Journal of Antimicrobial Chemotherapy (2009) 63, 269– 273

doi:10.1093/jac/dkn512
Advance Access publication 18 December 2008

Emergence and persistence of integron structures harbouring

VIM genes in the Children’s Memorial Health Institute, Warsaw,
Poland, 1998 –2006

Jan A. Patzer1, Timothy R. Walsh2, Janis Weeks2, Danuta Dzierżanowska1 and Mark A. Toleman2*
1
Department of Clinical Microbiology and Immunology, The Children’s Memorial Health Institute, Warsaw,
Poland; 2Department of Medical Microbiology, University of Cardiff, Cardiff CF14 4XN, UK

Received 18 August 2008; returned 3 October 2008; revised 24 November 2008; accepted 24 November 2008

Downloaded from jac.oxfordjournals.org by guest on November 7, 2010

Objectives: The aim was to perform a genetically detailed study of the emergence of metallo-
b-lactamase (MBL) genes in Pseudomonas spp. in the Children’s Memorial Health Institute over a 9
year period.
Methods: Carbapenem-resistant Pseudomonas spp. isolates were collected from 1998 to 2006 and
screened for MBL production. MBL-positive isolates were further investigated by a combination of
genetic techniques including PCR, genomic location experiments using pulsed-field gel electrophor-
esis (PFGE) of I-Ceu1, S1 and SpeI digests, and sequencing.
Results: Of the 20 MBL-containing Pseudomonas isolates collected from 1998 to 2006, 16
Pseudomonas aeruginosa isolates contained an identical class 1 integron structure. Two P. aeruginosa
isolates contained the blaVIM-2 gene, and two Pseudomonas putida isolates harboured the blaVIM-4
gene cassette in different integron structures. PFGE analysis indicated that all blaVIM-4-containing
P. aeruginosa isolates were closely related, whereas the P. putida isolates were not. All MBL genes in
this study were chromosomally encoded, and all isolates harboured only one class 1 integron. The
blaVIM-2 isolates were clonal, and the genetic structure supporting the blaVIM-2 gene was found in an
identical chromosomal position.
Conclusions: MBL gene emergence in this hospital has paralleled a 6-fold increase in carbapenem
usage. We have found an increase in MBL gene diversity, MBL host organisms and MBL genetic
support structures in the hospital over the 9 year study period. There is also compelling evidence of
the persistence of individual strains in the hospital throughout the study period. This suggests that
once MBL genes have emerged in a hospital environment, they are difficult to remove.

Keywords: metallo-b-lactamases, class 1 integrons, VIM-2, VIM-4

Introduction encoding IMP, VIM, SIM-1 and GIM-1 enzymes are found as
gene cassettes within integron structures, whereas the genes
Among the various b-lactamases, the genetically mobile encoding SPM-1, AIM-1 and NDM-1 are found to be associated
metallo-b-lactamases (MBLs) are the most versatile, able to with ISCR elements. The combination of these gene acquisition
hydrolyse all b-lactams except the monobactams.1 In the last systems together with genetic vectors such as plasmids and con-
decade, the emergence and dissemination of mobile MBL genes jugative transposons has enabled MBL genes to disseminate
have been extensively documented and are thought to be driven among Gram-negative pathogens.4
by the regional consumption of extended-spectrum cephalospor- In Poland, MBLs were initially described in 2003.5 Our pre-
ins and/or carbapenems.2 Several families of mobile MBLs have vious studies also identified VIM-4-producing Pseudomonas
been documented (http://www.lahey.org/Studies/), including IMP, aeruginosa strains recovered from hospitalized children in
VIM, SPM, GIM, SIM, AIM and NDM (M. A. Toleman, unpub- Warsaw.6 A further countrywide study of P. aeruginosa isolates
lished results) that vary considerably in amino acid sequence. in 2000 –04 identified 38 isolates with MBL genes, comprising
Bacterial isolates producing the VIM MBL, especially eight different integron structures.7 Here, we describe a longi-
VIM-2, are widespread and found in many countries.3 All genes tudinal study of MBL genes in Pseudomonas species over a

.....................................................................................................................................................................................................................................................................................................................................................................................................................................

*Corresponding author. Tel: þ44-2920-743129; E-mail: tolemanma@cardiff.ac.uk

.....................................................................................................................................................................................................................................................................................................................................................................................................................................

269
# The Author 2008. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.
For Permissions, please e-mail: journals.permissions@oxfordjournals.org
 Patzer et al.

P. putida 283/02
intI1 blaVIM-4/VIM-4rpt aacA4 oxa-2 orfD qacEΔ1/sul

P. putida 229/03
intI1 blaVIM-4/VIM-4rpt aadB oxa-2 orf4 orfD qacEΔ1/sul

P. aeruginosa 414/03
intI1 aacA4 blaVIM-2 qacEΔ1/sul

P. aeruginosa 89/04
intI1 aacA4 blaVIM-2 qacEΔ1/sul

P. aeruginosa 266/03,
395-05,61-06, 147-06, intI1 aacA4 blaVIM-4/VIM-4rpt qacEΔ1/sul
38-06

P. aeruginosa isolates
from previous study
(11 isolates 1998-2001) intI1 aacA4 blaVIM-4/VIM-4rpt qacEΔ1/sul

Figure 1. Schematic of class 1 integrons in Polish isolates. Open boxes depict open reading frames with arrows indicating the direction of their transcription.
Ellipses represent the attachment site, where gene cassettes are inserted into the class 1 integron. Open circles represent the 59 base elements of each

Downloaded from jac.oxfordjournals.org by guest on November 7, 2010

individual gene cassette.

9 year period (1998 – 2006), documenting the emergence of new
types of MBL and integron structures, and also the long-term
persistence of individual isolates in the Children’s Memorial
Hospital, Warsaw, Poland.
Materials and methods
Bacterial strains and serotyping
Eighteen P. aeruginosa and two Pseudomonas putida strains used in
this study were recovered from a variety of specimens obtained from
patients hospitalized at the Children’s Memorial Hospital, Warsaw,
during 1998–2006. Eleven isolates were previously partially charac-
terized,6 and nine further isolates were collected from 2002– 06 in
this study. In addition, isolate 81-11963, which was the first
MBL-containing isolate detected in Poland,5 was also further
characterized. The isolates were identified by standard laboratory
methods. P. aeruginosa isolate 303 known to have a plasmid-
encoded VIM-2 gene (M. A. Toleman, unpublished results) was
used as a control of genetic location.
Antimicrobial susceptibility testing and detection of MBLs
MICs were determined using the agar dilution method on Mueller –
Hinton II agar (BD Microbiology Systems, Cockeysville, MD,
USA), as recommended by the CLSI.8
Detection of MBLs
Phenotypic screening involved Etest MBL strips (AB BIODISK,
Solna, Sweden) and hydrolysis experiments with and without pre-
incubation with 20 mM EDTA.
PCR screening for integron variable regions, MBL genes
and DNA sequencing
Primers used to detect the various MBL genes and integron variable
regions are as described previously.9 PCR analysis was carried out
using Extensor Taq polymerase (Thermo Fisher Scientific).
Sequencing was determined using Perkin-Elmer Biosystems 377
DNA sequencer.
Pulsed-field gel electrophoresis (PFGE) and genomic
location experiments
PFGE was performed as described previously for SpeI digests.10 For
S1 (Invitrogen, Paisley, UK) and I-Ceu1 (New England Biolabs,
Hitchin, UK) digests, plugs were washed once in 1 mL of 0.1  TE
for 30 min, followed by two 30 min incubations in 1 mL of S1 or
I-Ceu1 buffer. Fresh buffer was then added (0.5 mL), and I-Ceu1
was added at a concentration of 20 U per plug or S1 at 0.3 U per
plug. I-Ceu1 digests were performed at 378C overnight (16 h) or
45 min for S1. All gels were run at 6 V/cm with an angle of 1208
and pulses from 5 to 45 s for 20 h at 148C against a Lambda ladder
PFG marker (New England Biolabs).
In-gel hybridization
Pulsed-field gels were photographed and dried on blotting paper
(Whatman GB004) for 5 h at 508C. The gel was then re-hydrated,
denatured (0.5 M NaOH, 1.5 M NaCl, 30 min) and neutralized (0.5 M
Tris–HCl, pH 7.5, 1.5 M NaCl, 30 min) before incubation overnight at
658C in pre-hybridization solution and probed with a blaVIM-4 probe.
32
P labelling
The probe (1 kb) was prepared by PCR with custom-designed
primers VIM162F (GTCTACATGACCGCGTCTGT) and blaVIM-1R
(CAAAAGTCCCGCTCCAACGA), using P. aeruginosa 170-01
DNA as template and labelled with 32P dCTP (Redivue, GE
Healthcare, Amersham, UK) using a Prime-it II Random Primer
Labelling Kit (Stratagene, Amsterdam, the Netherlands). Gels were
hybridized overnight at 658C, washed with 2 SSC/0.1% SDS and
then 0.1 SSC/0.1% SDS for 30 min before autoradiography.
Accession numbers
Sequences determined are listed in the EMBL database under the acces-
sion numbers FM179465, FM179466, FM179467 and FM179468.

270
 Persistence of VIMs in hospital environment

(a) 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
0.8 Mb
425 kb

140 kb
97 kb

48.5 kb

(b) 1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
1 Mb
425 kb

Downloaded from jac.oxfordjournals.org by guest on November 7, 2010

145.5 kb
97 kb

48.5 kb

(c) 1 2 3 4 5 6 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
1 Mb

250 kb

130 kb

80 kb
45 kb
35 kb

Figure 2. PFGE and in-gel hybridization results of (a) I-Ceu1-digested plugs, (b) S1-digested plugs and (c) SpeI-digested plugs of the various Pseudomonas
isolates collected from 1998 to 2006. Numbers refer to the following isolates: 1, P. putida 229-03; 2, P. aeruginosa 147-06; 3, P. putida 283-02; 4, 38-06; 5, 266-03;
6, 61-06; 7, 395-05; 8, 89-04; 9, 414-03 (isolates 4–9 are all P. aeruginosa collected from 2002 to 2006); 10, P. aeruginosa 303-03 (plasmid control isolate); 11,
P. aeruginosa 81-11963 (initial Polish MBL isolate); 12, 404-00; 13, 170-01; 14, 101-01; 15, 301-99; 16, 419-99; 17, 486-01 (isolates 12–17 are all P. aeruginosa
isolates collected from 1998 to 2001); 18, Lambda ladder molecular weight marker.

assays. Additionally, two imipenem-resistant P. putida strains

Results producing MBL were detected. All isolates were also resistant to
Antimicrobial susceptibility testing aminoglycosides, all b-lactams (except aztreonam), and were
susceptible to ciprofloxacin (six of nine).
The results of antimicrobial susceptibility testing of 1358
P. aeruginosa isolates from 2002 to 2006 showed that resistance Screening for MBL genes and sequence analysis of class 1
varied from 13.5% to 18.4% and from 7.3% to 12.4% for
imipenem- and meropenem-resistant strains, respectively. integrons
Among 228 isolates of imipenem-resistant P. aeruginosa, seven Screening by PCR gave a positive result for the presence of the
produced MBL as detected using Etest MBL and hydrolysis blaVIM genes. This was further confirmed by sequencing to

271
 Patzer et al.
reveal the specific genes present in each variable region and also
their order (Figure 1). The majority of the isolates were found to
be blaVIM-4-positive with the unusual blaVIM-4 repeat sequence
of 169 bp and two 59 base elements as recorded previously.6
However, two isolates (414-03 and 89-04) were
blaVIM-2-positive. Isolates 266-03, 395-05, 404-04, 147-06,
38-06 and 61-06 had an integron identical to the isolates
reported previously in this hospital.6
PFGE analysis and genomic location experiments
PFGE analysis of SpeI- and I-Ceu1-digested plugs of the
various isolates revealed that the P. putida isolates were unre-
lated (Figure 2). In contrast, the analysis of P. aeruginosa
SpeI-digested isolates harbouring blaVIM-4 revealed that they
were very similar throughout the 1998 – 2006 study. Further,
pulsed-field gels of all isolates that were digested with I-Ceu1
and S1 and probed with a blaVIM-4 gene (Figure 2) indicated
that all genes were chromosomally encoded. This was as com-
pared with the control blaVIM-2-harbouring isolate, which is
resident on a plasmid of 425 kb (Figure 2). Further probing
of SpeI-digested plugs indicated that P. aeruginosa blaVIM-4
genes were all encoded on a chromosomal fragment of
80 kb, whereas P. aeruginosa blaVIM-2 isolates were on frag-
ments of 35 kb (Figure 2), which was identical to the first
Polish MBL isolate 81-11963.5 Interestingly, the blaVIM-4
probe hybridized with differently sized SpeI fragments (130
and 45 kb) in the two P. putida isolates, confirming their lack
of close identity.
Discussion
A 4-fold increase in the use of imipenem and meropenem was
noted at this hospital during 1993 –2003.10 From 2003 to 2006,
the use of carbapenems increased further to a value over six
times higher than that in 1993 (J. A. Patzer, unpublished
results). This was accompanied with an increase in resistance to
imipenem from 4.3% in 1998 to 18.4% in 2006. During 1998 –
2001, 11 MBL-producing P. aeruginosa were isolated from chil-
dren hospitalized on the surgical wards.6 In this study, we col-
lected a further nine MBL-positive Pseudomonas spp. Overall,
there was a decrease in MBL prevalence from 7.2% of
imipenem-resistant P. aeruginosa isolates possessing an MBL in
1998 –2001 to 3.25% from 2002 to 2006. The majority of the P.
aeruginosa isolates had identical resistance gene arrays to those
previously isolated. However, two harboured the MBL gene
blaVIM-2. An identical MBL blaVIM-4 was also found in two
unrelated P. putida species.
The genomic location of MBL genes is largely unknown,
with very few publications indicating whether they are encoded
on plasmids or resident on the chromosome. To address this, we
developed an in-gel hybridization strategy and combined this
with the PFGE of S1- and I-Ceu1-digested plugs. This strategy
was successful in determining that all the MBL genes in
this hospital were on the chromosome of their hosts. All
P. aeruginosa isolates harbouring blaVIM-4 were clearly related,
with very similar PFGE SpeI profiles, indicating that the same
strains have been present in the hospital for 9 years. This result
was also confirmed by their position on an identical 80 kb SpeI
chromosomal fragment. The blaVIM-2-harbouring isolates were
272
clonal, and the blaVIM-2 gene was located on a 35 kb SpeI frag-
ment, an identical position to the same gene found on the first
MBL-harbouring isolate found in Poland, which may suggest
relatedness.
Only one class 1 integron could be detected in each isolate,
an arrangement that probably severely limits the spread of the
MBL gene cassettes. This may explain the low prevalence of
this resistance mechanism during the time span of this study.
However, the chromosomal position and the limited number of
integrons in the strains are excellent factors for long-term main-
tenance of the MBL resistance cassettes. It, therefore, appears
that these particular isolates are particularly suited for long-term
persistence.
In summary, this paper documents the first genetically
detailed longitudinal study of MBL gene emergence in a
single institution and indicates that individual MBL-harbour-
ing strains can persist for extended periods probably due to
MBL gene fixation on the chromosome of their host
organisms.
Downloaded from jac.oxfordjournals.org by guest on November 7, 2010
Funding
M. A. T. was funded by the EC through COBRA contract
LSHM-CT-2003-503335 and internal funding from Cardiff
University. J. A. P. was funded by the Children’s Memorial
Health Institute, Warsaw.
Transparency declarations
All authors: none to declare.
References
1. Nordmann P, Poirel L. Emerging carbapenemases in
Gram-negative aerobes. Clin Microbiol Infect 2002; 8: 321–31.
2. Lee K, Lee WG, Uh Y et al. VIM- and IMP-type metallo-b-
lactamase-producing Pseudomonas spp. and Acinetobacter spp. in
Korean hospitals. Emerg Infect Dis 2003; 9: 868–71.
3. Walsh TR, Toleman MA, Poirel L et al. Metallo-b-lactamases:
the quiet before the storm? Clin Microbiol Rev 2005; 18:
306–25.
4. Yan JJ, Ko WC, Chuang CL et al. Metallo-b-lactamase-producing
Enterobacteriaceae isolates in a university hospital in Taiwan: pre-
valence of IMP-8 in Enterobacter cloacae and first identification of
VIM-2 in Citrobacter freundii. J Antimicrob Chemother 2002; 50:
503–11.
5. Walsh TR, Toleman MA, Hryniewicz W et al. Evolution of an
integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY
Antimicrobial Surveillance Program. J Antimicrob Chemother 2003; 52:
116–9.
6. Patzer J, Toleman MA, Deshpande LM et al. Pseudomonas
aeruginosa strains harbouring an unusual blaVIM-4 gene cassette iso-
lated from hospitalized children in Poland (1998–2001). J Antimicrob
Chemother 2004; 53: 451–6.
7. Fiett J, Baraniak A, Mrowka A et al. Molecular epidemiology of
acquired-metallo-b-lactamase-producing bacteria in Poland. Antimicrob
Agents Chemother 2006; 50: 880–6.
 Persistence of VIMs in hospital environment
8. Clinical and Laboratory Standards Institute. Methods for Dilution genes in Europe: report from the SENTRY worldwide antimicro-
Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically. bial surveillance programme. J Antimicrob Chemother 2003; 52:
CLSI, Wayne, PA, USA, 2006. 583 –90.
9. Toleman MA, Biedenbach D, Bennett D et al. Genetic character- 10. Patzer JA, Dzierzanowska D. Increase of imipenem resistance
ization of a novel metallo-b-lactamase gene, blaIMP-13, harboured by a among Pseudomonas aeruginosa isolates from a Polish paediatric hos-
novel Tn5051-type transposon disseminating carbapenemase pital (1993–2002). Int J Antimicrob Agents 2007; 29: 153–8.

Downloaded from jac.oxfordjournals.org by guest on November 7, 2010

273