Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE

Multiplex PCR assay for simultaneous detection and differentiation of Mycobacterium tuberculosis, Mycobacterium avium complexes and other Mycobacterial species directly from clinical specimens
K. Gopinath and S. Singh
Division of Clinical Microbiology, Department of Laboratory Medicine, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, India

Keywords HIV, Mycobacterium avium, mixed infection, multiplex PCR, tuberculosis. Correspondence Sarman Singh, Division of Clinical Microbiology, Department of Laboratory Medicine, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110 029, India. E-mail: sarman_singh@yahoo.com

Abstract Aims: Polymerase chain reaction (PCR) is the most rapid and sensitive method for diagnosing mycobacterial infections and identifying the aetiological Mycobacterial species in order to administer the appropriate therapy and for better patient management. Methods and Results: Two hundred and thirty-five samples from 145 clinically suspected cases of tuberculosis were processed for the detection of Mycobacterial infections by ZN (Ziehl Neelsen) smear examination, L-J & BACTECTM MGIT-960 culture and multiplex PCR tests. The multiplex PCR comprised of genus-specific primers targeting hsp65 gene, Mycobacterium tuberculosis complex-specific primer targeting cfp10 (Rv3875, esxB) region and Mycobacterium avium complex-specific primer pairs targeting 16S–23S Internal Transcribed Spacer sequences. The multiplex PCR developed had an analytical sensitivity of 10 fg (3–4 cells) of mycobacterial DNA. The multiplex PCR test showed the highest (77Æ24%) detection rate, while ZN smear examination had the lowest (20%) detection rate, which was bettered by L-J culture (34Æ4%) and BACTECTM MGIT-960 culture (50Æ34%) methods. The mean isolation time for M. tuberculosis was 19Æ03 days in L-J culture and 8Æ7 days in BACTECTM MGIT960 culture. Using the multiplex PCR, we could establish M. tuberculosis + M. avium co-infection in 1Æ3% HIV-negative and 2Æ9% HIV-positive patients. The multiplex PCR was also highly useful in diagnosing mycobacteraemia in 38Æ09% HIV-positive and 15Æ38% HIV-negative cases. Conclusions: The developed in-house multiplex PCR could identify and differentiate the M. tuberculosis and M. avium complexes from other Mycobacterial species directly from clinical specimens. Significance and Impact of the Study: The triplex PCR developed by us could be used to detect and differentiate M. tuberculosis, M. avium and other mycobacteria in a single reaction tube. elsewhere: the rapid and sensitive diagnosis of the infection and identification of the pathogenic species. The latter has gained significant importance after AIDS epidemic, where several nontubercular species of the mycobacterium cause human diseases. Because of these two major concerns and limitations, progress in case detection had slowed down globally in 2006 and began to stall in China and India (WHO 2008). After AIDS epidemic, nontubercular mycobacteria, especially Mycobacterium
425

2008 ⁄ 1183: received 9 July 2008, revised 4 December 2008 and accepted 13 December 2008
doi:10.1111/j.1365-2672.2009.04218.x

Introduction India has far more cases of tuberculosis than any other country in the world and it accounts for one-fifth of the global TB burden (WHO 2008). A total of 9Æ2 million new cases and 1Æ7 million deaths from tuberculosis (TB) occurred in 2006, of which 0Æ7 million had human immunodeficiency virus (HIV) co-infection. There are two main concerns about TB control in India and

ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology, Journal of Applied Microbiology 107 (2009) 425–435

1999). especially for extrapulmonary samples like cerebrospinal fluid (CSF). Director. DNA was isolated using rapid Phenol– Chloroform extraction method (Sambrook et al. the diagnosis of mycobacterial infections is not made timely leading to mismanagement and empirical therapeutic trials. Mycobacterium chelonae (n = 2) and M. M. Powderly 1996). Gopinath et al. L-J culture and BACTECTM MGIT-960 automated culture system. Mycobacterium terrae (TMC-1450). Not infrequently. This method has the poorest detection rate in HIV positive patients (Gopinath et al. The mycobacterial clinical isolates used for the standardization were confirmed by multiple molecular methods including the species-specific PCR.M. microscopical demonstration of acid-fast bacilli (AFB). tuberculosis-specific monoplex PCRs are being commercially marketed and also done in some research and referral laboratories. 1996. 2001). M. in this study. Thailand (Mahaisavariya et al. The study was approved by Institutional Research Ethics Committee and a written consent was obtained from all patients who consented to provide 5 ml of blood specimen for multiplex PCR-based detection of mycobacteriosis. tuberculosis as mixed infection in HIV-positive patients have recently been published from all parts of the world including the Netherlands (Kox et al. Prophylaxis and management of disease caused by nontubercular mycobacteria differ greatly from that of M. Mycobacterium duvalii (NCTC-358) and Mycobacterium smegmatis mc2155) were obtained as a kind gift from Dr V. ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. these monoplex PCRs are bound to miss out the coinfections and infections with nontubercular mycobacteria. 2003). terrae (n = 4). but not to the desired level. intracellulare (TMC1406). Brazil (Ruiz et al. Even though M. Materials and methods This study was carried out in the Department of Laboratory Medicine. by using specific gene targets. 128 clinical isolates of mycobacteria and other bacteria were used to assess the specificity of the multiplex PCR. M. Therefore. Mycobacterium intracellulare (n = 4). to detect and differentiate M. National JALMA Institute for Leprosy and other Mycobacterial Diseases.Multiplex PCR assay for M. pleural fluid and urine. tuberculosis. In developing countries. avium and others. tuberculosis H37Rv (TMC-102). McConkey Agar. Rosas et al. a multiplex PCR method was developed. Agra. (n = 1) and Pseudomonas aeruginosa (n = 1). For DNA isolation from nonmycobacterial isolates. etc. The whole exercise of isolation and speciation sometime takes too long time and by that time most often the patient has almost completed his treatment. 2004. tuberculosis H37Rv (n = 62). Steinbrook 2007).. Optimization of the multiplex PCR assay Mycobacterial strains used A total of six mycobacterial reference strains. India. All mycobacterial strains were grown and maintained on L-J medium (Kent and Kubica 1985). India. bovis BCG (n = 1). avium (NCTC-8551). Gopinath and S. M. 1999). Singh avium complex. M. Therefore. tuberculosis and M. 2003) and India (Gopinath et al. avium concomitantly with M. USA) and DNA sequencing. avium complex and other Mycobacterial 426 species directly from clinical samples. Polymerase Chain Reaction (PCR)-mediated DNA amplification methods allow rapid and precise identification of mycobacteria from all samples including blood and paucibacillary clinical specimens irrespective of their HIV status. The sensitivity and specificity of the multiplex PCR were evaluated and compared with Ziehl Neelsen (ZN) microscopy. M. especially after HIV epidemic. tuberculosis complex. the time taken for detecting the bacilli has reduced and the sensitivity has also increased (Hanna et al. 1995). which give rise to development of drug resistance (CDC 2002). AccuprobeTM MTB complex detection test (Gen-Probe Inc. such patients will also have multiple infections with Mycobacterium tuberculosis.e. Staphylococcus aureus (n = 3). an early detection and identification of the infecting mycobacterial species are most desirable for early and specific therapy and better patient management (Montessori et al. Mycobacterium kansasii (n = 3). avium (n = 11). The major reason for this delayed and inaccurate diagnosis is reliance of laboratories on least sensitive detection method i. bovis (n = 2). details of which are published elsewhere (Singh et al. whereas other bacterial species were maintained on appropriate bacteriological solid media such as Muller–Hinton Agar. two loopful of bacteria was taken in a sterile 1Æ5 ml eppendorf tube. The six reference mycobacterial strains (M. San Diego. Five other bacterial species included as negative controls were: Escherichia coli (n = 19). Despite the limitation of detecting dead bacilli. 2007. Mycobacterium fortuitum (n = 4). Some tertiary care hospital laboratories in these countries carry out speciation but only after culturing the organisms by the conventional Lowenstein–Jensen (L-J) culture. smegmatis (n = 4). With the employment of automated culture detection system. Several reports of isolating M. These wellcharacterized isolates included M. Proteus mirabilis (n = 2). Journal of Applied Microbiology 107 (2009) 425–435 . CA. Katoch. 1989) and the isolated DNA was dissolved in 50 ll of TE buffer. M. Colombia (MurciaAranguren et al. 2008). 2007). M. New Delhi. 2001. Mycobacterium scrofulaceum (n = 5). have increasingly been reported in these severely immuno-compromised patients (Benson et al. 2008). Acinetobacter sp. avium complex K. All India Institute of Medical Sciences (AIIMS). which is a cumbersome and time-consuming procedure (Hanna et al.

avium complex before quantification. The inoculum used for spiking the clinical specimens was made with a loopful of the respective culture suspended in 1Æ0 ml of sterile distilled water equivalent to No. The DNA concentration was measured spectrophotometrically (Thermo Scientific. Reves et al. lymph node aspirate (LNA). 9 bronchioalveolar lavage from patients with intrathoracic malignancy and 8 urine samples from patients with bacterial urinary tract infections were included. 68 were HIV positive and 77 HIV negative. seven with E. stool. ascitic fluid. Reves et al. To detect mycobacteraemia using the multiplex PCR. 4 peritoneal fluid. For assessing the specificity of multiplex PCR assay on other unrelated specimens. fever with or without cough. Of the 145 patients. 39 specimens from patients having no past history of TB and having confirmed diagnosis of nonmycobacterial diseases were included.1 McFarland turbidity standard (Difco ⁄ BBLTM). a prospective study was conducted from April 2005 to March 2006. 2003) were also included. 3 ml). From 77 HIV-negative patients. the DNA of M. Of the 68 HIV infected patients. India) and from the rest of the sample. To determine the analytical sensitivity of multiplex PCR. tuberculosis H37Rv (TMC-102). Fourteen of these were spiked with M. a total of 235 clinical specimens (169 pulmonary and 66 extra pulmonary) were obtained and processed for various in vitro diagnostic methods including the multiplex PCR under evaluation. a total of 31 sputa that were mycobacteriologically negative by both culture and monoplex PCR were taken out from our archival collection stored at )70°C. 2008). USA). Mycobacteraemia has been reported more frequently in HIV infected patients from all parts of the world including India (Gopinath et al. weight loss or night sweats lasting longer than 2 weeks. eight with M. tuberculosis and M. mixture was neutralized with phosphate buffer (pH 6Æ8) up to a total volume of 50 ml followed by centrifugation at 8000 g for 10 min. In this.K. 0Æ5 ml of the spiked and neat specimen was aliquoted and DNA was extracted by Phenol–Chloroform method (Sambrook et al. 1989). Journal of Applied Microbiology 107 (2009) 425–435 . Singh Multiplex PCR assay for M. The ethanol precipitated DNA was further solubilized in 20 ll of TE buffer and 10 ll of the same was used for PCR reaction. Evaluation of the m-PCR assay using clinical specimens After standardizing the DNA isolation and PCR protocols. These included 12 LNAs ⁄ biopsies from patients of malignant lymphoma. Gopinath and S. 143 clinical specimens were obtained. the mixture was vortexed and incubated at 37°C for 10 min. All the patients were aware of their HIV status during the enrolment in the study. urine and ascitic fluid were first decontaminated with NALC-NaOH (modified Petroff’s method) as reported earlier (Kent and Kubica 1985).g. as a satellite study. From the decontaminated sample. 49 had suspected pulmonary tuberculosis (PTB). 10 sputa from patients with pyogenic respiratory tract infections. e. smears were made for the ZN staining from both the direct and decontaminated specimens. 427 ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. For detecting mycobacteraemia. 2 endometrial aspirate and 2 faecal samples). DE. urine or stool) was mixed with an equal volume of 0Æ5% NALC – 4% NaOH mixture in 50 ml ridge capped round bottom processing tube. smegmatis mc2155 were serially diluted in TE buffer from 1 lg to 1 fg per microlitre. In brief. The contaminated specimens such as sputum. From 68 HIV-positive patients. Culture and identification The sterile body fluids (CSF and LNA) were directly inoculated into the MGIT-960 culture bottles and part of the specimens was stored for the DNA isolation at )70°C. 92 clinical specimens were obtained (72 sputa from 49 HIVPTB patients and 20 specimens from 19 EPTB patients) and processed using the protocol described below. 7 pleural fluids. After brief vortexing. 4 CSF. Wilmington. 5 ml of intravenous blood was collected under aseptic conditions in sterile containers having 1 ml acid citrate dextrose. and 50 ll of this suspension was used for spiking the sputum specimen (c. avium (NCTC-8551) and M. The supernatant was decanted and the pellet was resuspended in 2 ml of the phosphate buffer. From 145 patients. 6 urine. defrosted to room temperature. 2003). while 19 had extrapulmonary tuberculosis (EPTB). Optimization of the PCR protocol For optimizing the multiplex PCR to detect mycobacteria directly from clinical specimens. sputum. After incubation. 1 ll of the diluted DNA was used as a template for PCR. were included in the study. 145 patients referred from various clinics of our own institute and other hospitals in and around Delhi for TB diagnosis were included. or suppurating or nonsuppurating cold single or mated lymph nodes (ATS 1999. M. and ⁄ or cavitary lesions in the lung fields on radiological examination. The clinical suspicion of tuberculosis was based on their clinico-radiological findings. avium. 0Æ5 ml of the suspension was inoculated into the BACTECTM MGIT tubes and 0Æ1 ml in L-J slants under sterile conditions in the biosafety cabinet type 2 (Kartos. tuberculosis H37 Rv. coli and the remaining two with Proteus mirabilis. 42 HIV-positive and 52 HIV-negative cases with a clinical suspicion of PTB (ATS 1999. stool and urine. viz. All patients were counselled prior to the test and who consented for providing clinical specimen. which included 97 pulmonary (95 sputum and 2 BAL) specimens and 46 extra pulmonary specimens (21 LNAs. about 5–6 ml of contaminated specimen (sputum.

USA). Proteins and macromolecules were precipitated using NaCl and hexadecyltrimethlyammonium bromide ⁄ NaCl solutions. these were further incubated for a maximum period of 60 days or till the growth appeared in the medium. 1% Triton X-100. USA). Journal of Applied Microbiology 107 (2009) 425–435 . avium complex) in a commercial sequencing facility. and 10 ll of the same was used in the PCR. niacin and aryl-sulfatase test (Kent and Kubica 1985) Other bacteria were also identified and speciated in accordance with standard reference manuals (Holt 1994. St Louis. M.and species-specific PCR primers In the multiplex PCR we used three primers sets. If negative in both Gram and ZN staining. The suspension was centrifuged at 6100 g for 10 min and the pellet was resuspended in 1 ml TE buffer (Sigma. Singh The inoculated MGIT-960 tubes were loaded in the BACTECTM MGIT-960 system. and MACF and MACR (M. The pellet was washed with ethanol. USA). Precautions to prevent cross contamination were also taken. as described in the beginning of this section. essentially. Cultures showing other bacteria on Gram’s staining were decontaminated as per the protocol mentioned above. DNA was isolated from BACTECTM MGIT-960 tubes (1 ml growth) or from the L-J medium (one loopful). avium was included as positive controls with sterile water as negative control in each run. avium complex K. The PCR results were ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. The results of culture. 1Æ5 mmol l)1 MgCl2. DNA isolated from cultured M. Significance was determined by the Chi-square test. esxB) and the upstream primer was named cfp10F (5¢GGCAGAGATGAAGACCGATG3¢) and downstream primer as cfp10R (5¢CCAAGAAGCAGCCAATAAGC3¢). reconstituted in 50 ll of TE buffer. 2000) and a novel M. tuberculosis). Sigma). 100 mmol l)1 Tris–HCl (pH 9Æ0). To this suspension. hence. MO.Multiplex PCR assay for M. dTTP and dCTP). The latter targets the cfp10 (Rv3875. . Purified PCR products were sequenced directly with the primers Tb11 and Tb12 (Mycobacterium sp. cell wall was lysed with lysozyme. 5–10 ml blood from suspected patients was collected aseptically as described above and peripheral blood mononuclear cells (PBMCs) were separated using Ficoll Hypaque (density 1Æ007 grams ⁄ ml. 1993). Each PCR was started with a ‘hot start’ for 10 min at 94°C followed by 30 cycles each of 1 min at 94°C. The Mycobacterium species isolated from the clinical specimens were identified phenotypically and by biochemical tests including heat stable catalase. followed by proteinase K digestion and sodium dodecyl sulfate treatment of proteins. We have been using the same protocol in our laboratory for the past several years. tuberculosis H37Rv and M. In brief. and a final extension for 10 min at 72°C in a thermal cycler (MJ Research. and the growth was continuously monitored up to 42 days in the fluorescence units and tubes flash positive after reaching a cut-off growth. Flashed positive cultures with no demonstrable AFB were checked with Gram’s staining for other bacteria. Speciation of the isolates by PCR For speciation of mycobacteria by multiplex PCR. 1998) in practice in our laboratory. Mycobacterium genus specific. AFB smear and PCR were compared with the final diagnosis of TB using individual patients as the unit of analysis and separately using individual specimens as the unit of analysis. was directly used for PCR (Kocagoz et al. The DNA was precipitated overnight with isopropanol at )20°C. As this method does not warrant any further purification of the DNA and. 0Æ2 mmol l)1 each deoxynucleoside triphosphate (dATP. dGTP. 428 For extracting the DNA from whole blood. Nucleic acids were recovered from the aqueous phase after extraction with chloroform and isoamyl alcohol. DNA isolation directly from the Clinical specimens Extraction of DNA from the clinical specimens and PBMCs was performed as described previously (Ausubel et al. nitrate. Switzerland). 1 min at 60°C and 1 min at 72°C. Collier et al. including the Mycobacterium genus specific primers (hsp 65) (Telenti et al. Gopinath and S. avium complex specific were visualized by staining with ethidium bromide (Fig. tuberculosis complex specific and 144 bp for M. Amplified products were resolved through 2% agarose gel in Tris-acetate buffer. The aliquots were kept in a water bath at 80°C for 20 min to heat kill the mycobacteria. These PBMCs were subjected for DNA extraction method for PCR. 1998). All oligonucleotides used in the study were synthesized by Microsynth Inc. 20 pmol of each primer and 1 U of Taq DNA polymerase (Promega. avium complex specific (MAC) primers (Park et al. 0Æ5% Sodium Dodecyl Sulfate and 1Æ2% Triton X-100 were added followed by boiling for 1 h. tuberculosis (MTB) complex-specific set of primers for the first time. tuberculosis and M. Genus. 1993). The sequences were aligned using the multiple alignment algorithms in the ClustalW and Blast tool to determine the species using the reference sequences available in GenBank. Positive signalled BACTECTM MGIT-960 tubes and colonies on L-J medium were confirmed for the presence of mycobacteria by microscopical examination of the smears prepared from these cultures. The L-J slants were incubated at 37°C for 6 weeks (Kent and Kubica 1985) and checked every week for the growth. cfp10F and cfp10R (M. 1).). The DNA samples from clinical samples and culture bottles were subjected to multiplex PCR and the constituents of mixtures were as follows: 500 mmol l)1 KCl. (Balgach. 191 bp for the M.

The multiplex PCR developed was further optimized with the clinical specimens spiked with mycobacterial and other bacterial species. 4. 10 pg. 1 pg. The 429 ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. (M – 100 bp marker (MBI.. 10 pg. (3–4 mycobacteria) of DNA (Fig. avium complex and other Mycobacterium species was standardized with the DNA isolated from the mycobacterial and other bacterial strains. 2. 1 ng. 100 pg. avium complex specific (144 bp) (Fig. avium complex-specific (MAC) 144 bp. 77 (53Æ1%) were HIV negative and 68 (46Æ85%) were HIV positive. These preliminary results prompted and gave us a confidence to evaluate the application of multiplex PCR system in clinical specimens along with the other tests such as microscopy. tuberculosis. 1 pg. Mycobacterium tuberculosis. Of these. 1. 53 (77Æ94%) were men and 15 (22Æ05%) were women. 2. Fermentas). avium spiked sputum specimens were precisely identified. tuberculosis (c) amplified from 1. it was found to be able to detect as low as 10 fg Figure 2 Analytical sensitivity of multiplex PCR for detecting Mycobacterium sp. 1 pg. L-J and BACTECTM MGIT-960 culture. 100 fg. Mycobacterium genus specific (441 bp). 3. Sensitivity was calculated as: (Tp ⁄ Tp) + (Fn) X-100. 6.5 – M.6 – M. and specificity was calculated as: (Tn ⁄ Tn) + (Fp) X-100. 100 pg. 5. M. 4. Singh Multiplex PCR assay for M. 6. All the 14 M. 1 fg DNA of M. true negatives (Tn). M. tuberculosis and eight M. 7. 10 fg. 5. The common clinical manifestations in these patients were weight loss (87Æ12%). 10 pg. avium and other mycobacterial species. While evaluating analytical sensitivity of PCR. 10 ng. Figure shows the analytical sensitivity of multiplex PCR from the DNA isolated from M. avium complex M 1 2 3 4 5 6 7 (a) M 1 2 3 4 5 6 7 441 bp (b) M 191 bp 144 bp 1 2 3 4 5 6 7 Figure 1 Multiplex PCR amplification of genus-specific 441 bp (hsp 65). Patients and specimens A total of 145 patients. 100 pg. In addition. 6. 1 fg DNA of Mycobacterium smegmatis (b) amplified from 1. the nine clinical specimens spiked with other nonmycobacterial species and the specimens used as neat did not show any nonspecific amplification (details not shown here). avium complex. The assembled sequences were compared with the reference sequences by Blastn analysis. 10 ng of DNA of M. fever (78Æ2%). 10 ng. Journal of Applied Microbiology 107 (2009) 425–435 . 4. 10 fg. 3. (a) amplified from 1.K. Amplified products were visible only with a DNA concentration exceeding 10 fg (4–5 bacilli). 2. The multiplex PCR precisely amplified the corresponding targets viz. no nonspecific amplification was seen among the other 26 DNA samples from nonmycobacterial isolates used in this study (details not shown here). 7 ) Negative control). tuberculosis. A total of eight amplified products were randomly selected and sequenced. Mycobacterium avium complexes. avium complex. 2). 122 (84Æ13%) men and 23 (15Æ86%) women with an age range of 13–58 (31 ± 6Æ71) years.4 – M. 100 fg. Results Optimization of the multiplex PCR assay The multiplex PCR for the detection and differentiation between the members of M. 1). tuberculosis + M. The DNA concentration was measured spectrophotometrically at 260 nm. (c) M 1 2 3 4 5 6 7 classified as true positives (Tp). tuberculosis complex specific (191 bp) and M. were included in this study. M. 2. Of the 68 HIV positive patients [aged between 28 and 46 (mean 30 ± 4Æ3) years] included in the study. 100 fg. tuberculosis and M. 5. MTB-specific 191 bp (cfp 10). M. false positives (Fp) and false negatives (Fn). 7. tuberculosis complex. 3. Gopinath and S. Furthermore. which showed 98–100% homology with their target sequences indicating high specificity of our PCR. cough with or without expectoration (71Æ4%) and raised ESR (68Æ6%). avium. 3.

avium and one each was M. avium complex was detected (Tables 2 and 3). pattern of clinical manifestations was similar in the 77 HIV-negative patients. As mentioned in the materials and methods section. scrofulaceum and M. tuberculosis and M. 21 had tuberculous lymphadenitis. The detection rate of the m-PCR was not significantly different in Table 2 Detection of mycobacterial infections by multiplex PCR from both pulmonary and extrapulmonary specimens of HIV-negative patients Culture positive* Sputum (n = 97) Mycobacterium tuberculosis Mycobacterium avium MTB + M. From 72 pulmonary samples. Total 48 (49Æ48) 2 (2Æ06) – 2 (2Æ06) 52 (53Æ6) Extrapulmonary (n = 46) 15 (32Æ6) – – 1 (2Æ17) 16 (34Æ78) Total (n = 143)à 63 (44Æ05) 2 (1Æ3) – 3 (2Æ09) 68 (47Æ55) Multiplex PCR positive Sputum (n = 97) 61 (62Æ88) 3 (3Æ09) – 4 (4Æ12) 68 (70Æ1) Extrapulmonary (n = 46) 26 (56Æ52) – 1 (2Æ17)  2 (4Æ34) 29 (63Æ04) Total (n = 143) 87 3 1 6 (60Æ83) (2Æ1) (0Æ69) (4Æ19) 97 (67Æ83) Values given in parenthesis are percentages. and seven had tuberculous lymphadenitis. In one patient. two were M. 16 had PTB. 72 and EPTB 20). mixed infection of M. whereas the isolation rate from extrapulmonary specimens was found to be higher among the HIV-positive cases as compared with HIV-negative cases (50% vs 34Æ78%. Singh Table 1 Detection of mycobacterial infections by multiplex PCR from both pulmonary and extrapulmonary specimens of HIV-positive patients Culture positive* Sputum (n = 72) Mycobacterium tuberculosis Mycobacterium avium MTB + M. abdominal TB. 92 samples were obtained (PTB. 34 had PTB. tuberculosis. 5 (9Æ61%) M. negative by culture. Culture positivity rate by L-J and BACTEC MGITTM 960 The culture isolation rate of Mycobacteria from pulmonary specimen was 58Æ33% from the HIV-positive (Table 1) and 53Æ6% HIV-negative patients (Table 2). P = 0Æ01) (Tables 1 and 2). while 12 of the 20 (60%) EPTB specimens were found positive for M. avium in one of the specimen. tuberculosis + M. 34 (36Æ95%) were positive for mycobacteria in L-J and 48 (52Æ17%) in MGIT-960 culture. §18 (19Æ56%) were positive by ZN smear examination. Positivity rate of multiplex PCR The positivity rate of the in-house multiplex PCR was found to be the highest of all the diagnostic tests used in this study (P = 0Æ01).  PCR from one of the specimen is positive for both M. i. From 77 HIV-negative patients. Total 34 4 2 2 (47Æ22) (5Æ55)  (2Æ77) (2Æ77) Extrapulmonary (n = 20) 8 (40) 1 (5) – 1 (5) 10 (50) Total (n = 92) 42 5 2 3 (45Æ65) (5Æ43) (2Æ17) (3Æ26) Multiplex PCR positive Sputum (n = 72) 48 3 3 4 (66Æ66) (4Æ16) (4Æ16)à (5Æ55) Extrapulmonary (n = 20) 12 (60) 1 (5) – 1 (5) 14 (70) Total (n = 92) 60 4 3 5 (65Æ21) (4Æ34) (3Æ26) (5Æ43) 42 (58Æ33) 52 (56Æ52)§ 58 (80Æ55) 72 (78Æ26) Values given in parenthesis are percentages. tuberculosis.  Endometrial aspirate sample from 23-year-old female with a history of infertility. xenopi (Table 2). avium. and genitourinary TB. avium Mycobacterium spp. M. we had 68 isolates of which 63 (92Æ6%) were M. *Data include combined result of L-J and MGIT-960 culture. avium complex K. 47 (32Æ8%) were positive for mycobacteria in L-J and 60 (41Æ9%) in MGIT-960 culture. and 1 (1Æ53%) M. tuberculosis and M. 11 tuberculous meningitis. fever (88Æ88%). From 68 HIV-positive patients. Gopinath and S.Multiplex PCR assay for M. 52 isolates were obtained of which 42 (80Æ7%) were M. chelonae. àTwenty-nine (20Æ3%) were positive by ZN smear examination. Journal of Applied Microbiology 107 (2009) 425–435 430 . seven genitourinary and four had abdominal TB. 48 (66Æ7%) were detected with M. Of 77 HIV-negative patients. tuberculosis. Hence the overall positivity rate of the in-house m-PCR in samples from HIV-positive patients was 78Æ2% (72 ⁄ 92). ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. from 68 HIV positive patients. Of the 68 clinically suspected patients of HIV-TB co-infection. cough with or without expectoration (81Æ6%) and raised ESR (61Æ5%).e. 2 (3Æ84%) M. avium complex. 31 had disseminated TB. terrae. terrae. The details of these findings are given in Table 1. àBoth BACTEC and L-J Culture yielded M. avium Mycobacterium spp. *Data include combined result of L-J and MGIT-960 culture. tuberculosis.

tuberculosis and M. amplification of human gamma globulin gene (578 bp) in every run as an internal control indicated that our PCR method was accurate. samples obtained from HIV-negative patients. àSpecimens were negative by smear microscopy. 5 3 0 0 0 3 2 6 3 0 0 3 3 (5Æ4) (5Æ8) Total 72 51 41 5 2 3 21 97 66 61 2 3 31 (78Æ3) (98Æ07) (97Æ6) (100) (100) (100) (52Æ5) (67Æ8) (97Æ05) (96Æ8) (100) (100) (41Æ3) (47Æ5) (60Æ9) (89Æ7) (96Æ8)* (2Æ1) (2Æ9) (100) (1Æ3) (0Æ7) (100) (5) (4Æ2) (4Æ4) (34Æ7) (1Æ3) (100) (4) Values given in parenthesis are percentages. *lymph node aspirate and CSF specimen from two HIV-negative cases were negative by PCR. Even this difference was statistically insignificant. Gopinath and S. for PTB and EPTB samples and overall positivity rate was 67Æ83% (103 ⁄ 143) (Table 2). Journal of Applied Microbiology 107 (2009) 425–435 431 . The two false-positive results remained positive even after repeating the PCR. ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. Detection of Mycobacteraemia by multiplex PCR Detection of circulating Mycobacterial DNA in the blood stream was significant finding of the study. While evaluating the specificity of multiplex PCR. Pseudomonas sp. (3) Bacteriologically negative specimens (40) HIV Negative (143) Bacteriologically confirmed specimens (68) MTB (63) MAC (2) Mycobacterium spp. respectively.  culture positive lymph node aspirate specimen from a HIV-positive case was negative by PCR. suggesting a possible overlapping co-morbidity. These rates were 62Æ88% and 56Æ52%. However. Sensitivity and specificity of the multiplex PCR The sensitivity of the multiplex PCR in mycobacteriologically confirmed. it was found to be 94Æ87% and false-positive reaction was seen only in two samples (BAL and Urine sample one each) (Table 4). avium complex ´-vis other tests on pulmonary and extrapulmonary specimens of suspected HIV–tuberculosis patients Table 3 Sensitivity of the multiplex PCR vis-a Multiplex PCR (+) MTB HIV Positive (92) Bacteriologically confirmed specimens (52) MTB (42) MAC (5) MTB+MAC (2) Mycobacterium spp. LNA from one HIV positive and one negative patient and one CSF from a HIV-negative patient remained negative even after repeating the PCR and DNA isolation. Singh Multiplex PCR assay for M. (3) Bacteriologically negative specimens (75) 60 41 41 0 0 0 19 87 61 61 0 0 26 (65Æ2) (78Æ8) (97Æ6) MAC 4 4 0 4 0 0 0 3 2 0 2 0 1 (4Æ3) (7Æ7) (80) MTB + MAC 3 3 0 1 2 0 0 1 0 0 0 0 1 (3Æ3) (5Æ8) (20) (100) Mycobacterium spp. Multiplex PCR was positive in blood specimens from 13 (30Æ95%) of the 42 HIV-positive PTB patients included for mycobacterial Table 4 Specificity of multiplex PCR on clinical specimens collected from the nontubercular disease controls PCR results Nature of specimens Lymph node Aspirate ⁄ biopsies (n = 12) Sputa (n = 10) Bronchio Alveolar Lavage (n = 9) Urine (n = 8) Total (n = 39)à Disease Malignant lymphoma (N = 12) Chronic bacterial lung infection (N = 10) Intrathoracic malignancy (N = 3) Other infectious aetiology (N = 6)* Other urinary tract infections (N = 8)  Positive – – – 1 1 2 Negative 12 10 3 5 7 37 Specificity (in %) 100 100 100 83Æ3 87Æ5 94Æ87 *Patients with pulmonary infiltrates from different origin such as sarcodiosis ⁄ COPD ⁄ pneumonia.  Urinary tract infection caused by bacteria such as Escherichia coli.K. HIV-positive cases and HIV-negative cases was 97Æ1% (51 ⁄ 52) and 97Æ05% (66 ⁄ 68) respectively (Table 3). L-J and MGIT-960 culture methods.

annealing temperature and optimum concentration of the primers used. Park et al. avium complex K. It is possible that due to similar culture characteristics of M. tuberculosis and M. the seed culture was subcultured and we successfully differentiated mixed growth of M. *Sputa collected from the cases were processed for smear L-J. All except two samples had M. Tanaka et al. The sputum sample from this patient showed luxurious growth of M. tuberculosis in the primary culture. tuberculosis and M. 2003. To consider as bacteriologically confirmed cases. avium complex (Mustafa et al. Mustafa et al. pleural fluid. 432 whereas the present assay had sensitivity between 96Æ0% and 100% depending on the nature of the clinical specimens (Table 3). Singh Table 5 Detection rate of mycobacteraemia by multiplex PCR from both HIV positive and negative suspected pulmonary TB cases Detection of mycobacteraemia by multiplex PCR (n = 42) Patient selection criteria HIV-Positive cases (42) Bacteriologically confirmed PTB cases* (18) MTB (13) MAC (3) MTB + MAC (1) MOTT (1) Bacteriologically negative PTB cases* (24) PCR Positive (15) PCR Negative (9) Total MTB MAC MTB + MAC Total 9 8 – 1 – 4 3 1 (50) (61Æ53) (16Æ16) (20) (11Æ1) 1 (5Æ5) – 1 (33Æ3) – – – – – 1 (2Æ38) 1 – 1 – – 1 1 – (5Æ5) (33Æ3) (4Æ16) (6Æ66) 11 (61Æ1) 8 (61Æ53) 2 (66Æ6) 1 – 5 (20Æ83) 4 (26Æ6) 1(11Æ1) 16 (38Æ09) 13 (30Æ95) 2 (4Æ76) Multiplex PCR positive from blood specimens (n = 52) Patient selection criteria HIV-negative cases (52) Bacteriologically confirmed PTB cases* (28) Bacteriologically negative PTB cases* (24) PCR Positive (11) PCR Negative (13) Total MTB MAC MTB + MAC Total 7 (25) 1 (4Æ16) 1 (9Æ09) – 8 (15Æ38) – – – – – – – – – – 7 (25) 1 (4Æ16) 1 (9Æ09) – 8 (15Æ38) Values given in parenthesis are percentages. at least one specimen from the patient must have been positive in smear and ⁄ or L-J or MGIT-960 culture. M. Even Park et al. tuberculosis and M. avium complexes from other mycobacterial species. (1999) developed an m-PCR for the differentiation of MTB complex from other mycobacterial species with a sensitivity of 88%. but in the other case. avium on the L-J medium slant. after having the PCR results. avium complex specific targets and were found to be HIV positive (Table 5). Interestingly. tuberculosis complex from M. bovis (Shah et al. Pinsky and Banaei 2008) and M. ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. tuberculosis and M. 1999. avium. avium + M. ours was unique in that we could successfully differentiate M. MGIT-960 culture and PCR. The two patients had double amplification of M. However. Discussion Multiplex PCR assays are technically more demanding as compared with conventional monoplex PCR protocols. Our Multiplex PCR was also highly useful in detecting the mixed infections of M. L-J culture showed mixed growth of M. 2002. avium complexes with a sensitivity of 96Æ4% and they used only respiratory samples. 2001). Journal of Applied Microbiology 107 (2009) 425–435 . avium.Multiplex PCR assay for M. blood and urine (Table 3). LNA. 2006). Though different multiplex PCR assays have been reported for the differentiation of M. (2006) had reported m-PCR to differentiate M. the latter is missed out. DNA detection. we could have missed the M. tuberculosis complex from M. intracellularae complex (Ruiz et al. tuberculosis in two HIV-positive cases. avium if the m-PCR had not been applied to the specimen. Our system not only worked well with all types of clinical samples but also equally useful in both-HIV positive (sensitivity of 98Æ07%) and HIV-negative (97Æ05%) cases. tuberculosis from M. tuberculosis and M. It is interesting that in one case. These technical concerns are competition and ⁄ or homology between the primers chosen. tuberculosis amplification only. Gopinath and S. tuberculosis and M. while our system had high sensitivity not only in the respiratory samples but also in various other clinical specimens including sputum. if not looked for carefully (Runyon 1974). avium from M. eight (15Æ38%) of the 52 HIV-negative cases were also found to have circulating mycobacterial DNA in their blood specimens. CSF.

M. the present study shows that the protocol for DNA extraction and PCR used in our laboratory was highly satisfactory and nonspecific inhibition was seen only in 1 out of 120 (0Æ83%) mycobacteriologically confirmed specimens (Table 3). 2001. Rodrigues Vde et al. which misses NTM disease and often the nonresponders are labelled as Multi-drug resistant tuberculosis cases (Gopinath et al. Recent reports indicate that not only mixed infections in immunocompromised patients are becoming common but also rarely two organs of the same patient can be colonized with two different mycobacterial species (Murcia-Aranguren et al. Using multiplex PCR system. 2002 and Crump et al. 2007). This assay was used to identify M. tuberculosis grew in MGIT-960.K. however. avium complex Mycobacterium avium is an emerging pathogen in AIDS patients and needs better attention of both clinical microbiologists and treating physicians. 2000). tuberculosis complex except M. The realtime PCR has an edge over the conventional PCR because the PCR products can be visualized on the screen simultaneously to the amplification process using end-stage hybridization or fluorescence probes and does not require gel-based detection. Gopinath and S. tuberculosis. In our settings. In some cases. 2008). 2008). Hence. a major advance in molecular diagnostic has been real-time PCR. a rapid and cost-effective two-step. The LNA has earlier also been reported to have PCR inhibition (Singh et al. we could detect mycobacterial DNA in 5 (20Æ83%) of 24 HIV negative cases using blood m-PCR (Table 5). Acknowledgements We wish to thank Dr V. avium from the skin of an AIDS patient. multiplex real-time PCR assay based on genomic deletions in the Mycobacterium has been reported by Pinsky and Banaei (2008). 2007. 17Æ6% of the PTB (Sankar et al. tuberculosis and M. the multiplex PCR was successfully applied to diagnose and differentiate mycobacterial infections. (2004) from New York reported isolation of M. Therefore. However. conventional PCRs have been adopted in most of the laboratories unlike real-time PCRs which are more difficult to standardize and are expensive. Mycobacterium marinum and Mycobacterium ulcerans does not compromise the specificity because of their rare association with human disease and environmental niche at least in India. In the present study. 2001. On culturing this LNA specimen. Singh 2008). Singh et al. 2003). Singh Multiplex PCR assay for M. and other members of the complex from both culture and directly from clinical specimens. Katoch of Central JALMA Institute for leprosy and other Mycobacterial Diseases. The protocol did not require costly resins or any columns. (1997) from Spain reported M. avium from sputum samples of an immunocompetent patient. Recently. 1993. 2005. However. the primers (cfp10) selected from the RD-1 region of M. bovis. Financial support from Indian Council of Medical Research and Department of Biotechnology. specimen examination is limited to direct sputum smear microscopy. tuberculosis and M. tuberculosis were specific to M. This has been a contentious issue if all DOTS programmes should continue with only smear microscopy. PCR-positive results without bacteriological confirmation of the specimen are often doubted as false positive. However. we propose that the multiplex PCR developed in our laboratory can detect and differentiate the causative mycobacterial species within 24–36 h and this development can also be utilized in the national TB-control programmes. this may be the only evidence of infection. at least as an adjunct if not a primary choice of sample. The biggest impact of nucleic acid amplification technology is expected on TB-control programmes. With the implementation of DOTS strategy. Agra for providing us with the standard strains of mycobacteria. which may not be affordable in developing countries. More interestingly. 2001. ours is the first multiplex PCR used for detecting mycobacteraemia in blood specimens from both HIV-positive and HIV-negative patients (Table 5). tuberculosis and M. because the detection rate of mycobacteraemia in HIVnegative patients using culture methods is reported to be extremely low (von Gottberg et al. In recent years. the existence of similar homologous genes in M. Nevertheless. but these apprehensions are not often true (Katoch 2004). if PCR is adopted for TB-control programmes. which cannot rule out the NTM lung disease (Jeon et al. we observed that 38Æ09% of the blood specimens were positive for mycobacteriosis. M. The real-time technology is not only more rapid and but also quantifies the pathogen in the given specimen. kansassi. Even though some authors have used blood specimens for diagnosing tuberculosis in HIV infected patients (Iralu et al. M. monoplex PCR assays have been used in all these studies. For PCR assays. Journal of Applied Microbiology 107 (2009) 425–435 . 2008) and 12Æ4% of EPTB patients were found to have nontubercular diseases. In this study. To the best of our knowledge and in the literature search published in English. one might require costly reagents such as resins or columns to remove possible inhibitors. bovis BCG. DNA extraction is crucial and for optimal DNA quantity. the rate of inhibition using the protocol used in this study was practically negligible as only one out of 21 (4Æ7%) samples had PCR inhibition. 433 ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. the utility of blood samples in the diagnosis of tuberculosis is highly promising. bovis BCG. Waddell et al. M. Gopinath et al. in the present study. and Damian et al. Gopinath et al. Nunez et al. care should be taken while interpreting the PCR results if considered as sole evidence.

avium-intracellulare cutaneous infection in an HIV patient. P. O. Sachedeva. Manonukul. 9th edn.D. Kocagoz. Balows. Int J Tuberc Lung Dis 9. 985S–986S. This official statement of the American Thoracic Society and the Centers for Disease Control and Prevention was adopted by the ATS Board of Directors. J Med Assoc Thai 86.Y. Baltimore: Williams and Wilkins. T. M. S. S. (1999) Detection of Mycobacterium tuberculosis complex and non-tuberculous mycobacteria by multiplex polymerase chain reactions. Int J Tuberc Lung Dis 5. Public Health Laboratory. 9th edn. A.S. (Senior Research Fellowship) is acknowledged. J...B. Murcia-Aranguren. 1046–1051. C. S.M.. New York: John Wiley and Sons. Singh Govt. 52–60.S.M. H. Y.P. (2004) Diagnostic relevance of detection of mycobacteremia. J. A guide for the level III laboratory.. Pieciak. tuberculosis and M. and Nachman. M. and K. J. (2004) A case of Mycobacterium tuberculosis (MTB) and Mycobacterium avium-complex (MAC) co-infection in an immunocompetent host: a pathogen and a colonizer or two pathogens in the same host? Chest 126. GA: U. A. and Sussman. (1994) Bergey’s Manual of Determinative Bacterio -logy. A. N. 1376–1395.. (2004) Treating opportunistic infections among HIV-exposed and infected children: recommendations from CDC. 3225–3233.. V. A.T. (1998) Preparation of Genomic DNA from Bacteria. A. K. C. W.D.. Infectious Diseases Society of America. V. (2007) Controlling multidrug-resistant tuberculosis in India..S.B. Phillips. 21. L.. BacT ⁄ ALERT MB. M. L. and ISOLATOR 10 systems for detection of mycobacteremia.. This statement was endorsed by the Council of the Infectious Disease Society of America. Damian. 401–404. M. J Dermatol 24.C. L. avium complex K. M. Knijper. Kaplan. P. 61–70... J. Hayran.. Bustillo. J. Gopinath.. K. Clin Infect Dis 22.G. A. Craib. M. E. C.S. A..N.A. (1998). W. Moore. MYCO ⁄ F LYTIC. Chung..K.. Chaiprasert. Koh.F.Y. H.G. Mahaisavariya.... Kingston. F.. and the Infectious Diseases Society of America. J Clin Microbiol 41. Tanner. Kent. and Reller.I. (1995) PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples. ed. MMWR Recomm Rep 53. Topley and Wilson’s Microbiology’ and Microbial Infections.. and Barker. B.. S. D’Costa. East Mediterr Health J 5. Ozkara.. Kim. Miralles. Jr (1993) Diagnosis of Mycobacterium avium bacteremia by polymerase chain reaction. H.A. Wirth. and Struhl. 1987–1990. Masur.. Manisankar.. Elliott. Indian J Med Res 119. (1993) Detection of Mycobacterium tuberculosis in sputum samples by polymerase chain reaction using a simplified procedure. S. E. and Black. J Clin Microbiol 37. Yilmaz. Ebrahimzadeh.F. R. J Clin Microbiol 31. V.H. and Pinitugsorn.. E. and Kubica. D. Ubol. B. S. Colombia. Atlanta.J. W. J. Bessuille. D..E.E. K.. J.G. P. Park. Gengviniij. S. J. Katoch. Kocagoz. 741–742. Seidman.A. pp...H.. Jeon.H.. the National Institutes of Health. Smith. References ATS. L. Current Protocols in Molecular Biology. Iralu.. Kumar.. of India to S. G. Harto.. S. et al. (2001) Utility of blood cultures and incidence of mycobacteremia in patients with suspected tuberculosis in a South African Infectious disease hospital.E.A. K. J. Novak.. H. tuberculosis and M.S. Acio. S. (2002) Disseminated infection with simiae-avium group mycobacteria in persons with AIDS – Thailand and Malawi.I. P. Morgan. Hilara.. Benson.. S. Abal. (1999) Diagnostic Standards and Classification of Tuberculosis in Adults and Children.V. (2008) Prevalence of mycobacteremia in Indian HIV-infected patients detected by the MB ⁄ BacT automated culture system.J. CDC and National Institutes of Health. 80–86. Leon.K.F. Lee. Montaner. Mannheimer.. E. M.M. S. Vinette. (2005) Recovery rate of NTM from AFB smear-positive sputum specimens at a medical centre in South Korea. BMC Infect Dis 1. (1985). ed.. C. et al.F. 1–112.. Brent. Rusch-Gerdes... Machala. 1435–1438. J. (1996) Species distribution in human immunodeficiency virus-related mycobacterial infections: implications for selection of initial treatment. 989–992. Gomez-Marin. N. Gopinath. Kumar. J. and Blumberg. M.. Schicchi. T. Eur J Clin Microbiol Infect Dis 27.. xi–xii. A..A..K..A. Centers for Disease Control and Prevention (CDC)... London: Arnold. 1129–1215. Gomez.. Department of Health and Human Services publication no (CDC) 86-8230. Iqbal. Pau... and Ledo. (1999) Multicenter evaluation of the BACTEC MGIT-960 system for recovery of mycobacteria. Dunbar. (2003) Controlled comparison of BACTEC 13A.. Gopinath and S. Collier. V. Maguire. (2003) Nontuberculous mycobacterial skin infections: clinical and bacteriological studies. S. and Chambers. Sritharan. Crump. F. S. 1997. (2001) Frequency of tuberculous and non-tuberculous mycobacteria in HIV infected patients from Bogota. (1997) Concurrent cytomegalovirus. J Clin Microbiol 31. and Kolk..T... von Gottberg. R. 423–431. K. van Leeuwen. et al.. Suh. Pintado. 501–502. Khemngern. J Clin Microbiol 33. L. J.... D. The work was conducted as a part of PhD programme of K.S. and Singh. Mustafa. and Chugh. July 1999..Multiplex PCR assay for M.M. Triana.G.G. Ausubel.B. Mirrett. Kox. Y.. Hanna. J. J. MMWR Morb Mortal Wkly Rep 51. L. 434 ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. Alvarado. Sacks.F. de Mendivelson. R. Am J Respir Crit Care Med 161. Kwon. S. Centres for Disease Control and Prevention.. Haley. Jansen. Nunez.. J...P. G. Holmes.. A. Holt.M. Montessori.. 811–814. 748–752. McKnight. Lancet 369. and Singh.. K. D. W.S. Journal of Applied Microbiology 107 (2009) 425–435 . S. A. M.. L. M. E..

A. Salomao. C. (2000) Comparison of in house polymerase chain reaction with conventional techniques for the detection of Mycobacterium tuberculosis DNA in granulomatous lymphadenopathy. (2002) A multiplex-PCR for the differentiation of Mycobacterium bovis and Mycobacterium tuberculosis... Muralidhar. Shahdad. Anno. FEMS Microbiol Lett 214. J Clin Microbiol 40. S. Simone. Financing. 55–60. Kreiswirth. NY: Cold Spring Harbor Laboratory Press. Escribano. Ann Intern Med 124. Journal of Applied Microbiology 107 (2009) 425–435 435 . I.. Waddell.. Ruiz. D.S. and Royo. Kapila. Leite. Rossetti.K. 342–344.. E. (2002) Detection of Mycobacterium avium in blood samples of patients with AIDS by using PCR. S. F.positive children and adults in Zambia. (2007) Tuberculosis and HIV in India. R..C. N. M. Talbot.. H... 175–178. Singh Multiplex PCR assay for M.L.. Reichman.. Jpn J Infect Dis 60. Pinsky. (2003) American Thoracic Society ⁄ Centers for Disease Control and Prevention ⁄ Infectious Diseases Society of America: treatment of tuberculosis.F. S. R. Chintu. 209–211. M... E. M. and Singh. 15. F. R. I. Queiroz Mello.. T. H.V. J.... R. 39–43. (2001) Bacteremia due to Mycobacterium tuberculosis or M. F. Fritsch. S. Singh. Tubercle 55.R. K. J. Planning. M. 4080–4085. K.C. R. R. (2003) Bloodstream infections in late-stage acquired immunodeficiency syndrome patients evaluated by a lysis centrifugation system. and Singh.. avium complex Park.393).B... Singh.K. A. Kim. Kim.. Lishimpi. Sankar.. J.H. Gopinath and S. Jang. J Clin Microbiol 31. Steinbrook.L. (1974) Ten mycobacterial pathogens. T. 235–240. et al. Shah. (1993) Rapid identification of mycobacteria to the species level by polymerase chain reaction and enzyme analysis. Telenti. C. C. I. Chang.S. Fonseca. S... Bally... and Chang.. W. C... Verma. 529–532. Karagas. S. D. E. (2001) Application of molecular biology techniques to the diagnosis of nontuberculous mycobacterial infections. (2008) Global Tuberculosis Control: Surveillance.L.K. von Reyn.L. Kumar.. 2297–2299. (2006) Development and evaluation of triplex PCR for direct detection of mycobacteria in respiratory specimens. Sharma. and Bodmer. Sambrook. 1198–1199. Pignatari. Rosas. Bottger.L. bovis. and Zaha. R.. Powderly. A. S. C. 857–864. E. Garcia-Martinez. Bakshi.. 2008. C. H. B. Park. (2008) Scaling up anti-mycobacterial drug susceptibility testing services in India: it is high time. R. B. A.K. and Song.C.. G. J Clin Microbiol 38. Park. (WHO ⁄ HTM ⁄ TB ⁄ 2008..S. Jain. da Matta..I.. Rodrigues Vde.A. and Banaei. World Health Organization (WHO) report. Singh. K. Rodriguez-Valera.. J Clin Microbiol 46. 2241–2246.. and Leite. Indian J Med Microbiol 26. M. A.. 603–662.. F. R. B. J Appl Microbiol 100. et al.G. J.K. M. A. (2008) In-vitro antimycobacterial drug susceptibility testing of non-tubercular mycobacteria by tetrazolium microplate assay. A. Chattopadhyaya. and Vernon. M.C. Marchesi. Am J Respir Crit Care Med 167. Gopinath. Cooksey. F. N.R.C. L. K.. (2000) Detection and identification of mycobacteria by amplification of the internal transcribed spacer regions with genus and species-specific PCR primers.. K.K.... P. C. H. N Engl J Med 356. (2003) Comparison of a multiplex-PCR assay with mycolic acids analysis and conventional methods for the identification of mycobacteria. M.M. Singh...D. Runyon. and Colombo.A. Park. K. Ribeiro. Ann Clin Microbiol Antimicrob 7. 307–312. and Sharma. (1989) Molecular Cloning: A Laboratory Manual.H. C. Balz. ª 2009 The Authors Journal compilation ª 2009 The Society for Applied Microbiology. A. tuberculosis and M.F. Tanaka. Chung.. Kaur. Lopes. B. Bacille Calmette-Guerin (BCG) among HIV. (2007) Nontuberculous mycobacterial infections in Indian AIDS patients detected by a novel set of ESAT-6 polymerase chain reaction primers. Rodriguez. T.K.C. Starke.R. Gopinath. Microbiol Immunol 47.. L. Reves. Kritski. 14–18..M. M. Geneva: World Health Organization. 355–361. K.. (1996) Prophylaxis for HIV-related infections: a work in progress. and Maniatis. AIDS 15. S. Mem Inst Oswaldo Cruz 98.K.O. J Clin Pathol 53.H.A. APMIS 109. 161–167. (2008) Multiplex real-time PCR assay for rapid identification of Mycobacterium tuberculosis complex members to the species level.. Singh.Q. Baboo. Singla. P..

Sign up to vote on this title
UsefulNot useful