Transcrição e Tradução 1- Descreva as propriedades comuns das reações catalisadas pela DNA polimerase e RNA polimerase.

2- Defina região promotora para genes de eucariotos e procariotos. 3- Descreva os passos que ocorrem durante o início da transcrição em procariotos. Qual o papel do fator sigma? Como a especificidade da incorporação dos nucleotídeos é determinada? 4- Qual a relação entre os hnRNAs e os mRNAs? Como essa relação foi descoberta? 5- A transcrição de introns consome reservas de energias celulares sem retorno aparente ao organismo. Quais seriam as possíveis vantagens da transcrição dos introns? 6- Quais são os possíveis efeitos de uma mutação na sequência (5´)AAUAAA em um transcrito de mRNA eucariótico. 7- Por que se emprega rifamicina no tratamento da tuberculose? Ela pode também atuar em mitocôndrias? Explique sua resposta. 8- Cogumelos que contêm alfa-amanitina são tóxicos. Por quê? Quais os sintomas observados pela intoxicação por alfa-amanitina? 9- Muitas das drogas em uso clínico ou sob avaliação para o tratamento da AIDS são inibidoras da transcriptase reversa do HIV. Quais transcriptases reversas das células humanas também poderiam ser inibidas por essas drogas? Quais seriam as consequências da inibição destas enzimas? 10- Por que os tRNAs são conhecidos como moléculas adaptadoras? Justifique a sua resposta considerando as estruturas comuns de tRNA. 11- Descreva a natureza da interação entre os tRNAs e as aminoacil-tRNA sintetases. 12- Por que a terceira posição de cada códon é chamada de oscilante? 13- A metionina é codificada por apenas um códon. Como esse único códon especifica o resíduo de iniciação e o resíduo de metionina interna. 14- Durante o elongamento da cadeia polipeptídica, é correto afirmar que: a) o aa-tRNA se move de um códon do mRNA para o próximo;

b) o ribossomo se move em direção ao terminal 3’ do mRNA, c) a cadeia polipeptídica crescente presente no tRNA localizado no sítio P move-se para o aminoácido presente no tRNA localizado no sítio A, d) os aa-tRNAs entram no sítio P vazio 15- Dada a seqüência da fita molde de um segmento de DNA, indique a seqüência de mRNA transcrita e a seqüência dos aminoácidos codificados: (5´) CTTAACACCCCTGACTTCGCGCCGTCG 16- O genoma do bacteriófago ФX174 codifica 10 proteínas, designadas de A a K, com tamanhos dados na tabela a seguir. Qual seria o tamanho do DNA necessário para codificar essas 10 proteínas? Considerando que o genoma do bacteriófago ФX174 contem apenas 5.386 bp, como é possível codificar essas 10 proteínas? Proteína A B C D E Número de a.a 455 120 86 152 91 Proteína F G H J K Número de a.a 427 175 328 38 56

17- Indique como os antibióticos estreptomicina, tetraciclina, cloranfenicol e eritromicina, inibem a síntese de proteínas e apresentam efeitos antibacterianos. 18- Difteria é uma doença altamente contagiosa causada por uma toxina secretada pela Corynebacterium diphtheriae. Embora a toxina seja uma proteína, ela não é produzida por um gene bacteriano, mas por um gene transportado por um bacteriófago infectante. A toxina da difteria é composta de duas subunidades protéicas, sendo que a subunidade B se liga ao receptor na superfície celular facilitando a entrada da subunidade A. A subunidade A catalisa a reação na qual a porção ADP-ribose (ADPR) do NAD é transferida para um resíduo de histidina, o fator de elongação 2 (EF-2). Qual o efeito desta toxina na célula? 19- Cite os tipos de modificações pós traducionais que ocorrem em proteínas.