You are on page 1of 6

Hum Genet (1992) 89:99-104

9 Springer-Verlag1992

13s Haplotypes in various world populations


Cihan Oner:, Aleksandar J. Dimovski 1, Nancy F. Olivieri 2, Gino Schiliro 3, John F. Codrington:' 4,
Sladdehine Fattoum L 5, Adekunle D. Adekile:' 6, Reyhan Oner 1, Gunes T. Yiiregir 7, (~. AItay 8, A. Gurgey s,
Rashik B. Gupta:" 9, Vinod B. Jogessar 1~ Michael N. Kitundu t' ::, Dimitris Loukopoulos 12, Gabriel P. Tamagnini 13,
M. Leticia S. Ribeiro :3, Ferdane Kutlar 1, Li-Hao Gu 1, Kenneth D. Lanclos:, and Titus H.J. Huisman 1
:Department of Biochemistryand Molecular Biology,MedicalCollegeof Georgia, Augusta, GA 30912-2100, USA
2Department of Hematology,The Hospital for Sick Children, Toronto M5G 1X8, Canada
3Department of Pediatric Hematology,Universityof Catania, 1-95125 Catania, Italy
4Academisch Ziekenhuis, Paramaribo, Suriname
5Laboratoire de Biochimie, H6pital d'Enfants, Place Bab-Saadoun,Tunis, Tunisie
6Department of Pediatrics, ObafemiAwolowoUniversity, Ile-Ife, Nigeria
7Department of Biochemistry,Universityof ffukurova,Adana, Turkey
8Children's Medical Center, Hacettepe University,Ankara, Turkey
9Regional Medical Center for Tribals, Jabalpur 482003, India
1~ of Haematology,KingEdward VIII Hospital, P.O. Congella, Durban, Republic of South Africa
l:Yuma FoundationLaboratories, Iramba District, Kinampanda,Tanzania
:2First Department of Medicine, Universityof Athens, Laikon Hospital, GR-11527 Athens, Greece
13Department of Hematology,Centro Hospitalar, P-3000 Coimbra, Portugal

Received July 15, 1991 / Revised October 29, 1991

Summary. We have determined the 13s haplotypes in 709 clinical severity are variable and are influenced by a
patients with sickle cell anemia, 30 with SC disease, 91 number of factors, including the simultaneous presence
with S-[~-thalassemia, and in 322 HbS heterozygotes of an a-thalassemia (a-thai), variations in H b F level,
from different countries. The methodology concerned and the haplotype background that is linked to the 13-
the detection of mutations in the promoter sequences of globin gene (for review see Nagel and Ranney 1990).
the Gy_ and Ay-globin genes through dot blot analysis of There is also convincing evidence that the ~s mutation
amplified DNA with 32p-labeled probes, and an analysis arose in Africa and Saudi Arabia-India on at least five
of isolated H b F by reversed phase high performance different types of chromosomes. These chromosomes
liquid chromatography to detect the presence of the ATX have distinct haplotypes that are linked to the [3s gene
chain [Ay75(E19) I l e ~ T h r ] that is characteristic for hap- and are numbered 17, 19, 20, 3, and 31, respectively,
lotype 17 (Cameroon). The results support previously and are also known as the Cameroon, Benin, Bantu or
published data obtained with conventional methodology CAR (Central African Republic), Senegal, and Saudi
that indicates that the 13s gene arose separately in differ- Arabia-India types, respectively (for review see Nagel
ent locations. The present methodology has the advan- and Ranney 1990; Schroeder et al. 1990).
tage of being relatively inexpensive and fast, allowing Determination of these haplotypes is based upon the
the collection of a vast body of data in a short period of presence or absence of different restriction sites (re-
time. It also offers the opportunity of identifying unusual viewed in Hattori et al. 1986). We recently detected cer-
13s haplotypes that may be associated with a milder ex- tain mutations within the promoter regions of the Gy_
pression of the disease. The numerous blood samples and Ay-globin genes and in the second intervening se-
obtained from many SS patients living in different coun- quence (IVS-II) of the Ay-globin gene that are character-
tries made it possible to compare their hematological istic for the listed haplotypes (Lanclos et al. 1991; Di-
data. Such information is included (as average values) for movski et al. 1991). A [3s chromosome with haplotype 19
395 SS patients with haplotype 19/19, for 2 with haplo- has two specific mutations, one in each of the promoter
type 17/17, for 50 with haplotype 20/20, for 2 with haplo- sequences, namely -369 (C---~G) Gy and -657 (G-*T)
type 3/3, and for 37 with haplotype 31/31. Some informa- Ay, that with haplotype 20 has a double-base mutation, a
tion on haplotype characteristics of normal ~A chromo- highly characteristic 6-bp deletion in the Gy promoter,
somes is also presented. and a single base pair mutation in the Ay promoter. A 13s
chromosome with haplotype 17 has none of these but
carries a T ~ C mutation at codon 75 (Ay) leading to the
Introduction synthesis of the A~tT chain (75 Ile---~Thr; Ricco et al.
Sickle cell anemia (SS) is one of the most common 1976). The 13s chromosome with either haplotypes 3 or
hereditary diseases. Its hematological characteristics and 31 cannot be distinguished from each other by this pro-
cedure. Both have only the C---,T mutation at -158 in
Offprint requests to: T. H. J. Huisman the Gy promoter that results in a high level of Gy chains
100

Table 1. Mutations characteristic for ~3s chromosomes with specific tion of the t y p e s of 7 chain b y r e v e r s e d p h a s e high p e r -
haplotypes. +, The mutation is present; - , the mutation is absent f o r m a n c e liquid c h r o m a t o g r a p h y ( H P L C ; the l a t t e r ap-
Mutations Haplotypes p r o a c h was u s e d in this study). A n a d d e d b e n e f i t o f the
m e t h o d o l o g y is t h a t it allows the selection o f u n u s u a l [3s
17 19 20 3 31
h a p l o t y p e s t h a t differ f r o m the five m a j o r types and a r e
-1106/05 (GC--~TT) (07) - - + - - o f t e n a s s o c i a t e d with a m i l d e r f o r m of the disease.
6 bp deletion ( - C T T T A A ) (07) - - + - - Since the d e v e l o p m e n t o f this m e t h o d o l o g y , we have
-369 (C---~G) (07) - + - - - r e c o n f i r m e d s o m e of the [3s h a p l o t y p e s p r e v i o u s l y d e t e r -
-158 (C--+T) (07) - - - + + m i n e d in o u r l a b o r a t o r y with the restriction e n d o n u c l e a s e
-657 (G---~T) (A~/) _ q_ _ _ _ m e t h o d , a n d all c u r r e n t d a t a w e r e o b t a i n e d with the new
-271 (C--+T) (A7) -- -- + -- -- a p p r o a c h . In the p r e s e n t c o m m u n i c a t i o n , we d e s c r i b e
Hb F high G7 (> 60%) -- _ _ + + o u r e x p e r i e n c e with h a p l o t y p i n g a large n u m b e r of [3s
Hb F with ATT +2 _ _ _b _b c h r o m o s o m e s f r o m p a t i e n t s living in 14 d i f f e r e n t coun-
tries using the n e w a p p r o a c h . D e t a i l s of h e m a t o l o g y and
a Due to a T---~Cmutation at codon 75 of the A7-globin gene
clinical f e a t u r e s for m o s t of the p a t i e n t s have e i t h e r b e e n
b Differentiation of haplotypes 3 and 31 is based on racial/ethnic
p u b l i s h e d o r will b e p u b l i s h e d e l s e w h e r e . T h e d a t a for
background of the subject or on the presence or absence of a
HinclI site 5' to the ~ gene (haplotype 31: +: 3: - ) p a t i e n t s f r o m the U n i t e d States ( H a t t o r i et al. 1986;
K u t l a r et al. 1985), K e n y a ( O j w a n g et al. 1987), a n d
T u n i s i a ( A b b e s et al. 1991; F a t t o u m et al. 1991) in the
( G i l m a n a n d H u i s m a n 1984; T a b l e 1). D i f f e r e n t i a t i o n p r e s e n t study are a r e c o n f i r m a t i o n of a l r e a d y p u b l i s h e d
b e t w e e n the two is b a s e d on the e t h n i c / r a c i a l b a c k - i n f o r m a t i o n , while the o t h e r s r e p r e s e n t n e w a n d o n g o i n g
g r o u n d of the i n d i v i d u a l a n d , in c e r t a i n cases, on t h e analyses.
p r e s e n c e o r a b s e n c e of the HinclI site 5' to the ~ gene
a n d the B a m H I site 3' to the [3-globin gene. M o r e o v e r ,
B e r g et al. (1991) h a v e r e p o r t e d t h a t t h e + A T A / - T Materials and methods
c o n f i g u r a t i o n at p o s i t i o n - 5 3 0 to the [3-globin g e n e is
c h a r a c t e r i s t i c for h a p l o t y p e 31. T o distinguish h a p l o - Blood samples from 1152 individuals were collected in vacutainers
t y p e s 3 a n d 31, a D N A s e g m e n t b e t w e e n p o s i t i o n s - 7 2 4 with EDTA as anticoagulant. The subjects came from 14 different
a n d + 2 7 r e l a t i v e to the C a p site o f the [3-globin gene is countries and had SS, SC disease, sickle cell trait (AS), or Hb 8-]3-
a m p l i f i e d and h y b r i d i z e d with p r o b e s specific for this thal; the 13-thalalleles were not identified.
The United States patients were mainly African Americans
c h a n g e in s e q u e n c e a n d for the n o r m a l s e q u e n c e (for from the Georgia area of the southeastern USA, but included one
m e t h o d o l o g y , see W o n g et al. 1989). T h e m e t h o d o l o g y Arab family. The Canadian patients were Caribbean immigrants:
is r e l a t i v e l y fast; n u m e r o u s a m p l i f i e d D N A s a m p l e s are those from Tunisia and Syria were Arabs, while those from Turkey
p l a c e d on a n y l o n m e m b r a n e a n d are h y b r i d i z e d s e q u e n - were Eti-Turks from ~ukurova province. The Italian and Greei~
tially with the p r o b e s for the f o u r m u t a t i o n s in the G7 patients were Caucasians from Sicily and Athens, respectively.
p r o m o t e r o r the two in t h e a 7 p r o m o t e r . I d e n t i f i c a t i o n The Surinamese were blacks with varying ancestries, and those
from India belonged to the Gond tribal groups from the central
o f h a p l o t y p e 17 r e q u i r e s e i t h e r an a d d i t i o n a l amplifica- part of the country. The Kenyans, Tanzanians, and Angolans were
tion involving the AT-globin g e n e a n d h y b r i d i z a t i o n with Bantus, while the Nigerians were representative of various ethnic
a p r o b e specific for the T--+C m u t a t i o n at c o d o n 75, o r groups (mainly Ibo, Hausa, and Yoruba) and were drawn from
the i s o l a t i o n of H b F f r o m the r e d cells a n d c h a r a c t e r i z a - eight different centers. All patients were attending sickle cell

Table 2. Data about primers and probes.


M, Mutant probe; N, normal probe Sequence Positions Function
5' 3'
ACGTCATAATCTACCAAG GTCATG c7: - 1227 to - 1204 Direct primer
AGCTTAGGGGATAAACTAATTTG A7: -- 1279 to -- 1257 Direct primer
C7
GGCGTCTGGACTAGGAGCTTATTG a,r +53 to +30 Reverse primer

T A C T T C C T [ ~ CATGTTAAG (M) 07: -- 1114 to --1096 - 1106/05 (GC~TT)


TACTTCCT G[GCJCATGTTAAG (N)
CATGCTTTAAACTACAGGC (M) 0,/: --407 to --383 (M) 6-bp deletion
TACATGCTITAAI CTTTAAIA (N) 409 to -391 (N) (-CTTTAA)
CTGGAGCTA~G~AGACAAGAA (M) 07:-378 to -360 -369 (C-+G)
CTGGAGCTAI C I A G A C A A G A A (N)
GAAACGGT~T~ CCTGGCTAAA (M) 0 7 : - 1 4 8 to -166 - 158 (C--,T)
GAAACGGT[CJ CCTGGCTAAA (N)
T G A G G T A A G C A T T A G [ ~ T C T (M) AT: -672 to -654 -657 (G--~T)
TGAGGTAAGCATTAGIGITCT (N)
A G A G A A A A A [ ~ T G G A A T G A C (M) AT: -280 to -262 -271 (C---~T)
A G A G A A A A A C~JTGGAATGAC (N)
101

clinics in their various countries but the Angolans were residents of America, 791 from Africa, 426 from Mediterranean
Portugal and attending the Central Hospital in Coimbra. All were countries, and 135 from Indian donors. The largest group
in steady state, i.e., not in crisis or any other acute illness at the of patients was from Nigeria, followed by the United
time of blood collection. Less then 10% of the patients were re-
lated, but the AS individuals were mostly relatives of the SS
States and Turkey. There was no significant sex differ-
patients. ence in the whole population.
All blood samples were kept, as much as possible, at 4~ for
varying periods of time, and were shipped or carried in wet ice by [3s Haplotypes (Table 3)
fast air service and by different authors to Augusta, Ga. Most sam-
ples reached the laboratory more than 3 weeks after collection. Four different haplotypes were present in the North and
However, complete blood counts were obtained within 1 day of South American donors; the frequency of haplotype 19
collection for samples from the United States, Canada, Portugal, was the highest in all three groups, followed by haplo-
Italy, Greece, and South Africa. These were done either locally at types 20, 3, and 17. The high frequency of haplotype 20
the centers of collection or in the laboratory in Augusta, Ga.
Hematological data were obtained using an automated cell among patients from Surinam was striking. The seven
counter. All samples were analyzed by isoelectrofocusing (IEF; chromosomes with haplotype 31 were from four mem-
Righetti 1986) and by cation exchange HPLC (Biss6 and Wieland bers of an Arab family, described before (Kutlar et al.
1988; Kutlar et al. 1990), for the quantitation of Hb F and Hb A2. 1985). As many as 36 [3s chromosomes had atypical hap-
Hb F was isolated by DEAE-cellulose chromatography (Schroeder lotypes; some of these are presently under study.
and Huisman 1980) and its 7 chain composition was determined by The data from African patients fell into two groups.
reversed phase H P L C (Shelton et al. 1984; Kutlar et al. 1986).
D N A was isolated from the blood samples with the method of
The Kenyan, Angolan, and Tanzanian [3s chromosomes
Poncz et al. (1982). For the majority of the samples the 13s muta- had haplotype 20, while those of Nigerian subjects had
tion was confirmed by dot-blot analysis, hybridizing amplified haplotype 19 with 3.7% haplotype 17, 1.0% haplotype 3,
D N A with a 32p-labeled oligonucleotide probe that is specific for and 0.8% haplotype 20. As many as 411 of the 426 [3s
the A---~T mutation at codon 6 (Glu---~Val) of the [3-globin gene. chromosomes (96.5%) from the patients of Mediterra-
Segments of about 1350 bp of both the c,{_ and Aq,-globin genes nean descent had haplotype 19; 13 13s chromosomes are
were amplified from genomic D N A with 5' direct oligonucleotide
primers specific for c~, and A7 and a common 3' reverse primer in need of further characterization. All but two of the
(Table 2). Aliquots of these amplified D N A samples were blotted 135 Indian 13s chromosomes had haplotype 31; the origin
onto nylon membranes and hybridized to the specific 5' end-labeled of two [3s chromosomes with haplotype 17 remains un-
oligonucleotide probes listed in Table 2; the listing includes se- clear.
quences of the probes, their locations within the sequences of the
5' flanking regions of the "~-globin genes, and the mutations or the
deletion for which these probes are specific. Methodology has
flA and [3-thal chromosomes
been detailed in earlier studies (Lanclos et al. 1991; Dimovski et Dimovski et al. (1991) reported the specific changes in
al. 1991).
the 5' flanking regions of the G7 and A7 genes of 105 13A
chromosomes from normal African American black in-
Results dividuals from the southeastern United States. They
found that 26 chromosomes were positive for the -657
Subjects G ~ T (A] t) mutation, while 18 of these 26 chromosomes
A total of 1861 13s chromosomes were analyzed; 509 [3s also had the -369 C---~G (GT) mutation. These two
chromosomes came from patients of North and South changes were specific for haplotype 19. None were posi-

Table 3. Number of patients with hemoglobinopathies participating in this study and their 13s haplotypes
Country SS SC AS SI3TM [3s Haplotypes
chromosomes
19 17 20 3 31 Others
U S A (SE) 147 13 41 23 371 205 13 71 56 7 19
Canada 21 11 5 3 61 30 8 7 8 0 8
Surinam 14 1 45 3 77 41 2 23 2 0 9
Kenya 55 0 1 0 111 2 0 109 0 0 0
Tanzania 14 0 13 0 41 0 0 41 0 0 0
Nigeria 294 2 30 3 623 576 23 5 6 0 13
Angola a 6 0 4 0 16 2 0 14 0 0 0
Tunisia 35 2 37 6 115 109 0 0 0 0 6
Saily (Italy) 18 0 19 15 70 70 0 0 0 0 0
Greece 0 0 14 0 14 13 0 0 1 0 0
Turkey 67 1 60 19 214 206 0 0 0 1 7
Syria 2 0 5 4 13 13 0 0 0 0 0
India 36 0 45 12 129 0 2 0 0 127 0
South Africa (Indians) 0 0 3 3 6 0 0 0 0 6 0

Total 709 30 322 91 1861 1267 48 270 73 141 62


a From subjects living in Portugal
102

Table 4. Hematological and Hb composition data for SS patients from different countries with homozygosities for specific 13s haplotypes
(average values with standard deviations in parentheses)? nd, No data: Hb, hemoglobin; PCV, Packed cell volume; RBC, red blood count:
MCV, mean corpuscular volume; MCH, mean corpuscular hemoglobin; MCHC, mean corpuscular hemoglobin concentration
Haplo- Country n Age Hb PCV RBC MCV MCH MCHC A2b Fb Gyc
type (years) (g/dl) Off) 10t2/l (fl) (pg) (g/dl) (%) (%) (%)
19/19 USA 24 7.9 8.80 0.250 3.02 84.0 29.4 35.0 2.9 11.7 40.8
(6.4) (1.0) (0.030) (0.57) (9.0) (4.0) (2.7) (0.5) (5.2) (4.6)
Surinam 5 10.5 8.30 0.294 2.85 102.5 28.8 28.2 3.2 9.3 42.4
(4.8) (1.4) (0.048) (0.35) (8.7) (2.7) (1.8) (1.0) (4.4) (4.0)
Nigeria 249 9.7 7.53 0.282 2.76 103.7 26.8 26.8 2.9 9.2 41.6
(6.0) (1.4) (0.045) (0.65) (13.3) (2.2) (2.2) (1.0) (5.6) (5.9t
Tunisia 35 14.3 8.20 0.250 2.53 98.8 32.4 32.8 2.9 7.6 36.5
(6,7) (1.2) (0.041) (0.31) (8.1) (3.11 (2.6) (1.1) (2.9) (4.3)
Italy 18 11.2 7.55 0.240 2.47 97.2 30.6 31.5 2.9 9.0 39.6
(7.1) (1.6) (0.039) (0.37) (7.5) (3.2) (2.1) (0.7) (4.1) (3.6)
Turkey 62 10.0 8.40 0.250 2.72 91.9 30.7 34.2 2.7 9.8 44.0
(4.2) (1.81 (0.060) (0.65) (7.0) (2,1) (2.0) (0.6) (4.0) (4.1)
Syria 2 4 7.20 0.225 2.73 82.0 26.2 32.0 3.7 7.8 41.1
20 9.20 0.255 2.61 98.0 35.2 36.1 3.1 9.2 40.0
17/17 USA 1 12 7.90 0.225 2.89 77.7 27.3 35.1 3.2 5.4 42.7
Nigeria 1 . . . . . . 3.1 14.1 49.2
20/20 USA 6 9.8 8.20 0.210 2.55 84.5 31.8 37.5 2.5 12.1 41.3
(4.1) (0.9) (0.020) (0.29) (7.11 (3.2) (1.4) (0.35) (6.4) (3.8)
Surinam 3 12.6 7.60 0.290 2.96 98.0 25.7 26.2 3.6 5.7 38.6
(4.8) (1.5) (0.050) (0.60) (7.1) (2.11 (1.5) (0.4) (2.3) (2.9)
Tanzania 12 10.7 6.42 0.247 2.27 108.8 28.8 26.0 nd 8.6 44.0
(6.5) (1.3) (0.050) (0.49) (14.4) (4.9) (1.7) (3.4) (3,6)
Kenya 25 10.9 7.85 0.260 2.54 102.4 30.9 30.2 3.1 7.5 40.6
(7.2) (1.3) (0.040) (0.31) (8.0) (2.8) (1.3) (0.7) (4.5) (4.9)
Angola 4 9.3 7.30 0.207 2.70 88.3 30.5 35.3 nd 2.7 nd
(5.0) (0.5) (-) (0.23) (6.4) (2.4) (1.0) (2.3)
3/3 USA 2 43 9.6 0.280 3.60 79.0 26.7 33.7 3.0 19.2 71.1
15 8.2 0.300 3.11 78.0 26.4 33.5 3.3 14.0 71.2
31/31 USA 3 13.3 10.1 0.295 3.78 78.0 26.7 34.2 1.2 27.8 64.9
(5.8) (1.4) (0.020) (0.12) (4.0) (2.7) (1.3) (0.3) (5.3) (1.3)
India 34 12.1 9.7 0.281 3.17 88.6 30.6 34.5 1.9 23.2 68.6
(8.2) (1.8) (0.038) (0.78) (7.0) (5.2) (1.4) (0.3) (5.9) (3.7)
a The data for the US patients are from Hattori et al. (1986); Kutlar et al. (1985)
b By microchromatography (Schleider et al. 1977) or cation exchange HPLC (Biss6 and Wieland 1988; Kutlar et al. 1990)
c By reversed phase HPLC (Shelton et al. 1984; Kutlar et al. 1986)

tive for haplotype 20. In the same study it was o b s e r v e d Hematological and hemoglobin (Hb) composition data
that 23 of 32 c h r o m o s o m e s with a [3-thal m u t a t i o n had
haplotype A (which is similar to the 13s haplotype 3). Five C o m p l e t e and satisfactory data could be obtained for
c h r o m o s o m e s with haplotype B, which is similar to 13s 486 SS patients (Table 4). Because m a n y samples were
haplotype 19, were positive for the - 6 5 7 G--+T (17) mu- collected m o r e than 3 weeks before analysis (Surinam,
tation, but only one c h r o m o s o m e carried the C - - , G mu- Nigeria, Tanzania, Syria, India), the PCV, MCV, and
tation at - 3 6 9 (Gy). O n e c h r o m o s o m e with an atypical M C H C values should be viewed with reservation. T h e
haplotype in the study was positive for 13s haplotype 20- most severe anemia is f o u n d a m o n g SS patients with
related mutations. haplotype 20/20, followed by the patients with haplotype
O f the 30 13A c h r o m o s o m e s f r o m Nigerian AS indi- 19/19. The hematological data from 37 SS patients with
viduals in the present study, seven (23.3%) were positive haplotype 31/31 indicated mild to m o d e r a t e anemia with
for haplotype 19-specific mutations, while one (3.3%) an average H b level of a b o u t 10.0 g/dl. H b F values var-
was positive for haplotype 20 mutations. T h e [3-thal ied considerably but were generally below 10.0% for SS
c h r o m o s o m e , present in three m e m b e r s of one family, patients with the 19/19, 17/17, and 20/20 haplotypes.
had haplotype 20-specific mutations. O f the thirteen ~3A H i g h e r values with high ~7 values were observed in all
c h r o m o s o m e s f r o m Tanzania, four had haplotype 19- SS patients with haplotype 3/3 and 31/31; detailed infor-
specific mutations. I n f o r m a t i o n on 13A c h r o m o s o m e s mation a b o u t the Indian SS patients will be presented
f r o m the o t h e r countries is not available. elsewhere ( G u p t a et al. 19911.
103

Discussion The polymerase chain reaction (PCR) amplification


method for mass screening of 13s haplotypes has the
Two recent reviews (Schroeder et al. 1990; Nagel and advantage over the restriction enzyme methodology of
Ranney 1990) have summarized the [3s haplotype data being fast, simple, and accurate, as was indicated by the
and have estimated the approximate boundaries of the excellent agreement between the data obtained with the
four major haplotypes. The Senegal type 3 is present in two approaches (Dimovski et al. 1991). Another advan-
Atlantic West Africa, the Benin type (19) in central tage is the rapid selection of unusual haplotypes that are
West Africa, the Bantu (CAR) type (20) in South-central associated with a milder expression of the disease; an
and Eastern Africa, while the Saudi Arabia-India type example is a new genetic rearrangement for the hybrid
31 is restricted to the Indian subcontinent and the east- haplotype (3/19) found in a Turkish SS patient with mild
ern section of the Arabian peninsula. The fifth type (17) disease and a high level of Hb F ((3ner et al. 1991). On
is much more restricted, being observed mainly in the the other hand, the method failed to detect the rare 13s
Eton ethnic group of Cameroon (Lapoumeroulie et al. haplotype observed among Indian SS patients that is
1989); it was originally observed among African Ameri- closely related to the common haplotype 31 (Kulozik et
cans living in the southeastern United States (Hattori al. 1986).
et al. 1986). The nearly exclusive occurrence of haplotype
19 among SS patients in various Mediterranean countries Acknowledgement. This study was supported by United States
suggests that this [3s chromosome was introduced from Public Health Service research grant HLB-41544.
central West Africa via Algeria, Tunisia, and Egypt.
The large body of data presented here supports these
References
conclusions. The almost exclusive occurrence of one spe-
cific [~s haplotype in patients from different countries (20 Abbes S, Fattoum S, Vidaud M, Goossens M, Rosa J (1991) Sickle
in Kenya, Angola, and Tanzania; 19 in Nigeria; 19 in all cell anemia in the Tunisian population: haplotyping and Hb F
Mediterranean countries; 31 in India) is most striking. expression. Hemoglobin 15 : 1-9
The presence of haplotypes 3 and 17 among Nigerian SS Berg PE, Mittleman M, Elion J, Labie D, Schechter AN (1991)
patients is as expected; [3s haplotype 3 is introduced from Increased protein binding to a -530 mutation of the human
the west and 17 from the east (Cameroon). The presence [3-globin gene associated with decreased [3-globin synthesis.
Am J Hematol 36: 42-47
of haplotype 20 is also not surprising since it is generally Biss6 E, Wieland H (1988) High-performance liquid chromato-
agreed that Bantu migration originated around the graphic separation of human haemoglobins: simultaneous
Nigeria/Cameroon area (Nagel 1984). Less evident is the quantitation of foetal and glycated haemoglobins. J Chro-
origin of the [3s haplotype 17 in two Indian tribal patients. matogr 434 : 95-110
The variation in the relative percentages of the African Bouhassira EE, Lachman H, Krishnamoorthy R, Labie D, Nagel
~s haplotypes in American, Canadian (mainly immi- RL (1989) A gene conversion located 5' to the Ay gene in
linkage disequilibrium with the Bantu haplotype in sickle cell
grants from the Caribbean area), and Surinam patients anemia. J Clin Invest 83 : 2070-2073
likely reflects the origins of their predecessors. Appar- Dimovski AJ, Oner C, Agarwal S, Gu Y-C, Kutlar F, Lanclos
ently, many slaves in South America were Bantus who KD, Huisman THJ (1991) Certain mutations observed in the
carry the [3s chromosome with haplotype 20. 5' sequences of the G?_and AT-globingenes of ~s chromosomes
Recently, Bouhassira et al. (1989) suggested the oc- are specific for chromosomes with major haplotypes. Acta
currence of a gene conversion in the [3s chromosome Haematol (Basel) 85 : 79-87
Fattoum S, Guemira F, Oner C, Oner R, Li H-W, Kutlar F, Huis-
with haplotype 20 that involves the replacement of the man THJ (1991) ~-Thalassemia, Hb S-[3-thalassemia and sickle
A7 sequence by a G7 sequence in the promoter of the Av- cell anemia among Tunisians. Hemoglobin 15:11-21
globin gene. The 5' limit of the conversion is thought to Gilman JG, Huisman THJ (1984) Two independent genetic factors
be located between positions - 3 0 6 and - 2 7 1 (at position in the [3-globin gene cluster are associated with high Gv levels
- 2 7 1 the C is replaced by a T as in Gy) and the 3' limit in the Hb F of SS patients. Blood 64 : 452-457
between positions +25 (the A is replaced by G) and Gupta RB, Tiwary RS, Pande PL, Kutlar F, Oner C, Oner R,
+1108 (the T found in Ay is retained; the 6y-globin gene Huisman THJ (1991) Hemoglobinopathies among the Gond
tribal groups of Central India; interaction of u- and [3-thalas-
has an A at this position). The authors observed that this semia with 13chain variants. Hemoglobin 15 : 441-458
conversion is highly, but not exclusively, associated with Hattori Y, Kutlar F, Kutlar A, McKie VC, Huisman THJ (1986)
haplotype 20 because some normal chromosomes also Haplotypes of ~s chromosomes among patients with sickle cell
appear to carry this change. Moreover, the frequency of anemia from Georgia. Hemoglobin 10 : 623-642
the conversion, determined for 11 SS patients with a Kulozik AE, Wainscoat JS, Serjeant GR, Kar BC, AI-Awamy B,
Essan GJF, Falusi AG, Haque SK, Hilali AM, Kate AS,
homozygosity for haplotype 20, was 0.82. The charac-
Ranasinghe WAEP, Weatherall DJ (1986) Geographical sur-
terization of the 13s chromosomes with haplotype 20, vey of Bs globin gene haplotypes: evidence for an independent
listed in Table 3, is based upon the presence of changes Asian origin of the sickle cell mutation. Am J Hum Genet
in the Gy and a,~ promoters, including the C---~Tmutation 39: 239-244
at position - 2 7 1 (Ay) (Table 2). All 270 [3s chromosomes Kutlar A, Hattori Y, Bakioglu I, Kutlar F, Kamel K, Huisman THJ
with haplotype 20 of the patients from the southeastern (1985) Hematological observations on Arabian SS patients
United States, the Caribbean area (the Canadian pa- with a homozygosity or heterozygosity for a ~s chromosome
with haplotype 31. Hemoglobin 9 : 545-557
tients), Surinam, and the African countries carried that Kutlar F, Kutlar A, Huisman THJ (1986) Separation of normal
mutation, while the other [3s chromosomes, the [3A, 13c, and abnormal hemoglobin chains by reversed phase high per-
and [3-thal chromosomes, did not. formance liquid chromatography. J Chromatogr 357:147-153
104

Kutlar A, Kutlar F, Gu L-G, Mayson SM, Huisman THJ (1990) amounts of peripheral blood: analysis of 13-like globin genes.
Fetal hemoglobin in normal adults and 13-thalassemia hetero- Hemoglobin 6 : 27-36
zygotes. Hum Genet 86:106-110 Ricco G, Mazza U, Turi RM, Pich PG, Camaschella C, Saglio G,
Lanclos KD, Oner C, Dimovski AJ, Gu Y-C, Huisman THJ (1991) Bernini LF (1976) Significance of a new type of human fetal
Sequence variations in the 5' flanking and IVS-II regions for hemoglobin carrying a replacement isoleucine-+threonine at
the ~ - and a,/-globin genes of 13s chromosomes with five differ- position 75(E19) of the 7 chain. Hum Genet 32:305-313
ent haplotypes. Blood 77 : 2488-2496 Righetti PG (1986) Practical application of isoelectricfocusing in
Lapoumeroulie C, Dunda O, Trabuchet G, Mony-Lobe M, Labie hemoglobin separation and identification. In: Huisman THJ
D, Elion J, Krishnamoorthy R (1989) A novel sickle gene of (ed) The hemoglobinopathies. (Methods in hematology, vol
yet another origin in Africa: the Cameroon type. Blood [Suppl 15) Churchill-Livingstone, Edinburgh, pp 47-70
1] 74:63a Schleider CTH, Mayson SM, Huisman THJ (1977) Further modifi-
Nagel RL (1984) The origin of the hemoglobin S gene: clinical, cation of the microchromatographic determination of hemo-
genetic and anthropological consequences. Einstein Quart J globin A2. Hemoglobin 1 : 503-504
Biol Med 2 : 53-62 Schroeder WA, Huisman THJ (1980) The chromatography of
Nagel RL, Ranney HM (1990) Genetic epidemiology of structural hemoglobin. (Clinical and biochemical analysis, vol 9) Dekker,
mutations of the 13-globingene. Semin Hematol 27 : 342-359 New York
Ojwang PJ, Ogada T, Beris P, Hattori Y, Lanclos KD, Kutlar A, Schroeder WA, Munger ES, Powars DR (1990) Sickle cell
Kutlar F, Huisman THJ (1987) Haplotypes and ~. globin gene anaemia, genetic variations, and the slave trade to the United
analyses in sickle cell anaemia patients from Kenia. Br J States. J African Hist 31 : 163-180
Haematol 65 : 211-215 Shelton JB, Shelton JR, Schroeder WA (1984) High performance
Oner C, Dimovski AJ, Altay (7, Gurgey A, Gu YC, Huisman liquid chromatographic separation of globin chains on a large-
THJ, Lanclos KD (1992) Sequence variations in the 5' hyper- pore C4 column. J Liquid Chromatogr 7:1969-1977
sensitive site-2 of the locus control region of 13s chromosomes Wong SC, Stoming TA, Efremov GD, Huisman THJ (1989) High
are associated with different levels of fetal globin in Hb S ho- frequencies of a rearrangement (+ATA; - T ) at -530 to the 13-
mozygotes. Blood 78 : 813-819 globin gene in different populations indicate the absence of a
Poncz M, Solowiejczyk D, Harpel B, Mory Y, Schwartz E, Surrey correlation with a silent [3-thalassemia determinant. Hemo-
S (1982) Construction of human gene libraries from small globin 13 : 1-5