,eze, astfei cà nu toli indivizii afectali genotipic vor fi letali fenotipic. Anumite gene letale au un îna1t grad de penetran!à ;i expresivitate, permi!înd un mic procent de supravieluire sau chiar deloc (penetranîà 1000/o) printre genotipurile afectate în stadiul embrionar sau postemrbrionar. Alùe gene numite senúletole sau su'bvitale permit supravieluirea unei propor{ii mai mari de genotipuri afectate (500/0-300/c). Se vede deci cà vitalitatea este un caracter influenlat de un spectru larg de gene, care variazà de la letalitatea completà la subl,eial, la subvital, apoi normal Ei în mod ocazional la supervital sau Ia genotipuri superioare celor medii. Dar, ca regulà, genele l,etal,e sînt considerate acelea al,e càror efecte cauzeazà moartea organismului, în mod obiEnuit, în primele stadii de dezvoltare, oricum înainte de reproclucere.

15. PLEIOTROPIA

Reprezintà un fenomen genetic opus polialeliei. EÌ se înregistreazà atunci cînd o singurà genà nu con'troleazà expresia unui sin,gur caracter, ci a mai mulúor caractere. Pleiotropia ar putea fi definità ca efectul fen'otipic multiplu al unei sin,gure
gene.

La mazàre, chiar l\{endel a constatat cà pelechea de gene cal'e determinà culoarea fl,orii acfioneazà gi asupra culorii seminfelor gi asupra prezenfei sau absen{ei petelor roqietice de pe stipele. La drosofilà, gena ug care determinà forma vestigialà a aripilor, controleazà, în acelaqi timp qi alte caractere precum distribulia periqorilor pe partea dorsalà, modificarea spermatecii, ducind Ei la reclucerea vitalitàlii Ei fecunditàlii. La mamif,ere, incluzînd omul, gena care este impiicatà în albinism, afecteazà de asemenea vàzul Si auzul. În aoest caz toate sectoarele corpului care sînt afectate au o origine comunà în dezvoltarea embrionarà timpurie qi anume ectodermicà. Astlei la om, în cazul sindro,rnului Lobstein, este implicatà o
195

genà care determinà deopotrivà surditatea, fragilitatea vaselor gi modificàri ale scl,eroticii. Nu este exclus ca marea majoritate a gerreior sà se manifeste pleiotropic, aspect care este izvorît din caracterul de in-

tegraiitate ai celulei, respectiv al indi-;idului biologic care, func{ionînd ca sistem unitar Ei avîncl o stare aiteratà într-unul din componentele sale subordonate, prezintà alteràri qi în alte elemen,te în urma interactiunilor structurai-functional,e.

Redactor: ADRIAN CJR.\NESCU l-elinoredactor: CONS'IANTIN RUSU

Crili

Apàrut: 1981. Bun de ti.par: 25.09.1S81. Comancla nr.2l0ll de tipar: 12,2i>. Hìr1"ia: veliné 90 g/mp. Format: 6f i.Brji 1{)

Tipaiul executat sub comanda nr.312/1981 la Înfrcprinderea Poligraficó Cluj, Municipiul Cluj-Napoca B-dul Lenrn nr. 146 Republica Socialistà Romània

Sign up to vote on this title
UsefulNot useful