In the Name of Allah, the Most

Gracious, the Most Merciful

‫الإعجاز المعرفي في القرآن‬
‫الكريم و السنة النبوية‬
‫الشريفة‬
‫د‪ .‬زيد غزّاوي‬
‫قسم الهندسة الطبية ‪ -‬الجامعة الهاشمية‬
‫دكتوراه في الهندسة الطبية‬
‫(جامعة ‪ - Surrey‬بريطانيا)‬

‫نظرة السلم للديانة النصرانية‬
‫الواضيع الت سيتم عرضها‪:‬‬
‫‪ .1‬مصداقية القرآن الكري و كتاب النصارى (‪ )Bible‬من منظور علمي‬
‫‪ .2‬عيسى عليه السلم من منظور اسلمي و نصران‬
‫‪ .3‬كيفية إحياء الوتى من منظور اسلمي و نصران‬

‫الزء الثان‬

‫عيسى عليه السلم من منظور اسلمي و نصران‬

‫عيسى عليه السلم من منظور‬
‫اسلمي‬
‫كما وصفه ال عز و جل في القرآن الكريم‬

‫وصف عيسى عليه السلم‬
‫في القرآن الكريم‬

‫بسم الله الرحمن الرحيم‬

‫سورة النساء‬

‫وصف ال عز و جل لعيسى عليه السلم ف‬
‫القرآن الكري‬
‫يتلخص وصف ال عز و جل لعيسى‬
‫‪:‬عليه السلم في القرآن الكريم بما يلي‬

‫بأنه رسول من ال عز و جل و أنه‬
‫بشر مئة بالمائة‬

‫بأنه كلمة من ال عز و جل‬

‫روح من المولى عز و جل‬

‫الحجة المنطقية و الدليل التاريخي على أن‬
‫عيسى عليه السلم هو رسول ال عز و جل و‬
‫أنه بشر مائة بالمائة‬

‫رحة ال عز و جل بالناس‬
‫سورة غافر‬

‫تتطلب الرحمة أن يبعث ال عز و جل‬
‫رسول ليهدي الناس الى صراط ال عز‬
‫و جل المستقيم و أن يكون هذا الرسول‬
‫بشر مائة بالمائة‪ ،‬لماذا؟‬

‫لنه إذا كان الرسول أكثر من بشر ل‬
‫يستطيع الناس التواصل معه فكيف‬
‫يستطيع الرسول أن يعلمك أمور مثل‬
‫الصبر على طاعة ال إذا لم يكن بشرا‬

‫و كيف تستطيع أن تأخذ الرسول مثال‬
‫على تحمل البلء إذا كان أكثر من بشر‬

‫بسم الله الرحمن الرحيم‬

‫سورة فاطر‬

‫سنة ال عز و جل في بعث الرسالة عبر العصور‬
‫إنسان يبلّغ رسالة ال عز و جل‬
‫إنسان هداه من هدى ال عز و جل‬

‫يؤيد ال عز و جل الرسالة‬
‫بمعجزة دالة على صدقها‬

‫المعجزة لها ارتباط أساسي‬
‫بالسمة الغالبة للناس في‬
‫عصر تنزيل الرسالة‬
‫و تكون متفوقة عليها‬

‫محمد صلّى ال عليه و سلم‬

‫السمة الغالبة للناس في‬
‫عصر محمد صلّى ال‬
‫عليه و سلم‪:‬‬
‫الفصاحة و البلغة في‬
‫اللغة العربية‬

‫المعجزات‪:‬‬
‫العجاز اللغوي في‬
‫القرآن الكريم‬

‫عيسى عليه السلم‬

‫السمة الغالبة للناس في‬
‫عصر عيسى عليه السلم‪:‬‬
‫الطب‬

‫المعجزات‪:‬‬
‫ احياء الموتى باذن ال‬‫‪-‬شفي البرص و العمى‬

‫موسى عليه السلم‬

‫السمة الغالبة للناس في عصر‬
‫‪ :‬موسى عليه السلم‬
‫السحر‬

‫المعجزات‪:‬‬
‫التحويل بين مملكة النبات و‬
‫الحيوان‬

‫المهدي‬
‫القرآن الكريم رسالة لكل الناس الى يوم القيامة‬
‫السمة الغالبة للناس في‬
‫هذا العصر‪:‬‬
‫العلم و المعرفة‬
‫المعجزات‪:‬‬
‫العجاز المعرفي في‬
‫القرآن الكريم‬

‫اعجاز ال عز و جل في أن كتابه يحتوي‬
‫على جميع فروع المعرفة بشكل تام و كامل‪.‬‬
‫و هو شيء يفهم بالسمة الغالبة لهذا العصر‬
‫و لكن متفوق عليها‪.‬‬

‫محمد صلّى ال عليه و سلم‬

‫السمة الغالبة للناس في‬
‫عصر محمد صلّى ال‬
‫عليه و سلم‪:‬‬
‫الفصاحة و البلغة في‬
‫اللغة العربية‬

‫المعجزات‪:‬‬
‫العجاز اللغوي في‬
‫القرآن الكريم‬

‫من غير المنطقي التفكير بعيسى عليه السلم بأنه أكثر من نبي‬
‫•‬

‫‪‬‬

‫لن ذلك يعارض سنة ال عز و جل في بعث الرسالة عبر العصور‬
‫عن طريق رسول من بني آدم (بشر فقط)‬
‫الناس ل يستطيعون أن يتواصلوا مع عيسى عليه السلم إذا كان أكثر‬
‫من بشر‬
‫‪ ‬لنه إذا شعر باللم (هل يشعر كما يشعر بذلك البشر؟)‬
‫‪ ‬كيف يستطيع إذا كان أكثر من بشر أن يعلمني عن الصبر و تحمل‬
‫المشقة؟‬

‫كيفية خلق عيسى عليه السلم من‬
‫منظور علمي؟‬
‫يكمن الجواب في كتاب ال عز و جل‬

‫يكمن الجواب في سورة آل عمران‬
‫(آية ‪)59‬‬
‫حيث يبين ال عز و جل بان هناك تطابق بين خلق آدم و عيسى‬
‫عليهما السلم‬

‫بسم الله الرحمن الرحيم‬

‫سورة آل عمران‬

‫مراحل خلق آدم عليه السلم‬

‫مراحل خلق عيسى عليه السلم‬

‫يذكر ال عز و جل بأنه خلق آدم عليه السلم‬
‫من تراب‪ .‬وهذا يعني بأن مكونات جسم آدم‬
‫عليه السلم يجب أن تكون هي ذاتها‬
‫مكونات التراب‬

‫بما أن ال عز و جل يذكر بأن مراحل خلق‬
‫عيسى عليه السلم مطابقة لدم إذا مكونات‬
‫جسم عيسى عليه السلم يجب أن تكون‬
‫مطابقة لمكونات التراب‬

‫تحليل المواد الموجودة في التراب‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫هيدروجين ((‪H‬‬
‫نيتروجين (‪)N‬‬
‫أوكسجين (‪)O‬‬
‫كاربون (‪)C‬‬
‫كالسيوم (‪)Ca‬‬
‫فوسفور(‪)P‬‬
‫بوتاسيوم(‪)K‬‬
‫كبريت (‪)S‬‬
‫صوديوم (‪)Na‬‬
‫كلور(‪)Cl‬‬
‫مغنيسيوم ( (‪Mg‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫يود(‪)I‬‬
‫حديد(‪)Fe‬‬
‫نحاس(‪)Cu‬‬
‫سيليكون (‪)Si‬‬

‫المواد المكونّة للحماض المينية‬
‫(المواد النشائية في جسم النسان)‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫المواد الموجودة في التراب‬
‫هيدروجين ((‪H‬‬
‫نيتروجين (‪)N‬‬
‫أوكسجين (‪)O‬‬
‫كربون (‪)C‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫المواد المكونّة للحماض المينية‬
‫هيدروجين ((‪H‬‬
‫نيتروجين (‪)N‬‬
‫أوكسجين (‪)O‬‬
‫كربون (‪)C‬‬

‫‪http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html‬‬

‫المواد الوظيفية في جسم النسان‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫صوديوم (‪ )Na‬و البوتاسيوم (‪ )K‬في نقل السيلت العصبية‬
‫الكالسيوم (‪ )Ca‬في تحفيز عمل الخليا و عمل العضلت‬
‫الحديد (‪ )Fe‬في نقل المواد في الدم‬
‫الفوسفور (‪ )P‬في تركيب صفائح العظم‬
‫اليود (‪ )I‬في عمل الغدد الصماء‬
‫الكلور (‪ )Cl‬في توازن السوائل في جسم النسان‬
‫النحاس (‪ )Cu‬في نقل الطاقة الكهربائية في العظم‬
‫السيليكون (‪ )Si‬كمادة إنشائية في جسم النسان‬
‫الكبريت (‪ )S‬في بروتين العضلت‬
‫المغنيسيوم (‪ )Mg‬في تركيب العظم البشري‬

‫‪‬‬

‫المواد النشائية (الحماض المينية)‬

‫‪‬‬

‫هيدروجين ((‪H‬‬
‫نيتروجين (‪)N‬‬
‫أوكسجين (‪)O‬‬
‫كاربون (‪)C‬‬

‫‪‬‬

‫المعادن المستخدمة في نقل الطاقة و النمو‬

‫‪‬‬

‫كالسيوم (‪)Ca‬‬
‫فوسفور(‪)P‬‬
‫بوتاسيوم(‪)K‬‬
‫كبريت (‪)S‬‬
‫صوديوم (‪)Na‬‬
‫كلور(‪)Cl‬‬
‫مغنيسيوم ( (‪Mg‬‬

‫‪‬‬

‫يود(‪)I‬‬
‫حديد(‪)Fe‬‬
‫نحاس(‪)Cu‬‬
‫سيليكون (‬

‫‪‬‬
‫‪‬‬
‫‪‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫‪‬‬
‫‪‬‬
‫‪‬‬

‫تطابق كامل بين‬
‫المواد و المعادن‬
‫الموجودة في‬
‫التراب و الموجودة‬
‫في جسم النسان‬

‫التطابق الكامل بين كيفية خلق آدم و عيسى عليهما السلم‬
‫خلق آدم عليه السلم من‬
‫العناصر المؤلفة للتراب‬

‫وخلق عيسى عليه السلم من‬
‫العناصر المؤلفة لجسم مريم‬
‫عليها السلم‬

‫وبما أن جسم مريم عليها السلم مؤلف من عناصر التراب وبما أن عيسى عليه السلم‬
‫خلق من العناصر المؤلفة لجسم مريم عليها السلم فهو بذلك يكون قد خلق من التراب كما‬
‫وصفه ال عز و جل في القرآن الكريم‬

‫مراحل خلق آدم عليه السلم‬

‫مراحل خلق عيسى عليه السلم‬

‫يذكر ال عز و جل بأنه خلق آدم عليه السلم‬
‫من تراب‪ .‬وهذا يعني بأن مكونات جسم آدم‬
‫عليه السلم يجب أن تكون هي ذاتها‬
‫مكونات التراب‬

‫بما أن ال عز و جل يذكر بأن مراحل خلق‬
‫عيسى عليه السلم مطابقة لدم إذا مكونات‬
‫جسم عيسى عليه السلم يجب أن تكون‬
‫مطابقة لمكونات التراب‬

‫ثم قال ال عز و جل لدم عليه السلم كن‬
‫فيكون‪ .‬فإذا آدم عليه السلم هو كلمة من ال‬
‫عز و جل التي أصبحت جسم آدم عليه‬
‫السلم‬

‫ثم قال ال عز و جل لعيسى عليه السلم كن‬
‫فيكون‪ .‬فإذا عيسى عليه السلم هو كلمة من‬
‫ال عز و جل التي أصبحت جسم عيسى‬
‫عليه السلم‬

‫كيف أن عيسى عليه السلم‬
‫هو كلمة من ال عز و جل؟‬
‫من منظور علمي‬

‫بسم الله الرحمن الرحيم‬

‫سورة النمل‬

‫الجبال‬

‫يصف ال عز و جل بأنه خلق الجبال‬
‫بعملية صنع‬

‫مخلوق من مخلوقات ال عز و جل‬

‫و عملية الصنع بحاجة الى معلومات‬
‫(كلمات) لكيفية تجميع الوحدات‬
‫الساسية اللزمة للصنع‬

‫بسم الله الرحمن الرحيم‬

‫سورة النفطار‬

‫يصف ال عز و جل بأنه خلق‬
‫جسم النسان بعملية تركيب‬

‫لذا هناك حاجة لمعلومات حول‬
‫ترتيب الوحدات الساسية المؤلفة‬
‫لجسم النسان‬

‫هذه المعلومات هي كلم ال عز و جل للخلق (كن فيكون)‬

‫يوجد كلم ال عز و جل للخلق في مركب‬
‫ال‪DNA‬‬
‫تخزين المعلومات باستخدام شيفرة هندسية‬

DNA ‫مركب‬

Tortora and Grabowski, 1996

http://www.chemie.fu-berlin.de/chemistry/bio/amino-acids_en.html

‫الحماض المينية‬

‫كل ثلثة اشكال هندسية ترمز لحمض أميني معين‬
‫‪DNA‬‬
‫‪Molecule‬‬

‫الحماض المينية‬

‫كلمة المولى التي تصبح جسدا‬
‫كلمة ال عز و جل لخلق مركب الكولجين في جسم النسان‬
‫(تخزين المعلومات بطريقة هندسية)‬

‫‪+‬‬
‫عند قراءة كلم ال عز و جل يتم‬
‫تجميع الحماض المينية بترتيب و‬
‫عدد معين لصنع البروتينات و‬
‫أنسجة الجسم المختلفة‬

‫عملية تصنيع البروتينات في جسم النسان‬

‫كلمة ال عز و جل لصنع مركب الكولجين في جسم‬
‫النسان‬
Start
codon

AGAGGGTCCTCGGGGGCCTGGTGGACCAGGAGG
GCCCATCTGGCCCACGTCTCCTGTCTCGCCCTTTT
CTCCTGGAGGTCCTGGCAAACCCTGCAATCCC
ACTGGCCCGGGGGGTCCTGGGAAACCTCTTGAA
CCTTCATCTCCTTTCTGCCCAAACAGGCCCTGCT
GTCCACGAGGGCCAGGTTCACCATCTGCTCCCG
AAGGGCCTGGCTGTCCAATCGGGCCTTGAGGAC
CGGTAGGCCCAGGAGGACCCTGCTCGCCTTTGTC
GCCCTTGCTTCCCTTCTGCCCTGGCTCTCCGATC

‫بسم الله الرحمن الرحيم‬

‫سورة الكهف‬

‫الكلمة التي أوحى بها ال عز و جل لمريم عليها السلم‬
‫‪ ‬الكلمة التي أصبحت عيسى عليه السلم تحتوي‬
‫على‪:‬‬
‫‪‬‬

‫معلومات لصنع المركبّات المختلفة لعيسى عليه السلم‬
‫من حيث‪:‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬
‫‪‬‬

‫أبعاد المركبّات المختلفة لخلق عيسى عليه السلم‬
‫لونه‬
‫تصميمه‬
‫التعليمات الهندسية لصنع المركب‬

‫مراحل خلق آدم عليه السلم‬

‫مراحل خلق عيسى عليه السلم‬

‫يذكر ال عز و جل بأنه خلق آدم عليه السلم‬
‫من تراب‪ .‬وهذا يعني بأن مكونات جسم آدم‬
‫عليه السلم يجب أن تكون هي ذاتها‬
‫مكونات التراب‬

‫بما أن ال عز و جل يذكر بأن مراحل خلق‬
‫عيسى عليه السلم مطابقة لدم إذا مكونات‬
‫جسم عيسى عليه السلم يجب أن تكون‬
‫مطابقة لمكونات التراب‬

‫ثم قال ال عز و جل لدم عليه السلم كن‬
‫فيكون‪ .‬فإذا آدم عليه السلم هو كلمة من ال‬
‫عز و جل التي أصبحت جسم آدم عليه‬
‫السلم‬

‫ثم قال ال عز و جل لعيسى عليه السلم كن‬
‫فيكون‪ .‬فإذا عيسى عليه السلم هو كلمة من‬
‫ال عز و جل التي أصبحت جسم عيسى‬
‫عليه السلم‬

‫و من ثم وضع ال عز و جل من روحة‬
‫في الجسم المادي لدم عليه السلم‬

‫و من ثم وضع ال عز و جل من روحة‬
‫في الجسم المادي لعيسى عليه السلم‬

‫كيف أن ال عز و جل وضع من‬
‫روحة في عيسى و آدم عليهما السلم؟‬
‫من منظور علمي‬

‫ماهية و وظيفة الروح‬
‫‪‬‬

‫لم يكن بمقدور آدم عليه السلم أن يتكلم‪ ،‬يمشي‪ ،‬أو أن يقوم‬
‫بأية وظيفة بدون وضع ال عز و جل للروح في جسمه‪:‬‬
‫‪‬‬

‫‪‬‬

‫أذا من الممكن الستنتاج بأن الروح لزمة لتحفيز العقد العصبية‬
‫في الدماغ لتفعيل وظائف الجسم‬

‫اذا من الممكن الستنتاج بأن الروح هي عبارة عن مجال‬
‫طاقة يوضع في جسم النسان و الذي يؤدي الى تفعيل‬
‫وظائف الجسم‬

‫الجسم المادي للنسان‬

‫‪Tortora and Grabowski, 1996‬‬

‫هيكل الطاقة الذي يضعه ال عز و جل في جسم النسان لتفعيل‬
‫الوظيفة‬

‫مجال‬
‫الطاقة‬
‫الناتج من‬
‫تفاعل‬
‫مجال‬
‫الجاذبية‬
‫مع عظمة‬
‫ذنب‬
‫الظهر‬

‫جسم النسان‬

‫بسم الله الرحمن الرحيم‬
‫وضع ال عز و جل للروح في جسم آدم عليه السلم‬

‫سورة الحجر‬

‫وضع ال عز و جل للروح في جسم عيسى عليه السلم‬

‫سورة النبياء‬

The birth of Jesus peace be upon him

Step 1: a word from Allah all Mighty, in this
word there is the following:

Characteristics of Jesus )pbuh( )skin, eyes, hair colour,
etc.(

Step 2: Shaping of Jesus )pbuh( in the womb done
by an angle )as it happens to every human)

‫عيسى عليه السلم من منظور‬
‫نصراني‬
‫كما تم وصفه في كتاب النصارى (‪)Bible‬‬

The birth of Jesus peace be upon Him in
the Bible

Luke 1 )NIV(
34
"How will this be," Mary asked the angel, "since I am a
virgin?"
35
The angel answered, "The Holy Spirit will come upon
you, and the power of the Most High will overshadow you.
So the holy one to be born will be called the Son of God.
‫ وَأَنَا لَسْتُ أَعْرِفُ َرجُلً؟‬،‫ « َكيْفَ يَحْدُثُ هَذَا‬:ِ‫ فَقَالَتْ مَ ْريَمُ لِلْمَلَك‬
ً‫ لِذلِكَ َأيْضا‬.ِ‫ وَقُدْرَةُ الْعَلِيّ تُظَلُّلك‬،ِ‫ «الرّوحُ الْ ُقدُسُ يَحِلّ عَلَ ْيك‬:ُ‫ فََأجَابَهَا الْمَلَك‬
.ِ‫فَالْقُدّوسُ الْمَوْلُودُ ِم ْنكِ ُيدْعَى ابْنَ ال‬

The Description of Jesus peace be upon
Him in the Bible
John 3:16 )King James Version(
For God so loved the world, that he gave his
only begotten Son, that whosoever believeth
in him should not perish, but have everlasting
life.
َ‫ ِل َكيْ لَ يَ ْهِلك‬،َ‫حتّى بَذَلَ ا ْبنَ ُه ا ْلوَحِيد‬
َ َ‫ل ا ْلعَالَم‬
ُ ‫حبّ ا‬
َ َ‫لنّهُ هكَذَا أ‬
َ 
ُ‫لبَ ِديّة‬
َ ‫حيَاةُ ا‬
َ ْ‫ بَلْ َتكُونُ لَ ُه ال‬،ِ‫كُلّ مَنْ ُي ْؤمِنُ بِه‬

‫بسم ال الرحن الرحيم‬

‫وَقَالُوا اّتخَذَ ال ّرحْمَنُ وَلَدًا * لَقَدْ جِئْتُمْ شَيْئًا إِدّا *‬
‫تَكَادُ السّمَاوَاتُ يَتَفَطّرْنَ مِنْهُ وَتَنشَقّ الَْأرْضُ وََتخِرّ‬
‫اْلجِبَا ُل هَدّا * أَن دَعَوْا لِل ّرحْمَنِ وَلَدًا * وَمَا يَنبَغِي‬
‫لِل ّرحْمَنِ أَن يَّتخِذَ وَلَدًا * إِن كُلّ مَن فِي السّمَاوَاتِ‬
‫وَالْأَ ْرضِ إِلّا آتِي الرّحْمَ ِن عَبْدًا‬
‫سورة مريم (‪)93-88‬‬

‫بسم ال الرحن الرحيم‬

‫وَنُنَزّلُ مِنَ الْقُرْآنِ مَا هُ َو شِفَاء َورَ ْحمَ ٌة‬
‫لّلْمُؤْمِنِيَ وَلَ يَزِيدُ الظّالِمِيَ إَلّ خَسَارًا‬
‫سورة السراء (‪)82‬‬

‫ زيد قاسم غزاوي‬.‫د‬
‫دكتوراه في الهندسة الطبية‬
‫ بريطانيا‬- ‫جامعة سري‬
Website: www.quran-miracle.com
E-mail: zaidquran@yahoo.com
zaidg@hotmail.com