You are on page 1of 4

EXERCICES DE TD

Exercice 1 : On se propose d’amplifier par PCR un fragment nucléique de 118 à 288 inclus de la séquence suivante : La taille des amorces est de 21 bases.
5 ’ GAATCCCAC G TTGTTGATCA GACTGGCCA T GTCGGCATG G TTGAACGGTT CACGCTGAC T GTAAATTGG A ACGTTAAGT A TGCCAGTTA A GTGAAAACG T CTTGTATGG C TGTCTGGTT A ACACAAGGA T CTCTGGTGT C GCTACCATTA TAAGGGCTG G CTGTGAATAC CACCC 3’ ATTCCAGTTC TGTCACACC G GTCGGTGGT C AAGATCGGT G TGTGAATTGG CAAAGCCAA A ACTTGCACG C ACGAAGGTG C ACTACGCCG G GTAACGAATC GGCCAACGA A TTGGCACGG T CGGTGTCGT T TATCAAATGG CAACTGTCCT 60 12 0 18 0 24 0 30 0 32 5

1. Quelle sera la taille du segment cible sans tenir compte des amorces ? En tenant compte de ces amorces ? 2. Indiquer la structure des amorces de 21 bases nécessaires pour amplifier le segment désigné. 3. Calculer la Tm de chaque amorce en utilisant la formule de Wallace. Exercice 2 : Calculer la longueur minimale (n en nucléotides), que devrait avoir une amorce nucléotidique si on souhaite qu'elle ne représente (statistiquement) qu'une seule séquence d'un génome de 3.109 (trois milliards) de paires de bases. Exercice 3 : Comment appelle-t-on les vecteurs qui peuvent être utilisés avec différents types de cellules hôtes (procaryotes ou eucaryotes) : 1. vecteurs navettes (shuttle vectors) 2. vecteurs polyvalents 3. Yac 4. Bac Exercice 4 : 1. Comment peut-on refermer un vecteur plasmique qui a été ouvert avec des extrémités franches ? 2. Définition des enzymes de restriction isoschizomères 3. Peut-on ligaturer directement, par leurs extrémités cohésives, des fragments de rfestrictions obtenus avec des endonucléases différentes qui ne sont pas des isoschizoenzymes ? Exercice 5 : 1. Quelle différence principale y a-t-il entre le mode d’action de l’ADN ligase d’Escherichia coli et celle de l’ADN ligase phagique T4 ? 2. Définition de l’enzyme de Klenow 3. Quel est l’intérêt de déphosphoryler un vecteur que l’on vient d’ouvrir par une enzyme de restriction ?

La séquence partielle du plasmide pGEM2 au niveau des sites de clonage Eco RI et Bam HI est écrite ci-dessous : 5'-ATTTAGGTGACACTATAGAATACACGGAATTCGAGCTCGCCCGG GGATCCTCTAGAGTCGACCTGCAGCCCAAGCTTCCGGTCCCTAT AGTGAGTCGT . de brins d'ADN après n cycles de PCR. combien obtient-on (en théorie). combien faut-il de phages au minimum pour contenir un génome de 3 milliards de paires de nucléotides ? 3. Pour préparer la sonde. Quelle est la différence physique qui existe entre une banque de phages et une banque plasmidique ? Exercice 7 : 1) Combien de types de molécules d'ADN (espèces moléculaires différentes en longueur). A partir de la séquence du site multiple de clonage de pGEM2 donnée ci-dessus. Sachant que la taille moyenne d’un insert d’ADN dans un vecteur phagique est de 15 Kb. Exercice 8 : Un fragment Eco RI-Bam HI de 1 kb contenant un gène de souris appelé BM est sous cloné dans un vecteur appelé pGEM2. la technique d’étude des polymorphismes de la longueur des fragments de restriction (RFLP : Restriction Fragments Lenght Polymorphism) 2. tracer sur une feuille de papier semi-log où à l'aide d'un tableur de type Excel®. sur 30 cycles. Définition du criblage (screening) de banque d’ADN 4. en partant d'une seule matrice de 2 brins d'ADN. se retrouvent dans le tube à la fin de l'amplification? 2) À partir de quelle étape p (p = numéro de cycle). donnez la séquence de 2 amorces de 20 nucléotides permettant d'amplifier le fragment Eco RI-Bam HI (1 kb) de pBM1 cloné aux sites Eco RI et Bam HI de pGEM2. Le plasmide obtenu lors de ce sous clonage est appelé pGEM-BM. l'évolution des produits de PCR copiés sur la matrice initialement introduite dans le tube à ceux de longueur souhaitée (obtenus à partir du p-ième cycle).Exercice 6 : 1. aux sites Eco RI et Bam HI de pGEM2.3' On souhaite utiliser le fragment Eco RI-Bam HI de 1 kb comme sonde pour faire une analyse RFLP chez différentes lignées de souris. la RT-PCR . Pour cela. sont formés les premiers produits d'amplification de longueur souhaitée? 3) Comparer. Exercice 9 : Expliquer le principe de : 1. on choisit de procéder par amplification spécifique de séquence (PCR) en incorporant des nucléotides marqués lors de l'amplification. 4) Montrer. le nombre de copies de chacune de ces espèces d'ADN en fonction du numéro de cycle. définition d’une banque d’ADN 2.

les fragments d’ADN les plus longs migrent les plus vite 4. Permet d’obtenir un grand nombre de copies d’une séquence d’ADN donnée 2. les fragments d’ADN deviennent fluorescents lorsqu’ils sont illuminés par des rayons UV 5.Exercice 10 : On donne la séquence d’une zone nucléique (appelée zone A) responsable d’une pathologie neurodégénérative à transmission autosomique récessive chez l’homme : 5’ GAGGGTATCA ACCCTGCCTG CAAACAGAGG CCCATGTTCC AAGGGGGACA CTGACCAGTT CGTTCGCTGC CCTCAGGGGG TTTCGGATAA TGCTGCCTAT CTGCAATGCT AGGCCTCTGA GAGACTTCAT CCCTAACCCC AGGCCTGCAG TCAGTGGTTG CTCCGGAAGC GAGATTCCTG AAGTGTGGCA TTTTCATGGA 3’ Déterminer les amorces (gauche et droite) qui pourraient permettre de réaliser avec succès l’amplification de la zone A par PCR. Exercice 11 : 1. Choisir votre réponse par ce qui suit : 1. un de 4 Kb. consiste à introduire des vecteurs recombinés dans des cellules hôtes afin de les multiplier 3. Permet de construire des banques d’ADN (ADN génomique ou ADNc) 5. coupé par l’enzyme EcoRI donne un fragment de 8Kb. un de 3 Kb et un de 2Kb. Produit des clones bactériens. Définition de random primer method Exercice : La technique de clonage moléculaire de l’ADN : 1. chacun renfermant un vecteur recombiné différent 4. un de 4 Kb et un de 3 Kb 2. la taille des fragments d’ADN digérés est évaluée par électrophorèse 3. coupé par les deux enzymes EcoRI et SmaI produit un fragment de 6 Kb. Donner les étapes de la technique FISH 2. coupé par l’enzyme SmaI donne un fragment de 9 Kb et un de 6 Kb 3. Peut aboutir à la production de grandes quantités de protéines à partir d’un clone bactérien Exercice 12 : Un fragment d’ADN 1. dans cette expérience. lors d’une électrophorèse. l’analyse de la taille permet de déduire que l’ordre des sites de restriction sur le fragment d’ADN est EcoRI-SmaI-EcoRI . la digestion par l’enzyme EcoRI produit des fragments d’ADN à bouts francs 2.

Exercice 13 : une banque d’ADNc 1. peut être spécifique d’un ou de quelques types cellulaires d’un organisme donné 4. peut être criblée au moyen d’un anticorps . peut être spécifique de l’ensemble des séquences transcrites dans un organisme à un stade de développement précis 5. est obtenue par réplication d’ADN 2. contient les séquences régulatrices des gènes d’un organisme 3.