You are on page 1of 33

Enseignement Obligatoire de T

erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
1

Lycée M.
Berthelot
__________________
T
erm
S
__________________
Enseignement
obligatoire












Stabilité et variabilité des génomes Stabilité et variabilité des génomes Stabilité et variabilité des génomes Stabilité et variabilité des génomes
Evolution Evolution Evolution Evolution

DOSSIER 4 - Sommaire :
I/ La méiose et la fécondation assurent la stabilité de l’espèce
Le cycle de développement des êtres vivants sexués nécessite une alternance de phase haploïde et diploïde. La
méiose permet de produire des gamètes haploïdes, la fécondation rétablit la diploïdie. Des accidents méiotiques
conduisent à des anomalies de nombre des chromosomes. Les individus porteurs de telles anomalies
chromosomiques meurent ou sont lourdement handicapés.

II/ La méiose et la fécondation assurent également la variabilité de l’individu
La méiose est une succession de 2 divisions. Lors de la première division un brassage interchromosomique a
lieu donnant naissance à une diversité de gamètes. Lors de cette première division, des crossing-over peuvent
apparaître en prophase, ce qui génèrent encore d’autres gamètes différents, d’autant plus qu’un second
brassage interchromosomique en métaphase 2 de la seconde division accompagne ce brassage
intrachromosomique. Enfin, la fécondation en associant au hasard encore, les gamètes produits, accentue
encore la diversité des individus possibles à chaque génération par le jeu de combinaisons allèliques originales.

III/ Les sources d’innovations génétiques : mutations et duplications géniques
Le Polymorphisme allèlique est le fruit de mutations d’allèles pré-existant, mutations qui peuvent avoir des
répercutions phénotypiques plus ou moins graves sur l’individu et sur l’espèce. Des duplications de gènes
augmentent le nombre de gène au sein du génome d’une espèce. Le génome actuel des espèces reflète leur
histoire génétique en cumulant des mutations et duplications au fil des générations.

IV/ Le devenir des innovations génétiques : Génomes et évolution
Les innovations génétiques, gènes et allèles issus respectivement des duplications géniques et mutations d’allèles
pré-existants, sont favorables, défavorables ou neutres pour le porteur si elles sont somatiques et pour l’espèce
si elles sont portées par les gamètes. La sélection naturelle tri l’innovation génétique dans un environnement
donné tandis que la dérive génétique fixe ou élimine la nouveauté génétique par le jeu du hasard quel que soit
l’environnement où apparaît l’innovation génétique. Des mutations portant sur des gènes de développement
peuvent avoir des conséquences phénotypiques considérables. L’émergence de la lignée humaine pourrait
s’expliquer par de telles mutations.
Samuel Remérand 2007-2008
Le polymorphisme
phénotypique d’Harmonia
axyridis implique un
polymorphisme génétique,
indispensable aux
phénomènes évolutifs.

D’après Modern
Genetics, , The
Benjamin/
Cummings
Publishing
Company, Inc
1984.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
2
Introduction Introduction Introduction Introduction

Le caryotype humain comporte 46 chromosomes, nombre caractéristique de l’espèce Homo sapiens.
Les 2/3 des 30.000 gènes que portent ces 46 chromosomes sont identiques chez tous les individus; les gènes
impliqués dans les communications nerveuse et hormonale ou encore les gènes architectes responsables du plan
d’organisation d’un être vivant, appartiennent à ce groupe. Ces gènes comme le caryotype sont spécifiques de
l’espèce et participent à la stabilité de l’espèce.
Le 1/3 des gènes restant existe sous plusieurs formes ou allèles. Ces allèles sont responsables, avec
l’environnement, des phénotypes variants ou alternatifs, c’est-à-dire des différences constatées entre individus.
Le polymorphisme de certains gènes, source de variabilité, est à la base de l’unicité de l’individu, de la
défense de l’organisme (Dossier 7) et de l’évolution des espèces.

Quels mécanismes assurent à la fois la stabilité de l’espèce tout en préservant voir créant la
variabilité au sein de cette même espèce ?

I/ La méiose et la fécondation assurent la stabilité de l’espèce

N A l’échelle de plusieurs millions d’années, une espèce est stable. Cette stabilité est marquée
notamment par la conservation, de génération en génération, du caryotype dont le nombre et la forme des
chromosomes sont caractéristiques d’une espèce (Doc. 1).

N La stabilité du caryotype de l’espèce est assurée au cours du développement de l’individu par la
reproduction sexuée ou plutôt procréation qui comprend deux phénomènes fondamentaux : méiose et
fécondation (Doc. 1).

I-1 Le cycle de développement est caractérisé par l’alternance d’une phase haploïde et d’une
phase diploïde (Doc. 1)

N La reproduction sexuée repose sur la formation de gamètes haploïdes : chaque gamète possède un
seul chromosome de chaque paire. Ces cellules à n chromosomes sont produites par la méiose. La
fécondation permet de reconstituer le stock chromosomique diploïde, spécifique à chaque espèce : la
réunion des n chromosomes du spermatozoïde avec les n chromosomes de l’ovule forme un œuf contenant 2n
chromosomes.

N Le cycle de développement de toutes les espèces à reproduction sexuée est marqué par une
alternance de phase diploïde et de phase haploïde. La phase diploïde domine la phase haploïde chez les
mammifères : le cycle est diploïde, la phase haploïde est plus longue chez les mousses ou le champignon
Sordaria : le cycle est haploïde.

I-2 La méiose présente une succession de deux divisions

N L’interphase précède la méiose. La cellule duplique pendant la phase S son ADN. (1
ère
S, Doc. 2)

N La première division réduit le nombre de chromosome : division réductionnelle (Doc. 3)

Au début de la méiose, la cellule est diploïde, elle possède donc 2n chromosomes.

L Les chromosomes homologues s’apparient pendant la prophase. La prophase débute avec la
condensation de chaque chromosome. Puis, vient la phase originale de la méiose : les chromosomes homologues
s’apparient, pour former des tétrades ou bivalents, grâce à des séquences nucléotidiques particulières qui
permettent de les aligner au gène près (sauf dans les cas de duplications des gènes !, voir infra). Des
enjambements ou Crossing-over donnent naissance à des contacts ou chiasmas qui unissent les deux
chromatides.
L Les paires de chromosomes s’ordonnent pendant la métaphase. Les paires de chromosomes
se trouvent alignées en plaque équatoriale.
L Les chromosomes homologues sont séparés pendant l’anaphase. Les chiasmas qui unissaient
les chromosomes pendant les phases antécédentes se rompent. Les échanges de fragments de chromosomes
sont alors fréquents et entraînent des recombinaisons géniques. Les deux lots de chromosomes homologues
sont entraînés chacun vers une extrémité de la cellule (sans se couper au niveau des centromères).
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
3
Doc. 1 : La stabilité du caryotype de l’espèce, caractéristique à chaque espèce, est assurée au cours du
cycle de développement de l’individu par la reproduction sexuée. Quelque soit l’espèce à reproduction
sexuée considérée, la sexualité comprend deux phénomènes fondamentaux : méiose et fécondation qui
séparent deux phases haploïde et diploïde, en alternance.

Champignon
Sordaria
Mammifère
Homo sp.
D’après SVT Term S, Bordas,
2002, modifié Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
4
Doc. 2 : L’interphase précède la méiose. La cellule duplique pendant la phase S son ADN.
D’après SVT 1
ère
S, Bordas, 2001, modifié Remérand 2001.


D’après aide - mémoire
SVT 2de/1
ère
et Terminale,
éditions Bordas 1994.
D’après SVT 1
ère
S, éditions
Bordas 1993.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
5

Doc. 3 : La méiose est une succession de 2 divisions. La première est réductionnelle (elle réduit de
moitié le stock chromosomique), la seconde équationnelle ( elle correspond à une mitose classique).
D’après Biologie terminale D, éditions Bordas 1983, modifié Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
6
L Les cellules filles haploïdes se séparent pendant la télophase. Une membrane plasmique sépare
les deux cellules filles. Chacune des cellules ne possède donc plus qu’un seul jeu de chromosome, chaque cellule
est haploïde. Chaque chromosome est encore constitué de deux chromatides.

N La deuxième division ressemble à une mitose normale : division équationnelle (Doc. 3)

L La télophase de la division 1 s’enchaîne avec la prophase de la division 2 (il n’y a donc pas de
nouvelle synthèse d’ADN !). Les chromosomes ne se décondensent pas. Chaque cellule issue de la première
division subit la deuxième division. Les mécanismes sont comparables à ceux d’une mitose classique :
L L'ADN se condense pendant la prophase,
L Les chromosomes s’ordonnent pendant la métaphase,
L Les chromosomes se partagent en deux lots identiques pendant l’anaphase, en se coupant au
niveau des centromères,
L Les cellules filles s’individualisent pendant la télophase.
La fin de cette division aboutit à la formation de 4 cellules filles haploïdes.

I-3 La fécondation rétablit la diploïdie et maintient le caryotype de l’espèce

N La fécondation permet de réunir les n chromosomes paternels et les n chromosomes maternels. La
cellule œuf produite possède donc 2n chromosomes. La fécondation permet donc de maintenir le caryotype
en rétablissant la diploïdie (Doc. 1).

N La reproduction sexuée via la méiose et la fécondation maintient une barrière entre les
caryotypes des différentes espèces et participe ainsi à la stabilité des espèces (Doc. 4).

I-4 Certains accidents méiotiques conduisent à des anomalies du nombre des chromosomes

N Tout écart dans le nombre de chromosomes engendre des avortements très précoces, dans les
meilleurs des cas des handicaps lourds pour l’individu, généralement éliminé, et donc pour l’espèce tributaire
des individus qui la compose !

N Il s’agit le plus souvent de trisomies autosomales (2n + 1), la plus commune étant la trisomie 21
(1/700 naissances). Ces trisomies peuvent également affecter les paires de chromosomes 13, 18 ainsi que les
chromosomes sexuels (syndrome de Klinefelter où le mâle est stérile par azoospermie et montre une atrophie
testiculaire, 1/1200 naissances) On rencontre également des monosomies (rares car à l’origine d’avortements
spontanés) comme dans le cas du syndrome de Turner (femme de petite taille, absence d’ovaire et diverses
malformations 1/2500 naissances). On rencontre également des trisomies et monosomies partielles (Doc. 5).

N L’origine de ces anomalies de nombre est parfois due à une division anormale de la cellule œuf
(Doc. 5), plus généralement une méiose anormale:
- mauvaise répartition des chromosomes homologues en tétrades (bivalents) en métaphase 1 : 1
paire de chromosomes homologues à 2 chromatides migrent du même côté de la cellule (Doc. 5).
- ou non disjonction (séparation) des chromosomes homologues en métaphase 2 : Un
chromosomes homologue à 2 chromatides ne se scinde pas en deux au niveau de son centromère.
Dans les cellules sexuelles apparaissent alors des caryotypes haploïdes déséquilibrés avec un, deux...
chromosomes supplémentaires ou un, deux ... chromosomes absents. Lors de la fécondation, le rétablissement
de la diploïdie n’est pas respecté, certaines informations génétiques sont en surplus dans les trisomies, d’autres
manquent dans les cas de monosomies d’où une altération des caractéristiques génétiques de l’espèce.

II/ La méiose et la fécondation assurent également la variabilité de l’individu

II-1 Rappels de 1
ère
S

NUn gène code pour une protéine à l’origine du phénotype moléculaire dont découlent les
phénotypes cellulaire et macroscopique. Un allèle code pour une version de cette protéine. Les allèles d’un
caractère sont situés au même locus (niveau) des chromosomes d’une paire (Doc. 6).

N Chaque individu diploïde possède 2 stocks de chromosomes homologues (ou autosomes, paires 1 à
22 chez l’Homme, dont la forme, la taille et la succession des gènes sont identiques mais pas forcément la
version allèlique) et deux chromosomes sexuels (hétérologues ou gonosomes) : XX chez la femme et XY chez
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
7

Doc. 4 : La reproduction sexuée joue un rôle dans la :
- stabilité de l’espèce en rétablissant la diploïdie et maintenant ainsi le caryotype de
l’espèce.
- variabilité de l’individu à travers la méiose et ses brassages inter et intrachromosomiques,
et la fécondation
D’après SVT Term S, éditions Hatier 2001, modifié Remérand 2002.

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
8

Doc. 5 : Certains accidents méiotiques conduisent à des anomalies du nombre des chromosomes.
D’après SVT Term S, éditions Nathan 2002, modifié Remérand 2002.

Trisomie 13
Syndrome de Klinefelter Trisomie 21

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
9
Doc. 6 : Un gène code pour une protéine à l’origine du phénotype moléculaire dont découlent
les phénotypes cellulaire et macroscopique. Un allèle code pour une version de cette protéine. Les
allèles d’un caractère sont situés au même locus (niveau) des chromosomes d’une paire.
Chaque individu diploïde possède 2 stocks de chromosomes homologues ou autosomes et
deux chromosomes sexuels (hétérologues ou gonosomes).
D’après SVT 1
ère
S, éditions Hatier, Bordas, Hachette et Nathan 2002 , modifié Remérand 2002.

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
10
l’Homme. Ces chromosomes proviennent pour moitié du patrimoine maternel et pour moitié du patrimoine
paternel (Doc. 6).

L L’expression d’un phénotype dépend d’un couple d’allèles. Cela concerne les gènes situés :
- sur les autosomes (paires 1 à 22) pour l’homme et la femme,
- sur les gonosomes XX (paire 23) de la femme, et la partie commune à X et Y pour l’homme.
Si les deux allèles sont identiques, l’individu est homozygote pour ce gène.
Si les deux allèles sont différents, l’individu est hétérozygote pour ce gène.
Le caractère qui s’exprime uniquement à l’état homozygote est dit récessif (Allèle O).
Lorsqu’un seul allèle suffit pour qu’il s’exprime, l’allèle est dit dominant (Allèles A et B dominent O).
Enfin, lorsque les deux allèles s’expriment conjointement, ils sont codominants (Allèles A et B)

L L’expression d’un phénotype dépend d’un seul allèle. Cela concerne, chez l’homme, les gènes
situés sur la partie non homologue des gonosomes X et Y (paire 23). Le gène allèle présent sur le X ou sur le Y
s’exprime toujours.

II-2 La méiose assure un brassage allèlique, interchromosomique, important chez les diploïdes

N Un tiers des gènes sont polymorphes c’est-à-dire possèdent plusieurs versions ou allèles avec
une fréquence supérieure ou égale à 1% (0,01) pour chacun d’entre eux. Chaque allèle est une innovation
génétique. Les gènes du CMH possèdent une extra-ordinaire diversité allèlique (Doc. 7).

N Les gamètes formés par méiose ne possèdent qu’un seul allèle de chaque gène. Le partage, lors
de la métaphase 1 des chromosomes homologues, donc des couples d’allèles qu’ils portent, se fait au hasard
(Doc. 8). Les gamètes formés par méiose sont différents : 1
ère
source de diversité pour les individus.

N Le nombre de combinaisons possibles de regroupement des allèles est très important, il peut être
calculé par la formule 2
n
soit si n =23 (comme chez l’Homme), 2
23
= 8.688.608 gamètes différents possibles par
individu (Doc. 8).

II-3 Le crossing-over permet un brassage intrachromosomique chez les diploïdes et les haploïdes

N Les échanges de gènes sont fréquents pendant la méiose. Ces échanges se produisent, en effet, quand
les chromosomes homologues établissent des chiasmas en prophase de division réductionnelle (Doc. 9). Ces
chiasmas permettent un échange d’une portion de chromatide sans détérioration de gènes, en général.
Le brassage intrachromosomique est une 2
ième
source supplémentaire de diversité pour les
individus surtout qu’alors un second brassage interchromosomique en métaphase 2 intervient, accentuant
ainsi encore la diversité des gamètes possibles.

N Chez un organisme diploïde comme l’Homme qui possède 30.000 gènes, en considérant seulement
des crossing-over sur 100 gènes on peut produire 2
100
x 2
23
gamètes différents (Doc. 9).

N Le champignon Sordaria passe la plus grande partie de son cycle sous la forme haploïde. En effet, la
fécondation est presque aussitôt suivie par la méiose qui forme 4 spores haploïdes. Chacune des cellules
haploïdes entre ensuite en mitose pour donner naissance à 8 spores par asque au total (Doc. 10).

N Un organisme haploïde possède un seul allèle par cellule. Cet allèle s’exprime donc toujours,
donc le phénotype correspond toujours au génotype.
L’analyse du contenu des asques chez Sordaria montre que la reproduction sexuée de ce champignon
donne naissance à 6 catégories d’asques. Ainsi au cours d’une méiose, pour le caractère « couleur de la spore »,
on obtient des gamètes (Doc. 10):
- de type parental 4/4, très fréquents, porteurs d’allèles non impliqués dans un crossing-over,
- de type recombiné 2/2/2/2, plus rare, porteurs d’allèles impliqués dans un crossing-over.

II-4 La fécondation multiplie la diversité des individus

N La fécondation augmente le nombre de combinaisons allélliques possibles (Doc. 11).
Le nombre de combinaisons possibles peut être calculé par la formule suivante : 2
n
x 2
n
soit pour n = 23
: 70 milliards d’œufs différents pour un couple (sans compter les recombinaisons possibles: 2
100
x 2
100
). Soit un
nombre de possibilités supérieur au nombre total d’atomes dans l’Univers. Chaque individu est unique.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
11
Doc. 7 : Les gènes du CMH possèdent une
extra-ordinaire diversité allèlique, ils sont très
polymorphes (fréquence supérieure à 1% pour
chaque allèle).
Doc. 8 : Le
partage, lors de l’anaphase
1 des chromosomes
homologues, donc des
couples d’allèles qu’ils
portent, se fait au hasard.
Les gamètes formés par
méiose sont différents :
c’est une première source
de diversité pour les
individus.

La formule 2
n
donne le nombre de
combinaisons allèliques possible en fonction
d’un nombre de chromosomes, soit si n =23
(comme chez l’Homme)

2
23
= 8.688.608 gamètes
différents possibles par individu,
à chaque méiose
D’après SVT 1
ère
S, éditions
Nathan 2002, modifié
Remérand 2002.
D’après SVT 1
ère
S,
éditions Didier 2002 ,
modifié Remérand
2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
12
Doc. 9 : Des échanges de gènes se produisent quand les chromosomes homologues établissent des
chiasmas en prophase de division réductionnelle. Ce brassage intrachromosomique est une source
supplémentaire de diversité pour les individus en créant des gamètes originaux, recombinés.
Chez un organisme diploïde comme l’Homme
qui possède 30.000 gènes, en considérant
seulement des crossing-over sur 100 gènes on
peut produire :

2
100
x 2
23
gamètes différents par
individu à chaque méiose
D’après SVT 1
ère
S,
éditions Nathan 2002 ,
modifié Remérand 2002.
D’après SVT 1
ère
S,
éditions Hatier
2002, modifié
Remérand 2002.
D’après SVT 1
ère
S,
éditions Nathan
2002 , modifié
Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
13
Doc. 10 : Un organisme haploïde possède un seul allèle par cellule. Cet allèle s’exprime donc
toujours, donc le phénotype correspond toujours au génotype.
L’analyse du contenu des asques chez Sordaria montre que la reproduction sexuée de ce
champignon donne naissance à des gamètes:
- de type parental 4/4, très fréquents, porteurs d’allèles non impliqués dans un crossing-over
- de type recombiné 2/2/2/2, plus rare, porteurs d’allèles impliqués dans un crossing-over.
D’après SVT 1
ère
S, éditions Hatier2002, modifié Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
14

Doc. 11 : La reproduction sexuée joue donc un double rôle dans la :
- stabilité de l’espèce en rétablissant la diploïdie et maintenant ainsi le caryotype de l’espèce de
génération en génération et donc une barrière génétique entre les espèces.
- variabilité des individus en créant des êtres originaux, uniques par l’intermédiaire :
o des brassages intrachromosomique et interchromosomique produits par la méiose
o de la fécondation

Père

A a

D d B b
Mère

A a

D d B b
Méiose

A A a a

D D d d B B b b

Gamètes sans crossing-over

A A a a
ou ou ou
D B D b d B d b

Gamètes avec crossing-over

A A a a
ou ou ou
D B D b d B d b
+

A A a a
ou ou ou
d B d b D B D b
Gamètes ADB ADb adB adb AdB Adb aDB aDb
ADB
ADb
adB
adb
AdB
Adb
aDB
aDb

Méiose

A A a a

D D d d B B b b

Gamètes sans crossing-over

A A a a
ou ou ou
D B D b d B d b

Gamètes avec crossing-over

A A a a
ou ou ou
D B D b d B d b
+

A A a a
ou ou ou
d B d b D B D b
n = 2 n = 2 n = 2 n = 2
n = 2 n = 2 n = 2 n = 2
2n = 4 2n = 4 2n = 4 2n = 4
n = 2 n = 2 n = 2 n = 2
Variabilité
de
l’espèce
Variabilité
de
l’espèce
Stabilité
de l’
espèce
Variabilité
de
l’espèce
Fécondation
2n = 4 2n = 4 2n = 4 2n = 4
Le nombre
d’œufs
possibles est :
2
n
x 2
n
soit
pour n = 23 :
70
milliards
d’œufs
différents
pour un
couple
(sans compter
les C.O
possibles: 2
100

x 2
100
)
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
15
II-5 La reproduction sexuée est facteur de stabilité pour l’espèce et de variabilité pour l’individu

N La reproduction sexuée joue un rôle fondamental à deux niveaux. C’est à la fois un
facteur (Doc. 11):
- de stabilité de l’espèce en maintenant le caryotype de l’espèce de génération en génération et
donc une barrière génétique entre les espèces.
- de variabilité des individus en créant des êtres originaux, uniques par l’intermédiaire :
o des brassages intrachromosomique et interchromosomique produits par la méiose
o de la fécondation

N Méiose et fécondation sont les mécanismes orientés dans la création de la nouveauté et la
diversité des individus. Ils permettent de faire du différent justifiant l’expression « unicité de l’individu ».
Le brassage génétique est inévitable et programmé, tout en restant hasardeux; il constitue un facteur
d'évolution de l’espèce et de survie des individus.

II-6 Les analyses de résultats génétiques permettent de localiser les gènes étudiés

N En fonction des résultats d’analyses de croisements génétiques il est possible de déterminer le
nombre et la localisation des gènes suivis (Doc. 12):
- sont-ils sur les gonosomes ou sur les autosomes ?
- sont-ils sur le même chromosome (gènes liés) ou sur des chromosomes différents (gènes
indépendants) ?

N Chez l’haploïde Sordaria, l’analyse des asques permet de mettre en évidence ou non la présence de
crossing-over.

N Chez les diploïdes (autres que L’Homme et ce pour des raisons éthiques), les croisements tests ou
test-cross permettent de connaître le génotype d’un individu au phénotype dominant (Doc. 13). En effet,
cet individu peut être soit homozygote dominant, soit hétérozygote. En croisant cet individu par le double
récessif, on obtient en F
1
:
- 100% d’individu au phénotype dominant si l’individu testé était dominant homozygote,
- 50% d’individu au phénotype dominant et 50% d’individu au phénotype récessif si l’individu était
hétérozygote.

III/ Les sources d’innovations génétiques : mutations et duplications géniques

Chaque individu est une combinaison allèlique unique, à l’exception des vrais jumeaux. Si la
reproduction sexuée (méiose et fécondation) contribue à l’unicité de l’individu par le biais de l’hétérozygotie et
donc le jeu des combinaisons alléliques, l’essence même de cette diversité provient du polyallèlisme c’est-à-
dire de la variabilité au sein du génome d’une espèce.
Quelle est l’origine des nouveaux allèles ?

Enfin, depuis l’apparition de la vie sous forme procaryote, le nombre de gènes composant les
différentes espèces a considérablement augmenté.
Comment se complexifie le génome au cours de l’évolution, de l’histoire du vivant ?
Quelles sont les sources d’innovations génétiques ?

III-1 Rappels de 1
ère
S : La diversité des phénotypes résulte de la diversité des génotypes

N Les différents niveaux de définition d’un phénotype, macroscopique, cellulaire et moléculaire,
sont intimement liés (Doc. 6) mais le phénotype moléculaire influence toujours directement ou
indirectement les phénotypes cellulaire et macroscopique via les protéines.

N Les différents phénotypes (phénotypes alternatifs) observés au sein d’une espèce (sauvage et
mutants) résultent donc à la base de différences dans les protéines concernées (variantes protéiques),
différences d’ordre qualitative (hémoglobine Hbs et HbA), quantitative (quantité de mélanine et couleur de
peau) ou fonctionnelle (enzyme non fonctionnelle dans les cas d’albinisme, impliquées dans la réalisation des
groupes sanguins).

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
16
Doc. 12 : L’analyse des résultats de croisements renseigne sur le nombre de gènes impliqués et leur
localisation.
D’après SVT 1
ère
S, éditions Nathan 2002 , modifié Remérand 2002.



2 Gènes indépendants

2 Gènes liés
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
17
Doc. 13 : Le test-cross, avec le récessif, permet de connaître le génotype d’un organisme au
phénotype dominant.
D’après SVT 1
ère
S, éditions Belin 2002 , modifié Remérand 2002.
2
ième
cas
1
er
cas
Doc. 14 : La fonction d’une protéine est directement liée à sa configuration spatiale, elle-même liée
aux propriétés physico-chimiques des acides aminés constitutifs de la protéine. La synthèse d’une
protéine exige donc un respect rigoureux de la séquence d’A.A., ordre codé sur l’ADN nucléaire.
D’après SVT 1
ère
S, éditions Belin 2002 , modifié Remérand 2002.

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
18
N La fonction et le niveau d’activité d’une protéine sont directement liés à sa configuration
spatiale, elle-même liée aux propriétés physico-chimiques des acides aminés constitutifs de la protéine.
Une modification au niveau de la séquence d’acide aminé peut avoir des conséquences phénotypiques plus
ou moins grave. La synthèse d’une protéine exige donc un respect rigoureux de la séquence d’A.A. Cet
ordre des A.A est codé sur l’ADN nucléaire (Doc. 14). Un gène code pour une protéine et un allèle pour
une forme de cette protéine.

III-2 A l’origine des nouveaux allèles : les mutations

III-2-1 Les phénotypes alternatifs impliquent un polymorphisme génétique

N Si on distingue deux phénotypes macroscopiques différents c’est généralement qu’il y a, à l’origine,
deux phénotypes moléculaires distincts(attention aux effets de l’environnement, comme le bronzage !). Par
contre l’inverse n’est pas systématiquement vrai, deux phénotypes moléculaires n’engendrent pas forcément
deux phénotypes macroscopiques différents (individus avec de l’hémoglobine fœtale sont sains). Un
polymorphisme phénotypique implique généralement un polymorphisme génétique (Doc. page sommaire).

N Un gène est qualifié de polymorphe lorsque ses allèles sont nombreux (> ou = à 2) et fréquents (>
à 1 %) dans une population. Cela concerne 1/3 du génome.
Parmi ces gènes polymorphes figurent les gènes du CMH (Doc. 7). Le polymorphisme de ces gènes
explique le très grand nombre de groupes tissulaires possibles et donc les difficultés d’une greffe pour trouver un
greffon compatible avec le groupe tissulaire du receveur.

III-2-2 Les mutations modifient la séquence de l’ADN codant

N Plusieurs phénomènes peuvent modifier l’information génétique (radiations, produits chimiques,
erreurs de duplication de l’ADN lors des divisions cellulaires...).

N Les allèles d’un gène sont des successions de nucléotides différant les uns des autres par un ou
plusieurs nucléotides. Ces différences font suite à des mutations qui modifient la séquence d’ADNt. Les
mutations sont donc à l’origine de la variabilité de l’information génétique (Doc. 15).

N Une mutation est un événement spontané, rare (10
-7
) et aléatoire qui créent de nouveaux allèles
d'un même gène à partir d’un gène pré-existant que l’on peut qualifié d’ancestral. Ces nouveaux allèles ne
sont donc crées ex nihilo, à partir de rien !

N Une mutation affecte la séquence codante des bases de l’ADN d’un gène. Ces modifications
concernent une ou plusieurs bases du gène : les mutations peuvent être ponctuelles ou étendues. Trois cas,
principalement, peuvent être envisagés parmi les mutations ponctuelles (Doc. 15):
- une base prend la place d’une autre mutation par substitution,
- une base est enlevée mutation par délétion,
- une base est ajoutée mutation par addition ou insertion.

III-2-3 Les conséquences des mutations sont variables

N Une mutation peut aussi bien affecter (Doc. 15):
- une base de la séquence signal: il n’y aura plus de lecture du gène, cela se traduira par l’absence de
synthèse de la protéine codée par ce gène (cas de l’albinisme),
- une base de la séquence du gène: dans ce cas, il peut y avoir modification de l’acide aminé traduit,
donc modification de la future séquence de la protéine,
- une base du signal stop: la lecture continuera jusqu’au prochain signal stop. Le nombre des A.A
augmente modifiant souvent les propriétés de la protéine synthétisée.
- une base en dehors du gène : cette mutation passera inaperçue.

N Les mutations génétiques peuvent avoir des répercussions sur l’histoire de l’individu et même sur
l’histoire de l’espèce.



Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
19

Doc. 15 : Une mutation est un événement spontané, rare (10
-7
) et aléatoire qui créent de nouveaux
allèles d'un même gène à partir d’un gène pré-existant que l’on peut qualifié d’ancestral. Une
mutation affecte la séquence codante des bases de l’ADN d’un gène. Les mutations peuvent être
ponctuelles ou étendues, décalantes ou non, touchées la séquence signal, codante ou de fin de gène.
D’après SVT 1
ère
S, éditions Belin 2002 , modifié Remérand 2002.


ACTATATAGCGTAC GACCACTGCCCGTAATTGCTTATC ATT CGTTAA


Séquence signal Séquence du gène Séquence fin de gène
Absence de synthèse Protéine + ou – modifiée Protéine + longue
de la protéine

En dehors du gène, aucune conséquence !
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
20
L LL L A l’échelle de la protéine

N Tout d’abord, les allèles ne se traduisent sur le phénotype moléculaire que s'ils sont dominants ou
homozygotes récessifs.

N Une mutation peut donc affecter la séquence d’acide aminé et avoir des répercussions plus ou moins
grave sur le phénotype moléculaire, puis cellulaire et macroscopique. Les mutations décalant le cadre de lecture
(insertion ou addition et délétion) sont très généralement beaucoup plus délétères (destructrices) que les
mutations non décalantes (Doc. 15).

N Les conséquences peuvent être nulles quand la forme tridimensionnelle de la protéine ne
change pas ou que le site actif n’est pas touché. Il s’agit des mutations non décalantes par substitution:
- silencieuse : l’acide aminé reste le même du fait de la redondance du code génétique.
- faux-sens si l’acide aminé initial est remplacé par un acide aminé ayant les mêmes propriétés
physico-chimiques ou bien si l'A.A possèdent des propriétés différentes mais que cet acide aminé
se trouve en dehors du site actif.

N Les conséquences sont importantes quand la structure tridimensionnelle de la protéine est
modifiée, en particulier le site actif. Il s’agit des mutations non décalantes par substitution:
- faux-sens si l’acide aminé initial est remplacé par un acide aminé aux propriétés physico-
chimiques différentes et que le site actif est touché.
- non-sens faisant apparaître un codon STOP dans l’ARNm ce qui entraîne un raccourcissement de
la protéine aux conséquences généralement dramatiques pour le porteur de cette mutation.

L LL L A l’échelle de l’individu

N Si la mutation affecte une cellule somatique (cellule autre que sexuelle), les effets sont limités à la
cellule concernée et aux cellules descendantes, issues de mitoses (reproduction conforme). Le cancer de la
peau, par exemple, bien qu’étant une maladie liée à un désordre génétique, une mutation, n’est pas transmissible
à la descendance car les cellules touchées ne sont pas les gamètes (Doc. 16).

N Si la mutation touche une cellule germinale, la mutation est transmissible à la descendance de
l’individu (Doc. 16). Encore faut-il que le gamète porteur de la mutation soit fécondé auparavant et que la
descendance survive et se reproduise !!

N Les propriétés de la nouvelle protéine issue d’une mutation somatique peuvent s’avérer bénéfiques
pour l’individu concerné (résistance à un antibiotique pour une bactérie, plus grande fécondité, plus grande
efficacité dans la recherche de nourriture ou dans la protection...), dans l’environnement où la mutation apparaît.
Souvent l’allèle muté entraîne des conséquences néfastes pour l’individu (la mutation du gène codant pour
l’insuline est responsable du diabète insulino-dépendant). Une majorité des mutations est neutre.

N Si la mutation touche un gène architecte (ou gène du développement), un gène régulateur, les
modifications phénotypiques peuvent être brutales et spectaculaires : des plans d’organisations nouveaux
peuvent apparaître (Doc. 17, voir chapitre IV-3).

L LL L A l’échelle de la population et de l’espèce

N Si une mutation portée par les gamètes permet la synthèse d’une nouvelle protéine aux propriétés
neutres ou avantageuses pour la descendance dans l’environnement où elle apparaît, cette innovation
génétique intéressera alors également, au-delà de la descendance, la population et l’espèce. En effet, le nouvel
allèle à l’origine de la nouvelle protéine peut se maintenir dans la population et enrichir le polymorphisme de
l’espèce. L’espèce accroît alors sa diversité allèlique (Doc. 16).

N Dans tous les cas où l’allèle est désavantageux pour la descendance dans l’environnement où elle
apparaît, ce nouvel allèle disparaîtra pour la population et l’espèce à la mort de la progéniture.

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
21
Doc. 16 : Si la mutation affecte une cellule somatique les effets sont limités à la cellule
concernée et aux cellules descendantes. Si la mutation touche une cellule germinale, la mutation est
transmissible à la descendance de l’individu.
La mutation peut être bénéfique pour l’individu dans l’environnement où elle apparaît. Souvent
l’allèle muté entraîne des conséquences néfastes pour l’individu. Une majorité des mutations est
neutre.
Ces mutations à travers la descendance peuvent également être favorables, défavorables ou
neutres pour l’espèce.
D’après SVT 2
nde
, éditions Bordas 2000, modifié Remérand 2002.
Mutations



Favorables
Défavorables
Neutres
pour l’individu
dans l’environnement où
elles apparaissent



Favorables
Défavorables
Neutres
pour l’espèce
dans l’environnement où
elles apparaissent
Doc. 17 : Si la mutation touche un gène architecte (ou gène du développement), un gène régulateur,
les modifications phénotypiques peuvent être brutales et spectaculaires : des plans d’organisations
nouveaux peuvent apparaître.
D’après SVT 2
nde
, éditions Bordas, Belin 2000 modifié Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
22
III-3 A l’origine des nouveaux gènes : le mécanisme de duplication-transposition, mutation et
évolution indépendante

N Ainsi, au sein du génome d’une espèce, les similitudes entre gènes (familles de gènes) sont
interprétées comme le résultat d’une ou plusieurs duplications d’un gène ancestral et la divergence observée
au sein des gènes d’une famille multigénique s’explique par l’accumulation de mutations.

N L’enchaînement duplication-transposition-mutation (Doc. 18) et évolution indépendante
explique la formation de ces familles multigéniques dont les globines et les hormones hypophysaires
(FSH, LH, TSH…) font partie :
- duplication : doublement
du nombre de gènes sur
une des chromatides des
chromosomes homologues
puis doublement d’un gène
sur un chromosome au
niveau des gamètes en fin
de méiose,
- transposition :
déplacement d’un gène
c’est-à-dire changement de
locus sur le même
chromosome ou sur un
autre chromosome,
- mutation : modification
de la séquence
nucléotidique, donc
possibilité de modification
de la chaîne protéique et
donc de la fonction de la
protéine et donc du gène,
- et évolution
indépendante : ces gènes
évoluant indépendamment
les uns des autres, les
différences s'accumulent
au cours du temps, les
fonctions et/ou les
propriétés des protéines
codées par ces gènes
diffèrent alors plus ou
moins



N Le gène supplémentaire peut muter sans nuire, par son absence, à son porteur et générer un
nouveau gène à la fonction proche de celle du gène ancestral (cas des globines) ou créer un gène à la
fonction totalement différente (cas des hormones hypophysaires ou de la prolactine et de la sueur).

III-4 Le génome actuel reflète l’histoire de l’espèce

Le génome actuel des espèces témoigne du passé génétique de l’espèce voir du clade. La
complexification du génome avec son augmentation du nombre de gènes et de versions allèliques résulte des
mécanismes de duplications géniques et des mutations d’allèles pré-existants survenus dans le passé au sein
des populations et cumulés au cours de l’histoire de l’espèce (Doc. 18).

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
23
Doc. 18 : L’enchaînement duplication-transposition-mutation et évolution indépendante explique la
formation de ces familles multigéniques. Le gène supplémentaire peut générer un nouveau gène à la
fonction proche de celle du gène ancestral ou créer un gène à la fonction totalement différente.
D’après SVT

Term S, éditions Nathan 2002, modifié Remérand 2002.

















Le génome actuel des espèces témoigne du passé
génétique de l’espèce avec ses mécanismes de
duplications géniques et de mutations d’allèles
survenus dans le passé au sein des populations
et cumulés au cours de l’histoire de l’espèce.
Doc. 19 : Tous les gènes et toutes les portions d’un même gène ne sont pas touchés avec la même
intensité. Ceci s’explique par une pression de sélection plus ou moins forte en fonction des protéines.
Les mutations neutres sont fixées dans le génome de l’espèce avec une grande régularité et peuvent
ainsi servir d’horloge moléculaire. D’après SVT

Term S, éditions Nathan 2002, modifié Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
24
IV/ Le devenir des innovations génétiques : Génomes et évolution

Les mutations peuvent porter sur des gènes de structure ou des gènes de développement. Seules
les mutations touchant la lignée ont un impact évolutif, l’évolution d’une espèce étant définie comme toute
modification de la fréquence allèlique d’une génération à l’autre.

IV-1 Tous les gènes et toutes les portions d’un même gène ne sont pas touchés avec la même
intensité

N Si l’on admet qu’une mutation survient de manière aléatoire et que, par conséquent, la
probabilité pour un nucléotide d’être remplacé par un autre est la même en tout point d’un gène, on
constate que (Doc. 19) :
- certaines portions de séquence d’un gène ou d’une protéine sont hautement conservées au cours
de l’évolution : exemple des histones et du cytochrome c et des segments A et B de l’insuline
- d’autres protéines varient considérablement chez des espèces phylogénétiquement proches comme
le montre les exemples des fibrinopeptides et du segment C de l’insuline.

N Ceci s’explique par le fait que les différences constatées entre molécules d’espèces différentes
reflètent non pas l’ensemble des mutations qui ont affecté cette molécule mais seulement les mutations
conservées au cours de l’évolution.
En effet, les mutations défavorables ont été éliminées avec leur porteur, elles ne nous sont pas
parvenues car elles n’ont pas été retenues par l’histoire de l’espèce.
Les zones hautement conservées de la protéine et donc les segments de gène correspondant sont des
zones impliquées dans la forme et donc la fonction de la protéine. Seules les mutations favorables,
améliorant l’efficacité de la protéine sont sélectionnées.
Quant aux zones hautement variables de la protéine elles correspondent à des portions de protéines et donc
de gènes qui peuvent s’autoriser de nombreuses variations sans conséquence pour le mutant. Ces mutations qui
ne présentent pas d’avantage sélectif sont neutres et conservées.

N Les mutations n’ont donc pas toutes les mêmes répercussions au sein des individus et donc de
l’espèce si ces mutations touchent la lignée gamétique : elles peuvent être défavorables, neutres ou
avantageuses.

N Le devenir des innovations génétiques est variable : élimination ou conservation. Le maintien
ou le retrait de gènes et des formes allèliques d’un gène, au cours du temps correspond à l’histoire
génétique même d’une espèce, à son évolution au fil du temps.

IV-2 La sélection naturelle élimine ou conserve les innovations génétiques respectivement
désavantageuses ou bénéfiques, apparues dans un environnement donné

N Dans un milieu où les ressources alimentaires, les sites de nidations... sont trop faibles pour le
nombre d’individu composant une espèce, certains génotypes sont mieux adaptés que les autres à survivre et
à laisser une descendance. Cette contribution différentielle à la génération suivante, en fonction des
génotypes et pour un environnement donné à un moment donné, est appelée sélection naturelle. La sélection
naturelle, favorisant certains allèles ou combinaisons allèliques, est adaptative d’un milieu donné, d’une
niche écologique donnée à un moment donné. Ainsi, les mutations qui confèrent un avantage sélectif aux
porteurs ont une probabilité plus grande de se répandre dans la population.

N Donc, la sélection naturelle trie les génotypes les plus aptes à laisser une descendance (les mieux
adaptés, les plus performants dans les conditions écologiques du moment) et donc à "passer leurs gènes". Mais
attention, que l’environnement change et la pression de sélection, l’orientation de la sélection naturelle
changera. C’est l’environnement qui dicte l’orientation de la sélection naturelle du moment !!

N La sélection naturelle est donc un processus orienté qui prend appui sur des processus aléatoires,
les innovations génétiques.

L LL L La sélection naturelle élimine l’innovation génétique non adaptée au milieu

4Des mutations au niveau des sites actifs des enzymes par exemple qui entraînent une diminution
de l’efficacité de la protéine ne sont pas ou peu conservées car elles diminuent la viabilité et donc la
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
25
Doc. 20 : Dans un milieu où les ressources alimentaires, les sites de nidations... sont trop
faibles pour le nombre d’individus composant une espèce, la sélection naturelle, favorise certains
allèles ou combinaisons allèliques pour un environnement donné. Ainsi, les mutations qui confèrent
un avantage sélectif aux porteurs ont une probabilité plus grande de se répandre dans la population.
C’est l’environnement qui dicte l’orientation de la sélection naturelle du moment !!
D’après SVT

Term S, éditions Belin et Hatier 2002, modifié Remérand 2002.

Cas du paludisme : Les porteurs Hbs/HbA en Europe sont désavantagés, par contre en Afrique ils résistent mieux
au paludisme. L’allèle Hbs se maintien en Afrique mais tend à disparaître en Europe.
Cas du mélanisme industriel : En période de pollution industrielle, la forme mélanique est favorisée, sinon la forme
blanche, mieux camouflée, est privilégiée.

Années
Fréquences
C c
1830 0 100
1868 0.03 0.97
1878 0.45 0.55
1938 0.96 0.04
1950 0.96 0.04
1988 0.58 0.42

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
26
reproduction de l’individu porteur. Des mutations sur le site actif de l’insuline, par exemple, diminuent
généralement l’efficacité de cette hormone et entraîne la mort par diabète de l’individu porteur. (Doc. 19)

4Des mutations de la protéine histone génèrent une baisse d’efficacité dans l’enroulement de
l’ADN et donc des difficultés lors de la mitose et de la méiose, hautement délétères (Doc. 19).

4Les allèles du gène de l’hémoglobine sont : HbA pour l’allèle de l’hémoglobine normale, Hbs
pour l ’allèle de l’hémoglobine qui provoque la drépanocytose. Le génotype Hbs/Hbs est létal (Doc. 20).

4 Dans le cas du mélanisme industriel, lors des périodes de moindre pollution par la suie, c’est-à-
dire avant la révolution industrielle et après l’arrêt de l’utilisation du charbon comme source d’énergie, la forme
prédatée était la forme mélanique « Carbonaria », mutant homozygote noir, plus facilement repérable sur
les bouleaux. La fréquence allèlique de l’allèle « Carbonaria » diminue, l’allèle mutant noir tend à
disparaître. Par contre lorsque les bouleaux sont recouverts de suie c’est la forme blanche qui tend à
disparaître: la sélection naturelle (qui prend la forme d’une pression de prédation) orientée vers les
formes blanches se retourne vers les formes mélaniques qui étaient largement minoritaires auparavant
(Doc. 20). Les fréquences des allèles « Carbonaria » et « blanc » fluctuent en fonction des conditions du
milieu, l’espèce évolue.

L LL L La sélection naturelle, conserve l'innovation génétique adaptative d’un milieu donné

4En Europe, la morbidité de l’allèle Hbs est le facteur de sélection qui avantage les homozygotes
HbA/HbA. La sélection naturelle avantage une seule forme allélique, la diversité tend à diminuer. L’allèle
Hbs tend à disparaître. (Doc. 20)
En Afrique et en Asie, essentiellement, les hétérozygotes (porteurs sains) HbA/Hbs sont plus résistants à
la malaria ou paludisme que les homozygotes HbA/HbA. L’avantage apporté par les hétérozygotes maintien la
fréquence de l’allèle Hbs à un haut niveau malgré la létalité de cet allèle à l’état homozygote (fardeau génétique).
Ainsi, dans les régions du monde où sévit le paludisme, la sélection naturelle avantage plusieurs formes
allélliques, la diversité des allèles, HbA et Hbs, est maintenue. (Doc. 20)

4La sélection naturelle a conservé la forme noire en période de pollution industrielle. Depuis,
l'arrêt de l'utilisation du charbon, la forme mélanique recule au profit de la forme normale qui est moins prédatée,
la pression de sélection, est à nouveau moins forte pour les formes blanches de nos jours (Doc. 20). La
fréquence de l’allèle « blanc » retrouve une valeur élevée.

IV-3 La dérive génétique maintient les innovations génétiques neutres par le jeu du hasard

N Les mutations neutres, qui affectent d’autres régions que le site actif d’une protéine, peuvent
s’accumuler car elles sont soumises à une pression de sélection moindre. Les individus porteurs peuvent
quand même se reproduire, cette mutation peut donc être perpétuée au travers des générations. Ces
mutations neutres peuvent donc s’accumuler au cours de l’évolution et ce sont elles qui servent d’horloge
moléculaire (Doc. 19).

4 44 4Ainsi, s’accumulent les mutations en dehors du site actif de l’insuline (Doc. 19) et spécialement sur
le segment C qui ne participe pas à la protéine finale (mais indispensable pour son transport intracellulaire).
4Un autre exemple typique est celui des fibrinopeptides qui peuvent accumuler de nombreuses
mutations puisque leur fonction n’est pas liée à une forme spécifique, rigide. Le caillot sanguin est un maillage
dans lequel s’agglomèrent les globules rouges. La trame de ce maillage est faîte de fibrinopeptides, leurs formes
peuvent être très différentes pour atteindre leur but d’où une sélection beaucoup plus lâche !
4 La duplication des gènes de la globine a donné naissance aux globines α αα α et β ββ β, deux protéines aux
fonctions rigoureusement identiques. Attention il s’agit de deux gènes différents situés sur deux chromosomes
différents, ces gènes possèdent des versions allèliques différentes. Cette duplication génique est neutre. Par
contre l’apparition de l’hémoglobine fœtale composée de deux globines α et de deux globines γ confère un
sérieux avantage à son porteur puisque cette hémoglobine montre une affinité plus grand pour le dioxygène que
l’hémoglobine adulte. Le porteur de cette mutation avait donc un avantage sur les autres en assurant à son
organisme une meilleure oxygénation en extrayant plus de dioxygène à partir du sang maternel.
4Les poils au niveau des oreilles du Lynx, les marqueurs A, B, AB et O des groupes sanguins ne
confèrent aucun avantage particulier à son porteur !


Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
27
Doc. 21 : Les mutations neutres complètent la panoplie des allèles de l’espèce par le jeu du
hasard. L’évolution aléatoire de leur fréquence ou dérive génétique s’explique par la production
aléatoire des gamètes lors de la méiose et de leur rencontre tout aussi hasardeuse lors de la
fécondation, en dehors de toute sélection naturelle. L’allèle neutre disparaîtra ou bien tendra à
envahir complètement toute la population et s’y fixer, augmentant la diversité allèlique de
l’espèce, son polymorphisme.
D’après SVT

Term S, éditions Belin 2002, modifié Remérand 2002.

D’après The Cambridge encyclopedia Human evolution, editions 1992, modifié Remérand 2002.
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
28
N NN N Ces mutations neutres complètent la panoplie des allèles de l’espèce par le jeu du hasard (Doc.
21). Ces allèles apparaissent et voient, d’une génération à l’autre, leur fréquence variée de manière aléatoire
au sein des populations de l’espèce. Cette dérive génétique s’explique par la production aléatoire des gamètes
lors de la méiose et de leur rencontre tout aussi hasardeuse lors de la fécondation, en dehors de toute
sélection naturelle. La fréquence de ces allèles fluctue ainsi de manière imprévisible, de générations en
générations, jusqu’au jour où l’allèle neutre disparaîtra de la collection d’allèles sans raison prévisible et
apparente ou bien tendra à envahir complètement toute la population et s’y fixer, augmentant la diversité
allèlique de l’espèce, son polymorphisme.

N NN N La fréquence des allèles A, B et O à travers le monde reflète la dérive génétique observée lors des
phénomènes migratoires. Une petite communauté d’individus s’extrait d’une population initiale. Les migrants
emmènent avec eux quelques allèles, qui ne reflètent par forcément ni la variabilité du gène ni la représentation
de la population initiale. Autrement dit, les individus colonisateurs ne sont pas forcément représentatifs de la
population dont ils sont issus et la variabilité intrapopulationnelle de départ ne se retrouve pas obligatoirement
dans le groupe de migrant. De vagues colonisatrices en vagues colonisatrices, le pool génique dérive et ne
correspond plus à la variabilité de départ ou plus dans les mêmes proportions, les fréquences allèliques diffèrent.
Ainsi, les fréquences allèliques des groupes A, B et O africains, diffèrent considérablement en Asie, en Europe et
en Amériques suite aux migrations humaines. Il est à noter que la variabilité allèliques fut conservée, les 3 allèles
sont toujours présents (Doc. 21).

N NN N La dérive génétique est donc un processus non orienté qui prend appui sur des processus
aléatoires, les innovations génétiques.

N NN N Les mutations neutres sont fixées dans le génome de l’espèce avec une grande régularité et
peuvent ainsi servir d’horloge moléculaire (Doc. 19).

IV-4 Quand les mutations touchent des gènes du développement, les conséquences
phénotypiques peuvent être spectaculaires

N NN N L’évolution des espèces est très généralement graduelle : la plupart des modifications
phénotypiques se faisant par une succession de petites retouches via les mutations de gènes de structures
soumis à la sélection naturelle et à la dérive génétique. Mais l’évolution peut parfois être également
discontinue, réalisant « des sauts » en touchant des gènes du développement ou gènes de régulation comme les
gènes homéotiques, si ces mutations sont conservées !

N NN N Les gènes de régulations orchestrent la mise en place des plans d’organisation des êtres vivants :
nombre et emplacement des organes au sein d’un organisme, durée des phases de développement, durée des
phases de croissance d’un organisme ou d’un organe.

N NN N Toute mutation d’un gène de développement conservée par l’espèce va engendrer des
modifications phénotypiques spectaculaires en modifiant (Doc. 22):
- le nombre des organes (4 ailes chez une drosophile au lieu de 2)
- l’emplacement des organes (œil sur la patte d’une drosophile)
- la durée et la vitesse du développement embryonnaire, processus d’hétérochronie (Mégacéros…).

N NN N Ce sont justement ces phénomènes d’hétérochronies qui sont évoqués pour expliquer
l’émergence de la lignée humaine (Doc. 23).
4En effet, une différence frappante entre les humains et les primates supérieurs concerne le
déroulement temporel des processus de développement. Chaque étape de la vie, des premiers pas de l’enfant
jusqu’à la vieillesse et à la mort en passant par la marche bipède même occasionnelle, l’autonomie, la maturité
sexuelle, est atteinte plus tardivement chez les humains que chez les singes anthropoïdes. De plus, la phase de
multiplication des neurones dure 2 semaines chez le chimpanzé alors qu’elle est de 8 semaines chez l’Homme.
L’Homme met plus de temps pour passer par les mêmes phases, tout se passe comme si, pour les processus
évoqués, le développement de l’Homme était freiné, ralenti.
4Les croissances du bassin, des membres supérieurs et du crâne avec son blocage du trou
occipital, semblent très ralentie chez l’Homme par rapport à celle du chimpanzé. Il est à noter que le blocage
du trou occipital impose la bipédie permanente tandis que le déplacement du trou occipital chez le
chimpanzé oblige à la quadrupédie. Seuls phénomènes qui semblent s’être accélérés chez l’homme,
l’acquisition du caractère opposable du pouce, signe d’agilité et d’habilité, plus précoce chez l’Homme et
l’intervention de la naissance, ceci pour des raisons anatomiques au niveau de la filière pelvienne (Les bébés
humains sont les seuls à présenter un cerveau d'un volume aussi réduit par rapport à la taille de cet organe chez l'adulte. Considérant la
Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
29
Doc. 22 : L’évolution des espèces est très généralement graduelle via les mutations de gènes de
structures soumis à la sélection naturelle et à la dérive génétique. Mais l’évolution peut parfois être
également discontinue, réalisant « des sauts » en touchant des gènes du développement qui
orchestrent la mise en place des plans d’organisation des êtres vivants.
D’après SVT Terms S, éditions Bordas, Belin 2000, Théorie de L’évolution chez Dunod 1989, Quand les poules auront des dents
chez Points Sciences1991, modifié Remérand 2002, et Grand guide encyclopédique des serpents, éditions Artémis 1995.

Nombre d’organes Emplacement des organes
Vitesse et durée de développement de tissus, d’organes.

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
30
Doc. 23 : Ce sont des phénomènes
d’hétérochronies qui sont évoqués
pour expliquer l’émergence de la
lignée humaine.
D’après SVT Terms S, éditions Nathan, Hatier
et Bordas 20002 modifié Remérand 2002,

Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
31
croissance et l'augmentation du volume du cerveau au cours de l'évolution, il est nécessaire que les naissances se produisent plus tôt pour être
sûr qu'il n'y aura pas de disproportion entre le crâne du fœtus et la taille de la filière pelvienne maternelle. En effet, il est intéressant de noter
le faible accroissement de la taille du cerveau des bébés au cours de l'évolution (passage de 300 à 350 cm
3
) alors que la taille des cerveaux
adultes a triplé dans le même temps (passage de 480 à 1344 cm
3
). Si au fil de l'évolution, le volume du cerveau à la naissance comparé à
celui de l'adulte s'était maintenu dans les mêmes proportions, c'est-à-dire dans un rapport de 60%, la taille du cerveau aurait été exagérément
importante pour permettre la parturition. En effet, un cerveau pleinement développé à la naissance échapperait aux risques de
l'environnement pouvant compromettre son épanouissement. Mais ce cerveau poserait des problèmes insolubles à la filière génitale
maternelle, rendant la locomotion verticale difficile par un dandinement marqué. La nécessité de provoquer l'accouchement plus tôt, donc à
un stade de développement précoce a donc été un impératif évolutif.)

N NN N La mise en place de caractères morphologiques et de processus biologiques sont accélérés ou
ralentis chez l’Homme par rapport au chimpanzé. Ces accélérations et ralentissements sont le jeu de quelques
gènes régulateurs qui vont activer d’autres gènes plus ou moins longtemps générant des déformations
phénotypiques importantes à l’origine des plus grosses différences phénotypiques entre espèces.

N NN N Le Chimpanzé adulte a perdu ses caractéristiques juvéniles alors que l'Homme adulte les a
conservées. L'Homme pourrait être une forme néoténique de l'ancêtre commun Homme-Chimpanzé qui aurait
alors conservé à l’âge adulte des traits qui existent encore chez les hominidés actuels (Bonobo) mais seulement
lorsqu’ils sont jeunes. Le passage de l'ancêtre commun Homme-Chimpanzé pourrait s'expliquer par un freinage,
un ralentissement du développement de l'Homme par rapport à son ancêtre. Une mutation portant sur un
gène de régulation du programme de développement pourrait être responsable de tels changements
morphologiques sans obligation de remaniements en profondeur du génome.
L'avantage de cette néoténie est en particulier la durée des mitoses des neurones qui se retrouvent
ainsi considérablement augmenter du fait du ralentissement du développement embryonnaire. Plus de mitoses
signifie plus de neurones, un volume cérébral beaucoup plus important expliquant en grande partie les capacités
intellectuelles des Hommes. De plus une accélération de la naissance et un ralentissement de la phase
juvénile par retard de la maturité sexuelle, malgré un besoin accru des soins parentaux pour la progéniture,
permettent un passage plus rapide dans un environnement stimulant pendant une phase de plasticité
cérébrale maximale, événement primordial pour l'éveil et le développement des facultés intellectuelles et
un allongement de la phase d'apprentissage pendant une phase de grande plasticité intellectuelle permettant
ainsi d'apprendre beaucoup et plus longtemps. L'apprentissage lié à l'expérience, est un avantage considérable
pour survivre d’où une sélection naturelle positive sur ces mutations de gènes de développement.






























Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
32

Conclusion


L’émergence de la vie se situe aux alentours de 3.8 milliards d’années, mais son explosion est beaucoup plus
tardive dans l’histoire de la Terre. En effet, d’après les indices paléontologiques, les premiers fossiles de formes
pluricellulaires datent de - 800 à -700 millions d’années. Pourquoi tant de temps entre la première cellule,
procaryotique, et la cellule eucaryotique; entre la cellule eucaryotique et les premiers multicellulaires ? Aucune
réponse satisfaisante n’a encore été avancée. Toujours est-il que l’apparition de la reproduction sexuée et donc
de la méiose et de la fécondation furent déterminantes pour la suite de l’évolution du monde vivant.

En effet, la diversité génétique qui à permis le développement et l’explosion des formes vivantes, la
complexification des espèces trouve son origine dans:
- la plasticité du génome : les mutations géniques
touchant la lignée germinale créent de nouveaux
allèles, les phénomènes de duplication-transposition-
mutation et évolution indépendante créent de
nouveaux gènes. Le génome et donc les espèces
peuvent se complexifier et évoluer. L’évolution se
traduit ainsi par un « bricolage moléculaire » qui
permet de faire du neuf avec du vieux. Les gènes
homéotiques illustrent parfaitement ce concept de
« récupération novatrice» de vieux gènes. On
minimise ainsi le coût énergétique en réduisant le
nombre de gènes architectes par exemple. Les
innovations génétiques sont au cœur même des
mécanismes évolutifs : le polymorphisme confère aux
populations une souplesse adaptative (adaptabilité) qui
lui permet de faire face aux variations du milieu et
d’évoluer. Autrement dit, les allèles conservés par la
sélection naturelle ou la dérive génétique constituent
un réservoir de « préadaptation » potentiel si l’on
entend par préadaptation la capacité de développer une
réponse adéquate en cas de changement de
l’environnement.
- la reproduction sexuée ou procréation qui :
- assure la stabilité des espèces en maintenant le
caryotype et donc une barrière entre les
espèces
- génèrent des combinaisons allélique
différentes à chaque génération :" Qui fait
un œuf fait du neuf !" via les brassages intra
et interchromosomiques associés à la
fécondation (La méiose et la fécondation sont
à l’origine de la diversité génétique, tandis
que les mutations sont à l’origine de la
diversité allèlique). Ces nouvelles
combinaisons alléliques serviront de matière
première à la sélection naturelle et à la
dérive génétique pour faire évoluer l’espèce.

Enfin, pour expliquer l’évolution des espèces et leur complexification, il ne faut pas oublier la redondance de l'information
génétique (après duplication des gènes) et des organes (deux poumons, deux reins dont l'un peut dévier de sa fonction primitive sans
pénaliser le porteur de cette nouveauté) et la plurifonctionnalité des organes (os de la mâchoire qui permettent la mastication et la
transmission des sons...) qui sont les phénomènes les plus fondamentaux de l'évolution, souvent oubliés, éliminant le problème souvent
soulevé et délicat du besoin des formes transitoires.





Enseignement Obligatoire de T
erm
S - Dossier 4 : Stabilité et variabilité des génomes et évolution -
33




¤Les cycles de développement des êtres vivants à reproduction sexuée montre une alternance de
phases haploïde et diploïde. La méiose assure le passage de la phase diploïde à la phase haploïde, la
fécondation permettant le retour à la diploïdie.

CLa méiose et la fécondation participent à la stabilité de l’espèce en maintenant de générations en
générations le caryotype, caractéristique, d’une espèce. Les perturbations méiotiques conduisent à des
anomalies du nombre des chromosomes, défavorables à la survie de l’individu et éliminées par l’espèce.

CLa méiose, avec ses brassages inter et intra-chromosomiques, et la fécondation participent à la
variabilité de l’espèce en générant des individus aux combinaisons allèliques uniques. Cette variabilité
allélique se manifeste au sein de l’espèce par une hétérozygotie à de nombreux loci.

¬Le brassage interchromosomique apparaît, uniquement, lors de la ségrégation au hasard des
chromosomes à 2 chromatides, lors de l'anaphase I de la division réductionnelle de la méiose si aucun
crossing-over n’apparaît. Si un enjambement s’opère, un deuxième brassage interchromosomique en
anaphase II s’ajoutent au brassage intrachromosomique de la prophase I.
Le brassage intrachromosomique provient des crossing-over qui peuvent apparaître lors de la
prophase I de la première division de la méiose. Ces échanges chromatidiens donnent naissance, lors des
ségrégations au hasard des chromosomes entiers en anaphase I puis lors de la séparation des chromatides en
anaphase II, à 4 arrangements allèliques différents donc 4 gamètes différents.

CL ‘analyse de résultats de croisements permet d’identifier le nombre et l’emplacement des gènes
étudiés et impliqués : gènes autosomaux, gonosomaux, liés ou indépendants.

CLes mutations d'allèles préexistants sont à l’origine de cette variabilité allélique. Le
polymorphisme au sein d’une espèce résulte de l’accumulation des mutations au fil des générations. Les
mutations n'ont pas toutes les mêmes conséquences pour l’individu et pour l’espèce selon quelles sont
décalantes (insertion, délétion) ou non (substitution), silencieuses, faux-sens, non-sens, qu'elles touchent la
séquence signal, codante ou de fin de gène, un gène de structure ou régulateur, une cellule germinale ou
somatique.

CLa méiose et la fécondation sont à l’origine de la diversité génétique, tandis que les mutations
sont à l’origine de la diversité allèlique.

² Le génome actuel des espèces témoigne du passé génétique de l’espèce. La complexification du
génome avec son augmentation du nombre de gènes et de versions allèliques résulte des mécanismes de
duplications géniques et des mutations d’allèles pré-existants survenus dans le passé au sein des
populations et cumulés au cours de l’histoire de l’espèce.

¹Seuls les nouveaux gènes et les mutations sont de l'innovation génétique si elles sont
transmissibles de génération en génération par la lignée germinale. Ces innovations génétiques peuvent être,
bénéfique, neutre ou défavorable pour la survie de l’espèce, à travers la descendance de l’individu mutant.
La sélection naturelle élimine dans un environnement donné les descendants porteurs d’innovations
défavorables et conserve la nouveauté génétique favorable à la descendance et donc à l’espèce. La sélection
naturelle est donc un processus orienté qui prend appui sur des processus aléatoires, les innovations
génétiques.
La dérive génétique maintient ou non par le jeu des rencontres au hasard des gamètes, une
innovation neutre. La dérive génétique est donc un processus non orienté qui prend appui sur des processus
aléatoires, les innovations génétiques.

1Les mutations touchant les gènes homéotiques et conservées par la sélection naturelle peuvent
avoir des répercussions sur la chronologie et la durée relative de la mise en place des caractères
morphologiques (processus d’hétérochronie), le nombre et l’emplacement des organes au sein d’un
organisme. Ces mutations peuvent donc modifier considérablement un organisme par rapport à son
ancêtre. L’Homme pourrait être issu de tels mécanismes d’hétérochronies.

DOSSIER 4 –Stabilité et variabilité des génomes et évolution Stabilité et variabilité des génomes et évolution Stabilité et variabilité des génomes et évolution Stabilité et variabilité des génomes et évolution-
Résumé